Sample records for vero cells grown

  1. Human Respiratory Syncytial Virus Memphis 37 Grown in HEp-2 Cells Causes more Severe Disease in Lambs than Virus Grown in Vero Cells

    PubMed Central

    Derscheid, Rachel J.; van Geelen, Albert; McGill, Jodi L.; Gallup, Jack M.; Cihlar, Tomas; Sacco, Randy E.; Ackermann, Mark R.


    Respiratory syncytial virus (RSV) is the most common cause of bronchiolitis in infants and young children. A small percentage of these individuals develop severe and even fatal disease. To better understand the pathogenesis of severe disease and develop therapies unique to the less-developed infant immune system, a model of infant disease is needed. The neonatal lamb pulmonary development and physiology is similar to that of infants, and sheep are susceptible to ovine, bovine, or human strains of RSV. RSV grown in Vero (African green monkey) cells has a truncated attachment G glycoprotein as compared to that grown in HEp-2 cells. We hypothesized that the virus grown in HEp-2 cells would cause more severe clinical symptoms and cause more severe pathology. To confirm the hypothesis, lambs were inoculated simultaneously by two different delivery methods (intranasal and nebulized inoculation) with either Vero-grown or HEp-2-grown RSV Memphis 37 (M37) strain of virus to compare viral infection and disease symptoms. Lambs infected with HEp-2 cell-derived virus by either intranasal or nebulization inoculation had significantly higher levels of viral RNA in lungs as well as greater clinical disease including both gross and histopathologic lesions compared to lambs similarly inoculated with Vero-grown virus. Thus, our results provide convincing in vivo evidence for differences in viral infectivity that corroborate previous in vitro mechanistic studies demonstrating differences in the G glycoprotein expression by RSV grown in Vero cells. PMID:24284879

  2. Death rate in a small air-lift loop reactor of vero cells grown on solid microcarriers and in macroporous microcarriers.


    Martens, D E; Nollen, E A; Hardeveld, M; van der Velden-de Groot, C A; de Gooijer, C D; Beuvery, E C; Tramper, J


    The death rate of Vero cells grown on Cytodex-3 microcarriers was studied as a function of the gas flow rate in a small air-lift loop reactor. The death rate may be described by first-order death-rate kinetics. The first-order death-rate constant as calculated from the decrease in viable cells, the increase in dead cells and the increase in LDH activity is linear proportional to the gas flow rate, with a specific hypothetical killing volume in which all cells are killed of about 2·10(-3) m(3) liquid per m(3) of air bubbles. In addition, an experiment was conducted in the same air-lift reactor with Vero cells grown inside porous Asahi microcarriers. The specific hypothetical killing volume calculated from this experiment has a value of 3·10(-4) m(3) liquid per m(3) of air bubbles, which shows that the porous microcarriers were at least in part able to protect the cells against the detrimental hydrodynamic forces generated by the bubbles. PMID:22358606

  3. Death rate in a small air-lift loop reactor of vero cells grown on solid microcarriers and in macroporous microcarriers.


    Martens, D E; Nollen, E A; Hardeveld, M; Velden-de Groot, C A; Gooijer, C D; Beuvery, E C; Tramper, J


    The death rate of Vero cells grown on Cytodex-3 microcarrierswas studied as a function of the gas flow rate in a smallair-lift loop reactor. The death rate may be described byfirst-order death-rate kinetics. The first-order death-rateconstant as calculated from the decrease in viable cells, theincrease in dead cells and the increase in LDH activity islinear proportional to the gas flow rate, with a specifichypothetical killing volume in which all cells are killed ofabout 2.10(-3)m(3) liquid per m(3) of air bubbles.In addition, an experiment was conducted in the sameair-lift reactor with Vero cells grown inside porous Asahimicrocarriers. The specific hypothetical killing volumecalculated from this experiment has a value of 3.10(-4)m(3) liquid per m(3) of air bubbles, which shows thatthe porous microcarriers were at least in part able to protectthe cells against the detrimental hydrodynamic forcesgenerated by the bubbles. PMID:22358522

  4. An inactivated Vero cell-grown Japanese encephalitis vaccine formulated with Advax, a novel inulin-based adjuvant, induces protective neutralizing antibody against homologous and heterologous flaviviruses

    PubMed Central

    Lobigs, Mario; Pavy, Megan; Hall, Roy A.; Lobigs, Päivi; Cooper, Peter; Komiya, Tomoyoshi; Toriniwa, Hiroko; Petrovsky, Nikolai


    Advax is a polysaccharide-based adjuvant that potently stimulates vaccine immunogenicity without the increased reactogenicity seen with other adjuvants. This study investigated the immunogenicity of a novel Advax-adjuvanted Vero cell culture candidate vaccine against Japanese encephalitis virus (JEV) in mice and horses. The results showed that, in mice, a two-immunization, low-dose (50 ng JEV antigen) regimen with adjuvanted vaccine produced solid neutralizing immunity comparable to that elicited with live ChimeriVax-JE immunization and superior to that elicited with tenfold higher doses of a traditional non-adjuvanted JEV vaccine (JE-VAX; Biken Institute) or a newly approved alum-adjuvanted vaccine (Jespect; Novartis). Mice vaccinated with the Advax-adjuvanted, but not the unadjuvanted vaccine, were protected against live JEV challenge. Equine immunizations against JEV with Advax-formulated vaccine similarly showed enhanced vaccine immunogenicity, confirming that the adjuvant effects of Advax are not restricted to rodent models. Advax-adjuvanted JEV vaccine elicited a balanced T-helper 1 (Th1)/Th2 immune response against JEV with protective levels of cross-neutralizing antibody against other viruses belonging to the JEV serocomplex, including Murray Valley encephalitis virus (MVEV). The adjuvanted JEV vaccine was well tolerated with minimal reactogenicity and no systemic toxicity in immunized animals. The cessation of manufacture of traditional mouse brain-derived unadjuvanted JEV vaccine in Japan has resulted in a JEV vaccine shortage internationally. There is also an ongoing lack of human vaccines against other JEV serocomplex flaviviruses, such as MVEV, making this adjuvanted, cell culture-grown JEV vaccine a promising candidate to address both needs with one vaccine. PMID:20130134

  5. Arenoviruses in Vero Cells: Ultrastructural Studies

    PubMed Central

    Murphy, Frederick A.; Webb, Patricia A.; Johnson, Karl M.; Whitfield, Sylvia G.; Chappell, W. Adrian


    Thin-section electron microscopy was carried out on Vero green monkey kidney cell cultures infected with some viruses of the newly constituted arenovirus group. Junin, Machupo, Amapari, Pichinde, Parana, Tamiami, and Latino viruses were morphologically identical and indistinguishable from lymphocytic choriomeningitis virus, the prototype virus of the group. Virus particles were round, oval, or pleomorphic, 60 to 280 nm in diameter, and matured via budding from plasma membranes. Most characteristically, particles contained various amounts of homogeneous, 20- to 25-nm, dense granules; these granules in large masses also formed distinctive intracytoplasmic inclusions. In negative-contrast preparations from infected Vero cell culture supernatant fluids, several of the viruses appeared as pleomorphic membrane-bound forms with rather pronounced surface projections. Most particles were between 90 and 220 nm in diameter, although some reached 350 nm in their longest dimension. Internal structure was not resolved by negative-contrast electron microscopy. All observations supported the current delineation of a distinct arenovirus group. Images PMID:5497898

  6. Increasing Vero viable cell densities for yellow fever virus production in stirred-tank bioreactors using serum-free medium.


    Mattos, Diogo A; Silva, Marlon V; Gaspar, Luciane P; Castilho, Leda R


    In this work, changes in Vero cell cultivation methods have been employed in order to improve cell growth conditions to obtain higher viable cell densities and to increase viral titers. The propagation of the 17DD yellow fever virus (YFV) in Vero cells grown on Cytodex I microcarriers was evaluated in 3-L bioreactor vessels. Prior to the current changes, Vero cells were repeatedly displaying insufficient microcarrier colonization. A modified cultivation process with four changes has resulted in higher cell densities and higher virus titers than previously observed for 17DD YFV. PMID:25930117

  7. Statistical optimization of influenza H1N1 production from batch cultures of suspension Vero cells (sVero).


    Paillet, Cristian; Forno, Guillermina; Soldano, Nicolas; Kratje, Ricardo; Etcheverrigaray, Marina


    Efficient vaccine production requires the growth of large quantities of virus produced with high yield from a safe host system. Human influenza vaccines are produced in embryonated chicken eggs. However, over the last decade many efforts have allowed the establishment of cell culture-derived vaccines. We generated a Vero cell line adapted to grow in suspension (sVero) in a serum-free medium and evaluated it for its potential as host cell for influenza vaccine production. Initially we studied the capacity of sVero cells to grow in the presence of incremental concentrations of trypsin. In comparison with adherent Vero cells (aVero), we found that sVero cells maintain their growth kinetics even with a three-fold increase in trypsin concentration. The influence of the conditions of infection on the yield of H1N1 produced in serum-free suspension cultures of sVero cells was investigated by a 2(2) full factorial experiment with center point. Each experiment tested the influence of the multiplicity of infection (m.o.i.) and trypsin concentration, on production yields at two levels, in four possible combinations of levels and conditions, plus a further combination in which each condition was set in the middle of its extreme levels. On the basis of software analysis, a combination of m.o.i. of 0.0066TCID(50%)/cell and trypsin concentration of 5?g/1.010(6) cells with a desirability of 0.737 was selected as the optimized condition for H1N1 production in sVero cells. Our results show the importance of proper selection of infection conditions for H1N1 production on sVero cells in serum-free medium. PMID:21756959

  8. Vero cells infected with the Lederle strain of canine distemper virus have increased Fas receptor signaling expression at 15 h post-infection.


    Del Puerto, H L; Martins, A S; Braz, G F; Alves, F; Heinemann, M B; Rajão, D S; Araújo, F C; Martins, S F; Nascimento, D R; Leite, R C; Vasconcelos, A C


    We evaluated the expression of the Fas receptor gene in Vero cells infected with the Lederle vaccine strain of canine distemper virus using RT-PCR. Vero cells were plated, and after being grown for 24 h in MEM with 5% FBS, 80-90% confluent monolayer cultures were infected with the virus. The cells were harvested at 3, 6, 9, and 15 h post-infection. Uninfected Vero cells were used as a control. Total RNA was isolated from Vero cells using 1 mL Trizol(®) LS, and RT was performed using 2 μg total RNA. Primer pairs for RT-PCR amplification for the canine distemper virus nucleocapsid gene, the S26 reference gene, and the Vero rFas gene were used to analyze expression in Vero cells. RT-PCR results revealed virus activity at 3, 6, 9, and 15 h in the virus-infected Vero cells. The S26 housekeeping gene was amplified in virus infected and control samples. However, expression of the cell death receptor Fas was detected in Vero cells only at 15 h post-infection. We suggest that the Lederle vaccine induces apoptosis by Fas receptor signaling, possibly through caspase-8 signaling rather than through mitochondrial signaling in the infected cells. PMID:22009866

  9. Potency assay of diphtheria antitoxin in Vero cell microcultures.


    Sánchez Gómez, R; Gallardo y Ramos, R; González-Pacheco, M


    Laboratory conditions were established for the titration of diphtheria toxin and antitoxin in Vero Cell Cultures (CCT) and a comparison was made with the intradermal test (IDT) as currently used throughout the world. Working dilutions and cut off values were established by reading both the change in color of phenol red used as pH indicator and changes in cell viability in the microscope. CCT shows high reproducibility and higher detectability than IDT in the titration of both WHO Reference Standard and high titer horse antisera. In sera of guinea pigs immunized for potency testing of diphtheria toxoid the titre was approximately 10 times lower than in the IDT. The explanation is a subject of speculation. The Vero cell titration might be adopted as such for titration of diphtheria antitoxin. In the case of the toxoid potency test it could be used if the limit for the titration is adjusted to 0.2 IU considering the equivalence obtained between the two tests, by taking into account a ratio of 1:10 between CCT and IDT. PMID:8986109

  10. Adaptation of Marek's disease virus to the Vero continuous cell line.


    Jaikumar, D; Read, K M; Tannock, G A


    Marek's disease virus (MDV) is a highly infectious, cell-associated oncogenic herpesvirus. Production of MD vaccines has been limited to primary chicken and duck embryo fibroblast (CEF and DEF) cultures. These have a limited life span and cannot be readily stored in liquid nitrogen. Moreover, the need to prepare CEF and DEF cells on a regular basis from 10 to 11 day-old embryos derived from a flock that must be tested continuously for the presence of avian pathogens adds to the cost of vaccine production. A continuous cell line that would support MDV replication could have significant advantages for the rapid large-scale preparation of MD vaccines. In this report, we describe the adaptation to growth of CEF-grown preparations of serotype 1 and serotype 3 (herpesvirus of turkeys; HVT) strains of MDV in cells of the Vero continuous cell line. Although both viruses produced typical CPE, higher levels of infectious progeny and more extensive virus-specific immunofluorescence were obtained for HVT than for the serotype 1 virus. PCR and pulsed field electrophoresis (PFE) analysis of the DNA from Vero cells infected with either virus confirmed the presence of virus-specific DNA. PMID:11230930

  11. Detection of infectious virus from field-collected mosquitoes by vero cell culture assay.


    Armstrong, Philip M; Andreadis, Theodore G; Finan, Shannon L; Shepard, John J; Thomas, Michael C


    Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing ≤50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population. PMID:21694689

  12. Improved poliovirus D-antigen yields by application of different Vero cell cultivation methods.


    Thomassen, Yvonne E; Rubingh, Olaf; Wijffels, René H; van der Pol, Leo A; Bakker, Wilfried A M


    Vero cells were grown adherent to microcarriers (Cytodex 1; 3 g L(-1)) using animal component free media in stirred-tank type bioreactors. Different strategies for media refreshment, daily media replacement (semi-batch), continuous media replacement (perfusion) and recirculation of media, were compared with batch cultivation. Cell densities increased using a feed strategy from 1×10(6) cells mL(-1) during batch cultivation to 1.8, 2.7 and 5.0×10(6) cells mL(-1) during semi-batch, perfusion and recirculation, respectively. The effects of these different cell culture strategies on subsequent poliovirus production were investigated. Increased cell densities allowed up to 3 times higher D-antigen levels when compared with that obtained from batch-wise Vero cell culture. However, the cell specific D-antigen production was lower when cells were infected at higher cell densities. This cell density effect is in good agreement with observations for different cell lines and virus types. From the evaluated alternative culture methods, application of a semi-batch mode of operations allowed the highest cell specific D-antigen production. The increased product yields that can easily be reached using these higher cell density cultivation methods, showed the possibility for better use of bioreactor capacity for the manufacturing of polio vaccines to ultimately reduce vaccine cost per dose. Further, the use of animal-component-free cell- and virus culture media shows opportunities for modernization of human viral vaccine manufacturing. PMID:24583004

  13. Susceptibility of the VERO line of African green monkey kidney cells to human enteroviruses

    PubMed Central

    Davis, Patricia M.; Phillpotts, R. J.


    The relative susceptibility of VERO cells and primary rhesus monkey kidney cells to 47 prototype strains of human enteroviruses is described. Of these strains, types 4, 14, 16, 17, 18, 21, 31 and 34 and Coxsackie virus A 9 failed to cause CPE in the VERO cells whilst only one, echovirus type 34, failed to cause CPE in the monkey kidney cells. A comparison is given of the efficiency of the two cell cultures for enterovirus isolation from clinical material. Results show that VERO cells are as useful as primary monkey kidney for the isolation of Coxsackie B viruses but less satisfactory for isolating echoviruses. They are satisfactory for the isolation of single types of poliovirus and appear to be more satisfactory than primary monkey kidney cells for the isolation of mixtures of polioviruses. The identification of enteroviruses by neutralization tests in VERO cells is successful. PMID:4361500

  14. The Genome Landscape of the African Green Monkey Kidney-Derived Vero Cell Line

    PubMed Central

    Osada, Naoki; Kohara, Arihiro; Yamaji, Toshiyuki; Hirayama, Noriko; Kasai, Fumio; Sekizuka, Tsuyoshi; Kuroda, Makoto; Hanada, Kentaro


    Continuous cell lines that originate from mammalian tissues serve as not only invaluable tools for life sciences, but also important animal cell substrates for the production of various types of biological pharmaceuticals. Vero cells are susceptible to various types of microbes and toxins and have widely contributed to not only microbiology, but also the production of vaccines for human use. We here showed the genome landscape of a Vero cell line, in which 25,877 putative protein-coding genes were identified in the 2.97-Gb genome sequence. A homozygous ∼9-Mb deletion on chromosome 12 caused the loss of the type I interferon gene cluster and cyclin-dependent kinase inhibitor genes in Vero cells. In addition, an ∼59-Mb loss of heterozygosity around this deleted region suggested that the homozygosity of the deletion was established by a large-scale conversion. Moreover, a genomic analysis of Vero cells revealed a female Chlorocebus sabaeus origin and proviral variations of the endogenous simian type D retrovirus. These results revealed the genomic basis for the non-tumourigenic permanent Vero cell lineage susceptible to various pathogens and will be useful for generating new sub-lines and developing new tools in the quality control of Vero cells. PMID:25267831

  15. New World Hantaviruses Activate IFNλ Production in Type I IFN-Deficient Vero E6 Cells

    PubMed Central

    Prescott, Joseph; Hall, Pamela; Acuna-Retamar, Mariana; Ye, Chunyan; Wathelet, Marc G.; Ebihara, Hideki; Feldmann, Heinz; Hjelle, Brian


    Background Hantaviruses indigenous to the New World are the etiologic agents of hantavirus cardiopulmonary syndrome (HCPS). These viruses induce a strong interferon-stimulated gene (ISG) response in human endothelial cells. African green monkey-derived Vero E6 cells are used to propagate hantaviruses as well as many other viruses. The utility of the Vero E6 cell line for virus production is thought to owe to their lack of genes encoding type I interferons (IFN), rendering them unable to mount an efficient innate immune response to virus infection. Interferon λ, a more recently characterized type III IFN, is transcriptionally controlled much like the type I IFNs, and activates the innate immune system in a similar manner. Methodology/Principal Findings We show that Vero E6 cells respond to hantavirus infection by secreting abundant IFNλ. Three New World hantaviruses were similarly able to induce IFNλ expression in this cell line. The IFNλ contained within virus preparations generated with Vero E6 cells independently activates ISGs when used to infect several non-endothelial cell lines, whereas innate immune responses by endothelial cells are specifically due to viral infection. We show further that Sin Nombre virus replicates to high titer in human hepatoma cells (Huh7) without inducing ISGs. Conclusions/Significance Herein we report that Vero E6 cells respond to viral infection with a highly active antiviral response, including secretion of abundant IFNλ. This cytokine is biologically active, and when contained within viral preparations and presented to human epithelioid cell lines, results in the robust activation of innate immune responses. We also show that both Huh7 and A549 cell lines do not respond to hantavirus infection, confirming that the cytoplasmic RNA helicase pathways possessed by these cells are not involved in hantavirus recognition. We demonstrate that Vero E6 actively respond to virus infection and inhibiting IFNλ production in these cells might increase their utility for virus propagation. PMID:20567522

  16. Correlation of increased nuclease activity with enhanced virus reactivation. [Monkey Vero cells, mouse L cells

    SciTech Connect

    Nishiyama, Y.; Maeno, K.; Yoshida, S.


    An increase in nuclease activity, which degraded both unirradiated and ultraviolet (UV)-irradiated DNA, was observed in the extract of monkey Vero cells after irradiation with an appropriate amount of UV. In contrast, no increase was observed with mouse L cells. Neither DNA polymerases nor uracil-DNA glycosylase was enhanced but rather suppressed by UV irradiation in both cell lines. Cytological studies showed that, in Vero cells, the reactivation of UV-irradiated herpes simplex virus was markedly enhanced by irradiating cells with UV before infection. However, no enhancement was observed with L cells. These results suggest that an increase in nuclease activity may be one of underlying mechanisms for the enhanced reactivation of DNA viruses.

  17. Adhesion and internalization differences of COM nanocrystals on Vero cells before and after cell damage.


    Gan, Qiong-Zhi; Sun, Xin-Yuan; Ouyang, Jian-Ming


    The adhesion and internalization between African green monkey kidney epithelial (Vero) cells (before and after oxidative damage by hydrogen peroxide) and calcium oxalate monohydrate (COM) nanocrystals (97±35nm) were investigated so as to discuss the molecular and cellular mechanism of kidney stone formation. Scanning electron microscope (SEM) was used to observe the Vero-COM nanocrystal adhesion; the nanocrystal-cell adhesion was evaluated by measuring the content of malonaldehyde (MDA), the activity of superoxide dismutase (SOD), the expression level of cell surface osteopontin (OPN) and the change of Zeta potential. Confocal microscopy and flow cytometry were used for the observation and quantitative analysis of crystal internalization. In the process of adhesion, the cell viability and the SOD activity declined, the MDA content, Zeta potential, and the OPN expression level increased. The adhesive capacity of injured Vero was obviously stronger than normal cells; in addition the injured cells promoted the aggregation of COM nanocrystals. The capacity of normal cells to internalize crystals was obviously stronger than that of injured cells. Cell injury increased adhesive sites on cell surface, thereby facilitating the aggregation of COM nanocrystals and their attachment, which results in enhanced risk of calcium oxalate stone formation. PMID:26652375

  18. Antiproliferative efficacy of Tabernaemontana divaricata against HEP2 cell line and Vero cell line

    PubMed Central

    Kumar, Arvind; Selvakumar, S.


    Background: Laryngeal cancer may also be called cancer of the larynx or laryngeal carcinoma. Conventional plants are a precious source of novel anticancer agents and are still in performance better role in health concern. The study was intended to estimation of the anticancer activity of the chloroformic extract of Tabernaemontana divaricata on the human epidermoid larynx carcinoma cell line (Hep 2). Materials and Method: The aerial parts (leaves, stem, and flowers) of T. divaricata were tested for its inhibitory effect in 96 microplate formats against Hep 2 cell line. The anticancer activity of samples on Hep 2 and Vero was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and various enzymatic parameters like catalase, reduced glutathione (GSH), GSH peroxidase, and superoxide anion scavenging activity. Viable cells were determined by the absorbance at 540 nm. Measurements were performed, and the concentration required for a 50% inhibition of viability (IC50) was determined graphically. The effect of the samples on the proliferation of Hep 2 and Vero cells was expressed as the % cell viability. Results: The extract on Hep 2 cell line up to 7.8 μg/ml and that IC50 value on Hep 2 cell line was 112 μg whereas 94 μg for Vero cell line. Hence, T. divaricata has lesser significant action on Vero cell line. Conclusion: Medicinal plant drug discovery continues to provide new and important leads against various pharmacological targets including cancer. Our results clearly indicate the anticancer property of the medicinal plant T. divaricata against the human laryngeal carcinoma cell lines (Hep 2 cell line). PMID:26109773

  19. Isolation and propagation of Dengue virus in Vero and BHK-21 cells expressing human DC-SIGN stably.


    Phanthanawiboon, Supranee; A-nuegoonpipat, Atchareeya; Panngarm, Narawan; Limkittikul, Kriengsak; Ikuta, Kazuyoshi; Anantapreecha, Surapee; Kurosu, Takeshi


    The "standard" methods of isolating dengue virus (DENV) utilize the mosquito cell line C6/36, monkey kidney LLC-MK2 cells, Vero cells, or baby hamster kidney (BHK-21) cells. However, these cells lines lack a particular DENV receptor, known as dendritic cell-specific ICAM-3-grabbing non-integrin (DC-SIGN), which is expressed on immature dendritic cells and monocytes/macrophages. This may result in less efficient virus isolation and propagation. The present study used a lentivirus vector to establish Vero and BHK-21 cell lines (Vero-DC and BHK-DC) that express human DC-SIGN stably. Five DENV strains, each passaged several times in C6/36 cells, replicated more efficiently in Vero-DC and BHK-DC than in the parental Vero or BHK-21 cells. Vero/Vero-DC and BHK-21/BHK-DC were used to isolate virus from buffy coats and plasma samples derived from 13 patients infected with DENV. Most of the viruses showed increased production in cell lines expressing DC-SIGN. However, the isolation rate was lower (15.4-46.2%) than that from C6/36 cells (84.6%). Interestingly, when the viruses were isolated in C6/36 cells prior to infecting Vero/Vero-DC and BHK-21/BHK-DC, the rate of virus production increased markedly, reaching levels higher than those initially achieved in C6/36 cells. These data suggest that Vero-DC and BHK-DC could be useful tools for virus propagation, and that human specimens may contain a factor that interferes with virus growth in mammalian cells. PMID:25205264

  20. Identification of a Putative Coreceptor on Vero Cells That Participates in Dengue 4 Virus Infection

    PubMed Central

    Martnez-Barragn, Jos de Jess; del Angel, Rosa M.


    Dengue virus infects target cells by attaching to a cell surface receptor through the envelope (E) glycoprotein, located on the surface of the viral membrane. On Vero and BHK cells, heparan sulfate (HS) moieties of proteoglycans are the receptors for dengue virus; however, additional proteins have also been described as putative dengue virus receptors on C6/36, HL60, and BM cells. HS can also act as a receptor for other types of viruses or as an attachment molecule for viruses that require additional host cell molecules to allow viral penetration. In this study we searched for molecules other than HS that could participate in dengue virus infection of Vero cells. Labeled dengue 4 virus bound with high affinity to two molecules of 74 and 44 kDa. Binding of dengue virus to the 74-kDa molecule was susceptible to protease and sodium periodate treatment and resistant to heparinase treatments. Lectins such as concanavalin A and wheat germ agglutinin prevented dengue virus binding to both the 74- and the 44-kDa protein in overlay assays, while phytohemagglutinin P did not affect binding, suggesting that carbohydrate residues (?-mannose or N-acetylglucosamine) are important in virus binding to host cells. Protease susceptibility, biotin labeling, and immunofluorescence with a polyclonal antibody raised against the 74-kDa protein consistently identified the protein on the surfaces of Vero cells. Moreover, the antibody against the 74-kDa protein was able to inhibit dengue virus infection. These data suggest that HS might serve as a primary receptor, probably concentrating virus particles on the surfaces of Vero cells, and then other molecules, such as the 74-kDa protein, might participate as coreceptors in viral penetration. The 74-kDa protein possibly constitutes part of a putative receptor complex for dengue virus infection of Vero cells. PMID:11483725

  1. Life cycle, growth characteristics and host cell response of Rickettsia helvetica in a Vero cell line.


    Elfving, Karin; Lukinius, Agneta; Nilsson, Kenneth


    Rickettsia helvetica, a spotted fever rickettsia and emerging pathogen with Ixodes ricinus ticks as the main vector, is an agent of human disease and may cause febrile illness as well as meningitis. In three parallel series the isolated standard type of R. helvetica, obtained from a PCR-positive I. ricinus tick, was high-passaged and propagated in a Vero cell line. By using quantitative real-time PCR, the generation time from inoculation to stationary phase of growth was calculated to 20-22 h. In the static cultivation system the stationary phase was observed from the seventh day after inoculation, and there was no observed degradation of R. helvetica DNA during the 14 days studied. Microscopy showed that the organisms invaded the host cells rapidly and were primarily found free in the cytoplasm and only occasionally located in the nucleus. Four days after inoculation some of the host cells were broken and many indifferent stages of cytoplasmic organic decomposition were seen. However the R. helvetica organism did not show any morphologic alterations and the number of organisms was stable after the replication peak which may indicate that R. helvetica is adapted to growth in a Vero cell line and/or that the phase of degradation occurs later than the 14 days studied. The findings differ from what has been reported for other rickettsiae of the spotted fever group and may be of importance for invasiveness and virulence of R. helvetica. PMID:22116301

  2. Experimental infection of BHK21 and Vero cell lines with different Mycoplasma spp

    PubMed Central

    Netto, Cristiane; Soccol, Vanete Thomaz; Sepulveda, Lya Madureira; Timenetsky, Jorge


    Mycoplasma spp, belongs to the class Mollicutes and is capable to produce alterations in cellular cultures causing damages to the biotechnological industry. Bioproducts generally require two essential inputs, bovine serum and cells. The study herein aims to evaluate the mycoplasma concentrations that affect the growing of BHK21 and Vero cells. The species used were: Mycoplasma orale, M. salivarium, M. arginini and M. hyorhinis, cultivated in a SP4 media. Two contamination tests were performed with BHK21 and Vero cells and one of them applied different concentrations of mycoplasma. In the first one, mycoplasma was applied at the day zero and, in the second one, the contamination was performed after the monolayer establishment. The both cellular cultures presented cytopathic effects with mycoplasma contamination, but the Vero cells suffered more damages than the BHK21 ones. It was also observed that the severity of the cytopathic effect depended on the mycoplasma specie, on the concentration and on the time of contact with the cellular culture, which evidences the importance of controlling the presence of mycoplasma in biotechnological industries. PMID:25763061

  3. Proteome analysis of virus-host cell interaction: rabies virus replication in Vero cells in two different media.


    Kluge, Sabine; Rourou, Samia; Vester, Diana; Majoul, Samy; Benndorf, Dirk; Genzel, Yvonne; Rapp, Erdmann; Kallel, Héla; Reichl, Udo


    The use of Vero cells for rabies vaccine production was recommended from the WHO in 2005. A controlled production process is necessary to reduce the risk of contaminants in the product. One step towards this is to turn away from animal-derived components (e.g. serum, trypsin, bovine serum albumin) and face a production process in animal component-free medium. In this study, a proteomic approach was applied, using 2-D differential gel electrophoresis and mass spectrometry to compare rabies virus propagation in Vero cells under different cultivation conditions in microcarrier culture. Protein alterations were investigated for uninfected and infected Vero cells over a time span from 1 to 8 days post-infection in two different types of media (serum-free versus serum-containing media). For mock-infected cells, proteins involved in stress response, redox status, protease activity or glycolysis, and protein components in the endoplasmic reticulum were found to be differentially expressed comparing both cultivation media at all sampling points. For virus-infected cells, additionally changes in protein expression involved in general cell regulation and in calcium homeostasis were identified under both cultivation conditions. The fact that neither of these additional proteins was identified for cells during mock infection, but similar protein expression changes were found for both systems during virus propagation, indicates for a specific response of the Vero cell proteome on rabies virus infection. PMID:23674149

  4. Adaptation and growth kinetics study of an Indian isolate of virulent duck enteritis virus in Vero cells.


    Aravind, S; Kamble, Nitin M; Gaikwad, Satish S; Shukla, Sanjeev Kumar; Dey, Sohini; Mohan, C Madhan


    Duck virus enteritis, also known as duck plague, is a viral infection of ducks caused by duck enteritis virus (DEV). The control of the disease is mainly done by vaccination with chicken embryo adapted live virus that is known to be poorly immunogenic and elicits only partial protection. Further, the embryo propagated vaccine virus pose a threat of harboring other infectious agents. Seeing these limitations, the present study reports for the first time regarding propagation and adaptation of a virulent Indian isolate of duck enteritis virus in Vero cell line. In this study isolation of an outbreak virus from Kerala state was done in chicken embryo fibroblast cell culture (CEF). Then adapted the DEV isolate in the Vero cell line. The characteristic cytopathic effects (CPE) of clumping and fusion of Vero cells were observed starting from the 7th passage onwards. The presence of the virus and its multiplication in Vero cells was confirmed by detection of viral specific DNA and antigen by using polymerase chain reaction (PCR) and indirect immuno fluorescent assay (IIFA), respectively. PCR detection of DEV using self designed primers for US4 (gD) and UL30 (DNA Polymerase) gene has been reported for the in the present study. The kinetics of DEV in Vero cells revealed a maximum infectivity titer of 10(5.6) TCID 50/ml after 48hr of viral infection. Compared to chicken embryo adapted DVE vaccine virus, the Vero cell culture system is free from other infectious agents. So it will be a good candidate for cultivation and propagation of duck enteritis virus vaccine strain. Further research studies are suggested to explore the feasibility of utilizing this Vero cell culture adapted DEV isolate for developing an attenuated vaccine virus against duck virus enteritis. PMID:25450886

  5. Prevention of lipid peroxidation induced by ochratoxin A in Vero cells in culture by several agents.


    Baudrimont, I; Ahouandjivo, R; Creppy, E E


    Ochratoxin A (OTA) is a mycotoxin produced by Aspergillus ochraceus as well as other moulds. This mycotoxin contaminates animal feed and food and is nephrotoxic for all animal species studied so far. OTA is immunosuppressive, genotoxic, teratogenic and carcinogenic. It is a structural analogue of phenylalanine and contains a chlorinated dihydroisocoumarinic moiety. Ochratoxin A inhibits protein synthesis by competition with phenylalanine in the phenylalanine-tRNA aminoacylation reaction. Recently lipid peroxidation induced by OTA has been reported, indicating that the lesions induced by this toxin could also be related to oxidative damage. An attempt to prevent its toxic effect, mainly the lipid peroxidation, has been made using aspartame (L-aspartyl-L-phenylalanine methyl ester) a structural analogue of both OTA and phenylalanine, piroxicam, a non steroidal anti-inflammatory drug and superoxide dismutase+catalase (endogenous oxygen radical scavengers). Lipid peroxidation was assayed in monkey kidney cells (Vero cells) treated by increasing concentrations of OTA (5-50 microM). After 24 h incubation OTA induced lipid peroxidation in Vero cells in a concentration dependent manner, as measured by malonaldehyde (MDA) production. The MDA production, in Vero cells, was significantly increased by 50.5% from 694.1 +/- 21.0 to 1041.5 +/- 23.5 pmol/mg of protein. In the presence of superoxide dismutase (SOD)+catalase (25 micrograms/ml each) the MDA production induced by OTA was significantly decreased. At 50 microM of OTA concentration (optimal production of MDA) the MDA production decreased from 1041.5 +/- 23.5 to 827.5 +/- 21.3 pmol/mg of protein. SOD and catalase, when applied prior to the toxin, seemed to prevent lipid peroxidation more efficiently than piroxicam (at a ten-fold higher concentration than OTA) and aspartame (at equimolar concentration). These molecules also partially prevented the OTA-induced leakage of MDA in the culture medium. PMID:9158693

  6. Superinfection exclusion is absent during acute Junin virus infection of Vero and A549 cells

    PubMed Central

    Gaudin, Raphaël; Kirchhausen, Tomas


    Many viruses have evolved strategies of so-called “superinfection exclusion” to prevent re-infection of a cell that the same virus has already infected. Although Old World arenavirus infection results in down-regulation of its viral receptor and thus superinfection exclusion, whether New World arenaviruses have evolved such a mechanism remains unclear. Here we show that acute infection by the New World Junin virus (JUNV) failed to down-regulate the transferrin receptor and did not induce superinfection exclusion. We observed that Vero cells infected by a first round of JUNV (Candid1 strain) preserve an ability to internalize new incoming JUNV particles that is comparable to that of non-infected cells. Moreover, we developed a dual infection assay with the wild-type Candid1 JUNV and a recombinant JUNV-GFP virus to discriminate between first and second infections at the transcriptional and translational levels. We found that Vero and A549 cells already infected by JUNV were fully competent to transcribe viral RNA from a second round of infection. Furthermore, flow cytometry analysis of viral protein expression indicated that viral translation was normal, regardless of whether cells were previously infected or not. We conclude that in acutely infected cells, Junin virus lacks a superinfection exclusion mechanism. PMID:26549784

  7. Removing residual DNA from Vero-cell culture-derived human rabies vaccine by using nuclease.


    Li, Si-Ming; Bai, Fu-Liang; Xu, Wen-Juan; Yang, Yong-Bi; An, Ying; Li, Tian-He; Yu, Yin-Hang; Li, De-Shan; Wang, Wen-Fei


    The clearance of host cell DNA is a critical indicator for Vero-cell culture-derived rabies vaccine. In this study, we evaluated the clearance of DNA in Vero-cell culture-derived rabies vaccine by purification process utilizing ultrafiltration, nuclease digestion, and gel filtration chromatography. The results showed that the bioprocess of using nuclease decreased residual DNA. Dot-blot hybridization analysis showed that the residual host cell DNA was <100 pg/ml in the final product. The residual nuclease in rabies vaccine was less than 0.1 ng/ml protein. The residual nuclease could not paly the biologically active role of digestion of DNA. Experiments of stability showed that the freeze-drying rabies virus vaccine was stable and titers were >5.0 IU/ml. Immunogenicity test and protection experiments indicated mice were greatly induced generation of neutralizing antibodies and invoked protective effects immunized with intraperitoneal injections of the rabies vaccine. These results demonstrated that the residual DNA was removed from virus particles and nuclease was removed by gel filtration chromatography. The date indicated that technology was an efficient method to produce rabies vaccine for human use by using nuclease. PMID:25108516

  8. Vero cells expressing porcine circovirus type 2-capsid protein and their diagnostic application.


    Kim, Yeon-Hee; Kweon, Chang-Hee; Kang, Seung-Won; Oh, Yoon I; Song, Jae Young; Lee, Kyoung Ki; Park, Se Chang


    Porcine circovirus type 2 (PCV2) is the causative agent of postweaning multisystemic wasting syndrome (PMWS) in swine. Although the incidences of PCV2-related diseases are ubiquitous throughout the world, the serological tools are rather limited, mainly because the virus does not induce any cytopathic effects in cells. The purpose of this study was to develop a rapid, sensitive and easy quantitative immunofluorescence assay (QIFA) using the recombinant PCV2 nucleocapsid protein (NCP) for the detection of PCV2-specific antibodies in pig sera. The recombinant PCV2 NCP was expressed in Vero cells by a lentivirus system. The performance of QIFA using these Vero cells as a diagnostic antigen was compared with currently available C-ELISA and I-ELISA; the relative sensitivity turned out to range from 92.5% up to 99.3%. The relative specificity was 93.3% when compared to C-ELISA as the gold standard. The serological experiment also indicated the inverse relationship between QIFA and the viral load in serum, semen, feces samples from 7 PCV2-positive boars. In addition, the PCV2 sequence detected from bone marrow cells shows 99% of sequence identity with PCV2 genome, confirming the infectivity of PCV2. PMID:23954842

  9. Mathematical model of adherent Vero cell growth and poliovirus production in animal component free medium.


    Ursache, Ramona V; Thomassen, Yvonne E; van Eikenhorst, Gerco; Verheijen, Peter J T; Bakker, Wilfried A M


    Sabin-IPV (or sIPV, inactivated polio vaccine based on attenuated Sabin strains) is anticipated to replace the oral polio vaccine for the endgame in polio eradication. Optimization of sIPV production will lead to a better economically feasible vaccine. To assist process optimization, we studied Sabin type 1 poliovirus (PV) infection kinetics on Vero cells in controlled bioreactor vessels. The aim of our study was to develop a descriptive mathematical model able to capture the dynamics of adherent Vero cell growth and PV infection kinetics in animal component free medium. The model predicts the cell density, metabolites profiles, and viral yields in time. We found that the multiplicity of infection (MOI) and the time of infection (TOI) within the investigated range did not affect maximal PV yields, but they did affect the process time. The latter may be reduced by selecting a low TOI and a high MOI. Additionally, we present a correlation between viral titers and D-antigen, a measure for immunogenicity, of Sabin type 1 PV. The developed model is adequate for further studies of the cell metabolism and infection kinetics and may be used to identify control strategies to increase viral productivity. Increased viral yields reduce costs of polio vaccines with large implications on public health. PMID:25294335

  10. Real-time Imaging of Rabies Virus Entry into Living Vero cells

    PubMed Central

    Xu, Haijiao; Hao, Xian; Wang, Shaowen; Wang, Zhiyong; Cai, Mingjun; Jiang, Junguang; Qin, Qiwei; Zhang, Maolin; Wang, Hongda


    Understanding the mechanism of rabies virus (RABV) infection is vital for prevention and therapy of virulent rabies. However, the infection mechanism remains largely uncharacterized due to the limited methods and viral models. Herein, we utilized a powerful single-virus tracking technique to dynamically and globally visualize the infection process of the live attenuated rabies vaccine strain-SRV9 in living Vero cells. Firstly, it was found that the actin-enriched filopodia is in favor of virus reaching to the cell body. Furthermore, by carrying out drug perturbation experiments, we confirmed that RABV internalization into Vero cells proceeds via classical dynamin-dependent clathrin-mediated endocytosis with requirement for intact actin, but caveolae-dependent endocytosis is not involved. Then, our real-time imaging results unambiguously uncover the characteristics of viral internalization and cellular transport dynamics. In addition, our results directly and quantitatively reveal that the intracellular motility of internalized RABV particles is largely microtubule-dependent. Collectively, our work is crucial for understanding the initial steps of RABV infection, and elucidating the mechanisms of post-infection. Significantly, the results provide profound insight into development of novel and effective antiviral targets. PMID:26148807

  11. Estimation of the Cultured Cells’ Volume and Surface Area: Application of Stereological Methods on Vero Cells Infected by Rubella Virus

    PubMed Central

    Noorafshan, Ali; Motamedifar, Mohammad; Karbalay-Doust, Saied


    Background: Morphological changes of the cells infected with rubella virus cannot be observed easily. Estimation of the size of the cultured cells can be a valuable parameter in this condition. This study was conducted to find answers to the following questions: How much time after infection with rubella virus, the volume and surface area of the Vero cells and their nuclei get started to change?How is it possible to apply stereological methods to estimate the volume and surface area of the cultured cells using the invariator, nucleator, and surfactor techniques? Methods: The cultured Vero cells were infected with rubella virus. The cells of the control and experimental groups were harvested at 2, 4, 8, 24, and 48 hours following the incubation period. The cells were processed and embedded in paraffin. Invariator, nucleator, and surfactor were applied to estimate the size of the Vero cells and their nuclei. Results: The cell volume was decreased by 15-24%, 48 hours after the infection in comparison to the non-infected cells. Besides, the cell surface area was decreased by 13%, 48 hours after the infection. However, no changes were detected in the nuclei. The values of the standard deviation and coefficient of variation of the cells, estimated by invariator, were lower compared to those measured by the nucleator or surfactor. Conclusion: In this study, the volume and surface area of the Vero cells were reduced by rubella virus 48 hours after infection. Invariator is a more precise method compared to nucleator or surfactor. PMID:26722143

  12. Diphtheria toxin-induced channels in Vero cells selective for monovalent cations

    SciTech Connect

    Sandvig, K.; Olsnes, S.


    Ion fluxes associated with translocation of diphtheria toxin across the surface membrane of Vero cells were studied. When cells with surface-bound toxin were exposed to low pH to induce toxin entry, the cells became permeable to Na+, K+, H+, choline+, and glucosamine+. There was no increased permeability to Cl-, SO4(-2), glucose, or sucrose, whereas the uptake of /sup 45/Ca2+ was slightly increased. The influx of Ca2+, which appears to be different from that of monovalent cations, was reduced by several inhibitors of anion transport and by verapamil, Mn2+, Co2+, and Ca2+, but not by Mg2+. The toxin-induced fluxes of N+, K+, and protons were inhibited by Cd2+. Cd2+ also protected the cells against intoxication by diphtheria toxin, suggesting that the open cation-selective channel is required for toxin translocation. The involvement of the toxin receptor is discussed.

  13. Cytotoxicity of methanol extracts of Elaeis guineensis on MCF-7 and Vero cell lines

    PubMed Central

    Vijayarathna, Soundararajan; Sasidharan, Sreenivasan


    Objective To investigate the cytotoxic effect of Elaeis guineensis methanol extract on MCF-7 and Vero cell. Methods In vitro cytotoxicity was evaluated in by MTT assay. Cell morphological changes were observed by using light microscope. Results The MTT assay indicated that methanol extract of the plant exhibited significant cytotoxic effects on MCF-7. Morphological alteration of the cell lines after exposure with Elaeis guineensis extract were observed under phase contrast microscope in the dose dependent manner. Conclusions The results suggest the probable use of the Elaeis guineensis methanol extract in preparing recipes for cancer-related ailments. Further studies on isolation of metabolites and their in vivo cytotoxicity are under investigation. PMID:23569855

  14. Chemical induction of endogenous retrovirus particles from the vero cell line of African green monkeys.


    Ma, Hailun; Ma, Yunkun; Ma, Wenbin; Williams, Dhanya K; Galvin, Teresa A; Khan, Arifa S


    Endogenous retroviral sequences are present in high copy numbers in the genomes of all species and may be expressed as RNAs; however, the majority are defective for virus production. Although virus has been isolated from various Old World monkey and New World monkey species, there has been no report of endogenous retroviruses produced from African green monkey (AGM) tissues or cell lines. We have recently developed a stepwise approach for evaluating the presence of latent viruses by chemical induction (Khan et al., Biologicals 37:196-201, 2009). Based upon this strategy, optimum conditions were determined for investigating the presence of inducible, endogenous retroviruses in the AGM-derived Vero cell line. Low-level reverse transcriptase activity was produced with 5-azacytidine (AzaC) and with 5'-iodo-2'-deoxyuridine (IUdR); none was detected with sodium butyrate. Nucleotide sequence analysis of PCR-amplified fragments from the gag, pol, and env regions of RNAs, prepared from ultracentrifuged pellets of filtered supernatants, indicated that endogenous retrovirus particles related to simian endogenous type D betaretrovirus (SERV) sequences and baboon endogenous virus type C gammaretrovirus (BaEV) sequences were induced by AzaC, whereas SERV sequences were also induced by IUdR. Additionally, sequence heterogeneity was seen in the RNAs of SERV- and BaEV-related particles. Infectivity analysis of drug-treated AGM Vero cells showed no virus replication in cell lines known to be susceptible to type D simian retroviruses (SRVs) and to BaEV. The results indicated that multiple, inducible endogenous retrovirus loci are present in the AGM genome that can encode noninfectious, viruslike particles. PMID:21543506

  15. Chemical Induction of Endogenous Retrovirus Particles from the Vero Cell Line of African Green Monkeys▿

    PubMed Central

    Ma, Hailun; Ma, Yunkun; Ma, Wenbin; Williams, Dhanya K.; Galvin, Teresa A.; Khan, Arifa S.


    Endogenous retroviral sequences are present in high copy numbers in the genomes of all species and may be expressed as RNAs; however, the majority are defective for virus production. Although virus has been isolated from various Old World monkey and New World monkey species, there has been no report of endogenous retroviruses produced from African green monkey (AGM) tissues or cell lines. We have recently developed a stepwise approach for evaluating the presence of latent viruses by chemical induction (Khan et al., Biologicals 37:196–201, 2009). Based upon this strategy, optimum conditions were determined for investigating the presence of inducible, endogenous retroviruses in the AGM-derived Vero cell line. Low-level reverse transcriptase activity was produced with 5-azacytidine (AzaC) and with 5′-iodo-2′-deoxyuridine (IUdR); none was detected with sodium butyrate. Nucleotide sequence analysis of PCR-amplified fragments from the gag, pol, and env regions of RNAs, prepared from ultracentrifuged pellets of filtered supernatants, indicated that endogenous retrovirus particles related to simian endogenous type D betaretrovirus (SERV) sequences and baboon endogenous virus type C gammaretrovirus (BaEV) sequences were induced by AzaC, whereas SERV sequences were also induced by IUdR. Additionally, sequence heterogeneity was seen in the RNAs of SERV- and BaEV-related particles. Infectivity analysis of drug-treated AGM Vero cells showed no virus replication in cell lines known to be susceptible to type D simian retroviruses (SRVs) and to BaEV. The results indicated that multiple, inducible endogenous retrovirus loci are present in the AGM genome that can encode noninfectious, viruslike particles. PMID:21543506

  16. Directional actin polymerization associated with spotted fever group Rickettsia infection of Vero cells.

    PubMed Central

    Heinzen, R A; Hayes, S F; Peacock, M G; Hackstadt, T


    Members of the spotted fever group (SFG) of rickettsiae spread rapidly from cell to cell by an unknown mechanism(s). Staining of Rickettsia rickettsii-infected Vero cells with rhodamine phalloidin demonstrated unique actin filaments associated with one pole of intracellular rickettsiae. F-actin tails greater than 70 microns in length were seen extending from rickettsiae. Treatment of infected cells with chloramphenicol eliminated rickettsia-associated F-actin tails, suggesting that de novo protein synthesis of one or more rickettsial proteins is required for tail formation. Rickettsiae were coated with F-actin as early as 15 min postinfection, and tail formation was detected by 30 min. A survey of virulent and avirulent species within the SFG rickettsiae demonstrated that all formed actin tails. Typhus group rickettsiae, which do not spread directly from cell to cell, lacked F-actin tails entirely or exhibited only very short tails. Transmission electron microscopy demonstrated fibrillar material in close association with R. rickettsii but not Rickettsia prowazekii. Biochemical evidence that actin polymerization plays a role in movement was provided by showing that transit of R. rickettsii from infected cells into the cell culture medium was inhibited by treatment of host cells with cytochalasin D. These data suggest that the cell-to-cell transmission of SFG rickettsiae may be aided by induction of actin polymerization in a fashion similar to that described for Shigella flexneri and Listeria monocytogenes. Images PMID:8478082

  17. Photoirradiation study of gold nanospheres and rods in Vero and Hela cell lines

    NASA Astrophysics Data System (ADS)

    Gananathan, Poorani; Aruna, Prakasarao; Ganesan, Singaravelu; Elanchezhiyan, Manickan


    Photoirradiation effect of gold nanospheres in conjucation with green light and rods in conjugation with red light corresponds to their absorption wavelength range found to be appreciable. In this present work concentration of nanomaterial and light dose were optimized. Gold nanospheres were synthesized by reduction technique using Sodium Borohydrate as reducing agent and Trisodium Citrate as capping agent. Au nanorods having 680-900nm absorption were synthesized using reduction techniques with CTAB and BDAC polymers. From UV-Vis absorption and Transmission Electron Microscopy the size of nanoparticles were confirmed. 30nm Gold nanospheres and green light source of 530nm wavelength with power 30mW were applied to Vero and Hela cell lines shows higher toxicity for Hela cells. Nanorods were applied and irradiated with 680nm wavelength light source with light intensity 45mW. Post irradiation effect for 24hrs, 48hrs confirms cell proliferation in normal rate in viable cells. The morphological changes in irradiated spot leads to apoptotoic cell death was confirmed with microscopic imaging. The LD50 value was also calculated.

  18. Development of an animal-component free medium for vero cells culture.


    Rourou, Samia; van der Ark, Arno; van der Velden, Tiny; Kallel, Héla


    This work describes the development of an animal-component free medium (IPT-AFM) that allows an optimal growth of Vero cells, an adherent cell line used for the production of viral vaccines. Statistical experimental design was applied to identify crucial nutrients that affect cell growth. Using Medium 199 or MEM as a basal medium, a serum-free medium (SFM) referred as IPT-SFM that only enclosed transferrin as a component of animal origin was developed at first. Then, the composition of IPT-SFM was further improved to obtain an animal-component free medium named IPT-AFM. IPT-AFM contains M199 as a basal medium, plant hydrolysates, epidermal growth factor, ethanolamine, ferric citrate, and vitamin C. Among various plant hydrolysates, specific combinations of soy (Hypep 1510) and wheat gluten (Hypeps 4601 and 4605) hydrolysates, were identified to promote cell growth; whereas individual Hypeps had a minor positive effect on cell growth. Nevertheless, the removal of serum did influence cell attachment. Coating tissue-culture flasks with teleostean, a product extracted from cold water fish skin, had not only enhanced cell attachment but also improved cell growth performance in static cultures. Different non-animal proteases were also assessed as an alternative to trypsin. TrypLE Select, a recombinant trypsin, gave the best cell growth performances. Kinetics of cell growth in IPT-AFM were investigated in T-flasks, cell growth was comparable with that obtained in MEM+10% fetal calf serum (FCS). A mean cell division number equal to 2.26 +/- 0.18 and a specific growth rate micro 0.019 +/- 0.003 h(-1) were achieved in IPT-AFM. PMID:19768803

  19. VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt

    PubMed Central

    Vilchez Larrea, Salomé C.; Kun, Alejandra


    Poly-ADP-ribose (PAR) is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs) and degraded by poly-ADP-ribose-glycohydrolase (PARG). Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair). Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt). In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO). PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications. PMID:25332845

  20. An inactivated yellow fever 17DD vaccine cultivated in Vero cell cultures.


    Pereira, Renata C; Silva, Andrea N M R; Souza, Marta Cristina O; Silva, Marlon V; Neves, Patrícia P C C; Silva, Andrea A M V; Matos, Denise D C S; Herrera, Miguel A O; Yamamura, Anna M Y; Freire, Marcos S; Gaspar, Luciane P; Caride, Elena


    Yellow fever is an acute infectious disease caused by prototype virus of the genus Flavivirus. It is endemic in Africa and South America where it represents a serious public health problem causing epidemics of hemorrhagic fever with mortality rates ranging from 20% to 50%. There is no available antiviral therapy and vaccination is the primary method of disease control. Although the attenuated vaccines for yellow fever show safety and efficacy it became necessary to develop a new yellow fever vaccine due to the occurrence of rare serious adverse events, which include visceral and neurotropic diseases. The new inactivated vaccine should be safer and effective as the existing attenuated one. In the present study, the immunogenicity of an inactivated 17DD vaccine in C57BL/6 mice was evaluated. The yellow fever virus was produced by cultivation of Vero cells in bioreactors, inactivated with β-propiolactone, and adsorbed to aluminum hydroxide (alum). Mice were inoculated with inactivated 17DD vaccine containing alum adjuvant and followed by intracerebral challenge with 17DD virus. The results showed that animals receiving 3 doses of the inactivated vaccine (2 μg/dose) with alum adjuvant had neutralizing antibody titers above the cut-off of PRNT50 (Plaque Reduction Neutralization Test). In addition, animals immunized with inactivated vaccine showed survival rate of 100% after the challenge as well as animals immunized with commercial attenuated 17DD vaccine. PMID:25862300

  1. The Effect of Vero Cell Coculture on the Development of Mouse Embryos Exposed to Monoclonal Antibodies Specific for Mammalian Heat Shock Protein 60

    PubMed Central

    Noh, Ji Hyun; Chung, Kyung Nam


    Heat shock proteins (HSP) have been identified as an important factor of a very complex and highly conserved cellular defense mechanism to preserve cell survival under adverse environmental conditions. HSP 60 are immunodominant antigens of microbe such as Chlamydia trachomatis and have a potentiality to become a target antigen due to antigenic similarity between chlamydial and human HSP. This study was conducted to investigate the effects of Vero cell coculture to anti-HSP 60 on the early mouse embryo development in vitro. The 2-cell mouse embryos (ICR) were cultured and mouse embryo development was observed every 24 hr for 3 days. 45% and 22.1% of the embryos cultured in Ham's F-10 plus anti HSP 60 with Vero cells developed to the 4- to 8-cell stage (day 1) and morular stage (day 2) as compared with 29.2% and 2.7% of those cultured without Vero cells respectively. But at day 3, the beneficial effect of Vero cells was not noted. These findings suggest that Vero cells have some roles to overcome the detrimental effect of anti-HSP 60 to some degree. These results suggest that Vero cells coculture will promote reproductive outcome in patient previously sensitized to microbial (e.g. Chlamydia trachomatis) HSP 60. PMID:16614519

  2. VeroNectin-4 is a highly sensitive cell line that can be used for the isolation and titration of Peste des Petits Ruminants virus.


    Fakri, F; Elarkam, A; Daouam, S; Tadlaoui, K; Fassi-Fihri, O; Richardson, C D; Elharrak, M


    Peste des Petits Ruminants virus (PPRV) is a member of the Morbillivirus subgroup of the family Paramyxoviridae, and is one of the most contagious diseases of small ruminants throughout Africa and the rest of the world. Different cell lines have previously been used to isolate PPRV but with limited success. Thus, to improve the isolation of Morbilliviruses, human, canine, and goat homologues of the lymphocyte receptor signaling lymphocyte activation molecule (SLAM) have been introduced into cells that can support virus replication. However, the amino acid sequence of SLAM varies between species, and often requires adaptation of a particular virus to different versions of the receptor. The protein sequence of Nectin-4 is highly conserved between different mammals, which eliminate the need for receptor adaptation by the virus. Cell lines expressing Nectin-4 have previously been used to propagate measles and canine distemper viruses. In this study, we compared infections in Vero cells expressing canine SLAM (VeroDogSLAM) to those in Vero cells expressing Nectin-4 (VeroNectin-4), following inoculations with wild-type strains of PPRV. Virus isolation using VeroNectin-4 cells was successful with 23% of swabbed samples obtained from live infected animals, and was 89% effective using post-mortem tissues of infected sheep. By contrast, only 4.5% efficiency was observed from swab samples and 67% efficiency was obtained in virus isolation from post-mortem tissues using VeroDogSLAM cells. The average incubation period for virus recovery from post-mortem tissues was 3.4 days using VeroNectin-4 cells, compared with 5.5 days when using VeroDogSLAM cells. The virus titers of PPRV obtained from VeroNectin-4 cells were also higher than those derived from VeroDogSLAM cells. A comparison of the growth kinetics for PPRV in the two cell lines confirmed the superiority of VeroNectin-4 cells for PPR diagnostic purposes and vaccine virus titration. PMID:26615804

  3. Apoptotic activity and anti-Toxoplasma effects of artemether on the tachyzoites and experimental infected Vero and J774 cell lines by Toxoplasma gondii

    PubMed Central

    Mikaeiloo, Hajar; Ghaffarifar, Fatemeh; Dalimi, Abdolhossein; Sharifi, Zohreh; Hassan, Zuhair Mohammad


    Objectives: Drugs used for toxoplasmosis have limited efficacy and also severe side effects. A new drug with good efficacy and limited side effects is need of the hour. We studied the effects of artemether on Toxoplasma gondii in vitro conditions. Materials and Methods: Artemether (methyl-ether-qinghaosu) was tested for tachyzoites, J774, and Vero cell lines infected by T. gondii. For evaluating the effect of drugs on Vero cells infected with T. gondii, we designed two separate experiments; in the first experiment, the Vero cells were infected with tachyzoites and then treated with artemether; while in the second one, the tachyzoites were exposed to artemether and then Vero cells were infected with treated tachyzoites. For evaluating the apoptotic effect of artemether on tachyzoites and infected J774 macrophages cell line with T. gondii, we used flow cytometry method. Inhibitory concentration (IC50) was evaluated by intracellular replication of tachyzoites in Vero cells. Results: IC50 for infected Vero cells with tachyzoites was determined as 49.13 μg/ml. In pretreated tachyzoites with artemether before entering into Vero cells, IC50 was calculated as 13.15 μg/ml. In both experiments, artemether showed a higher inhibitory effect than sulfadiazine (positive control). Artemether even at the highest concentrations only showed low cytotoxicity on Vero and J774 cell lines. Apoptosis in tachyzoites rise with an increasing concentration of artemether. Conclusions: Our findings indicate that artemether is effective to control the tachyzoites of T. gondii in vitro and maybe a good alternative drug for toxoplasmosis. PMID:27127321

  4. Japanese encephalitis virus production in Vero cells with serum-free medium using a novel oscillating bioreactor.


    Toriniwa, Hiroko; Komiya, Tomoyoshi


    A novel oscillating bioreactor, BelloCell, was successfully applied for the cultivation of Vero cells using serum-free medium, and the production of Japanese encephalitis virus. The BelloCell requires no air sparging, pumping, or agitation, and thus provides a low shear environment. Owing to its simple design, BelloCell is extremely easy to handle and operate. Using this BelloCell (500 ml culture), Vero cells reached a maximum number of 2.8 x 10(9) cells and the Japanese encephalitis virus yield reached 6.91 x 10(11) PFU, versus 9.0 x 10(8) cells and 2.98 x 10(11) PFU using a spinner flask (500 ml) with microcarriers. The cell yield and virus production using BelloCell were markedly higher than with microcarrier culture. The neutralizing capacity of the Japanese encephalitis virus produced using BelloCell was equal to that using a microcarrier system. Therefore, these benefits should enable BelloCell to be adopted as a simple system for high population density cell culture and virus production. PMID:17400474

  5. Comparison of herpes simplex (HSV) proteins synthesized in Vero, HEP-2 and human megakaryocyte-like cell lines

    SciTech Connect

    Soslau, G.; Pastorino, M.B.; Morgan, D.A.; Brodsky, I.; Howett, M.K.


    The natural human host blood cell capable of supporting herpes virus replication has yet to be defined. They found that a recently cultured human megakaryocyte-like (Meg) cell line can support HSV 1 and 2 replication as demonstrated by growth inhibition, CPE, virus production and HSV DNA synthesis. The HSV proteins synthesized and post-translationally modified in Vero and HEp-2 infected cells were compared to the protein species produced in the infected Meg cell since differences may influence antigenic properties and host range. Host cell protein synthesis was greatly reduced in all three cell lines within hours post infection (pi). However, maximum viral protein synthesis occurs between 4 and 24 hrs pi with the Meg cells as compared to 24-48 hrs pi with the other cell lines. The immunoprecipitated /sup 35/S-methionine labeled HSV protein gel patterns for each infected cell line are qualitatively and quantitatively very different from each other. Dramatic differences were also observed when infected cells were labeled with /sup 32/P-ATP (in vitro method) or /sup 32/Pi (in vivo method). Finally, analysis of /sup 3/H-mannose labeled HSV glycoproteins demonstrates that the post-translational modifications of these proteins are significantly altered in the Meg cell as compared to the Vero and HEp-2 cells.

  6. Phorbol Esters Isolated from Jatropha Meal Induced Apoptosis-Mediated Inhibition in Proliferation of Chang and Vero Cell Lines

    PubMed Central

    Oskoueian, Ehsan; Abdullah, Norhani; Ahmad, Syahida


    The direct feeding of Jatropha meal containing phorbol esters (PEs) indicated mild to severe toxicity symptoms in various organs of different animals. However, limited information is available on cellular and molecular mechanism of toxicity caused by PEs present in Jatropha meal. Thus, the present study was conducted to determine the cytotoxic and mode of action of PEs isolated from Jatropha meal using human hepatocyte (Chang) and African green monkey kidney (Vero) cell lines. The results showed that isolated PEs inhibited cell proliferation in a dose-dependent manner in both cell lines with the CC50 of 125.9 and 110.3 ?g/mL, respectively. These values were compatible to that of phorbol 12-myristate 13-acetate (PMA) values as positive control i.e., 124.5 and 106.3 ?g/mL respectively. Microscopic examination, flow cytometry and DNA fragmentation results confirmed cell death due to apoptosis upon treatment with PEs and PMA at CC50 concentration for 24 h in both cell lines. The Western blot analysis revealed the overexpression of PKC-? and activation of caspase-3 proteins which could be involved in the mechanism of action of PEs and PMA. Consequently, the PEs isolated form Jatropha meal caused toxicity and induced apoptosis-mediated proliferation inhibition toward Chang and Vero cell lines involving over-expression of PKC-? and caspase-3 as their mode of actions. PMID:23203036

  7. Dengue-3 Virus Entry into Vero Cells: Role of Clathrin-Mediated Endocytosis in the Outcome of Infection

    PubMed Central

    Piccini, Luana E.; Castilla, Viviana; Damonte, Elsa B.


    The endocytic uptake and intracellular trafficking for penetration of DENV-3 strain H-87 into Vero cells was analyzed by using several biochemical inhibitors and dominant negative mutants of cellular proteins. The results presented show that the infective entry of DENV-3 into Vero cells occurs through a non-classical endocytosis pathway dependent on low pH and dynamin, but non-mediated by clathrin. After uptake, DENV-3 transits through early endosomes to reach Rab 7-regulated late endosomes, and according with the half-time for ammonium chloride resistance viral nucleocapsid is released into the cytosol approximately at 12 min post-infection. Furthermore, the influence of the clathrin pathway in DENV-3 infective entry in other mammalian cell lines of human origin, such as A549, HepG2 and U937 cells, was evaluated demonstrating that variable entry pathways are employed depending on the host cell. Results show for the first time the simultaneous coexistence of infective and non -infective routes for DENV entry into the host cell, depending on the usage of clathrin-mediated endocytosis. PMID:26469784

  8. Dengue-3 Virus Entry into Vero Cells: Role of Clathrin-Mediated Endocytosis in the Outcome of Infection.


    Piccini, Luana E; Castilla, Viviana; Damonte, Elsa B


    The endocytic uptake and intracellular trafficking for penetration of DENV-3 strain H-87 into Vero cells was analyzed by using several biochemical inhibitors and dominant negative mutants of cellular proteins. The results presented show that the infective entry of DENV-3 into Vero cells occurs through a non-classical endocytosis pathway dependent on low pH and dynamin, but non-mediated by clathrin. After uptake, DENV-3 transits through early endosomes to reach Rab 7-regulated late endosomes, and according with the half-time for ammonium chloride resistance viral nucleocapsid is released into the cytosol approximately at 12 min post-infection. Furthermore, the influence of the clathrin pathway in DENV-3 infective entry in other mammalian cell lines of human origin, such as A549, HepG2 and U937 cells, was evaluated demonstrating that variable entry pathways are employed depending on the host cell. Results show for the first time the simultaneous coexistence of infective and non -infective routes for DENV entry into the host cell, depending on the usage of clathrin-mediated endocytosis. PMID:26469784

  9. High cell density perfusion cultures of anchorage-dependent Vero cells in a depth filter perfusion system.


    Choi, S K; Chang, H N; Lee, G M; Kim, I H; Oh, D J


    A depth filter perfusion system (DFPS) with polypropylene fibers had been demonstrated to support high density cultures of anchorage-independent hybridoma cells. The DFPS provides advantages of high surface-to-volume ratio of 450-600 cm(2)/cm(3), low cost set-up, easy operation and scale-up. To test the feasibility of using DFPS for high density cultures of anchorage-dependent cells, Vero cells were cultivated in the DFPS. Gelatin coating on polypropylene fibers in the DFPS was necessary to promote cell attachment and growth. Dissolved oxygen (DO) concentrations could be controlled by sparging air into the reservoir vessel through a filter sparger. When DO concentration was controlled above 40% of air saturation in the DFPS with 40 μm pore size, the maximum cell concentration as estimated on specific lactate production rate, was 3.81×10(7) cells/ml of the total reactor volume. This viable cell concentration is approximately 18 times higher than that obtained in a T-flask batch culture. Taken together, the results obtained here showed the potential of DFPS for high-density cultures of anchorage-dependent cells. PMID:22358557

  10. Shiga toxin glycosphingolipid receptors of Vero-B4 kidney epithelial cells and their membrane microdomain lipid environment.


    Steil, Daniel; Schepers, Catherine-Louise; Pohlentz, Gottfried; Legros, Nadine; Runde, Jana; Humpf, Hans-Ulrich; Karch, Helge; Mthing, Johannes


    Shiga toxins (Stxs) are produced by enterohemorrhagic Escherichia coli (EHEC), which cause human infections with an often fatal outcome. Vero cell lines, derived from African green monkey kidney, represent the gold standard for determining the cytotoxic effects of Stxs. Despite their global use, knowledge about the exact structures of the Stx receptor glycosphingolipids (GSLs) and their assembly in lipid rafts is poor. Here we present a comprehensive structural analysis of Stx receptor GSLs and their distribution to detergent-resistant membranes (DRMs), which were prepared from Vero-B4 cells and used as lipid raft equivalents. We identified globotriaosylceramide (Gb3Cer) and globotetraosylceramide (Gb4Cer) as the GSL receptors for Stx1a, Stx2a, and Stx2e subtypes using TLC overlay detection combined with MS. The uncommon Stx receptor, globopentaosylceramide (Gb5Cer, Gal?3GalNAc?3Gal?4Gal?4Glc?1Cer), which was specifically recognized (in addition to Gb3Cer and Gb4Cer) by Stx2e, was fully structurally characterized. Lipoforms of Stx receptor GSLs were found to mainly harbor ceramide moieties composed of sphingosine (d18:1) and C24:0/C24:1 or C16:0 fatty acid. Moreover, co-occurrence with lipid raft markers, SM and cholesterol, in DRMs suggested GSL association with membrane microdomains. This study provides the basis for further exploring the functional impact of lipid raft-associated Stx receptors for toxin-mediated injury of Vero-B4 cells. PMID:26464281

  11. Preclinical evaluation of Vaxfectin-adjuvanted Vero cell-derived seasonal split and pandemic whole virus influenza vaccines

    PubMed Central

    Smith, Larry R.; Wodal, Walter; Crowe, Brian A.; Kerschbaum, Astrid; Bruehl, Peter; Schwendinger, Michael G.; Savidis-Dacho, Helga; Sullivan, Sean M.; Shlapobersky, Mark; Hartikka, Jukka; Rolland, Alain; Barrett, P. Noel; Kistner, Otfried


    Increasing the potency and supply of seasonal and pandemic influenza vaccines remains an important unmet medical need which may be effectively accomplished with adjuvanted egg- or cell culture-derived vaccines. Vaxfectin, a cationic lipid-based adjuvant with a favorable safety profile in phase 1 plasmid DNA vaccines trials, was tested in combination with seasonal split, trivalent and pandemic whole virus, monovalent influenza vaccines produced in Vero cell cultures. Comparison of hemagglutination inhibition (HI) antibody titers in Vaxfectin-adjuvanted to nonadjuvanted vaccinated mice and guinea pigs revealed 3- to 20-fold increases in antibody titers against each of the trivalent influenza virus vaccine strains and 2- to 8-fold increases in antibody titers against the monovalent H5N1 influenza virus vaccine strain. With the vaccine doses tested, comparable antibody responses were induced with formulations that were freshly prepared or refrigerated at conventional 28C storage conditions for up to 6 mo. Comparison of T-cell frequencies measured by interferon-gamma ELISPOT assay between groups revealed increases of between 2- to 10-fold for each of the adjuvanted trivalent strains and up to 22-fold higher with monovalent H5N1 strain. Both trivalent and monovalent vaccines were easy to formulate with Vaxfectin by simple mixing. These preclinical data support further testing of Vaxfectin-adjuvanted Vero cell culture vaccines toward clinical studies designed to assess safety and immunogenicity of these vaccines in humans. PMID:23857272

  12. Absolute quantification of dengue virus serotype 4 chimera vaccine candidate in Vero cell culture by targeted mass spectrometry.


    Rougemont, Blandine; Simon, Romain; Carrière, Romain; Biarc, Jordane; Fonbonne, Catherine; Salvador, Arnaud; Huillet, Céline; Berard, Yves; Adam, Olivier; Manin, Catherine; Lemoine, Jérôme


    Infection by dengue flavivirus is transmitted by mosquitoes and affects tens to hundreds of millions people around the world each year. Four serotypes have been described, all of which cause similar disease. Currently, there no approved vaccines or specific therapeutics for dengue, although several vaccine prototypes are in different stages of clinical development. Among them, a chimeric vaccine, built from the replication machinery of the yellow fever 17D virus, has shown promising results in phase III trials. Accurate quantitation of expressed viral particles in alive attenuated viral antigen vaccine is essential and determination of infectious titer is usually the method of choice. The current paper describes an alternative or orthogonal strategy, namely, a multiplexed and absolute assay of four proteins of the chimera yellow fever/dengue serotype 4 virus using targeted MS in SRM mode. Over 1 month, variability of the assay using a partially purified Vero cell extract was between 8 and 17%, and accuracy was between 80 and 120%. In addition, the assay was linear between 6.25 and 200 nmol/L and could therefore be used in the near future to quantify dengue virus type 4 during production and purification from Vero cells. PMID:26205729

  13. Chemical Synthesis, Characterisation, and Biocompatibility of Nanometre Scale Porous Anodic Aluminium Oxide Membranes for Use as a Cell Culture Substrate for the Vero Cell Line: A Preliminary Study

    PubMed Central

    Poinern, Gérrard Eddy Jai; Le, Xuan Thi; Becker, Thomas; Fawcett, Derek


    In this preliminary study we investigate for the first time the biomedical potential of using porous anodic aluminium oxide (AAO) membranes as a cell substrate for culturing the Cercopithecus aethiops (African green monkey) Kidney (Vero) epithelial cell line. One advantage of using the inorganic AAO membrane is the presence of nanometre scale pore channels that allow the exchange of molecules and nutrients across the membrane. The size of the pore channels can be preselected by adjusting the controlling parameters of a temperature controlled two-step anodization process. The cellular interaction and response of the Vero cell line with an in-house synthesised AAO membrane, a commercially available membrane, and a glass control were assessed by investigating cell adhesion, morphology, and proliferation over a 72 h period. The number of viable cells proliferating over the respective membrane surfaces revealed that the locally produced in-house AAO membrane had cells numbers similar to the glass control. The study revealed evidence of focal adhesion sites over the surface of the nanoporous membranes and the penetration of cellular extensions into the pore structure as well. The outcome of the study has revealed that nanometre scale porous AAO membranes have the potential to become practical cell culture scaffold substrates with the capability to enhance adhesion and proliferation of Vero cells. PMID:24579077

  14. Enhanced Growth of Influenza Vaccine Seed Viruses in Vero Cells Mediated by Broadening the Optimal pH Range for Virus Membrane Fusion

    PubMed Central

    Murakami, Shin; Ito, Mutsumi; Takano, Ryo; Katsura, Hiroaki; Shimojima, Masayuki


    Vaccination is one of the most effective preventive measures to combat influenza. Prospectively, cell culture-based influenza vaccines play an important role for robust vaccine production in both normal settings and urgent situations, such as during the 2009 pandemic. African green monkey Vero cells are recommended by the World Health Organization as a safe substrate for influenza vaccine production for human use. However, the growth of influenza vaccine seed viruses is occasionally suboptimal in Vero cells, which places limitations on their usefulness for enhanced vaccine production. Here, we present a strategy for the development of vaccine seed viruses with enhanced growth in Vero cells by changing an amino acid residue in the stem region of the HA2 subunit of the hemagglutinin (HA) molecule. This mutation optimized the pH for HA-mediated membrane fusion in Vero cells and enhanced virus growth 100 to 1,000 times in the cell line, providing a promising strategy for cell culture-based influenza vaccines. PMID:22090129

  15. Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

    SciTech Connect

    Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.


    Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.

  16. Non-linear relationships between aflatoxin B₁ levels and the biological response of monkey kidney vero cells.


    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel


    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B₁ (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  17. Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

    PubMed Central

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel


    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  18. High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

    SciTech Connect

    Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude; Wang, Yue; Liao, Guoyang


    Highlights: Black-Right-Pointing-Pointer Vero cell-based HPAI H5N1 vaccine with stable high yield. Black-Right-Pointing-Pointer Stable high yield derived from the YNVa H3N2 backbone. Black-Right-Pointing-Pointer H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

  19. Photodynamic efficiency of hypericin compared with chlorin and hematoporphyrin derivatives in HEp-2 and Vero epithelial cell lines.


    Bernal, Claudia; Ribeiro, Anderson O; Andrade, Gislaine P; Perussi, Janice R


    Hypericin (HY) is a photoactive aromatic dianthraquinone that is considered a potent photodynamic agent. In this study, hypericin and two other photosensitizers, a hematoporphyrin derivative (Photogem(®); PG) and a chlorin derivative (Photodithazine(®); PZ), were compared in terms of their phototoxicity toward two cell lines, HEp-2 and Vero. The median inhibitory concentration (IC(50)) of each of the photosensitizers was obtained after a 16.2J cm(-2) dose of irradiation at 630 ± 10 nm. The IC(50) values were 0.07 ± 0.01 (HY), 1.0 ± 0.2 (PZ), and 9 ± 1 μgmL(-1) (PG) in HEp-2 cells and 0.3 ± 0.1 (HY), 1.6 ± 0.2 (PZ) and 11 ± 1 μgmL(-1) (PG) in Vero cells, showing that HY is more phototoxic than the others when irradiated at 630 nm. If these results are analyzed, simultaneously, with the first-order constant for BSA tryptophan photooxidation, obtained by fluorescence decay (λ(excitation)=280 nm), which are 11×10(-3) min(-1)±1. 10(-3) min(-1) (HY), 10 × 10(-3) min(-1)±1 × 10(-3) min(-1) (PZ), and 6 × 10(-3)min(-1) ± 1×10(-3)min(-1) (PG), it is possible to infer that the photodynamic efficiency alone is not sufficient to explain the higher HY phototoxicity. The lipophilicity is also an important factor for an efficient target cell accumulation and was assessed for all sensitizers through the octanol-water partition coefficient (log P): 1.20 ± 0.02 (HY), -0.62 ± 0.03 (PZ), and -0.9 ± 0.2 (PG). The higher value for HY correlates well with its observed superior efficiency to promote damage at low concentrations and doses. As HY is used for the long-term treatment of mild depression, it is considered safe for humans. This fact and the present results reinforce the great potential of this photosensitizer to replace porphyrin derivatives, with the advantages that mean it could be used as photosensitizer in clinical photodynamic therapy. PMID:25910552

  20. Isolation of bovine coronavirus (bcoV) in vero cell line and its confirmation by direct FAT and RT-PCR.


    Hansa, A; Rai, R B; Dhama, K; Wani, M Y; Saminathan, M; Ranganath, G J


    Bovine Coronavirus (BCoV) is widespread both in dairy and beef cattle throughout the world. The virus is one of the largest RNA virus and has specific tropism for intestinal and pulmonary epithelial cells. It is responsible for huge economic losses by causing winter dysentery in adult dairy cattle and respiratory and intestinal tract infections leading to pneumo-enteritis in young calves. Isolation of BCoV has been reported to be difficult. Studies regarding epidemiology, virus isolation and molecular detection from India are very few. In the present study Vero cell line was used for isolation of the BCoV from Enzyme Linked Immunosorbent Assay (ELISA) positive samples. Direct florescent antibody technique (dFAT) and reverse transcriptase-polymerase chain reaction (RT-PCR) were used to confirm the isolated virus strains at antigenic and genomic levels, respectively. Out of the 15 positive fecal samples, virus from only seven was able to infect vero cell line. Subsequently BCoV got adapted to the vero cell line upto three passages, which was confirmed both at genomic and antigenic levels by dFAT and RT-PCR testing. It can be concluded that vero cell line can be used for isolation of BCoV, however due to the enormous stain diversity of the virus it is possible that many stains can't grow and get adapt in this cell line. Further studies are required for isolation of different viral strains, finding the susceptible cell lines and also to confirm the variations among the BCoV isolates at antigenic/genomic levels. PMID:24511744

  1. Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods.


    Huleihel, Mahmoud; Shufan, Elad; Zeiri, Leila; Salman, Ahmad


    Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives) is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA) was performed on the Raman spectra after principal component analysis (PCA) with a leave one out (LOO) approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment. PMID:27078266

  2. Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods

    PubMed Central

    Huleihel, Mahmoud; Shufan, Elad; Zeiri, Leila; Salman, Ahmad


    Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives) is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA) was performed on the Raman spectra after principal component analysis (PCA) with a leave one out (LOO) approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment. PMID:27078266

  3. Evaluation of physicochemical and biological properties of chitosan/poly (vinyl alcohol) polymer blend membranes and their correlation for Vero cell growth.


    Sharma, Parul; Mathur, Garima; Dhakate, Sanjay R; Chand, Subhash; Goswami, Navendu; Sharma, Sanjeev K; Mathur, Ashwani


    The blend membranes with varying weight ratios of chitosan/poly (vinyl alcohol) (CS/PVA) (1:0, 1:1, 1:2.5, 1.5:1, 1.5: 2.5) were prepared using solvent casting method and were evaluated for their potential application in single-use membrane bioreactors (MBRs). The physicochemical properties of the prepared membranes were investigated for chemical interactions (FTIR), surface morphology (SEM), water uptake, protein sorption (qe), ammonia sorption and growth kinetics of Vero cells. CS/PVA blend membrane having weight ratio of 1.5:1 had shown enhanced membrane flexibility, reduced water uptake, less protein sorption and no ammonium sorption compared to CS membrane. This blend membrane also showed comparatively enhanced higher specific growth rate (0.82/day) of Vero cells. Improved physicochemical properties and growth kinetics obtrude CS/PVA (1.5:1) as a potential surface for adhesion and proliferation with possible application in single use membrane bioreactors. Additionally, new insight explaining correlation between water holding (%) of CS/PVA (1.5:1) blend membrane and doubling time (td) of Vero cells is proposed. PMID:26686166

  4. Evaluation of cytokines concentration and percentage of survival of rabies virus-infected mice submitted to anti-rabies Vero-cell propagated vaccine and P. acnes.


    Megid, J; Appolinario, C M; Mazzini, A M; Almeida, M F


    Previously, survival of rabies infection was shown to correlate with low IL-6 serum concentration in mice subjected to post-exposure treatment with the Fuenzalida Palacios rabies vaccine in conjunction with the immunomodulator Propionibacterium acnes, previously Corynebacterium parvum. Considering the substitution of the Fuenzalida Palacios rabies vaccine by the Vero cell raised anti-rabies vaccine in almost all countries, the objective of this work was to evaluate the survival and cytokine serum concentration of rabies virus-infected mice treated with P. acnes in conjunction with or the anti-rabies-VERO vaccine. For this, Swiss mice were experimentally infected with street rabies virus and subjected to vaccine and/or P. acnes following infection. Animals were killed at different times and serum was collected to evaluate cytokines. The greatest survival was observed in animals given one or two does of P. acnes in the absence of vaccination. Animals given anti-rabies VERO vaccine alone or with three doses of P. acnes had the second highest survival rate. The group that had the highest percentage of mortality also had the highest IL-6 concentration on the 10th day, a time correlating with clinical symptoms of the animals. The results reinforce the inefficacy of anti-rabies vaccine in only one dose as a post-exposure treatment irrespective of the type of vaccine used, the immunomodulation activity of P. acnes in rabies post-exposure treatment and suggest a role for IL-6 in rabies virus pathogenesis. PMID:16930720

  5. Neutralizing Antibody Response after Intramuscular Purified Vero Cell Rabies Vaccination (PVRV) in Iranian Patients with Specific Medical Conditions

    PubMed Central

    Rahimi, Pooneh; Vahabpour, RouhAllah; Aghasadeghi, Mohammad Reza; Sadat, Syed Mehdi; Howaizi, Nader; Mostafavi, Ehsan; Eslamifar, Ali; Fallahian, Vida


    Objective Post exposure prophylaxis using one of the WHO-approved vaccines is the method of choice for preventing rabies. Abnormal immune function in patients with some specific medical conditions, such as pregnancy, chronic hepatitis B virus infection, different types of cancers like lymphoma, diabetes I and II, corticosteroid consumption by patients with rheumatoid arthritis and lupus erythematosus, could impair the immunologic response to various vaccines. The immune response to rabies vaccination has never been examined in patients with any of these described medical conditions. This study purposed to evaluate the neutralyzing antibody response after vaccination with purified Vero cell rabies vaccine (PVRV) according to the WHO-recommended Post–Exposure Prophylaxis (PEP) "ESSEN" regimen. Methods Thirty healthy volunteers and 50 volunteers with different medical conditions who were exposed to a suspected rabid animal in the 2nd or 3rd category of exposure received 5 doses of PVRV under the ESSEN protocol. Three blood samples were collected on days 0 (before the first dose), 14, and 35. The anti-rabies antibody titer was measured using the Rapid Fluorescent Foci Inhibition Test (RFFIT) and an ELISA Bio-Rad, Platelia, Rabies II kit. Results All subjects reached NAb titers above 0.5 IU/ml by day 14 after vaccination. On day 35 (1 week after receiving the last rabies vaccine), anti-rabies antibodies were in the protective level (>0.5 IU/ml) in both groups. There was no statistically significant difference in anti-rabies antibody response due to the type of exposure (category 2 or 3), and successful seroconversion was confirmed in both groups. Conclusion In conclusion, the ESSEN protocol using the PVRV vaccine is sufficient for rabies prophylaxis in patients with specific medical conditions. PMID:26440665

  6. Vero/BC-F: an efficient packaging cell line stably expressing F protein to generate single round-infectious human parainfluenza virus type 2 vector.


    Ohtsuka, J; Fukumura, M; Tsurudome, M; Hara, K; Nishio, M; Kawano, M; Nosaka, T


    A stable packaging cell line (Vero/BC-F) constitutively expressing fusion (F) protein of the human parainfluenza virus type 2 (hPIV2) was established for production of the F-defective and single round-infectious hPIV2 vector in a strategy for recombinant vaccine development. The F gene expression has not evoked cytostatic or cytotoxic effects on the Vero/BC-F cells and the F protein was physiologically active to induce syncytial formation with giant polykaryocytes when transfected with a plasmid expressing hPIV2 hemagglutinin-neuraminidase (HN). Transduction of the F-defective replicon RNA into the Vero/BC-F cells led to the release of the infectious particles that packaged the replicon RNA (named as hPIV2ΔF) without detectable mutations, limiting the infectivity to a single round. The maximal titer of the hPIV2ΔF was 6.0 × 10(8) median tissue culture infections dose per ml. The influenza A virus M2 gene was inserted into hPIV2ΔF, and the M2 protein was found to be highly expressed in a human lung cancer cell line after transduction. Furthermore, in vivo airway infection experiments revealed that the hPIV2ΔF was capable of delivering transgenes to hamster tracheal cells. Thus, non-transmissible or single round-infectious hPIV2 vector will be potentially applicable to human gene therapy or recombinant vaccine development. PMID:24942630

  7. Reduction of spiked porcine circovirus during the manufacture of a Vero cell-derived vaccine.


    Lackner, Cornelia; Leydold, Sandra M; Modrof, Jens; Farcet, Maria R; Grillberger, Leopold; Schäfer, Birgit; Anderle, Heinz; Kreil, Thomas R


    Porcine circovirus-1 (PCV1) was recently identified as a contaminant in live Rotavirus vaccines, which was likely caused by contaminated porcine trypsin. The event triggered the development of new regulatory guidance on the use of porcine trypsin which shall ensure that cell lines and porcine trypsin in use are free from PCV1. In addition, manufacturing processes of biologicals other than live vaccines include virus clearance steps that may prevent and mitigate any potential virus contamination of product. In this work, artificial spiking of down-scaled models for the manufacturing process of an inactivated pandemic influenza virus vaccine were used to investigate inactivation of PCV1 and the physico-chemically related porcine parvovirus (PPV) by formalin and ultraviolet-C (UV-C) treatment as well as removal by the purification step sucrose gradient ultracentrifugation. A PCV1 infectivity assay, using a real-time PCR infectivity readout was established. The formalin treatment (0.05% for 48h) showed substantial inactivation for both PCV1 and PPV with reduction factors of 3.0log10 and 6.8log10, respectively, whereas UV-C treatment resulted in complete PPV (≥5.9log10) inactivation already at a dose of 13mJ/cm but merely 1.7log10 at 24mJ/cm(2) for PCV1. The UV-C inactivation results with PPV were confirmed using minute virus of mice (MVM), indicating that parvoviruses are far more sensitive to UV-C than PCV1. The sucrose density gradient ultracentrifugation also contributed to PCV1 clearance with a reduction factor of 2log10. The low pH treatment during the production of procine trypsin was investigated and showed effective inactivation for both PCV1 (4.5log10) and PPV (6.4log10). In conclusion, PCV1 in general appears to be more resistant to virus inactivation than PPV. Still, the inactivated pandemic influenza vaccine manufacturing process provides for robust virus reduction, in addition to the already implemented testing for PCV1 to avoid any contaminations. PMID:24560672

  8. Transcriptional profiling of Vero E6 cells over-expressing SARS-CoV S2 subunit: Insights on viral regulation of apoptosis and proliferation

    SciTech Connect

    Yeung, Y.-S. Yip, C.-W. Hon, C.-C. Chow, Ken Y.C. Ma, Iris C.M. Zeng Fanya Leung, Frederick C.C.


    We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by the diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level.

  9. Immunogenicity and Protective Efficacy of a Vero Cell Culture-Derived Whole-Virus H7N9 Vaccine in Mice and Guinea Pigs

    PubMed Central

    Wodal, Walter; Schwendinger, Michael G.; Savidis-Dacho, Helga; Crowe, Brian A.; Hohenadl, Christine; Fritz, Richard; Brühl, Peter; Portsmouth, Daniel; Karner-Pichl, Anita; Balta, Dalida; Grillberger, Leopold; Kistner, Otfried; Barrett, P. Noel; Howard, M. Keith


    Background A novel avian H7N9 virus with a high case fatality rate in humans emerged in China in 2013. We evaluated the immunogenicity and protective efficacy of a candidate Vero cell culture-derived whole-virus H7N9 vaccine in small animal models. Methods Antibody responses induced in immunized DBA/2J mice and guinea pigs were evaluated by hemagglutination inhibition (HI), microneutralization (MN), and neuraminidase inhibition (NAi) assays. T-helper cell responses and IgG subclass responses in mice were analyzed by ELISPOT and ELISA, respectively. Vaccine efficacy against lethal challenge with wild-type H7N9 virus was evaluated in immunized mice. H7N9-specific antibody responses induced in mice and guinea pigs were compared to those induced by a licensed whole-virus pandemic H1N1 (H1N1pdm09) vaccine. Results The whole-virus H7N9 vaccine induced dose-dependent H7N9-specific HI, MN and NAi antibodies in mice and guinea pigs. Evaluation of T-helper cell responses and IgG subclasses indicated the induction of a balanced Th1/Th2 response. Immunized mice were protected against lethal H7N9 challenge in a dose-dependent manner. H7N9 and H1N1pdm09 vaccines were similarly immunogenic. Conclusions The induction of H7N9-specific antibody and T cell responses and protection against lethal challenge suggest that the Vero cell culture-derived whole-virus vaccine would provide an effective intervention against the H7N9 virus. PMID:25719901

  10. Degradation of cellular mRNAs induced by a virion-associated factor during herpes simplex virus infection of Vero cells.

    PubMed Central

    Schek, N; Bachenheimer, S L


    We have used Northern blot hybridization to study the accumulation of specific cellular mRNAs in Vero cells infected with herpes simplex virus (HSV) type 1 or type 2. HSV-1 infection decreased the cytoplasmic levels of beta- and gamma-actin, beta-tubulin, and histone H3 and H4 mRNAs, though not all at the same rate. HSV-2 infection resulted in a more rapid decrease in actin and histone mRNA levels compared with HSV-1 infection. The turnover rate of each type of mRNA studied was accelerated in HSV-infected cells compared with the rate in uninfected cells. Cellular mRNA degradation was induced by HSV infection under conditions of (i) inhibition of de novo protein synthesis, (ii) inhibition of de novo RNA synthesis, (iii) infection with HSV-1(17) tsK, which fails to produce early and late viral gene products at the nonpermissive temperature, and (iv) infection with purified virions in the presence of actinomycin D. We have concluded that, in Vero cells, cellular mRNA degradation is induced by a factor associated with the infecting HSV virion and thus does not require de novo RNA or protein synthesis. Despite the overall inhibition of cellular mRNA accumulation, a novel 2.2-kilobase cytoplasmic actin transcript was produced in HSV-infected cells when viral gene expression was allowed. The level of accumulation of cytoplasmic host mRNAs was compared with the rate of cellular protein synthesis under different conditions of infection. This analysis suggests that both HSV-1 and HSV-2 require an additional function(s) to completely inhibit cellular protein synthesis. Images PMID:4020960

  11. In vitro susceptibilities of Rickettsia and Bartonella spp. to 14-hydroxy-clarithromycin as determined by immunofluorescent antibody analysis of infected vero cell monolayers.


    Ives, T J; Marston, E L; Regnery, R L; Butts, J D; Majerus, T C


    The in vitro susceptibilities of Rickettsia akari, Rickettsia conorii, Rickettsia prowazekii, Rickettsia rickettsii, Bartonella elizabethae, Bartonella henselae and Bartonella quintana to different concentrations of clarithromycin, 14-hydroxy-clarithromycin (the primary metabolite of clarithromycin) and tetracycline in Vero cell cultures, were determined by enumeration of immunofluorescently-stained bacilli. The extent of antibiotic-induced inhibition of foci was recorded for each dilution of antibiotic and compared with an antibiotic-negative control. Based upon MIC data, clarithromycin alone is highly active against all three Bartonella spp., R. akari and R. prowazekii, while 14-hydroxy-clarithromycin is active against R. conorii, R. prowazekii and R. rickettsii. Further testing is warranted in animal models and human clinical trials, to examine the activity of both clarithromycin and its primary metabolite and to define further the role of clarithromycin in therapy, particularly of infections caused by obligate intracellular bacteria such as Rickettsia and Bartonella spp. PMID:10702548

  12. Preparation and characterization of an anti-inflammatory agent based on a zinc-layered hydroxide-salicylate nanohybrid and its effect on viability of Vero-3 cells.


    Ramli, Munirah; Hussein, Mohd Zobir; Yusoff, Khatijah


    A new organic-inorganic nanohybrid based on zinc-layered hydroxide intercalated with an anti-inflammatory agent was synthesized through direct reaction of salicylic acid at various concentrations with commercially available zinc oxide. The basal spacing of the pure phase nanohybrid was 15.73 Å, with the salicylate anions arranged in a monolayer form and an angle of 57 degrees between the zinc-layered hydroxide interlayers. Fourier transform infrared study further confirmed intercalation of salicylate into the interlayers of zinc-layered hydroxide. The loading of salicylate in the nanohybrid was estimated to be around 29.66%, and the nanohybrid exhibited the properties of a mesoporous-type material, with greatly enhanced thermal stability of the salicylate compared with its free counterpart. In vitro cytotoxicity assay revealed that free salicylic acid, pure zinc oxide, and the nanohybrid have a mild effect on viability of African green monkey kidney (Vero-3) cells. PMID:23345976

  13. Antibody response of patients after postexposure rabies vaccination with small intradermal doses of purified chick embryo cell vaccine or purified Vero cell rabies vaccine.

    PubMed Central

    Briggs, D. J.; Banzhoff, A.; Nicolay, U.; Sirikwin, S.; Dumavibhat, B.; Tongswas, S.; Wasi, C.


    Although the introduction of tissue culture vaccines for rabies has dramatically improved the immunogenicity and safety of rabies vaccines, they are often prohibitively expensive for developing countries. To examine whether smaller doses of these vaccines could be used, we tested the safety and immunogenicity of purified chick embryo cell vaccine (PCECV) on 211 patients in Thailand with World Health Organization (WHO) category II and III exposures to rabies. The patients presented at two Thai hospitals and were randomized into three groups. Patients in Group 1 received 0.1 ml PCECV intradermally at two sites on days 0, 3, 7, and at one site on days 30 and 90. Group 2 was treated similarly, except that purified Vero cell rabies vaccine (PVRV) was used instead of PCECV. Group 3 received 1.0 ml PCECV intramuscularly on days 0, 3, 7, 14, 30 and 90. After 0, 3, 7, 14, 30 and 90 days serum was collected from the subjects and the geometric mean titres (GMTs) of rabies virus neutralizing antibody determined. After 14 days the GMT of 59 patients vaccinated intradermally with PCECV was equivalent to that of patients who received PVRV. Adverse reactions were more frequent in patients who received vaccines intradermally, indicating the reactions were associated with the route of injection, rather than the vaccine per se. We conclude that PCECV is a safe and highly immunogenic vaccine for postexposure rabies vaccination when administered intradermally in 0.1-ml doses using the two-site method ("2,2,2,0,1,1") recommended by WHO. PMID:10859864

  14. Protective effect of methanol extract from citrus press cakes prepared by far-infrared radiation drying on H2O2-mediated oxidative damage in Vero cells

    PubMed Central

    Wijesinghe, W.A.J.P.; Senevirathne, Mahinda; Oh, Myung-Cheol


    In the present study, a suitable drying method was developed for citrus press cakes (CPCs), which are produced as a by-product in citrus juice plants, and the protective effect of methanol extract of CPCs prepared by far-infrared radiation (FIR) drying against H2O2-induced DNA damage was evaluated versus that of freeze-dried CPCs. Methanol extract of FIR-dried CPCs exhibited comparatively good ROS scavenging activity versus the freeze-dried CPCs at the concentration of 100 µg/mL. The extract strongly enhanced the cell viability against H2O2-induced oxidative damage in Vero cells. Lipid peroxidation inhibitory activity of the extract from FIR-dried CPCs was comparable to that of the extract from freeze-dried CPCs. This sample also exhibited good protective effects against H2O2-mediated cell apoptosis as demonstrated by decreased apoptotic body formation in the nuclear staining with Hoechst 33342. In the comet assay, the CPC extracts exhibited strong inhibitory effects against H2O2-mediated DNA damage in a dose-dependent manner. Thus, this study demonstrated that FIR drying effectively preserves CPC as a functionally important natural antioxidant source and the FIR drying can be adapted for drying CPCs and is more economical for massive production than freeze drying. PMID:22125675

  15. Induction of herpes simplex virus type 1 immediate-early gene expression by a cellular activity expressed in Vero and NB41A3 cells after growth arrest-release.

    PubMed Central

    Ralph, W M; Cabatingan, M S; Schaffer, P A


    Infected cell protein 0 (ICP0), a major immediate-early regulatory protein of herpes simplex virus type 1 (HSV-1), activates expression of all classes of HSV genes as well as a variety of heterologous viral and cellular genes. Previous studies have shown that a cellular activity expressed maximally in Vero cells 8 h after release from growth arrest in the G0/G1 phase of the cell cycle can enhance plaque formation and gene expression of a mutant virus (7134) lacking both copies of the gene encoding ICP0 (W. Cai and P. Schaffer, J. Virol. 65:4078-4090, 1991). This observation suggests that the cellular activity can substitute for ICP0 to activate viral gene expression. To further characterize this cellular activity, Vero and NB41A3 (mouse neuroblastoma) cells were transfected at various times after release from growth arrest with promoter-chloramphenicol acetyltransferase (CAT) constructs containing promoters representing the major kinetic classes of HSV genes, and CAT activity was measured from 2 to 24 h postrelease. The results of these tests demonstrate that CAT expression from immediate-early promoter-CAT plasmids was enhanced 10- and 3-fold when Vero and NB41A3 cells were transfected at 6 and 2 h postrelease, respectively. In contrast, only low levels of immediate-early promoter-driven CAT activity were apparent when cells were transfected at later times postrelease. No significant stimulation of CAT activity was observed from promoter-CAT plasmids containing representative early or late HSV promoters or a heterologous viral (simian virus 40 early) promoter. Differences in the efficiency of uptake of plasmid DNA by cells at various times postrelease did not account for the observed differences in CAT expression. Unlike Vero cells, in which cell division resumed after release from growth arrest, division of NB41A3 cells did not resume. Rather, these cells displayed morphological features suggestive of a differentiated phenotype. Collectively, these findings demonstrate that a cellular activity expressed in Vero and NB41A3 cells after release from growth arrest can activate HSV gene expression by enhancing immediate-early gene expression. Images PMID:7933067

  16. Evaluation and Comparison of the In Vitro Cytotoxic Activity of Withania somnifera Methanolic and Ethanolic Extracts against MDA-MB-231 and Vero Cell Lines

    PubMed Central

    Srivastava, A. N.; Ahmad, Rumana; Khan, Mohsin Ali


    Withania somnifera Dunal (WS), commonly known as Ashwagandha in India, belongs to the family Solanaceae. It is extensively used in most of the Indian herbal pharmaceuticals and nutraceuticals. In the current study, the in vitro cytotoxic activity of methanolic, ethanolic, and aqueous extracts of WS stems was evaluated using cytometry and the MTT assay against the MDA-MB-231 human breast cancer cell line. Methanolic and ethanolic extracts of WS showed potent anticancer activity on the MDA-MB-231 human breast cancer cell line, whereas the aqueous extract did not exhibit any significant activity at 100 µg/ml. The percentage viability of the cell lines was determined by using the Trypan blue dye exclusion method. Cell viability was reduced to 21% and 0% at 50 and 100 µg/ml of the methanolic extract, respectively, as compared to 19% and 0% at 50 and 100 µg/ml for the ethanolic extract and 37% at 100 µg/ml in sterile Milli-Q water after 48 hours of treatment. Methanolic and ethanolic extracts of WS were shown to possess IC50 values of 30 and 37 µg/ml, respectively, by the MTT assay and cytometer-based analysis, with the methanolic extract being more active than the other two. On the other hand, methanolic and ethanolic extracts of WS did not exhibit any significant in vitro activity against the normal epithelial cell line Vero at 50 µg/ml. HPLC was carried out for the analysis of its phytochemical profile and demonstrated the presence of the active component Withaferin A in both extracts. The methanolic and ethanolic extracts of Withania should be studied further for the isolation and characterization of the active components to lead optimization studies. PMID:27110497

  17. A new selective chromogenic and turn-on fluorogenic probe for copper(II) in solution and vero cells: recognition of sulphide by [CuL].


    Mahapatra, Ajit Kumar; Mondal, Sanchita; Manna, Saikat Kumar; Maiti, Kalipada; Maji, Rajkishor; Uddin, Md Raihan; Mandal, Sukhendu; Sarkar, Deblina; Mondal, Tapan Kumar; Maiti, Dilip Kumar


    A new coumarin-appended thioimidazole-linked imine conjugate, viz. has been synthesized and characterized. has been found to recognize Cu(2+) selectively among a wide range of biologically relevant metal ions. The chemosensing behavior of has been demonstrated through fluorescence, absorption, visual fluorescence color changes, ESI-MS and (1)H NMR titrations. The chemosensor showed selectivity toward Cu(2+) by switch on fluorescence among the 18 metal ions studied with a detection limit of 1.53 μM. The complex formed between and Cu(2+) is found to be 1 : 1 on the basis of absorption and fluorescence titrations and was confirmed by ESI-MS. DFT and TDDFT calculations were performed in order to demonstrate the structure of and [CuL] and the electronic properties of chemosensor and its copper complex. This highly fluorescent [CuL] complex has been used to recognize sulphide selectively among the other allied anions. Microstructural features of and its Cu(2+) complex have been investigated by SEM imaging (scanning electron microscopy). The biological applications of were evaluated in Vero cells and it was found to exhibit low cytotoxicity and good membrane permeability for the detection of Cu(2+). PMID:25752696

  18. Selection of Escherichia coli heat-labile toxin (LT) inhibitors using both the GM1-ELISA and the cAMP Vero cell assay.


    Verhelst, Roderick; Schroyen, Martine; Buys, Nadine; Niewold, Theo


    Weaned piglets are very susceptible to diarrhea caused by enterotoxigenic Escherichia coli. In the past, various natural components were proposed to have beneficial effects by reducing the effects of diarrheal infectious diseases in humans and animals, and thus may represent an alternative for the use of (prophylactic) antibiotics. Alternatives may inactivate enterotoxigenic Escherichia coli heat-labile toxin (LT) by interfering with toxin binding to the cellular receptor GM1. In this study, various plants and other natural substances were tested for inhibitory properties, in the GM1 binding assay, and in the LT-induced cAMP production in Vero cells. The toxic dose of each compound was determined in a cell viability assay, and the highest nontoxic concentrations were used in the GM1 and cAMP assays. Results demonstrated that only d-(+)-galactose, lactose, N-acetyl-d-galactosamine, and two tea extracts were able to inhibit the binding of LT to its GM1 receptor. In the cAMP assay, only the two tea extracts showed inhibitory activity. This shows that d-(+)-galactose, lactose, and N-acetyl-d-galactosamine can indeed inhibit LT binding to GM1 based on structural homology with GM1 in the absence of living cells. However, in the cAMP assay, d-(+)-galactose, and lactose, N-acetyl-d-galactosamine are apparently metabolized to below their effective inhibitory concentration, likely predicting limited practical applicability in vivo. Both tea extracts maintained their activity in the presence of cells. The active compounds in both are probably polyphenols, which are not easily metabolized, and most likely work by aggregating the toxin. In conclusion, the combination of methods used here is a convenient and fast method for preselecting natural substances containing potentially toxin-binding compounds. Furthermore, if antidiarrhea activity is attributed to compounds found inactive here, their activity is unlikely based on interference with toxin binding. PMID:23692076

  19. Colon tumor cells grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    These photos compare the results of colon carcinoma cells grown in a NASA Bioreactor flown on the STS-70 Space Shuttle in 1995 flight and ground control experiments. The cells grown in microgravity (left) have aggregated to form masses that are larger and more similar to tissue found in the body than the cells cultured on the ground (right). The principal investigator is Milburn Jessup of the University of Texas M. D. Anderson Cancer Center. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Cell constructs grown in a rotating bioreactor on Earth (left) eventually become too large to stay suspended in the nutrient media. In the microgravity of orbit, the cells stay suspended. Rotation then is needed for gentle stirring to replenish the media around the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Credit: NASA and University of Texas M. D. Anderson Cancer Center.

  20. Characterization of yellow fever virus proteins E and NS1 expressed in Vero and Spodoptera frugiperda cells.


    Desprs, P; Girard, M; Bouloy, M


    The cDNA encoding the E and NS1 proteins of the yellow fever virus (YFV) was expressed in Spodoptera frugiperda cells via the recombinant baculovirus Ac-E. NS1 as a gp100 precursor which was cleaved to generate the recombinant proteins E and NS1 similar in size, folding and antigenicity to the authentic ones. Recombinant protein E exhibited immunodominant epitopes as judged by its reactivity with YFV-neutralizing MAbs. Using the Triton X-114 phase separation system, authentic and recombinant E proteins as well as the gp100 precursor exhibited hydrophobic properties similar to those of integral membrane proteins. Recombinant protein E was found neither in the extracellular medium nor on the cell surface, suggesting that it did not migrate within the secretory pathway of insect cells. Analysis of protein NS1 expressed in primate and insect cells revealed that the newly synthesized 48K NS1 glycoprotein was converted to a heat-labile gp72 homo-oligomeric form. This phenomenon did not require the presence of carbohydrate groups. Using the Triton X-114 phase separation system, the oligomeric form of NS1 was shown to be associated with cellular membranes although it appeared less hydrophobic than protein E and gp100. A small fraction of YFV NS1 oligomers were transported throughout the secretory pathway to be shed into the extracellular medium of primate cells. YFV NS1 oligomers migrated from the endoplasmic reticulum to the Golgi complex, whereas their N-oligosaccharides of the high-mannose type are processed to the complex-mannose type. Protein NS1 expressed by recombinant baculovirus-infected insect cells was not found in the extracellular medium but associated with the plasma membrane of the cells. Two recombinant NS1 forms were detected in insect cells: a major one with an apparent Mr of 48K and a minor one of 47K in which N-linked glycans were probably processed to a trimannosyl core without further elongation. Thus, it appears that the transport strategy as well as the N-glycosylation of NS1 in insect cells infected with recombinant baculovirus were different from those of the NS1 in primate cells infected with YFV. PMID:1710649

  1. Human respiratory syncytial virus Memphis 37 grown in HEp-2 cells causes more severe disease in lambs than virus grown in vero cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Respiratory syncytial virus (RSV) is the most common cause of bronchiolitis in infants and young children. A small percentage of these individuals develop severe and even fatal disease. To better understand the pathogenesis of severe disease and develop therapies unique to the less-developed infan...

  2. The Progressive Adaptation of a Georgian Isolate of African Swine Fever Virus to Vero Cells Leads to a Gradual Attenuation of Virulence in Swine Corresponding to Major Modifications of the Viral Genome

    PubMed Central

    Krug, Peter W.; Holinka, Lauren G.; O'Donnell, Vivian; Reese, Bo; Sanford, Brenton; Fernandez-Sainz, Ignacio; Gladue, Douglas P.; Arzt, Jonathan; Rodriguez, Luis; Risatti, Guillermo R.


    ABSTRACT African swine fever virus (ASFV) causes a contagious and often lethal disease of feral and domestic swine. Experimental vaccines derived from naturally occurring, genetically modified, or cell culture-adapted ASFV have been evaluated, but no commercial vaccine is available to control African swine fever (ASF). We report here the genotypic and phenotypic analysis of viruses obtained at different passages during the process of adaptation of a virulent ASFV field isolate from the Republic of Georgia (ASFV-G) to grow in cultured cell lines. ASFV-G was successively passaged 110 times in Vero cells. Viruses obtained at passages 30, 60, 80, and 110 were evaluated in vitro for the ability to replicate in Vero cells and primary swine macrophages cultures and in vivo for assessing virulence in swine. Replication of ASFV-G in Vero cells increased with successive passages, corresponding to a decreased replication in primary swine macrophages cultures. In vivo, progressive loss of virus virulence was observed with increased passages in Vero cells, and complete attenuation of ASFV-G was observed at passage 110. Infection of swine with the fully attenuated virus did not confer protection against challenge with virulent parental ASFV-G. Full-length sequence analysis of each of these viruses revealed significant deletions that gradually accumulated in specific areas at the right and left variable ends of the genome. Mutations that result in amino acid substitutions and frameshift mutations were also observed, though in a rather limited number of genes. The potential importance of these genetic changes in virus adaptation/attenuation is discussed. IMPORTANCE The main problem in controlling ASF is the lack of vaccines. Attempts to produce vaccines by adaptation of ASFV to cultured cell lines have been made. These attempts led to the production of attenuated viruses that conferred only homologous protection. Specifics regarding adaptation of these isolates to cell cultures have been insufficiently described. Details like the numbers of passages required to obtain attenuated viruses, genetic modifications introduced into the virus genomes along passages, and the extent of attenuation and induced protective efficacy are not readily available. In this study, we assessed the changes that lead to decreased growth in swine macrophages and to attenuation in swine. Loss of virulence, probably associated with limited replication in vivo, may lead to the lack of protective immunity in swine observed after challenge. This report provides valuable information that can be used to further the understanding of ASFV gene function, virus attenuation, and protection against infection. PMID:25505073

  3. In vitro susceptibilities of Bartonella henselae, B. quintana, B. elizabethae, Rickettsia rickettsii, R. conorii, R. akari, and R. prowazekii to macrolide antibiotics as determined by immunofluorescent-antibody analysis of infected Vero cell monolayers.


    Ives, T J; Manzewitsch, P; Regnery, R L; Butts, J D; Kebede, M


    The in vitro susceptibilities of Bartonella (Rochalimaea) henselae, B. quintana, B. elizabethae, Rickettsia akari, R. conorii, R. prowazekii, and R. rickettsii to different concentrations of azithromycin, clarithromycin, dirithromycin, erythromycin, and roxithromycin in Vero cell cultures were evaluated. Bartonella and Rickettsia spp. were allowed to initiate infection of the antibiotic-free Vero cell monolayers, which were maintained in 16-chamber microscope slides in the absence of antibiotics at 32 degrees C in a CO2-enriched atmosphere. The monolayers were then incubated for 3 h to allow for initial host cell intracellular penetration by infecting species. After inoculation, inocula were replaced and tested with media containing 12 different concentrations of each antibiotic in replicate (10 wells of each antibiotic dilution) for each species, and the monolayers were reincubated. Tetracycline served as the control. Growth status of Bartonella spp. and Rickettsia spp. was determined by evaluation of immunofluorescent staining bacilli. Five days later, when antibiotic-free, control-infected cell monolayers demonstrated significant fluorescence, media were removed for all cell monolayers, the monolayers were fixed, and all specimens were stained with standard indirect immunofluorescent antibody reagents. Fluorescent foci were enumerated by counting such foci on random fields visualized with an epifluorescence microscope. The extent of antibiotic-induced focus inhibition was recorded for each dilution of antibiotic and compared with that of an antibiotic-negative control. Effective antibiotic dilution endpoints for inhibition of Bartonella and Rickettsia proliferation, as judged by absence of increase of significant fluorescence (as compared with no-growth controls), were enumerated by determining the number of cell culture chambers at various antibiotic dilutions that were negative or positive for significant Bartonella- or Rickettsia-specific fluorescence. All of the macrolide agents tested were readily active against all three Bartonella organisms, and azithromycin, clarithromycin, and roxithromycin may have potential in the treatment of Rickettsia infections. Animal model-based clinical trials are warranted to define the specific treatment role of the newer macrolide antibiotics. PMID:9055996

  4. Quantitative Proteomics Using Stable Isotope Labeling with Amino Acids in Cell Culture Reveals Changes in the Cytoplasmic, Nuclear, and Nucleolar Proteomes in Vero Cells Infected with the Coronavirus Infectious Bronchitis Virus*

    PubMed Central

    Emmott, Edward; Rodgers, Mark A.; Macdonald, Andrew; McCrory, Sarah; Ajuh, Paul; Hiscox, Julian A.


    Virus-host interactions involve complex interplay between viral and host factors, rendering them an ideal target for proteomic analysis. Here we detail a high throughput quantitative proteomics analysis of Vero cells infected with the coronavirus infectious bronchitis virus (IBV), a positive strand RNA virus that replicates in the cytoplasm. Stable isotope labeling with amino acids in cell culture (SILAC) was used in conjunction with LC-MS/MS to identify and quantify 1830 cellular and two viral proteins from IBV-infected cells. Fractionation of cells into cytoplasmic, nuclear, and nucleolar extracts was used to reduce sample complexity and provide information on the trafficking of proteins between the different compartments. Each fraction showed a proportion of proteins exhibiting ≥2-fold changes in abundance. Ingenuity Pathway Analysis revealed that proteins that changed in response to infection could be grouped into different functional categories. These included proteins regulated by NF-κB- and AP-1-dependent pathways and proteins involved in the cytoskeleton and molecular motors. A luciferase-based reporter gene assay was used to validate the up-regulation of AP-1- and NF-κB-dependent transcription in IBV-infected cells and confirmed using immunofluorescence. Immunofluorescence was used to validate changes in the subcellular localization of vimentin and myosin VI in IBV-infected cells. The proteomics analysis also confirmed the presence of the viral nucleocapsid protein as localizing in the cytoplasm, nucleus, and nucleolus and the viral membrane protein in the cytoplasmic fraction. This research is the first application of SILAC to study total host cell proteome changes in response to positive sense RNA virus infection and illustrates the versatility of this technique as applied to infectious disease research. PMID:20467043

  5. Quantitative proteomics using stable isotope labeling with amino acids in cell culture reveals changes in the cytoplasmic, nuclear, and nucleolar proteomes in Vero cells infected with the coronavirus infectious bronchitis virus.


    Emmott, Edward; Rodgers, Mark A; Macdonald, Andrew; McCrory, Sarah; Ajuh, Paul; Hiscox, Julian A


    Virus-host interactions involve complex interplay between viral and host factors, rendering them an ideal target for proteomic analysis. Here we detail a high throughput quantitative proteomics analysis of Vero cells infected with the coronavirus infectious bronchitis virus (IBV), a positive strand RNA virus that replicates in the cytoplasm. Stable isotope labeling with amino acids in cell culture (SILAC) was used in conjunction with LC-MS/MS to identify and quantify 1830 cellular and two viral proteins from IBV-infected cells. Fractionation of cells into cytoplasmic, nuclear, and nucleolar extracts was used to reduce sample complexity and provide information on the trafficking of proteins between the different compartments. Each fraction showed a proportion of proteins exhibiting >or=2-fold changes in abundance. Ingenuity Pathway Analysis revealed that proteins that changed in response to infection could be grouped into different functional categories. These included proteins regulated by NF-kappaB- and AP-1-dependent pathways and proteins involved in the cytoskeleton and molecular motors. A luciferase-based reporter gene assay was used to validate the up-regulation of AP-1- and NF-kappaB-dependent transcription in IBV-infected cells and confirmed using immunofluorescence. Immunofluorescence was used to validate changes in the subcellular localization of vimentin and myosin VI in IBV-infected cells. The proteomics analysis also confirmed the presence of the viral nucleocapsid protein as localizing in the cytoplasm, nucleus, and nucleolus and the viral membrane protein in the cytoplasmic fraction. This research is the first application of SILAC to study total host cell proteome changes in response to positive sense RNA virus infection and illustrates the versatility of this technique as applied to infectious disease research. PMID:20467043

  6. Comparison of the antiproliferative activity of crude ethanol extracts of nine salvia species grown in Jordan against breast cancer cell line models

    PubMed Central

    Abu-Dahab, Rana; Afifi, Fatma; Kasabri, Violet; Majdalawi, Lara; Naffa, Randa


    Background: The antiproliferative activity of Salvia species grown in Jordan has not been fully evaluated yet. The aim of this work was to study the antiproliferative activity of crude ethanol extracts from nine Salvia species grown in Jordan against a panel of breast cancer cell lines. Material and Methods: Cytotoxic activity was evaluated in human tumor models of breast cancer; MCF-7, T47D, ZR-75-1, and BT 474 by the sulforhodamine B assay. In addition, the extracts were evaluated using a non-transformed cell line (Vero) and normal fibroblast cells in order to demonstrate their selectivity and safety. Results: From the nice ethanol extracts under investigation, those of S. dominica and S. fruticosa showed an inhibitory concentration of 50% of cells (IC50) in concentrations less than 30μg/mL against the four cell lines under investigation. S. syriaca and S. hormium showed an IC50 below 30μg/ml for two out of the four cell lines. S. fruticosa, S. hormium and S. syriaca showed selectivity in their antiproliferative activity against estrogen receptor positive cell lines with minimal toxicity against normal human periodontal fibroblasts. Phytochemical screening using thin layer chromatography indicated the presence of terpenoids, flavonoids and coumarins in all examined extracts. Conclusion: Three of the plant extracts under investigation exhibited antiproliferative activity against breast cancer cells and were shown to be safe and selective. These could be considered as a potential source for novel anticancer therapy. PMID:24082637

  7. Photopigments in Rhodopseudomonas capsulata cells grown anaerobically in darkness.

    PubMed Central

    Madigan, M; Cox, J C; Gest, H


    The phototrophic bacterium Rhodopseudomonas capsulata can obtain energy for dark anaerobic growth from sugar fermentations dependent on accessory oxidants such as trimethylamine-N-oxide or dimethyl sulfoxide. Cells grown for one to two subcultures in this fashion, with fructose as the energy source, showed approximately a twofold increase in bacteriochlorophyll content (per milligram of cell protein) and developed extensive intracytoplasmic membranes in comparison with cells grown photosynthetically at saturating light intensity. Cells harvested from successive anaerobic dark subcultures, however, showed progressively lower pigment contents. After ca. 20 transfers, bacteriochlorophyll and carotenoids were barely detectable, and the amount of intracytoplasmic membrane diminished considerably. Spontaneous mutants incapable of producing normal levels of photosynthetic pigments arose during prolonged anaerobic dark growth. Certain mutants of this kind appear to have a selective advantage over wild-type cells under fermentative growth conditions. Of four pigment mutants characterized (two being completely unable to produce bacteriochlorophyll), only one retained the capacity to grow photosynthetically. Images PMID:7076623

  8. OM-VPE grown materials for high efficiency solar cells

    NASA Technical Reports Server (NTRS)

    Saxena, R.; Cooper, B., III; Ludowise, M.; Borden, P.; Gregory, P.


    Organometallic sources are available for all the III-V elements and a variety of dopants; thus it is possible to use the technique to grow a wide variety of semiconductor compounds. AlGaAsSb and AlGaInAs alloys for multijunction monolithic solar cells were grown by OM-VPE. While the effort concentrated on terrestrial applications, the success of OM-VPE grown GaAs/AlGaAs concentrator solar cells (23% at 400 suns) demonstrates that OM-VPE is suitable for growing high efficiency solar cells in large quantities for space applications. In addition, OM-VPE offers the potential for substantial cost reduction of photovoltaic devices with scale up and automation and due to high process yield from reproducible, uniform epitaxial growths with excellent surface morphology.

  9. High Survivability of Cheese Whey-Grown Rhizobium meliloti Cells upon Exposure to Physical Stress †

    PubMed Central

    Bissonnette, N.; Lalande, R.


    Whey, a by-product of the dairy industry, has been found to protect the rhizobia cells during freezing and thawing. Cells of rhizobia grown on whey sustained freezing better at −18°C than did cells grown on mannitol or sucrose. Suspensions of cells grown on whey or mannitol that were suspended in whey performed equally well at −18 and −80°C, with 94 and 100% survival, respectively. Whey-grown rhizobia in pellets withstood desiccation better than did their mannitol-grown equivalents. Rhizobia that were grown on whey and then inoculated onto commercial peat showed a survival rate of 100% after 23 weeks at −4°C. Whey-grown cells in peat performed better at various temperatures during storage, even when they were exposed to desiccation, than did mannitol-grown cells in peat. Whey, therefore, offers interesting possibilities as a Rhizobium protectant for the inoculum industry. PMID:16347524

  10. Feasibility of using the Vero SBRT system for intracranial SRS.


    Burghelea, Manuela; Verellen, Dirk; Gevaert, Thierry; Depuydt, Tom; Poels, Kenneth; Simon, Viorica; De Ridder, Mark


    The Vero SBRT system was benchmarked in a planning study against the Novalis SRS system for quality of delivered dose distributions to intracranial lesions and assessing the Vero system's capacity for SRS. A total of 27 patients with one brain lesion treated on the Novalis system, with 3 mm leaf width MLC and C-arm gantry, were replanned for Vero, with a 5 mm leaf width MLC mounted on an O-ring gantry allowing rotations around both the horizontal and vertical axis. The Novalis dynamic conformal arc (DCA) planning included vertex arcs, using 90 couch rotation. These vertex arcs cannot be reproduced with Vero due to the mechanical limitations of the O-ring gantry. Alternative class solutions were investigated for the Vero. Additionally, to distinguish between the effect of MLC leaf width and different beam arrangements on dose distributions, the Vero class solutions were also applied for Novalis. In addition, the added value of noncoplanar IMRT was investigated in this study. Quality of the achieved dose distributions was expressed in the conformity index (CI) and gradient index (GI), and compared using a paired Student's t-test with statistical significance for p-values ? 0.05. For lesions larger than 5 cm3, no statistical significant difference in conformity was observed between Vero and Novalis, but for smaller lesions, the dose distributions showed a significantly better conformity for the Novalis (?CI = 13.74%, p = 0.0002) mainly due to the smaller MLC leaf width. Using IMRT on Vero reduces this conformity difference to nonsignificant levels. The cutoff for achieving a GI around 3, characterizing a sharp dose falloff outside the target volume was 4 cm3 for Novalis and 7 cm3 for Vero using DCA technique. Using noncoplanar IMRT, this threshold was reduced to 3 cm3 for the Vero system. The smaller MLC and the presence of the vertex fields allow the Novalis system to better conform the dose around the lesion and to obtain steeper dose falloff outside the lesion. Comparable dosimetric characteristics can be achieved with Vero for lesions larger than 3 cm3 and using IMRT. PMID:24423838

  11. Gamma radiation-induced single strand breaks in DNA and their repair in spheroplasts and nuclei of light-grown and dark-grown Euglena cells.


    Netrawali, M S; Nair, K A


    Exposure of light-grown and dark-grown Euglena cells to gamma radiation causes single strand breaks in nuclear DNA as assessed by sedimentation analysis in alkaline sucrose density gradients. The number of radiation-induced single strand breaks in nuclear DNA of light-grown cells is found to be less than that in dark-grown cells. Post-irradiation incubation of both types of cells in 0 . 1 M phosphate buffer, pH 7 . 0 at 25 degrees C for 1 hour results in restitution of the strand breaks in DNA. Light-grown cells (cells with chloroplasts) are able to rejoin all the single strand breaks in DNA produced by gamma irradiation at D50 and D5 doses. On the other hand, dark-grown cells (cells devoid of chloroplasts) are unable to rejoin all the strand breaks caused by irradiation at either of the doses. The rate of DNA repair in dark-grown cells is also much slower than that in light-grown cells. Radiation-induced single strand breaks in DNA and their repair in nuclei from both types of cells is found to be similar to that observed in the spheroplasts. It is suggested that some factor(s) elaborated by chloroplasts may contribute towards the efficiency of nuclear DNA repair in Euglena cells. PMID:6403482

  12. Organic solar cells using CVD-grown graphene electrodes.


    Kim, Hobeom; Bae, Sang-Hoon; Han, Tae-Hee; Lim, Kyung-Geun; Ahn, Jong-Hyun; Lee, Tae-Woo


    We report on the development of flexible organic solar cells (OSCs) incorporating graphene sheets synthesized by chemical vapor deposition (CVD) as transparent conducting electrodes on polyethylene terephthalate (PET) substrates. A key barrier that must be overcome for the successful fabrication of OSCs with graphene electrodes is the poor-film properties of water-based poly(3,4-ethylenedioxythiphene):poly(styrenesulfonate) (PEDOT:PSS) when coated onto hydrophobic graphene surfaces. To form a uniform PEDOT:PSS film on a graphene surface, we added perfluorinated ionomers (PFI) to pristine PEDOT:PSS to create 'GraHEL', which we then successfully spin coated onto the graphene surface. We systematically investigated the effect of number of layers in layer-by-layer stacked graphene anode of an OSC on the performance parameters including the open-circuit voltage (Voc), short-circuit current (Jsc), and fill factor (FF). As the number of graphene layers increased, the FF tended to increase owing to lower sheet resistance, while Jsc tended to decrease owing to the lower light absorption. In light of this trade-off between sheet resistance and transmittance, we determined that three-layer graphene (3LG) represents the best configuration for obtaining the optimal power conversion efficiency (PCE) in OSC anodes, even at suboptimal sheet resistances. We finally developed efficient, flexible OSCs with a PCE of 4.33%, which is the highest efficiency attained so far by an OSC with CVD-grown graphene electrodes to the best of our knowledge. PMID:24334624

  13. Organic solar cells using CVD-grown graphene electrodes

    NASA Astrophysics Data System (ADS)

    Kim, Hobeom; Bae, Sang-Hoon; Han, Tae-Hee; Lim, Kyung-Geun; Ahn, Jong-Hyun; Lee, Tae-Woo


    We report on the development of flexible organic solar cells (OSCs) incorporating graphene sheets synthesized by chemical vapor deposition (CVD) as transparent conducting electrodes on polyethylene terephthalate (PET) substrates. A key barrier that must be overcome for the successful fabrication of OSCs with graphene electrodes is the poor-film properties of water-based poly(3,4-ethylenedioxythiphene):poly(styrenesulfonate) (PEDOT:PSS) when coated onto hydrophobic graphene surfaces. To form a uniform PEDOT:PSS film on a graphene surface, we added perfluorinated ionomers (PFI) to pristine PEDOT:PSS to create ‘GraHEL’, which we then successfully spin coated onto the graphene surface. We systematically investigated the effect of number of layers in layer-by-layer stacked graphene anode of an OSC on the performance parameters including the open-circuit voltage (Voc), short-circuit current (Jsc), and fill factor (FF). As the number of graphene layers increased, the FF tended to increase owing to lower sheet resistance, while Jsc tended to decrease owing to the lower light absorption. In light of this trade-off between sheet resistance and transmittance, we determined that three-layer graphene (3LG) represents the best configuration for obtaining the optimal power conversion efficiency (PCE) in OSC anodes, even at suboptimal sheet resistances. We finally developed efficient, flexible OSCs with a PCE of 4.33%, which is the highest efficiency attained so far by an OSC with CVD-grown graphene electrodes to the best of our knowledge.

  14. Photosynthetic Characteristics of Photoautotrophically Grown Tobacco Callus Cells 1

    PubMed Central

    Berlyn, Mary B.; Zelitch, Israel; Beaudette, Pamela D.


    Haploid callus cells of tobacco (Nicotiana tabacum) were grown photoautotrophically on a solid agar medium in the absence of sucrose in Petri plates in an atmosphere of 1% or 3% CO2 in air. The averages of dry weight increases for four to five consecutive passages were 2.3- to 3.6-fold per 3-week passage for different subclones. Photosynthetic 14CO2 assimilation was maximum at about 1% CO2 with half-maximal rates obtained at 0.2% CO2. At saturating CO2 concentration the average rate of CO2 fixation was about 5 μmole per gram fresh weight per hour or about 125 μmole per mg of chlorophyll per hour. The existence of an active photorespiratory system in these tissues was established in a number of independent ways. The photosynthetic rate in 0.18% CO2 was inhibited 38 to 50% in 100% O2 compared with 21% O2. Glycolate accumulated at a constant rate in the presence of 5 mm α-hydroxy-2-pyridinemethanesulfonic acid for 20 minutes in light. This rate was rapid relative to the photosynthetic rate. Glycolate synthesis was three times faster in autotrophic than in heterotrophic cells. [1-14C]Glycolate was rapidly metabolized and the products included 14CO2, [14C]glycine, and [14C]serine, thus demonstrating an active glycolate pathway. Photorespiration was demonstrated directly by measurement of an O2-dependent release of 14CO2 in the light from callus that fixed 14CO2 for about 22 hours. Autotrophic growth in 60% O2 and 0.03% CO2 was slowed and ceased entirely after two or three passages, while heterotrophic growth was unaffected by 60% O2 in the atmosphere. The method of growing autotrophic callus which has an active photorespiratory system should facilitate the selection and analysis of photosynthetic mutants in which photorespiration is regulated. PMID:16660346

  15. Interaction between Wall Deposition and Cell Elongation in Dark-Grown Hypocotyl Cells in Arabidopsis1

    PubMed Central

    Refrégier, Guislaine; Pelletier, Sandra; Jaillard, Danielle; Höfte, Herman


    A central problem in plant biology is how cell expansion is coordinated with wall synthesis. We have studied growth and wall deposition in epidermal cells of dark-grown Arabidopsis hypocotyls. Cells elongated in a biphasic pattern, slowly first and rapidly thereafter. The growth acceleration was initiated at the hypocotyl base and propagated acropetally. Using transmission and scanning electron microscopy, we analyzed walls in slowly and rapidly growing cells in 4-d-old dark-grown seedlings. We observed thick walls in slowly growing cells and thin walls in rapidly growing cells, which indicates that the rate of cell wall synthesis was not coupled to the cell elongation rate. The thick walls showed a polylamellated architecture, whereas polysaccharides in thin walls were axially oriented. Interestingly, innermost cellulose microfibrils were transversely oriented in both slowly and rapidly growing cells. This suggested that transversely deposited microfibrils reoriented in deeper layers of the expanding wall. No growth acceleration, only slow growth, was observed in the cellulose synthase mutant cesA6prc1-1 or in seedlings, which had been treated with the cellulose synthesis inhibitor isoxaben. In these seedlings, innermost microfibrils were transversely oriented and not randomized as has been reported for other cellulose-deficient mutants or following treatment with dichlorobenzonitrile. Interestingly, isoxaben treatment after the initiation of the growth acceleration in the hypocotyl did not affect subsequent cell elongation. Together, these results show that rapid cell elongation, which involves extensive remodeling of the cell wall polymer network, depends on normal cellulose deposition during the slow growth phase. PMID:15181211

  16. Lipids of Pseudomonas aeruginosa cells grown on hydrocarbons and on trypticase soy broth.


    Edmonds, P; Cooney, J J


    Lipids were extracted from cells of Pseudomonas aeruginosa grown on a pure hydrocarbon (tridecane), mixed hydrocarbons (JP-4 jet fuel), and on Trypticase Soy Broth. Total lipids produced from each substrate represented from 7.1 to 8.2% of cellular dry weight, of which 5.0 to 6.4% were obtained before cellular hydrolysis (free lipids) and 1.7 to 2.0% were extracted after cellular hydrolysis (bound lipids). Free lipids from cells grown on each medium were separated into four fractions by thin-layer chromatography. All fractions were present in cells from each type of medium, and the "neutral fraction" constituted the largest fraction. The fatty acid composition of free lipids was determined by gas-liquid chromatography. Cells grown on each medium contained saturated and unsaturated C(14) to C(20) fatty acids. Trace amounts of C(13) fatty acids were found in tridecane-grown cells. Saturated C(16) and C(18) were the major acids present in all cells. Quantitative differences were found in fatty acids produced on the three media, but specific correlations between substrate carbon sources and fatty acid content of cells were not evident. Tridecane-grown cells contained only traces of C(13) acid and small amounts of C(15) and C(17) acids, suggesting that the organism's fatty acids were derived from de novo synthesis rather than by direct incorporation of the hydrocarbon. PMID:4976464

  17. 75 FR 65581 - Proposed Amendment and Revocation of Class E Airspace, Vero Beach, FL

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...This action proposes to amend Class E surface airspace, and airspace extending upward from 700 feet above the surface, and remove Class E airspace designated as an extension to Class D surface area at Vero Beach Municipal Airport, Vero Beach, FL. The Vero Beach Non- Directional Beacon (NDB) has been decommissioned and new Standard Instrument Approach Procedures (SIAPs) have been developed for......

  18. Separation and Ultrastructure of Proplastids from Dark-grown Euglena Cells.


    Ophir, I; Ben-Shaul, Y


    A procedure for the separation of proplastids free of mitochondria from dark-grown Euglena cells has been developed. A fraction enriched in proplastids was used for freeze-etching study of proplastid structure. The prolamellar body in freeze-etched replicas appeared sponge-like, with thylakoids, often vesicular, emerging from it. The prolamellar body and the thylakoids were covered by particles of about 100A in diameter. No larger particles, typical of light-grown chloroplasts, were observed. PMID:16658476

  19. Endocytic activity of Sertoli cells grown in bicameral culture chambers

    SciTech Connect

    Dai, R.X.; Djakiew, D.; Dym, M.


    Immature rat Sertoli cells were cultured for 7 to 14 days on Millipore filters impregnated with a reconstituted basement membrane extract in dual-environment (bicameral) culture chambers. Electron microscopy of the cultured cells revealed the presence of rod-shaped mitochondria, Golgi apparatus, rough endoplasmic reticulum, and Sertoli-Sertoli tight junctions, typical of these cells in vivo. The endocytic activity of both the apical and basal surfaces of the Sertoli cells was examined by either adding alpha 2-macroglobulin (alpha 2-M) conjugated to 20 nm gold particles to the apical chamber or by adding /sup 125/I labeled alpha 2-M to the basal chamber. During endocytosis from the apical surface of Sertoli cells, the alpha 2-M-gold particles were bound initially to coated pits and then internalized into coated vesicles within 5 minutes. After 10 minutes, the alpha 2-M-gold was found in multi-vesicular bodies (MVBs) and by 30 minutes it was present in the lysosomes. The proportion of alpha 2-M-gold found within endocytic cell organelles after 1 hour of uptake was used to estimate the approximate time that this ligand spent in each type of organelle. The alpha 2-M-gold was present in coated pits, coated vesicles, multivesicular bodies, and lysosomes for approximately 3, 11, 22, and 24 minutes, respectively. This indicates that the initial stages of endocytosis are rapid, whereas MVBs and lysosomes are relatively long-lived.

  20. Comparison of saftey and immunogenicity of purified chick embryo cell rabies vaccine (PCECV) and purified vero cell rabies vaccine (PVRV) using the Thai Red Cross intradermal regimen at a dose of 0.1 ML.


    Madhusudana, Shampur N; Sanjay, Thitamaranahalli V; Mahendra, Bangalore J; Sudarshan, Mysore K; Narayana, Doddabele H Ashwath; Giri, Anand; Muhamuda, Kader; Ravi, Vasanthapuram; Vakil, Hoshang B; Malerczyk, Cladius


    Intradermal (ID) vaccination with modern cell culture rabies vaccines is a means to significantly reduce the cost of post-exposure prophylaxis as compared to intramuscular vaccination. In this study we evaluated the efficacy, immunogenicity and tolerability of PCECV and PVRV administered ID in doses of 0.1 mL per site according to the 2-site Thai Red Cross (TRC) regimen. Patients with WHO category III exposure to suspect or laboratory proven rabid animals were administered either PCECV (n = 58) or PVRV (n = 52) ID at a dose of 0.1 mL per site at two sites on days 0, 3 and 7 and at one site on days 30 and 90. Serum samples were withdrawn on days 0, 14, 30, 90 and 180 and rabies virus neutralizing antibody (RVNA) titers were determined by rapid fluorescent focus inhibition test (RFFIT). Patients who were exposed to laboratory confirmed rabid animals were followed up for one year after exposure. All 110 patients developed RVNA titers above 0.5 IU/mL by day 14. Adequate titers >0.5 IU/mL were maintained up to day 180. Both vaccines induced equivalent RVNA titers at all time points and were well tolerated. Five subjects who were bitten by laboratory confirmed rabid dogs were alive and healthy one year after exposure. As demonstrated, PCECV and PVRV are both immunogenic, efficacious and well tolerated when administered in the TRC post-exposure prophylaxis regimen in ID doses of 0.1 mL as recommended by WHO guidelines. The use of PCECV in this regimen may prove more economical in developing countries like India. PMID:17035734

  1. Appearance of a methylated ribonucleic acid on illumination of Euglena gracillis cells grown in the dark.


    Perl, M


    Investigation of the methylation of nucleic acids by [Me-(3)H]methionine after illumination of Euglena cells grown in the dark has shown that a high-molecular-weight nucleic acid fraction undergoes methylation after exposure to light for 60-120min. This methylated nucleic acid fraction was isolated both by sucrose-density-gradient centrifugation and exclusion chromatography on Sephadex G-200. The fraction was shown to consist of a preformed RNA that is present in cells grown in the dark and which on illumination is transmethylated by methionine. PMID:5004197

  2. Prodigiosin Induces Autolysins in Actively Grown Bacillus subtilis Cells.


    Danevčič, Tjaša; Borić Vezjak, Maja; Tabor, Maja; Zorec, Maša; Stopar, David


    Prodigiosin produced by marine bacterium Vibrio ruber DSM 14379 exhibits a potent antimicrobial activity against a broad range of Gram positive and Gram negative bacteria. The mechanism of prodigiosin antimicrobial action, however, is not known. In this work, the effect of prodigiosin on Bacillus subtilis growth, cell membrane leakage, and induction of autolysins was studied. Treating B. subtilis with prodigiosin resulted in rapid decline of optical density and increased cell membrane leakage measured by β-galactosidase activity. Cell lysis was initiated immediately after treatment with prodigiosin in the middle exponential phase and was completed within 2 h. Lytic activity of prodigiosin in mutant strains with impaired autolysin genes lytABCD decreased for 80% compared to the wild type strain, while in lytABCDEF mutant strain prodigiosin had no bacteriolytic but only bacteriostatic effect. Fast prodigiosin lytic activity on individual B. subtilis cells was confirmed by a modified comet assay. The results indicate that prodigiosin autolysin induction in B. subtilis is growth phase dependent. PMID:26858704

  3. Prodigiosin Induces Autolysins in Actively Grown Bacillus subtilis Cells

    PubMed Central

    Danevčič, Tjaša; Borić Vezjak, Maja; Tabor, Maja; Zorec, Maša; Stopar, David


    Prodigiosin produced by marine bacterium Vibrio ruber DSM 14379 exhibits a potent antimicrobial activity against a broad range of Gram positive and Gram negative bacteria. The mechanism of prodigiosin antimicrobial action, however, is not known. In this work, the effect of prodigiosin on Bacillus subtilis growth, cell membrane leakage, and induction of autolysins was studied. Treating B. subtilis with prodigiosin resulted in rapid decline of optical density and increased cell membrane leakage measured by β-galactosidase activity. Cell lysis was initiated immediately after treatment with prodigiosin in the middle exponential phase and was completed within 2 h. Lytic activity of prodigiosin in mutant strains with impaired autolysin genes lytABCD decreased for 80% compared to the wild type strain, while in lytABCDEF mutant strain prodigiosin had no bacteriolytic but only bacteriostatic effect. Fast prodigiosin lytic activity on individual B. subtilis cells was confirmed by a modified comet assay. The results indicate that prodigiosin autolysin induction in B. subtilis is growth phase dependent. PMID:26858704

  4. Plastid distribution in columella cells of a starchless Arabidopsis mutant grown in microgravity

    NASA Technical Reports Server (NTRS)

    Hilaire, E.; Paulsen, A. Q.; Brown, C. S.; Guikema, J. A.; Spooner, B. S. (Principal Investigator)


    Wild-type and starchless Arabidopsis thaliana mutant seedlings (TC7) were grown and fixed in the microgravity environment of a U.S. Space Shuttle spaceflight. Computer image analysis of longitudinal sections from columella cells suggest a different plastid positioning mechanism for mutant and wild-type in the absence of gravity.

  5. Comparison of electrogenic capabilities of microbial fuel cell with different light power on algae grown cathode.


    Juang, D F; Lee, C H; Hsueh, S C


    Electricity generation capabilities of microbial fuel cell with different light power on algae grown cathode were compared. Results showed that microbial fuel cell with 6 and 12W power of light always produced higher voltage and power density than with 18 and 26W. Similarly, microbial fuel cell with 6 and 12W of light power always displayed higher Coulombic efficiency and specific power than the one with 18 and 26W. The results also showed that microbial fuel cell with covered anodic chamber always displayed higher voltage, power density, Coulombic efficiency and specific power than the one without covered anodic chamber. Binary quadratic equations can be used to express the relationships between the light power and the voltage, power density, Coulombic efficiency and specific power. Although lower power of light on algae grown cathode and covering anodic chamber will increase system's electricity production, they will not significantly reduce its internal resistance. PMID:22929741

  6. Diversity of the exoproteome of Fusarium graminearum grown on plant cell wall.


    Phalip, Vincent; Delalande, François; Carapito, Christine; Goubet, Florence; Hatsch, Didier; Leize-Wagner, Emmanuelle; Dupree, Paul; Dorsselaer, Alain Van; Jeltsch, Jean-Marc


    The exoproteome of the fungus Fusarium graminearum grown on glucose and on hop (Humulus lupulus, L.) cell wall has been investigated. The culture medium was found to contain a higher quantity of proteins and the proteins are more diverse when the fungus is grown on cell wall. Using both 1D and 2D electrophoresis followed by mass spectrometry analysis and protein identification based on similarity searches, 84 unique proteins were identified in the cell wall-grown fungal exoproteome. Many are putatively implicated in carbohydrate metabolism, mainly in cell wall polysaccharide degradation. The predicted carbohydrate-active enzymes fell into 24 different enzymes classes, and up to eight different proteins within a same class are secreted. This indicates that fungal metabolism becomes oriented towards synthesis and secretion of a whole arsenal of enzymes able to digest almost the complete plant cell wall. Cellobiohydrolase is one of the only four proteins found both after growth on glucose and on plant cell wall and we propose that this enzyme could act as a sensor of the extracellular environment. Extensive knowledge of this very diverse F. graminearum exoproteome is an important step towards the full understanding of Fusarium/plants interactions. PMID:16283313

  7. Modifications of the cell wall of yeasts grown on hexadecane and under starvation conditions.


    Dmitriev, Vladimir V; Crowley, David E; Zvonarev, Anton N; Rusakova, Tatiana G; Negri, Maria C; Kolesnikova, Svetlana A


    Electron-microscopic examinations have demonstrated local modifications in the cell wall of the yeast Candida maltosa grown on hexadecane. In our earlier studies, these modified sites, observed in other yeasts grown on oil hydrocarbons, were conventionally called 'canals'. The biochemical and cytochemical studies of C. maltosa have revealed a correlation between the formation of 'canals' and decrease in the amount of cell wall polysaccharides, glucan and mannan. The ultrathin sections and surface replicas have shown that the 'canals' are destroyed by pronase, thus indicating that a significant proportion of their content is represented by proteins. This finding was compatible with our earlier data on the localization of oxidative enzymes in 'canals' and possible participation of the 'canals' in the primary oxidation of hydrocarbons. A completely unexpected and intriguing phenomenon has been the appearance of 'canals' in the yeast C. maltosa under starvation conditions. Unlike the yeasts grown on hexadecane, mannan almost disappears in starving cells, while the quantity of glucan first decreases and then is restored to its initial level. The role of 'canals' in starving cells is as yet unclear; it is assumed that they acquire exoenzymes involved in the utilization of products of cell lysis in the starving population. In the future, 'canals' of starving cells will be studied in connection with their possible participation in apoptosis. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26833628

  8. Detailed Structural and Quantitative Analysis Reveals the Spatial Organization of the Cell Walls of in Vivo Grown Mycobacterium leprae and in Vitro Grown Mycobacterium tuberculosis*

    PubMed Central

    Bhamidi, Suresh; Scherman, Michael S.; Jones, Victoria; Crick, Dean C.; Belisle, John T.; Brennan, Patrick J.; McNeil, Michael R.


    The cell wall of mycobacteria consists of an outer membrane, analogous to that of Gram-negative bacteria, attached to the peptidoglycan (PG) via a connecting polysaccharide arabinogalactan (AG). Although the primary structure of these components is fairly well deciphered, issues such as the coverage of the PG layer by covalently attached mycolates in the outer membrane and the spatial details of the mycolic acid attachment to the arabinan have remained unknown. It is also not understood how these components work together to lead to the classical acid-fast staining of mycobacteria. Because the majority of Mycobacterium tuberculosis bacteria in established experimental animal infections are acid-fast negative, clearly cell wall changes are occurring. To address both the spatial properties of mycobacterial cell walls and to begin to study the differences between bacteria grown in animals and cultures, the cell walls of Mycobacterium leprae grown in armadillos was characterized and compared with that of M. tuberculosis grown in culture. Most fundamentally, it was determined that the cell wall of M. leprae contained significantly more mycolic acids attached to PG than that of in vitro grown M. tuberculosis (mycolate:PG ratios of 21:10 versus 16:10, respectively). In keeping with this difference, more arabinogalactan (AG) molecules, linking the mycolic acids to PG, were found. Differences in the structures of the AG were also found; the AG of M. leprae is smaller than that of M. tuberculosis, although the same basic structural motifs are retained. PMID:21555513

  9. Homojunction GaAs solar cells grown by close space vapor transport

    SciTech Connect

    Boucher, Jason W.; Ritenour, Andrew J.; Greenaway, Ann L.; Aloni, Shaul; Boettcher, Shannon W.


    We report on the first pn junction solar cells grown by homoepitaxy of GaAs using close space vapor transport (CSVT). Cells were grown both on commercial wafer substrates and on a CSVT absorber film, and had efficiencies reaching 8.1%, open circuit voltages reaching 909 mV, and internal quantum efficiency of 90%. The performance of these cells is partly limited by the electron diffusion lengths in the wafer substrates, as evidenced by the improved peak internal quantum efficiency in devices fabricated on a CSVT absorber film. Unoptimized highly-doped n-type emitters also limit the photocurrent, indicating that thinner emitters with reduced doping, and ultimately wider band gap window or surface passivation layers, are required to increase the efficiency.

  10. Effects of method of detachment on electrophoretic mobility of mammalian cells grown in monolayer culture

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.


    A variety of proteolytic and micolytic enzumes, mechanical procedures, and changes in the ionic environment, especially Ca chelation, are used for dispersal of monolayer grown cells. If either chelating agents or mechanical dispersion are used alone, the cell yield is often low and suspensions of single cells are difficult to obtain. Confluent monolayers treated with EDTA tend to be released from their surfaces in sheets, and clumps of cells remain even after further incubation in EDTA. Crude trypsin is the most popular dispersal agent and is known to contain a variety of contaminating enzymes which contribute to the dispersal of cells. A variety of cell injuries resulting from the activity of proteolytic enzymes are reported. It is shown that crystalline trypsin is least harmful to cell integrity as judged by trypan blue uptake.

  11. Progressive adaptation of a Georgian isolate of African swine fever virus to vero cells leads to a gradual attenuation of virulence in swine corresponding to major changes of the viral genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    African swine fever virus (ASFV) causes a contagious and often lethal disease of feral and domestic swine. Experimental vaccines derived from naturally occurring, genetically modified or cell culture-adapted ASFV have been evaluated but no commercial vaccine is available to control African Swine Fev...

  12. Solution-Grown Monocrystalline Hybrid Perovskite Films for Hole-Transporter-Free Solar Cells.


    Peng, Wei; Wang, Lingfei; Murali, Banavoth; Ho, Kang-Ting; Bera, Ashok; Cho, Namchul; Kang, Chen-Fang; Burlakov, Victor M; Pan, Jun; Sinatra, Lutfan; Ma, Chun; Xu, Wei; Shi, Dong; Alarousu, Erkki; Goriely, Alain; He, Jr-Hau; Mohammed, Omar F; Wu, Tom; Bakr, Osman M


    High-quality perovskite monocrystalline films are successfully grown through cavitation-triggered asymmetric crystallization. These films enable a simple cell structure, ITO/CH3 NH3 PbBr3 /Au, with near 100% internal quantum efficiency, promising power conversion efficiencies (PCEs) >5%, and superior stability for prototype cells. Furthermore, the monocrystalline devices using a hole-transporter-free structure yield PCEs ≈6.5%, the highest among other similar-structured CH3 NH3 PbBr3 solar cells to date. PMID:26931100

  13. Growth and radiation response of cells grown in macroporous gelatin microcarriers (CultiSpher-G).

    PubMed Central

    Rasey, J. S.; Cornwell, M. M.; Maurer, B. J.; Boyles, D. J.; Hofstrand, P.; Chin, L.; Cerveny, C.


    Four cell lines have been cultured in macroporous gelatin microcarrier beads (CultiSpher-G) to test this as a new model of three-dimensional cell growth for use in experimental cancer therapy. A549, KB 3-1, KB 8-5 and V79 cells were successfully grown in CultiSphers, albeit with longer doubling times than observed for the respective cell type in monolayer cultures. MTT staining and histology demonstrated three-dimensional contact of cells in the microcarriers. A549 cells populated the microcarriers more densely than KB 3-1 cells, and with both cell types there is bead-to-bead variation in occupancy by cells. [3H]TdR autoradiography reveals labelled cells throughout A549 and KB 3-1 CultiSphers, with no proliferation gradient from edge to centre. Central necrosis has not been observed. A549 cells but not KB 3-1 cells demonstrated a radiation contact effect (i.e. resistance) when irradiated in CultiSphers, compared with monolayers. We conclude that CultiSphers may be a useful model for three-dimensional growth and cell contact when investigators want to investigate these phenomena without the microenvironmental gradients of spheroids. Images Figure 1 PMID:8763852

  14. Performance of silicon solar cells fabricated from multiple Czochralski ingots grown by using a single crucible

    NASA Technical Reports Server (NTRS)

    Kachare, A. H.; Uno, F. M.; Miyahira, T.; Lane, R. L.


    Results on the performance of solar cells fabricated on wafers from multiple silicon ingots of large diameter, grown by using a single crucible and a sequential melt replenishment Czochralski (CZO) technique are presented. Samples were analyzed for resistivity, dislocation density and impurity content. Solar cells were fabricated from the seed, center and tang end of each ingot to evaluate the growth reproducibility and material quality. The cell efficiency within a given wafer varies by no more than plus or minus 5% of the average value. A small but consistent decrease in the cell efficiency is observed from the first to the fourth ingot grown from a single crucible. This decrease may be related to an increase in impurity content or dislocation density or a combination of both. The efficiency of the cells fabricated from the tang end of the fourth ingot is about 10% lower than that of the control cell. An impurity effects model is employed to correlate this decrease in efficiency with the impurity build-up in the residual melt.

  15. Longevity of U cells of differentiated yeast colonies grown on respiratory medium depends on active glycolysis.


    Čáp, Michal; Váchová, Libuše; Palková, Zdena


    Colonies of Saccharomyces cerevisiae laboratory strains pass through specific developmental phases when growing on solid respiratory medium. During entry into the so-called alkali phase, in which ammonia signaling is initiated, 2 prominent cell types are formed within the colonies: U cells in upper colony regions, which have a longevity phenotype and activate the expression of a large number of metabolic genes, and L cells in lower regions, which die more quickly and exhibit a starvation phenotype. Here, we performed a detailed analysis of the activities of enzymes of central carbon metabolism in lysates of both cell types and determined several fermentation end products, showing that previously reported expression differences are reflected in the different enzymatic capabilities of each cell type. Hence, U cells, despite being grown on respiratory medium, behave as fermenting cells, whereas L cells rely on respiratory metabolism and possess active gluconeogenesis. Using a spectrum of different inhibitors, we showed that glycolysis is essential for the formation, and particularly, the survival of U cells. We also showed that β-1,3-glucans that are released from the cell walls of L cells are the most likely source of carbohydrates for U cells. PMID:26566867

  16. InP-based quantum well solar cells grown by chemical beam epitaxy

    SciTech Connect

    Freundlich, A.; Rossignol, V.; Vilela, M.F.; Renaud, P.; Bensaoula, A.; Medelci, N.


    The authors present the first experimental investigation of InP based-multiquantum well (MQW) solar cells. Lattice matched In{sub 0.47}Ga{sub 0.53}As/InP and strained InAs{sub x}P{sub 1{minus}x}/InP (x = 0.3 to 0.7) multiquantum well were introduced in the intrinsic region of a p-i(MQW)-n InP solar cell. All device structures (MQW and InP p and n layer) were grown by chemical beam epitaxy.

  17. Expression of fetal antigens by normal human skin cells grown in tissue culture.


    Thorpe, W P; Parker, G A; Rosenberg, S A


    Normal human sera are capable of causing complement-mediated lysis of normal human skin cells grown in tissue culture. This lytic reactivity can be completely removed by absorption with first trimester fetal tissue. Absorption with a variety of normal adult human tissues including lymphocytes, decidua, skin, and muscle are incapable of absorbing reactivity. Absorption of reactivity by fetal tissue is specific and not due to the introduction of anti-complementary or other nonspecific factors, as evidenced by the inability of simultaneous fetal absorption to remove reactivity from antisera with specificity for HLA antigens. Similarly, absorption of lytic sera with fetal calf serum proteins was incapable of removing reactivity against normal cells in tissue culture. It thus appears that normal human cells in tissue culture express antigens shared by the first trimester human fetus, but not present on a variety of adult human tissues. This "neoantigen" present on normal human cells when grown in tissue culture is a potential source of confusion and must be accounted for in searching for human tumor-specific antigens utilizing tissue culture cells. PMID:330754

  18. Light-triggered organization of the stigma in dark-grown nondividing cells of Euglena gracilis.


    Osafune, T; Alhadeff, M; Schiff, J A


    Dark-grown cells of Euglena gracilis Klebs var. bacillaris Cori contain amorphous stigma material. When these cells are placed on resting medium for 3 days in darkness, the cells cease division; the organization of a normal stigma from the amorphous material requires continuous illumination for 72-96 hr. We have now found that if dark-grown cells are placed on resting medium for 8 days, a 40-min light pulse is sufficient to cause normal organization of the stigma in a subsequent 72-hr dark period. Thus stigma development is light-dependent at 3 days of resting but becomes light-triggered at 8 days. Other examples of light-triggered phenomena in Euglena are discussed and a model based on turnover of protein molecules repressing development that are ordinarily removed by exposure to light is presented; it is suggested that as the cells become more starved their ability to replace repressor molecules removed by light becomes limited and the system thereby becomes light-triggered rather than light-dependent. PMID:3938992

  19. DNA content and differentiation of root apical cells of Brassica rapa plants grown in microgravity.


    Kordyum, E L; Martin, G I; Zaslavsky, V A; Jiao, S; Hilaire, E; Guikema, J A


    Root cap is proposed to be a graviperceptive tissue in the plant root, and it is composed of several cell types. One such cell type, the columella cells, are thought to initiate the gravity-induced signal transduction cascade, and these cells arise from the activity of the meristematic zone of the root cap. There is, in fact, a continuum of cells in the central column of the root cap representing the meristematic cells, developing columella cells, mature cells, and those that will soon be sloughed off into the soil. In order to study the functional roles of the root cap cells in gravity-sensing, we compared the ultrastructural organization, differentiation, and DNA content in the meristematic, elongating, and differentiating cells of root tips in Brassica rapa plants grown in space microgravity and at 1g. The experiments were also designed to determine the reactions of root cap cells in both main roots (in which the original root cap was present in an embryonic form within the seed) and lateral roots (in which the root cap formed completely in space after seed germination on orbit) to the space microgravity. This study (ROOTS) was performed in collaboration with the B-PAC experiment on the Space shuttle "Columbia" mission STS-87 (Collaborative US/Ukrainian Experiment (CUE) during November 19-December 5, 1997. PMID:11542985

  20. Comparative studies of two membrane fractions isolated from chemotrophically and phototrophically grown cells of Rhodopseudomonas capsulata.

    PubMed Central

    Garcia, A F; Drews, G; Reidl, H H


    Light and heavy membrane fractions have been isolated by equilibrium sucrose density centrifugation from Rhodopseudomonas capsulata 938 GCM grown aerobically in the dark (chemotrophically) and anaerobically in the light (phototrophically). The densities of the light and heavy fractions from phototrophic cells were 1.1004 to 1.1006 and 1.1478, respectively, and the densities of the light and heavy fractions from chemotrophic cells were 1.0957 to 1.0958 and 1.1315, respectively. Both fractions were active in photochemical and respiratory functions and in electron transport-coupled phosphorylation. The light membrane fraction isolated from chemotrophic cells contained the reaction center and the light-harvesting pigment-protein complex B 870, but not the variable light-harvesting complex B 800-850. A small amount of the complex B 800-850 was present in the light fraction isolated from phototrophically grown cells, but it was not energetically coupled to the photosynthetic apparatus. From inhibitor studies, difference spectroscopy, and measurement of enzyme activities it was tentatively concluded that the light membrane fraction contains only the reduced nicotinamide adenine dinucleotide-oxidizing electron transport chain having a KCN-insensitive, low-potential cytochrome c oxidase, whereas the heavy fraction contains additionally the succinate dehydrogenase and a high-potential cytochrome b terminal oxidase sensitive to KCN. The light membrane fraction was more labile than the heavy fraction in terms of phosphorylating activity. PMID:7204341

  1. GaInP/GaAs cascade solar cells grown by molecular beam epitaxy

    SciTech Connect

    Lammasniemi, J.; Kazantsev, A.B.; Jaakkola, R.; Toivonen, M.; Jalonen, M.; Aho, R.; Pessa, M.


    First results for molecular beam epitaxy (MBE) grown Ga{sub 0.51}In{sub 0.49}P/GaAs cascade solar cells are presented. The structures were prepared by both solid-source (SS) MBE and gas-source (GS) MBE. The tunnel diodes between the subcells were grown by using the standard MBE dopants (silicon and beryllium) but dopant diffusion related degradation of the cell characteristics was not observed. For the best SSMBE structure, a conversion efficiency of 21.1% was measured at AMO for a 1x1 cm{sup 2} cell. For the GSMBE structures, the best AMO conversion efficiency was 20.8% for a 2x2 cm{sup 2} device. In addition, the first MBE results for advanced Al{sub 0.51}In{sub 0.49}P/Ga{sub 0.51}In{sub 0.49}P-based tunnel diodes are presented.

  2. Human norovirus infection of caco-2 cells grown as a three-dimensional tissue structure.


    Straub, Timothy M; Bartholomew, Rachel A; Valdez, Catherine O; Valentine, Nancy B; Dohnalkova, Alice; Ozanich, Richard M; Bruckner-Lea, Cynthia J; Call, Douglas R


    Human norovirus (hNoV) infectivity was studied using a three-dimensional model of large intestinal epithelium. Large intestine Caco-2 cells were grown in rotating wall vessel bioreactors for 18-21 days at 37 degrees C and then transferred to 24-well tissue culture plates where they were infected with GI.1 and GII.4 human noroviruses collected from human challenge trials and various outbreak settings, respectively. Compared with uninfected cells, transmission micrographs of norovirus-infected cells displayed evidence of shortening or total loss of apical microvilli, and vacuolization. Quantitative reverse transcription real-time PCR (qRT-PCR) indicated an approximate 2-3 log10 increase in viral RNA copies for the infected cells. A passage experiment examined both the ability for continued viral RNA and viral antigen detection. In the passaged samples 1.01x10(6) copies ml(-1) were detected by qRT-PCR. Immune electron microscopy using primary antibody to hNoV GI.1 capsids in conjunction with 6 nm gold-labelled secondary antibodies was performed on crude cellular lysates. Localization of antibody was observed in infected but not for uninfected cells. Our present findings, coupled with earlier work with the three-dimensional small intestinal INT407 model, demonstrate the utility of 3-D cell culture methods to develop infectivity assays for enteric viruses that do not readily infect mammalian cell cultures. PMID:21942189

  3. Single and multijunction space solar cells grown by organometallic vapor phase epitaxy (OM-VPE)

    SciTech Connect

    Borden, P.G.; Gregory, P.E.; Larue, R.A.; Ludowise, M.J.


    Organometallic Vapor Phase Epitaxy (OM-VPE) is a versatile technique for growing III-V compound semiconductor solar cells. It has good uniformity and morphology, control that allows growth of extremely thin layers, and is a technique readily automated. The vehicle for the present discussion is a metal interconnected cascade (MIC/sup 2/) solar cell that has achieved 16.6% AM0 and 22% AM3 efficiency (uncorrected for 14% grid coverage). These are the best results reported to date for a cascade solar cell. Features include a 9-layer epitaxial structure, the thinnest of which is less than 1000 thick, a high-efficiency 30% AlGaAs top cell only 1.5 microns thick, a GaAs bottom cell that has survived the 780/sup 0/C, 20-minute top cell growth, and process yields greater than 4 cm/sup 2/ per wafer. The paper describes the cell design requirements, how it was grown by OM-VPE, and performance results.

  4. Rabies veterinary virus vaccine produced in BHK-21 cells grown on microcarriers in a bioreactor.


    Gallegos Gallegos, R M; Espinosa Larios, E L; Ramos Ramrez, L; Kretschmer Schmid, R; Aguilar Setin, A


    BHK-21 cells were grown in microcarriers in the CELLIGEN CL 50 bioreactor to produce a stock of rabies veterinary virus vaccine PV (Pasteur virus) strain. Perfusion mode operation of this bioreactor produced between two- and fourfold larger yields (cells/ml) than traditional stationary cell culture systems (i.e., Blake, and Roller bottles or cell factory multitrays). The method employed harvested 281 of rabies virus in 200 h (infectivity titer 0.6 +/- 1.4 x 10(7) LD50 per ml) in a single operation. The risk of contamination is thus reduced when compared with traditional stationary methods which, in order to obtain the same amount of virus, would require the operation of 285 Blake bottles, or 143 Roller bottles, or 15 Cell Factory multitrays (10 trays). By perfusion mode operation of the bioreactor, 89% of the cell culture medium was recovered as vaccinal virus, which contrasts with the yield of only 50-59% using traditional cell culture systems. On the other hand, only 925 ml of fetal serum was required to obtain the 281 of rabies virus harvest as compared to the 3420 ml required by traditional methods. PMID:7711449

  5. Human Norovirus Infection of Caco-2 Cells Grown as a 3-Dimensional Tissue Structure

    PubMed Central

    Bartholomew, Rachel A.; Valdez, Catherine O.; Valentine, Nancy B.; Dohnalkova, Alice; Ozanich, Richard M.; Bruckner-Lea, Cynthia J.; Call, Douglas R.


    Human norovirus (hNoV) infectivity was studied using a 3-dimensional model of large intestinal epithelium. Large intestine Caco-2 cells were grown in rotating wall vessel bioreactors for 18-21 days at 37°C and then transferred to 24-well tissue culture plates where they were infected with GI.1 and GII.4 human noroviruses collected from human challenge trials and various outbreak settings, respectively. Compared to uninfected cells, transmission micrographs of norovirus infected cells displayed evidence of shortening or total loss of apical microvilli, and vacuolization. Quantitative reverse transcription real-time PCR (qRT-PCR) indicated an approximate 2-3 Log10 increase in viral RNA copies for the infected cells. A passage experiment examined both the ability for continued viral RNA and viral antigen detection. In the passaged samples 1.01 × 106 copies/mL were detected by qRT-PCR. Immune electron microscopy using primary antibody to hNoV GI.1 capsids in conjunction with 6 nm gold-labeled secondary antibodies was performed on crude cellular lysates. Localization of antibody was observed in infected but not for uninfected cells. Our present findings, coupled with earlier work with the 3-dimensional small intestinal INT407 model, demonstrate the utility of 3-D cell culture methods to develop infectivity assays for enteric viruses that do not readily infect mammalian cell cultures. PMID:21942189

  6. Proliferation and Differentiation Potential of Human Adipose-Derived Stem Cells Grown on Chitosan Hydrogel

    PubMed Central

    Debnath, Tanya; Ghosh, Sutapa; Potlapuvu, Usha Shalini; Kona, Lakshmi; Kamaraju, Suguna Ratnakar; Sarkar, Suprabhat; Gaddam, Sumanlatha; Chelluri, Lakshmi Kiran


    Applied tissue engineering in regenerative medicine warrants our enhanced understanding of the biomaterials and its function. The aim of this study was to evaluate the proliferation and differentiation potential of human adipose-derived stem cells (hADSCs) grown on chitosan hydrogel. The stability of this hydrogel is pH-dependent and its swelling property is pivotal in providing a favorable matrix for cell growth. The study utilized an economical method of cross linking the chitosan with 0.5% glutaraldehyde. Following the isolation of hADSCs from omentum tissue, these cells were cultured and characterized on chitosan hydrogel. Subsequent assays that were performed included JC-1 staining for the mitochondrial integrity as a surrogate marker for viability, cell proliferation and growth kinetics by MTT assay, lineage specific differentiation under two-dimensional culture conditions. Confocal imaging, scanning electron microscopy (SEM), and flow cytometry were used to evaluate these assays. The study revealed that chitosan hydrogel promotes cell proliferation coupled with > 90% cell viability. Cytotoxicity assays demonstrated safety profile. Furthermore, glutaraldehyde cross linked chitosan showed < 5% cytotoxicity, thus serving as a scaffold and facilitating the expansion and differentiation of hADSCs across endoderm, ectoderm and mesoderm lineages. Additional functionalities can be added to this hydrogel, particularly those that regulate stem cell fate. PMID:25746846

  7. Comparison of Chloroflexus aurantiacus strain J-10-fl proteomes of cells grown chemoheterotrophically and photoheterotrophically

    SciTech Connect

    Cao, Li; Bryant, Donald A.; Schepmoes, Athena A.; Vogl, Kajetan; Smith, Richard D.; Lipton, Mary S.; Callister, Stephen J.


    Chloroflexus aurantiacus J-10-fl is a thermophilic green bacterium, a filamentous anoxygenic phototroph, and the model organism of the phylum Chloroflexi. We applied high-throughput, liquid chromatography-mass spectrometry in a global quantitative proteomics investigation of C. aurantiacus cells grown under oxic (chemoorganoheterotrophically) and anoxic (photoorganoheterotrophically) redox states. Our global analysis identified 13,524 high-confidence peptides that matched to 1,286 annotated proteins, 242 of which were either uniquely identified or significantly increased in abundance under anoxic culture conditions. Fifty-three of the 242 proteins are previously characterized photosynthesis-related proteins, including chlorosome proteins, proteins involved in the bacteriochlorophyll biosynthesis, 3-hydroxypropionate (3-OHP) CO2 fixation pathway, and components of electron transport chains. The remaining 190 proteins have not previously been reported. Of these, five proteins were found to be encoded by genes from a novel operon and observed only in photoheterotrophically grown cells. These proteins candidates may prove useful in further deciphering the phototrophic physiology of C. aurantiacus and other filamentous anoxygenic phototrophs.

  8. Characterization of Epitaxial Film Silicon Solar Cells Grown on Seeded Display Glass: Preprint

    SciTech Connect

    Young, D. L.; Grover, S.; Teplin, C.; Stradins, P.; LaSalvia, V.; Chuang, T. K.; Couillard, J. G.; Branz, H. M.


    We report characterizations of epitaxial film crystal silicon (c-Si) solar cells with open-circuit voltages (Voc) above 560 mV. The 2-um absorber cells are grown by low-temperature (<750 degrees C) hot-wire CVD (HWCVD) on Corning EAGLE XG display glass coated with a layer-transferred (LT) Si seed. The high Voc is a result of low-defect epitaxial Si (epi-Si) growth and effective hydrogen passivation of defects. The quality of HWCVD epitaxial growth on seeded glass substrates depends on the crystallographic quality of the seed and the morphology of the epitaxial growth surface. Heterojunction devices consist of glass/c-Si LT seed/ epi n+ Si:P/epi n- Si:P/intrinsic a-Si:H/p+ a-Si:H/ITO. Similar devices grown on electronically 'dead' n+ wafers have given Voc {approx}630 mV and {approx}8% efficiency with no light trapping features. Here we study the effects of the seed surface polish on epi-Si quality, how hydrogenation influences the device character, and the dominant junction transport physics.

  9. Electron-cytochemical study of Ca2+ in cotyledon cells of soybean seedlings grown in microgravity

    NASA Technical Reports Server (NTRS)

    Nedukha, O.; Brown, C. S.; Kordyum, E.; Piastuch, W. C.; Guikema, J. A. (Principal Investigator)


    Microgravity and horizontal clinorotation are known to cause the rearrangement of the structural-functional organization of plant cells, leading to accelerated aging. Altered gravity conditions resulted in an increase in the droplets volume in cells and the destruction of chloroplast structure in Arabidopsis thaliana plants, an enhancement of cytosolic autophagaous processes, an increase in the respiration rate and a greater number of multimolecular forms of succinate- and malate dehydrogenases in cells of the Funaria hygrometrica protonema and Chlorella vulgaris, and changes in calcium balance of cells. Because ethylene is known to be involved in cell aging and microgravity appears to speed the process, and because soybean seedlings grown in space produce higher ethylene levels we asked: 1) does an acceleration of soybean cotyledon cell development and aging occur in microgravity? 2) what roles do Ca2+ ions and the enhanced ethylene level play in these events? Therefore, the goal of our investigation was to examine of the interaction of microgravity and ethylene on the localization of Ca2+ in cotyledon mesophyll of soybean seedlings.

  10. Stimulation of Cell Elongation by Tetraploidy in Hypocotyls of Dark-Grown Arabidopsis Seedlings

    PubMed Central

    Narukawa, Hideki; Yokoyama, Ryusuke; Komaki, Shinichiro; Sugimoto, Keiko; Nishitani, Kazuhiko


    Plant size is largely determined by the size of individual cells. A number of studies showed a link between ploidy and cell size in land plants, but this link remains controversial. In this study, post-germination growth, which occurs entirely by cell elongation, was examined in diploid and autotetraploid hypocotyls of Arabidopsis thaliana (L.) Heynh. Final hypocotyl length was longer in tetraploid plants than in diploid plants, particularly when seedlings were grown in the dark. The longer hypocotyl in the tetraploid seedlings developed as a result of enhanced cell elongation rather than by an increase in cell number. DNA microarray analysis showed that genes involved in the transport of cuticle precursors were downregulated in a defined region of the tetraploid hypocotyl when compared to the diploid hypocotyl. Cuticle permeability, as assessed by toluidine-blue staining, and cuticular structure, as visualized by electron microscopy, were altered in tetraploid plants. Taken together, these data indicate that promotion of cell elongation is responsible for ploidy-dependent size determination in the Arabidopsis hypocotyl, and that this process is directly or indirectly related to cuticular function. PMID:26244498

  11. Rapid differentiation of NT2 cells in Sertoli-NT2 cell tissue constructs grown in the rotating wall bioreactor.


    Saporta, Samuel; Willing, Alison E; Shamekh, Rania; Bickford, Paula; Paredes, Daniel; Cameron, Don F


    Cell replacement therapy is of great interest as a long-term treatment of neurodegenerative diseases such as Parkinson's disease (PD). We have previously shown that Sertoli cells (SC) provide neurotrophic support to transplants of dopaminergic fetal neurons and NT2N neurons, derived from the human clonal precursors cell line NTera2/D1 (NT2), which differentiate into dopaminergic NT2N neurons when exposed to retinoic acid. We have created SC-NT2 cell tissue constructs cultured in the high aspect ratio vessel (HARV) rotating wall bioreactor. Sertoli cells, NT2, and SC plus NT2 cells combined in starting ratios of 1:1, 1:2, 1:4 and 1:8 were cultured in the HARV in DMEM with 10% fetal bovine serum and 1% growth factor reduced Matrigel for 3 days, without retinoic acid. Conventional, non-HARV, cultures grown in the same culture medium were used as controls. The presence of tyrosine hydroxylase (TH) was assessed in all culture conditions. Sertoli-neuron-aggregated-cell (SNAC) tissue constructs grown at starting ratios of 1:1 to 1:4 contained a significant amount of TH after 3 days of culture in the HARV. No TH was detected in SC HARV cultures, or SC, NT2 or SC-NT2 conventional co-cultures. Quantitative stereology of immunolabled 1:4 SNAC revealed that approximately 9% of NT2 cells differentiate into TH-positive (TH+) NT2N neurons after 3 days of culture in the HARV, without retinoic acid. SNAC tissue constructs also released dopamine (DA) when stimulated with KCl, suggesting that TH-positive NT2N neurons in the SNAC adopted a functional dopaminergic phenotype. SNAC tissue constructs may be an important source of dopaminergic neurons for neuronal transplantation. PMID:15561470

  12. Suppression of Hydroxycinnamate Network Formation in Cell Walls of Rice Shoots Grown under Microgravity Conditions in Space

    PubMed Central

    Wakabayashi, Kazuyuki; Soga, Kouichi; Hoson, Takayuki; Kotake, Toshihisa; Yamazaki, Takashi; Higashibata, Akira; Ishioka, Noriaki; Shimazu, Toru; Fukui, Keiji; Osada, Ikuko; Kasahara, Haruo; Kamada, Motoshi


    Network structures created by hydroxycinnamate cross-links within the cell wall architecture of gramineous plants make the cell wall resistant to the gravitational force of the earth. In this study, the effects of microgravity on the formation of cell wall-bound hydroxycinnamates were examined using etiolated rice shoots simultaneously grown under artificial 1 g and microgravity conditions in the Cell Biology Experiment Facility on the International Space Station. Measurement of the mechanical properties of cell walls showed that shoot cell walls became stiff during the growth period and that microgravity suppressed this stiffening. Amounts of cell wall polysaccharides, cell wall-bound phenolic acids, and lignin in rice shoots increased as the shoot grew. Microgravity did not influence changes in the amounts of cell wall polysaccharides or phenolic acid monomers such as ferulic acid (FA) and p-coumaric acid, but it suppressed increases in diferulic acid (DFA) isomers and lignin. Activities of the enzymes phenylalanine ammonia-lyase (PAL) and cell wall-bound peroxidase (CW-PRX) in shoots also increased as the shoot grew. PAL activity in microgravity-grown shoots was almost comparable to that in artificial 1 g-grown shoots, while CW-PRX activity increased less in microgravity-grown shoots than in artificial 1 g-grown shoots. Furthermore, the increases in expression levels of some class III peroxidase genes were reduced under microgravity conditions. These results suggest that a microgravity environment modifies the expression levels of certain class III peroxidase genes in rice shoots, that the resultant reduction of CW-PRX activity may be involved in suppressing DFA formation and lignin polymerization, and that this suppression may cause a decrease in cross-linkages within the cell wall architecture. The reduction in intra-network structures may contribute to keeping the cell wall loose under microgravity conditions. PMID:26378793

  13. Suppression of Hydroxycinnamate Network Formation in Cell Walls of Rice Shoots Grown under Microgravity Conditions in Space.


    Wakabayashi, Kazuyuki; Soga, Kouichi; Hoson, Takayuki; Kotake, Toshihisa; Yamazaki, Takashi; Higashibata, Akira; Ishioka, Noriaki; Shimazu, Toru; Fukui, Keiji; Osada, Ikuko; Kasahara, Haruo; Kamada, Motoshi


    Network structures created by hydroxycinnamate cross-links within the cell wall architecture of gramineous plants make the cell wall resistant to the gravitational force of the earth. In this study, the effects of microgravity on the formation of cell wall-bound hydroxycinnamates were examined using etiolated rice shoots simultaneously grown under artificial 1 g and microgravity conditions in the Cell Biology Experiment Facility on the International Space Station. Measurement of the mechanical properties of cell walls showed that shoot cell walls became stiff during the growth period and that microgravity suppressed this stiffening. Amounts of cell wall polysaccharides, cell wall-bound phenolic acids, and lignin in rice shoots increased as the shoot grew. Microgravity did not influence changes in the amounts of cell wall polysaccharides or phenolic acid monomers such as ferulic acid (FA) and p-coumaric acid, but it suppressed increases in diferulic acid (DFA) isomers and lignin. Activities of the enzymes phenylalanine ammonia-lyase (PAL) and cell wall-bound peroxidase (CW-PRX) in shoots also increased as the shoot grew. PAL activity in microgravity-grown shoots was almost comparable to that in artificial 1 g-grown shoots, while CW-PRX activity increased less in microgravity-grown shoots than in artificial 1 g-grown shoots. Furthermore, the increases in expression levels of some class III peroxidase genes were reduced under microgravity conditions. These results suggest that a microgravity environment modifies the expression levels of certain class III peroxidase genes in rice shoots, that the resultant reduction of CW-PRX activity may be involved in suppressing DFA formation and lignin polymerization, and that this suppression may cause a decrease in cross-linkages within the cell wall architecture. The reduction in intra-network structures may contribute to keeping the cell wall loose under microgravity conditions. PMID:26378793

  14. Label-free optical detection of cells grown in 3D silicon microstructures.


    Merlo, Sabina; Carpignano, Francesca; Silva, Gloria; Aredia, Francesca; Scovassi, A Ivana; Mazzini, Giuliano; Surdo, Salvatore; Barillaro, Giuseppe


    We demonstrate high aspect-ratio photonic crystals that could serve as three-dimensional (3D) microincubators for cell culture and also provide label-free optical detection of the cells. The investigated microstructures, fabricated by electrochemical micromachining of standard silicon wafers, consist of periodic arrays of silicon walls separated by narrow deeply etched air-gaps (50 ?m high and 5 ?m wide) and feature the typical spectral properties of photonic crystals in the wavelength range 1.0-1.7 ?m: their spectral reflectivity is characterized by wavelength regions where reflectivity is high (photonic bandgaps), separated by narrow wavelength regions where reflectivity is very low. In this work, we show that the presence of cells, grown inside the gaps, strongly affects light propagation across the photonic crystal and, therefore, its spectral reflectivity. Exploiting a label-free optical detection method, based on a fiberoptic setup, we are able to probe the extension of cells adherent to the vertical silicon walls with a non-invasive direct testing. In particular, the intensity ratio at two wavelengths is the experimental parameter that can be well correlated to the cell spreading on the silicon wall inside the gaps. PMID:23817434

  15. Electrochemically grown ZnO nanorods for hybrid solar cell applications

    SciTech Connect

    Hames, Yakup; Alpaslan, Zuehal; Koesemen, Arif; San, Sait Eren; Yerli, Yusuf


    A hybrid solar cell is designed and proposed as a feasible and reasonable alternative, according to acquired efficiency with the employment of zinc oxide (ZnO) nanorods and ZnO thin films at the same time. Both of these ZnO structures were grown electrochemically and poly(3-hexylthiophene):phenyl-C61-butyric acid methyl ester; (P3HT:PCBM) was used as an active polymer blend, which was found to be compatible to prepared indium-tin-oxide (ITO) substrate base. This ITO base was introduced with mentioned ZnO structure in such a way that, the most efficient configuration was optimized to be ITO/ZnO film/ZnO nanorod/P3HT: PCBM/Ag. Efficiency of this optimized device is found to be 2.44%. All ZnO works were carried out electrochemically, that is indeed for the first time and at relatively lower temperatures. (author)

  16. Canine and Equine Mesenchymal Stem Cells Grown in Serum Free Media Have Altered Immunophenotype.


    Clark, Kaitlin C; Kol, Amir; Shahbenderian, Salpi; Granick, Jennifer L; Walker, Naomi J; Borjesson, Dori L


    Mesenchymal stem cell (MSC) therapy is being increasingly used to treat dogs and horses with naturally-occurring diseases. However these animals also serve as critical large animal models for ongoing translation of cell therapy products to the human market. MSC manufacture for clinical use mandates improvement in cell culture systems to meet demands for higher MSC numbers and removal of xeno-proteins (i.e. fetal bovine serum, FBS). While serum-free media (SFM) is commercially available, its affects on MSC phenotype and immunomodulatory functions are not fully known. The objective of this study was to determine if specific MSC culture conditions, MSC expansion in HYPERFlasks® or MSC expansion in a commercially available SFM, would alter MSC proliferation, phenotype or immunomodulatory properties in vitro. MSCs cultured in HYPERFlasks® were similar in phenotype, proliferative capacity and immunomodulatory functions to MSCs grown in standard flasks however MSC yield was markedly increased. HYPERFlasks® therefore provide a viable option to generate greater cell numbers in a streamlined manner. Canine and equine MSCs expanded in SFM displayed similar proliferation, surface phenotype and inhibitory effect on lymphocyte proliferation in vitro. However, MSCs cultured in the absence of FBS secreted significantly less PGE2, and were significantly less able to inhibit IFNγ secretion by activated T-cells. Immunomodulatory functions altered by expansion in SFM were species dependent. Unlike equine MSCs, in canine adipose-derived MSCs, the inhibition of lymphocyte proliferation was not principally modulated by PGE2. The removal of FBS from both canine and equine MSC culture systems resulted in altered immunomodulatory properties in vitro and warrants further investigation prior to moving towards FBS-free culture conditions. PMID:26638159

  17. PEDF and VEGF-A Output from Human Retinal Pigment Epithelial Cells Grown on Novel Microcarriers

    PubMed Central

    Falk, Torsten; Congrove, Nicole R.; Zhang, Shiling; McCourt, Alexander D.; Sherman, Scott J.; McKay, Brian S.


    Human retinal pigment epithelial (hRPE) cells have been tested as a cell-based therapy for Parkinson's disease but will require additional study before further clinical trials can be planned. We now show that the long-term survival and neurotrophic potential of hRPE cells can be enhanced by the use of FDA-approved plastic-based microcarriers compared to a gelatin-based microcarrier as used in failed clinical trials. The hRPE cells grown on these plastic-based microcarriers display several important characteristics of hRPE found in vivo: (1) characteristic morphological features, (2) accumulation of melanin pigment, and (3) high levels of production of the neurotrophic factors pigment epithelium-derived factor (PEDF) and vascular endothelial growth factor-A (VEGF-A). Growth of hRPE cells on plastic-based microcarriers led to sustained levels (>1 ng/ml) of PEDF and VEGF-A in conditioned media for two months. We also show that the expression of VEGF-A and PEDF is reciprocally regulated by activation of the GPR143 pathway. GPR143 is activated by L-DOPA (1 μM) which decreased VEGF-A secretion as opposed to the previously reported increase in PEDF secretion. The hRPE microcarriers are therefore novel candidate delivery systems for achieving long-term delivery of the neuroprotective factors PEDF and VEGF-A, which could have a value in neurodegenerative conditions such as Parkinson's disease. PMID:22547925

  18. Morphology of Tumours Induced in Hamsters by CELO Virus, Tumour Tissue, and Tumour Cells Grown in Culture*

    PubMed Central

    Mancini, L. O.; Jasty, V.; Anderson, J.; Yates, V. J.


    Tumours in hamsters, induced by the chicken-embryo-lethal-orphan (CELO) virus, by tumour tissue transplants, or by tumour cells grown in culture, were well circumscribed solid tumours and covered by a thin capsule-like structure. All were fibrosarcomata. However, tumours produced by the 3 inocula exhibited the following histological differences. Neoplasms induced by CELO virus were generally less differentiated and were composed of cells with polygonal or oval nuclei and indistinct cytoplasmic boundaries. Numerous multinucleated bizarre giant cells were found. Those produced by tumour tissue transplants were more differentiated and were composed of spindle shaped cells with abundant collagen fibre formation. Neoplasms induced by tumour cells grown in culture were generally undifferentiated with many mitotic figures and contained numerous giant cells. Cells from tumours induced by CELO virus or tumour transplants produced similar morphologies when cultured in vitro. The cell cultures consisted of large cells with oval or rounded large nuclei and prominent nucleoli. Multinucleated giant cells, cells in mitosis, and a disorganized growth pattern were also characteristic of the cell cultures. However, mitosis and a piling-up of cells occurred more frequently with cell cultures derived from the CELO virus-induced tumour. ImagesFig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6 PMID:4335495

  19. GaSb thermophotovoltaic cells grown on GaAs by molecular beam epitaxy using interfacial misfit arrays

    SciTech Connect

    Juang, Bor-Chau Laghumavarapu, Ramesh B.; Foggo, Brandon J.; Lin, Andrew; Simmonds, Paul J.; Liang, Baolai; Huffaker, Diana L.


    There exists a long-term need for foreign substrates on which to grow GaSb-based optoelectronic devices. We address this need by using interfacial misfit arrays to grow GaSb-based thermophotovoltaic cells directly on GaAs (001) substrates and demonstrate promising performance. We compare these cells to control devices grown on GaSb substrates to assess device properties and material quality. The room temperature dark current densities show similar characteristics for both cells on GaAs and on GaSb. Under solar simulation the cells on GaAs exhibit an open-circuit voltage of 0.121 V and a short-circuit current density of 15.5 mA/cm{sup 2}. In addition, the cells on GaAs substrates maintain 10% difference in spectral response to those of the control cells over a large range of wavelengths. While the cells on GaSb substrates in general offer better performance than the cells on GaAs substrates, the cost-savings and scalability offered by GaAs substrates could potentially outweigh the reduction in performance. By further optimizing GaSb buffer growth on GaAs substrates, Sb-based compound semiconductors grown on GaAs substrates with similar performance to devices grown directly on GaSb substrates could be realized.

  20. A549 Lung Epithelial Cells Grown as Three-Dimensional Aggregates: Alternative Tissue Culture Model for Pseudomonas aeruginosa Pathogenesis

    PubMed Central

    Carterson, A. J.; Höner zu Bentrup, K.; Ott, C. M.; Clarke, M. S.; Pierson, D. L.; Vanderburg, C. R.; Buchanan, K. L.; Nickerson, C. A.; Schurr, M. J.


    A three-dimensional (3-D) lung aggregate model was developed from A549 human lung epithelial cells by using a rotating-wall vessel bioreactor to study the interactions between Pseudomonas aeruginosa and lung epithelial cells. The suitability of the 3-D aggregates as an infection model was examined by immunohistochemistry, adherence and invasion assays, scanning electron microscopy, and cytokine and mucoglycoprotein production. Immunohistochemical characterization of the 3-D A549 aggregates showed increased expression of epithelial cell-specific markers and decreased expression of cancer-specific markers compared to their monolayer counterparts. Immunohistochemistry of junctional markers on A549 3-D cells revealed that these cells formed tight junctions and polarity, in contrast to the cells grown as monolayers. Additionally, the 3-D aggregates stained positively for the production of mucoglycoprotein while the monolayers showed no indication of staining. Moreover, mucin-specific antibodies to MUC1 and MUC5A bound with greater affinity to 3-D aggregates than to the monolayers. P. aeruginosa attached to and penetrated A549 monolayers significantly more than the same cells grown as 3-D aggregates. Scanning electron microscopy of A549 cells grown as monolayers and 3-D aggregates infected with P. aeruginosa showed that monolayers detached from the surface of the culture plate postinfection, in contrast to the 3-D aggregates, which remained attached to the microcarrier beads. In response to infection, proinflammatory cytokine levels were elevated for the 3-D A549 aggregates compared to monolayer controls. These findings suggest that A549 lung cells grown as 3-D aggregates may represent a more physiologically relevant model to examine the interactions between P. aeruginosa and the lung epithelium during infection. PMID:15664956

  1. Antrodia camphorata Grown on Germinated Brown Rice Suppresses Melanoma Cell Proliferation by Inducing Apoptosis and Cell Differentiation and Tumor Growth

    PubMed Central

    Song, Minjung; Park, Dong Ki; Park, Hye-Jin


    Antrodia camphorata grown on germinated brown rice (CBR) was prepared to suppress melanoma development. CBR extracts were divided into hexane, EtOAc, BuOH, and water fractions. Among all the fractions, EtOAc fraction showed the best suppressive effect on B16F10 melanoma cell proliferation by CCK-8 assay. It also showed the increased cell death and the changed cellular morphology after CBR treatment. Annexin V-FITC/PI, flow cytometry, and western blotting were performed to elucidate anticancer activity of CBR. The results showed that CBR induced p53-mediated apoptotic cell death of B16F10. CBR EtOAc treatment increased melanin content and melanogenesis-related proteins of MITF and TRP-1 expressions, which supports its anticancer activity. Its potential as an anticancer agent was further investigated in tumor-xenografted mouse model. In melanoma-xenografted mouse model, melanoma tumor growth was significantly suppressed under CBR EtOAc fraction treatment. HPLC analysis of CBR extract showed peak of adenosine. In conclusion, CBR extracts notably inhibited B16F10 melanoma cell proliferation through the p53-mediated apoptosis induction and increased melanogenesis. These findings suggest that CBR EtOAc fraction can act as an effective anticancer agent to treat melanoma. PMID:23533475

  2. Antrodia camphorata Grown on Germinated Brown Rice Suppresses Melanoma Cell Proliferation by Inducing Apoptosis and Cell Differentiation and Tumor Growth.


    Song, Minjung; Park, Dong Ki; Park, Hye-Jin


    Antrodia camphorata grown on germinated brown rice (CBR) was prepared to suppress melanoma development. CBR extracts were divided into hexane, EtOAc, BuOH, and water fractions. Among all the fractions, EtOAc fraction showed the best suppressive effect on B16F10 melanoma cell proliferation by CCK-8 assay. It also showed the increased cell death and the changed cellular morphology after CBR treatment. Annexin V-FITC/PI, flow cytometry, and western blotting were performed to elucidate anticancer activity of CBR. The results showed that CBR induced p53-mediated apoptotic cell death of B16F10. CBR EtOAc treatment increased melanin content and melanogenesis-related proteins of MITF and TRP-1 expressions, which supports its anticancer activity. Its potential as an anticancer agent was further investigated in tumor-xenografted mouse model. In melanoma-xenografted mouse model, melanoma tumor growth was significantly suppressed under CBR EtOAc fraction treatment. HPLC analysis of CBR extract showed peak of adenosine. In conclusion, CBR extracts notably inhibited B16F10 melanoma cell proliferation through the p53-mediated apoptosis induction and increased melanogenesis. These findings suggest that CBR EtOAc fraction can act as an effective anticancer agent to treat melanoma. PMID:23533475

  3. Three-dimensional reconstruction of confocal laser microscopy images to study the behaviour of osteoblastic cells grown on biomaterials.


    Ramires, P A; Giuffrida, A; Milella, E


    The adhesion, spreading and cytoskeletal organization of osteoblastic cells seeded onto titanium and titania/hydroxyapatite composite coating (TiO2/HA) were studied using images acquired by confocal laser scanning microscopy. The fluorescence staining technique was employed to visualize actin cytoskeletal organization of cells, 2-D images were exhaustive when the cells were seeded at low density (in the first 24 h of incubation), but they were less clear when the cells proliferated and appeared stacked. Since the shareware software were not satisfactory, a new 3-D image reconstruction was developed using ordinary software and a model was obtained directly from the optical section set, in order to achieve a more realistic and faithful vision of morphological structures and to evaluate the behaviour of bone cells grown on materials. The results showed that the cells grown on titanium conform to the irregular substrate surfaces maximizing the contact between the cell membrane and the substrate and proliferate disposing close to each other. On the contrary, the osteoblasts seeded onto TiO2/HA coating develop clusters where the cells aggregated extending processes in order to establish intercellular connections. Cell aggregation is an early and critical event leading to cell differentiation and mineralization process and could be a first signal of the tendency of TiO2/HA coating to stimulate cell differentiation. PMID:11761159

  4. Proteomic analysis of Staphylococcus aureus biofilm cells grown under physiologically relevant fluid shear stress conditions

    PubMed Central


    Background The biofilm forming bacterium Staphylococcus aureus is responsible for maladies ranging from severe skin infection to major diseases such as bacteremia, endocarditis and osteomyelitis. A flow displacement system was used to grow S. aureus biofilms in four physiologically relevant fluid shear rates (50, 100, 500 and 1000s-1) to identify proteins that are associated with biofilm. Results Global protein expressions from the membrane and cytosolic fractions of S. aureus biofilm cells grown under the above shear rate conditions are reported. Sixteen proteins in the membrane-enriched fraction and eight proteins in the cytosolic fraction showed significantly altered expression (p?

  5. Effect of flow on vascular endothelial cells grown in tissue culture on polytetrafluoroethylene grafts

    SciTech Connect

    Sentissi, J.M.; Ramberg, K.; O'Donnell, T.F. Jr.; Connolly, R.J.; Callow, A.D.


    Vascular grafts lined with endothelial cells (EC) grown to confluence in culture before implantation may provide a thromboresistant flow surface. Growth of EC on and their adherence to currently available prosthetic materials under conditions of flow are two impediments remaining in the development of such a graft. To address these problems, 22 polytetrafluoroethylene grafts (PTFE) (5 cm by 4 mm inside diameter) were pretreated with collagen and fibronectin, seeded with 2 to 3 X 10(6) bovine aortic EC per graft, and placed in tissue culture (seeded grafts). Twenty-two grafts pretreated with collagen and fibronectin alone served as controls. After 2 weeks morphologic studies revealed that 20/22 seeded grafts were lined with a confluent endothelial layer. Indium 111-oxine was then used to label the EC-seeded grafts. After exposure to either low (25 ml/min) or high (200 ml/min) flow rates for 60 minutes in an in vitro circuit, examination of the luminal surface of the graft by light microscopy and scanning electron microscopy revealed minimal loss of EC. These findings were corroborated by radionuclide scans that showed an insignificant loss of the EC-associated indium label during exposure to flow (7% low flow, 11% high flow). Pretreatment of PTFE grafts with collagen and fibronectin thus promotes both attachment and adherence of EC even under flow conditions.

  6. Targeting FAK Radiosensitizes 3-Dimensional Grown Human HNSCC Cells Through Reduced Akt1 and MEK1/2 Signaling

    SciTech Connect

    Hehlgans, Stephanie; Department of Radiotherapy and Oncology, University of Frankfurt, Frankfurt am Main; Institute of Radiopharmacy, Helmholtz Center Dresden-Rossendorf, Dresden ; Eke, Iris; Cordes, Nils; Institute of Radiopharmacy, Helmholtz Center Dresden-Rossendorf, Dresden; Department of Radiation Oncology, University Hospital and Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden


    Purpose: Focal adhesion kinase (FAK), a main regulator of integrin signaling and cell migration, is frequently overexpressed and hyperphosphorylated in human head-and-neck squamous cell carcinoma (HNSCC). We have previously shown that pharmacologic FAK inhibition leads to radiosensitization of 3-dimensionally grown HNSCC cell lines. To further evaluate the role of FAK in radioresistance and as a potential cancer target, we examined FAK and FAK downstream signaling in HNSCC cell lines grown in more physiologic extracellular matrix-based 3-dimensional cell cultures. Methods and Materials: Seven HNSCC cell lines were grown in 3-dimensional extracellular matrix and the clonogenic radiation survival, expression, and phosphorylation of FAK, paxillin, Akt1, extracellular signal-regulated kinase (ERK)1/2, and MEK1/2 were analyzed after siRNA-mediated knockdown of FAK, Akt1, MEK1, FAK+Akt1, or FAK+MEK1 compared with controls or stable overexpression of FAK. The role of MEK1/2 for clonogenic survival and signaling was investigated using the MEK inhibitor U0126 with or without irradiation. Results: FAK knockdown moderately or significantly enhanced the cellular radiosensitivity of 3-dimensionally grown HNSCC cells. The FAK downstream targets paxillin, Akt1, and ERK1/2 were substantially dephosphorylated under FAK depletion. FAK overexpression, in contrast, increased radiation survival and paxillin, Akt1, and ERK1/2 phosphorylation. The degree of radiosensitization upon Akt1, ERK1/2, or MEK1 depletion or U0126 was superimposable to FAK knockdown. Combination knockdown conditions (ie, Akt1/FAK, MEK1/FAK, or U0126/FAK) failed to provide additional radiosensitization. Conclusions: Our data provide further evidence for FAK as important determinant of radiation survival, which acts in the same signaling axis as Akt1 and ERK1/2. These data strongly support our hypothesis that FAK is a relevant molecular target for HNSCC radiotherapy.

  7. Growth and radiation sensitivity of the MLS human ovarian carcinoma cell line grown as multicellular spheroids and xenografted tumours.

    PubMed Central

    Rofstad, E. K.; Sutherland, R. M.


    The growth characteristics and the radiation sensitivity of multicellular spheroids of the MLS human ovarian carcinoma cell line grown in spinner culture in atmospheres of 5% CO2 in air or 5% CO2, 5% O2 and 90% N2 were studied and compared to that of MLS xenografted tumours. The spheroids grew exponentially with a volume-doubling time of approximately 24 h up to a diameter of approximately 580 microns and then the growth rate tapered off, more for spheroids grown at the low than at the high oxygen tension. Thirty days after initiation, the spheroid diameters were approximately 1,500 microns at the low and 2,100 microns at the high oxygen tension. The tumour volume-doubling times were approximately 8 days (V less than 200 mm3) and 17 days (V = 1,000-4,000 mm3). The histological appearance of the spheroids and the tumours was remarkably similar; both developed large central necrosis and both were composed of epithelial cells and showed pseudoglandular structures with lumen. The spheroids were slightly less differentiated than the tumours. The intrinsic, cellular radiation sensitivity was independent of whether the cells were grown in vitro as spheroids or in vivo as tumours, as revealed by irradiating single cells from dissociated spheroids and tumours under aerobic conditions and intact spheroids and tumours under hypoxic conditions. Studies of 1,600 microns spheroids grown in 5% CO2 in air showed that the intrinsic radiation sensitivity of the chronically hypoxic cells was the same as that of acutely hypoxic cells. The fraction of radiobiologically hypoxic cells under these conditions was approximately 15% and similar to those of 9% (V = 200 mm3) and 28% (V = 2,000 mm3) found for the tumours. Spheroids with diameter of 1,200 microns did not show survival curves parallel to those for acutely hypoxic cells, i.e. they did not contain a measurable fraction of clonogenic cells at complete radiobiological hypoxia. The final portion of their survival curves represented partially hypoxic cells; the OERs were 1.6 and 1.3 for spheroids grown at the high and the low oxygen tension, respectively. The considerable similarity between the spheroids and the tumours suggests that MLS spheroids constitute a valuable in vitro model for studies of human tumour radiation biology and related physiological processes. MLS spheroids may be particularly useful in studies of therapeutic consequences of partial radiobiological hypoxia since complete hypoxia and different levels of partial hypoxia can be studied separately by varying spheroid size and the oxygen tension in the culture medium. Images Figure 2 Figure 5 Figure 6 PMID:2757922

  8. Salicylic acid induces apoptosis in colon carcinoma cells grown in-vitro: Influence of oxygen and salicylic acid concentration

    SciTech Connect

    Zitta, Karina; Meybohm, Patrick; Bein, Berthold; Huang, Ying; Heinrich, Christin; Scholz, Jens; Steinfath, Markus; Albrecht, Martin


    In solid tumors the hypoxic environment can promote tumor progression and resistance to therapy. Recently, acetylsalicylic acid a major component of analgesic drugs and its metabolite salicylic acid (SA) have been shown to reduce the risk of colon cancer, but the mechanisms of action remain still unclear. Here we elucidate the effects of physiologically relevant concentrations of SA on colon carcinoma cells (CaCo-2) grown under normoxic and hypoxic conditions. Western blotting, caspase-3/7 apoptosis assays, MTS cell-proliferation assays, LDH cytotoxicity assays and hydrogen peroxide measurements were performed to investigate the effects of 1 and 10 {mu}M SA on CaCo-2 cells grown under normoxic conditions and cells exposed to hypoxia. Under normoxic conditions, SA did not influence cell proliferation or LDH release of CaCo-2 cells. However, caspase-3/7 activity was significantly increased. Under hypoxia, cell proliferation was reduced and LDH release and caspase-3/7 activities were increased. None of these parameters was altered by the addition of SA under hypoxic conditions. Hypoxia increased hydrogen peroxide concentrations 300-fold and SA significantly augmented the release of hydrogen peroxide under normoxic, but not under hypoxic conditions. Phosphorylation of the pro-survival kinases akt and erk1/2 was not changed by SA under hypoxic conditions, whereas under normoxia SA reduced phosphorylation of erk1/2 after 2 hours. We conclude that in colon carcinoma cells effects of SA on apoptosis and cellular signaling are dependent on the availability of oxygen. -- Highlights: Black-Right-Pointing-Pointer Effects of salicylic acid on colon carcinoma cells grown under normoxic and hypoxic conditions Black-Right-Pointing-Pointer Salicylic acid increases caspase-3/7 activity and hydrogen peroxide release under normoxia Black-Right-Pointing-Pointer Salicylic acid decreases pro-survival erk-1/2 phosphorylation under normoxia Black-Right-Pointing-Pointer Salicylic acid does not influence any of the investigated parameters under hypoxia.

  9. 75 FR 79293 - Amendment and Revocation of Class E Airspace; Vero Beach, FL

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... a notice of proposed rulemaking to amend and remove Class E airspace at Vero Beach, FL (75 FR 65581... 12866; (2) is not a ``significant rule'' under DOT Regulatory Policies and Procedures (44 FR 11034..., 40120; E.O. 10854, 24 FR 9565, 3 CFR, 1959-1963 Comp., p. 389. Sec. 71.1 0 2. The incorporation...

  10. Guggulsterone production in cell suspension cultures of the guggul tree, Commiphora wightii, grown in shake-flasks and bioreactors.


    Mathur, Meeta; Ramawat, K G


    Cell suspension cultures of Commiphora wightii, grown in modified MS medium containing 2,4-dichlorophenoxyacetic acid (0.5 mg l(-1)) and kinetin (0.25 mg l(-1)), produced approximately 5 microg guggulsterone g(-1) dry wt. In a 2 l stirred tank bioreactor, the biomass was 5.5 g l(-1) and total guggulsterone was 36 microg l(-1). PMID:17354018

  11. A Stack Property of Solid Oxide Fuel Cell Having YSZ Electrolyte Film Grown by RF Magnetron Sputtering

    NASA Astrophysics Data System (ADS)

    Sasaki, Norikazu; Okamura, Kentaro; Kimura, Takeshi; Nagata, Akiyoshi

    Stack characteristic of solid oxide fuel cell (SOFC) having yttria-stabilized zirconia (YSZ) electrolyte film has been studied on the operating property until lower temperature of 770°C. The YSZ electrolyte film was grown on the Ni-YSZ cermet substrate using as fuel electrode by the RF magnetron sputtering, Terminal voltage of a single cell decreased as lowering the operating temperature. In two parallel cells, the cell resistance reduced to half value and the load current became larger, as compared with the property of a single cell. As a result, it was confirmed that the compact cell stack of thin SOFC improved well the power generation characteristic at middle operating temperature of 770°C.

  12. Possible pathways linking ploidy level to cell elongation and cuticular function in hypocotyls of dark-grown Arabidopsis seedlings.


    Narukawa, Hideki; Yokoyama, Ryusuke; Nishitani, Kazuhiko


    The mechanisms underlying correlations between ploidy level and cell size in eukaryotes remain unclear. Recently, we showed that cell length was higher in tetraploid than in diploid dark-grown Arabidopsis hypocotyls. Cuticular function was aberrant, and expression of genes of cuticle formation was reduced. Here, the links between cell elongation, cuticular function, and ploidy level in the etiolated hypocotyl were examined. Seedlings defective in cuticle formation exhibited shorter hypocotyls. This was due to inhibition of cell elongation rather than cell proliferation, indicating that the reduced cuticular function was a consequence of tetraploidy-induced cell elongation rather than its cause. Inhibition of hypocotyl elongation by impaired cuticles was lower in tetraploid than diploid, indicating that tetraploid hypocotyls were less sensitive to cuticular damage. PMID:26618780

  13. Accumulation of a novel glycolipid and a betaine lipid in cells of Rhodobacter sphaeroides grown under phosphate limitation.


    Benning, C; Huang, Z H; Gage, D A


    Cells of the photosynthetic bacterium Rhodobacter sphaeroides grown under phosphate-limiting conditions accumulated nonphosphorous glycolipids and lipids carrying head groups derived from amino acids. Concomitantly, the relative amount of phosphoglycerolipids decreased from 90 to 22 mol% of total polar lipids in the membranes. Two lipids, not detectable in cells grown under standard conditions, were synthesized during phosphate-limited growth. Fast atom bombardment mass spectroscopy, exact mass measurements, 1H NMR spectroscopy, sugar composition analysis, and methylation analysis of the predominant glycolipid led to the identification of the novel compound 1,2-di-O-acyl-3-O-[alpha-D-glucopyranosyl-(1-->4)-O-beta-D-galactopyr anosyl]glycerol. The second lipid was identified as the betaine lipid 1,2-di-O-acyl-[4'-(N,N,N-trimethyl)-homoserine]glycerol by cochromatography employing an authentic standard from Chlamydomonas reinhardtii, fast atom bombardment mass spectroscopy, exact mass measurements, and 1H NMR spectroscopy. Prior to this observation, the occurrence of this lipid was thought to be restricted to lower plants and algae. Apparently, these newly synthesized nonphosphorous lipids, in addition to the sulfo- and the ornithine lipid also found in R. sphaeroides grown under optimal conditions, take over the role of phosphoglycerolipids in phosphate-deprived cells. PMID:7872771

  14. Growth and characterization of Czochralski-grown n and p-type GaAs for space solar cell substrates

    NASA Technical Reports Server (NTRS)

    Chen, R. T.


    Progress in LEC (liquid encapsulated Czochralski) crystal growth techniques for producing high-quality, 3-inch-diameter, n- and p-type GaAs crystals suitable for solar cell applications is described. The LEC crystals with low dislocation densities and background impurities, high electrical mobilities, good dopant uniformity, and long diffusion lengths were reproducibly grown through control of the material synthesis, growth and doping conditions. The capability for producing these large-area, high-quality substrates should positively impact the manufacturability of highly efficiency, low cost, radiation-hard GaAs solar cells.

  15. Epitaxial Crystal Silicon Absorber Layers and Solar Cells Grown at 1.8 Microns per Minute: Preprint

    SciTech Connect

    Bobela, D. C.; Teplin, C. W.; Young, D. L.; Branz, H. M.; Stradins, P.


    We have grown device-quality epitaxial silicon thin films at growth rates up to 1.8 μm/min, using hot-wire chemical vapor deposition from silane at substrate temperatures below 750 degrees C. At these rates, which are more than 30 times faster than those used by the amorphous and nanocrystalline Si industry, capital costs for large-scale solar cell production would be dramatically reduced, even for cell absorber layers up to 10 ?m thick. We achieved high growth rates by optimizing the three key parameters: silane flow, depletion, and filament geometry, based on our model developed earlier. Hydrogen coverage of the filament surface likely limits silane decomposition and growth rate at high system pressures. No considerable deterioration in PV device performance is observed when grown at high rate, provided that the epitaxial growth is initiated at low rate. A simple mesa device structure (wafer/epi Si/a-Si(i)/a-Si:H(p)/ITO) with a 2.3 um epitaxial silicon absorber layer was grown at 700 nm/min. The finished device had an open-circuit voltage of 0.424 V without hydrogenation treatment.

  16. Biotransformation of Hydroxylaminobenzene and Aminophenol by Pseudomonas putida 2NP8 Cells Grown in the Presence of 3-Nitrophenol

    PubMed Central

    Zhao, Jian-Shen; Singh, Ajay; Huang, Xiao-Dong; Ward, Owen P.


    Biotransformation products of hydroxylaminobenzene and aminophenol produced by 3-nitrophenol-grown cells of Pseudomonas putida 2NP8, a strain grown on 2- and 3-nitrophenol, were characterized. Ammonia, 2-aminophenol, 4-aminophenol, 4-benzoquinone, N-acetyl-4-aminophenol, N-acetyl-2-aminophenol, 2-aminophenoxazine-3-one, 4-hydroquinone, and catechol were produced from hydroxylaminobenzene. Ammonia, N-acetyl-2-aminophenol, and 2-aminophenoxazine-3-one were produced from 2-aminophenol. All of these metabolites were also found in the nitrobenzene transformation medium, and this demonstrated that they were metabolites of nitrobenzene transformation via hydroxylaminobenzene. Production of 2-aminophenoxazine-3-one indicated that oxidation of 2-aminophenol via imine occurred. Rapid release of ammonia from 2-aminophenol transformation indicated that hydrolysis of the imine intermediate was the dominant reaction. The low level of 2-aminophenoxazine-3-one indicated that formation of this compound was probably due to a spontaneous reaction accompanying oxidation of 2-aminophenol via imine. 4-Hydroquinone and catechol were reduction products of 2- and 4-benzoquinones. Based on these transformation products, we propose a new ammonia release pathway via oxidation of aminophenol to benzoquinone monoimine and subsequent hydrolysis for transformation of nitroaromatic compounds by 3-nitrophenol-grown cells of P. putida 2NP8. We propose a parallel mechanism for 3-nitrophenol degradation in P. putida 2NP8, in which all of the possible intermediates are postulated. PMID:10831408

  17. Study of a 1 eV GaNAsSb photovoltaic cell grown on a silicon substrate

    SciTech Connect

    Tan, K. H.; Loke, W. K.; Wicaksono, S.; Li, D.; Leong, Y. R.; Yoon, S. F.; Sharma, P.; Milakovich, T.; Bulsara, M. T.; Fitzgerald, E. A.


    We report the performance of a 1 eV GaNAsSb photovoltaic cell grown on a Si substrate with a SiGe graded buffer grown using molecular beam epitaxy. For comparison, the performance of a similar 1 eV GaN{sub 0.018}As{sub 0.897}Sb{sub 0.085} photovoltaic cell grown on a GaAs substrate was also reported. Both devices were in situ annealed at 700 °C for 5 min, and a significant performance improvement over our previous result was observed. The device on the GaAs substrate showed a low open circuit voltage (V{sub OC}) of 0.42 V and a short circuit current density (J{sub SC}) of 23.4 mA/cm{sup 2} while the device on the Si substrate showed a V{sub OC} of 0.39 V and a J{sub SC} of 21.3 mA/cm{sup 2}. Both devices delivered a quantum efficiency of 50%–55% without any anti-reflection coating.

  18. Single Junction InGaP/GaAs Solar Cells Grown on Si Substrates using SiGe Buffer Layers

    NASA Astrophysics Data System (ADS)

    Ringel, S. A.; Carlin, J. A.; Andre, C. L.; Hudait, M. K.; Gonzalez, M.; Wilt, D. M.; Clark, E. B.; Jenkins, P.; Scheiman, D.; Allerman, A.


    Single junction InGaP/GaAs solar cells displaying high efficiency and record high open circuit voltage values have been grown by metalorganic chemical vapor deposition on Ge/graded SiGe/Si substrates. Open circuit voltages as high as 980 mV under AM0 conditions have been verified to result from a single GaAs junction, with no evidence of Ge-related sub-cell photoresponse. Current AM0 efficiencies of close to 16% have been measured for a large number of small area cells, whose performance is limited by non-fundamental current losses due to significant surface reflection resulting from greater than 10% front surface metal coverage and wafer handling during the growth sequence for these prototype cells. It is shown that at the material quality currently achieved for GaAs grown on Ge/SiGe/Si substrates, namely a 10 nanosecond minority carrier lifetime that results from complete elimination of anti-phase domains and maintaining a threading dislocation density of approximately 8 x 105 per square centimeter, 19-20% AM0 single junction GaAs cells are imminent. Experiments show that the high performance is not degraded for larger area cells, with identical open circuit voltages and higher short circuit current (due to reduced front metal coverage) values being demonstrated, indicating that large area scaling is possible in the near term. Comparison to a simple model indicates that the voltage output of these GaAs on Si cells follows ideal behavior expected for lattice mismatched devices, demonstrating that unaccounted for defects and issues that have plagued other methods to epitaxially integrate III-V cells with Si are resolved using SiGe buffers and proper GaAs nucleation methods. These early results already show the enormous and realistic potential of the virtual SiGe substrate approach for generating high efficiency, lightweight and strong III-V solar cells.

  19. Single Junction InGaP/GaAs Solar Cells Grown on Si Substrates using SiGe Buffer Layers

    NASA Technical Reports Server (NTRS)

    Ringel, S. A.; Carlin, J. A.; Andre, C. L.; Hudait, M. K.; Gonzalez, M.; Wilt, D. M.; Clark, E. B.; Jenkins, P.; Scheiman, D.; Allerman, A.


    Single junction InGaP/GaAs solar cells displaying high efficiency and record high open circuit voltage values have been grown by metalorganic chemical vapor deposition on Ge/graded SiGe/Si substrates. Open circuit voltages as high as 980 mV under AM0 conditions have been verified to result from a single GaAs junction, with no evidence of Ge-related sub-cell photoresponse. Current AM0 efficiencies of close to 16% have been measured for a large number of small area cells, whose performance is limited by non-fundamental current losses due to significant surface reflection resulting from greater than 10% front surface metal coverage and wafer handling during the growth sequence for these prototype cells. It is shown that at the material quality currently achieved for GaAs grown on Ge/SiGe/Si substrates, namely a 10 nanosecond minority carrier lifetime that results from complete elimination of anti-phase domains and maintaining a threading dislocation density of approximately 8 x 10(exp 5) per square centimeter, 19-20% AM0 single junction GaAs cells are imminent. Experiments show that the high performance is not degraded for larger area cells, with identical open circuit voltages and higher short circuit current (due to reduced front metal coverage) values being demonstrated, indicating that large area scaling is possible in the near term. Comparison to a simple model indicates that the voltage output of these GaAs on Si cells follows ideal behavior expected for lattice mismatched devices, demonstrating that unaccounted for defects and issues that have plagued other methods to epitaxially integrate III-V cells with Si are resolved using SiGe buffers and proper GaAs nucleation methods. These early results already show the enormous and realistic potential of the virtual SiGe substrate approach for generating high efficiency, lightweight and strong III-V solar cells.

  20. Effects of growth temperature and device structure on GaP solar cells grown by molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Vaisman, M.; Tomasulo, S.; Masuda, T.; Lang, J. R.; Faucher, J.; Lee, M. L.


    Gallium phosphide (GaP) is an attractive candidate for wide-bandgap solar cell applications, possessing the largest bandgap of the III-arsenide/phosphides without aluminum. However, GaP cells to date have exhibited poor internal quantum efficiency (IQE), even for photons absorbed by direct transitions, motivating improvements in material quality and device structure. In this work, we investigated GaP solar cells grown by molecular beam epitaxy over a range of substrate temperatures, employing a much thinner emitter than in prior work. Higher growth temperatures yielded the best solar cell characteristics, indicative of increased diffusion lengths. Furthermore, the inclusion of an AlGaP window layer improved both open-circuit voltage and short wavelength IQE.

  1. Effects of growth temperature and device structure on GaP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Vaisman, M.; Tomasulo, S.; Masuda, T.; Lang, J. R.; Faucher, J.; Lee, M. L.


    Gallium phosphide (GaP) is an attractive candidate for wide-bandgap solar cell applications, possessing the largest bandgap of the III-arsenide/phosphides without aluminum. However, GaP cells to date have exhibited poor internal quantum efficiency (IQE), even for photons absorbed by direct transitions, motivating improvements in material quality and device structure. In this work, we investigated GaP solar cells grown by molecular beam epitaxy over a range of substrate temperatures, employing a much thinner emitter than in prior work. Higher growth temperatures yielded the best solar cell characteristics, indicative of increased diffusion lengths. Furthermore, the inclusion of an AlGaP window layer improved both open-circuit voltage and short wavelength IQE.

  2. Cell-cycle-specific fluctuation in cytoplasmic membrane composition in aerobically grown Rhodospirillum rubrum.

    PubMed Central

    Myers, C R; Collins, M L


    Aerobic growth with synchronous cell division was induced in Rhodospirillum rubrum by starvation methods. Cells were harvested at different points in the cell cycle. Analysis of the composition of the cell envelope prepared by differential centrifugation or density gradient-purified cytoplasmic membrane obtained from cells at different times indicated that the protein/phospholipid ratio fluctuated with the cell cycle. The protein/phospholipid ratio of cell envelope from selection-synchronized cells also fluctuated with the cell cycle. These studies indicate that the phenomenon of cell-cycle-dependent fluctuation in membrane composition is not restricted to the intracytoplasmic chromatophore membrane of phototrophic cells. PMID:3119564

  3. Pemetrexed alters folate phenotype and inflammatory profile in EA.hy 926 cells grown under low-folate conditions

    PubMed Central

    Hammons, Andrea L.; Summers, Carolyn M.; Jochems, Jeanine; Arora, Jasbir S.; Zhang, Suhong; Blair, Ian A.; Whitehead, Alexander S.


    Elevated homocysteine is a risk marker for several major human pathologies. Emerging evidence suggests that perturbations of folate/homocysteine metabolism can directly modify production of inflammatory mediators. Pemetrexed acts by inhibiting thymidylate synthetase (TYMS), dihydrofolate reductase (DHFR), and glycinamide ribonucleotide formyltransferase (GARFT). EA.hy 926 cells grown under low (“Lo”) and high (“Hi”) folate conditions were treated with pemetrexed. The concentrations of several intracellular folate derivatives were measured using LC-MRM/MS. Lo cells had lower total folate concentrations and a different distribution of the intracellular folate derivatives than Hi cells. Treatment with pemetrexed caused a decrease in individual folate analytes. Microarray analysis showed that several genes were significantly up or down-regulated in pemetrexed treated Lo cells. Several of the significantly up-regulated transcripts were inflammatory. Changes in transcript levels of selected targets, including C3, IL-8, and DHFR, were confirmed by quantitative RT-PCR. C3 and IL-8 transcript levels were increased in pemetrexed-treated Lo cells relative to Lo controls; DHFR transcript levels were decreased. In Lo cells, IL-8 and C3 protein concentrations were increased following pemetrexed treatment. Pemetrexed drug treatment was shown in this study to have effects that lead to an increase in pro-inflammatory mediators in Lo cells. No such changes were observed in Hi cells, suggesting that pemetrexed could not modify the inflammatory profile in the context of cellular folate sufficiency. PMID:22975265

  4. Characteristics of a Galactose-adapted Sugarcane Cell Line Grown in Suspension Culture 1

    PubMed Central

    Maretzki, Andrew; Thom, Margaret


    Although d-galactose is normally toxic to sugarcane (Saccharum sp.) cells, a cell line that grows on 100 mm galactose has been propagated. Nonadapted cells in a medium containing galactose instead of sucrose accumulate UDP-galactose; these cells also have much lower UDP-galactose 4-epimerase (EC activity than do adapted cells. This enzyme may determine whether or not galactose will cause toxicity symptoms to develop. The growth rate of galactose-adapted cells is similar to most cell lines on several other carbohydrates. The galactose-adapted cells are also similar to sucrose stock cells in cell wall composition and sugar phosphate concentrations, but, like the nonadapted cells, accumulate free galactose. PMID:16660333

  5. Penetration and intracellular routing of nucleus-directed peptide-based shuttles (loligomers) in eukaryotic cells.


    Singh, D; Kiarash, R; Kawamura, K; LaCasse, E C; Gariépy, J


    Loligomers are multitasking, peptide-based shuttles that are able to penetrate cells and self-localize into distinct cellular compartments. In particular, loligomer 4 incorporates internalization and nuclear import sequences as well as reporter groups. The intracellular routing of loligomer 4 was analyzed by microscopy and flow cytometry, to define and demonstrate localization events. Electron micrographs of CHO cells exposed to a biotinylated derivative of loligomer 4 as well as confocal images of CHO cells treated with rhodamine-labeled loligomer 4 indicate their presence in the cytosol, endocytic vesicles, and the nucleus of CHO cells. Loligomer 4 accumulates irreversibly inside cells. Uptake of loligomer 4 by six mammalian cell lines (Daudi, EL4, CHO, COS-7, VERO, and HeLa) was proven by flow cytometry, establishing the generality of the principle. Cells presented as monolayers typically were less able to endocytose the construct than cells grown in suspension. Cellular accumulation of loligomer 4 varied between cell lines with COS-7 and VERO cells showing the highest level of uptake. Plasmids harboring reporter genes could be transported efficiently inside CHO cells, suggesting that loligomer 4 either alone or noncovalently associated with large macromolecules can effectively reach the nucleus of cells. In summary, loligomer 4 constructs provide a simple synthetic platform for the design of guided intracellular agents. PMID:9558313

  6. "allometry" Deterministic Approaches in Cell Size, Cell Number and Crude Fiber Content Related to the Physical Quality of Kangkong (Ipomoea reptans) Grown Under Different Plant Density Pressures

    NASA Astrophysics Data System (ADS)

    Selamat, A.; Atiman, S. A.; Puteh, A.; Abdullah, N. A. P.; Mohamed, M. T. M.; Zulkeefli, A. A.; Othman, S.

    Kangkong, especially the upland type (Ipomoea reptans) is popularly consumed as a vegetable dish in the South East Asian countries for its quality related to Vitamins (A and C) and crude fiber contents. Higher fiber contents would prevent from the occurrence of colon cancer and diverticular disease. With young stem edible portion, its cell number and size contribute to the stem crude fiber content. The mathematical approach of allometry of cell size, number, and fiber content of stem could be used in determining the 'best' plant density pressure in producing the quality young stem to be consumed. Basically, allometry is the ratio of relative increment (growth or change) rates of two parameters, or the change rate associated to the log of measured variables relationship. Kangkog grown equal or lower than 55 plants m-2 produced bigger individual plant and good quality (physical) kangkong leafy vegetable, but with lower total yield per unit area as compared to those grown at higher densities.

  7. High-efficiency GaAs and GaInP solar cells grown by all solid-state molecular-beam-epitaxy

    PubMed Central


    We report the initial results of GaAs and GaInP solar cells grown by all solid-state molecular-beam-epitaxy (MBE) technique. For GaAs single-junction solar cell, with the application of AlInP as the window layer and GaInP as the back surface field layer, the photovoltaic conversion efficiency of 26% at one sun concentration and air mass 1.5 global (AM1.5G) is realized. The efficiency of 16.4% is also reached for GaInP solar cell. Our results demonstrate that the MBE-grown phosphide-contained III-V compound semiconductor solar cell can be quite comparable to the metal-organic-chemical-vapor-deposition-grown high-efficiency solar cell. PMID:22040124

  8. Development of a 2.0 eV AlGaInP Solar Cell Grown by OMVPE

    SciTech Connect

    Perl, Emmett E.; Simon, John; Geisz, John F.; Olavarria, Waldo; Young, Michelle; Duda, Anna; Dippo, Pat; Friedman, Daniel J.; Steiner, Myles A.


    AlGaInP solar cells with a bandgap (Eg) of ~2.0 eV are developed for use in next-generation multijunction photovoltaic devices. This material system is of great interest for both space and concentrator photovoltaics due to its high bandgap, which enables the development of high-efficiency five-junction and six-junction devices and is also useful for solar cells operated at elevated temperatures. In this work, we explore the conditions for the Organometallic Vapor Phase Epitaxy (OMVPE) growth of AlGaInP and study their effects on cell performance. A ~2.0 eV AlGaInP solar cell is demonstrated with an open circuit voltage (VOC) of 1.59V, a bandgap-voltage offset (WOC) of 420mV, a fill factor (FF) of 88.0%, and an efficiency of 14.8%. These AlGaInP cells have attained a similar FF, WOC and internal quantum efficiency (IQE) to the best upright GaInP cells grown in our lab to date.

  9. Temperature coefficients and radiation induced DLTS spectra of MOCVD grown n(+)p InP solar cells

    NASA Technical Reports Server (NTRS)

    Walters, Robert J.; Statler, Richard L.; Summers, Geoffrey P.


    The effects of temperature and radiation on n(+)p InP solar cells and mesa diodes grown by metallorganic chemical vapor deposition (MOCVD) were studied. It was shown that MOCVD is capable of consistently producing good quality InP solar cells with Eff greater than 19 percent which display excellent radiation resistance due to minority carrier injection and thermal annealing. It was also shown that universal predictions of InP device performance based on measurements of a small group of test samples can be expected to be quite accurate, and that the degradation of an InP device due to any incident particle spectrum should be predictable from a measurement following a single low energy proton irradiation.

  10. The Proteome of Filter-Grown Caco-2 Cells With a Focus on Proteins Involved in Drug Disposition.


    Ölander, Magnus; Wiśniewski, Jacek R; Matsson, Pär; Lundquist, Patrik; Artursson, Per


    Caco-2 cells are widely used in studies of intestinal cell physiology and drug transport. Here, the global proteome of filter-grown Caco-2 cells was quantified using the total protein approach and compared with the human colon and jejunum proteomes. In total, 8096 proteins were identified. In-depth analysis of proteins defining enterocyte differentiation-including brush-border hydrolases, integrins, and adherens and tight junctions-gave near-complete coverage of the expected proteins. Three hundred twenty-seven absorption, distribution, metabolism and excretion proteins were identified, including 112 solute carriers and 20 ATP-binding cassette transporters. OATP2B1 levels were 16-fold higher in Caco-2 cells than in jejunum. To investigate the impact of this difference on in vitro-in vivo extrapolations, we studied the uptake kinetics of the OATP2B1 substrate pitavastatin in Caco-2 monolayers, and found that the contribution of OATP2B1 was 60%-70% at clinically relevant intestinal concentrations. Pitavastatin kinetics was combined with transporter concentrations to model the contribution of active transport and membrane permeation in the jejunum. The lower OATP2B1 expression in jejunum led to a considerably lower transporter contribution (<5%), suggesting that transmembrane diffusion dominates pitavastatin absorption in vivo. In conclusion, we present the first in-depth quantification of the filter-grown Caco-2 proteome. We also demonstrate the crucial importance of considering transporter expression levels for correct interpretation of drug transport routes across the human intestine. PMID:26869432

  11. Control of membrane permeability by external and internal ATP in 3T6 cells grown in serum-free medium.

    PubMed Central

    Dicker, P; Heppel, L A; Rozengurt, E


    Cultures of 3T6 cells were plated in serum-free medium and grown in the presence of insulin (1 microgram/ml) and epidermal growth factor (0.5 ng/ml). External ATP (250 microM) applied to such cultures caused a rapid efflux of acid-soluble pools labeled with [3H]uridine, 2-deoxy[3H]glucose, or 86Rb+ and allowed the entry of p-nitrophenylphosphate. This increase in passive membrane permeability depended on ATP concentration, pH, and time of ATP contact with the cells, and it was not produced by GTP, UTP, or Pi. In the presence of compounds that decrease intracellular ATP, low concentrations of external ATP (40 microM) caused a massive synergistic stimulation of efflux. The efflux of acid-soluble pools was stopped (sealing) by bringing the cultures of 3T6 cells to neutral pH in the presence of Ca2+ and Mg2+. Exposure of 3T6 cells grown in serum-free medium to [gamma-32P]ATP under the conditions of permeabilization led to the selective labeling of a membrane protein with a molecular weight of 44,000 as revealed by NaDodSO4 polyacrylamide gel electrophoresis and autoradiography. The results show that the control of membrane permeability by ATP is completely independent of serum-deprived proteins. Furthermore, the protein band (Mr, 44 x 10(3)) that shows selective labeling by [32P]ATP during permeabilization is not an adsorbed serum component. Images PMID:6929541

  12. Epitaxially grown collagen fibrils reveal diversity in contact guidance behavior among cancer cells.


    Wang, Juan; Petefish, Joseph W; Hillier, Andrew C; Schneider, Ian C


    Invasion of cancer cells into the surrounding tissue is an important step during cancer progression and is driven by cell migration. Cell migration can be random, but often it is directed by various cues such as aligned fibers composed of extracellular matrix (ECM), a process called contact guidance. During contact guidance, aligned fibers bias migration along the long axis of the fibers. These aligned fibers of ECM are commonly composed of type I collagen, an abundant structural protein around tumors. In this paper, we epitaxially grew several different patterns of organized type I collagen on mica and compared the morphology and contact guidance behavior of two invasive breast cancer cell lines (MDA-MB-231 and MTLn3 cells). Others have shown that these cells randomly migrate in qualitatively different ways. MDA-MB-231 cells exert large traction forces, tightly adhere to the ECM, and migrate with spindle-shaped morphology and thus adopt a mesenchymal mode of migration. MTLn3 cells exert small traction forces, loosely adhere to the ECM, and migrate with a more rounded morphology and thus adopt an amoeboid mode of migration. As the degree of alignment of type I collagen fibrils increases, cells become more elongated and engage in more directed contact guidance. MDA-MB-231 cells perceive the directional signal of highly aligned type I collagen fibrils with high fidelity, elongating to large extents and migrating directionally. Interestingly, behavior in MTLn3 cells differs. While highly aligned type I collagen fibril patterns facilitate spreading and random migration of MTLn3 cells, they do not support elongation or directed migration. Thus, different contact guidance cues bias cell migration differently and the fidelity of contact guidance is cell type dependent, suggesting that ECM alignment is a permissive cue for contact guidance, but requires a cell to have certain properties to interpret that cue. PMID:25531276

  13. Epitaxially Grown Collagen Fibrils Reveal Diversity in Contact Guidance Behavior among Cancer Cells

    PubMed Central


    Invasion of cancer cells into the surrounding tissue is an important step during cancer progression and is driven by cell migration. Cell migration can be random, but often it is directed by various cues such as aligned fibers composed of extracellular matrix (ECM), a process called contact guidance. During contact guidance, aligned fibers bias migration along the long axis of the fibers. These aligned fibers of ECM are commonly composed of type I collagen, an abundant structural protein around tumors. In this paper, we epitaxially grew several different patterns of organized type I collagen on mica and compared the morphology and contact guidance behavior of two invasive breast cancer cell lines (MDA-MB-231 and MTLn3 cells). Others have shown that these cells randomly migrate in qualitatively different ways. MDA-MB-231 cells exert large traction forces, tightly adhere to the ECM, and migrate with spindle-shaped morphology and thus adopt a mesenchymal mode of migration. MTLn3 cells exert small traction forces, loosely adhere to the ECM, and migrate with a more rounded morphology and thus adopt an amoeboid mode of migration. As the degree of alignment of type I collagen fibrils increases, cells become more elongated and engage in more directed contact guidance. MDA-MB-231 cells perceive the directional signal of highly aligned type I collagen fibrils with high fidelity, elongating to large extents and migrating directionally. Interestingly, behavior in MTLn3 cells differs. While highly aligned type I collagen fibril patterns facilitate spreading and random migration of MTLn3 cells, they do not support elongation or directed migration. Thus, different contact guidance cues bias cell migration differently and the fidelity of contact guidance is cell type dependent, suggesting that ECM alignment is a permissive cue for contact guidance, but requires a cell to have certain properties to interpret that cue. PMID:25531276

  14. Enzymatic Detachment of Therapeutic Mesenchymal Stromal Cells Grown on Glass Carriers in a Bioreactor

    PubMed Central

    Salzig, Denise; Schmiermund, Alexandra; P. Grace, Pablo; Elseberg, Christiane; Weber, Christian; Czermak, Peter


    Cell therapies require the in vitro expansion of adherent cells such as mesenchymal stromal cells (hMSCs) in bioreactor systems or other culture environments, followed by cell harvest. As hMSCs are strictly adherent cells, cell harvest requires cell detachment. The use of hMSCs for cell therapy requires GMP production in accordance with the guidelines for advanced therapeutic medical products. Therefore, several GMP-conform available proteolytic enzymes were investigated for their ability to promote hMSC detachment. An allogeneic hMSC cell line (hMSC-TERT) that is used in clinical trials in the form of alginate cell capsules was chosen as a model. This study investigated the influence of several factors on the outcome of proteolytic hMSC-TERT detachment. Therefore, hMSC-TERT detachment was analyzed in different cultivation systems (static, dynamic) and in combination with further cell processing including encapsulation. Only two of the commercially available enzymes (AccutaseTM, TrypZeanTM) that fulfill all process requirements (commercial availability, cost, GMP conditions during manufacturing and non-animal origin) are found to be generally suitable for detaching hMSC-TERT. Combining cell detachment with encapsulation demonstrated a high impact of the experimental set up on cell damage. It was preferable to reduce the temperature during detachment and limit the detachment time to a maximum of 20 minutes. Cell detachment in static systems was not comparable with detachment in dynamic systems. Detachment yields in dynamic systems were lower and cell damage was higher for the same experimental conditions. Finally, only TrypZeanTM seemed to be suitable for the detachment of hMSC-TERT from dynamic reactor systems. PMID:24478807

  15. Dye-sensitized solar cells with vertically aligned TiO2 nanowire arrays grown on carbon fibers.


    Cai, Xin; Wu, Hongwei; Hou, Shaocong; Peng, Ming; Yu, Xiao; Zou, Dechun


    One-dimensional semiconductor TiO2 nanowires (TNWs) have received widespread attention from solar cell and related optoelectronics scientists. The controllable synthesis of ordered TNW arrays on arbitrary substrates would benefit both fundamental research and practical applications. Herein, vertically aligned TNW arrays in situ grown on carbon fiber (CF) substrates through a facile, controllable, and seed-assisted thermal process is presented. Also, hierarchical TiO2 -nanoparticle/TNW arrays were prepared that favor both the dye loading and depressed charge recombination of the CF/TNW photoanode. An impressive conversion efficiency of 2.48 % (under air mass 1.5 global illumination) and an apparent efficiency of 4.18 % (with a diffuse board) due to the 3D light harvesting of the wire solar cell were achieved. Moreover, efficient and inexpensive wire solar cells made from all-CF electrodes and completely flexible CF-based wire solar cells were demonstrated, taking into account actual application requirements. This work may provide an intriguing avenue for the pursuit of lightweight, cost-effective, and high-performance flexible/wearable solar cells. PMID:24488679

  16. Effects of temperature on the cell wall and osmotic properties in dark-grown rice and azuki bean seedlings.


    Nakamura, Yukiko; Wakabayashi, Kazuyuki; Kamisaka, Seiichiro; Hoson, Takayuki


    The mechanism inducing the difference in growth rate under various temperature (10-50 degrees C) conditions was analyzed using rice and azuki bean seedlings. The growth rate of rice coleoptiles and azuki bean epicotyls increased as temperature increased up to 40 and 30 degrees C, respectively, and the elongation was retarded at a higher temperature. The cell wall extensibility of rice coleoptiles and azuki bean epicotyls also showed the highest value at 40 and 30 degrees C, respectively, and became smaller as the temperature rose or dropped from the optimum. The opposite tendency was observed in the minimum stress-relaxation time of the cell wall. On the other hand, the cellular osmotic concentration of rice coleoptiles and azuki bean epicotyls was lower at the temperature optimum for growth at 40 and 30 degrees C, respectively. When rice and azuki bean seedlings grown at 10, 20, 40, or 50 degrees C were transferred to the initial temperature (30 degrees C), the growth rate of coleoptiles and epicotyls was mostly elevated, concomitant with an increase in the cell wall extensibility. The growth rate was correlated with the cell wall mechanical parameters in both materials. These results suggest that the environmental temperature modulates the growth rate of plant shoots by affecting mainly the mechanical properties of the cell wall. PMID:12579449

  17. Antigenic Protein In Microgravity-Grown Human Mixed Mullerian Tumor (LN1) Cells Preserved In RNA Stabilizing Agent

    NASA Technical Reports Server (NTRS)

    Hammond, Dianne K.; Becker, Jeanne; Holubec, K.; Baker, T. L.; Love, J. E.


    Cells treated with RNAlater(TradeMark) have previously been shown to contain antigenic proteins that can be visualized using Western blot analysis. These proteins seem to be stable for several months when stored in RNA stabilizer at 4 C. Antigenic protein can be recovered from cells that have been processed using an Ambion RNAqueous(Registered TradeMark) kit to remove RNA. In this set of experiments, human mixed Mullerian tumor (LN1) cells grown on the International Space Station during Expedition 3 were examined for antigenic stability after removal of RNA. The cells were stored for three months in RNAlater(TradeMark) and RNA was extracted. The RNA filtrate Containing the protein was precipitated, washed, and suspended in buffer containing sodium dodecyl sulfate (SDS). Samples containing equal concentrations of protein were loaded onto SDS-polyacrylamide gels. Proteins were separated by electrophoresis and transferred by Western blot to polyvinylidene fluoride (PVDF) membrane. The Western blots were stained with an enhanced chemiluminescent ECL(Registered TradeMark)Plus detection kit (Amersham) and scanned using a Storm 840 gel image analyzer (Amersham, Molecular Dynamics). ImageQuant(Registered TradeMark)a software was used to quantify the densities of the protein bands. The ground control and flight LN1 cell samples showed a similar staining pattern over time with antibodies to vimentin, glyceraldehyde-3-phosphate dehydrogenase, and epithelial membrane antigens.

  18. Antigenic Protein In Microgravity-Grown Human Mixed Mullerian Tumor (LN1) Cells Preserved In RNA Stabilizing Agent

    NASA Technical Reports Server (NTRS)

    Hammond, Dianne K.; Becker, Jeanne; Elliott, T. F.; Holubec, K.; Baker, T. L.; Love, J. E.


    Cells treated with RNAlater(TradeMark) have previously been shown to contain antigenic proteins that can be visualized using Western blot analysis. These proteins seem to be stable for several months when stored in RNA stabilizer at 4 C. Antigenic protein can be recovered from cells that have been processed using an Ambion RNAqueous(Registered TradeMark) kit to remove RNA. In this set of experiments, human mixed Mullerian tumor (LNI) cells grown on the International Space Station during Expedition 3 were examined for antigenic stability after removal of RNA. The cells were stored for three months in RNAlater(TradeMark) and RNA was extracted. The RNA filtrate containing the protein was precipitated, washed, and suspended in buffer containing sodium dodecyl sulfate (SDS). Samples containing equal concentrations of protein were loaded onto SDS-polyacrylamide gels. Proteins were separated by electrophoresis and transferred by Western blot to polyvinylidene fluoride (PVDF) membrane. The Western blots were stained with an enhanced chemiluminescent ECL(Registered Trademark) Plus detection kit (Amersham) and scanned using a Storm 840 gel image analyzer (Amersham, Molecular Dynamics). ImageQuant(Registered TradeMark) software was used to quantify the densities of the protein bands. The ground control and flight LN1 cell samples showed a similar staining pattern over time with antibodies to vimentin, glyceraldehyde-3-phosphate dehydrogenase, and epithelial membrane antigens.

  19. Positioning effects on quantum dot solar cells grown by molecular beam epitaxy

    SciTech Connect

    Zhou, D.; Sharma, G.; Fimland, B. O.; Vullum, P. E.; Thomassen, S. F.; Holmestad, R.; Reenaas, T. W.


    We report current-voltage and spectral response characteristics of high density InAs/GaAs quantum dot (QD) solar cells with different positions where dots are located. The short circuit current density (J{sub sc}), open circuit voltage (V{sub oc}), and external quantum efficiency of these cells under air mass 1.5 are presented and compared with a GaAs reference cell. An extended photoresponse in contrast to the GaAs reference cell was confirmed for all these cells. The effect of inserting QD layers into emitter and base region on device performance is shown. The J{sub sc} is reduced, while the V{sub oc} is maintained. The cell with QDs located toward the base side shows better performance, confirmed by both current-voltage and spectral response measurements.

  20. Effect of Hypergravity on Localization Calcium Ions in Plant Cells Grown in Vivo and in Vitro

    NASA Astrophysics Data System (ADS)

    Nedukha, Olena

    Using plant callus tissues and Arabidopsis thaliana plants as model systems we have been investigated the effect of hypergravity on the localization and relative content of calcium ions in photosynthesizing cells. The tobacco callus cells in log stage of growth and mesophyll cells from developed A. thaliana leaves were used in the experiments. Plant samples were exposed to hypergravity at 6.5 g, 10g and 14 g for 15-60 min. After centrifugation, dye Fluo-4 was loaded in the control leaves and the centrifuged samples by the standard cytochemical method. Observation of calcium fluorescence was carried out with a laser confocal microscope LSM 5 Pascal at the excitation wave 488 nm (by the argon laser), at emission wavelength 516 nm. The data of the calcium ion distribution and quantification in cells were obtained using software "Pascal" (Carl Zeiss). The effect of hypergravity on redistribution of calcium ions in plant cells has been established. This effect is depended from exposure time and from the value of hypergravity. The cells cultivated in vitro is showed fast response to hypergravity influence. Plasmolysis cells and calcium domains formation have been observed in most of callus cells. This influence was like to that, which was wrote in Funaria hygrometrica protonema cells after 8.5 g influence (Sytnik et al., 1984). Leaf cells of A. thaliana were of less responsively to hypergravity than callus cells. Sytnik K, Kordyum E, Nedukha O. et al. 1984. Plant Cell Under Change of Geophysical Factors. Kiev: Naukova Dumka, 1-134 p.

  1. The density of apical cells of dark-grown protonemata of the moss Ceratodon purpureus

    NASA Technical Reports Server (NTRS)

    Schwuchow, J. M.; Kern, V. D.; Wagner, T.; Sack, F. D.


    Determinations of plant or algal cell density (cell mass divided by volume) have rarely accounted for the extracellular matrix or shrinkage during isolation. Three techniques were used to indirectly estimate the density of intact apical cells from protonemata of the moss Ceratodon purpureus. First, the volume fraction of each cell component was determined by stereology, and published values for component density were used to extrapolate to the entire cell. Second, protonemal tips were immersed in bovine serum albumin solutions of different densities, and then the equilibrium density was corrected for the mass of the cell wall. Third, apical cell protoplasts were centrifuged in low-osmolarity gradients, and values were corrected for shrinkage during protoplast isolation. Values from centrifugation (1.004 to 1.015 g/cm3) were considerably lower than from other methods (1.046 to 1.085 g/cm3). This work appears to provide the first corrected estimates of the density of any plant cell. It also documents a method for the isolation of protoplasts specifically from apical cells of protonemal filaments.

  2. Thyrotropin dependent and independent thyroid cell lines selected from FRTL-5 derived tumors grown in nude mice

    SciTech Connect

    Ossendorp, F.A.; Bruning, P.F.; Schuuring, E.M.; Van Den Brink, J.A.; van der Heide, D.; De Vijlder, J.J.; De Bruin, T.W. )


    FRTL-5 cells were used to set up a thyroid tumor model system in C3H nu/nu mice. FRTL-5 tumors could be grown in nude mice provided serum TSH levels were elevated. Persistent TSH elevation was obtained by administration of Na131I, rendering the mice hypothyroid. After 4 weeks FRTL-5 cells were injected sc resulting in tumor growth within 2 weeks in eight out of eight mice. Although the tumors showed an apparently undifferentiated histology, lacking normal follicular structures, they were functional since the tumors were capable of concentrating (131)iodine, as demonstrated by nuclear imaging. From one of the tumors a new cell line was isolated (FRTL-5/T) that, like the parental FRTL-5 cell line, was TSH dependent for growth. In a control group of six euthyroid nude mice FRTL-5 tumor growth could not be obtained with one exception. After 3 months one animal developed a small tumor that grew rapidly thereafter. This tumor was easily transplantable in other euthyroid nude mice, showed an undifferentiated histology, and was nonfunctional, as it could not concentrate (131)iodine. From this tumor two cell lines were derived: one cultured in the presence of TSH (FRTL-5/TP) and one in the absence of TSH (FRTL-5/TA). The cell lines were analyzed for TSH responsive functions and TSH receptor expression. Responsiveness to TSH in FRTL-5/T and the parental FRTL-5 cell line were similar for most thyroid specific functions tested. However, FRTL-5/T was less sensitive than FRTL-5 for TSH induced (3H)thymidine incorporation. Both cell lines had two classes of TSH binding sites with high and low affinity respectively. FRTL-5/TP and FRTL-5/TA were both able to grow in TSH free medium and were nonresponsive to TSH in vitro, as tested for (3H)thymidine and (3H)uridine incorporation, iodine uptake, thyroglobulin iodination, and thyroglobulin secretion.

  3. MDR-1-overexpression in HT 29 colon cancer cells grown in SCID mice.


    Schumacher, Udo; Nehmann, Nina; Adam, Elizabeth; Mukthar, Dhia; Slotki, Itzchak N; Horny, Hans-Peter; Flens, Marcel J; Schlegelberger, Brigitte; Steinemann, Doris


    The multidrug-resistance 1 (MDR-1) P-glycoprotein (Pgp) is a transmembrane transporter system, which actively pumps cytotoxic drugs out of the cell. MDR-1 acquired in vitro differs from MDR-1 acquired in vivo, but has important consequences on the cellular phenotype and metastatic behavior. Here we report that the human colonic cancer cell line HT29 (MDR-1 negative) is more malignant than its MDR-1 overexpressing variant (HT29 MDR-1 positive). HT29 MDR-1 negative cells produce undifferentiated signet ring carcinomas when implanted subcutaneously into SCID mice, while HT29 MDR-1 positive cells form tumors with tubular structures, but without signet ring cells. Immunohistochemical proliferation marker analysis revealed that the MDR-1 positive cells proliferate much more slowly than the MDR-1 negative cells. MDR-1 overexpression results in a less differentiated phenotype at the cellular level (absence of mucin producing cells) but in a more differentiated phenotype at the tissue level (tubule formation). In addition, lectin binding patterns including that of Helix pomatia agglutinin (HPA), an indicator of metastatic potential, differed between the two cell lines. HT29 MDR-1 positive cells had less HPA binding sites than HT29 MDR-1 negative counterparts and metastasized less frequently in SCID mice. As slow proliferation, low degree of differentiation and multidrug-resistance is a hallmark of cancer stem cells and all were present in MDR-1 positive tumors, it is attractive to speculate that they represent a stem cell rich tumor. As shown by global gene expression analyses, genes involved, e.g. in cell adhesion, glycosylation and signal transduction, were deregulated in MDR-1 positive tumors compared to MDR-negative tumors. Overexpression of E-cadherin and carcinoembryonic antigen-related cell adhesion molecules 1 (CEACAM1) may provide clues to the mechanisms responsible for the reduced metastatic potential of MDR-1 overexpressing tumors. Since drug treatment shifted the cells towards a less metastatic phenotype in this in vivo model, it seems conceivable to achieve this using drug treatment also in a clinical situation. PMID:22154301

  4. Changes in levels of cell wall constituents in wheat seedlings grown under continuous hypergravity conditions

    NASA Astrophysics Data System (ADS)

    Wakabayashi, K.; Soga, K.; Kamisaka, S.; Hoson, T.

    Effects of continuous hypergravity stimuli on the amounts and composition of cell wall constituents were investigated in wheat shoots. Hypergravity (300 g) treatment for three days after germination increased the net amount of cell wall polysaccharides such as hemicellulose and cellulose, but reduced the shoot elongation. As a result, the amount of cell wall polysaccharides per unit length of shoot increased under hypergravity. The hemicellulose fraction contained polysaccharides in the middle and low molecular mass range (5 kDa-1 MDa) and increased in response to hypergravity. Also, the amounts of arabinose (Ara) and xylose (Xyl), the major sugar components of the hemicellulose fraction, increased under hypergravity conditions. In addition to wall polysaccharides, hypergravity increased the amounts of cell wall-bound phenolic acids, such as ferulic acid (FA) and diferulic acid (DFA). Furthermore, the activity of phenylalanine ammonia-lyase (PAL, EC was enhanced under hypergravity conditions. These results suggest that continuous hypergravity stimulates the synthesis of cell wall constituents, especially hemicellulosic arabinoxylans and cell wall-bound FA and DFA in wheat shoots. The increased PAL activity may promote the formation of FA and DFA. These changes in cell wall architecture may be involved in making rigid and tough cell walls under hypergravity conditions and thereby contribute to the ability of plant to sustain their structures against gravitational stimuli.

  5. Production of putative virulence factors by Renibacterium salmoninarum grown in cell culture.


    McIntosh, D; Flaño, E; Grayson, T H; Gilpin, M L; Austin, B; Villena, A J


    A cell culture system, employing the fish cell line Epithelioma papillosum cyprini (EPC), was developed to study the synthesis of intracellular antigen and the expression of putative virulence factors by Renibacterium salmoninarum. EPC cultures infected with R. salmoninarum could be maintained for 7 weeks, during which the pathogen multiplied intracellularly. Immunohistochemical examination of infected cultures revealed the production of the p57 antigen, haemolysin and cytolysin. The intracellular nature of the infection was confirmed by transmission electron microscopic examination of EPC monolayers. A comparison of the relative virulence of bacterial cells cultured in EPC cells and on agar plates revealed that the former were markedly more virulent in challenge experiments with juvenile rainbow trout (Oncorhynchus mykiss Walbaum). The EPC cell culture model provided a system for the study of R. salmoninarum under more natural conditions than those achieved with plate culture techniques. PMID:9353936

  6. Identification of morphological differences between avian influenza A viruses grown in chicken and duck cells.


    Al-Mubarak, Firas; Daly, Janet; Christie, Denise; Fountain, Donna; Dunham, Stephen P


    Although wild ducks are considered to be the major reservoirs for most influenza A virus subtypes, they are typically resistant to the effects of the infection. In contrast, certain influenza viruses may be highly pathogenic in other avian hosts such as chickens and turkeys, causing severe illness and death. Following in vitro infection of chicken and duck embryo fibroblasts (CEF and DEF) with low pathogenic avian influenza (LPAI) viruses, duck cells die more rapidly and produce fewer infectious virions than chicken cells. In the current study, the morphology of viruses produced from CEF and DEF cells infected with low pathogenic avian H2N3 was examined. Transmission electron microscopy showed that viruses budding from duck cells were elongated, while chicken cells produced mostly spherical virions; similar differences were observed in viral supernatants. Sequencing of the influenza genome of chicken- and duck-derived H2N3 LPAI revealed no differences, implicating host cell determinants as responsible for differences in virus morphology. Both DEF and CEF cells produced filamentous virions of equine H3N8 (where virus morphology is determined by the matrix gene). DEF cells produced filamentous or short filament virions of equine H3N8 and avian H2N3, respectively, even after actin disruption with cytochalasin D. These findings suggest that cellular factors other than actin are responsible for the formation of filamentous virions in DEF cells. The formation of elongated virions in duck cells may account for the reduced number of infectious virions produced and could have implications for virus transmission or maintenance in the reservoir host. PMID:25613009

  7. Investigation of InGaP/(In)AlGaAs/GaAs triple-junction top cells for smart stacked multijunction solar cells grown using molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Sugaya, Takeyoshi; Mochizuki, Toru; Makita, Kikuo; Oshima, Ryuji; Matsubara, Koji; Okano, Yoshinobu; Niki, Shigeru


    We report high-quality InGaP/(In)AlGaAs/GaAs triple-junction solar cells fabricated using solid-source molecular beam epitaxy (MBE) for the first time. The triple-junction cells can be used as top cells for smart stacked multijunction solar cells. A growth temperature of 480 °C was found to be suitable for an (In)AlGaAs second cell to obtain high-quality tunnel junctions. The properties of AlGaAs solar cells were better than those of InAlGaAs solar cells when a second cell was grown at 480 °C. The high-quality InGaP/AlGaAs/GaAs solar cell had an impressive open-circuit voltage of 3.1 V. This result indicates that high-performance InGaP/AlGaAs/GaAs triple-junction solar cells can be fabricated using solid-source MBE.

  8. Transcriptome profiling in Arabidopsis inflorescence stems grown under hypergravity in terms of cell walls and plant hormones

    NASA Astrophysics Data System (ADS)

    Tamaoki, D.; Karahara, I.; Nishiuchi, T.; De Oliveira, S.; Schreiber, L.; Wakasugi, T.; Yamada, K.; Yamaguchi, K.; Kamisaka, S.


    Land plants rely on lignified secondary cell walls in supporting their body weight on the Earth. Although gravity influences the formation of the secondary cell walls, the regulatory mechanism of their formation by gravity is not yet understood. We carried out a comprehensive analysis of gene expression in inflorescence stems of Arabidopsis thaliana L. using microarray (22 K) to identify genes whose expression is modulated under hypergravity condition (300 g). Total RNA was isolated from the basal region of inflorescence stems of plants grown for 24 h at 300 g or 1 g. Microarray analysis showed that hypergravity up-regulated the expression of 403 genes to more than 2-fold. Hypergravity up-regulated the genes responsible for the biosynthesis or modification of cell wall components such as lignin, xyloglucan, pectin and structural proteins. In addition, hypergravity altered the expression of genes related to the biosynthesis of plant hormones such as auxin and ethylene and that of genes encoding hormone-responsive proteins. Our transcriptome profiling indicates that hypergravity influences the formation of secondary cell walls by modulating the pattern of gene expression, and that auxin and/or ethylene play an important role in signaling hypergravity stimulus.

  9. MG63 Osteoblast-Like Cells Exhibit Different Behavior when Grown on Electrospun Collagen Matrix versus Electrospun Gelatin Matrix

    PubMed Central

    Tsai, Shiao-Wen; Liou, Hau-Min; Lin, Cheng-Jie; Kuo, Ko-Liang; Hung, Yi-Sheng; Weng, Ru-Chun; Hsu, Fu-Yin


    Electrospinning is a simple and efficient method of fabricating a non-woven polymeric nanofiber matrix. However, using fluorinated alcohols as a solvent for the electrospinning of proteins often results in protein denaturation. TEM and circular dichroism analysis indicated a massive loss of triple-helical collagen from an electrospun collagen (EC) matrix, and the random coils were similar to those found in gelatin. Nevertheless, from mechanical testing we found the Young's modulus and ultimate tensile stresses of EC matrices were significantly higher than electrospun gelatin (EG) matrices because matrix stiffness can affect many cell behaviors such as cell adhesion, proliferation and differentiation. We hypothesize that the difference of matrix stiffness between EC and EG will affect intracellular signaling through the mechano-transducers Rho kinase (ROCK) and focal adhesion kinase (FAK) and subsequently regulates the osteogenic phenotype of MG63 osteoblast-like cells. From the results, we found there was no significant difference between the EC and EG matrices with respect to either cell attachment or proliferation rate. However, the gene expression levels of OPN, type I collagen, ALP, and OCN were significantly higher in MG63 osteoblast-like cells grown on the EC than in those grown on the EG. In addition, the phosphorylation levels of Y397-FAK, ERK1/2, BSP, and OPN proteins, as well as ALP activity, were also higher on the EC than on the EG. We further inhibited ROCK activation with Y27632 during differentiation to investigate its effects on matrix-mediated osteogenic differentiation. Results showed the extent of mineralization was decreased with inhibition after induction. Moreover, there is no significant difference between EC and EG. From the results of the protein levels of phosphorylated Y397-FAK, ERK1/2, BSP and OPN, ALP activity and mineral deposition, we speculate that the mechanism that influences the osteogenic differentiation of MG63 osteoblast-like cells on EC and EG is matrix stiffness and via ROCK-FAK-ERK1/2. PMID:22319618

  10. Heteroepitaxial film silicon solar cell grown on Ni-W foils

    SciTech Connect

    Wee, Sung Hun; Cantoni, Claudia; Fanning, Thomas; Teplin, Charles; Bogorin, Daniela Florentina; Bornstein, Jon; Bowers, Karen; Schroeter,; Hasoon, Falah; Branz, Howard; Paranthaman, Mariappan Parans; Goyal, Amit


    Today, silicon-wafer-based technology dominates the photovoltaic (PV) industry because it enables high efficiency, is produced from abundant, non-toxic materials and is proven in the PV marketplace.[1] However, costs associated with the wafer itself limit ultimate cost reductions.[1,2] PV based on absorber layers of crystalline Si with only 2 to 10 m thickness are a promising route to reduce these costs, while maintaining efficiencies above 15%.[3-5] With the goal of fabricating low-cost film crystalline Si (c-Si), recent research has explored wafer peeling,[6,7] crystallization of amorphous silicon films on glass,[4,8-10] and seed and epitaxy approaches.[3,5,11] In this third approach, one initially forms a seed layer that establishes the grain size and crystalline order. The Si layer is then grown heteroepitaxially on the seed layer, so that it replicates the seed crystal structure. In all of these film c-Si approaches, the critical challenge is to grow c-Si with adequate material quality: specifically, the diffusion length (LD) must be at least three times the film thickness.[12] In polycrystalline Si films, grain boundaries (GBs) are recombination-active and significantly reduce LD. This adverse effects of GBs motivates research into growth of large grained c-Si [13,14] (for a low density of GBs) and biaxially-textured c-Si [11] (for low-angle GBs).

  11. Effects of substrate conductivity on cell morphogenesis and proliferation using tailored, atomic layer deposition-grown ZnO thin films.


    Choi, Won Jin; Jung, Jongjin; Lee, Sujin; Chung, Yoon Jang; Yang, Cheol-Soo; Lee, Young Kuk; Lee, You-Seop; Park, Joung Kyu; Ko, Hyuk Wan; Lee, Jeong-O


    We demonstrate that ZnO films grown by atomic layer deposition (ALD) can be employed as a substrate to explore the effects of electrical conductivity on cell adhesion, proliferation, and morphogenesis. ZnO substrates with precisely tunable electrical conductivity were fabricated on glass substrates using ALD deposition. The electrical conductivity of the film increased linearly with increasing duration of the ZnO deposition cycle (thickness), whereas other physical characteristics, such as surface energy and roughness, tended to saturate at a certain value. Differences in conductivity dramatically affected the behavior of SF295 glioblastoma cells grown on ZnO films, with high conductivity (thick) ZnO films causing growth arrest and producing SF295 cell morphologies distinct from those cultured on insulating substrates. Based on simple electrostatic calculations, we propose that cells grown on highly conductive substrates may strongly adhere to the substrate without focal-adhesion complex formation, owing to the enhanced electrostatic interaction between cells and the substrate. Thus, the inactivation of focal adhesions leads to cell proliferation arrest. Taken together, the work presented here confirms that substrates with high conductivity disturb the cell-substrate interaction, producing cascading effects on cellular morphogenesis and disrupting proliferation, and suggests that ALD-grown ZnO offers a single-variable method for uniquely tailoring conductivity. PMID:25897486

  12. Effects of substrate conductivity on cell morphogenesis and proliferation using tailored, atomic layer deposition-grown ZnO thin films

    PubMed Central

    Choi, Won Jin; Jung, Jongjin; Lee, Sujin; Chung, Yoon Jang; Yang, Cheol-Soo; Lee, Young Kuk; Lee, You-Seop; Park, Joung Kyu; Ko, Hyuk Wan; Lee, Jeong-O


    We demonstrate that ZnO films grown by atomic layer deposition (ALD) can be employed as a substrate to explore the effects of electrical conductivity on cell adhesion, proliferation, and morphogenesis. ZnO substrates with precisely tunable electrical conductivity were fabricated on glass substrates using ALD deposition. The electrical conductivity of the film increased linearly with increasing duration of the ZnO deposition cycle (thickness), whereas other physical characteristics, such as surface energy and roughness, tended to saturate at a certain value. Differences in conductivity dramatically affected the behavior of SF295 glioblastoma cells grown on ZnO films, with high conductivity (thick) ZnO films causing growth arrest and producing SF295 cell morphologies distinct from those cultured on insulating substrates. Based on simple electrostatic calculations, we propose that cells grown on highly conductive substrates may strongly adhere to the substrate without focal-adhesion complex formation, owing to the enhanced electrostatic interaction between cells and the substrate. Thus, the inactivation of focal adhesions leads to cell proliferation arrest. Taken together, the work presented here confirms that substrates with high conductivity disturb the cell-substrate interaction, producing cascading effects on cellular morphogenesis and disrupting proliferation, and suggests that ALD-grown ZnO offers a single-variable method for uniquely tailoring conductivity. PMID:25897486

  13. Compensation mechanism of undoped GaAs films grown by molecular beam epitaxy using an As-valved cracker cell

    NASA Astrophysics Data System (ADS)

    Hong, C. U.; Gozu, S.; Okayasu, J.; Koyano, M.; Katayama, S.; Hori, H.; Yamada, S.


    We have investigated GaAs films epitaxially grown by molecular beam epitaxy (MBE) using a valved As-cracker source. When the cracking temperature ( Tc) of the As-valved cracker cell is raised, which means the dominant As species changes from As 4 to As 2, the conduction type of the films changed from p - to n -. In order to clarify the origins of the change of compensation mechanism of those GaAs films, estimations were made using electrical (Hall effect) and optical (photoluminescence and far-infrared) measurements. Impurity incorporation behaviors suggested by these estimations are found to give a reasonable explanation for the change of conduction type, that is, the change of compensation mechanism.

  14. Changes in cell wall architecture of wheat coleoptiles grown under continuous hypergravity conditions

    NASA Astrophysics Data System (ADS)

    Wakabayashi, K.; Soga, K.; Kamisaka, S.; Hoson, T.

    Modifications of cell wall structure of wheat coleoptiles in response to continuous hypergravity (300 g) treatment were investigated. Length of coleoptiles exposed to hypergravity for 2-4 days from germination stage was 60-70% of that of 1 g control. The net amounts of cell wall polysaccharides, such as hemicellulose and cellulose, of hypergravity-treated coleoptiles increased as much as those of 1 g control coleoptiles during the incubation period. As a result, the levels of cell wall polysaccharides per unit length of coleoptile, which mean the thickness of cell walls, largely increased under hypergravity conditions. Particularly, the amounts of hemicellulosic polymers with middle molecular mass (0.2-1 MDa) largely increased from day 2 to 3 under hypergravity conditions. The major sugar components of the hemicellulose fraction are arabinose, xylose and glucose. The ratios of arabinose and xylose to glucose were higher in hypergravity-treated coleoptiles than in control coleoptiles. The fractionation of hemicellulosic polymers into the neutral and acidic polymers by the anion-exchange column showed that the levels of acidic polymers (mainly composed of arabinoxylans) in cell walls of hypergravity-treated coleoptiles were higher than those of control coleoptiles. In addition to wall polysaccharides, the amounts of cell wall-bound phenolics, such as ferulic acid and diferulic acid, substantially increased during the incubation period both in 1 g control and hypergravity-treated coleoptiles. Especially, the levels of diferulic acid which cross-links hemicellulosic polymers were higher in hypergravity-treated coleoptiles than in control coleoptiles during the incubation period. These results suggest that hypergravity stimuli from the germination stage bias the type of synthesized hemicellulosic polysaccharides, although they do not restrict the net synthesis of cell wall constituents in wheat coleoptiles. The stimulation of the synthesis of arabinoxylans and of the formation of DFA, and also the resultant cell wall thickening may contribute to plant resistance to gravity stimuli.

  15. Photovoltaic characteristics of n(+)pp(+) InP solar cells grown by OMVPE

    NASA Technical Reports Server (NTRS)

    Tyagi, S.; Singh, K.; Bhimnathwala, H.; Ghandhi, S. K.; Borrego, J. M.


    The photovoltaic characteristics of n(+)/p/p(+) homojunction InP solar cells fabricated by organometallic vapor-phase epitaxy (OMVPE) are described. The cells are characterized by I-V, C-V and quantum efficiency measurements, and simulations are used to obtain various device and material parameters. The I-V characteristics show a high recombination rate in the depletion region; this is shown to be independent of the impurity used. It is shown that cadmium is easier to use as an acceptor for the p base and p(+) buffer and is therefore beneficial. The high quantum efficiency of 98 percent at long wavelengths measured in these cells indicates a very good collection efficiency in the base. The short-wavelength quantum efficiency is poor, indicating a high surface recombination.

  16. Scanning electron microscopic observations on cells grown in vitro. VII. HeLa cells can penetrate Wi38 fibroblasts.


    Benke, R; Paweletz, N


    When HeLa cells are seeded on a preexisting monolayer of Wi38 fibroblasts, the HeLa cells "try" to get into direct contact with the glass substrate. Once on top of a flat fibroblast the HeLa cell can either migrate from the fibroblast to settle between two fibroblasts on glass or somehow stimulate the underlying cells to retract. In a few cases the HeLa cell directly penetrates the fibroblast, "melting" its way through the underlying cell. The mechanism of this phenomenon which has never been described before in this combination is discussed. PMID:6698044

  17. Biotransformation of d-Limonene to (+) trans-Carveol by Toluene-Grown Rhodococcus opacus PWD4 Cells

    PubMed Central

    Duetz, Wouter A.; Fjällman, Ann H. M.; Ren, Shuyu; Jourdat, Catherine; Witholt, Bernard


    The toluene-degrading strain Rhodococcus opacus PWD4 was found to hydroxylate d-limonene exclusively in the 6-position, yielding enantiomerically pure (+) trans-carveol and traces of (+) carvone. This biotransformation was studied using cells cultivated in chemostat culture with toluene as a carbon and energy source. The maximal specific activity of (+) trans-carveol formation was 14.7 U (g of cells [dry weight])−1, and the final yield was 94 to 97%. Toluene was found to be a strong competitive inhibitor of the d-limonene conversion. Glucose-grown cells did not form any trans-carveol from d-limonene. These results suggest that one of the enzymes involved in toluene degradation is responsible for this allylic monohydroxylation. Another toluene degrader (Rhodococcus globerulus PWD8) had a lower specific activity but was found to oxidize most of the formed trans-carveol to (+) carvone, allowing for the biocatalytic production of this flavor compound. PMID:11375201

  18. Optimization towards high density quantum dots for intermediate band solar cells grown by molecular beam epitaxy

    SciTech Connect

    Zhou, D.; Sharma, G.; Fimland, B. O.; Thomassen, S. F.; Reenaas, T. W.


    We report high density quantum dots (QDs) formation with optimized growth temperature and V/III ratio. At lower growth temperature, QD density is increased, due to smaller surface migration length of In adatoms. With higher V/III, the QD density is higher but it results in large clusters formation and decreases the QD uniformity. The QD solar cell was fabricated and examined. An extended spectral response in contrast to the GaAs reference cell was presented but the external quantum efficiency at energies higher than GaAs band gap is reduced, resulting from the degradation for the emitter above the strained QD layers.

  19. High efficiency GaAs-Ge tandem solar cells grown by MOCVD

    NASA Technical Reports Server (NTRS)

    Vernon, S. M.; Tobin, S. P.; Bajgar, C.; Haven, Victor E.; Geoffroy, L. M.; Lillington, D. R.; Hart, R. E., Jr.


    High conversion efficiency and low weight are obviously desirable for solar cells intended for space applications. One promising structure is GaAs on Ge. The advantages of using Ge wafers as substrates include the following: they offer high efficiency by forming a two-junction tandem cell; low weight combined with superior strength allows usage of thin (3 mil) wafers; and they are a good substrate for GaAs, being lattice matched, thermal expansion matched, and available as large-area wafers.

  20. Human amniotic fluid cells grown in a hormone-supplemented medium: suitability for prenatal diagnosis.

    PubMed Central

    Chang, H C; Jones, O W; Masui, H


    A new supplemented medium has been developed to improve human amniotic fluid cell growth and to reduce the dependence on exogenously added serum. The medium consists of a mixture of Ham's F12 medium and Dulbecco's modified Eagle's medium supplemented with Hepes, antibiotics, and 10 growth-promoting factors at 4% fetal bovine serum. Good clonal growth is achieved consistently in 8--13 days and is associated with large numbers of metaphase cells. Primary clones may be analyzed directly, thereby reducing difficulty with interpretation of chromosomal mosaicism. This medium could also be used for cultivation of fetal solid tissues and peripheral blood cultures of lymphocytes. Images PMID:6956891

  1. Low temperature grown ZnO@TiO{sub 2} core shell nanorod arrays for dye sensitized solar cell application

    SciTech Connect

    Goh, Gregory Kia Liang; Le, Hong Quang; Huang, Tang Jiao; Hui, Benjamin Tan Tiong


    High aspect ratio ZnO nanorod arrays were synthesized on fluorine-doped tin oxide glasses via a low temperature solution method. By adjusting the growth condition and adding polyethylenimine, ZnO nanorod arrays with tunable length were successfully achieved. The ZnO@TiO{sub 2} core shells structures were realized by a fast growth method of immersion into a (NH{sub 4}){sub 2}·TiF{sub 6} solution. Transmission electron microscopy, X-ray Diffraction and energy dispersive X-ray measurements all confirmed the existence of a titania shell uniformly covering the ZnO nanorod's surface. Results of solar cell testing showed that addition of a TiO{sub 2} shell to the ZnO nanorod significantly increased short circuit current (from 4.2 to 5.2 mA/cm{sup 2}), open circuit voltage (from 0.6 V to 0.8 V) and fill factor (from 42.8% to 73.02%). The overall cell efficiency jumped from 1.1% for bare ZnO nanorod to 3.03% for a ZnO@TiO{sub 2} core shell structured solar cell with a 18–22 nm shell thickness, a nearly threefold increase. - Graphical abstract: The synthesis process of coating TiO{sub 2} shell onto ZnO nanorod core is shown schematically. A thin, uniform, and conformal shell had been grown on the surface of the ZnO core after immersing in the (NH{sub 4}){sub 2}·TiF{sub 6} solution for 5–15 min. - Highlights: • ZnO@TiO{sub 2} core shell nanorod has been grown on FTO substrate using low temperature solution method. • TEM, XRD, EDX results confirmed the existing of titana shell, uniformly covered rod's surface. • TiO{sub 2} shell suppressed recombination, demonstrated significant enhancement in cell's efficiency. • Core shell DSSC's efficiency achieved as high as 3.03%, 3 times higher than that of ZnO nanorods.

  2. Heteroepitaxial Film Silicon Solar Cell Grown on Ni-W Foils

    SciTech Connect

    Wee, S. H.; Cantoni, C.; Fanning, T. R.; Teplin, C. W.; Bogorin, D. F.; Bornstein, J.; Bowers, K.; Schroeter, P.; Hasoon, F.; Branz, H. M.; Paranthaman, M. P.; Goyal, A.


    Heteroepitaxial semiconductor films on low-cost, flexible metal foil templates are a potential route to inexpensive, high-efficiency solar cells. Here, we report epitaxial growth of Si films on low-cost, flexible, biaxially-textured Ni-W substrates. A robust buffer architecture comprised of multiple epitaxial oxide layers has been developed to grow high quality, heteroepitaxial Si films without any undesired reaction between the Si film and the metal substrate and with a single biaxial texture. XRD analysis including {omega}-scans, {phi}-scans, and pole figures confirms that the buffers and silicon are all epitaxial, with excellent cube-on-cube epitaxy. A photo-conversion efficiency of 1.1% is demonstrated from a proof-of-concept heteroepitaxial film Si solar cell.

  3. Highly efficient Cu(In,Ga)Se2 solar cells grown on flexible polymer films.


    Chirilă, Adrian; Buecheler, Stephan; Pianezzi, Fabian; Bloesch, Patrick; Gretener, Christina; Uhl, Alexander R; Fella, Carolin; Kranz, Lukas; Perrenoud, Julian; Seyrling, Sieghard; Verma, Rajneesh; Nishiwaki, Shiro; Romanyuk, Yaroslav E; Bilger, Gerhard; Tiwari, Ayodhya N


    Solar cells based on polycrystalline Cu(In,Ga)Se(2) absorber layers have yielded the highest conversion efficiency among all thin-film technologies, and the use of flexible polymer films as substrates offers several advantages in lowering manufacturing costs. However, given that conversion efficiency is crucial for cost-competitiveness, it is necessary to develop devices on flexible substrates that perform as well as those obtained on rigid substrates. Such comparable performance has not previously been achieved, primarily because polymer films require much lower substrate temperatures during absorber deposition, generally resulting in much lower efficiencies. Here we identify a strong composition gradient in the absorber layer as the main reason for inferior performance and show that, by adjusting it appropriately, very high efficiencies can be obtained. This implies that future manufacturing of highly efficient flexible solar cells could lower the cost of solar electricity and thus become a significant branch of the photovoltaic industry. PMID:21927005

  4. GaAsPN-based PIN solar cells MBE-grown on GaP substrates: toward the III-V/Si tandem solar cell

    NASA Astrophysics Data System (ADS)

    Da Silva, M.; Almosni, S.; Cornet, C.; Létoublon, A.; Levallois, C.; Rale, P.; Lombez, L.; Guillemoles, J.-F.; Durand, O.


    GaAsPN semiconductors are promising material for the elaboration of high efficiencies tandem solar cells on silicon substrates. GaAsPN diluted nitride alloy is studied as the top junction material due to its perfect lattice matching with the Si substrate and its ideal bandgap energy allowing a perfect current matching with the Si bottom cell. We review our recent progress in materials development of the GaAsPN alloy and our recent studies of some of the different building blocks toward the elaboration of a PIN solar cell. A lattice matched (with a GaP(001) substrate, as a first step toward the elaboration on a Si substrate) 1μm-thick GaAsPN alloy has been grown by MBE. After a post-growth annealing step, this alloy displays a strong absorption around 1.8-1.9 eV, and efficient photoluminescence at room temperature suitable for the elaboration of the targeted solar cell top junction. Early stage GaAsPN PIN solar cells prototypes have been grown on GaP (001) substrates, with 2 different absorber thicknesses (1μm and 0.3μm). The external quantum efficiencies and the I-V curves show that carriers have been extracted from the GaAsPN alloy absorbers, with an open-circuit voltage of 1.18 V, while displaying low short circuit currents meaning that the GaAsPN structural properties needs a further optimization. A better carrier extraction has been observed with the absorber displaying the smallest thickness, which is coherent with a low carriers diffusion length in our GaAsPN compound. Considering all the pathways for improvement, the efficiency obtained under AM1.5G is however promising.

  5. Moringa oleifera Lam. (Moringaceae) grown in Nigeria: In vitro antisickling activity on deoxygenated erythrocyte cells

    PubMed Central

    Adejumo, Olufunmilayo E.; Kolapo, Adelodun L.; Folarin, Akintomiwa O.


    Context: Traditional medicine, which is more available and affordable for the poor uses medicinal plants for the treatment and management of various ailments, including the sickle cell disease (SCD). About 24 million Nigerians are carriers of this sickled cell gene, while approximately 2.4 million are SCD patients. Moringa oleifera Lam. (Moringaceae) possesses high nutritional value and has been used in folklore medicine to treat various ailments related to pain and inflammation. Chemical, pharmacological and pharmacognostical applications of Moringa oleifera have been reported. Objective: This study investigated the antisickling potential of polar and non-polar extracts of the seed, flower and leaf of Moringa oleifera for the first time. Materials and Methods: Using crude methanol extract, aqueous extract, ethyl acetate and butanol, the in vitro antisickling activities of Moringa oleifera fractions, were evaluated using erythrocyte cells deoxygenated with 2% sodium metabisulphite. p-Hydroxybenzoic acid and normal saline were employed as positive and negative controls. Results: Phytochemical screening revealed the presence of saponins, free anthraquinones, and alkaloids. Extracts of the seed and flower demonstrated a higher (P<0.05) antisickling activity in comparison to the leaf extract. The leaf extract, as well as those of the seed and flower, equally demonstrated a (P<0.05) reversal of sickled erythrocytes. Discussions and Conclusions: These findings suggest that Moringa oleifera may play a role in the management of SCD, by incorporation of its fractions into recipes. More extensive biological evaluations and further studies will be necessary for the chemical characterization of the antisickling principles. PMID:22557922

  6. Molecular and immunological characterization of three strains of Anaplasma marginale grown in cultured tick cells.


    Lis, Katarzyna; Fernndez de Mera, Isabel G; Popara, Marina; Cabezas-Cruz, Alejandro; Aylln, Nieves; Zweygarth, Erich; Passos, Lygia M F; Broniszewska, Marzena; Villar, Margarita; Kocan, Katherine M; Ribeiro, Mucio F B; Pfister, Kurt; de la Fuente, Jos


    Anaplasma marginale is an economically important tick-borne pathogen of cattle that causes bovine anaplasmosis. A wide range of geographic strains of A. marginale have been isolated from cattle, several of which have been characterized using genomics and proteomics. While many of these strains have been propagated in tick lines, comparative analyses after propagation in tick cells have not been reported. The overall purpose of this research therefore was to compare the degree of conservation of selected genes after propagation in tick cell culture among A. marginale strains from the U.S. (the Virginia strain) and Brazil (UFMG1 and UFMG2 strains). The genes studied herein included those which encode the proteins HSP70 and SODB involved in heat shock and stress responses, respectively, and two genes that encode major surface proteins MSP4 and MSP5. Strain identities were first confirmed by sequencing the tandem repeats of the msp1a gene which encodes for the adhesin, MSP1a. The results of these studies demonstrated that the genes encoding for both stress response and heat shock proteins were highly conserved among the three A. marginale strains. Antibodies specific for MSP4, MSP5, SODB and HSP70 proteins were used to further characterize the A. marginale strains, and they reacted with all of these strains propagated in tick cell culture, providing further evidence for antigenic conservation. Although antigenic differences were not found among the three A. marginale strains, multi-locus sequence analysis (MLSA) performed with nucleotide sequences of these genes demonstrated that the A. marginale Brazilian and U.S. strains fall in different clades. These results showed that phylogenetically distant strains of A. marginale are antigenically conserved, even after several in vitro passages, supporting the use of some of the above conserved proteins as candidates for universal vaccines. PMID:25943785

  7. Hybrid solar cells based on dc magnetron sputtered films of n-ITO on APMOVPE grown p-InP

    NASA Technical Reports Server (NTRS)

    Coutts, T. J.; Li, X.; Wanlass, M. W.; Emery, K. A.; Gessert, T. A.


    Hybrid indium-tin-oxide (ITO)/InP solar cells are discussed. The cells are constructed by dc magnetron sputter deposition of ITO onto high-quality InP films grown by atmospheric pressure metal-organic vapor-phase epitaxy (APMOVPE). A record efficiency of 18.9 percent, measured under standard Solar Energy Research Institute reporting conditions, has been obtained. The p-InP surface is shown to be type converted, principally by the ITO, but with the extent of conversion being modified by the nature of the sputtering gas. The deposition process, in itself, is not responsible for the type conversion. Dark currents have been suppressed by more than three orders of magnitude by the addition of hydrogen to the sputtering gas during deposition of a thin (5 nm) interface layer. Without this layer, and using only the more usual argon/oxygen mixture, the devices had poorer efficiencies and were unstable. A discussion of associated quantum efficiencies and capacitance/voltage measurements is also presented from which it is concluded that further improvements in efficiency will result from better control over the type-conversion process.

  8. Performance of microbial electrolysis cells with bioanodes grown at different external resistances.


    Rago, Laura; Monpart, Nuria; Cortés, Pilar; Baeza, Juan A; Guisasola, Albert


    Bioelectrochemical systems need an anode with a high abundance of exoelectrogenic bacteria for an optimal performance. Among all possible operational parameters for an efficient enrichment, the role of external resistance in microbial fuel cell (MFC) has gained a lot of interest since it indirectly poises an anode potential, a key parameter for biofilm distribution and morphology. Thus, this work aims at investigating and discussing whether bioanodes selected at different external resistances under MFC operation present different responses under both MFC and microbial electrolysis cell (MEC) operation. A better MEC performance (i.e. shorter start-up time, higher current intensity and higher H2 production rate) was obtained with an anode from an MFC developed under low external resistance. Quantitative real-time polymerase chain reaction (qPCR) confirmed that a low external resistance provides an MFC anodic biofilm with the highest content of Geobacter because it allows higher current intensity, which is correlated to exoelectrogenic activity. High external resistances such as 1,000 Ω led to a slower start-up time under MEC operation. PMID:26942536

  9. Growth and stoichiometry of a Catharanthus roseus cell suspension culture grown under nitrogen-limiting conditions.


    Rho, D; André, G


    The uptake of carbohydrate and nitrate by Catharanthus roseus cell suspension cultures was studied in relation to biomass production in shake flasks. Biomass production was similar when using either 6, 12, 18, or 24 mM nitrate as the nitrogen source and 20 g L(-1) sucrose as the carbon source. In all cases, maximum biomass production was reached when carbohydrates were entirely consumer by the cells. Apparent biomass yields, Y(X/S) and Y(X/N) were 0.49 g biomass g(-1) glucose equivalent and 0.23 g biomass mmol(-1) nitrate, respectively. The determination of the cellular carbon-to-nitrogen ration (C/N ration) resulted in the identification of three district growth phases: an active growth phase, and accumulation phase, and a biomass decline phase (endogenous metabolism). The onset of the last two phases was correlated with nitrate and sugar of the last two phases was correlated with nitrate and sugar exhaustion, respectively. Balanced stoichiometric equations describing the active growth and accumulation phases were proposed based on elemental composition and ash content of the biomass. The stoichiometric equation related to the accumulation phase predicts that the available sugars are stored as starch- and lipid-like materials. PMID:18604877

  10. Genotoxic Effects of Low- and High-LET Radiation on Human Epithelial Cells Grown in 2-D Versus 3-D Culture

    NASA Technical Reports Server (NTRS)

    Patel, Z. S.; Cucinotta, F. A.; Huff, J. L.


    Risk estimation for radiation-induced cancer relies heavily on human epidemiology data obtained from terrestrial irradiation incidents from sources such as medical and occupational exposures as well as from the atomic bomb survivors. No such data exists for exposures to the types and doses of high-LET radiation that will be encountered during space travel; therefore, risk assessment for space radiation requires the use of data derived from cell culture and animal models. The use of experimental models that most accurately replicate the response of human tissues is critical for precision in risk projections. This work compares the genotoxic effects of radiation on normal human epithelial cells grown in standard 2-D monolayer culture compared to 3-D organotypic co-culture conditions. These 3-D organotypic models mimic the morphological features, differentiation markers, and growth characteristics of fully-differentiated normal human tissue and are reproducible using defined components. Cultures were irradiated with 2 Gy low-LET gamma rays or varying doses of high-LET particle radiation and genotoxic damage was measured using a modified cytokinesis block micronucleus assay. Our results revealed a 2-fold increase in residual damage in 2 Gy gamma irradiated cells grown under organotypic culture conditions compared to monolayer culture. Irradiation with high-LET particle radiation gave similar results, while background levels of damage were comparable under both scenarios. These observations may be related to the phenomenon of "multicellular resistance" where cancer cells grown as 3-D spheroids or in vivo exhibit an increased resistance to killing by chemotherapeutic agents compared to the same cells grown in 2-D culture. A variety of factors are likely involved in mediating this process, including increased cell-cell communication, microenvironment influences, and changes in cell cycle kinetics that may promote survival of damaged cells in 3-D culture that would otherwise die or be rendered reproductively inactive in 2-D culture.

  11. Dye-sensitized solar cell employing zinc oxide aggregates grown in the presence of lithium

    SciTech Connect

    Zhang, Qifeng; Cao, Guozhong


    Provided are a novel ZnO dye-sensitized solar cell and method of fabricating the same. In one embodiment, deliberately added lithium ions are used to mediate the growth of ZnO aggregates. The use of lithium provides ZnO aggregates that have advantageous microstructure, morphology, crystallinity, and operational characteristics. Employing lithium during aggregate synthesis results in a polydisperse collection of ZnO aggregates favorable for porosity and light scattering. The resulting nanocrystallites forming the aggregates have improved crystallinity and more favorable facets for dye molecule absorption. The lithium synthesis improves the surface stability of ZnO in acidic dyes. The procedures developed and disclosed herein also help ensure the formation of an aggregate film that has a high homogeneity of thickness, a high packing density, a high specific surface area, and good electrical contact between the film and the fluorine-doped tin oxide electrode and among the aggregate particles.

  12. Enhanced-Depletion-Width GaInNAs Solar Cells Grown by Molecular-Beam Epitaxy

    SciTech Connect

    Ptak, A. J.; Friedman, D. J.


    The 3-junction, GaInP2/GaAs/Ge solar cell is a non-optimized structure due to excess light falling on the Ge junction. Because of this, a fourth junction inserted between the GaAs and Ge subcells could use the excess light and provide an increase in device efficiency. Unfortunately, the leading candidate material, GaInNAs, suffers from very low minority-carrier diffusion lengths compared to its parent compound, GaAs. These low diffusion lengths do not allow for the collection of adequate current to keep the overall 4-junction structure current matched. If the currents generated from the GaInNAs subcell are increased, the possibility exists for practical efficiencies of greater than 40% from this structure.

  13. Dilute Nitride GaNP Wide Bandgap Solar Cells Grown by Gas-Source Molecular Beam Epitaxy

    NASA Astrophysics Data System (ADS)

    Sukrittanon, Supanee

    Integration of III-V semiconductors and Si is a very attractive means to achieve low-cost high-efficiency solar cells. A promising configuration is to utilize a dual-junction solar cell, in which Si is employed as the bottom junction and a wide-bandgap III-V semiconductor as the top junction. The use of a III-V semiconductor as a top junction offers the potential to achieve higher efficiencies than today's best Si solar cell. Dilute nitride GaNP is a promising candidate for the top cell in dual-junction solar cells because it possesses several extremely important attributes: a direct-bandgap that is also tunable as well as easily-attained lattice-match with Si. As a first step towards integration of GaNP solar cells onto Si, the goal of this dissertation is to optimize and demonstrate GaNP solar cells grown by gas-source molecular beam epitaxy (GSMBE) on GaP (001) substrate. The dissertation is divided into three major parts. In the first part, we demonstrate ˜ 2.05 eV ([N]˜ 1.8%) dilute nitride GaNP thin film solar cells, in which the GaNP is closely lattice-matched to Si, on GaP substrates. From transmission electron microscopy (TEM), the device exhibits defects only at the GaNP/GaP interface, and no threading dislocations in an active layer are observed. Our best GaNP solar cell achieved an efficiency of 7.9% with anti-reflection (AR) coating and no window layer. This GaNP solar cell's efficiency is higher than the most efficient GaP solar cell to date and higher than other solar cells with similar direct bandgap (InGaP, GaAsP). Through a systematic study of the structural, electrical, and optical properties of the device, efficient broadband optical absorption and enhanced solar cell performance using GaNP are demonstrated. In the second part, we demonstrate the successful fabrication of GaP/GaNP core/shell microwires utilizing a novel technique: top-down reactive-ion etching (RIE) to create the cores and MBE to create the shells. Systematic studies have been performed over a series of microwire lengths, array periods, and microwire sidewall morphology. For a fixed length, short circuit current (J sc) increases as physical fill factor (PFF) of microwires increases, while, for a fixed array period, Jsc increases as microwire length increases. Our studies show that the open circuit voltage (Voc) is degraded primarily due to defects at the GaP/GaNP interface and in the shells, not surface recombination. The best efficiency we achieved using our microwire solar cell is 3.2% using an AR coating. Compared to thin film solar cells in the same growth run, the microwire solar cells exhibit greater J sc but poorer Voc. This results from greater light absorption and a greater number of defects in the microwire structure, respectively. In the final part, vertical self-catalyzed GaP, GaNP, and GaNP/GaNP core/shell nanowires are demonstrated. The growth window of GaP nanowires is comparable to the growth window of GaNP nanowires. The diameter of nanowires (cores) can be controlled by adjusting substrate temperature (Tsub). The shells can be grown by decreasing Tsub and increasing the V/III incorporation ratio to reduce adatom mobility. The crystal structures of GaP and GaNP nanowires are mixtures of cubic zincblend phase and hexagonal wurtzite phase along the [111] growth direction. According to photoluminescence measurements, the broad spectrum of nanowire arrays do not result from the variation of N composition among nanowires, but from the mechanism of light emission of GaNP.

  14. Scanning electron microscopic observations on cells grown in vitro. VIII. Cell-cell interactions between HeLa cells and WI38 fibroblasts.


    Benke, R; Paweletz, N


    Adherent HeLa 1 and non-adherent HeLa S cells were seeded onto a preexisting monolayer of WI38 fibroblasts. Both cell types were able to attach to and to spread on top of the fibroblasts. Furthermore, both cell types were able to migrate actively from these fibroblasts if they managed to contact the underlying glass support. Both cell types were capable of penetrating the monolayer, under-lapping the fibroblast cells and finally destroying the monolayer. The cells' behavior was different when the monolayer consisted of alcohol-fixed or irradiated WI38 cells. In this case spreading on top of the treated fibroblasts resembled the concentric spreading seen on glass or plastic. This was in contrast to the spreading on untreated cells where the tumor cells became more or less spindle shaped. Moreover, the HeLa cells appeared to be less mobile and destruction of the monolayer was never observed. From all this we concluded: i: HeLa 1 and HeLa S cells have more than one attachment mechanism. ii: the spreading behavior is strongly influenced by the underlying support. iii: the upper cell surface of fibroblasts supports the spreading and movement of other cell types. iv: movement of HeLa cells and consequently the destruction of the monolayer is promoted by the intact fibroblasts. PMID:4085498

  15. Highly transparent and conductive indium tin oxide thin films for solar cells grown by reactive thermal evaporation at low temperature

    NASA Astrophysics Data System (ADS)

    Du, Jian; Chen, Xin-liang; Liu, Cai-chi; Ni, Jian; Hou, Guo-fu; Zhao, Ying; Zhang, Xiao-dan


    Transparent conductive tin-doped indium oxide (In2O3:Sn, ITO) thin films with various Sn-doping concentrations have been prepared using the low cost reactive thermal evaporation (RTE) technique at a low growth temperature of ~160 °C. The structural characteristics, optical and electrical properties of the ITO thin films were investigated. These polycrystalline ITO films exhibited preferential orientation along (222) plane and possessed low resistivities ranging from 3.51 to 5.71 × 10-4 Ω cm. The decreased mobility was attributed to the scattering by ionized and neutral impurities at high doping concentrations. The optimized ITO thin film deposited with 6.0 wt% Sn-doping concentration exhibited a high average transparency of 87 % in the wavelength range of 380-900 nm and a low resistivity of 3.74 × 10-4 Ω cm with a high Hall mobility of 47 cm2 V-1s-1. A hydrogenated amorphous silicon and silicon-germanium (a-Si:H/a-SiGe:H) double-junction solar cell fabricated with the RTE-grown ITO electrodes presented a conversion efficiency of 10.51 %.

  16. An outbreak of Vero cytotoxin producing Escherichia coli O157 infection associated with takeaway sandwiches.


    McDonnell, R J; Rampling, A; Crook, S; Cockcroft, P M; Wilshaw, G A; Cheasty, T; Stuart, J


    An outbreak of food poisoning due to Escherichia coli O157 phage type 2 Vero cytotoxin 2 affected 26 people in southern counties of England in May and June 1995. The organism was isolated from faecal specimens from 23 patients, 16 of whom lived in Dorset and seven in Hampshire. Isolates were indistinguishable by phage typing, Vero cytotoxin gene typing, restriction fragment length polymorphism, and pulsed field gel electrophoresis. Three associated cases, linked epidemiologically to the outbreak, were confirmed serologically by detection of antibodies to E. coli O157 lipopolysaccharide. Twenty-two of the 26 patients were adults: four were admitted to hospital with haemorrhagic colitis. Four cases were children: two were admitted to hospital with haemolytic uraemic syndrome (HUS). There were no deaths. Although E. coli O157 was not isolated from any food samples, illness was associated with having eaten cold meats in sandwiches bought from two sandwich producers, in Weymouth and in Portsmouth. Both shops were supplied by the same wholesaler, who kept no records and obtained cooked meats from several sources in packs that did not carry adequate identification marks. It was, therefore, impossible to trace back to the original producer or to investigate further to determine the origin of contamination with E. coli O157. To protect the public health it is essential that all wholesale packs of ready-to-eat food carry date codes and the producer's identification mark. Detailed record keeping should be part of hazard analysis critical control point (HACCP) systems and should be maintained throughout the chain of distribution from the producer to retail outlets. PMID:9447785

  17. Superparamagnetic iron oxide nanoparticles exert different cytotoxic effects on cells grown in monolayer cell culture versus as multicellular spheroids

    NASA Astrophysics Data System (ADS)

    Theumer, Anja; Gräfe, Christine; Bähring, Franziska; Bergemann, Christian; Hochhaus, Andreas; Clement, Joachim H.


    The aim of this study was to investigate the interaction of superparamagnetic iron oxide nanoparticles (SPION) with human blood-brain barrier-forming endothelial cells (HBMEC) in two-dimensional cell monolayers as well as in three-dimensional multicellular spheroids. The precise nanoparticle localisation and the influence of the NP on the cellular viability and the intracellular Akt signalling were studied in detail. Long-term effects of different polymer-coated nanoparticles (neutral fluidMAG-D, anionic fluidMAG-CMX and cationic fluidMAG-PEI) and the corresponding free polymers on cellular viability of HBMEC were investigated by real time cell analysis studies. Nanoparticles exert distinct effects on HBMEC depending on the nanoparticles' surface charge and concentration, duration of incubation and cellular context. The most severe effects were caused by PEI-coated nanoparticles. Concentrations above 25 μg/ml led to increased amounts of dead cells in monolayer culture as well as in multicellular spheroids. On the level of intracellular signalling, context-dependent differences were observed. Monolayer cultures responded on nanoparticle incubation with an increase in Akt phosphorylation whereas spheroids on the whole show a decreased Akt activity. This might be due to the differential penetration and distribution of PEI-coated nanoparticles.

  18. Expression and subcellular location of the tetrapyrrole synthesis enzyme porphobilinogen deaminase in light-grown Euglena gracilis and three nonchlorophyllous cell lines.


    Shashidhara, L S; Smith, A G


    The expression and subcellular location of porphobilinogen deaminase (PBGD, also known as hydroxymethylbilane synthase; EC, one of the early enzymes of porphyrin synthesis, was investigated in light-grown Euglena and in three cell lines that do not contain chlorophyll: dark-grown Euglena, a streptomycin-bleached mutant, and Astasia longa. In wild-type Euglena, immunogold electron microscopy demonstrated that all the immunodetectable enzyme protein was in the chloroplast. PBGD was shown to be photoregulated, and like many other nuclear-encoded proteins in Euglena, the regulation was at the posttranscriptional level. In the three nonchlorophyllous cell lines, as in light-grown Euglena, a single protein of 40 kDa was detected with antiserum to PBGD. This same antiserum immunoprecipitated a larger precursor protein from the total translation products of poly(A)+ RNA, and a single transcript, which was large enough to encode the precursor, was detected on Northern blots of all four cell types. Therefore, in cells that make chlorophyll and those that do not (or cannot), PBGD is located in the plastid. No evidence was obtained for another form of the enzyme, which suggests that in Euglena there is only one pathway for the synthesis of the tetrapyrrole moiety of chlorophyll and heme. PMID:11607141

  19. SU-E-J-129: A Strategy to Consolidate the Image Database of a VERO Unit Into a Radiotherapy Management System

    SciTech Connect

    Yan, Y; Medin, P; Yordy, J; Zhao, B; Jiang, S


    Purpose: To present a strategy to integrate the imaging database of a VERO unit with a treatment management system (TMS) to improve clinical workflow and consolidate image data to facilitate clinical quality control and documentation. Methods: A VERO unit is equipped with both kV and MV imaging capabilities for IGRT treatments. It has its own imaging database behind a firewall. It has been a challenge to transfer images on this unit to a TMS in a radiation therapy clinic so that registered images can be reviewed remotely with an approval or rejection record. In this study, a software system, iPump-VERO, was developed to connect VERO and a TMS in our clinic. The patient database folder on the VERO unit was mapped to a read-only folder on a file server outside VERO firewall. The application runs on a regular computer with the read access to the patient database folder. It finds the latest registered images and fuses them in one of six predefined patterns before sends them via DICOM connection to the TMS. The residual image registration errors will be overlaid on the fused image to facilitate image review. Results: The fused images of either registered kV planar images or CBCT images are fully DICOM compatible. A sentinel module is built to sense new registered images with negligible computing resources from the VERO ExacTrac imaging computer. It takes a few seconds to fuse registered images and send them to the TMS. The whole process is automated without any human intervention. Conclusion: Transferring images in DICOM connection is the easiest way to consolidate images of various sources in your TMS. Technically the attending does not have to go to the VERO treatment console to review image registration prior delivery. It is a useful tool for a busy clinic with a VERO unit.

  20. Interface enhanced superconductivity in one unit-cell FeSe films grown on SrTiO3

    NASA Astrophysics Data System (ADS)

    Ma, Xucun


    Heterostructure based interface engineering has been proved an effective method for finding new superconducting systems and raising superconducting transition temperature (Tc). Recently discovered high temperature superconductivity in one unit-cell (UC) FeSe films on SrTiO3 (STO) substrate grown by molecular beam epitaxy has attracted intensive attention. In sharp contrast to FeSe films on graphene where a 2.2 meV superconducting gap is observed on thick films and no superconducting gap on 1-UC FeSe down to 2.3 K, 1-UC FeSe films on STO substrate exhibit unexpected large superconducting gaps of 15-20 meV. Interestingly, the anomalously large superconducting gap is only found in the first UC FeSe but not on 2-UC or thicker layers, indicating that interface plays a crucial role in the enhanced superconductivity in 1-UC FeSe films on STO substrate. Another interesting point of this system is its simple band structure that consists only of electron Fermi pockets at M points, which is different from that of bulk FeSe. In this talk, a comprehensive study of 1-UC FeSe films by in situ scanning tunneling microscopy/spectroscopy (STM/STS) and angle-resolved photoemission spectroscopy (ARPES) and ex situ transport measurements will be presented to discuss the possible superconducting mechanism in this well-defined heterostructure. Collaborators: Qi-Kun Xue, Lili Wang, Yayu Wang (Tsinghua University); Xingjiang Zhou (Institute of Physics, CAS); Jian Wang (Peking University)

  1. Expression Profile of Drug and Nutrient Absorption Related Genes in Madin-Darby Canine Kidney (MDCK) Cells Grown under Differentiation Conditions

    PubMed Central

    Quan, Yong; Jin, Yisheng; Faria, Teresa N.; Tilford, Charles A.; He, Aiqing; Wall, Doris A.; Smith, Ronald L.; Vig, Balvinder S.


    The expression levels of genes involved in drug and nutrient absorption were evaluated in the Madin-Darby Canine Kidney (MDCK) in vitro drug absorption model. MDCK cells were grown on plastic surfaces (for 3 days) or on Transwell® membranes (for 3, 5, 7, and 9 days). The expression profile of genes including ABC transporters, SLC transporters, and cytochrome P450 (CYP) enzymes was determined using the Affymetrix® Canine GeneChip®. Expression of genes whose probe sets passed a stringent confirmation process was examined. Expression of a few transporter (MDR1, PEPT1 and PEPT2) genes in MDCK cells was confirmed by RT-PCR. The overall gene expression profile was strongly influenced by the type of support the cells were grown on. After 3 days of growth, expression of 28% of the genes was statistically different (1.5-fold cutoff, p < 0.05) between the cells grown on plastic and Transwell® membranes. When cells were differentiated on Transwell® membranes, large changes in gene expression profile were observed during the early stages, which then stabilized after 5–7 days. Only a small number of genes encoding drug absorption related SLC, ABC, and CYP were detected in MDCK cells, and most of them exhibited low hybridization signals. Results from this study provide valuable reference information on endogenous gene expression in MDCK cells that could assist in design of drug-transporter and/or drug-enzyme interaction studies, and help interpret the contributions of various transporters and metabolic enzymes in studies with MDCK cells. PMID:24300234

  2. Changes of ribulose bisphosphate carboxylase/oxygenase content, ribulose bisphosphate concentration, and photosynthetic activity during adaptation of high-CO/sub 2/ grown cells to low-CO/sub 2/ conditions in Chlorella pyrenoidosa

    SciTech Connect

    Yokota, A.; Canvin, D.T.


    Changes of some photosynthetic properties of high-CO/sub 2/ grown cells of Chlorella pyrenoidosa during adaptation to low-CO/sub 2/ conditions have been investigated. The K/sub m/ value of photosynthesis of the high-CO/sub 2/ grown cells for dissolved inorganic carbon was 3.3 millimolar and decreased to 25 to 30 micromolar within 4 hours after transferring to air. In the presence of saturating CO/sub 2/ concentrations the photosynthetic activity of the high-CO/sub 2/ grown cells was 1.5 times as high as that of the low-CO/sub 2/ grown cells. There was a significant rise of the photosynthetic activity during adaptation of the high-CO/sub 2/ grown cells to air, followed by a steady decrease. The activity of ribulose 1,5-bisphosphate carboxylase/oxygenase in both the high and low-CO/sub 2/ grown cells was close to the photosynthetic activity of the cells. The concentration of ribulose 1,5-bisphosphate (RuBP) was higher in the low-CO/sub 2/ adapting and low-CO/sub 2/ grown celsl than in the high-CO/sub 2/ grown cells regardless of the photosynthetic rate. This seems to be due to an increased RuBP regeneration activity during adaptation followed by maintenance of the new higher concentration. The RuBP level always exceeded the concentration of ribulose 1,5-bisphosphate carboxylase/oxygenase RuBP binding sites in both the high- and low-CO/sub 2/ grown cells at any dissolved inorganic carbon concentration.

  3. A multiple p-n junction structure obtained from as-grown Czochralski silicon crystals by heat treatment - Application to solar cells

    NASA Technical Reports Server (NTRS)

    Chi, J. Y.; Gatos, H. C.; Mao, B. Y.


    Multiple p-n junctions have been prepared in as-grown Czochralski p-type silicon through overcompensation near the oxygen periodic concentration maxima by oxygen thermal donors generated during heat treatment at 450 C. Application of the multiple p-n-junction configuration to photovoltaic energy conversion has been investigated. A new solar-cell structure based on multiple p-n-junctions was developed. Theoretical analysis showed that a significant increase in collection efficiency over the conventional solar cells can be achieved.

  4. Magnesium doping of efficient GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition

    NASA Technical Reports Server (NTRS)

    Lewis, C. R.; Ford, C. W.; Werthen, J. G.


    Magnesium has been substituted for zinc in GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition (MOCVD). Bis(cyclopentadienyl)magnesium (Cp2Mg) is used as the MOCVD transport agent for Mg. Full retention of excellent material quality and efficient cell performance results. The substitution of Mg for Zn would enhance the abruptness and reproducibility of doping profiles, and facilitate high temperature processing and operation, due to the much lower diffusion coefficient of Mg, relative to Zn, in these materials.

  5. Vero cytotoxin-producing Escherichia coli O157 outbreaks in England and Wales, 1995: phenotypic methods and genotypic subtyping.

    PubMed Central

    Willshaw, G. A.; Smith, H. R.; Cheasty, T.; Wall, P. G.; Rowe, B.


    Vero cytotoxin-producing Escherichia coli O157 belonging to four phage types (PTs) caused 11 outbreaks of infection in England and Wales in 1995. Outbreak strains of different PTs were distinguishable by DNA-based methods. Pulsed-field gel electrophoresis best discriminated among strains belonging to the same PT, distinguishing six of the seven PT2 outbreak strains and both PT49 outbreak strains. PMID:9366610

  6. InGaAs/GaAsP superlattice solar cells with reduced carbon impurity grown by low-temperature metal-organic vapor phase epitaxy using triethylgallium

    NASA Astrophysics Data System (ADS)

    Fujii, Hiromasa; Toprasertpong, Kasidit; Sodabanlu, Hassanet; Watanabe, Kentaroh; Sugiyama, Masakazu; Nakano, Yoshiaki


    In this paper, we investigated the effects of carbon incorporation on photovoltaic performance of InGaAs/GaAsP superlattice (SL) solar cells grown by low-temperature MOVPE (LT-MOVPE), which is required for stable SL growth on vicinal substrates. Using trimethylgallium (TMGa) as the gallium precursor, methyl radicals formed by its pyrolysis tend to be absorbed on the surface at low temperature, causing severe carbon incorporation and p-type background doping. High background carrier concentration flattens the band-lineup of the intrinsic region and blocks the carrier transport across the SLs, and resulted in serious degradation of photocurrent. Intentional sulfur doping to cancel out the background doping and hence to recover the built-in field greatly improved the cell performance, but was found to require very precise control of doping level to achieve an exact compensation doping condition. Use of triethylgallium (TEGa) instead of TMGa much reduced the carbon incorporation at low temperature and significantly enhanced the photocurrent extraction without sulfur doping treatment. By thinning GaAsP barriers to 3 nm to facilitate efficient tunneling transport, a 50-period SL cell with bandgap of 1.22 eV grown on 6°-miscut substrates achieved 1.13 times higher efficiency with 31% current enhancement as middle cell performance than a GaAs reference cell.

  7. ZnO nanowires array grown on Ga-doped ZnO single crystal for dye-sensitized solar cells.


    Hu, Qichang; Li, Yafeng; Huang, Feng; Zhang, Zhaojun; Ding, Kai; Wei, Mingdeng; Lin, Zhang


    High quality ZnO nanowires arrays were homoepitaxial grown on Ga-doped ZnO single crystal (GZOSC), which have the advantages of high conductivity, high carrier mobility and high thermal stability. When it was employed as a photoanode in the DSSCs, the cell exhibited a 1.44% power-conversion efficiency under the illumination of one sun (AM 1.5G). The performance is superior to our ZnO nanowires/FTO based DSSCs under the same condition. This enhanced performance is mainly attributed to the perfect interface between the ZnO nanowires and the GZOSC substrate that contributes to lower carrier scattering and recombination rates compared with that grown on traditional FTO substrate. PMID:26099568

  8. Opsonization of Toxoplasma gondii tachyzoites with nonspecific immunoglobulins promotes their phagocytosis by macrophages and inhibits their proliferation in nonphagocytic cells in tissue culture.


    Vercammen, M; Scorza, T; El Bouhdidi, A; Van Beeck, K; Carlier, Y; Dubremetz, J F; Verschueren, H


    We have recently shown that Toxoplasma gondii tachyzoites grown in in vitro culture can bind unspecific immunoglobulin (Ig) through their Fc moiety. We show now that Fc receptors are also present on T. gondii within the host animal, and that intraperitoneal parasites in immunocompetent mice are saturated with unspecific Ig. We have also investigated the effect of the parasite's Fc receptor on the interaction of tachyzoites with mammalian cells, using the Vero cell line as a model for nonphagocytic host cells and murine peritoneal macrophages in primary culture as a model for phagocytic cells. Coating of tachyzoites with parasite-unrelated Ig did not enhance their invasive capacity in either target cell type, but slightly decreased the parasite proliferation. Moreover, phagocytosis by macrophages was increased by approximately 50% when parasites were coated with unspecific Ig. These results indicate that the Fc receptor on T. gondii affects the balance between invasion and phagocytosis in a way that is detrimental to the parasites. PMID:10583856

  9. The gene expression profiles of canine mammary cancer cells grown with carcinoma-associated fibroblasts (CAFs) as a co-culture in vitro

    PubMed Central


    Background It is supposed that fibroblasts present in tumour microenvironment increase cancer invasiveness and its ability to metastasize but the mechanisms have not been clearly defined yet. Thus, the current study was designed to assess changes in gene expression in five various cancer cell lines grown as a co-culture with the carcinoma-associated fibroblasts (CAFs) in vitro. Results A carcinoma-associated fibroblast cell line was isolated from a canine mammary cancer. Then, a co-culture of cancer cells with the CAFs was established and maintained for 72 hrs. Having sorted the cells, a global gene expression in cancer cells using DNA microarrays was examined. The analysis revealed an up-regulation of 100 genes and a down-regulation of 106 genes in the cancer cells grown as a co-culture with the CAFs in comparison to control conditions. The PANTHER binomial statistics tool was applied to determine statistically over-manifested pathways (p < 0.05). Bulk of the up-regulated genes are involved in the adhesion, the angiogenesis, the epithelial-mesenchymal transition (EMT) and generally take part in the developmental processes. These results were further confirmed using real-time qPCR. Moreover, a wound-healing assay and growth characteristics on Matrigel matrix showed that CAFs increase cancer cell migration and matrix invasion. Conclusion The results of the current study showed that the co-culturing of cancer cells and the CAFs caused significant changes to the cancer gene expression. The presence of the CAFs in a microenvironment of cancer cells promotes adhesion, angiogenesis and EMT. PMID:22453032

  10. Effects of buffer layer and back-surface field on MBE-grown InGaAsP/InGaAs solar cells

    NASA Astrophysics Data System (ADS)

    Wu, Yuanyuan; Ji, Lian; Dai, Pai; Tan, Ming; Lu, Shulong; Yang, Hui


    Solid-state molecular beam epitaxy (MBE)-grown InGaAsP/InGaAs dual-junction solar cells on InP substrates are reported. An efficiency of 10.6% under 1-sun AM1.5 global light intensity is realized for the dual-junction solar cell, while the efficiencies of 16.4 and 12.3% are reached for the top InGaAsP and bottom InGaAs cells, respectively. The effects of the buffer layer and back-surface field on the performance of solar cells are discussed. High device performance is achieved in the case of a low concentration of oxygen and weak recombination when InGaAs buffers and InP back-surface field layers are used, respectively.

  11. Loss of capacity for acid-induced wall loosening as the principal cause of the cessation of cell enlargement in light-grown bean leaves.


    Van Volkenburgh, E; Schmidt, M G; Cleland, R E


    Cell enlargement in primary leaves of bean (Phaseolus vulgaris L.) can be induced, free of cell divisions, by exposure of 10-d-old, red-light-grown seedlings to white light. The absolute rate of leaf expansion increases until day 12, then decreases until the leaves reached mature size on day 18. The cause of the reduction in growth rate following day 12 has been investigated. Turgor calculated from measurements of leaf water and osmotic potential fell from 6.5 to 3.5 bar before day 12, but remained constant thereafter. The decline of growth after day 12 is not caused by a decrease in turgor. On the other hand, Instron-measured cell-wall extensibility decreased in parallel with growth rate after day 12. Two parameters influencing extensibility were examined. Light-induced acidification of cell walls, which has been shown to initiate wall extension, remained constant over the growth period (days 10-18). Furthermore, cells of any age could be stimulated to excrete H(+) by fusicoccin. However, older tissue was not able to grow in response to fusicoccin or light. Measurements of acid-induced extension on preparations of isolated cell walls showed that as cells matured, the cell walls became less able to extend when acidified. These data indicate that it is a decline in the capacity for acid-induced wall loosening that reduces wall extensibility and thus cell enlargement in maturing leaves. PMID:24249449

  12. Fabrication of hydrogenated amorphous Si/crystalline Si1-xGex (x ? 0.84) heterojunction solar cells grown by solid source molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Oshima, Ryuji; Yamanaka, Mitsuyuki; Kawanami, Hitoshi; Sakata, Isao; Matsubara, Koji; Sugaya, Takeyoshi


    We characterized hydrogenated amorphous Si/single-crystalline Si1-xGex heterojunction solar cells grown on Si substrates with Ge content (x) between 0.49 and 0.84 in an effort to develop materials with a bandgap range of 0.9-1.0 eV for solar applications. We showed that 3-m-thick Si0.16Ge0.84 films grown by molecular-beam epitaxy on a virtual substrate composed of buffer layers with stepwise gradation of their composition have an almost fully strain-relaxed condition and a low dislocation density, less than 105 cm-2. An absorption edge extending up to 1300 nm and an increased quantum efficiency were observed in Si1-xGex cells with x = 0.49, 0.70, and 0.84. Consequently, the short-circuit current density increased non-linearly with Ge content, being 14.0 and 24.0 mA/cm2 for 3-m-thick Si and Si0.16Ge0.84 cells, respectively.

  13. Cellular response to the deposition of diesel exhaust particle aerosols onto human lung cells grown at the air-liquid interface by inertial impaction.


    Cooney, Daniel J; Hickey, Anthony J


    The pathogenesis of disease resulting from exposure to diesel exhaust particles (DEP) is often studied using cultured lung cells. Frequently, researchers expose cells to DEP by spiking a suspension of particles in liquid onto the apical surface. This is not representative of in vivo exposure, where aerosols are deposited onto cell surfaces at the air-liquid interface (ALI). Inertial impaction provides an opportunity to deliver high doses of particles with aerodynamic diameters>∼1 μm to the surface of cells in seconds in a reproducible and predictable manner. A custom device was constructed to deposit DEP aerosols onto the surface of Calu-3 and A549 cells grown at the ALI. The pro-inflammatory and toxic cellular response to exposure to the deposited DEP aerosols was measured and compared to the response of cells exposed to DEP as suspensions. Calu-3 cells showed evidence of an oxidative stress response for both exposure types, while there was strong evidence to suggest that the method of aerosol delivery was harmful to the A549 cells. PMID:21756993

  14. Comparison of single junction AlGaInP and GaInP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Masuda, T; Tomasulo, S; Lang, JR; Lee, ML


    We have investigated similar to 2.0 eV (AlxGa1-x)(0.51)In0.49P and similar to 1.9 eV Ga0.51In0.49P single junction solar cells grown on both on-axis and misoriented GaAs substrates by molecular beam epitaxy (MBE). Although lattice-matched (AlxGa1-x)(0.51)In0.49P solar cells are highly attractive for space and concentrator photovoltaics, there have been few reports on the MBE growth of such cells. In this work, we demonstrate open circuit voltages (V-oc) ranging from 1.29 to 1.30 V for Ga0.51In0.49P cells, and 1.35-1.37 V for (AlxGa1-x)(0.51)In0.49P cells. Growth on misoriented substrates enabled the bandgap-voltage offset (W-oc = E-g/q - V-oc) of Ga0.51In0.49P cells to decrease from similar to 575 mV to similar to 565 mV, while that of (AlxGa1-x)(0.51)In0.49P cells remained nearly constant at 620 mV. The constant Woc as a function of substrate offcut for (AlxGa1-x)(0.51)In0.49P implies greater losses from non-radiative recombination compared with the Ga0.51In0.49P devices. In addition to larger Woc values, the (AlxGa1-x)(0.51)In0.49P cells exhibited significantly lower internal quantum efficiency (IQE) values than Ga0.51In0.49P cells due to recombination at the emitter/window layer interface. A thin emitter design is experimentally shown to be highly effective in improving IQE, particularly at short wavelengths. Our work shows that with further optimization of both cell structure and growth conditions, MBE-grown (AlxGa1-x)(0.51)In0.49P will be a promising wide-bandgap candidate material for high-efficiency, lattice-matched multi-junction solar cells. (C) 2015 AIP Publishing LLC.

  15. Significant changes in cell and chloroplast development in young wheat leaves (Triticum aestivum cv Hereward) grown in elevated CO{sub 2}

    SciTech Connect

    Robertson, E.J.; Leech, R.M.


    Cell and chloroplast development were characterized in young Triticum aestivum cv Hereward leaves grown at ambient (350 {mu}L L{sup {minus}1}) or at elevated (650 {mu}L L{sup {minus}1}) CO{sub 2}. In elevated CO{sub 2}, cell and chloroplast expansion was accelerated by 10 and 25%, respectively, in the first leaf of 7-d-old wheat plants without disruption to the leaf developmental pattern. Elevated CO{sub 2} did not affect the number of chloroplasts in relation to mesophyll cell size or the linear relationship between chloroplast number or size and mesophyll cell size. No major changes in leaf anatomy or in chloroplast ultrastructure were detected as a result of growth in elevated CO{sub 2}, but there was a marked reduction in starch accumulation. In leaf sections fluorescently tagged antisera were used to visualize and quantitate the amount of cytochrome f, the {alpha}- and {beta}-subunits of the coupling factor 1 in ATP synthase, D1 protein of the photosystem II reaction center, the 33-kD protein of the extrinsic oxygen-evolving complex, subunit II of photosystem I, and ribulose-1,5-biphosphate carboxylase/oxygenase. A significant finding was that in 10 to 20% of the mesophyll cells grown in elevated CO{sub 2} the 33-kD protein of the extrinsic oxygen-evolving complex of photosystem II and cytochrome f were deficient by 75%, but the other proteins accumulated normally. 29 refs., 6 figs., 2 tabs.

  16. MBE-grown InGaAsP solar cells with 1.0 eV bandgap on InP(001) substrates for application to multijunction solar cells

    NASA Astrophysics Data System (ADS)

    Oshima, Ryuji; Makita, Kikuo; Mizuno, Hidenori; Takato, Hidetaka; Matsubara, Koji; Sugaya, Takeyoshi


    In this study, we have developed the first ever solid-source molecular beam epitaxy (SS-MBE)-grown In0.81Ga0.19As0.43P0.57/In0.47Ga0.53As dual-junction solar cells grown on InP substrates with a 1.0/0.7 eV bandgap for use in mechanically stacked multijunction solar cells. We studied the adsorption efficiencies of As2 and P2 to determine the optimal parameters for the growth of lattice-matched In0.81Ga0.19As0.43P0.57 by SS-MBE. The adsorption efficiency of As2 was found to be seven times greater than that of P2, and lattice-matched In0.81Ga0.19AsyP1-y (y = 0.43) can be achieved at a PAs/(PP + PAs) ratio of ˜0.10. Then, we studied the effect of growth temperature on the characteristics of lattice-matched In0.81Ga0.19As0.43P0.57 single-junction solar cells. The open-circuit voltage (VOC) was found to be greatly affected by the growth temperature, and the highest VOC = 0.47 V (efficiency η = 10.5%) was obtained for cells grown at 440 °C. On the other hand, photoluminescence intensity measured for these cells at room temperature monotonically increased with an increase in the growth temperature, which implies that the reduction in VOC for the cells grown at 400 and 420 °C was due to the increase in the intrinsic defects and unexpected contaminations. By contrast, the reduction in VOC for the cell grown at 450 °C is presumably attributed to an increase in local compositional fluctuations. We integrated the abovementioned In0.81Ga0.19As0.43P0.57 top cell with the In0.47Ga0.53As bottom cell and an η of 3.7% was obtained using an 880-nm-long pass filter.

  17. Properties of Retinal Precursor Cells Grown on Vertically Aligned Multiwalled Carbon Nanotubes Generated for the Modification of Retinal Implant-Embedded Microelectrode Arrays

    PubMed Central

    Johnen, Sandra; Meißner, Frank; Krug, Mario; Baltz, Thomas; Endler, Ingolf; Mokwa, Wilfried; Walter, Peter


    Background. To analyze the biocompatibility of vertically aligned multiwalled carbon nanotubes (MWCNT), used as nanomodification to optimize the properties of prostheses-embedded microelectrodes that induce electrical stimulation of surviving retinal cells. Methods. MWCNT were synthesized on silicon wafers. Their growth was achieved by iron particles (Fe) or mixtures of iron-platinum (Fe-Pt) and iron-titanium (Fe-Ti) acting as catalysts. Viability, growth, adhesion, and gene expression of L-929 and retinal precursor (R28) cells were analyzed after nondirect and direct contact. Results. Nondirect contact had almost no influence on cell growth, as measured in comparison to reference materials with defined levels of cytotoxicity. Both cell types exhibited good proliferation properties on each MWCNT-coated wafer. Viability ranged from 95.9 to 99.8%, in which better survival was observed for nonfunctionalized MWCNT generated with the Fe-Pt and Fe-Ti catalyst mixtures. R28 cells grown on the MWCNT-coated wafers showed a decreased gene expression associated with neural and glial properties. Expression of the cell cycle-related genes CCNC, MYC, and TP53 was slightly downregulated. Cultivation on plasma-treated MWCNT did not lead to additional changes. Conclusions. All tested MWCNT-covered slices showed good biocompatibility profiles, confirming that this nanotechnology is a promising tool to improve prostheses bearing electrodes which connect with retinal tissue. PMID:27200182

  18. Factors derived from Escherichia coli Nissle 1917, grown in different growth media, enhance cell death in a model of 5-fluorouracil-induced Caco-2 intestinal epithelial cell damage.


    Wang, Hanru; Bastian, Susan E P; Lawrence, Andrew; Howarth, Gordon S


    We evaluated supernatants (SNs) from Escherichia coli Nissle 1917 (EcN) grown in commonly used growth media for their capacity to affect the viability of Caco-2 colon cancer cells in the presence and absence of 5-Fluorouracil (5-FU) chemotherapy. EcN was grown in Luria-Bertani (LB), tryptone soya (TSB), Man Rogosa Sharpe (MRS), and M17 broth supplemented with 10% (v/v) lactose solution (M17). Human Caco-2 colon cancer cells were treated with DMEM (control), growth media alone (LB, TSB, MRS, and M17) or EcN SNs derived from these 4 media, in the presence and absence of 5-FU. Cell viability, reactive oxygen species (ROS), and cell monolayer permeability were determined. EcN SN in LB medium reduced Caco-2 cell viability significantly, to 51% at 48 h. The combination of this EcN SN and 5-FU further reduced cell viability to 37% at 48 h, compared to 5-FU control. MRS broth and EcN SN in MRS, together with 5-FU, generated significantly lower levels of ROS compared to 5-FU control. However, all 5-FU treatments significantly disrupted the Caco-2 cell barrier compared to control; with no significant differences observed among any of the 5-FU treatments. EcN SNs (LB+) was most effective at decreasing the viability of Caco-2 cells. This could indicate a potential role for this EcN SN in chemoprevention for colon cancer. PMID:25625670


    EPA Science Inventory

    Human lung epithelial cells have been cultured and characterized for phospholipid content. Any residual fibroblasts were removed by selective trypsinization within the first 48 hours in culture. Epithelial cells were serially subpassaged when cultures reached ca. 80% confluency. ...

  20. A novel approach to determining the affinity of protein-carbohydrate interactions employing adherent cancer cells grown on a biosensor surface.


    Peiris, Diluka; Markiv, Anatoliy; Curley, G Paul; Dwek, Miriam V


    The development of biological agents for the treatment of solid tumours is an area of considerable activity. We are pursuing carbohydrate-binding proteins (lectins) in a strategy aimed at targeting cancer-associated changes in glycosylation. To evaluate lectin-cancer cell interactions we developed a novel cell biosensor in which binding events take place at the cell surface, more closely mimicking an in vivo system. Metastatic, SW620, and non-metastatic, SW480, colorectal cancer cells were grown on the surface of a tissue-culture compatible polystyrene coated biosensor chip and housed in a quartz crystal microbalance (QCM) apparatus, the kinetics of binding of a diverse range of lectins was evaluated. The lectin Helix pomatia agglutinin (HPA) has been shown to bind aggressive metastatic cancer and was produced in recombinant form (His- and RFP-tagged). The affinity of HPA was in the nanomolar range to the metastatic SW620 cells but was only in the micromolar range to the non-metastatic SW480. Overall, the dissociation constant (K(D)) of the lectins tested in the new cell biosensor system was an order of magnitude lower (nanomolar range) than has generally been reported with systems such as QCM/SPR. This new cell-biosensor enables molecular interactions to be studied in a more relevant environment. An intrinsic problem with developing new biological therapies is the difficulty in determining the affinity with which proteins will interact with intact cell surfaces. This methodology will be of interest to researchers developing new biological approaches for targeting cell surfaces in a wide range of diseases, including cancer. PMID:22424753

  1. Effect of temperature and pH on ethanol production by free and immobilized cells of Kluyveromyces marxianus grown on Jerusalem artichoke extract

    SciTech Connect

    Bajpai, P.; Margaritis, A.


    The effect of temperature and pH on the kinetics of ethanol production by free and calcium alginate immobilized cells of Kluyveromyces marxianus grown on Jerusalem artichoke extract was investigated. With the free cells, the ethanol and biomass yields were relatively constant over the temperature range 25-35 degrees C, but dropped sharply beyond 35 degrees C. Other kinetic parameters, specific growth rate, specific ethanol production rate, and specific total sugar uptake rate were maximum at 35 degrees C. However, with the immobilized cells, ethanol yield remained almost constant in the temperatue range 25-45 degrees C, and the specific ethanol production rate and specific total sugar uptake rate attained their maximum values at 40 degrees C. For the pH range between 3 and 7, the free-cell optimum for growth and product formation was found to be circa pH 5. At this pH, the specific growth rate was 0.35/h and specific ethanol production rate was 2.83 g/g/h. At values higher or lower than pH 5, a sharp decrease in specific ethanol production rate as well as specific growth rate was observed. In comparison, the immobilized cells showed a broad optimum pH profile. The best ethanol production rates were observed between pH 4 and 6. (Refs. 22).

  2. Differences in carbohydrate profiles in batch culture grown planktonic and biofilm cells of Amphora rostrata Wm. Sm.


    Khodse, Vishwas B; Bhosle, Narayan B


    Diatoms are abundant in biofilms developed on surfaces immersed in sunlit waters. In both the planktonic and the biofilm mode of growth, diatoms produce carbohydrate polymers which perform several functions including motility, protection, production of macro-aggregates and detoxification. However, little is known about the differences, if any, in the production and characterization at the molecular level of carbohydrates in planktonic and biofilm cells. In order to identify the differences in these two modes of growth, the concentration of total carbohydrates, carbohydrate fractions, neutral carbohydrates, uronic acids and amino sugars in planktonic and biofilm cells of Amphora rostrata were measured. The results showed that the distribution of carbohydrate fractions, uronic acids and amino sugars was different in biofilm and planktonic cells. Cell normalized concentrations of these components were two to five times greater in planktonic cells compared with biofilm cells. The concentrations of glucose and glucosamine decreased, whereas fucose increased in planktonic cells over the period of cultivation. Conversely, the concentrations of glucose and glucosamine increased while that of fucose decreased in attached cells. The study suggests that marked differences exist between the carbohydrates of the planktonic and the biofilm cells of A. rostrata. PMID:20512708

  3. The polyGeVero® software for fast and easy computation of 3D radiotherapy dosimetry data

    NASA Astrophysics Data System (ADS)

    Kozicki, Marek; Maras, Piotr


    The polyGeVero® software package was elaborated for calculations of 3D dosimetry data such as the polymer gel dosimetry. It comprises four workspaces designed for: i) calculating calibrations, ii) storing calibrations in a database, iii) calculating dose distribution 3D cubes, iv) comparing two datasets e.g. a measured one with a 3D dosimetry with a calculated one with the aid of a treatment planning system. To accomplish calculations the software was equipped with a number of tools such as the brachytherapy isotopes database, brachytherapy dose versus distance calculation based on the line approximation approach, automatic spatial alignment of two 3D dose cubes for comparison purposes, 3D gamma index, 3D gamma angle, 3D dose difference, Pearson's coefficient, histograms calculations, isodoses superimposition for two datasets, and profiles calculations in any desired direction. This communication is to briefly present the main functions of the software and report on the speed of calculations performed by polyGeVero®.

  4. Improved Performance of GaInNAs Solar Cells Grown by Molecular-Beam Epitaxy Using Increased Growth Rate Instead of Surfactants

    SciTech Connect

    Ptak, A. J.; France, R.; Jiang, C. S.; Romero, M. J.


    GaInNAs is potentially useful for increasing the conversion efficiency of multijunction solar cells if low photocurrents and photovoltages can be increased. Wide-depletion width devices generate significant photocurrents using an n-i-p structure grown by molecular-beam epitaxy, but these wide depletion widths are only realized in a region of parameter space that leads to rough surface morphologies. Surfactants are effective at reducing the surface roughness, but lead to increased defect densities and changes in the net acceptor or donor concentration. Here, we show that increasing the growth rate of GaInNAs solar cells leads to smooth surfaces without the use of a surfactant, even at high In compositions and substrate temperatures. No degradation in material quality is observed when increasing the growth rate from 1.5 to 3.0 {micro}m/h, but a shunt resistance does appear for the high-growth-rate samples. This shunt is attributed to increased spitting of the Ga cell, leading to an increase in the oval defect density, at the higher effusion cell temperatures used to achieve high growth rates. As with the case of Bi in GaInNAs, increased growth rates also appear to increase the net donor concentration, but it is not clear if these effects have the same cause.

  5. Density and length of stomatal and epidermal cells in "living fossil" trees grown under elevated CO 2 and a polar light regime

    NASA Astrophysics Data System (ADS)

    Ogaya, R.; Llorens, L.; Peñuelas, J.


    During the Cretaceous and early Tertiary, when the climate was warm and the atmospheric CO 2 concentration ([CO 2]) was at least double that of the present-day, polar forests populated high latitude landmasses. We investigated the density and length of stomata and other epidermal cells of two deciduous and three evergreen "living fossil" tree species representative of these ancient forests. These tree species were grown in a simulated Cretaceous high latitude environment at either ambient (400 ppmv) or elevated (800 ppmv) [CO 2] during four years. After 4 years growing at elevated [CO 2], the leaf stomatal density and index (percentage of leaf epidermal cells that are stomata) of these plants were similar to those of their counterparts growing at ambient [CO 2]. While the CO 2 enrichment only modified the stomatal pore length in two of the five studied species, it increased significantly the overall length of the epidermal cells of all the species, reducing their density. These results revealed that leaf epidermal cells of these "living fossil" species were more sensitive than stomata to an experimental doubling of atmospheric CO 2 concentration.

  6. Lipid content and fatty acid composition of green algae Scenedesmus obliquus grown in a constant cell density apparatus

    NASA Technical Reports Server (NTRS)

    Choi, K. J.; Nakhost, Z.; Barzana, E.; Karel, M.


    The lipids of alga Scenedesmus obliquus grown under controlled conditions were separated and fractionated by column and thin-layer chromatography, and fatty acid composition of each lipid component was studied by gas-liquid chromatography (GLC). Total lipids were 11.17%, and neutral lipid, glycolipid and phospholipid fractions were 7.24%, 2.45% and 1.48% on a dry weight basis, respectively. The major neutral lipids were diglycerides, triglycerides, free sterols, hydrocarbons and sterol esters. The glycolipids were: monogalactosyl diglyceride, digalactosyl diglyceride, esterified sterol glycoside, and sterol glycoside. The phospholipids included: phosphatidyl choline, phosphatidyl glycerol and phosphatidyl ethanolamine. Fourteen fatty acids were identified in the four lipid fractions by GLC. The main fatty acids were C18:2, C16:0, C18:3(alpha), C18:1, C16:3, C16:1, and C16:4. Total unsaturated fatty acid and essential fatty acid compositions of the total algal lipids were 80% and 38%, respectively.

  7. Failure of propagation of human norovirus in intestinal epithelial cells with microvilli grown in three-dimensional cultures

    PubMed Central

    Takanashi, Sayaka; Saif, Linda J.; Hughes, John H.; Meulia, Tea; Jung, Kwonil; Scheuer, Kelly A.; Wang, Qiuhong


    Human noroviruses (HuNoVs) are a leading cause of acute gastroenteritis. Establishment of a cell culture system for in vitro HuNoV growth remains challenging. Replication of HuNoVs in human intestinal cell lines (INT-407 and Caco-2) that differentiate to produce microvilli in rotation wall vessel (RWV) three-dimensional cultures has been reported (Straub et al., Emerg Infect Dis 13:396–403 2007, J Water Health 9:225–240 2011, and Water Sci Technol 67:863–868 2013). We used a similar RWV system, intestinal cell lines, and the same (Genogroup [G] I.1) plus additional (GII.4 and GII.12) HuNoV strains to test the system’s reproducibility and to expand the earlier findings. Apical microvilli were observed on the surface of both cell lines by light and electron microscopy. However, none of the cell types tested resulted in productive viral replication of any of the HuNoV strains, as confirmed by plateau or declining viral RNA titers in the supernatants and cell lysates of HuNoV-infected cells, determined by real-time reverse transcription PCR. These trends were the same when culture supplements were added that have been reported to be effective for replication of other fastidious enteric viruses in vitro. Additionally, by confocal microscopy and orthoslice analysis, viral capsid proteins were mainly observed above the actin filament signals, which suggested that the majority of viral antigens were on the cell surface. We conclude that even intestinal cells displaying microvilli were not sufficient to support HuNoV replication under the conditions tested. PMID:23974469

  8. Effects of the aspect ratio on the dye adsorption of ZnO nanorods grown by using a sonochemical method for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Choi, Seok Cheol; Yun, Won Suk; Sohn, Sang Ho; Oh, Sang Jin


    Well-aligned ZnO nanorods for the photoelectrode of dye-sensitized solar cells (DSSCs) were grown via a sonochemical method, and the effects of their aspect ratios on the dye adsorption in DSSCs were studied. The control of the aspect ratio of well-aligned ZnO nanorods was performed by tuning the mole concentration of zinc acetate dehydrate in the range of 0.04-0.06M. The dye amounts adsorbed in the ZnO nanorods were estimated from the UV-Visible absorbance by using the Beer-Lambert law. The efficiency of DSSCs with ZnO nanorods was measured to investigate the effects of the aspect ratio of the ZnO nanorods on the dye adsorption properties. A change in the aspect ratio of the ZnO nanorods was founded to yield a change in their dye adsorption ability, resulting in a change in the efficiency of the DSSCs.

  9. High external quantum efficiency and fill-factor InGaN/GaN heterojunction solar cells grown by NH{sub 3}-based molecular beam epitaxy

    SciTech Connect

    Lang, J. R.; Hurni, C. A.; Cruz, S. C.; Matioli, E.; Speck, J. S.; Neufeld, C. J.; Mishra, U. K.


    High external quantum efficiency (EQE) p-i-n heterojunction solar cells grown by NH{sub 3}-based molecular beam epitaxy are presented. EQE values including optical losses are greater than 50% with fill-factors over 72% when illuminated with a 1 sun AM0 spectrum. Optical absorption measurements in conjunction with EQE measurements indicate an internal quantum efficiency greater than 90% for the InGaN absorbing layer. By adjusting the thickness of the top p-type GaN window contact layer, it is shown that the short-wavelength (<365 nm) quantum efficiency is limited by the minority carrier diffusion length in highly Mg-doped p-GaN.

  10. The light intensity under which cells are grown controls the type of peripheral light-harvesting complexes that are assembled in a purple photosynthetic bacterium

    SciTech Connect

    Brotosudarmo, Tatas H. P.; Collins, Aaron M.; Gall, Andrew; Roszak, Aleksander W.; Gardiner, Alastair T.; Blankenship, Robert E.; Cogdell, Richard J.


    The differing composition of LH2 (peripheral light-harvesting) complexes present in Rhodopseudomonas palustris 2.1.6 have been investigated when cells are grown under progressively decreasing light intensity. Analysis of the absorption spectra reveals there must be more than two types of LH2 complexes present. Purified HL (high-light) and LL (low-light) LH2 complexes have mixed apoprotein compositions. The HL complexes contain PucABa and PucABb apoproteins. The LL complexes contain PucABa, PucABd and PucBb-only apoproteins. This mixed apoprotein composition can explain their resonance Raman spectra.

  11. Chemical and biological properties of B16 murine melanoma cells grown in defined medium containing bovine serum albumin.


    Banks, J R; Bhavanadan, V P; Davidson, E A


    The addition of 1 percent (w/v) bovine serum albumin (BSA) to the F12 medium utilized for the growth of the B16 melanoma cells significantly stimulated the growth of this cell line. The synthesis of mucopolysaccharides and sialoglycopeptides in this medium is identical with that in Eagle's minimal essential medium with Earle's balanced salt solution supplemented with 2 mM L-glutamine, twice the recommended concentration of vitamins, nonessential amino acids, sodium pyruvate, and 10 percent (v/v) fetal calf serum. Cell volume and morphology did not change significantly, under the different growth conditions and tumorigenicity, as assayed by injection of cultured cells into syngeneic animals, was not decreased. Analysis of the BSA used indicated the presence of a sialoglycoprotein contaminant. This sialoglycoprotein contaminant was present in all lots examined and contains N-acetyl-and N-glycolylneuraminic acid, mannose, galactose, and glucosamine. The sialoglycoprotein can be removed by chromatography on acetate form anion-exchange resin at pH 4.3. F12 media containing the purified BSA plus selenite and the sodium salts of palmitic, oleic, and linoleic acids supported growth of the melanoma cells to the same extent as did the media containing unpurified BSA, indicating that the sialoglycoprotein has no role in sustaining the growth of the cells. PMID:144559

  12. Differences In Early T-Cell Signaling In Cultures Grown In a Rotating Clinostat vs. Static Controls

    NASA Technical Reports Server (NTRS)

    Alexamder. M.; Nelman-Gonzales, M.; Penkala, J.; Sams, C.


    Altered gravity has previously been demonstrated to be a stress that can influence components of the immune system. Specifically, T-cell activation has been shown to be affected by changes in gravity, exhibiting a decrease in proliferative response to in vitro stimulation in microgravity. Subsequent ground based studies utilizing a rotating clinostat to model some of the effects of microgravity have been consistent with earlier flight based experiments. These ground and flight experiments have examined T-cell activation by measuring various responses including production of cytokines, DNA synthesis and the production of various cell surface activation markers. These indicators of T-cell activation were measured anywhere from 4 to 72 hours after stimulation. Prior to the work described here, the initial signaling events in T-cell activation had not been directly examined. The goal of this project was to determine how the process of early signal transduction was affected by growth in a rotating clinostat. Here we directly show a defect in signaling from TCR to MAPK in purified peripheral T-cells activated in the clinostat by OKT3/antiCD28 coated microbeads as compared to static controls.

  13. Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture

    NASA Technical Reports Server (NTRS)

    Gruener, R.; Hoeger, G.


    Cocultured Xenopus neurons and myocytes were subjected to non-vectorial gravity by clinostat rotation to determine if microgravity, during space flights, may affect cell development and communications. Clinorotated cells showed changes consistent with the hypothesis that cell differentiation, in microgravity, is altered by interference with cytoskeleton-related mechanisms. We found: increases in the myocyte and its nuclear area, "fragmentation" of nucleoli, appearance of neuritic "aneurysms", decreased growth in the presence of "trophic" factors, and decreased yolk utilization. The effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. Some parameters returned to near control values within 48 hrs after cessation of rotation. Cells from cultures rotated at higher speeds (>50 rpm) appeared comparable to controls. Compensation by centrifugal forces may account for this finding. Our data are consistent, in principle, with effects on other, flighted cells and suggest that "vector-free" gravity may simulate certain aspects of microgravity. The distribution of acetylcholine receptor aggregates, on myocytes, was also altered. This indicates that brain development, in microgravity, may also be affected.

  14. Cell wall-bound peroxidase activity and lignin formation in azuki bean epicotyls grown under hypergravity conditions.


    Wakabayashi, Kazuyuki; Nakano, Saho; Soga, Kouichi; Hoson, Takayuki


    The effects of accelerated gravity stimuli on the cell wall-bound peroxidase activity and the lignin content were investigated along epicotyls of azuki bean (Vigna angularis) seedlings. The endogenous growth occurred primarily in the upper regions of the epicotyl, but no growth was detected in the middle or basal regions. Hypergravity treatment at 300g for 6h suppressed elongation growth and stimulated lateral expansion of the upper regions. The content of acetyl bromide-soluble lignin increased gradually from the apical to the basal regions of epicotyls. Hypergravity treatment stimulated the increase in the lignin content in epicotyls, particularly in the middle and basal regions. The peroxidase activity in the protein fraction extracted with a high ionic strength buffer from the cell wall preparation also increased gradually toward the basal region, and hypergravity treatment increased the activity in all epicotyl regions. There was a close correlation between the lignin content and the enzyme activity. These results suggest that hypergravity increases the activity of cell wall-bound peroxidase followed by increases of the lignin formation in epicotyl cell walls, which may contribute to increasing the rigidity of cell walls against the gravitational force. PMID:19195738

  15. Comparison of single junction AlGaInP and GaInP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Masuda, Taizo Tomasulo, Stephanie; Lang, Jordan R.; Lee, Minjoo Larry


    We have investigated ∼2.0 eV (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P and ∼1.9 eV Ga{sub 0.51}In{sub 0.49}P single junction solar cells grown on both on-axis and misoriented GaAs substrates by molecular beam epitaxy (MBE). Although lattice-matched (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P solar cells are highly attractive for space and concentrator photovoltaics, there have been few reports on the MBE growth of such cells. In this work, we demonstrate open circuit voltages (V{sub oc}) ranging from 1.29 to 1.30 V for Ga{sub 0.51}In{sub 0.49}P cells, and 1.35–1.37 V for (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells. Growth on misoriented substrates enabled the bandgap-voltage offset (W{sub oc} = E{sub g}/q − V{sub oc}) of Ga{sub 0.51}In{sub 0.49}P cells to decrease from ∼575 mV to ∼565 mV, while that of (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells remained nearly constant at 620 mV. The constant W{sub oc} as a function of substrate offcut for (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P implies greater losses from non-radiative recombination compared with the Ga{sub 0.51}In{sub 0.49}P devices. In addition to larger W{sub oc} values, the (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells exhibited significantly lower internal quantum efficiency (IQE) values than Ga{sub 0.51}In{sub 0.49}P cells due to recombination at the emitter/window layer interface. A thin emitter design is experimentally shown to be highly effective in improving IQE, particularly at short wavelengths. Our work shows that with further optimization of both cell structure and growth conditions, MBE-grown (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P will be a promising wide-bandgap candidate material for high-efficiency, lattice-matched multi-junction solar cells.

  16. Pertubation of beta1 integrin function using anti-sense or function-blocking antibodies on corneal cells grown on fibronectin and tenascin.


    Doane, Kathleen J; Bhattacharya, Raka; Marchant, Jeff


    During corneal development, neural crest derivatives from the periocular mesenchyme migrate into the cornea and differentiate into corneal fibroblasts. During this time, these cells interact with a variety of extracellular matrices for proper orientation and development. In the present studies, we have examined the interaction of beta(1) integrins on periocular mesenchyme cells (POM) and corneal fibroblasts (CF) with fibronectin and tenascin by perturbing the function of this integrin. POM and CF attached and spread to a much greater extent on fibronectin than on tenascin. An antibody against beta(1) integrin, CSAT, decreased spreading and attachment, and resulted in a lack of immuno-detectable beta(1) integrin in focal adhesions on fibronectin; few beta(1) positive focal adhesions were observed in cells grown on tenascin. An anti-sense retroviral construct decreased endogenous levels of beta(1) integrin protein, and caused decreased attachment and spreading as well as sparse, disorganized focal adhesions. These data indicate that in vitro, both POM and CF have beta(1) integrins that interact with fibronectin and allow them to attach and spread, while tenascin is anti-adhesive. Further studies using both of these experimental paradigms will clarify whether these interactions also occur in vivo. PMID:11846443

  17. Maslinic Acid, a Triterpene from Olive, Affects the Antioxidant and Mitochondrial Status of B16F10 Melanoma Cells Grown under Stressful Conditions

    PubMed Central

    Mokhtari, Khalida; Rufino-Palomares, Eva E.; Pérez-Jiménez, Amalia; Reyes-Zurita, Fernando J.; Figuera, Celeny; García-Salguero, Leticia; Medina, Pedro P.; Peragón, Juan; Lupiáñez, José A.


    Maslinic acid (MA) is a natural compound whose structure corresponds to a pentacyclic triterpene. It is abundant in the cuticular lipid layer of olives. MA has many biological and therapeutic properties related to health, including antitumor, anti-inflammatory, antimicrobial, antiparasitic, antihypertensive, and antioxidant activities. However, no studies have been performed to understand the molecular mechanism induced by this compound in melanoma cancer. The objective of this study was to examine the effect of MA in melanoma (B16F10) cells grown in the presence or absence of fetal bovine serum (FBS). We performed cell proliferation measurements, and the reactive oxygen species (ROS) measurements using dihydrorhodamine 123 (DHR 123) and activities of catalase, glucose 6-phosphate dehydrogenase, glutathione S-transferase, and superoxide dismutase. These changes were corroborated by expression assays. FBS absence reduced cell viability decreasing IC50 values of MA. The DHR 123 data showed an increase in the ROS level in the absence of FBS. Furthermore, MA had an antioxidant effect at lower assayed levels measured as DHR and antioxidant defense. However, at higher dosages MA induced cellular damage by apoptosis as seen in the results obtained. PMID:26236377

  18. Maslinic Acid, a Triterpene from Olive, Affects the Antioxidant and Mitochondrial Status of B16F10 Melanoma Cells Grown under Stressful Conditions.


    Mokhtari, Khalida; Rufino-Palomares, Eva E; Pérez-Jiménez, Amalia; Reyes-Zurita, Fernando J; Figuera, Celeny; García-Salguero, Leticia; Medina, Pedro P; Peragón, Juan; Lupiáñez, José A


    Maslinic acid (MA) is a natural compound whose structure corresponds to a pentacyclic triterpene. It is abundant in the cuticular lipid layer of olives. MA has many biological and therapeutic properties related to health, including antitumor, anti-inflammatory, antimicrobial, antiparasitic, antihypertensive, and antioxidant activities. However, no studies have been performed to understand the molecular mechanism induced by this compound in melanoma cancer. The objective of this study was to examine the effect of MA in melanoma (B16F10) cells grown in the presence or absence of fetal bovine serum (FBS). We performed cell proliferation measurements, and the reactive oxygen species (ROS) measurements using dihydrorhodamine 123 (DHR 123) and activities of catalase, glucose 6-phosphate dehydrogenase, glutathione S-transferase, and superoxide dismutase. These changes were corroborated by expression assays. FBS absence reduced cell viability decreasing IC50 values of MA. The DHR 123 data showed an increase in the ROS level in the absence of FBS. Furthermore, MA had an antioxidant effect at lower assayed levels measured as DHR and antioxidant defense. However, at higher dosages MA induced cellular damage by apoptosis as seen in the results obtained. PMID:26236377

  19. Comparison of surface proteins of Anaplasma marginale grown in tick cell culture, tick salivary glands, and cattle.


    Barbet, A F; Blentlinger, R; Yi, J; Lundgren, A M; Blouin, E F; Kocan, K M


    Anaplasma marginale, a tick-borne rickettsial pathogen of cattle, infects bovine erythrocytes, resulting in mild to severe hemolytic disease that causes economic losses in domestic livestock worldwide. Recently, the Virginia isolate of A. marginale was propagated in a continuous tick cell line, IDE8, derived from embryonic Ixodes scapularis. Development of A. marginale in cell culture was morphologically similar to that described previously in ticks. In order to evaluate the potential of the cell culture-derived organisms for use in future research or as an antigen for serologic tests and vaccines, the extent of structural conservation of the major surface proteins (MSPs) between the cell culture-derived A. marginale and the bovine erythrocytic stage, currently the source of A. marginale antigen, was determined. Structural conservation on the tick salivary-gland stage was also examined. Monoclonal and monospecific antisera against MSPs 1 through 5, initially characterized against erythrocyte stages, also reacted with A. marginale from cell culture and tick salivary glands. MSP1a among geographic A. marginale isolates is variable in size because of different numbers of a tandemly repeated 28- or 29-amino-acid peptide. The cell culture-derived A. marginale maintained the same-size MSP1a as that found on the Virginia isolate of A. marginale in bovine erythrocytes and tick salivary glands. Although differences were observed in the polymorphic MSP2 antigen between culture and salivary-gland stages, MSP2 did not appear to vary, by two-dimensional gel electrophoresis, during continuous passage in culture. These data show that MSPs of erythrocyte-stage A. marginale are present on culture stages and may be structurally conserved during continuous culture. The presence of all current candidate diagnostic and vaccine antigens suggests that in vitro cultures are a valuable source of rickettsiae for basic research and for the development of improved diagnostic reagents and vaccines against anaplasmosis. PMID:9864202

  20. Stem Cells Grown in Osteogenic Medium on PLGA, PLGA/HA, and Titanium Scaffolds for Surgical Applications

    PubMed Central

    Asti, Annalia; Gastaldi, Giulia; Dorati, Rossella; Saino, Enrica; Conti, Bice; Visai, Livia; Benazzo, Francesco


    Pluripotent adipose tissue-derived stem cells (hASCs) can differentiate into various mesodermal cell types such as osteoblasts, chondroblasts, and myoblasts. We isolated hASCs from subcutaneous adipose tissue during orthopaedic surgery and induced the osteogenic differentiation for 28 days on three different synthetic scaffolds such as polylactide-co-glycolide (PLGA), polylactide-co-glycolide/hydroxyapatite (PLGA/HA), and trabecular titanium scaffolds (Ti6Al4V). Pore size can influence certain criteria such as cell attachment, infiltration, and vascularization. The aim of this study was to investigate the performance of PLGA and PLGA/HA scaffolds with a higher porosity, ranging between 75% and 84%, with respect to Ti scaffolds but with smaller pore size, seeded with hASCs to develop a model that could be used in the treatment of bone defects and fractures. Osteogenesis was assessed by ELISA quantitation of extracellular matrix protein expression, von Kossa staining, X-ray microanalysis, and scanning electron microscopy. The higher amount of protein matrix on the Ti scaffold with respect to PLGA and PLGA/HA leads to the conclusion that not only the type of material but the structure significantly affects cell proliferation. PMID:21234383

  1. Hap4p overexpression in glucose-grown Saccharomyces cerevisiae induces cells to enter a novel metabolic state

    PubMed Central

    Lascaris, Romeo; Bussemaker, Harmen J; Boorsma, André; Piper, Matt; van der Spek, Hans; Grivell, Les; Blom, Jolanda


    Background Metabolic and regulatory gene networks generally tend to be stable. However, we have recently shown that overexpression of the transcriptional activator Hap4p in yeast causes cells to move to a state characterized by increased respiratory activity. To understand why overexpression of HAP4 is able to override the signals that normally result in glucose repression of mitochondrial function, we analyzed in detail the changes that occur in these cells. Results Whole-genome expression profiling and fingerprinting of the regulatory activity network show that HAP4 overexpression provokes changes that also occur during the diauxic shift. Overexpression of HAP4, however, primarily acts on mitochondrial function and biogenesis. In fact, a number of nuclear genes encoding mitochondrial proteins are induced to a greater extent than in cells that have passed through a normal diauxic shift: in addition to genes required for mitochondrial energy conservation they include genes encoding mitochondrial ribosomal proteins. Conclusions We show that overproduction of a single nuclear transcription factor enables cells to move to a novel state that displays features typical of, but clearly not identical to, other derepressed states. PMID:12537548

  2. Development of high-bandgap AlGaInP solar cells grown by organometallic vapor-phase epitaxy


    Perl, Emmett E.; Simon, John; Geisz, John F.; Olavarria, Waldo; Young, Michelle; Duda, Anna; Friedman, Daniel J.; Steiner, Myles A.


    AlGaInP solar cells with bandgaps between 1.9 and 2.2 eV are investigated for use in next-generation multijunction photovoltaic devices. This quaternary alloy is of great importance to the development of III-V solar cells with five or more junctions and for cells optimized for operation at elevated temperatures because of the high bandgaps required in these designs. In this work, we explore the conditions for the organometallic vapor-phase epitaxy growth of AlGaInP and study their effects on cell performance. Initial efforts focused on developing ~2.0-eV AlGaInP solar cells with a nominal aluminum composition of 12%. Under the direct spectrum at 1000more » W/m2 (AM1.5D), the best of these samples had an open-circuit voltage of 1.59 V, a bandgap-voltage offset of 440 mV, a fill factor of 88.0%, and an efficiency of 14.8%. We then varied the aluminum composition of the alloy from 0% to 24% and were able to tune the bandgap of the AlGaInP layers from ~1.9 to ~2.2 eV. Furthermore, while the samples with a higher aluminum composition exhibited a reduced quantum efficiency and increased bandgap-voltage offset, the bandgap-voltage offset remained at 500 mV or less, up to a bandgap of ~2.1 eV.« less

  3. Biofilm-Grown Burkholderia cepacia Complex Cells Survive Antibiotic Treatment by Avoiding Production of Reactive Oxygen Species

    PubMed Central

    Van Acker, Heleen; Sass, Andrea; Bazzini, Silvia; De Roy, Karen; Udine, Claudia; Messiaen, Thomas; Riccardi, Giovanna; Boon, Nico; Nelis, Hans J.; Mahenthiralingam, Eshwar; Coenye, Tom


    The presence of persister cells has been proposed as a factor in biofilm resilience. In the present study we investigated whether persister cells are present in Burkholderia cepacia complex (Bcc) biofilms, what the molecular basis of antimicrobial tolerance in Bcc persisters is, and how persisters can be eradicated from Bcc biofilms. After treatment of Bcc biofilms with high concentrations of various antibiotics often a small subpopulation survived. To investigate the molecular mechanism of tolerance in this subpopulation, Burkholderia cenocepacia biofilms were treated with 1024 µg/ml of tobramycin. Using ROS-specific staining and flow cytometry, we showed that tobramycin increased ROS production in treated sessile cells. However, approximately 0.1% of all sessile cells survived the treatment. A transcriptome analysis showed that several genes from the tricarboxylic acid cycle and genes involved in the electron transport chain were downregulated. In contrast, genes from the glyoxylate shunt were upregulated. These data indicate that protection against ROS is important for the survival of persisters. To confirm this, we determined the number of persisters in biofilms formed by catalase mutants. The persister fraction in ΔkatA and ΔkatB biofilms was significantly reduced, confirming the role of ROS detoxification in persister survival. Pretreatment of B. cenocepacia biofilms with itaconate, an inhibitor of isocitrate lyase (ICL), the first enzyme in the glyoxylate shunt, reduced the persister fraction approx. 10-fold when the biofilms were subsequently treated with tobramycin. In conclusion, most Bcc biofilms contain a significant fraction of persisters that survive treatment with high doses of tobramycin. The surviving persister cells downregulate the TCA cycle to avoid production of ROS and at the same time activate an alternative pathway, the glyoxylate shunt. This pathway may present a novel target for combination therapy. PMID:23516582

  4. Protein phosphorylations in poliovirus infected cells.


    James, L A; Tershak, D R


    In vivo phosphorylation of proteins that are associated with polysomes of poliovirus-infected VERO (African green monkey kidney) and HeLa (Henrietta Lacks) cells differed from phosphorylations observed with uninfected cells that were fed fresh medium. With both types of cells infection stimulated phosphorylation of proteins with molecular weights of 40 000-41 000, 39 000, 34 000, 32 000, and 24 000. Similarities of phosphorylations in VERO and HeLa cells suggest that they are a specific consequence of infection and might serve a regulatory function during protein synthesis. PMID:6260321

  5. Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture

    NASA Technical Reports Server (NTRS)

    Gruener, Raphael; Hoeger, Glenn


    Cocultured Xenopus neurons and myocytes were subjected to nonvectorial gravity by clinostat rotation to determine the effects of microgravity on cell development and communications. Observed effects included increases in the myocyte and its nuclear area, fragmentation of nucleoli, the appearance of neuritic aneurysms, decreased growth in the presence of trophic factors, and decreased yolk utilization. These effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. It is found that, in microgravity, cell differentiation is altered by interference with cytoskeleton-related mechanisms. It is suggested that the alteration of the distribution of acetylcholine receptor aggregates on myocytes which occurs might indicate that microgravity affects brain development.

  6. Neural Progenitor Cells Grown on Hydrogel Surfaces Respond to the product of the Transgene of Encapsulated Genetically Engineered Fibroblasts

    PubMed Central

    Shanbhag, Mihir S.; Lathia, Justin D.; Mughal, Mohamed R.; Francis, Nicola L.; Pashos, Nicholas; Mattson, Mark P.; Wheatley, Margaret A.


    Engineered tissue strategies for central nervous system (CNS) repair have the potential for localizing treatment using a wide variety of cells or growth factors. However, these strategies are often limited by their ability to address only one aspect of the injury. Here we report the development of a novel alginate construct that acts as a multi-functional tissue scaffold for CNS repair, and as a localized growth factor delivery vehicle. We show that the surface of this alginate construct acts as an optimal growth environment for neural progenitor cell (NPC) attachment, survival, migration, and differentiation. Importantly, we show that tailor-made alginate constructs containing brain-derived neurotrophic factor or neurotrophin-3 differentially direct lineage fates of NPCs and may therefore be useful in treating a wide variety of injuries. It is this potential for directed differentiation of a scaffold prior to implantation at the injury site that we explore here. PMID:20942395

  7. Effects of green-synthesized silver nanoparticles on lung cancer cells in vitro and grown as xenograft tumors in vivo

    PubMed Central

    He, Yan; Du, Zhiyun; Ma, Shijing; Liu, Yue; Li, Dongli; Huang, Huarong; Jiang, Sen; Cheng, Shupeng; Wu, Wenjing; Zhang, Kun; Zheng, Xi


    Silver nanoparticles (AgNPs) have now been recognized as promising therapeutic molecules and are extending their use in cancer diagnosis and therapy. This study demonstrates for the first time the antitumor activity of green-synthesized AgNPs against lung cancer in vitro and in vivo. Cytotoxicity effect was explored on human lung cancer H1299 cells in vitro by MTT and trypan blue assays. Apoptosis was measured by morphological assessment, and nuclear factor-κB (NF-κB) transcriptional activity was determined by a luciferase reporter gene assay. The expressions of phosphorylated stat3, bcl-2, survivin, and caspase-3 were examined by Western blot analysis. AgNPs showed dose-dependent cytotoxicity and stimulation of apoptosis in H1299 cells. The effects on H1299 cells correlated well with the inhibition of NF-κB activity, a decrease in bcl-2, and an increase in caspase-3 and survivin expression. AgNPs significantly suppressed the H1299 tumor growth in a xenograft severe combined immunodeficient (SCID) mouse model. The results demonstrate the anticancer activities of AgNPs, suggesting that they may act as potential beneficial molecules in lung cancer chemoprevention and chemotherapy, especially for early-stage intervention. PMID:27217750

  8. Effect of Increasing Doses of γ-Radiation on Bone Marrow Stromal Cells Grown on Smooth and Rough Titanium Surfaces.


    Huang, Bo; Guang, Mengkai; Ye, Jun; Gong, Ping; Tang, Hua


    Radiation therapy for oral and maxillofacial tumors could damage bone marrow stromal cells (BMSCs) in jaw, which caused dental implant failure. However, how radiation affects BMSCs on SLA (sandblasted with large-grits, acid-etched) surfaces is still unknown. The aim of this study was to investigate effect of different dose of γ-radiation on BMSCs on SLA and PT (polished titanium) surfaces. Rat BMSCs were radiated with 2, 4, and 8 Gy γ-radiation and then seeded on both surfaces. Cell adhesion, spreading, and proliferation were tested. The osteogenesis and the adipogenesis ability were examined by Alizarin-Red and Oil-Red staining, respectively. Real-time PCR was performed to detect osteogenic (osteocalcin, OCN; runt-related transcription factor 2, Runx2) and adipogenic (peroxisome proliferator-activated receptor gamma, PPARγ) gene expression at days 7 and 14 postirradiation. Results showed that γ-radiation reduced cell proliferation, adhesion, spreading, and osteogenic differentiation. 2 Gy radiation promoted adipogenic differentiation, but it was significantly decreased when dosage reached 4 Gy. In conclusion, results suggest that γ-radiation influenced BMSCs behaviors in a dosage-dependent manner except adipogenic differentiation, low dose promoted it, and high dose inhibited it. This effect was influenced by surface characteristics, which may explain the different failure rate of various implants in patients after radiation. PMID:26257788

  9. Phage typing of Vero cytotoxin-producing Escherichia coli O 157 isolated in the United Kingdom: 1989-91.

    PubMed Central

    Frost, J. A.; Cheasty, T.; Thomas, A.; Rowe, B.


    Between 1989 and 1991 a total of 1092 Vero cytotoxin-producing Escherichia coli O 157 isolated in the United Kingdom were phage typed in the Laboratory of Enteric Pathogens (LEP). Twenty-three phage types was identified, the most frequent being types 2 (36.1%), 49 (29.6%), 1 (10.3%) and 4 (8.9%). Although isolations of O 157 VTEC have increased each year from 1 in 1982 to 532 in 1991, the predominant phage types have remained unchanged although the proportion of strains belonging to types 2 and 49 has increased. O 157 VTEC from 17 outbreaks were phage typed during this period with phage type 49 predominating (7 of 17 outbreaks). PMID:8519312

  10. Broad visible emission from GaN nanowires grown on n-Si (1 1 1) substrate by PVD for solar cell application

    NASA Astrophysics Data System (ADS)

    Saron, K. M. A.; Hashim, M. R.


    Nanostructured gallium nitrides (GaNs) were grown on a catalyst-free Si (1 1 1) substrates using physical vapor deposition via thermal evaporation of GaN powder at 1150 °C in the absence of NH3 gas for different deposition time. Scanning electron microscopy (SEM) and energy-dispersive X-ray spectrometer (EDX) results indicated that the growth of GaN nanostructure varies with deposition time. Both X-ray diffraction (XRD) patterns and Raman spectra reveals a hexagonal GaN with wurtzite structure. Photoluminescence (PL) showed that the UV emission was suppressed, and the visible band emission was enhanced with increasing deposition time. Enhancement of visible band emission from the GaN NWs is due to the increasement of deep level states, which was resulted from growth process. Current-voltage (IV) characteristics of GaN/Si heterostructure were measured and good rectifying behavior was observed for this photodiode (PD). The forward current under illumination was almost three times than that in the dark current at +5 V. Responsivity of the photodetector was 10.5 A/W at range from 350 nm to 500 nm, which rapidly increased to 13.6 A/W at 700 nm. We found that the fabricated photodiode PD has an infra-red (IR) photoresponse behavior. The analysis of optical and electrical properties indications that the grown GaN in the absent of NH3 is a promising optical material and has potential applications in photo voltage solar cell.

  11. Metformin Induces Apoptosis and Downregulates Pyruvate Kinase M2 in Breast Cancer Cells Only When Grown in Nutrient-Poor Conditions

    PubMed Central

    Silvestri, Alessandra; Palumbo, Francesco; Rasi, Ignazio; Posca, Daniela; Pavlidou, Theodora; Paoluzi, Serena; Castagnoli, Luisa; Cesareni, Giovanni


    Introduction Metformin is proposed as adjuvant therapy in cancer treatment because of its ability to limit cancer incidence by negatively modulating the PI3K/AKT/mTOR pathway. In vitro, in addition to inhibiting cancer cell proliferation, metformin can also induce apoptosis. The molecular mechanism underlying this second effect is still poorly characterized and published data are often contrasting. We investigated how nutrient availability can modulate metformin-induced apoptosis in three breast cancer cell lines. Material and Methods MCF7, SKBR3 and MDA-MB-231 cells were plated in MEM medium supplemented with increasing glucose concentrations or in DMEM medium and treated with 10 mM metformin. Cell viability was monitored by Trypan Blue assay and treatment effects on Akt/mTOR pathway and on apoptosis were analysed by Western Blot. Moreover, we determined the level of expression of pyruvate kinase M2 (PKM2), a well-known glycolytic enzyme expressed in cancer cells. Results Our results showed that metformin can induce apoptosis in breast cancer cells when cultured at physiological glucose concentrations and that the pro-apoptotic effect was completely abolished when cells were grown in high glucose/high amino acid medium. Induction of apoptosis was found to be dependent on AMPK activation but, at least partially, independent of TORC1 inactivation. Finally, we showed that, in nutrient-poor conditions, metformin was able to modulate the intracellular glycolytic equilibrium by downregulating PKM2 expression and that this mechanism was mediated by AMPK activation. Conclusion We demonstrated that metformin induces breast cancer cell apoptosis and PKM2 downregulation only in nutrient-poor conditions. Not only glucose levels but also amino acid concentration can influence the observed metformin inhibitory effect on the mTOR pathway as well as its pro-apoptotic effect. These data demonstrate that the reduction of nutrient supply in tumors can increase metformin efficacy and that modulation of PKM2 expression/activity could be a promising strategy to boost metformin anti-cancer effect. PMID:26291325

  12. GaInP/GaAs tandem solar cells with highly Te- and Mg-doped GaAs tunnel junctions grown by MBE

    NASA Astrophysics Data System (ADS)

    Zheng, Xin-He; Liu, San-Jie; Xia, Yu; Gan, Xing-Yuan; Wang, Hai-Xiao; Wang, Nai-Ming; Yang, Hui


    We report a GaInP/GaAs tandem solar cell with a novel GaAs tunnel junction (TJ) with using tellurium (Te) and magnesium (Mg) as n- and p-type dopants via dual-filament low temperature effusion cells grown by molecular beam epitaxy (MBE) at low temperature. The test Te/Mg-doped GaAs TJ shows a peak current density of 21 A/cm2. The tandem solar cell by the Te/Mg TJ shows a short-circuit current density of 12 mA/cm2, but a low open-circuit voltage range of 1.4 V˜1.71 V under AM1.5 illumination. The secondary ion mass spectroscopy (SIMS) analysis reveals that the Te doping is unexpectedly high and its doping profile extends to the Mg doping region, thus possibly resulting in a less abrupt junction with no tunneling carriers effectively. Furthermore, the tunneling interface shifts from the intended GaAs n++/p++ junction to the AlGaInP/GaAs junction with a higher bandgap AlGaInP tunneling layers, thereby reducing the tunneling peak. The Te concentration of ˜ 2.5 × 1020 in GaAs could cause a lattice strain of 10-3 in magnitude and thus a surface roughening, which also negatively influences the subsequent growth of the top subcell and the GaAs contacting layers. The doping features of Te and Mg are discussed to understand the photovoltaic response of the studied tandem cell. Project supported by the SINANO-SONY Joint Program (Grant No. Y1AAQ11001), the National Natural Science Foundation of China (Grant No. 61274134), the USCB Start-up Program (Grant No. 06105033), and the International Cooperation Projects of Suzhou City, China (Grant No. SH201215).

  13. [Investigation of Endomyces magnusii respiratory system. Characteristics of mitochondria from cells grown in the presence of antimycin A].


    Eviagil'skaia, R A; Korosteleva, N L; Kotel'nikova, A V


    Mitochondria from AA-cells are a unique model with separately finctioning 1st and 3rd points of energy coupling and with completely blocked 2nd coupling point. In vivo the terminal segment of the respiratory chain does not operate, cytochromes c and a+a3 remain oxidized, and dominating terminal oxidase appears to be a component inhibiting by salicylhydroxamate and bound with the respiratory chain via cytochromes b or ubiquinone pool. The blocking of the 2nd coupling point is due to firm and, probably, quantitative binding of AA with cytochromes b, especially with b559, and also to a partial denaturation of the complex III. PMID:200284

  14. Comparison of initial feasibility of host cell lines for viral vaccine production.


    Vlecken, Danielle H W; Pelgrim, Ralf P M; Ruminski, Slawomir; Bakker, Wilfried A M; van der Pol, Leo A


    In order to reduce the time required for the development and production of viral vaccines, host cell lines should be available as expression systems for production of viral vaccines against groups of viral pathogens. A selection of cell lines was compared for their initial feasibility as expression system for the replication of polioviruses, influenza A viruses and respiratory syncytial virus (wild type strain A2). Six adherent cell lines (Vero, HEK-293, MRC-5, CHO-K1, BHK-21 c13, MDCK) and six single cell suspension cell lines (CAP, AGE1.CR.HS, sCHO-K1, BHK-21 c13 2p, MDCK SFS) were studied for their ability to propagate viruses. First, maximum cell densities were determined. Second, virus receptor expression and polarization of the cell lines regarding receptor distribution of eight different viruses were monitored using flow cytometry and immunocytochemistry. Organization of the actin cytoskeleton was studied by transfection of the cells with Lifeact™, a construct coding for actin-EGFP. Finally, the ability to produce virus progeny of the viruses studied was assayed for each cell line. The results suggest that single cell suspension cell lines grown on serum free medium are the best candidates to serve as host cell lines for virus replication. PMID:23684847

  15. Adenosine accelerates the healing of diabetic ischemic ulcers by improving autophagy of endothelial progenitor cells grown on a biomaterial

    PubMed Central

    Chen, Wen; Wu, Yangxiao; Li, Li; Yang, Mingcan; Shen, Lei; Liu, Ge; Tan, Ju; Zeng, Wen; Zhu, Chuhong


    Endothelial progenitor cells (EPCs) seeded on biomaterials can effectively promote diabetic ischemic wound healing. However, the function of transplanted EPCs is negatively affected by a high-glucose and ischemic microenvironment. Our experiments showed that EPC autophagy was inhibited and mitochondrial membrane potential (MMP) was increased in diabetic patients, while adenosine treatment decreased the energy requirements and increased the autophagy levels of EPCs. In animal experiments, we transplanted a biomaterial seeded with EPCs onto the surface of diabetic wounds and found that adenosine-stimulated EPCs effectively promoted wound healing. Increased microvascular genesis and survival of the transplanted cells were also observed in the adenosine-stimulated groups. Interestingly, our study showed that adenosine increased the autophagy of the transplanted EPCs seeded onto the biomaterial and maintained EPC survival at 48 and 96 hours. Moreover, we observed that adenosine induced EPC differentiation through increasing the level of autophagy. In conclusion, our study indicated that adenosine-stimulated EPCs seeded onto a biomaterial significantly improved wound healing in diabetic mice; mechanistically, adenosine might maintain EPC survival and differentiation by increasing high glucose-inhibited EPC autophagy and maintaining cellular energy metabolism. PMID:26108983

  16. Multi-stacked InAs/GaAs quantum dots grown with different growth modes for quantum dot solar cells

    SciTech Connect

    Kim, Yeongho; Ban, Keun-Yong Honsberg, Christiana B.


    We have studied the material properties and device performance of InAs/GaAs quantum dot solar cells (QDSCs) made using three different QD growth modes: Stranski-Krastanov (S-K), quasi-monolayer (QML), and sub-monolayer (SML) growth modes. All QDSCs show an extended external quantum efficiency (EQE) at near infrared wavelengths of 950–1070 nm from the QD absorption. Compared to the S-K and SML QDSCs, the QML QDSC with a higher strain exhibits a poor EQE response in the wavelength region of 300–880 nm due to increased non-radiative recombination. The conversion efficiency of the S-K and SML QDSCs exceeds that of the reference cell (13.4%) without QDs due to an enhanced photocurrent (>16% increase) produced by the silicon doped QD stacks. However, as expected from the EQE of the QML QDSC, the increase of strain-induced crystalline defects greatly degrades the photocurrent and open-circuit voltage, leading to the lowest conversion efficiency (8.9%)

  17. Hybrid nanostructure heterojunction solar cells fabricated using vertically aligned ZnO nanotubes grown on reduced graphene oxide

    NASA Astrophysics Data System (ADS)

    Yang, Kaikun; Xu, Congkang; Huang, Liwei; Zou, Lianfeng; Wang, Howard


    Using reduced graphene oxide (rGO) films as the transparent conductive coating, inorganic/organic hybrid nanostructure heterojunction photovoltaic devices have been fabricated through hydrothermal synthesis of vertically aligned ZnO nanorods (ZnO-NRs) and nanotubes (ZnO-NTs) on rGO films followed by the spin casting of a poly(3-hexylthiophene) (P3HT) film. The data show that larger interfacial area in ZnO-NT/P3HT composites improves the exciton dissociation and the higher electrode conductance of rGO films helps the power output. This study offers an alternative to manufacturing nanostructure heterojunction solar cells at low temperatures using potentially low cost materials.

  18. Hybrid nanostructure heterojunction solar cells fabricated using vertically aligned ZnO nanotubes grown on reduced graphene oxide.


    Yang, Kaikun; Xu, Congkang; Huang, Liwei; Zou, Lianfeng; Wang, Howard


    Using reduced graphene oxide (rGO) films as the transparent conductive coating, inorganic/organic hybrid nanostructure heterojunction photovoltaic devices have been fabricated through hydrothermal synthesis of vertically aligned ZnO nanorods (ZnO-NRs) and nanotubes (ZnO-NTs) on rGO films followed by the spin casting of a poly(3-hexylthiophene) (P3HT) film. The data show that larger interfacial area in ZnO-NT/P3HT composites improves the exciton dissociation and the higher electrode conductance of rGO films helps the power output. This study offers an alternative to manufacturing nanostructure heterojunction solar cells at low temperatures using potentially low cost materials. PMID:21911927

  19. Scanning electron microscopic observation on cells grown in vitro. VI. aggregate formation in confrontation cultures of human diploid and tumor cells.


    Gerstberger, R; Paweletz, N


    Two human cell lines, HeLa carcinoma cells and Wi38 lung fibroblasts have been used in confrontation experiments to study different adhesion processes including cellular motility, sorting out and invasion by SEM and statistics. Aggregates of one cell type were co-cultured with resuspended cells of the other type for up to 96 hours and vice versa. Homotypic aggregation kinetics as a control showed a saturation of the time-dependent increase in aggregate diameter and a mirror-like decrease in single cell number for both cell lines. In the heterotypic aggregation process, dissociated HeLa cells covered the surface of Wi38 aggregates without showing any particular distribution pattern. They partially penetrated the outer fibroblast layers and invasive actions were detected. Suspended Wi38 lung cells also adhered to the tumor cell aggregates. After a period of non-coordinated, random settlement (8 to 18 h or co-cultivation), the fibroblasts sorted out to form a network around the tumor aggregates in the form of sheets of cells arranged in parallel. The underlying HeLa cells then broke through the Wi38 layers, thus performing an inside-out invasion. Finally, all the aggregates were again covered by HeLa cells. PMID:7327174

  20. Inhibition of vimentin or B1 integrin reverts morphology of prostate tumor cells grown in laminin-rich extracellular matrix gels and reduces tumor growth in vivo

    SciTech Connect

    Zhang, Xueping; Fournier, Marcia V; Ware, Joy L; Bissell, Mina J; Yacoub, Adly; Zehner, Zendra E


    Prostate epithelial cells grown embedded in laminin-rich extracellular matrix (lrECM) undergo morphologic changes that closely resemble their architecture in vivo. In this study, growth characteristics of three human prostate epithelial sublines derived from the same cellular lineage, but displaying different tumorigenic and metastatic properties in vivo, were assessed in three-dimensional lrECM gels. M12, a highly tumorigenic and metastatic subline, was derived from the immortalized, prostate epithelial P69 cell line by selection in athymic, nude mice and found to contain a deletion of 19p-q13.1. The stable reintroduction of an intact human chromosome 19 into M12 resulted in a poorly tumorigenic subline, designated F6. When embedded in lrECM gels, the parental, nontumorigenic P69 line produced acini with clearly defined lumena. Immunostaining with antibodies to {beta}-catenin, E-cadherin, or {alpha}6 and {beta}1 integrins showed polarization typical of glandular epithelium. In contrast, the metastatic M12 subline produced highly disorganized cells with no evidence of polarization. The F6 subline reverted to acini-like structures exhibiting basal polarity marked with integrins. Reducing either vimentin levels via small interfering RNA interference or the expression of {alpha}6 and {beta}1 integrins by the addition of blocking antibodies, reorganized the M12 subline into forming polarized acini. The loss of vimentin significantly reduced M12-Vim tumor growth when assessed by s.c. injection in athymic mice. Thus, tumorigenicity in vivo correlated with disorganized growth in three-dimensional lrECM gels. These studies suggest that the levels of vimentin and {beta}1 integrin play a key role in the homeostasis of the normal acinus in prostate and that their dysregulation may lead to tumorigenesis. [Mol Cancer Ther 2009;8(3):499-508].

  1. Regulation of Cell Division, Biofilm Formation, and Virulence by FlhC in Escherichia coli O157:H7 Grown on Meat▿†

    PubMed Central

    Sule, Preeti; Horne, Shelley M.; Logue, Catherine M.; Prüß, Birgit M.


    To understand the continuous problems that Escherichia coli O157:H7 causes as food pathogen, this study assessed global gene regulation in bacteria growing on meat. Since FlhD/FlhC of E. coli K-12 laboratory strains was previously established as a major control point in transducing signals from the environment to several cellular processes, this study compared the expression pattern of an E. coli O157:H7 parent strain to that of its isogenic flhC mutant. This was done with bacteria that had been grown on meat. Microarray experiments revealed 287 putative targets of FlhC. Real-time PCR was performed as an alternative estimate of transcription and confirmed microarray data for 13 out of 15 genes tested (87%). The confirmed genes are representative of cellular functions, such as central metabolism, cell division, biofilm formation, and pathogenicity. An additional 13 genes from the same cellular functions that had not been hypothesized as being regulated by FlhC by the microarray experiment were tested with real-time PCR and also exhibited higher expression levels in the flhC mutant than in the parent strain. Physiological experiments were performed and confirmed that FlhC reduced the cell division rate, the amount of biofilm biomass, and pathogenicity in a chicken embryo lethality model. Altogether, this study provides valuable insight into the complex regulatory network of the pathogen that enables its survival under various environmental conditions. This information may be used to develop strategies that could be used to reduce the number of cells or pathogenicity of E. coli O157:H7 on meat by interfering with the signal transduction pathways. PMID:21498760

  2. Electrical characteristics of amorphous Si:H/crystalline Si0.3Ge0.7 heterojunction solar cells grown on compositionally graded buffer layers

    NASA Astrophysics Data System (ADS)

    Oshima, Ryuji; Yamanaka, Mitsuyuki; Kawanami, Hitoshi; Sakata, Isao; Matsubara, Koji; Sugaya, Takeyoshi


    We examined the influence of the processing temperature on hydrogenated amorphous Si/crystalline Si0.3Ge0.7 heterojunction solar cells with a bandgap of 1.0 eV, which were grown on Si(001) by solid-source molecular beam epitaxy. Stepwise, compositionally graded buffer Si1-xGex layers were applied to prepare Si0.3Ge0.7 films with low dislocation density. We studied the influence of the annealing temperature applied at the buffer layer on the diode characteristics. The diode factor was minimized to 1.45 at 800 °C, and the saturation current density monotonically decreased from 7.5×10-4 A/cm2 for an annealing temperature of 650 °C to 5.0×10-5 A/cm2 for that of 900 °C, as a result of the promotion of dislocation annihilation. Consequently, the Si0.3Ge0.7 heterojunction solar cell showed a maximum conversion efficiency of 1.50% when the annealing temperature was 850 °C. We also studied the influence of the growth temperature of the p-Si0.3Ge0.7 active layer (absorber) on the cell performance. The short circuit current density increased from 16.03 mA/cm2 for 520 °C to 20.95 mA/cm2 for 600 °C. This result corresponded to an improvement of quantum efficiency response in the longer wavelength region due to the reduction of crystal defects caused by oxygen contamination. However, the Si0.3Ge0.7 active layer processed at a higher temperature showed an accumulation of threading dislocations and roughening of the surface, resulting in the degradation of both the open circuit voltage and the fill factor.

  3. InGaAs/GaAsP strain balanced multi-quantum wires grown on misoriented GaAs substrates for high efficiency solar cells

    NASA Astrophysics Data System (ADS)

    Alonso-Álvarez, D.; Thomas, T.; Führer, M.; Hylton, N. P.; Ekins-Daukes, N. J.; Lackner, D.; Philipps, S. P.; Bett, A. W.; Sodabanlu, H.; Fujii, H.; Watanabe, K.; Sugiyama, M.; Nasi, L.; Campanini, M.


    Quantum wires (QWRs) form naturally when growing strain balanced InGaAs/GaAsP multi-quantum wells (MQW) on GaAs [100] 6° misoriented substrates under the usual growth conditions. The presence of wires instead of wells could have several unexpected consequences for the performance of the MQW solar cells, both positive and negative, that need to be assessed to achieve high conversion efficiencies. In this letter, we study QWR properties from the point of view of their performance as solar cells by means of transmission electron microscopy, time resolved photoluminescence and external quantum efficiency (EQE) using polarised light. We find that these QWRs have longer lifetimes than nominally identical QWs grown on exact [100] GaAs substrates, of up to 1 μs, at any level of illumination. We attribute this effect to an asymmetric carrier escape from the nanostructures leading to a strong 1D-photo-charging, keeping electrons confined along the wire and holes in the barriers. In principle, these extended lifetimes could be exploited to enhance carrier collection and reduce dark current losses. Light absorption by these QWRs is 1.6 times weaker than QWs, as revealed by EQE measurements, which emphasises the need for more layers of nanostructures or the use light trapping techniques. Contrary to what we expected, QWR show very low absorption anisotropy, only 3.5%, which was the main drawback a priori of this nanostructure. We attribute this to a reduced lateral confinement inside the wires. These results encourage further study and optimization of QWRs for high efficiency solar cells.

  4. InGaAs/GaAsP strain balanced multi-quantum wires grown on misoriented GaAs substrates for high efficiency solar cells

    SciTech Connect

    Alonso-Álvarez, D.; Thomas, T.; Führer, M.; Hylton, N. P.; Ekins-Daukes, N. J.; Lackner, D.; Philipps, S. P.; Bett, A. W.; Sodabanlu, H.; Fujii, H.; Watanabe, K.; Sugiyama, M.; Nasi, L.; Campanini, M.


    Quantum wires (QWRs) form naturally when growing strain balanced InGaAs/GaAsP multi-quantum wells (MQW) on GaAs [100] 6° misoriented substrates under the usual growth conditions. The presence of wires instead of wells could have several unexpected consequences for the performance of the MQW solar cells, both positive and negative, that need to be assessed to achieve high conversion efficiencies. In this letter, we study QWR properties from the point of view of their performance as solar cells by means of transmission electron microscopy, time resolved photoluminescence and external quantum efficiency (EQE) using polarised light. We find that these QWRs have longer lifetimes than nominally identical QWs grown on exact [100] GaAs substrates, of up to 1 μs, at any level of illumination. We attribute this effect to an asymmetric carrier escape from the nanostructures leading to a strong 1D-photo-charging, keeping electrons confined along the wire and holes in the barriers. In principle, these extended lifetimes could be exploited to enhance carrier collection and reduce dark current losses. Light absorption by these QWRs is 1.6 times weaker than QWs, as revealed by EQE measurements, which emphasises the need for more layers of nanostructures or the use light trapping techniques. Contrary to what we expected, QWR show very low absorption anisotropy, only 3.5%, which was the main drawback a priori of this nanostructure. We attribute this to a reduced lateral confinement inside the wires. These results encourage further study and optimization of QWRs for high efficiency solar cells.

  5. Alteration of cell cycle progression by Sindbis virus infection

    SciTech Connect

    Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa; Shirasawa, Hiroshi


    We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G{sub 1} phase preferred to proliferate during S/G{sub 2} phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G{sub 1} phase than in cells infected during S/G{sub 2} phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases.

  6. Graphene grown on stainless steel as a high-performance and ecofriendly anti-corrosion coating for polymer electrolyte membrane fuel cell bipolar plates

    NASA Astrophysics Data System (ADS)

    Pu, Nen-Wen; Shi, Gia-Nan; Liu, Yih-Ming; Sun, Xueliang; Chang, Jeng-Kuei; Sun, Chia-Liang; Ger, Ming-Der; Chen, Chun-Yu; Wang, Po-Chiang; Peng, You-Yu; Wu, Chia-Hung; Lawes, Stephen


    In this study, the growth of graphene by chemical vapor deposition (CVD) on SUS304 stainless steel and on a catalyzing Ni/SUS304 double-layered structure was investigated. The results indicated that a thin and multilayered graphene film can be continuously grown across the metal grain boundaries of the Ni/SUS304 stainless steel and significantly enhance its corrosion resistance. A 3.5 wt% saline polarization test demonstrated that the corrosion currents in graphene-covered SUS304 were improved fivefold relative to the corrosion currents in non-graphene-covered SUS304. In addition to enhancing the corrosion resistance of stainless steel, a graphene coating also ameliorates another shortcoming of stainless steel in a corrosive environment: the formation of a passive oxidation layer on the stainless steel surface that decreases conductivity. After a corrosion test, the graphene-covered stainless steel continued to exhibit not only an excellent low interfacial contact resistance (ICR) of 36 mΩ cm2 but also outstanding drainage characteristics. The above results suggest that an extremely thin, lightweight protective coating of graphene on stainless steel can act as the next-generation bipolar plates of fuel cells.

  7. SU-E-J-156: Preclinical Inverstigation of Dynamic Tumor Tracking Using Vero SBRT Linear Accelerator: Motion Phantom Dosimetry Study

    SciTech Connect

    Mamalui-Hunter, M; Wu, J; Li, Z; Su, Z


    Purpose: Following the ‘end-to-end testing’ paradigm of Dynamic Target Tracking option in our Image-Guided dedicated SBRT VeroTM linac, we verify the capability of the system to deliver planned dose to moving targets in the heterogeneous thorax phantom (CIRSTM). The system includes gimbaled C-band linac head, robotic 6 degree of freedom couch and a tumor tracking method based on predictive modeling of target position using fluoroscopically tracked implanted markers and optically tracked infrared reflecting external markers. Methods: 4DCT scan of the motion phantom with the VisicoilTM implanted marker in the close vicinity of the target was acquired, the ‘exhale’=most prevalent phase was used for planning (iPlan by BrainLabTM). Typical 3D conformal SBRT treatment plans aimed to deliver 6-8Gy/fx to two types of targets: a)solid water-equivalent target 3cm in diameter; b)single VisicoilTM marker inserted within lung equivalent material. The planning GTV/CTV-to-PTV margins were 2mm, the block margins were 3 mm. The dose calculated by MonteCarlo algorithm with 1% variance using option Dose-to-water was compared to the ion chamber (CC01 by IBA Dosimetry) measurements in case (a) and GafchromicTM EBT3 film measurements in case (b). During delivery, the target 6 motion patterns available as a standard on CIRSTM motion phantom were investigated: in case (a), the target was moving along the designated sine or cosine4 3D trajectory; in case (b), the inserted marker was moving sinusoidally in 1D. Results: The ion chamber measurements have shown the agreement with the planned dose within 1% under all the studied motion conditions. The film measurements show 98.1% agreement with the planar calculated dose (gamma criteria: 3%/3mm). Conclusion: We successfully verified the capability of the SBRT VeroTM linac to perform real-time tumor tracking and accurate dose delivery to the target, based on predictive modeling of the correlation between implanted marker motion and external surrogate of breathing motion.

  8. Geometric Verification of Dynamic Wave Arc Delivery With the Vero System Using Orthogonal X-ray Fluoroscopic Imaging

    SciTech Connect

    Burghelea, Manuela; Verellen, Dirk; Poels, Kenneth; Gevaert, Thierry; Depuydt, Tom; Tournel, Koen; Hung, Cecilia; Simon, Viorica; Hiraoka, Masahiro; Ridder, Mark de


    Purpose: The purpose of this study was to define an independent verification method based on on-board orthogonal fluoroscopy to determine the geometric accuracy of synchronized gantry–ring (G/R) rotations during dynamic wave arc (DWA) delivery available on the Vero system. Methods and Materials: A verification method for DWA was developed to calculate O-ring-gantry (G/R) positional information from ball-bearing positions retrieved from fluoroscopic images of a cubic phantom acquired during DWA delivery. Different noncoplanar trajectories were generated in order to investigate the influence of path complexity on delivery accuracy. The G/R positions detected from the fluoroscopy images (DetPositions) were benchmarked against the G/R angulations retrieved from the control points (CP) of the DWA RT plan and the DWA log files recorded by the treatment console during DWA delivery (LogActed). The G/R rotational accuracy was quantified as the mean absolute deviation ± standard deviation. The maximum G/R absolute deviation was calculated as the maximum 3-dimensional distance between the CP and the closest DetPositions. Results: In the CP versus DetPositions comparison, an overall mean G/R deviation of 0.13°/0.16° ± 0.16°/0.16° was obtained, with a maximum G/R deviation of 0.6°/0.2°. For the LogActed versus DetPositions evaluation, the overall mean deviation was 0.08°/0.15° ± 0.10°/0.10° with a maximum G/R of 0.3°/0.4°. The largest decoupled deviations registered for gantry and ring were 0.6° and 0.4° respectively. No directional dependence was observed between clockwise and counterclockwise rotations. Doubling the dose resulted in a double number of detected points around each CP, and an angular deviation reduction in all cases. Conclusions: An independent geometric quality assurance approach was developed for DWA delivery verification and was successfully applied on diverse trajectories. Results showed that the Vero system is capable of following complex G/R trajectories with maximum deviations during DWA below 0.6°.

  9. Inhibitory effect of essential oils obtained from plants grown in Colombia on yellow fever virus replication in vitro

    PubMed Central

    Meneses, Rocío; Ocazionez, Raquel E; Martínez, Jairo R; Stashenko, Elena E


    Background An antiviral drug is needed for the treatment of patients suffering from yellow fever. Several compounds present in plants can inactive in vitro a wide spectrum of animal viruses. Aim In the present study the inhibitory effect of essential oils of Lippia alba, Lippia origanoides, Oreganum vulgare and Artemisia vulgaris on yellow fever virus (YFV) replication was investigated. Methods The cytotoxicity (CC50) on Vero cells was evaluated by the MTT reduction method. The minimum concentration of the essential oil that inhibited virus titer by more than 50% (MIC) was determined by virus yield reduction assay. YFV was incubated 24 h at 4°C with essential oil before adsorption on Vero cell, and viral replication was carried out in the absence or presence of essential oil. Vero cells were exposed to essential oil 24 h at 37°C before the adsorption of untreated-virus. Results The CC50 values were less than 100 μg/mL and the MIC values were 3.7 and 11.1 μg/mL. The CC50/MIC ratio was of 22.9, 26.4, 26.5 and 8.8 for L. alba, L origanoides, O. vulgare and A. vulgaris, respectively. The presence of essential oil in the culture medium enhances the antiviral effect: L. origanoides oil at 11.1 μg/mLproduced a 100% reduction of virus yield, and the same result was observed with L. alba, O. vulgare and A. vulgaris oils at100 μg/mL. No reduction of virus yield was observed when Vero cells were treated with essential oil before the adsorption of untreated-virus. Conclusion The essential oils evaluated in the study showed antiviral activities against YFV. The mode of action seems to be direct virus inactivation. PMID:19267922

  10. Effect of passivation layer grown by atomic layer deposition and sputtering processes on Si quantum dot superlattice to generate high photocurrent for high-efficiency solar cells

    NASA Astrophysics Data System (ADS)

    Maksudur Rahman, Mohammad; Higo, Akio; Sekhar, Halubai; Erman Syazwan, Mohd; Hoshi, Yusuke; Usami, Noritaka; Samukawa, Seiji


    The effect of passivation films on a Si quantum dot superlattice (QDSL) was investigated to generate high photocurrent in solar-cell applications. Three types of passivation films, sputter-grown amorphous silicon carbide (a-SiC), hydrogenated a-SiC (a-SiC:H), and atomic-layer-deposited aluminum oxide (ALD-Al2O3), were used to passivate the Si QDSLs containing a stack of four 4 nm Si nanodisks (NDs) and 2 nm silicon carbide (SiC) films fabricated by neutral beam etching (NBE). Because of the high surface-to-volume ratio typically present in quantum Si-NDs formed in the top-down NBE process, there is a tendency to form larger surface dangling bonds on untreated Si-ND surfaces as well as to have short distance (<10 nm) between high-aspect-ratio nanopillars of stacked 4 nm Si-NDs/2 nm SiC films, which conventionally sputter SiC films cannot uniformly cover. Therefore, we optimized the passivation techniques with an ALD-Al2O3 film. Scanning electron microscopy (SEM) analysis helped to explain the surface morphology before and after the passivation of the QDSLs. After the completion of the passivation process, the quality of the top surface films of the QDSLs was analyzed from the surface roughness by atomic force microscopy (AFM) analysis, which revealed that ALD-Al2O3 passivated films had the smallest roughness (RMS) of 1.09 nm with respect to sputter-grown a-SiC (RMS: 1.75 nm) and a-SiC:H (RMS: 1.54 nm) films. Conductive atomic force microscopy (CAFM) revealed that ALD-Al2O3 passivation decreased the surface-leakage current as a result of proper passivation of side-wall surface defects in the QDSLs. The carrier transport characteristics were extracted from the QDSLs using the photovoltaic (PV) properties of p++/i/n+ solar cells, where the QDSLs consisted of different passivation layers acting as intermediate layers (i-layers) between the high-doping-density p++ Si (1 × 1020 cm-3) and n+ Si (1 × 1019 cm-3) substrates. High-doping-density p++ Si acted as a hole conductor instead of a photocarrier generator, hence, we could observe the PV properties of the i-layers. The highest short-circuit current density of 4.75 mA cm-2 was generated from the QDSL with the ALD-Al2O3-passivated surface, which is suitable for high-efficiency QD solar cells compared with a-SiC-passivated (0.04 mA cm-2) and a-SiC:H-passivated (0.37 mA cm-2) QDSL surfaces.

  11. Video of Tissue Grown in Space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    Principal investigator Leland Chung grew prostate cancer and bone stromal cells aboard the Space Shuttle Columbia during the STS-107 mission. Although the experiment samples were lost along with the ill-fated spacecraft and crew, he did obtain downlinked video of the experiment that indicates the enormous potential of growing tissues in microgravity. Cells grown aboard Columbia had grown far larger tissue aggregates at day 5 than did the cells grown in a NASA bioreactor on the ground.

  12. Optical and electrical characterization of CdS-Glycine thin films with ammonia free buffer grown at different temperatures for solar cells applications

    NASA Astrophysics Data System (ADS)

    Berman-Mendoza, D.; Quiñones-Urías, D.; Ferra-González, S.; Vera-Marquina, A.; Rojas-Hernández, A.; Gómez Fuentes, R.; García-Juárez, A.; Leal-Cruz, A. L.; Ramos-Carrasco, A.


    In this work we report the fabrication and electro-optical characterization of CdS thin films using glycine as complexing agent with ammonia and ammonia free buffer by the Chemical Bath Deposition (CBD) method. The CdS thin films were grown at different temperatures of 50, 60, 70 and 80 °C in a thermal water bath. The morphology of these films was determined using atomic force microscopy; the resultant films were homogeneous, well adhered to the substrate, and specularly reflecting with a varying color depending on the deposition temperature. Transmittance and reflectance measurements of thermally treated CdS films were carried to study the effect of the ammonia buffer on its optical properties and bandgap. The crystallinity of the CdS thin films was determined by means of X Ray diffraction measurements. Therefore, for this study, an ammonia-free complexing agent has been taken for the deposition of CdS. Among different methods, which are being used for the preparation of CdS films, Chemical Bath Deposition (CBD) is the most attractive due to its low cost, easy to handle and large possibilities regarding doping and deposition on various substrates. In particular it can be used to easily obtain field effect devices by depositing CdS thin films over a SiO2/Si substrate. Heterostructures with interesting physical properties can be imagined, realized and tested in this way.. Structures CdS/PbS also were realized and have shown good solar cell characteristics.

  13. Aeromonas salmonicida grown in vivo.

    PubMed Central

    Garduño, R A; Thornton, J C; Kay, W W


    The virulent fish pathogen Aeromonas salmonicida was rapidly killed in vivo when restricted inside a diffusion chamber implanted intraperitoneally in rainbow trout. After a period of regrowth, the survivors had acquired resistance to host-mediated bacteriolysis, phagocytosis, and oxidative killing, properties which were subsequently lost by growth in vitro. Resistance to bacteriolysis and phagocytosis was associated with a newly acquired capsular layer revealed by acidic polysaccharide staining and electron microscopy. This capsular layer shielded the underlying, regular surface array (S-layer) from immunogold labeling with a primary antibody to the S-layer protein. Resistance to oxidative killing was mediated by a mechanism not associated with the presence of the capsular layer. An attenuated vaccine strain of A. salmonicida grown in vivo failed to express the capsular layer. Consequently, the in vivo-grown cells of this attenuated strain remained as sensitive to bacteriolysis, and as avidly adherent to macrophages, as the in vitro-grown cells. The importance of these new virulence determinants and their relation to the known virulence factors of A. salmonicida are discussed. Images PMID:8359906

  14. Acquisition of cell-cell fusion activity by amino acid substitutions in spike protein determines the infectivity of a coronavirus in cultured cells.


    Yamada, Yoshiyuki; Liu, Xiao Bo; Fang, Shou Guo; Tay, Felicia P L; Liu, Ding Xiang


    Coronavirus host and cell specificities are determined by specific interactions between the viral spike (S) protein and host cell receptor(s). Avian coronavirus infectious bronchitis (IBV) has been adapted to embryonated chicken eggs, primary chicken kidney (CK) cells, monkey kidney cell line Vero, and other human and animal cells. Here we report that acquisition of the cell-cell fusion activity by amino acid mutations in the S protein determines the infectivity of IBV in cultured cells. Expression of S protein derived from Vero- and CK-adapted strains showed efficient induction of membrane fusion. However, expression of S protein cloned from the third passage of IBV in chicken embryo (EP3) did not show apparent syncytia formation. By construction of chimeric S constructs and site-directed mutagenesis, a point mutation (L857-F) at amino acid position 857 in the heptad repeat 1 region of S protein was shown to be responsible for its acquisition of the cell-cell fusion activity. Furthermore, a G405-D point mutation in the S1 domain, which was acquired during further propagation of Vero-adapted IBV in Vero cells, could enhance the cell-cell fusion activity of the protein. Re-introduction of L857 back to the S gene of Vero-adapted IBV allowed recovery of variants that contain the introduced L857. However, compensatory mutations in S1 and some distant regions of S2 were required for restoration of the cell-cell fusion activity of S protein carrying L857 and for the infectivity of the recovered variants in cultured cells. This study demonstrates that acquisition of the cell-cell fusion activity in S protein determines the selection and/or adaptation of a coronavirus from chicken embryo to cultured cells of human and animal origins. PMID:19572016

  15. Catalase Activity of Psychrophilic Bacteria Grown at 2 and 30 C1

    PubMed Central

    Frank, Hilmer A.; Ishibashi, Sandra T.; Reid, Ann; Ito, June S.


    Catalase activity was measured in resting-cell suspensions of psychrophilic bacteria grown at 2 and at 30 C. Enzyme activity decreased in both cell-suspension types as harvest age increased. At comparable physiological age, cells grown at 2 C had more catalase than cells grown at 30 C. PMID:13959237

  16. Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based γ-evaluation and dose-area-histograms.


    Sothmann, T; Blanck, O; Poels, K; Werner, R; Gauer, T


    The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between  +1.5 Gy to  +6.0 Gy (CyberKnife:  +0.5 Gy to  +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were  -1.0 mm to  +0.7 mm (lateral) /-0.6 mm to  +0.1 mm (superior-inferior) for CyberKnife and  -0.8 mm to  +0.2 mm /-0.8 mm to  +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm. PMID:26836488

  17. Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based γ-evaluation and dose-area-histograms

    NASA Astrophysics Data System (ADS)

    Sothmann, T.; Blanck, O.; Poels, K.; Werner, R.; Gauer, T.


    The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between  +1.5 Gy to  +6.0 Gy (CyberKnife:  +0.5 Gy to  +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were  -1.0 mm to  +0.7 mm (lateral) /-0.6 mm to  +0.1 mm (superior-inferior) for CyberKnife and  -0.8 mm to  +0.2 mm /-0.8 mm to  +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm.

  18. Investigation of anodic and chemical oxides grown on p-type InP with applications to surface passivation for n(+)-p solar cell fabrication

    NASA Technical Reports Server (NTRS)

    Faur, Maria; Faur, Mircea; Goradia, Manju; Goradia, Chandra; Jenkins, Phillip; Jayne, Douglas; Weinberg, Irving


    Most of the previously reported InP anodic oxides were grown on a n-type InP with applications to fabrication of MISFET structures and were described as a mixture of In2O3 and P2O5 stoichiometric compounds or nonstoichiometric phases which have properties similar to crystalline compounds In(OH)3, InPO4, and In(PO3)3. Details of the compositional change of the anodic oxides grown under different anodization conditions were previously reported. The use of P-rich oxides grown either by anodic or chemical oxidation are investigated for surface passivation of p-type InP and as a protective cap during junction formation by closed-ampoule sulfur diffusion. The investigation is based on but not limited to correlations between PL intensity and X-ray photoelectron spectroscopy (XPS) chemical composition data.

  19. Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin

    SciTech Connect

    Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.


    An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of /sup 125/I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of /sup 125/I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies.

  20. Comparative study of cytotoxicity of Aeromonas spp. on four different cell lines.


    Ghatak, S; Agarwal, R K; Bhilegaonkar, K N


    In vitro cytotoxicity is an important virulence property of motile mesophilic Aeromonas species. Cell-free supernatant prepared from 55 Aeromonas isolates including one A. hydrophila type strain (MTCC 646) were examined for their cytotoxic potential on four different cell lines (Vero, BHK-21, MDBK, B 95a). Results of the study revealed cytotoxic potential in 92.72% of the isolates. Analysis of data exposed significant variation among isolates in respect of their cytotoxicity. Vero cells proved to be most sensitive to aeromonal toxins and B 95a cells showed significantly (P<0.01) lower response compared to other cell lines. Sensitivities of BHK-21 and MDBK cell lines were in between Vero and B 95a. PMID:16935331

  1. Evaluation of Cytotoxicity and Cell Death Induced In Vitro by Saxitoxin in Mammalian Cells.


    Melegari, Silvia P; de Carvalho Pinto, Cátia R S; Moukha, Serge; Creppy, Edmond E; Matias, William G


    Since the cyanotoxin saxitoxin (STX) is a neurotoxin and induces ecological changes in aquatic environments, a potential risk to public and environmental health exists. However, data on STX-mediated cytotoxic and genotoxic effects are still scare. In order to gain a better understanding of the effects of this toxin, the cytotoxic and genotoxic potential of STX was examined in two mammalian cell lines. Neuro 2A (N2A), a neuroblastoma mouse cell line, and Vero cell line, derived from Vero green monkey kidney cells, were exposed to several concentrations of STX ranging from 0.5 to 64 nM to determine cell viability, induction of apoptosis (DNA fragmentation assay), and formation of micronuclei (MN) (cytokinesis-block micronucleus assay; CBMN) following 24 h of incubation. The half maximal effective concentration (EC50) values for STX calculated in cell viability tests were 1.01 nM for N2A and 0.82 nM for Vero cells. With increasing STX concentration there was evidence of DNA fragmentation indicating apoptosis induction in Vero cells with a 50% increase in DNA fragmentation compared to control at the highest STX concentration tested (3 nM). The results demonstrated no significant changes in the frequency of micronucleated binucleated cells in N2A and Vero cells exposed to STX, indicating the absence of genotoxicity under these test conditions. There was no apparent cellular necrosis as evidenced by a lack of formation of multinucleated cells. In conclusion, data reported herein demonstrate that STX produced death of both cell types tested through an apoptotic process. PMID:26436995

  2. Human sepsis-associated Escherichia coli (SEPEC) is able to adhere to and invade kidney epithelial cells in culture

    PubMed Central

    Conceição, R.A.; Ludovico, M.S.; Andrade, C.G.T.J.; Yano, T.


    The adhesins of extraintestinal pathogenic Escherichia coli are essential for mediating direct interactions between the microbes and the host cell surfaces that they infect. Using fluorescence microscopy and gentamycin protection assays, we observed that 49 sepsis-associated E. coli (SEPEC) strains isolated from human adults adhered to and invaded Vero cells in the presence of D-mannose (100%). In addition, bacteria concentrations of approximately 2 × 107 CFU/mL were recovered from Vero cells following an invasion assay. Furthermore, PCR analysis of adhesin genes showed that 98.0% of these SEPEC strains tested positive for fimH, 69.4% for flu, 53.1% for csgA, 38.8% for mat, and 32.7% for iha. Analysis of the invasin genes showed that 16.3% of the SEPEC strains were positive for tia, 12.3% for gimB, and 10.2% for ibeA. Therefore, these data suggest that SEPEC adhesion to cell surfaces occurs through non-fimH mechanisms. Scanning electron microscopy showed the formation of microcolonies on the Vero cell surface. SEPEC invasiveness was also confirmed by the presence of intracellular bacteria, and ultrastructural analysis using electron transmission microscopy revealed bacteria inside the Vero cells. Taken together, these results demonstrate that these SEPEC strains had the ability to adhere to and invade Vero cells. Moreover, these data support the theory that renal cells may be the predominant pathway through which SEPEC enters human blood vessels. PMID:22488222

  3. Investigation of H2/CH4 mixed gas plasma post-etching process for ZnO:B front contacts grown by LP-MOCVD method in silicon-based thin-film solar cells

    NASA Astrophysics Data System (ADS)

    Wang, Li; Zhang, Xiaodan; Zhao, Ying; Yamada, Takuto; Naito, Yusuke


    A new plasma post-etching method, H2/CH4 mixed gas plasma, is introduced to modify ZnO:B films grown by LP-MOCVD technique, successfully relaxing the double trade-offs, i.e., transparency/conductivity trade-off and surface texture/Voc and FF trade-off. To deeply evaluate the post-etching process, optical emission spectroscopy technique is applied to diagnose the plasma condition. Upon different etching power, three distinct possible etching mechanisms are identified by analyzing the evolution of Hα*, Hβ*, CH* emission species in the plasma space. It is demonstrated that Hβ* and CH* species are responsible for the physical etching process and chemical etching process, respectively, from which a new “soft” surface morphology is formed with a combination of micro- and nano-sized texture. Additionally, Hα* species can bond with ZnO and also passivate the grains boundaries, thereby making both the carrier concentration and hall mobility increase. This process is defined as chemical bonding process. Finally, pin-type a-Si:H single-junction solar cells with an optimized device structure is grown on the etched ZnO:B substrate. The corresponding electrical parameters, such as Jsc, Voc and FF, are simultaneously improved compared with the solar cell deposited on as-grown ZnO:B substrate with the same fabrication process. As a consequence, a noteworthy 8.85% conversion-efficiency is achieved with an absorber layer thickness only 160 nm.

  4. Protein, free amino acid, phenloic, ß-carotene, and lycopene content, and antioxidative and cancer cell inhibitory effects of 12 greenhouse-grown commercial cherry tomato varieties

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The content of water, free amino acids, amino acid metabolites, crude protein, the carotene pigments ß-carotene and lycopene, and 9 characterized and 2 incompletely characterized individual phenolic (flavonoid) compounds of 12 greenhouse-grown cherry tomato varieties of various colors (green, yellow...

  5. The role of cell culture vaccines in the control of the next influenza pandemic.


    Audsley, J M; Tannock, G A


    Pandemic influenza A viruses of avian origin are of particular concern and have crossed the species barrier several times in recent years, giving rise to illness and occasionally death in humans. This situation could become dramatically worse if the infectivity of avian viruses for humans were increased by reassortment between the genes of human and avian viruses. Co-infection of humans or an intermediate host with an avian strain and an existing human strain could produce new viruses of unknown pathogenicity to which the entire population would be susceptible. Inactivated vaccines against influenza have been prepared for many years using viruses grown in embryonated chicken eggs. However, the use of eggs presents difficulties when vaccine supplies need to be expanded at short notice. It seems likely that future vaccines will be prepared in high-yielding cell cultures from continuous lines that are preferably anchorage-independent. At present, only certain preparations of the Vero and Madin-Darby canine kidney cell lines, grown and maintained in serum-free medium, are acceptable to all regulatory authorities. However, this situation is likely to change with increasing need for non-pandemic and pandemic vaccines. PMID:15155162

  6. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin (AF)-producing fungi contaminate food and feed during preharvest, storage and processing periods. Once consumed, AF accumulates in tissues, causing illnesses in animals and humans. At least 20 different types of AFs have been identified, and of these, aflatoxin B1 (AFB1) is the most ubiqui...

  7. Virological and Serological Findings in Rousettus aegyptiacus Experimentally Inoculated with Vero Cells-Adapted Hogan Strain of Marburg Virus

    PubMed Central

    Paweska, Janusz T.; Jansen van Vuren, Petrus; Masumu, Justin; Leman, Patricia A.; Grobbelaar, Antoinette A.; Birkhead, Monica; Clift, Sarah; Swanepoel, Robert; Kemp, Alan


    The Egyptian fruit bat, Rousettus aegyptiacus, is currently regarded as a potential reservoir host for Marburg virus (MARV). However, the modes of transmission, the level of viral replication, tissue tropism and viral shedding pattern remains to be described. Captive-bred R. aegyptiacus, including adult males, females and pups were exposed to MARV by different inoculation routes. Blood, tissues, feces and urine from 9 bats inoculated by combination of nasal and oral routes were all negative for the virus and ELISA IgG antibody could not be demonstrated for up to 21 days post inoculation (p.i.). In 21 bats inoculated by a combination of intraperitoneal/subcutaneous route, viremia and the presence of MARV in different tissues was detected on days 2–9 p.i., and IgG antibody on days 9–21 p.i. In 3 bats inoculated subcutaneously, viremia was detected on days 5 and 8 (termination of experiment), with virus isolation from different organs. MARV could not be detected in urine, feces or oral swabs in any of the 3 experimental groups. However, it was detected in tissues which might contribute to horizontal or vertical transmission, e.g. lung, intestines, kidney, bladder, salivary glands, and female reproductive tract. Viremia lasting at least 5 days could also facilitate MARV mechanical transmission by blood sucking arthropods and infections of susceptible vertebrate hosts by direct contact with infected blood. All bats were clinically normal and no gross pathology was identified on post mortem examination. This work confirms the susceptibility of R. aegyptiacus to infection with MARV irrespective of sex and age and contributes to establishing a bat-filovirus experimental model. Further studies are required to uncover the mode of MARV transmission, and to investigate the putative role of R. aegyptiacus as a reservoir host. PMID:23029039

  8. Porcine aminopeptidase N mediated polarized infection by porcine epidemic diarrhea virus in target cells

    SciTech Connect

    Cong, Yingying; Li, Xiaoxue; Bai, Yunyun; Lv, Xiaonan; Herrler, Georg; Enjuanes, Luis; Zhou, Xingdong; Qu, Bo; Meng, Fandan; Cong, Chengcheng; Ren, Xiaofeng; Li, Guangxing


    Infection of polarized intestinal epithelial cells by porcine epidemic diarrhea virus (PEDV) was characterized. Indirect immunofluorescence assay, real-time PCR, and transmission electron microscopy confirmed PEDV can be successfully propagated in immortalized swine small intestine epithelial cells (IECs). Infection involved porcine aminpeptidase N (pAPN), a reported cellular receptor for PEDV, transient expression of pAPN and siRNA targeted pAPN increased and decreased the infectivity of PEDV in IECs, respectively. Subsequently, polarized entry into and release from both Vero E6 and IECs was analyzed. PEDV entry into polarized cells and pAPN grown on membrane inserts occurs via apical membrane. The progeny virus released into the medium was also quantified which demonstrated that PEDV is preferentially released from the apical membrane. Collectively, our data demonstrate that pAPN, the cellular receptor for PEDV, mediates polarized PEDV infection. These results imply the possibility that PEDV infection may proceed by lateral spread of virus in intestinal epithelial cells. - Highlights: • PEDV infection of polarized intestinal epithelial cells (IECs) was characterized. • Porcine aminpeptidase N (pAPN) facilitated PEDV infection in IECs. • PEDV entry into and release from polarized cell via its apical membrane. • PEDV infection may proceed by lateral spread of virus in IECs.

  9. Gifted Children Grown Up.

    ERIC Educational Resources Information Center

    Freeman, Joan

    This book describes the outcomes of a longitudinal study of 210 British children that compared the recognized and the unrecognized gifted with their classmates. It describes what has happened to them and their families as they have grown up in very different circumstances, in poverty or wealth, through many types of schooling and life…

  10. Herpes simplex virus type 1 glycoprotein K is not essential for infectious virus production in actively replicating cells but is required for efficient envelopment and translocation of infectious virions from the cytoplasm to the extracellular space.

    PubMed Central

    Jayachandra, S; Baghian, A; Kousoulas, K G


    We characterized the glycoprotein K (gK)-null herpes simplex virus type 1 [HSV-1] (KOS) delta gK and compared it to the gK-null virus HSV-1 F-gKbeta (L. Hutchinson et al., J. Virol. 69:5401-5413, 1995). delta gK and F-gKbeta mutant viruses produced small plaques on Vero cell monolayers at 48 h postinfection. F-gKbeta caused extensive fusion of 143TK cells that was sensitive to melittin, a specific inhibitor of gK-induced cell fusion, while delta gK virus did not fuse 143TK cells. A recombinant plasmid containing the truncated gK gene specified by F-gKbeta failed to rescue the ICP27-null virus KOS (d27-1), while a plasmid with the delta gK deletion rescued the d27-1 virus efficiently. delta gK virus yield was approximately 100,000-fold lower in stationary cells than in actively replicating Vero cells. The plaquing efficiencies of delta gK and F-gKbeta virus stocks on VK302 cells were similar, while the plaquing efficiency of F-gKbeta virus stocks on Vero cells was reduced nearly 10,000-fold in comparison to that of delta gK virus. Mutant delta gK and F-gKbeta infectious virions accumulated within Vero and HEp-2 cells but failed to translocate to extracellular spaces. delta gK capsids accumulated in the nuclei of Vero but not HEp-2 cells. Enveloped delta gK virions were visualized in the cytoplasms of both Vero and HEp-2 cells, and viral capsids were found in the cytoplasm of HEp-2 cells within vesicles. Glycoproteins B, C, D, and H were expressed on the surface of delta gK-infected Vero cells in amounts similar to those for KOS-infected Vero cells. These results indicate that gK is involved in nucleocapsid envelopment, and more importantly in the translocation of infectious virions from the cytoplasm to the extracellular spaces, and that actively replicating cells can partially compensate for the envelopment but not for the cellular egress deficiency of the delta gK virus. Comparison of delta gK and F-gKbeta viruses suggests that the inefficient viral replication and plaquing efficiency of F-gKbeta virus in Vero cells and its syncytial phenotype in 143TK- cells are most likely due to expression of a truncated gK. PMID:9188566

  11. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.


    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki


    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. PMID:25680810

  12. Graphic Grown Up

    ERIC Educational Resources Information Center

    Kim, Ann


    It's no secret that children and YAs are clued in to graphic novels (GNs) and that comics-loving adults are positively giddy that this format is getting the recognition it deserves. Still, there is a whole swath of library card-carrying grown-up readers out there with no idea where to start. Splashy movies such as "300" and "Spider-Man" and their…

  13. Graphic Grown Up

    ERIC Educational Resources Information Center

    Kim, Ann


    It's no secret that children and YAs are clued in to graphic novels (GNs) and that comics-loving adults are positively giddy that this format is getting the recognition it deserves. Still, there is a whole swath of library card-carrying grown-up readers out there with no idea where to start. Splashy movies such as "300" and "Spider-Man" and their

  14. Bi2S3microspheres grown on graphene sheets as low-cost counter-electrode materials for dye-sensitized solar cells.


    Li, Guang; Chen, Xiaoshuang; Gao, Guandao


    In this work, we synthesized 3D Bi2S3 microspheres comprised of nanorods grown along the (211) facet on graphene sheets by a solvothermal route, and investigated its catalytic activities through I-V curves and conversion efficiency tests as the CE in DSSCs. Although the (211) facet has a large band gap for a Bi2S3 semiconductor, owing to the introduction of graphene into the system, its short-circuit current density, open-circuit voltage, fill factor, and efficiency were Jsc = 12.2 mA cm(-2), Voc = 0.75 V, FF = 0.60, and η = 5.5%, respectively. By integrating it with graphene sheets, our material achieved the conversion efficiency of 5.5%, which is almost triple the best conversion efficiency value of the DSSCs with (211)-faceted 3D Bi2S3 without graphene (1.9%) reported in the latest literature. Since this conversion-efficient 3D material grown on the graphene sheets significantly improves its catalytic properties, it paves the way for designing and applying low-cost Pt-free CE materials in DSSC from inorganic nanostructures. PMID:24509629

  15. High-efficiency, one-sun (22. 3% at air mass 0; 23. 9% at air mass 1. 5) monolithic two-junction cascade solar cell grown by metalorganic vapor phase epitaxy

    SciTech Connect

    Chung, B.; Virshup, G.F.; Werthen, J.G.


    A high-efficiency monolithic two-junction solar cell consisting of an Al/sub 0.37/Ga/sub 0.63/As (E/sub g/ = 1.93 eV) upper cell and a GaAs lower cell has been grown by metalorganic vapor phase epitaxy. Since both component cells have the n-on-p configuration, the unwanted p-n junction has been eliminated with the use of metal-interconnect contact during post-growth processing. As a two-terminal device, an efficiency of 22.3% has been achieved under 1 sun, air mass 0 illumination conditions, whereas an efficiency of 23.9% was obtained when the cascade cell was operated as a three-terminal device under 1 sun, air mass 1.5 illumination. This result represents the highest 1 sun efficiency ever reported. The advantages of utilizing this multijunction solar cell for terrestrial and space applications are also described.

  16. Acquisition of Cell–Cell Fusion Activity by Amino Acid Substitutions in Spike Protein Determines the Infectivity of a Coronavirus in Cultured Cells

    PubMed Central

    Fang, Shou Guo; Tay, Felicia P. L.; Liu, Ding Xiang


    Coronavirus host and cell specificities are determined by specific interactions between the viral spike (S) protein and host cell receptor(s). Avian coronavirus infectious bronchitis (IBV) has been adapted to embryonated chicken eggs, primary chicken kidney (CK) cells, monkey kidney cell line Vero, and other human and animal cells. Here we report that acquisition of the cell–cell fusion activity by amino acid mutations in the S protein determines the infectivity of IBV in cultured cells. Expression of S protein derived from Vero- and CK-adapted strains showed efficient induction of membrane fusion. However, expression of S protein cloned from the third passage of IBV in chicken embryo (EP3) did not show apparent syncytia formation. By construction of chimeric S constructs and site-directed mutagenesis, a point mutation (L857-F) at amino acid position 857 in the heptad repeat 1 region of S protein was shown to be responsible for its acquisition of the cell–cell fusion activity. Furthermore, a G405-D point mutation in the S1 domain, which was acquired during further propagation of Vero-adapted IBV in Vero cells, could enhance the cell–cell fusion activity of the protein. Re-introduction of L857 back to the S gene of Vero-adapted IBV allowed recovery of variants that contain the introduced L857. However, compensatory mutations in S1 and some distant regions of S2 were required for restoration of the cell–cell fusion activity of S protein carrying L857 and for the infectivity of the recovered variants in cultured cells. This study demonstrates that acquisition of the cell–cell fusion activity in S protein determines the selection and/or adaptation of a coronavirus from chicken embryo to cultured cells of human and animal origins. PMID:19572016

  17. Scanning electron microscopic study of human neuroblastoma cells affected with Naegleria fowleri Thai strains.


    Tiewcharoen, Supathra; Rabablert, Jundee; Chetanachan, Pruksawan; Junnu, Virach; Worawirounwong, Dusit; Malainual, Nat


    In order to understand the pathogenesis of Naegleria fowleri in primary amoebic meningoencephalitis, the human neuroblastoma (SK-N-MC) and African green monkey kidney (Vero) cells were studied in vitro. Amoeba suspension in cell-culture medium was added to the confluent monolayer of SK-N-MC and Vero cells. The cytopathic activity of N. fowleri trophozoites in co-culture system was elucidated by scanning electron microscope at 3, 6, 9, 12, and 24 h. Two strains of N. fowleri displayed well-organized vigorous pseudopods in Nelson's medium at 37 degrees C. In co-culture, the target monolayer cells were damaged by two mechanisms, phagocytosis by vigorous pseudopods and engulfment by sucker-like apparatus. N. fowleri trophozoites produced amoebostomes only in co-culture with SK-N-MC cells. In contrast, we could not find such apparatus in the co-culture with Vero cells. The complete destruction time (100%) at 1:1 amoeba/cells ratio of SK-N-MC cells (1 day) was shorter than the Vero cells (12 days). In conclusion, SK-N-MC cells were confirmed to be a target model for studying neuropathogenesis of primary amoebic meningoencephalitis. PMID:18685867

  18. Cyclic AMP stimulation of transferrin secretion by breast cancer cell grown on extracellular matrix or in two-compartment culture chambers

    SciTech Connect

    Vandewalle, B.; Hornez, L.; Revillion, F.; Lefebvre, J. )


    Extrahepatic synthesis and secretion of transferrin (Tf), the major iron-carrying protein, have been described in normal and tumoral tissues suggesting a potential role for paracrine or autocrine function. In breast tumor cell MCF-7, we have previously shown a Tf secretion stimulated by estradiol which might confer selective growth advantages of these rapidly proliferating cells. The present work refers to possible additional Tf functions related to differentiation of breast tumor cells. We induced MCF-7 cell differentiation by the cyclic AMP derivative, dibutyryl cAMP (dB cAMP) and studied Tf secretion in different culture conditions after labeling with (35S) methionine. Our results demonstrate that dB cAMP stimulates Tf secretion only in culture environment that permits access to the basolateral surface and caters to the polarity requirements of the cell. These results suggest that Tf may also act as a modulator of cellular differentiation in breast cancer cells.

  19. Presence of lactate dehydrogenase and lactate racemase in Megasphaera elsdenii grown on glucose or lactate.

    PubMed Central

    Hino, T; Kuroda, S


    Activity of D-lactate dehydrogenase (D-LDH) was shown not only in cell extracts from Megasphaera elsdenii grown on DL-lactate, but also in cell extracts from glucose-grown cells, although glucose-grown cells contained approximately half as much D-LDH as DL-lactate-grown cells. This indicates that the D-LDH of M. elsdenii is a constitutive enzyme. However, lactate racemase (LR) activity was present in DL-lactate-grown cells, but was not detected in glucose-grown cells, suggesting that LR is induced by lactate. Acetate, propionate, and butyrate were produced similarly from both D- and L-lactate, indicating that LR can be induced by both D- and L-lactate. These results suggest that the primary reason for the inability of M. elsdenii to produce propionate from glucose is that cells fermenting glucose do not synthesize LR, which is induced by lactate. PMID:8439152

  20. Respiratory syncytial virus matures at the apical surfaces of polarized epithelial cells.

    PubMed Central

    Roberts, S R; Compans, R W; Wertz, G W


    Respiratory syncytial (RS) virus infects the epithelium of the respiratory tract. We examined the replication and maturation of RS virus in two polarized epithelial cell lines, Vero C1008 and MDCK. Electron microscopy of RS virus-infected Vero C1008 cells revealed the presence of pleomorphic viral particles budding exclusively from the apical surface, often in clusters. The predominant type of particle was filamentous, 80 to 100 nm in diameter, and 4 to 8 microns in length, and evidence from filtration studies indicated that the filamentous particles were infectious. Cytopathology produced by RS virus infection of polarized Vero C1008 cells was minimal, and syncytia were not observed, consistent with the maintenance of tight junctions and the exclusively apical maturation of the virus. Infectivity assays with MDCK cells confirmed that in this cell line, RS virus was released into the apical medium but not into the basolateral medium. In addition, the majority of the RS virus transmembrane fusion glycoprotein on the cell surface was localized to the apical surface of the Vero C1008 cells. Taken together, these results demonstrate that RS virus matures at the apical surface of polarized epithelial cell lines. PMID:7884920

  1. Guidelines for the control of infection with Vero cytotoxin producing Escherichia coli (VTEC). Subcommittee of the PHLS Advisory Committee on Gastrointestinal Infections.



    Increasing numbers of cases of Vero cytotoxin producing Escherichia coli (VTEC) O157 infection, well published incidents, and new scientific evidence make it appropriate to produce new guidelines for their control. This document reviews the clinical and epidemiological features of VTEC O157 infection, describes the principles of microbiological investigation and laboratory safety, and presents recommendations for the prevention of spread of VTEC) O157. The recommendations consider direct spread of infection from animals, foodborne spread, the institutions in which spread is more likely to occur (nursing homes, schools, and children's day nurseries), and groups at particular risk of acquiring and transmitting infection (in essence, food handlers, and those unable to maintain high standards of hygiene for themselves and their carers). PMID:10743313

  2. The participation of growth factors in simulating the quiescent, proliferative, and differentiative stages of rat granulosa cells grown in a serum-free medium.


    Anderson, E; Lee, G Y


    Ovarian granulosa cells from small antral follicles from immature rats were cultured in a serum-free medium on an extracellular matrix for 10 days with growth factors in an effort to simulate the metabolic states they experience during their differentiation. During in vivo differentiation granulosa cells are initially quiescent, later proliferate and subsequently commence differentiation. With the production of androstenedione by the vascularized theca interna they produce estrogen and when the follicle reaches the preovulatory stage, granulosa cells produce both estrogen and progesterone. Culturing granulosa cells in serum-free medium plus FSH, PDGF, or FSH plus PDGF, the cells remain quiescent. The cells proliferate most consistently (as assessed by DNA quantitation) when cultured in FSH, PDGF, TGF alpha, TGF beta and GH, and undergo the first level of differentiation by producing estrogen (assessed by RIA) when cultured in FSH, PDGF, TGF beta, IGF-I and delta 4-A. Further differentiation is achieved in the presence of FSH, PDGF, TGF alpha, bFGF and delta 4-A when the cells produce both estrogen and progesterone similar to their production in preovulatory follicles. Phase contrast photomicrographs were made to monitor cellular shape changes. Electron microscopic analysis of the quiescent and proliferative cells reveal them to contain the normally occurring organelles. After 8 days in culture, cells producing estrogen, and estrogen and progesterone, contain endoplasmic reticulum of the smooth variety, an organelle which, in cooperation with mitochondria, is known to be involved in the production of steroids such as estrogen and progesterone. Therefore, with the addition of one or more growth factors and androstenedione to FSH-containing serum free medium, the simulated conditions are partially reminiscent of the follicular microenvironment, in which granulosa cells cultured on extracellular matrix can exhibit characteristics of growth and differentiation similar to folliculogenesis. PMID:8470094

  3. Feasibility evaluation of a new irradiation technique: three-dimensional unicursal irradiation with the Vero4DRT (MHI-TM2000).


    Mizowaki, Takashi; Takayama, Kenji; Nagano, Kazuo; Miyabe, Yuki; Matsuo, Yukinori; Kaneko, Shuji; Kokubo, Masaki; Hiraoka, Masahiro


    The Vero4DRT (MHI-TM2000) is a newly designed unique image-guided radiotherapy system consisting of an O-ring gantry. This system can realize a new irradiation technique in which both the gantry head and O-ring continuously and simultaneously rotate around the inner circumference of the O-ring and the vertical axis of the O-ring, respectively, during irradiation. This technique creates three-dimensional (3D) rotational dynamic conformal arc irradiation, which we term '3D unicursal irradiation'. The aim of this study was to present the concept and to estimate feasibility and potential advantages of the new irradiation technique. Collision maps were developed for the technique and a 3D unicursal plan was experimentally created in reference to the collision map for a pancreatic cancer case. Thereafter, dosimetric comparisons among the 3D unicursal, a two-dimensionally rotational dynamic conformal arc irradiation (2D-DCART), and an intensity-modulated radiation therapy (IMRT) plan were conducted. Dose volume data of the 3D unicursal plan were comparable or improved compared to those of the 2D-DCART and IMRT plans with respect to both the target and the organs at risk. The expected monitor unit (MU) number for the 3D unicursal plan was only 7% higher and 22.1% lower than the MUs for the 2D-DCART plan and IMRT plan, respectively. It is expected that the 3D unicursal irradiation technique has potential advantages in both treatment time and dose distribution, which should be validated under various conditions with a future version of the Vero4DRT fully implemented the function. PMID:22923744

  4. High-density InAs/GaAs1-xSbx quantum-dot structures grown by molecular beam epitaxy for use in intermediate band solar cells

    NASA Astrophysics Data System (ADS)

    Debnath, M. C.; Mishima, T. D.; Santos, M. B.; Cheng, Y.; Whiteside, V. R.; Sellers, I. R.; Hossain, K.; Laghumavarapu, R. B.; Liang, B. L.; Huffaker, D. L.


    InAs quantum-dot structures were grown using a GaAs1-xSbx matrix on a GaAs(001) substrate. The use of GaAs1-xSbx for the buffer and cap layers effectively suppressed coalescence between dots and significantly increased the dot density. The highest density (˜3.5 × 1011/cm2) was obtained for a nominal 3.0 monolayer deposition of InAs with an Sb composition of x = 13-14% in the GaAs1-xSbx matrix. When the Sb composition was increased to 18%, the resulting large photoluminescent red shift (˜90 meV) indicated the release of compressive strain inside the quantum dots. For x > 13%, we observed a significant decrease in photoluminescence intensity and an increase in the carrier lifetime (≥4.0 ns). This is attributed to the type-II band alignment between the quantum dots and matrix material.

  5. Investigation of crystallinity and planar defects in the Si nanowires grown by vapor–liquid–solid mode using indium catalyst for solar cell applications

    NASA Astrophysics Data System (ADS)

    Ajmal Khan, Muhammad; Ishikawa, Yasuaki; Kita, Ippei; Tani, Ayumi; Yano, Hiroshi; Fuyuki, Takashi; Konagai, Makoto


    Stacking-fault-free and planar defect (twinning plane)-free In-catalyzed Si nanowires (NWs) are essential for carrier transport and nanoscale device applications. In this article, In-catalyzed, vertically aligned, and cone-shaped Si NWs on Si(111) were grown successfully, in the vapor–liquid–solid (VLS) mode. In particular, the influences of substrate temperature (TS) and cooling rate (ΔTS/Δt) on the formation of planar defects, twinning planes along the [112] direction, and stacking faults in Si NWs were investigated. When TS was decreased from 600 °C to room temperature at a rate of 100 °C/240 s after Si NW growth, twinning plane defects perpendicular to the substrate and along different segments of (111)-oriented Si NWs were observed. Finally, one simple model was proposed to explain the stacking fault formation as well as Si NW length limitation due to the In-nanoparticle (In-NP) migration, and root causes of the twinning plane defects in the Si-NWs.

  6. Interface ferroelectric transition near the gap-opening temperature in a single-unit-cell FeSe film grown on Nb-Doped SrTiO3 substrate.


    Cui, Y-T; Moore, R G; Zhang, A-M; Tian, Y; Lee, J J; Schmitt, F T; Zhang, W-H; Li, W; Yi, M; Liu, Z-K; Hashimoto, M; Zhang, Y; Lu, D-H; Devereaux, T P; Wang, L-L; Ma, X-C; Zhang, Q-M; Xue, Q-K; Lee, D-H; Shen, Z-X


    We report findings of strong anomalies in both mutual inductance and inelastic Raman spectroscopy measurements of single-unit-cell FeSe film grown on Nb-doped SrTiO3, which occur near the temperature where the superconductinglike energy gap opens. Analysis suggests that the anomaly is associated with a broadened ferroelectric transition in a thin layer near the FeSe/SrTiO3 interface. The coincidence of the ferroelectric transition and gap-opening temperatures adds credence to the central role played by the film-substrate interaction on the strong Cooper pairing in this system. We discuss scenarios that could explain such a coincidence. PMID:25659015

  7. N/P InP homojunction solar cells with an In0.53Ga0.47As contacting layer grown by liquid phase epitaxy

    NASA Technical Reports Server (NTRS)

    Shen, C. C.; Choi, K. Y.


    N/P InP homojunction solar cells with an In sub 0.53 Ga sub 0.47 As contacting layer were fabricated by liquid phase epitaxy (LPE). Electron-Beam-Induced-Current (EBIC) measurements were performed on several selected samples. It was found that the background doping level in the base region sometimes results in a deep junction, which greatly affects the cell performance.

  8. What is the influence of ordinary epidermal cells and stomata on the leaf plasticity of coffee plants grown under full-sun and shady conditions?


    Pompelli, M F; Martins, S C V; Celin, E F; Ventrella, M C; Damatta, F M


    Stomata are crucial in land plant productivity and survival. In general, with lower irradiance, stomatal and epidermal cell frequency per unit leaf area decreases, whereas guard-cell length or width increases. Nevertheless, the stomatal index is accepted as remaining constant. The aim of this paper to study the influence of ordinary epidermal cells and stomata on leaf plasticity and the influence of these characteristics on stomata density, index, and sizes, in the total number of stomata, as well as the detailed distribution of stomata on a leaf blade. As a result, a highly significant positive correlation (R²(a) = 0.767 p ≤ 0.001) between stomatal index and stomatal density, and with ordinary epidermal cell density (R²(a) = 0.500 p ≤ 0.05), and a highly negative correlation between stomatal index and ordinary epidermal cell area (R²(a) = -0.571 p ≤ 0.001), were obtained. However in no instance was the correlation between stomatal index or stomatal density and stomatal dimensions taken into consideration. The study also indicated that in coffee, the stomatal index was 19.09% in shaded leaves and 20.08% in full-sun leaves. In this sense, variations in the stomatal index by irradiance, its causes and the consequences on plant physiology were discussed. PMID:21180918

  9. Flexible solar cells with a Cu(In,Ga)Se2 absorber grown by using a Se thermal cracker on a polyimide substrate

    NASA Astrophysics Data System (ADS)

    Park, Soo-Jeong; Chung, Yong-Duck; Lee, Woo-Jung; Cho, Dae-Hyung; Wi, Jae-Hyung; Han, Won-Seok; Cho, Yousuk; Yoon, Jong-man


    A polyimide substrate was used for the fabrication of flexible Cu(In,Ga)Se2 (CIGS) thin-film solar cells. To deposit a stable Mo layer on a flexible substrate, we measured the residual stress in the polyimide film after the deposition of a Mo layer by varying the process pressure. A CIGS absorber was deposited on a Mo layer at a growth temperature below 500℃ by using a Se thermal cracker and various cracking zone temperatures ( T C ) to improve the reactivity of Se due to the low process temperature. To investigate the effect of Na on the efficiency of a flexible CIGS solar cell, we deposited a Mo:Na layer as a source of Na between the Mo layer and the polyimide substrate. In case of the flexible CIGS solar cell fabricated under the condition of a T C of 800℃ with a Mo:Na layer, the highest cell efficiency was achieved at 10.76% without an anti-reflection coating, which is significantly increased by 4% compared to the efficiency of a solar cell without the Mo:Na layer.

  10. Comparative lipid composition of heterotrophically and autotrophically grown Sulfolobus acidocaldarius.

    PubMed Central

    Langworthy, T A


    Complex lipids from the thermoacidophilic facultative autotroph Sulfolobus acidocaldarius, as well as a strictly autotrophic isolate, were compared between cells grown on yeast extract and elemental sulfur. Lipids from both organisms grown autotrophically were nearly identical. Each contained about 15% neutral lipids, 35% glycolipids, and 50% acidic lipids. Glycolipids and acidic lipids contained C40H82-76-derived glycerol ether residues. Major glycolipids included the glycerol ether analogues of glucosyl galactosyl diglyceride (5%) and glucosyl polyol diglyceride (75%). Acidic lipids were comprised mainly of the glycerol ether analogues of phosphatidyl inositol (7%), inositolphosphoryl glucosyl polyol diglyceride (72%), and a partially characterized sulfate- and phosphate-containing derivative of glucosyl polyol diglyceride (13%). The lipids from cells grown heterotrophically were similar to those from autotrophically grown cells, except that the partially characterized acidic lipid was absent. In addition, the two glycolipids as well as the respective inositolphosphoryl derivatives were each present in nearly equal proportions. Images PMID:863856

  11. High-efficiency screen-printed solar cell on edge-defined film-fed grown ribbon silicon through optimized rapid belt co-firing of contacts and high-sheet-resistance emitter

    NASA Astrophysics Data System (ADS)

    Rohatgi, Ajeet; Hilali, Mohamed M.; Nakayashiki, Kenta


    High-quality screen-printed contacts were achieved on a high-sheet-resistance emitter (˜100 Ω/sq.) using PV168 Ag paste and rapid co-firing in the belt furnace. The optimized co-firing cycle developed for a 100 Ω/sq. emitter produced 16.1% efficient 4 cm2 planar edge-defined film-fed grown (EFG) ribbon Si cells with a low series-resistance (0.8 Ω cm2), high fill factor of ˜0.77, along with very significant bulk lifetime enhancement from 3 to 100 μs. This represents the highest-efficiency screen-printed EFG Si cells with single-layer antireflection (AR) coating. These cells were fabricated using a simple process involving POCl3 diffusion for a high-sheet-resistance emitter, SiNx AR coating and rapid cofiring of Ag grid and Al-doped back-surface field in a conventional belt furnace. The rapid cofiring process also prevented junction shunting while maintaining very effective SiNx-induced hydrogen passivation of defects, resulting in an average bulk lifetime exceeding 100 μs.

  12. [The effect of poly(3-hydroxybutyrate) modification by poly(ethylene glycol) on the viability of cells grown on the polymer films].


    Zharkova, I I; Bonartsev, A P; Boskhomdzhiev, A P; Efremov, Iu M; Bagrov, D V; Makhina, T K; Myshkina, V L; Voinova, V V; Iakovlev, S G; Filatova, E V; Zernov, A L; Andreeva, N V; Ivanov, E A; Bonartseva, G A; Shaĭtan, K V


    A biodegradable polymer of bacterial origin, poly(3-hydroxybutyrate) (PHB), is intensively studied as biomaterial for tissue engineering. However, factors determining its biocompatibility still require better understanding. To analyze the PHB films biocompatibility, the polymer material was modified by hydrophilic polymer, poly(ethylene glycol) 300 (PEG). The blends PHB/PEG with different PEG content (10, 20, 30 and 50%) were produced by subsequent incubation in water resulted in removal of 95% PEG. The surface roughness and hydrophilicity were studied by atomic force microscopy (AFM) and contact angle "water-polymer" measurement, respectively. The film biocompatibility on cell culture of COS-1 fibroblasts was studied in vitro. It was shown that both roughness and hydrophobicity are directly proportional to initial PEG content in the PHB/PEG blends. The growth rate of COS-1 fibroblasts on polymer films is determined by combination of two basic physicochemical properties of the polymer surface: the roughness and hydrophilicity. The optimal roughness requred for COS-1 cells growth is the average roughness more than 25 nm, whereas the limit values of the contact angle "water-polymer" that was responsible for relatively high cell viability were not found. These data indicate that the film surface roughness had the greatest effect on the cell growth, whereas the increase in the polymer surface hydrophilicity caused the additional positive effect on viability of attached cells. Thus, the modification of PHB polymer material by PEG resulted in the improved viability of cells cultivated on the polymer films in vitro. The obtained data can be used for development of such medical devices as surgeon patches and periodontal membranes. PMID:23289300

  13. Frequency of N6-Benzyladenine Incorporation into Major RNA Fractions of Tobacco Cell Suspensions Grown at Stimulatory or Cytostatic Cytokinin Concentration 1

    PubMed Central

    Jouanneau, Jean-Pierre; de la Serve, Bernard Teyssendier; Péaud-Lenoël, Claude


    The frequency of incorporation of the cytokinin N6-[p-3H]benzyladenine into major RNA species of tobacco (Nicotiana tabacum cv W 38) cells steadily increased as a function of its concentration in the culture medium, up to a 10 micromolar cytostatic overdose. During a 55-hour incubation of cells with 0.4 micromolar benzyladenine (BA), which is the optimal concentration for cell division, the incorporation frequency increased to one BA per 1.5 to 2.0 × 104 conventional bases in total RNA. Frequencies of BA incorporation into 18S and 25S rRNA and into RNA precursors were very similar, 2- to 3-fold higher than the frequency of BA incorporation into the 4S + 5S RNA fraction. In cells incubated with 10 micromolar BA, the rate of RNA synthesis between 24 and 55 hours was lower than at optimal growth conditions; 18S and 25S rRNA synthesis was depressed more than the synthesis of 4S + 5S RNA. At 55 hours, BA was incorporated into total RNA at the steady state frequency of one per 1,300 conventional bases. All major RNA species were BA-labeled to approximately the same level, except that the labeling of the RNA precursors was 2-fold higher than the labeling of mature RNA species. These results may reflect an alteration in the processing of the RNA precursors at supra-optimal cytokinin concentration. PMID:16663478

  14. Transwell-grown HepG2 cell monolayers as in vitro permeability model to study drug-drug or drug-food interactions.


    Berginc, Katja; Kristl, Albin


    HepG2 cell monolayers, formed during cell growth on collagen-coated Transwell (Corning Inc., Corning, NY, USA) inserts, can be used for the evaluation of interactions between food supplements and drugs that are substrates for P-glycoprotein (Pgp) and/or multidrug resistance-associated protein 2 (MRP-2). Samples obtained during such permeability studies were relatively free of intracellular proteins or cell debris compared to usually performed uptake experiments with HepG2 cells; therefore no special preparation protocol prior to the analysis was needed. In the presence of aged garlic extract the activities of hepatic efflux transporters (Pgp, MRP-2) changed, which was observed as significant permeability changes of tested human immunodeficiency virus (HIV) protease inhibitors. Darunavir efflux significantly increased, whereas that of saquinavir significantly decreased. Because of the observed in vitro interactions between aged garlic extract and HIV protease inhibitors (darunavir, saquinavir), any alterations of in vivo liver transport in the presence of garlic phytochemicals could also significantly influence darunavir/saquinavir hepatocyte intracellular concentrations and hence their bioavailabilities. Therefore this aspect needs further in vivo animal evaluation. PMID:21138349

  15. Transwell-grown HepG2 cell monolayers as in vitro permeability model to study drug-drug or drug-food interactions.

    TOXLINE Toxicology Bibliographic Information

    Berginc K; Kristl A


    HepG2 cell monolayers, formed during cell growth on collagen-coated Transwell (Corning Inc., Corning, NY, USA) inserts, can be used for the evaluation of interactions between food supplements and drugs that are substrates for P-glycoprotein (Pgp) and/or multidrug resistance-associated protein 2 (MRP-2). Samples obtained during such permeability studies were relatively free of intracellular proteins or cell debris compared to usually performed uptake experiments with HepG2 cells; therefore no special preparation protocol prior to the analysis was needed. In the presence of aged garlic extract the activities of hepatic efflux transporters (Pgp, MRP-2) changed, which was observed as significant permeability changes of tested human immunodeficiency virus (HIV) protease inhibitors. Darunavir efflux significantly increased, whereas that of saquinavir significantly decreased. Because of the observed in vitro interactions between aged garlic extract and HIV protease inhibitors (darunavir, saquinavir), any alterations of in vivo liver transport in the presence of garlic phytochemicals could also significantly influence darunavir/saquinavir hepatocyte intracellular concentrations and hence their bioavailabilities. Therefore this aspect needs further in vivo animal evaluation.

  16. Freestanding aligned carbon nanotube array grown on a large-area single-layered graphene sheet for efficient dye-sensitized solar cell.


    Qiu, Longbin; Wu, Qiong; Yang, Zhibin; Sun, Xuemei; Zhang, Yuanbo; Peng, Huisheng


    A novel carbon nanomaterial with aligned carbon nanotubes (CNTs) chemically bonded to a single-layered, large area graphene sheet is designed and fabricated, showing remarkable electronic and electrocatalytic properties. When the carbon nanomaterial is used as a counter electrode, the resulting dye-sensitized solar cell exhibits ≈11% enhancement of energy conversion efficiency than aligned CNT array. PMID:24889384

  17. Microhardness studies of vapour grown tin (II) sulfide single crystals

    NASA Astrophysics Data System (ADS)

    Hegde, S. S.; Kunjomana, A. G.; Ramesh, K.


    Earth abundant tin sulfide (SnS) has attracted considerable attention as a possible absorber material for low-cost solar cells due to its favourable optoelectronic properties. Single crystals of SnS were grown by physical vapour deposition (PVD) technique. Microindentation studies were carried out on the cleaved surfaces of the crystals to understand their mechanical behaviour. Microhardness increased initially with the load, giving sharp maximum at 15 g. Quenching effect has increased the microhardness, while annealing reduced the microhardness of grown crystals. The hardness values of as-grown, annealed and quenched samples at 15 g load are computed to be 99.69, 44.52 and 106.29 kg/mm2 respectively. The microhardness of PVD grown crystals are high compared to CdTe, a leading low-cost PV material. The as-grown faces are found to be fracture resistant.

  18. Prostate tumor grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    This prostate cancer construct was grown during NASA-sponsored bioreactor studies on Earth. Cells are attached to a biodegradable plastic lattice that gives them a head start in growth. Prostate tumor cells are to be grown in a NASA-sponsored Bioreactor experiment aboard the STS-107 Research-1 mission in 2002. Dr. Leland Chung of the University of Virginia is the principal investigator. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Credit: NASA and the University of Virginia.

  19. Use of a feline respiratory epithelial cell culture system grown at the air-liquid interface to characterize the innate immune response following feline herpesvirus 1 infection.


    Nelli, Rahul K; Maes, Roger; Kiupel, Matti; Hussey, Gisela Soboll


    Infection with feline herpesvirus-1 (FHV-1) accounts for 50% of viral upper respiratory diseases in domestic cats and is a significant cause of ocular diseases. Despite the clinical significance and high prevalence of FHV-1 infection, currently available vaccines cannot completely protect cats from infection and lifelong latency. FHV-1 infects via the mucous membranes and replicates in respiratory epithelial cells, but very little is known about the early innate immunity at this site. To address questions about immunity to FHV-1, feline respiratory epithelial cells cultured at air-liquid interface (ALI-FRECs) were established by collecting respiratory tracts from 6 healthy cats after euthanasia. Cells were isolated, cultured and characterized histologically and immunologically before infection with FHV-1. The expression of Toll-like receptors (TLRs), cytokine and chemokine responses were measured by real time PCR. ALI-FRECs morphologically resembled the natural airways of cats with multilayered columnar epithelial cells and cilia. Immunological properties of the natural airways were maintained in ALI-FRECs, as evidenced by the expression of TLRs, cytokines, chemokines, interferons, beta-defensins, and other regulatory genes. Furthermore, ALI-FRECs were able to support infection and replication of FHV-1, as well as modulate transcriptional regulation of various immune genes in response to infection. IL-1β and TNFα were increased in ALI-FRECs by 24hpi, whereas expression levels of IFN-α and TLR9 were not increased until 36hpi. In contrast, TLR3, GM-CSF and TGF-1β expression was down-regulated at 36hpi. The data presented show the development of a system ideal for investigating the molecular pathogenesis and immunity of FHV-1 or other respiratory pathogens. PMID:26795546

  20. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation

    NASA Astrophysics Data System (ADS)

    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu


    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation.

  1. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation.


    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu


    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation. PMID:26727026

  2. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation

    PubMed Central

    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu


    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation. PMID:26727026

  3. Angiogenic tube formation of bovine aortic endothelial cells grown on patterns formed by H2/He plasma treatment of the plasma polymerized hexamethyldisiloxane film.


    Park, Jisoo; Ha, Myunghoon; Lee, Hye-Rim; Park, Heonyong; Yu, Jung-Hoon; Boo, Jin-Hyo; Jung, Donggeun


    Angiogenesis, the process to generate new vessels, is necessary for normal development in children as well as the wound healing and the tumor growth in adults. Therefore, it is physiologically and/or pathophysiologically significant to monitor angiogenesis. However, classical in vitro methods to evaluate angiogenesis take a long time and are expensive. Here, the authors developed a novel method to analyze the angiogenesis in a simple and economical way, using patterned films. In this study, the authors fabricated a plasma polymerized hexamethyldisiloxane (PPHMDSO) thin film deposited by capacitively coupled plasma chemical vapor deposition system with various plasma powers. The patterned PPHMDSO film was plasma treated by 10:90 H2/He mixture gas through a metal shadow mask. The films were characterized by water contact angle, atomic force microscopy, x-ray photoelectron spectroscopy, and Fourier-transform infrared spectroscopy analyses. Our results show that the PPHMDSO film suppresses the cell adhesion, whereas surface modified PPHMDSO film enhances the cell adhesion and proliferation. From cell culture experiments, the authors found that the patterned film with 300 μm line interval was most efficient to evaluate the tube formation, a sapient angiogenic indicator. This patterned film will provide an effective and promising method for evaluating angiogenesis. PMID:25724221

  4. Detection of the quantity of kinesin and microgravity-sensitive kinesin genes in rat bone marrow stromal cells grown in a simulated microgravity environment

    NASA Astrophysics Data System (ADS)

    Ni, Chengzhi; Wang, Chunyan; Li, Yuan; Li, Yinghui; Dai, Zhongquan; Zhao, Dongming; Sun, Hongyi; Wu, Bin


    Kinesin and kinesin-like proteins (KLPs) constitute a superfamily of microtubule motor proteins found in all eukaryotic organisms. Members of the kinesin superfamily are known to play important roles in many fundamental cellular and developmental processes. To date, few published studies have reported on the effects of microgravity on kinesin expression. In this paper, we describe the expression pattern and microgravity-sensitive genes of kinesin in rat bone marrow stromal cells cultured in a ground-based rotating bioreactor. The quantity of kinesin under the clinorotation condition was examined by immunoblot analysis with anti-kinesin. Furthermore, the distribution of kinesin at various times during clinorotation was determined by dual immunostaining, using anti-kinesin monoclonal antibody or anti-β-tubulin monoclonal antibody. In terms of kinesin quantity, we found that the ratios of the amounts of clinorotated/stationary KLPs decreased from clinorotation day 5 to day 10, although it increased on days 2 and 3. Immunofluorescence analysis revealed that kinesin in the nucleus was the first to be affected by simulated microgravity, following the kinesin at the periphery that was affected at various times during clinorotation. Real-time RT-PCR analysis of kinesin mRNA expression was performed and led to the identification of 3 microgravity-sensitive kinesin genes: KIF9, KIFC1, and KIF21A. Our results suggest that kinesin has a distinct expression pattern, and the identification of microgravity-sensitive kinesin genes offers insight into fundamental cell biology.

  5. The structure of the glucuronoxylomannan produced by culinary-medicinal yellow brain mushroom (Tremella mesenterica Ritz.:Fr., Heterobasidiomycetes) grown as one cell biomass in submerged culture.


    Vinogradov, Evgeny; Petersen, Bent O; Duus, Jens Ø; Wasser, Solomon


    The yellow brain mushroom Tremella mesenterica possesses a wide spectrum of medicinal properties, including immunostimulating, protecting against radiation, antidiabetic, anti-inflammatory, hypocholesterolemic, hepatoprotective, and antiallergic effects. A unique feature of T. mesenterica is that most of the above mentioned medicinal properties depend on glucuronoxylomannan (GXM) contained in fruiting bodies or produced in pure culture conditions. We developed a new strain of T. mesenterica CBS 101939, which grows in submerged culture and offers superior yields of one-cell biomass rich in exocellular heteropolysaccharide GXM. The structure of the GXM was analyzed by NMR spectroscopy and chemical methods. The polysaccharide has a defined repeating unit structure, which is O-acetylated at several points: [structure: see text]. These results differ from previously published structure of Tremella extracellular polysaccharides, where mannan backbone was believed to be randomly glycosylated with xylan chains of different length. PMID:15178391

  6. Anti-West Nile virus activity of in vitro expanded human primary natural killer cells

    PubMed Central


    Background Natural Killer (NK) cells are a crucial component of the host innate immune system with anti-viral and anti-cancer properties. However, the role of NK cells in West Nile virus (WNV) infection is controversial, with reported effects ranging from active suppression of virus to no effect at all. It was previously shown that K562-mb15-41BBL (K562D2) cells, which express IL-15 and 4-1BBL on the K562 cell surface, were able to expand and activate human primary NK cells of normal peripheral blood mononuclear cells (PBMC). The expanded NK cells were tested for their ability to inhibit WNV infection in vitro. Results Co-culture of PBMC with irradiated K562D2 cells expanded the NK cell number by 2-3 logs in 2-3 weeks, with more than 90% purity; upregulated NK cell surface activation receptors; downregulated inhibitory receptors; and boosted interferon gamma (IFN-γ) production by ~33 fold. The expanded NK (D2NK) cell has strong natural killing activity against both K562 and Vero cells, and killed the WNV infected Vero cells through antibody-dependent cellular cytotoxicity (ADCC). The D2NK cell culture supernatants inhibited both WNV replication and WNV induced cytopathic effect (CPE) in Vero cells when added before or after infection. Anti-IFN-γ neutralizing antibody blocked the NK supernatant-mediated anti-WNV effect, demonstrating a noncytolytic activity mediated through IFN-γ. Conclusions Co-culture of PBMC with K562D2 stimulatory cells is an efficient technique to prepare large quantities of pure and active NK cells, and these expanded NK cells inhibited WNV infection of Vero cells through both cytolytic and noncytolytic activities, which may imply a potential role of NK cells in combating WNV infection. PMID:20089143

  7. Wide-spectrum Mg and Ga co-doped ZnO TCO thin films for solar cells grown via magnetron sputtering with H2 introduction

    NASA Astrophysics Data System (ADS)

    Chen, Xin-liang; Liu, Jie-ming; Ni, Jian; Zhao, Ying; Zhang, Xiao-dan


    Wide-spectrum Mg and Ga co-doped ZnO transparent conductive oxide (TCO) thin films are deposited via magnetron sputtering at various H2 flow rates on glass substrates. The structural, electrical, and optical properties of MGZO thin films are investigated with different H2 flow rates. The experiment results show that the MGZO thin films are polycrystalline with a hexagonal wurtzite structure exhibiting a preferred (0 0 2) crystal plane orientation. The carrier concentration remarkably increases from 5.15 × 1019 cm-3 to 2.12 × 1020 cm-3 with increasing the H2 flow rate from 0 sccm to 4.0 sccm and then decreases when further increasing the H2 flow rate. The glass/MGZO thin film deposited at the H2 flow rate of 4.0 sccm exhibits the lowest resistivity of 1.96 × 10-3 Ω cm (film thickness d ∼ 548 nm) and an average transmittance (Ta) of 80.5% in the wavelength range from 340 nm to 1100 nm. Optical measurements indicate that the optical band gap (Eg) of MGZO thin films varies from 3.45 eV to 3.78 eV with adjusting H2 flow rate from 0 sccm to 12.0 sccm. The obtained MGZO thin films with an appropriate thickness are preliminarily applied in p-i-n type hydrogenated amorphous silicon (a-Si:H) thin film solar cells. The a-Si:H solar cell with MGZO layer presents higher quantum efficiency in the short wavelength region than that with GZO layer, resulting from widened optical band gap.

  8. Effect of high energy shock waves on tumor cells.


    Kohri, K; Uemura, T; Iguchi, M; Kurita, T


    Exposure of bladder tumor cell strain HT-1197, chronic bonemarrow leukemic cell strain K-562, and African green-turtle normal kidney cell strain Vero to high energy shock waves resulted in ultrastructural changes and a reduction in cell viability as determined by 3H-thymidine incorporation assay and flowcytometer. K-562 was the most sensitive while Vero was the most resistant to the high energy shock wave. By flowcytometry using anti BrdU antibody, described K-562 in the S phase was found to be inhibited by the exposure. Electron microscopy revealed destruction of microvilli over the cell surface and swollen mitochondria in K-562 and HT-1197. These effects were related to the number of high energy shock wave exposures. Our study demonstrates that a high energy shock wave has an anti-tumor effect in vitro. PMID:2339478

  9. In vitro infection of nonendothelial cells by Ehrlichia ruminantium.


    Zweygarth, E; Josemans, A I


    The Welgevonden stock of Ehrlichia ruminantium was propagated in eight nonendothelial cell cultures derived from different animal species, both ruminants and nonruminants. The origins of the cells were: bovine fetal testis (BFT), cat ovary (COC), donkey fibroblasts (DFC), sheep fibroblasts (E(2)), horse testis (HTC), lamb fetal testis (LFT), mouse connective tissue (L), and African green monkey kidney (Vero). Four cell culture types (BFT, E(2), LFT and Vero) required supplementation of the medium with cycloheximide for suitable growth of E. ruminantium, whereas the other four (COC, DFC, HTC, and L) did not. Three other stocks of E. ruminantium, Senegal, Ball 3, and Gardel, were also propagated, either in LFT cultures only or in both E(2) and LFT cell cultures. The Welgevonden stock was successfully initiated using E(2) and LFT cell cultures. PMID:12860692

  10. Quantification of confocal images of biofilms grown on irregular surfaces

    PubMed Central

    Ross, Stacy Sommerfeld; Tu, Mai Han; Falsetta, Megan L.; Ketterer, Margaret R.; Kiedrowski, Megan R.; Horswill, Alexander R.; Apicella, Michael A.; Reinhardt, Joseph M.; Fiegel, Jennifer


    Bacterial biofilms grow on many types of surfaces, including flat surfaces such as glass and metal and irregular surfaces such as rocks, biological tissues and polymers. While laser scanning confocal microscopy can provide high-resolution images of biofilms grown on any surface, quantification of biofilm-associated bacteria is currently limited to bacteria grown on flat surfaces. This can limit researchers studying irregular surfaces to qualitative analysis or quantification of only the total bacteria in an image. In this work, we introduce a new algorithm called modified connected volume filtration (MCVF) to quantify bacteria grown on top of an irregular surface that is fluorescently labeled or reflective. Using the MCVF algorithm, two new quantification parameters are introduced. The modified substratum coverage parameter enables quantification of the connected-biofilm bacteria on top of the surface and on the imaging substratum. The utility of MCVF and the modified substratum coverage parameter were shown with Pseudomonas aeruginosa and Staphylococcus aureus biofilms grown on human airway epithelial cells. A second parameter, the percent association, provides quantified data on the colocalization of the bacteria with a labeled component, including bacteria within a labeled tissue. The utility of quantifying the bacteria associated with the cell cytoplasm was demonstrated with Neisseria gonorrhoeae biofilms grown on cervical epithelial cells. This algorithm provides more flexibility and quantitative ability to researchers studying biofilms grown on a variety of irregular substrata. PMID:24632515

  11. Correlation between Phylogroups and Intracellular Proteomes of Propionibacterium acnes and Differences in the Protein Expression Profiles between Anaerobically and Aerobically Grown Cells

    PubMed Central

    Dekio, Itaru; Culak, Renata; Ball, Graham; Gharbia, Saheer; Shah, Haroun N.


    Propionibacterium acnes is one of the dominant commensals on the human skin and also an opportunistic pathogen in relation to acne, sarcoidosis, prostate cancer, and various infections. Recent investigations using housekeeping and virulence genes have revealed that the species consists of three major evolutionary clades (types I, II, and III). In order to investigate protein expression differences between these phylogroups, proteomic profiles of 21 strains of P. acnes were investigated. The proteins extracted from cells cultured under anaerobic and aerobic conditions were analysed using a SELDI-TOF mass spectrometer, high-resolution capillary gel electrophoresis, and LC-MS/ MS. The SELDI spectral profiles were visualised as a heat map and a dendrogram, which resulted in four proteomic groups. Strains belonging to type I were represented in the proteome Group A, while Group B contained type III strains. Groups C and D contained mixtures of types I and II. Each of these groups was not influenced by differences in culture conditions. Under anoxic growth conditions, a type IB strain yielded high expressions of some proteins, such as methylmalonyl-CoA epimerase and the Christie-Atkins-Munch-Petersen (CAMP) factor. The present study revealed good congruence between genomic and proteomic data suggesting that the microenvironment of each subtype may influence protein expression. PMID:23878795

  12. The impact of meteorology on the occurrence of waterborne outbreaks of vero cytotoxin-producing Escherichia coli (VTEC): a logistic regression approach.


    O'Dwyer, Jean; Morris Downes, Margaret; Adley, Catherine C


    This study analyses the relationship between meteorological phenomena and outbreaks of waterborne-transmitted vero cytotoxin-producing Escherichia coli (VTEC) in the Republic of Ireland over an 8-year period (2005-2012). Data pertaining to the notification of waterborne VTEC outbreaks were extracted from the Computerised Infectious Disease Reporting system, which is administered through the national Health Protection Surveillance Centre as part of the Health Service Executive. Rainfall and temperature data were obtained from the national meteorological office and categorised as cumulative rainfall, heavy rainfall events in the previous 7 days, and mean temperature. Regression analysis was performed using logistic regression (LR) analysis. The LR model was significant (p < 0.001), with all independent variables: cumulative rainfall, heavy rainfall and mean temperature making a statistically significant contribution to the model. The study has found that rainfall, particularly heavy rainfall in the preceding 7 days of an outbreak, is a strong statistical indicator of a waterborne outbreak and that temperature also impacts waterborne VTEC outbreak occurrence. PMID:26837828

  13. An animal component free medium that promotes the growth of various animal cell lines for the production of viral vaccines.


    Rourou, Samia; Ben Ayed, Yousr; Trabelsi, Khaled; Majoul, Samy; Kallel, Héla


    IPT-AFM is a proprietary animal component free medium that was developed for rabies virus (strain LP 2061) production in Vero cells. In the present work, we demonstrated the versatility of this medium and its ability to sustain the growth of other cell lines and different virus strains. Here, three models were presented: Vero cells/rabies virus (strain LP 2061), MRC-5 cells/measles virus (strain AIK-C) and BHK-21 cells/rabies virus (strain PV-BHK21). The cell lines were first adapted to grow in IPT-AFM, by progressive reduction of the amount of serum in the culture medium. After their adaptation, BHK-21 cells grew in suspension by forming clumps, whereas MRC-5 cells remained adherent. Then, kinetics of cell growth were studied in agitated cultures for both cell lines. In addition, kinetics of virus replication were investigated. PMID:24583007

  14. Effect of spacer layer thickness on multi-stacked InGaAs quantum dots grown on GaAs (311)B substrate for application to intermediate band solar cells

    SciTech Connect

    Shoji, Yasushi; Narahara, Kohei; Okada, Yoshitaka; Tanaka, Hideharu; Kita, Takashi; Akimoto, Katsuhiro


    We have investigated the properties of multi-stacked layers of self-organized In{sub 0.4}Ga{sub 0.6}As quantum dots (QDs) on GaAs (311)B grown by molecular beam epitaxy. We found that a high degree of in-plane ordering of QDs structure with a six-fold symmetry was maintained though the growth has been performed at a higher growth rate than the conventional conditions. The dependence of photoluminescence characteristics on spacer layer thickness showed an increasing degree of electronic coupling between the stacked QDs for thinner spacer layers. The external quantum efficiency for an InGaAs/GaAs quantum dot solar cell (QDSC) with a thin spacer layer thickness increased in the longer wavelength range due to additive contribution from QD layers inserted in the intrinsic region. Furthermore, a photocurrent production by 2-step photon absorption has been observed at room temperature for the InGaAs/GaAs QDSC with a spacer layer thickness of 15 nm.

  15. Nucleolus in clinostat-grown plants

    SciTech Connect

    Shen-Miller, J.; Dannenhoffer, J. ); Hinchman, R. )


    The clinostat is an apparatus that is used to mimic zero gravity in studies of plant growth in the absence of gravitropic response. Clinostat-grown tissue cultures of carrot exhibit significant increases both in the number of nuclei containing more than one nucleolus and in nucleolar volume. Oat seedlings germinated and grown on clinostats exhibit a decreased rate of shoot elongation, increased tissue sensitivity to applied auxin, and an increased response to gravitropic stimulation. Clinostat treatment clearly affects plant metabolism. The nucleolus is the region in the nucleus where ribosome synthesis and assembly take place. The 18S, 5.8S, and 25S ribosomal genes, in tandem units, are located in the nucleolus. Ribosomes orchestrate the production of all proteins that are necessary for the maintenance of cell growth, development, and survival. A full study of the effects of nullification of gravitropism, by clinostat rotation, on nucleolar development in barley has been initiated. The authors study developmental changes of nucleolar number and diameter in clinostat-grown root tissues. Preliminary results show that barley roots exhibit changes in nucleolar number and diameter. Growth rates of barley root and shoot also appear to be reduced, in measurements of both length and weight.

  16. Characteristics of Murayama virus in various cell cultures and laboratory animals.


    Nishikawa, F; Yamamoto, K; Sugiyama, T


    Some biological properties of Murayama virus, a new paramyxovirus, were studied. The virus grew well in primary monkey kidney cells as well as embryonated eggs, while the virus yields in primary chick embryo and BHK-21 cells were much lower. The infected BHK-21 cells formed large syncytia and showed typical hemadsorption, but did not produce any detectable amount of hemagglutinin in the culture fluid. The virus yields were very low in Vero. LLC-MK2 and MDCK cells at first passages. The addition of trypsin to the medium enhanced virus growth in Vero and LLC-MK2 but not in MDCK cells. Cell fusion activity of the virus was observed in Molt-4 cells. Hemolytic activity was enhanced by freeze-thawing. Several species of mammals and birds were susceptible to experimental infections with the virus as evidenced by seroconversion and positive virus isolation without showing any clinical signs. PMID:6790746

  17. Cellular Lipids of a Nocardia Grown on Propane and n-Butane

    PubMed Central

    Davis, J. B.


    Lipid fractions of propane- and n-butane-grown nocardial cells each contain a chloroform-soluble, ether-insoluble polymer not observed previously in liquid n-alkane-grown cells. The polymer in propane-grown cells is poly-β-hydroxybutyrate. The polymer in n-butane-grown cells apparently contains unsaturation in the molecule, and is identified tentatively as a co-polymer of β-hydroxybutyric and β-hydroxybutenoic (specifically 3-hydroxy 2-butenoic) acids. The other major component of the lipid fraction consists of triglycerides containing principally palmitic and stearic acids. There seems to be little qualitative distinction in the glycerides of propane- or n-butane-grown cells. Oxidative assimilation of n-butane is described. PMID:14199017

  18. Cytopathogenesis of Naegleria fowleri Thai strains for cultured human neuroblastoma cells.


    Tiewcharoen, Supathra; Malainual, Nat; Junnu, Virach; Chetanachan, Pruksawan; Rabablert, Jundee


    The aim of this study is to evaluate cellular interaction between free-living amoebae Naegleria fowleri strains and mammalian target cells in vitro. Two Thai strains of N. fowleri; Khon Kaen strain from the environment and Siriraj strain from the patient's cerebrospinal fluid and the Center of Disease Control VO 3081 strain from Atlanta (US) were studied. Human neuroblastoma (SK-N-MC) and African Green monkey Kidney (Vero) cells were used as target cells. Each cell line was inoculated with each strain of N. fowleri at a ratio of 1:1 and observed for 7 days. The uninoculated target cells and each strain of N. fowleri were used as control. The numbers of the challenged and unchallenged cells as well as the free-living amoebae were counted three times by trypan blue exclusion method. The inoculation began when the amoebae attached to the cell membrane and ingested the target cells. In this study, extensive cytopathogenesis with many floating inoculated cells and abundant number of amoebae were observed. The destruction pattern of both inoculated SK-N-MC and Vero target cells were similar. Interestingly, SK-N-MC was more susceptible to N. fowleri strains than the Vero cell. In addition, N. fowleri Siriraj strain showed the highest destruction pattern for each target cell. Our findings suggest that the SK-N-MC should be used as a base model for studying the neuropathogenesis in primary amoebic meningoencephalitis patients. PMID:18214541

  19. Characterization of silicon crystals grown by the heat exchanger method

    SciTech Connect

    Hyland, S.; Dumas, K.A.; Engelbrecht, J.A.A.; Leung, D.; Schwuttke, G.M.


    Silicon ingots grown by the Heat Exchanger Method (HEM) as large as 45 kg in mass (34 cm x 34 cm x 17 cm) are characterized electrically and structurally. The defect state in the crystal is related to the solar cell efficiency. Such characterization indicates that the solar cell efficiency of HEM crystals is limited by the crystal perfection, but that HEM silicon has the potential to yield silicon with quality comparable to Cz grown silicon. A new approach to grow HEM material of better quality is discussed.

  20. Protein Crystals Grown in Space

    NASA Technical Reports Server (NTRS)


    A collage of protein and virus crystals, many of which were grown on the U.S. Space Shuttle or Russian Space Station, Mir. The crystals include the proteins canavalin; mouse monoclonal antibody; a sweet protein, thaumatin; and a fungal protease. Viruses are represented here by crystals of turnip yellow mosaic virus and satellite tobacco mosaic virus. The crystals are photographed under polarized light (thus causing the colors) and range in size from a few hundred microns in edge length up to more than a millimeter. All the crystals are grown from aqueous solutions and are useful for X-ray diffraction analysis. Credit: Dr. Alex McPherson, University of California, Irvine.

  1. Evidence that an internal carbonic anhydrase is present in 5% CO/sub 2/-grown and air-grown Chlamydomonas. [Chlamydomonas reinhardtii

    SciTech Connect

    Moroney, J.V.; Togasaki, R.K.; Husic, H.D.; Tolbert, N.E.


    Inorganic carbon (C/sub i/) uptake was measured in wild-type cells of Chlamydomonas reinhardtii, and in cia-3, a mutant strain of C. reinhardtii that cannot grow with air levels of CO/sub 2/. Both air-grown cells, that have a CO/sub 2/ concentrating system, and 5% CO/sub 2/-grown cells that do not have this system, were used. When the external pH was 5.1 or 7.3, air-grown, wild-type cells accumulated inorganic carbon (C/sub i/) and this accumulation was enhanced when the permeant carbonic anhydrase inhibitor, ethoxyzolamide, was added. When the external pH was 5.1, 5% CO/sub 2/-grown cells also accumulated some C/sub i/, although not as much as air-grown cells and this accumulation was stimulated by the addition of ethoxyzolamide. At the same time, ethoxyzolamide inhibited CO/sub 2/ fixation by high CO/sub 2/-grown, wild-type cells at both pH 5.1 and 7.3. These observations imply that 5% CO/sub 2/-grown, wild-type cells, have a physiologically important internal carbonic anhydrase, although the major carbonic anhydrase located in the periplasmic space is only present in air-grown cells. Inorganic carbon uptake by cia-3 cells supported this conclusion. This mutant strain, which is thought to lack an internal carbonic anhydrase, was unaffected by ethoxyzolamide at pH 5.1. Other physiological characteristics of cia-3 resemble those of wild-type cells that have been treated with ethoxyzolamide. It is concluded that an internal carbonic anhydrase is under different regulatory control than the periplasmic carbonic anhydrase.

  2. Extremely low-frequency electromagnetic fields cause DNA strand breaks in normal cells

    PubMed Central


    Background Extremely low frequency electromagnetic fields aren’t considered as a real carcinogenic agent despite the fact that some studies have showed impairment of the DNA integrity in different cells lines. The aim of this study was evaluation of the late effects of a 100 Hz and 5.6 mT electromagnetic field, applied continuously or discontinuously, on the DNA integrity of Vero cells assessed by alkaline Comet assay and by cell cycle analysis. Normal Vero cells were exposed to extremely low frequency electromagnetic fields (100 Hz, 5.6 mT) for 45 minutes. The Comet assay and cell cycle analysis were performed 48 hours after the treatment. Results Exposed samples presented an increase of the number of cells with high damaged DNA as compared with non-exposed cells. Quantitative evaluation of the comet assay showed a significantly (<0.001) increase of the tail lengths, of the quantity of DNA in tail and of Olive tail moments, respectively. Cell cycle analysis showed an increase of the frequency of the cells in S phase, proving the occurrence of single strand breaks. The most probable mechanism of induction of the registered effects is the production of different types of reactive oxygen species. Conclusions The analysis of the registered comet indices and of cell cycle showed that extremely low frequency electromagnetic field of 100 Hz and 5.6 mT had a genotoxic impact on Vero cells. PMID:24401758

  3. Fatty acid composition of Cladosporium resinae grown on glucose and on hydrocarbons.


    Cooney, J J; Proby, C M


    Cladosporium resinae was grown in submerged cultures on glucose; on Jet-A commercial aviation fuel; and on a series of n-alkanes, n-decane through n-tetradecane. Cell yield was greatest on glucose and least on Jet-A; n-alkanes were intermediate. Among n-alkanes cell yield decreased as chain length increased, except for n-dodecane, which supported less growth than n-tridecane or n-tetradecane. The total fatty acids of stationary-phase cells were analyzed by gas-liquid chromatography. In all cases the predominant fatty acids were 16:0, 18:1, and 18:2. The fatty acid composition of glucose-grown cells was similar to that of hydrocarbon-grown cells. Cells grown on n-tridecane or n-tetradecane yielded small amounts of acids homologous to the carbon source, but a similar correlation was not noted for n-decane, n-undecane, or n-dodecane. Cells grown on n-undecane or n-tridecane contained more odd-carbon fatty acids than cells grown on the other substrates, and the effect was more pronounced in n-tridecane-grown cells. Thus, the fatty acids of this organism are derived chiefly from de novo synthesis rather than from direct incorporation of oxidized hydrocarbons. The extent of direct incorporation increases as the chain length of the hydrocarbon growth substrate is increased. PMID:5166858

  4. Reduced virulence of Pseudomonas aeruginosa grown in the presence of benzalkonium chloride.


    Adair, F W; Liauw, H L; Geftic, S G; Gelzer, J


    Resistant cells of Pseudomonas aeruginosa ATCC 9027 which were grown in the presence of 1 mg of benzalkonium chloride (BC) per ml caused only a mild conjunctivitis when they were dropped onto the scratched corneas of rabbits. In contrast, cells of the BC-sensitive parent strain induced a severe keratoconjunctivitis. In addition, the BC-grown cells also had a reduced capacity to produce kidney infections in mice as compared to the parent strain. BC-grown cells acted as weak complex antigens which conferred slight protection against lethal doses of BC-grown cells. No cross-protection to cells of the parent strain occurred. The data indicate that growth in the presence of BC results in cells with reduced virulence. PMID:809470

  5. Dendritic cells in antitumor immune responses. II. Dendritic cells grown from bone marrow precursors, but not mature DC from tumor-bearing mice, are effective antigen carriers in the therapy of established tumors.


    Gabrilovich, D I; Nadaf, S; Corak, J; Berzofsky, J A; Carbone, D P


    Antitumor CTL responses were studied in a model tumor hearing a mutant human p53 gene. We found ineffective induction of antitumor CTL in mice bearing these tumors associated with measurable defects in the function of dendritic cells (DC) from these animals. In this study we investigate the mechanism of this defect in mature DC and find that functional DC can be generated by growth from the bone marrow of tumor-hearing animals. Tumor cell supernatants did not affect the function of mature DC obtained from the spleen of tumor-bearing animals, but significantly suppressed the ability to generate functional DC from the bone marrow of control mice in vitro. This suggests that tumor cells may release factors which block early stages of DC maturation from precursors. DC generated from the bone marrow of tumor-bearing mice showed normal potential to stimulate allogeneic T cells, to stimulate anti-mutant p53 peptide-specific cytotoxic T cells, and to induce anti-p53 CTL responses in vivo in control mice. Repeated immunization with peptide-pulsed DC generated from the bone marrow of control mice (every 4-5 days) blocked progression of established tumors. Immunization of mice with peptide-pulsed DC obtained from the spleen of tumor-bearing mice (4 weeks after tumor injection) did not affect the tumor growth, whereas immunization with peptide-pulsed DC generated from bone marrow of tumor-bearing mice resulted in significantly prolonged survival and delayed tumor growth. Tumor progression was associated with change of the balance Th1/Th2 cells in favor of the Th2-like cytokine profile, while effective immunization was associated with a shift to the Th1 phenotype. Thus, frequent immunization of mice with mutant p53 peptide-pulsed DC generated from stem cells of tumor-bearing hosts can induce effective antitumor CTL responses associated with production of Th1 cells and lead to significant antitumor effects. PMID:8665591

  6. Authentication of African green monkey cell lines using human short tandem repeat markers

    PubMed Central


    Background Tools for authenticating cell lines are critical for quality control in cell-based biological experiments. Currently there are methods to authenticate human cell lines using short tandem repeat (STR) markers based on the technology and procedures successfully used in the forensic community for human identification, but there are no STR based methods for authenticating nonhuman cell lines to date. There is significant homology between the human and vervet monkey genome and we utilized these similarities to design the first multiplex assay based on human STR markers for vervet cell line identification. Results The following STR markers were incorporated into the vervet multiplex PCR assay: D17S1304, D5S1467, D19S245, D1S518, D8S1106, D4S2408, D6S1017, and DYS389. The eight markers were successful in uniquely identifying sixty-two vervet monkey DNA samples and confirmed that Vero76 cells and COS-7 cells were derived from Vero and CV-1 cells, respectively. The multiplex assay shows specificity for vervet DNA within the determined allele range for vervet monkeys; however, the primers will also amplify human DNA for each marker resulting in amplicons outside the vervet allele range in several of the loci. The STR markers showed genetic stability in over sixty-nine passages of Vero cells, suggesting low mutation rates in the targeted STR sequences in the Vero cell line. Conclusions A functional vervet multiplex assay consisting of eight human STR markers with heterozygosity values ranging from 0.53-0.79 was successful in uniquely identifying sixty-two vervet monkey samples. The probability of a random match using these eight markers between any two vervet samples is approximately 1 in 1.9 million. While authenticating a vervet cell line, the multiplex assay may also be a useful indicator for human cell line contamination since the assay is based on human STR markers. PMID:22059503

  7. Investigation of the uptake of drugs, carcinogens and mutagens by individual mammalian cells using a scanning proton microprobe

    NASA Astrophysics Data System (ADS)

    Cholewa, M.; Turnbull, I. F.; Legge, G. J. F.; Weigold, H.; Marcuccio, S. M.; Holan, G.; Tomlinson, E.; Wright, P. J.; Dillon, C. T.; Lay, P. A.; Bonin, A. M.


    The use of micro-PIXE [1] in measuring the quantitative uptake of drugs containing metal atoms by individual Vero cells (African green monkey kidney cell line) and V79 Chinese hamster lung cells is demonstrated. One class of drugs, heteropolytungstates, which are being assessed for activity against the HIV virus, were studied using Vero cells. The cellular uptake of a series of chromium compounds, including carcinogens and mutagens, in which the metal oxidation state was either (III), (V) or (VI), was measured using V79 cells. It was found that, unlike any other techniques, scanning proton microprobe (SPM) offers both the sensitivity and spatial resolution to carry out unicellular analysis. The use of cultured cell lines in these analyses was shown to have distinct advantages over cells such as peripheral blood lymphocytes (PBLs).

  8. A Novel Cell-Based Method to Detect Shiga Toxin 2 from Escherichia coli O157:H7 and Inhibitors of Toxin Activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Escherichia coli O157:H7 is a leading cause of foodborne illness. This human pathogen produces Shiga toxins (Stx1 and Stx2) which inhibit protein synthesis by inactivating ribosome function. The present study describes a novel cell-based assay to detect Stxs and inhibitors of Stx activity. A Vero...

  9. Cell culture adaptation of Puumala hantavirus changes the infectivity for its natural reservoir, Clethrionomys glareolus, and leads to accumulation of mutants with altered genomic RNA S segment.

    PubMed Central

    Lundkvist, A; Cheng, Y; Sjölander, K B; Niklasson, B; Vaheri, A; Plyusnin, A


    This paper reports the establishment of a model for hantavirus host adaptation. Wild-type (wt) (bank vole-passaged) and Vero E6 cell-cultured variants of Puumala virus strain Kazan were analyzed for their virologic and genetic properties. The wt variant was well adapted for reproduction in bank voles but not in cell culture, while the Vero E6 strains replicated to much higher efficiency in cell culture but did not reproducibly infect bank voles. Comparison of the consensus sequences of the respective viral genomes revealed no differences in the coding region of the S gene. However, the noncoding regions of the S gene were found to be different at positions 26 and 1577. In one additional and independent adaptation experiment, all analyzed cDNA clones from the Vero E6-adapted variant were found to carry substitutions at position 1580 of the S segment, just 3 nucleotides downstream of the mutation observed in the first adaptation. No differences were found in the consensus sequences of the entire M segments from the wt and the Vero E6-adapted variants. The results indicated different impacts of the S and the M genomic segments for the adaptation process and selective advantages for the variants that carried altered noncoding sequences of the S segment. We conclude that the isolation in cell culture resulted in a phenotypically and genotypically altered hantavirus. PMID:9371614

  10. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    Dr. Lisa E. Freed of the Massachusetts Institute of Technology and her colleagues have reported that initially disc-like specimens tend to become spherical in space, demonstrating that tissues can grow and differentiate into distinct structures in microgravity. The Mir Increment 3 (Sept. 16, 1996 - Jan. 22, 1997) samples were smaller, more spherical, and mechanically weaker than Earth-grown control samples. These results demonstrate the feasibility of microgravity tissue engineering and may have implications for long human space voyages and for treating musculoskeletal disorders on earth. Final samples from Mir and Earth appeared histologically cartilaginous throughout their entire cross sections (5-8 mm thick), with the exception of fibrous outer capsules. Constructs grown on Earth (A) appeared to have a more organized extracellular matrix with more uniform collagen orientation as compared with constructs grown on Mir (B), but the average collagen fiber diameter was similar in the two groups (22 +- 2 nm) and comparable to that previously reported for developing articular cartilage. Randomly oriented collagen in Mir samples would be consistent with previous reports that microgravity disrupts fibrillogenesis. These are transmission electron micrographs of constructs from Mir (A) and Earth (B) groups at magnifications of x3,500 and x120,000 (Inset). The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Credit: Proceedings of the National Academy of Sciences.

  11. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    Dr. Lisa E. Freed of the Massachusetts Institute of Technology and her colleagues have reported that initially disc-like specimens of cartilage tend to become spherical in space, demonstrating that tissues can grow and differentiate into distinct structures in microgravity. The Mir Increment 3 (Sept. 16, 1996 - Jan. 22, 1997) samples were smaller, more spherical, and mechanically weaker than Earth-grown control samples. These results demonstrate the feasibility of microgravity tissue engineering and may have implications for long human space voyages and for treating musculoskeletal disorders on earth. Constructs grown on Mir (A) tended to become more spherical, whereas those grown on Earth (B) maintained their initial disc shape. These findings might be related to differences in cultivation conditions, i.e., videotapes showed that constructs floated freely in microgravity but settled and collided with the rotating vessel wall at 1g (Earth's gravity). In particular, on Mir the constructs were exposed to uniform shear and mass transfer at all surfaces such that the tissue grew equally in all directions, whereas on Earth the settling of discoid constructs tended to align their flat circular areas perpendicular to the direction of motion, increasing shear and mass transfer circumferentially such that the tissue grew preferentially in the radial direction. A and B are full cross sections of constructs from Mir and Earth groups shown at 10-power. C and D are representative areas at the construct surfaces enlarged to 200-power. They are stained red with safranin-O. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Photo credit: Proceedings of the National Academy of Sciences.

  12. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    For 5 days on the STS-70 mission, a bioreactor cultivated human colon cancer cells, such as the culture section shown here, which grew to 30 times the volume of control specimens grown on Earth. This significant result was reproduced on STS-85 which grew mature structures that more closely match what are found in tumors in humans. The two white circles within the tumor are part of a plastic lattice that helped the cells associate. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators.

  13. Electron microscopy of Mycoplasma pneumoniae microcolonies grown on solid surfaces.

    PubMed Central

    Kim, C K; Pfister, R M; Somerson, N L


    Mycoplasma pneumoniae sprain CL-8 was studied by using various surfaces for adherence and growth. Cells grown on Epon 812, Formvar, carbon, and glass were of similar morphology. Thin Epon pieces were good material for culturing the organisms and examining thin-sectioned microcolonies by transmission electron microscopy. Images PMID:931378

  14. Penetration and intracellular growth of Brucella abortus in nonphagocytic cells in vitro.

    PubMed Central

    Detilleux, P G; Deyoe, B L; Cheville, N F


    In pregnant ruminants, Brucella abortus localizes and replicates within the rough endoplasmic reticulum of trophoblastic epithelial cells. In this study, Vero cells were exposed to B. abortus to investigate its internalization and intracellular growth in nonphagocytic cells. A new double-fluorescence staining procedure to discriminate between extracellular and intracellular bacteria was developed. Studies with the double-fluorescence staining procedure and quantitative bacteriologic culture of disrupted host cells showed that various B. abortus strains replicated within Vero cells, including smooth virulent (strains 2308S and 544), smooth attenuated (strain 19), and rough (strains 45/20 and 2308R) strains. Rough brucellae were more adherent and entered a greater number of Vero cells. Intracellular replication occurred in a larger percentage of cells with smooth virulent (2308S and 544) strains than with smooth attenuated (19) or rough (45/20 and 2308R) strains. Differences in adhesiveness and invasiveness were correlated to hydrophobicity of the organism, as measured by hydrocarbon adherence. Ultrastructurally, intracellular smooth (2308S) and rough (45/20) brucellae were consistently found within cisternae of the rough endoplasmic reticulum and nuclear envelope. The results suggest that transfer to the rough endoplasmic reticulum is the limiting step in the infection of nonphagocytic cells by B. abortus. Images PMID:2114362

  15. Measurement of exhaled nitric oxide concentration in asthma: a systematic review and economic evaluation of NIOX MINO, NIOX VERO and NObreath.

    PubMed Central

    Harnan, Sue E; Tappenden, Paul; Essat, Munira; Gomersall, Tim; Minton, Jon; Wong, Ruth; Pavord, Ian; Everard, Mark; Lawson, Rod


    BACKGROUND High fractions of exhaled nitric oxide (FeNO) in the breath of patients with symptoms of asthma are correlated with high levels of eosinophils and indicate that a patient is likely to respond to inhaled corticosteroids. This may have a role in the diagnosis and management of asthma. OBJECTIVE To assess the diagnostic accuracy, clinical effectiveness and cost-effectiveness of the hand-held electrochemical devices NIOX MINO(®) (Aerocrine, Solna, Sweden), NIOX VERO(®) (Aerocrine) and NObreath(®) (Bedfont Scientific, Maidstone, UK) for the diagnosis and management of asthma. DATA SOURCES Systematic searches were carried out between March 2013 and April 2013 from database inception. Databases searched included MEDLINE, EMBASE, the Cochrane Database of Systematic Reviews, the Database of Abstracts of Reviews of Effects, Science Citation Index Expanded and Conference Proceedings Citation Index - Science. Trial registers such as and the metaRegister of Controlled Trials were also searched in March 2013. All searches were updated in September 2013. REVIEW METHODS A rapid review was conducted to assess the equivalence of hand-held and chemiluminescent FeNO monitors. Systematic reviews of diagnostic accuracy and management efficacy were conducted. A systematic review of economic analyses was also conducted and two de novo health economic models were developed. All three reviews were undertaken according to robust high-quality methodology. RESULTS The rapid review (27 studies) found varying levels of agreement between monitors (Bland-Altman 95% limits of agreement up to ±10 parts per billion), with better agreement at lower FeNO values. Correlation was good (generally r > 0.9). The diagnostic accuracy review identified 22 studies in adults (all ages) and four in children. No studies used NObreath or NIOX VERO and seven used NIOX MINO. Estimates of diagnostic accuracy varied widely. FeNO used in combination with another test altered diagnostic accuracy only slightly. High levels of heterogeneity precluded meta-analysis. Limited observations included that FeNO may be more reliable and useful as a rule-in than as a rule-out test; lower cut-off values in children and in smokers may be appropriate; and FeNO may be less reliable in the elderly. The management review identified five randomised controlled trials in adults, one in pregnant asthmatics and seven in children. Despite clinical heterogeneity, exacerbation rates were lower in all studies but not generally statistically significantly so. Effects on inhaled corticosteroid (ICS) use were inconsistent, possibly because of differences in management protocols, differential effectiveness in adults and children and differences in population severity. One UK diagnostic model and one management model were identified. Aerocrine also submitted diagnostic and management models. All had significant limitations including short time horizons and the selective use of efficacy evidence. The de novo diagnostic model suggested that the expected difference in quality-adjusted life-year (QALY) gains between diagnostic options is likely to be very small. Airway hyper-responsiveness by methacholine challenge test is expected to produce the greatest QALY gain but with an expected incremental cost-effectiveness ratio (ICER) compared with FeNO (NObreath) in combination with bronchodilator reversibility of £1.125M per QALY gained. All remaining options are expected to be dominated. The de novo management model indicates that the ICER of guidelines plus FeNO monitoring using NObreath compared with guidelines alone in children is expected to be approximately £45,200 per QALY gained. Within the adult subgroup, FeNO monitoring using NObreath compared with guidelines alone is expected to have an ICER of approximately £2100 per QALY gained. The results are particularly sensitive to assumptions regarding changes in ICS use over time, the number of nurse visits for FeNO monitoring and duration of effect. CONCLUSIONS Limitations of the evidence base impose considerable uncertainty on all analyses. Equivalence of devices was assumed but not assured. Evidence for diagnosis is difficult to interpret in the context of inserting FeNO monitoring into a diagnostic pathway. Evidence for management is also inconclusive, but largely consistent with FeNO monitoring resulting in fewer exacerbations, with a small or zero reduction in ICS use in adults and a possible increased ICS use in children or patients with more severe asthma. It is unclear which specific management protocol is likely to be most effective. The economic analysis indicates that FeNO monitoring could have value in diagnostic and management settings. The diagnostic model indicates that FeNO monitoring plus bronchodilator reversibility dominates many other diagnostic tests. FeNO-guided management has the potential to be cost-effective, although this is largely dependent on the duration of effect. The conclusions drawn from both models require strong technical value judgements with respect to several aspects of the decision problem in which little or no empirical evidence exists. There are many potential directions for further work, including investigations into which management protocol is best and long-term follow-up in both diagnosis and management studies. STUDY REGISTRATION This study is registered as PROSPERO CRD42013004149. FUNDING The National Institute for Health Research Health Technology Assessment programme. PMID:26484874

  16. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.


    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  17. Development and strategies of cell-culture technology for influenza vaccine.


    Feng, Shao-Zhen; Jiao, Pei-Rong; Qi, Wen-Bao; Fan, Hui-Ying; Liao, Ming


    Influenza is a pandemic contagious disease and causes human deaths and huge economic destruction of poultry in the world. In order to control and prevent influenza, mainly type A, influenza vaccine for human and poultry were available since the 1940s and 1920s, respectively. In the development of vaccine production, influenza viruses were cultured originally from chicken embryos to anchorage-dependent cell lines, such as MDCK and Vero. The anchorage-independent lines have also been used to produce influenza virus, such as PER.C6 and engineering modified MDCK and Vero. During the process of influenza vaccine production, the common problem faced by all producers is how to improve the titer of influenza virus. This paper focuses on the developments of cell culture for influenza virus vaccine production, limitations of cell culture, and relative strategies for improvement virus yields in cell-culture systems. PMID:21063703

  18. Influence of FcγRIIa-Expressing Cells on the Assessment of Neutralizing and Enhancing Serum Antibodies Elicited by a Live-Attenuated Tetravalent Dengue Vaccine

    PubMed Central

    Byers, Anthony M.; Broder, Ryan; Haupfear, Kelly; Timiryasova, Tatyana M.; Hu, Branda T.; Boaz, Mark; Warren, William L.; Jackson, Nicholas; Moser, Janice M.; Guy, Bruno


    Background. Recent trials of recombinant, live-attenuated chimeric yellow fever-dengue tetravalent dengue vaccine (CYD-TDV) demonstrated efficacy against symptomatic, virologically confirmed dengue disease with higher point estimates of efficacy toward dengue virus (DENV)3 and DENV4 and moderate levels toward DENV1 and DENV2. It is interesting to note that serotype-specific efficacy did not correlate with absolute neutralizing antibody (nAb) geometric mean titer (GMT) values measured in a Vero-based plaque reduction neutralization test assay. The absence of Fcγ receptors on Vero cells may explain this observation. Methods. We performed parallel seroneutralization assays in Vero cells and CV-1 cells that express FcγRIIa (CV-1-Fc) to determine the neutralizing and enhancing capacity of serotype-specific DENV Abs present in CYD-TDV clinical trial sera. Results. Enhancement of DENV infection was observed in CV-1-Fc cells in naturally exposed nonvaccine sera, mostly for DENV3 and DENV4, at high dilutions. The CYD-TDV-vaccinated sera showed similar enhancement patterns. The CV-1-Fc nAb GMT values were 2- to 9-fold lower than Vero for all serotypes in both naturally infected individuals and CYD-TDV-vaccinated subjects with and without previous dengue immunity. The relative (CV-1-Fc/Vero) GMT decrease for anti-DENV1 and anti-DENV2 responses was not greater than for the other serotypes. Conclusions. In vitro neutralization assays utilizing FcγRIIa-expressing cells provide evidence that serotype-specific Ab enhancement may not be a primary factor in the serotype-specific efficacy differences exhibited in the CYD-TDV trials. PMID:26719844

  19. Influence of FcγRIIa-Expressing Cells on the Assessment of Neutralizing and Enhancing Serum Antibodies Elicited by a Live-Attenuated Tetravalent Dengue Vaccine.


    Byers, Anthony M; Broder, Ryan; Haupfear, Kelly; Timiryasova, Tatyana M; Hu, Branda T; Boaz, Mark; Warren, William L; Jackson, Nicholas; Moser, Janice M; Guy, Bruno


    Background.  Recent trials of recombinant, live-attenuated chimeric yellow fever-dengue tetravalent dengue vaccine (CYD-TDV) demonstrated efficacy against symptomatic, virologically confirmed dengue disease with higher point estimates of efficacy toward dengue virus (DENV)3 and DENV4 and moderate levels toward DENV1 and DENV2. It is interesting to note that serotype-specific efficacy did not correlate with absolute neutralizing antibody (nAb) geometric mean titer (GMT) values measured in a Vero-based plaque reduction neutralization test assay. The absence of Fcγ receptors on Vero cells may explain this observation. Methods.  We performed parallel seroneutralization assays in Vero cells and CV-1 cells that express FcγRIIa (CV-1-Fc) to determine the neutralizing and enhancing capacity of serotype-specific DENV Abs present in CYD-TDV clinical trial sera. Results.  Enhancement of DENV infection was observed in CV-1-Fc cells in naturally exposed nonvaccine sera, mostly for DENV3 and DENV4, at high dilutions. The CYD-TDV-vaccinated sera showed similar enhancement patterns. The CV-1-Fc nAb GMT values were 2- to 9-fold lower than Vero for all serotypes in both naturally infected individuals and CYD-TDV-vaccinated subjects with and without previous dengue immunity. The relative (CV-1-Fc/Vero) GMT decrease for anti-DENV1 and anti-DENV2 responses was not greater than for the other serotypes. Conclusions.  In vitro neutralization assays utilizing FcγRIIa-expressing cells provide evidence that serotype-specific Ab enhancement may not be a primary factor in the serotype-specific efficacy differences exhibited in the CYD-TDV trials. PMID:26719844

  20. Fine Structure of Cryptococcus neoformans Grown In Vivo as Observed by Freeze-Etching

    PubMed Central

    Takeo, K.; Uesaka, I.; Uehira, K.; Nishiura, M.


    Cryptococcus neoformans grown in the parasitic state was observed by the freeze-etching technique and was compared with that grown on culture media. Unlike other yeasts, this organism grown in vivo is very often devoid of the “ordinary” invaginations. The membrane of the cell grown in vivo was almost free from concavity and convexity except for many round depressions which represent the surface view of paramural bodies. Some of the paramural bodies were found to be multivesicular systems. Most were spherical invaginations containing a single vesicle or its ghost remaining after secretion of the vesicles. In clear contrast to the cell grown in vitro, the in vivo cell contained a great number of vesicles in the cytoplasm. These seemed to show high-secretion activity in C. neoformans grown in the parasitic state. On transfer from in vitro to in vivo, this organism enlarged the cell wall, capsule, and cell body. The appearance of a large vacuole, accumulation of storage organelles, and the existence of rodlike structures, seemingly lipid deposits, were also noted in the cytoplasm of the cell grown in vivo. the meaning of these results as well as the mode of capsular production are discussed. Images PMID:4570787

  1. Fourier Transform Infrared spectroscopy discloses different types of cell death in flow cytometrically sorted cells.


    Le Roux, K; Prinsloo, L C; Meyer, D


    Fourier Transform Infrared (FTIR) spectroscopy is a label free methodology showing promise in characterizing different types of cell death. Cervical adenocarcinoma (HeLa) and African monkey kidney (Vero) cells were treated with a necrosis inducer (methanol), novel apoptotic inducers (diphenylphosphino gold (I) complexes) and positive control, auranofin. Following treatment, cells stained with annexin-V and propidium iodide were sorted using a Fluorescence Activated Cell Sorter (FACS Aria) to obtain populations consisting of either viable, necrotic or apoptotic cells. Transmission Electron Microscopy confirmed successful sorting of all three populations. Four bands were identified which could discriminate between viable and necrotic cells namely 989 cm(-1), 2852 cm(-1), 2875 cm(-1) and 2923 cm(-1). In HeLa cells viable and induced apoptosis could be distinguished by 1294 cm(-1), while four bands were different in Vero cells namely; 1626 cm(-1), 1741 cm(-1), 2852 cm(-1) 2923 cm(-1). Principal Component Analysis showed separation between the different types of cell death and the loadings plots indicated an increase in an additional band at 1623 cm(-1) in dead cells. FTIR spectroscopy can be developed into an invaluable tool for the assessment of specific types of chemically induced cell death with notably different molecular signatures depending on whether the cells are cancerous and mechanism of cell death. PMID:26254093

  2. Defining the N-linked glycosylation site of Hantaan virus envelope glycoproteins essential for cell fusion.


    Zheng, Feng; Ma, Lixian; Shao, Lihua; Wang, Gang; Chen, Fengzhe; Zhang, Ying; Yang, Song


    The Hantaan virus (HTNV) is an enveloped virus that is capable of inducing low pH-dependent cell fusion. We molecularly cloned the viral glycoprotein (GP) and nucleocapsid (NP) cDNA of HTNV and expressed them in Vero E6 cells under the control of a CMV promoter. The viral gene expression was assessed using an indirect immunofluorescence assay and immunoprecipitation. The transfected Vero E6 cells expressing GPs, but not those expressing NP, fused and formed a syncytium following exposure to a low pH. Monoclonal antibodies (MAbs) against envelope GPs inhibited cell fusion, whereas MAbs against NP did not. We also investigated the N-linked glycosylation of HTNV GPs and its role in cell fusion. The envelope GPs of HTNV are modified by N-linked glycosylation at five sites: four sites on G1 (N134, N235, N347, and N399) and one site on G2 (N928). Site-directed mutagenesis was used to construct eight GP gene mutants, including five single N-glycosylation site mutants and three double-site mutants, which were then expressed in Vero E6 cells. The oligosaccharide chain on residue N928 of G2 was found to be crucial for cell fusion after exposure to a low pH. These results suggest that G2 is likely to be the fusion protein of HTNV. PMID:17342054

  3. Cytotoxic effects of mycotoxin combinations in mammalian kidney cells.


    Ruiz, María-José; Macáková, Petra; Juan-García, Ana; Font, Guillermina


    The cytotoxicity of three Fusarium mycotoxins (beauvericin, deoxynivalenol and T-2 toxin) has been investigated using the NR assay, after 24, 48 and 72h of incubation. The IC(50) values ranged from 6.77 to 11.08, 3.30 to 10.00 and 0.004 to 0.005 for beauvericin, deoxynivalenol and T-2 toxin, respectively. Once the potential interaction has been detected, a quantitative assessment is necessary to ensure and characterize these interactions, that is, each mycotoxin contributes to the toxic effect in accord with its own potency. Combination of mycotoxins was determined in Vero cells after 24, 48 and 72h of exposure. Isobolograms and median effect method of Chou and Talalay were used to assess the nature and quantitative aspects of interaction observed between studied mycotoxins. Median effect analysis was used to calculate the combination index (CI) with values >1 indicating synergism, 1 additive effect, and <1 antagonism. CI values of BEA+DON (1.22-2.74), BEA+T-2 toxin (1.43-5.89), DON+T-2 toxin (3.13-7.62) and BEA+DON+T-2 toxin (1.32-2.68) for 24, 48 and 72h produced antagonistic effects in Vero cells. The highest antagonistic effect in Vero cells was observed with binary DON and T-2 toxin mixture. PMID:21798303

  4. Chromosome Conformation of Human Fibroblasts Grown in 3-Dimensional Spheroids

    PubMed Central

    Chen, Haiming; Comment, Nicholas; Chen, Jie; Ronquist, Scott; Hero, Alfred; Ried, Thomas; Rajapakse, Indika


    In the study of interphase chromosome organization, genome-wide chromosome conformation capture (Hi-C) maps are often generated using 2-dimensional (2D) monolayer cultures. These 2D cells have morphological deviations from cells that exist in 3-dimensional (3D) tissues in vivo, and may not maintain the same chromosome conformation. We used Hi-C maps to test the extent of differences in chromosome conformation between human fibroblasts grown in 2D cultures and those grown in 3D spheroids. Significant differences in chromosome conformation were found between 2D cells and those grown in spheroids. Intra-chromosomal interactions were generally increased in spheroid cells, with a few exceptions, while inter-chromosomal interactions were generally decreased. Overall, chromosomes located closer to the nuclear periphery had increased intra-chromosomal contacts in spheroid cells, while those located more centrally had decreased interactions. This study highlights the necessity to conduct studies on the topography of the interphase nucleus under conditions that mimic an in vivo environment. PMID:25738643

  5. Characterization of dengue virus 2 growth in megakaryocyte-erythrocyte progenitor cells.


    Clark, Kristina B; Hsiao, Hui-Mien; Bassit, Leda; Crowe, James E; Schinazi, Raymond F; Perng, Guey Chuen; Villinger, Francois


    Megakaryocyte-erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. PMID:27058763

  6. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.


    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  7. High-efficiency solar cells fabricated from direct-current magnetron sputtered n-indium tin oxide onto p-InP grown by atmospheric pressure metalorganic vapor phase epitaxy

    NASA Technical Reports Server (NTRS)

    Li, X.; Wanlass, M. W.; Gessert, T. A.; Emery, K. A.; Coutts, T. J.


    An attempt is made to improve device efficiencies by depositing indium tin oxide onto epitaxially grown p-InP on p(+)-InP substrates. This leads to a reduction in the device series resistance, high-quality reproducible surfaces, and an improvement in the transport properties of the base layer. Moreover, many of the facets associated with badly characterized bulk liquid encapsulated Czochralski substrates used in previous investigations are removed in this way.

  8. Infectious dengue vesicles derived from CD61+ cells in acute patient plasma exhibited a diaphanous appearance.


    Hsu, Alan Yi-Hui; Wu, Shang-Rung; Tsai, Jih-Jin; Chen, Po-Lin; Chen, Ya-Ping; Chen, Tsai-Yun; Lo, Yu-Chih; Ho, Tzu-Chuan; Lee, Meed; Chen, Min-Ting; Chiu, Yen-Chi; Perng, Guey Chuen


    The levels of neutralizing antibody to a pathogen are an effective indicator to predict efficacy of a vaccine in trial. And yet not all the trial vaccines are in line with the theory. Using dengue virus (DENV) to investigate the viral morphology affecting the predictive value, we evaluated the viral morphology in acute dengue plasma compared to that of Vero cells derived DENV. The virions in plasma were infectious and heterogeneous in shape with a "sunny-side up egg" appearance, viral RNA was enclosed with CD61+ cell-derived membrane interspersed by the viral envelope protein, defined as dengue vesicles. The unique viral features were also observed from ex vivo infected human bone marrow. Dengue vesicles were less efficiently neutralized by convalescent patient serum, compared to virions produced from Vero cells. Our results exhibit a reason why potencies of protective immunity fail in vivo and significantly impact dengue vaccine and drug development. PMID:26657027

  9. Infectious dengue vesicles derived from CD61+ cells in acute patient plasma exhibited a diaphanous appearance

    PubMed Central

    Hsu, Alan Yi-Hui; Wu, Shang-Rung; Tsai, Jih-Jin; Chen, Po-Lin; Chen, Ya-Ping; Chen, Tsai-Yun; Lo, Yu-Chih; Ho, Tzu-Chuan; Lee, Meed; Chen, Min-Ting; Chiu, Yen-Chi; Perng, Guey Chuen


    The levels of neutralizing antibody to a pathogen are an effective indicator to predict efficacy of a vaccine in trial. And yet not all the trial vaccines are in line with the theory. Using dengue virus (DENV) to investigate the viral morphology affecting the predictive value, we evaluated the viral morphology in acute dengue plasma compared to that of Vero cells derived DENV. The virions in plasma were infectious and heterogeneous in shape with a “sunny-side up egg” appearance, viral RNA was enclosed with CD61+ cell-derived membrane interspersed by the viral envelope protein, defined as dengue vesicles. The unique viral features were also observed from ex vivo infected human bone marrow. Dengue vesicles were less efficiently neutralized by convalescent patient serum, compared to virions produced from Vero cells. Our results exhibit a reason why potencies of protective immunity fail in vivo and significantly impact dengue vaccine and drug development. PMID:26657027

  10. Scaffold hybridization in generation of indenoindolones as anticancer agents that induce apoptosis with cell cycle arrest at G2/M phase.


    Kashyap, Maneesh; Das, Dipon; Preet, Ranjan; Mohapatra, Purusottam; Satapathy, Shakti Ranjan; Siddharth, Sumit; Kundu, Chanakya N; Guchhait, Sankar K


    Scaffold hybridization of several natural and synthetic anticancer leads led to the consideration of indenoindolones as potential novel anticancer agents. A series of these compounds were prepared by a diversity-feasible synthetic method. They were found to possess anticancer activities with higher potency compared to etoposide and 5-fluorouracil in kidney cancer cells (HEK 293) and low toxicity to corresponding normal cells (Vero). They exerted apoptotic effect with blocking of cell cycle at G2/M phase. PMID:22381050

  11. SU-E-J-70: Feasibility Study of Dynamic Arc and IMRT Treatment Plans Utilizing Vero Treatment Unit and IPlan Planning Computer for SRS/FSRT Brain Cancer Patients

    SciTech Connect

    Huh, S; Lee, S; Dagan, R; Malyapa, R; Mendenhall, N; Mendenhall, W; Ho, M; Hough, D; Yam, M; Li, Z


    Purpose: To investigate the feasibility of utilizing Dynamic Arc (DA) and IMRT with 5mm MLC leaf of VERO treatment unit for SRS/FSRT brain cancer patients with non-invasive stereotactic treatments. The DA and IMRT plans using the VERO unit (BrainLab Inc, USA) are compared with cone-based planning and proton plans to evaluate their dosimetric advantages. Methods: The Vero treatment has unique features like no rotational or translational movements of the table during treatments, Dynamic Arc/IMRT, tracking of IR markers, limitation of Ring rotation. Accuracies of the image fusions using CBCT, orthogonal x-rays, and CT are evaluated less than ∼ 0.7mm with a custom-made target phantom with 18 hidden targets. 1mm margin is given to GTV to determine PTV for planning constraints considering all the uncertainties of planning computer and mechanical uncertainties of the treatment unit. Also, double-scattering proton plans with 6F to 9F beams and typical clinical parameters, multiple isocenter plans with 6 to 21 isocenters, and DA/IMRT plans are evaluated to investigate the dosimetric advantages of the DA/IMRT for complex shape of targets. Results: 3 Groups of the patients are divided: (1) Group A (complex target shape), CI's are same for IMRT, and DGI of the proton plan are better by 9.5% than that of the IMRT, (2) Group B, CI of the DA plans (1.91+/−0.4) are better than cone-based plan, while DGI of the DA plan is 4.60+/−1.1 is better than cone-based plan (5.32+/−1.4), (3) Group C (small spherical targets), CI of the DA and cone-based plans are almost the same. Conclusion: For small spherical targets, cone-based plans are superior to other 2 plans: DS proton and DA plans. For complex or irregular plans, dynamic and IMRT plans are comparable to cone-based and proton plans for complex targets.

  12. Harvesting microalgae grown on wastewater.


    Udom, Innocent; Zaribaf, Behnaz H; Halfhide, Trina; Gillie, Benjamin; Dalrymple, Omatoyo; Zhang, Qiong; Ergas, Sarina J


    The costs and life cycle impacts of microalgae harvesting for biofuel production were investigated. Algae were grown in semi-continuous culture in pilot-scale photobioreactors under natural light with anaerobic digester centrate as the feed source. Algae suspensions were collected and the optimal coagulant dosages for metal salts (alum, ferric chloride), cationic polymer (Zetag 8819), anionic polymer (E-38) and natural coagulants (Moringa Oleifera and Opuntia ficus-indica cactus) were determined using jar tests. The relative dewaterability of the algae cake was estimated by centrifugation. Alum, ferric chloride and cationic polymer could all achieve >91% algae recovery at optimal dosages. Life cycle assessment (LCA) and cost analysis results revealed that cationic polymer had the lowest cost but the highest environmental impacts, while ferric chloride had the highest cost and lowest environmental impacts. Based on the LCA results, belt presses are the recommended algae dewatering technology prior to oil extraction. PMID:23648758

  13. Tissue grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    Cells from kidneys lose some of their special features in conventional culture but form spheres replete with specialized cell microvilli (hair) and synthesize hormones that may be clinically useful. Ground-based research studies have demonstrated that both normal and neoplastic cells and tissues recreate many of the characteristics in the NASA bioreactor that they display in vivo. Proximal kidney tubule cells that normally have rich apically oriented microvilli with intercellular clefts in the kidney do not form any of these structures in conventional two-dimensional monolayer culture. However, when normal proximal renal tubule cells are cultured in three-dimensions in the bioreactor, both the microvilli and the intercellular clefts form. This is important because, when the morphology is recreated, the function is more likely also to be rejuvenated. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC).

  14. PER.C6(®) cells as a serum-free suspension cell platform for the production of high titer poliovirus: a potential low cost of goods option for world supply of inactivated poliovirus vaccine.


    Sanders, Barbara P; Edo-Matas, Diana; Custers, Jerome H H V; Koldijk, Martin H; Klaren, Vincent; Turk, Marije; Luitjens, Alfred; Bakker, Wilfried A M; Uytdehaag, Fons; Goudsmit, Jaap; Lewis, John A; Schuitemaker, Hanneke


    There are two highly efficacious poliovirus vaccines: Sabin's live-attenuated oral polio vaccine (OPV) and Salk's inactivated polio vaccine (IPV). OPV can be made at low costs per dose and is easily administrated. However, the major drawback is the frequent reversion of the OPV vaccine strains to virulent poliovirus strains which can result in Vaccine Associated Paralytic Poliomyelitis (VAPP) in vaccinees. Furthermore, some OPV revertants with high transmissibility can circulate in the population as circulating Vaccine Derived Polioviruses (cVDPVs). IPV does not convey VAPP and cVDPVs but the high costs per dose and insufficient supply have rendered IPV an unfavorable option for low and middle-income countries. Here, we explored whether the human PER.C6(®) cell-line, which has the unique capability to grow at high density in suspension, under serum-free conditions, could be used as a platform for high yield production of poliovirus. PER.C6(®) cells supported replication of all three poliovirus serotypes with virus titers ranging from 9.4 log(10) to 11.1 log(10)TCID(50)/ml irrespective of the volume scale (10 ml in shaker flasks to 2 L in bioreactors). This production yield was 10-30 fold higher than in Vero cell cultures performed here, and even 100-fold higher than what has been reported for Vero cell cultures in literature [38]. In agreement, the D-antigen content per volume PER.C6(®)-derived poliovirus was on average 30-fold higher than Vero-derived poliovirus. Interestingly, PER.C6(®) cells produced on average 2.5-fold more D-antigen units per cell than Vero cells. Based on our findings, we are exploring PER.C6(®) as an interesting platform for large-scale production of poliovirus at low costs, potentially providing the basis for global supply of an affordable IPV. PMID:23123018

  15. Characterization of sodium chloride crystals grown in microgravity

    NASA Astrophysics Data System (ADS)

    Fontana, Pietro; Schefer, Jürg; Pettit, Donald


    NaCl crystals grown by the evaporation of an aqueous salt solution in microgravity on the International Space Station (ISS) were characterized and compared to salt crystals grown on earth. NaCl crystallized as thin wafers in a supersaturated film of 200-700 μm thickness and 50 mm diameter, or as hopper cubes in 10 mm diameter supersaturated spheres. Neutron diffraction shows no change in crystal structure and in cell parameters compared to earth-grown crystals. However, the morphology can be different, frequently showing circular, disk-like shapes of single crystals with <1 1 1> perpendicular to the disks, an unusual morphology for salt crystals. In contrast to the growth on earth the lateral faces of the microgravity tabular hopper crystals are symmetrical because they are free floating during the crystallization process. Hopper cubes were produced without the need to suspend the growing crystals by an ongoing stirring. "Fleur de Sel" is shown as an example of two-dimensional growth of salt on earth and compared to the space grown crystals. It is shown that in microgravity conditions brine fluid inclusions form within the salt crystals.

  16. [Use of continuous human and animal cell lines for the production of viral vaccines].


    Grachev, V P; Khapchaev, Iu Kh


    History of development of safety criteria for continuous human and animal cell lines approved for manufacture of immunobiologic preparations. It was noted that current WHO documents recommend mandatory use of respective WHO's reference cell cultures (Vero-10-87 for continuous cell lines, and Wi-38 or MRC-5 for diploid cell lines) during attestation of new cell cultures proposed for the manufacturing of immunobiologic preparations. Examples of practical use of continuous cell lines (CCLs) for production of viral vaccines on industrial scale are described. On the basis of modern data most important principles were formulated which should be considered to provide safety and efficacy of vaccines produced on the CCLs. PMID:18368760

  17. Comparison of Vibrio parahaemolyticus grown in estuarine water and rich medium.

    PubMed Central

    Pace, J; Chai, T J


    Cell envelope composition and selected physiological traits of Vibrio parahaemolyticus were studied in regard to the Kanagawa phenomenon and growth conditions. Cell envelopes were prepared from cells cultured in Proteose Peptone-beef extract (Difco Laboratories, Detroit, Mich.) medium or filtered estuarine water. Protein, phospholipid, and lipopolysaccharide contents varied with culture conditions. The phospholipids present in the cell envelopes were identified as phosphatidylethanolamine, phosphatidylglycerol, and cardiolipin. Phosphatidylethanolamine decreased and phosphatidylglycerol increased in cells grown in estuarine water. Profiles of proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated numerous protein species, with four to six predominant proteins ranging from 26,000 to 120,000 in molecular weight. The profile of V. parahaemolyticus cell envelope proteins was unique and might be useful in the identification of the organism. Alkaline phosphatase activity was slightly higher in Kanagawa-negative strains and was higher in cells grown in estuarine water than in cells grown in rich laboratory medium. The DNA levels in estuarine water-grown cells increased, while RNA levels and cell volume decreased. Bacteriophage sensitivity typing demonstrated a close intraspecies relationship. Results indicated that Kanagawa-positive and -negative strains were closely related, but they could be grouped separately and may have undergone starvation-related physiological changes when cultured in estuarine water. Images PMID:2782869

  18. Characterization of Si(100) homoepitaxy grown in the STM at low temperatures

    SciTech Connect

    Grube, H.; Brown, G. W.; Pomeroy, J. M.; Hawley, M. E.


    We explore the growth of low-temperature bulk-like Si(100) homoepitaxy with regard to microscopic surface roughness and defects We characterize films grown at different temperatures up to 500K in-situ by means of an effusion cell added to our UHVSTM. The development of novel architectures for future generation computers calls for high-quality homoepitaxial (WOO) grown at low temperature. Even though Si(100) can be grown crystalline up to a limited thickness: the microstructure reveals significant small-scale surface roughness and defects specific to low-temperature growth. Both can he detrimental to fabrication and operation of small-scale electronic devices.

  19. Rift Valley Fever Virus Incorporates the 78 kDa Glycoprotein into Virions Matured in Mosquito C6/36 Cells

    PubMed Central

    Weingartl, Hana M.; Zhang, Shunzhen; Marszal, Peter; McGreevy, Alan; Burton, Lynn; Wilson, William C.


    Rift Valley fever virus (RVFV), genus Phlebovirus, family Bunyaviridae is a zoonotic arthropod-borne virus able to transition between distant host species, causing potentially severe disease in humans and ruminants. Viral proteins are encoded by three genomic segments, with the medium M segment coding for four proteins: nonstructural NSm protein, two glycoproteins Gn and Gc and large 78 kDa glycoprotein (LGp) of unknown function. Goat anti-RVFV polyclonal antibody and mouse monoclonal antibody, generated against a polypeptide unique to the LGp within the RVFV proteome, detected this protein in gradient purified RVFV ZH501 virions harvested from mosquito C6/36 cells but not in virions harvested from the mammalian Vero E6 cells. The incorporation of LGp into the mosquito cell line - matured virions was confirmed by immune-electron microscopy. The LGp was incorporated into the virions immediately during the first passage in C6/36 cells of Vero E6 derived virus. Our data indicate that LGp is a structural protein in C6/36 mosquito cell generated virions. The protein may aid the transmission from the mosquitoes to the ruminant host, with a possible role in replication of RVFV in the mosquito host. To our knowledge, this is a first report of different protein composition between virions formed in insect C6/36 versus mammalian Vero E6 cells. PMID:24489907

  20. Rift Valley fever virus incorporates the 78 kDa glycoprotein into virions matured in mosquito C6/36 cells.


    Weingartl, Hana M; Zhang, Shunzhen; Marszal, Peter; McGreevy, Alan; Burton, Lynn; Wilson, William C


    Rift Valley fever virus (RVFV), genus Phlebovirus, family Bunyaviridae is a zoonotic arthropod-borne virus able to transition between distant host species, causing potentially severe disease in humans and ruminants. Viral proteins are encoded by three genomic segments, with the medium M segment coding for four proteins: nonstructural NSm protein, two glycoproteins Gn and Gc and large 78 kDa glycoprotein (LGp) of unknown function. Goat anti-RVFV polyclonal antibody and mouse monoclonal antibody, generated against a polypeptide unique to the LGp within the RVFV proteome, detected this protein in gradient purified RVFV ZH501 virions harvested from mosquito C6/36 cells but not in virions harvested from the mammalian Vero E6 cells. The incorporation of LGp into the mosquito cell line - matured virions was confirmed by immune-electron microscopy. The LGp was incorporated into the virions immediately during the first passage in C6/36 cells of Vero E6 derived virus. Our data indicate that LGp is a structural protein in C6/36 mosquito cell generated virions. The protein may aid the transmission from the mosquitoes to the ruminant host, with a possible role in replication of RVFV in the mosquito host. To our knowledge, this is a first report of different protein composition between virions formed in insect C6/36 versus mammalian Vero E6 cells. PMID:24489907

  1. Molecule diagram from space-grown crystals

    NASA Technical Reports Server (NTRS)


    Researchers' at Hauptman-Woodward Medical Research Institute, in Buffalo, N.Y. have analyzed the molecular structures of insulin crystals grown during Space Shuttle experiments and are unlocking the mystery of how insulin works.

  2. [Analyses of chromosomal karyotypes and cytogenetic variations of animal cell lines].


    Zhang, D L; Li, L J; Xia, G T; He, X Y; Gao, B X; Bai, X H; Huang, G S; Liu, S G; Yan, L F; Fang, F D; Hu, C L; Wang, L J; Jiang, H H; Feng, A M; Zhang, G M; An, S G; Ren, Y Q; Guo, J M; Hu, S X; Fan, J X; Niu, Y L; Song, Z J; Li, Y; Fan, S J


    After the master cell stock(mcs) and working cell bank of more than 30 different strains of 7 animal kidney cell lines (F-81 or CRFK cell line, MDCK cell line, Vero or Vero-2 cell line, MA-104 cell line and BHK-21 cell line) were established in China, the chromosomal number variations and structural aberrations of the above lines, primary feline or canine kidney cell (FKC or CKC) and HeLa cell line were investigated and their karyotypes of routine or Giemsa chromosomal bands were analyzed. The carcinogenesis or tumorigenicity testing of these cells in about 700 nude mice and for colony formation in soft agar (SA) and for agglutination under different concentration of plant lectins was carried out. Both tumorigenicity-negative strains of F-81, CRFK, Vero or Vero-2 lines and very-low-tumorigenicity strains of MDCK line were successfully selected and evaluated for the production of canine or feline combination viral vaccines, which are free of infectious agents, and described with respect to cytogenetic characteristics and tumorigenicity. Rate of modal chromosome number represents the ratio of cell number having modal chromosome number to all the split cell number analyzed at random. Rate of difference represents the ratio of difference of the rate of modal chromosome number between mcs (master cell stock) + n and mcs passages. The chromosomal analysis results showed that the ratio of difference of the rate of modal chromosome number between mcs + n and mcs passages was not more than 5%-15% and the structure aberrations was generally 0%-3%, not more than 5%-10%, thus the hereditary character of cell lines is comparatively stable without significant difference between different passages. The genetic characteristics of chromosomal number of cell lines determines their tumorigenicity, but it is species specific. Experimental models were established for the researches on the prevention and prophylaxis of malignant tumors or cancers and their genetically biological characteristics. Tests showed that there was correlation among cell line chromosome number variations, anchorage independence in soft agar, agglutination under plant lectins and tumor-forming ability in nude mice. Since testing in vitro is more economic, simpler, faster, and is thought to be reliable, we recommend plant lectins followed by SA or analysis of karyotypes as the initial means for monitoring tumorigenicity of animal cell line in nude mice. PMID:11329875

  3. Surface characteristics of Pseudomonas aeruginosa grown in a chamber implant model in mice and rats.

    PubMed Central

    Kelly, N M; Bell, A; Hancock, R E


    Pseudomonas aeruginosa PAO1 was grown in vivo in chambers implanted into the peritoneums of mice and rats. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of extracts of bacterial cells taken from the chambers and washed to remove loosely bound host proteins revealed the presence of the major outer membrane proteins D2, E, F, G, and H2. Western immunoblotting with specific antisera confirmed the presence of porin protein F and lipoprotein H2. However, there was no apparent induction of the phosphate starvation-inducible porin P or the divalent cation starvation-inducible protein H1. Small amounts of proteins with molecular weights similar to those of the iron-regulated outer membrane proteins were found in cells grown in vivo; however, their presence could not be confirmed immunologically. The presence of pili and flagella on the cells grown in vivo was demonstrated by electron microscopy and Western immunoblotting. A consistent alteration in the lipopolysaccharide banding pattern was observed after growth in vivo. Compared with cells of strain PAO1 grown in vitro, cells grown in vivo appeared to lack a series of high-molecular-weight O-antigen-containing lipopolysaccharide bands and gained a new series of lower-molecular-weight lipopolysaccharide bands. This alteration in the lipopolysaccharide after growth in vivo did not affect the O-antigen serotype or the resistance of the bacteria to serum. Images PMID:2492257

  4. Propagation of Asian isolates of canine distemper virus (CDV) in hamster cell lines

    PubMed Central

    Sultan, Serageldeen; Lan, Nguyen Thi; Ueda, Toshiki; Yamaguchi, Ryoji; Maeda, Ken; Kai, Kazushige


    Backgrounds The aim of this study was to confirm the propagation of various canine distemper viruses (CDV) in hamster cell lines of HmLu and BHK, since only a little is known about the possibility of propagation of CDV in rodent cells irrespective of their epidemiological importance. Methods The growth of CDV in hamster cell lines was monitored by titration using Vero.dogSLAMtag (Vero-DST) cells that had been proven to be susceptible to almost all field isolates of CDV, with the preparations of cell-free and cell-associated virus from the cultures infected with recent Asian isolates of CDV (13 strains) and by observing the development of cytopathic effect (CPE) in infected cultures of hamster cell lines. Results Eleven of 13 strains grew in HmLu cells, and 12 of 13 strains grew in BHK cells with apparent CPE of cell fusion in the late stage of infection. Two strains and a strain of Asia 1 group could not grow in HmLu cells and BHK cells, respectively. Conclusion The present study demonstrates at the first time that hamster cell lines can propagate the majority of Asian field isolates of CDV. The usage of two hamster cell lines suggested to be useful to characterize the field isolates biologically. PMID:19835588

  5. Comparison Of LEC-Grown And VGF-Grown GaSb

    NASA Astrophysics Data System (ADS)

    Reijnen, L.; Brunton, R.; Grant, I. R.


    GaSb 2″ diameter ingots doped with Tellurium have been grown by Vertical Gradient Freeze (VGF) on a (1 0 0) orientation. The ingots were grown in quartz crucibles with the use of an encapsulant and both 6 mm diameter and 50 mm diameter seeds. Twinning in the seed or in the cone of the crucible occurred in almost all cases when a 6 mm diameter seed was used, while using full-diameter (50 mm ID) seeds with a carefully controlled diameter resulted in single-crystal growth. The quality of the VGF-grown GaSb:Te from both 6 mm and full-diameter seeds has been compared to our commercially produced Liquid Encapsulated Czochralski (LEC) grown GaSb. The donor density and raman spectra of the VGF-grown GaSb are comparable to the electronic properties of LEC-grown GaSb, but slightly lower mobilities for the VGF-material are observed. The etch pit density (EPD) in VGF-grown GaSb from 6 mm diameter seeds is extremely low, around 5 per cm2. As expected the EPD of LEC-grown GaSb is significantly higher, due to the higher stress induced in the material during growth. Interestingly, the EPD for GaSb grown by VGF from full diameter seeds is comparable to the EPD from LEC-grown material. It is believed that seeding in VGF-growth induces stress and, therefore, a higher EPD. The use of small seeds ensures that dislocations can grow out. The crystal quality of the three materials is compared by comparing the X-ray rocking curves. LEC-grown GaSb and VGF-grown GaSb from full-diameter and 6 mm diameter seeds show a FWHM of 14.6, 15.1, and 20.7 arcsec, respectively.

  6. Effect of growth conditions on heat resistance of Arizona bacteria grown in a chemostat.

    PubMed Central

    Ng, H


    The effects of various growth conditions on the heat resistance of Arizona bacteria grown in a continuous-culture device (chemostat) were studied. Using either glucose, NH4Cl, NaH2PO4, or MgCl2 as the rate-limiting nutrient, it was found that the heat resistance, in all cases depended on the dilution rate and, hence, growth rate of the culture. Cells grown at high dilution rates were less heat resistant than those grown at low dilution rates. If, however, the dilution rate was maintained at a constant rate, the higher the growth temperature, the more heat resistant were the cells. Also at any given dilution rate, the cells were most heat resistant when grown at a near neutral pH. Most survival curves were biphasic in shape, indicating the presence in the population of two fractions of cells, one fraction being more resistant than the other. The size of the more heat-resistant fraction varied from almost 100% in very slow-growing cultures to practically 0% in cultures grown at a dilution rate of 0.67 h-1. PMID:7103473

  7. Some karyological observations on plants grown in space

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.; Oconnor, S. A.


    Experiments were conducted to assess whether cell division in a plant root would be affected by prolonged exposure to microgravity. Root materials from sunflower, oat, and mung bean plants grown on STS-2 and STS-3 were utilized for the experiments. It is found that all oat, sunflower, and mung seedlings showed a reduced number of cells in division as they went through their first cell division cycle on earth when compared to their ground controls. A significant number of oat, mung, and sunflower plantlets exhibited random root orientation and the lack of strictly orthotropic growth of their shoot systems in the flight samples. In addition, it is found that the mung roots were apparently least affected in terms of their cytology despite the fact that their roots were often randomly oriented.

  8. Microwave Heating Inactivates Shiga Toxin (Stx2) in Reconstituted Fat-Free Milk and Adversely Affects the Nutritional Value of Cell Culture Medium.


    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel


    Microwave exposure is a convenient and widely used method for defrosting, heating, and cooking numerous foods. Microwave cooking is also reported to kill pathogenic microorganisms that often contaminate food. In this study, we tested whether microwaves would inactivate the toxicity of Shiga toxin 2 (Stx2) added to 5% reconstituted fat-free milk administered to monkey kidney Vero cells. Heating of milk spiked with Stx2 in a microwave oven using a 10% duty cycle (cycle period of 30 s) for a total of 165 kJ energy or thermal heating (pasteurization), widely used to kill pathogenic bacteria, did not destroy the biological effect of the toxin in the Vero cells. However, conventional heating of milk to 95 C for 5 min or at an increased microwave energy of 198 kJ reduced the Stx2 activity. Gel electrophoresis showed that exposure of the protein toxin to high-energy microwaves resulted in the degradation of its original structure. In addition, two independent assays showed that exposure of the cell culture medium to microwave energy of 198 kJ completely destroyed the nutritional value of the culture medium used to grow the Vero cells, possibly by damaging susceptible essential nutrients present in the medium. These observations suggest that microwave heating has the potential to destroy the Shiga toxin in liquid food. PMID:24669932

  9. Degradation of pentachlorophenol by a Flavobacterium species grown in continuous culture under various nutrient limitations.

    PubMed Central

    Topp, E; Hanson, R S


    A Flavobacterium sp. was grown in continuous culture limited for growth with ammonium, phosphate, sulfate, glucose, glucose + pentachlorophenol (PCP) (0.065 h -1), or PCP. Cells ere harvested, washed, and suspended to 3 x 10(7) cells ml (-1) in shake flasks containing a complete mineral salts medium without added carbon or supplemented with 50 mg of PCP ml(-1) or 50 mg of PCP ml(-1) + 100 mg of glucose ml(-1). The PCP concentration and the viable cell density were determined periodically. Cells that were grown under phosphate, glucose, or glucose + PCP limitation were more sensitive to PCP and took longer to degrade 50 mg of PCP ml(-1) than did cells that very were grown under ammonium, sulfate, or PCP limitation. Glucose stimulated viability and PCP degradation in all cases except when the cells were grown under carbon limitation with glucose and PCP added together as the carbon source. These results indicate that there is a relationship between nutrient limitation, phenotypic variation, and the sensitivity to and degradation of PCP by this organism. PMID:2306092

  10. Wood quality from fast-grown plantations

    SciTech Connect

    Zobel, B.


    As forestry becomes more intensive and as forestry operations move toward the tropical areas, an increasing proportion of the wood available to the industry will come from young, fast-grown plantations. The wood of such trees, especially from the conifers, is so different that it will have a major effect on utilization and product standards. Acceptability of wood from fast-grown plantations will change as solid wood and paper quality standards change. Some of the primary effects on wood and products from fast-grown plantations are discussed in this paper. The wood is very suitable for some products and poor for others. The paper reports on conifers and hardwoods separately, with a large section on Eucalyptus.

  11. Stability of Detached Grown Germanium Single Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Volz, M. P.; Cobb, S. D.; Vujisic, L.; Szofran, F. R.; Rose, M. Franklin (Technical Monitor)


    Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years, especially under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 micrometers, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5 mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 micrometers. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be discussed in detail.

  12. Stability of Detached Grown Germanium Single Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Volz, M. P.; Cobb, S. D.; Motakef, S.; Szofran, F. R.; Curreri, Peter A. (Technical Monitor)


    Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years especially, under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 microns, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 microns. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be discussed in detail.

  13. Cell type-specific cleavage of nucleocapsid protein by effector caspases during SARS coronavirus infection.


    Diemer, Claudia; Schneider, Martha; Seebach, Judith; Quaas, Janine; Frösner, Gert; Schätzl, Hermann M; Gilch, Sabine


    The epidemic outbreak of severe acute respiratory syndrome (SARS) in 2003 was caused by a novel coronavirus (CoV), designated SARS-CoV. The RNA genome of SARS-CoV is complexed by the nucleocapsid protein (N) to form a helical nucleocapsid. Besides this primary function, N seems to be involved in apoptotic scenarios. We show that upon infection of Vero E6 cells with SARS-CoV, which elicits a pronounced cytopathic effect and a high viral titer, N is cleaved by caspases. In contrast, in SARS-CoV-infected Caco-2 cells, which show a moderate cytopathic effect and a low viral titer, this processing of N was not observed. To further verify these observations, we transiently expressed N in different cell lines. Caco-2 and N2a cells served as models for persistent SARS-CoV infection, whereas Vero E6 and A549 cells did as prototype cell lines lytically infected by SARS-CoV. The experiments revealed that N induces the intrinsic apoptotic pathway, resulting in processing of N at residues 400 and 403 by caspase-6 and/or caspase-3. Of note, caspase activation is highly cell type specific in SARS-CoV-infected as well as transiently transfected cells. In Caco-2 and N2a cells, almost no N-processing was detectable. In Vero E6 and A549 cells, a high proportion of N was cleaved by caspases. Moreover, we examined the subcellular localization of SARS-CoV N in these cell lines. In transfected Vero E6 and A549 cells, SARS-CoV N was localized both in the cytoplasm and nucleus, whereas in Caco-2 and N2a cells, nearly no nuclear localization was observed. In addition, our studies indicate that the nuclear localization of N is essential for its caspase-6-mediated cleavage. These data suggest a correlation among the replication cycle of SARS-CoV, subcellular localization of N, induction of apoptosis, and the subsequent activation of caspases leading to cleavage of N. PMID:18155731

  14. Ion implanted epitaxially grown ZnSe

    NASA Technical Reports Server (NTRS)


    The epitaxial growth of ZnSe on (100) Ge using the close-spaced transport process is described. Substrate temperature of 575 C and source temperatures of 675 C yield 10 micron, single crystal layers in 10 hours. The Ge substrates provides a nonreplenishable chemical transport agent and the epitaxial layer thickness is limited to approximately 10 microns. Grown epitaxial layers show excellent photoluminescence structure at 77 K. Grown layers exhibit high resistivity, and annealing in Zn vapor at 575 C reduces the resistivity to 10-100 ohms-cm. Zinc vapor annealing quenches the visible photoluminescence.

  15. Mechanoresponses of human primary osteoblasts grown on carbon nanotubes.


    Kroustalli, A; Kotsikoris, V; Karamitri, A; Topouzis, S; Deligianni, D


    Bone mechanotransduction is strongly influenced by the biomaterial properties. A good understanding of these mechanosensory mechanisms in bone has the potential to provide new strategies in the highly evolving field of bone tissue engineering. The aim of the present investigation was to study the interactive effects of local mechanical stimuli on multiwalled carbon nanotubes (MWCNTs)/osteoblast interface, using an in vitro model that allows the study of cell growth, attachment and differentiation. Strain was applied at physiological levels [strain magnitudes 500 microstrain (μɛ), at frequency of load application 0.5 Hz]. The effect of mechanical strain and substrate was thus studied by measuring the messenger RNA expression of alkaline phosphatase, vinculin, collagen 1A, and integrins β1, β3, α4, and αv, using real-time quantitative polymerase chain reaction. The osteoblasts grown on MWCNTs displayed quick adaptation to the new environment by modulating the expression of key adhesion integrins. Furthermore, the addition of mechanical strain interplayed with the extracellular matrix and was efficiently transduced by cells grown on MWCNTs, providing stronger adhesion and survival. MWCNTs are therefore a material perfectly compatible with osteoblast differentiation, adhesion, and growth, and should be further evaluated, to derive new-generation biomaterial scaffolds for the treatment of skeletal defects which require bone reconstruction. PMID:24910375

  16. Automorphogenesis and gravitropism of plant seedlings grown under microgravity conditions

    NASA Astrophysics Data System (ADS)

    Hoson, T.; Saiki, M.; Kamisaka, S.; Yamashita, M.

    Plant seedlings exhibit automorphogenesis on clinostats. The occurrence of automorphogenesis was confirmed under microgravity in Space Shuttle STS-95 flight. Rice coleoptiles showed an inclination toward the caryopsis in the basal region and a spontaneous curvature in the same adaxial direction in the elongating region both on a three-dimensional (3-D) clinostat and in space. Both rice roots and Arabidopsis hypocotyls also showed a similar morphology in space and on the 3-D clinostat. In rice coleoptiles, the mechanisms inducing such an automorphic curvature were studied. The faster-expanding convex side of rice coleoptiles showed a higher extensibility of the cell wall than the opposite side. Also, in the convex side, the cell wall thickness was smaller, the turnover of the matrix polysaccharides was more active, and the microtubules oriented more transversely than the concave side, and these differences appear to be causes of the curvature. When rice coleoptiles grown on the 3-D clinostat were placed horizontally, the gravitropic curvature was delayed as compared with control coleoptiles. In clinostatted coleoptiles, the corresponding suppression of the amyloplast development was also observed. Similar results were obtained in Arabidopsis hypocotyls. Thus, the induction of automorphogenesis and a concomitant decrease in graviresponsiveness occurred in plant shoots grown under microgravity conditions.

  17. Using Speckle Dynamics for Comparison of the Metabolic Activity of Different Cell Cultures

    NASA Astrophysics Data System (ADS)

    Vladimirov, A. P.; Malygin, A. S.; Mikhailova, Yu. A.; Borodin, E. M.; Bakharev, A. A.; Poryvaeva, A. P.


    The dynamics of speckles in the image plane of a monolayer of cells cultivated on a glass substrate has been recorded. Cell cultures HEL-3, L-41, and Vero were selected as the objects of research. The digitized value of the radiation intensity I in one pixel and the parameter η characterizing the change in the intensity distribution on an 10 × 10 pixel area was recorded for 24 hours. The multiple determinacy coefficient of three cell cultures, which was obtained from the time dependences of η, was equal to 0.94.

  18. Cell Fusion by Canine Distemper Virus-Infected Cells

    PubMed Central

    Rankin, Anne M.; Fisher, Linda E.; Bussell, Robert H.


    AV3 cells (continuous human amnion) infected with the Onderstepoort strain of canine distemper virus produced cell fusion within 2 to 5 hr when added to AV3 cell monolayers. An apparent requirement for intact, infected cells was demonstrated by showing that (i) frozen-and-thawed infected cells failed to induce fusion, (ii) infected cells frozen in the presence of glycerol retained their ability to induce fusion, (iii) infected cells subjected to swelling in hypotonic buffer and homogenization lost their ability to fuse cells, and (iv) semipurified and concentrated virus preparations with infectivity titers as high as 107.5 mean tissue culture doses per ml failed to induce fusion within 5 hr. Preparations of intact, infected cells had a mean log10 ratio of infectivity to fusion activity of 3.6. Treatment with beta-propiolactone rendered the active preparations free from detectable infectivity while they retained their ability to cause cell fusion. Cycloheximide did not block the formation of syncytia in assay cells. This type of cell fusion was neutralized by canine distemper virus immune antisera, and measles virus immune sera showed a slight degree of cross-neutralization. Other cell lines, HEp-2, MA 139 (embryonic ferret lung), MA 104 (embryonic rhesus monkey kidney), and Vero (African green monkey kidney) were also susceptible. PMID:4644630

  19. Chloroplast avoidance movement is not functional in plants grown under strong sunlight.


    Higa, Takeshi; Wada, Masamitsu


    Chloroplast movement in nine climbing plant species was investigated. It is thought that chloroplasts generally escape from strong light to avoid photodamage but accumulate towards weak light to perform photosynthesis effectively. Unexpectedly, however, the leaves of climbing plants grown under strong sunlight showed very low or no chloroplast photorelocation responses to either weak or strong blue light when detected by red light transmittance through leaves. Direct observations of Cayratia japonica leaves, for example, revealed that the average number of chloroplasts in upper periclinal walls of palisade tissue cells was only 1.2 after weak blue-light irradiation and almost all of the chloroplasts remained at the anticlinal wall, the state of chloroplast avoidance response. The leaves grown under strong light have thin and columnar palisade tissue cells comparing with the leaves grown under low light. Depending on our analyses and our schematic model, the thinner cells in a unit leaf area have a wider total plasma membrane area, such that more chloroplasts can exist on the plasma membrane in the thinner cells than in the thicker cells in a unit leaf-area basis. The same strategy might be used in other plant leaves grown under direct sunlight. PMID:26586173

  20. Molecule diagram from earth-grown crystals

    NASA Technical Reports Server (NTRS)


    Like many chemicals in the body, the three-dimensional structure of insulin is extremely complex. When grown on the ground, insulin crystals do not grow as large or as ordered as researchers desire--obscuring the blueprint of the insulin molecules.

  1. Rice Plants Grown With and Without Endophytes

    These rice plants show the difference in growth of rice plants exposed to salt when grown with and without endophytes, which are mutually beneficial microscopic fungi that live in most plants. The plant on the left was colonized with a fungi that made it salt-tolerant, but it wasn't exposed to ...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Reports on the lycopene content of tomatoes vary widely with country and source of fruit (field, greenhouse, retail). This study was done to compare the lycopene content of organically grown tomatoes, and to compare fully red fruit to those ripened after harvest. Thirteen tomato cultivars (12 beef...

  3. Grown-ups Ought To Know Better.

    ERIC Educational Resources Information Center

    Brightman, Samuel C.

    Among the articles by Sam Brightman collected in this volume from the newsletter, "Adult & Continuing Education Today (ACET)" are the following: "Grown-Ups Ought to Know Better"; "Adult Education: The Only Sure Factor Is Growth"; "Adult Education Important in This Election Year"; "Will Nursery School External Degree Programs Come Next?";…

  4. Efflux Of Nitrate From Hydroponically Grown Wheat

    NASA Technical Reports Server (NTRS)

    Huffaker, R. C.; Aslam, M.; Ward, M. R.


    Report describes experiments to measure influx, and efflux of nitrate from hydroponically grown wheat seedlings. Ratio between efflux and influx greater in darkness than in light; increased with concentration of nitrate in nutrient solution. On basis of experiments, authors suggest nutrient solution optimized at lowest possible concentration of nitrate.

  5. An automated GCxGC-TOF-MS protocol for batch-wise extraction and alignment of mass isotopomer matrixes from differential 13C-labelling experiments: a case study for photoautotrophic-mixotrophic grown Chlamydomonas reinhardtii cells.


    Kempa, Stefan; Hummel, Jan; Schwemmer, Thorsten; Pietzke, Matthias; Strehmel, Nadine; Wienkoop, Stefanie; Kopka, Joachim; Weckwerth, Wolfram


    Two dimensional gas chromatography coupled to time-of-flight mass spectrometry (GCxGC-TOF-MS) is a promising technique to overcome limits of complex metabolome analysis using one dimensional GC-TOF-MS. Especially at the stage of data export and data mining, however, convenient procedures to cope with the complexity of GCxGC-TOF-MS data are still in development. Here, we present a high sample throughput protocol exploiting first and second retention index for spectral library search and subsequent construction of a high dimensional data matrix useful for statistical analysis. The method was applied to the analysis of (13)C-labelling experiments in the unicellular green alga Chlamydomonas reinhardtii. We developed a rapid sampling and extraction procedure for Chlamydomonas reinhardtii laboratory strain (CC503), a cell wall deficient mutant. By testing all published quenching protocols we observed dramatic metabolite leakage rates for certain metabolites. To circumvent metabolite leakage, samples were directly quenched and analyzed without separation of the medium. The growth medium was adapted to this rapid sampling protocol to avoid interference with GCxGC-TOF-MS analysis. To analyse batches of samples a new software tool, MetMax, was implemented which extracts the isotopomer matrix from stable isotope labelling experiments together with the first and second retention index (RI1 and RI2). To exploit RI1 and RI2 for metabolite identification we used the Golm metabolome database (GMD [1] with RI1/RI2-reference spectra and new search algorithms. Using those techniques we analysed the dynamics of (13)CO(2) and (13)C-acetate uptake in Chlamydomonas reinhardtii cells in two different steady states namely photoautotroph and mixotroph growth conditions. PMID:19206143

  6. [Safety assessment of stevia rebaudiana bertoni grown in southeastern Mexico as food sweetener].


    Aranda-Gonzlez, Irma; Barbosa-Martn, Enrique; Toraya-Avils, Roco; Segura-Campos, Maira; Moguel-Ordoez, Yolanda; Betancur-Ancona, David


    Stevia rebaudiana leaves and their glycosides have been recently and significantly used so important as sweeteners. However, it has been reported an antihyperglycemic effect of the extract and a glycoside. The aim of this study was to quantify S. rebaudiana glycosides, assess cytotoxicity of the extract and its acute and chronic effect on blood glucose in animal models and in human. The glycosides of the Morita II and Criolla extract were quantified by HPLC, using a C18 column (250 mm x 4.6 mm and particle size of 5 uM) with UV detection at 210 nm, mobile phase of acetonitrile/sodium phosphate buffer 10 mmol/L, pH 2.6 (32:68 v/v). Cytotoxicity study was performed in Vero cells, whereas an intraperitoneal glucose tolerance test (IPGTT) and a chronic consumption assay (4 weeks) were executed in an animal model of diabetes; finally the glycemic index (G.I.) was determined in healthy individuals. The glycoside content is higher in the Morita variety II although both had a CC50 >300 ?g/mL. The areas under the curve of the IPGTT and fasting glucose of the animals were not significantly different (p> 0.05) and the I.G. extract was 11.11 %, which classifies the extract as low I.G. The extract of S. rebaudiana Morita II has a low glycemic index and, in the doses tested, is not cytotoxic nor has acute or chronic effect on blood sugar, which makes it a safe sweetener. PMID:25238836

  7. Human Colon Cancer Cells Cultivated in Space

    NASA Technical Reports Server (NTRS)


    Within five days, bioreactor cultivated human colon cancer cells (shown) grown in Microgravity on the STS-70 mission in 1995, had grown 30 times the volume of the control specimens on Earth. The samples grown in space had a higher level of cellular organization and specialization. Because they more closely resemble tumors found in the body, microgravity grown cell cultures are ideal for research purposes.

  8. A comparative study of gel grown and space grown lead hydrogen phosphate crystals

    NASA Astrophysics Data System (ADS)

    Robert, M. C.; Lefaucheux, F.; Jannot, B.; Godefroy, G.; Garnier, E.


    Lead hydrogen phosphate (LHP) and lead nitrophosphate (LNP) crystals have been grown by counterdiffusion of lead nitrate and phosphoric acid solutions either in a gelled medium or in a free medium under the reduced gravity environment of Spacelab. Characterization of grown crystals allows to conclude that diffusive regimes are obtained in both xases. Dielectric measurements reveal significant differences which can be correlated with the crystalline quality.

  9. Cytokinins induce photomorphogenic development in dark-grown gametophytes of Ceratopteris richardii.


    Spiro, Mark D; Torabi, Behzad; Cornell, Catharine N


    The cytokinins benzylaminopurine, kinetin and isopentenyladenine induce photomorphogenesis in dark-grown gametophytes of the fern Ceratopteris richardii. At sub-nanomolar concentrations each altered the rate and pattern of cell division, elongation and differentiation, mimicking aspects of the light-mediated transition from filamentous to prothallial growth. Untreated dark-grown gametophytes grow as narrow, elongate, asexual filaments with an apical meristem. Cytokinin treatments as low as 10(-12) M reduced the length-to-width ratio through decreased cell elongation, increased periclinal cell division and induced the formation of rhizoid initials in the cells immediately below the apical meristem. Higher concentrations (10(-9)-10(-8) M) induced conversion of the meristem from apical to notch morphology. Cytokinins induced both red- and blue-light-mediated photomorphogenic events, suggesting stimulation of both phytochrome and cryptochrome signaling; however, cytokinin treatment only partially substituted for light in that it did not induce hermaphroditic sexual development or spore germination in the dark. Additionally, cytokinins did not increase chlorophyll synthesis in dark-grown gametophytes, which unlike angiosperms are able to produce mature chloroplasts in the dark. Cytokinin treatment had only slight effects on light-grown gametophytes. These results suggest evolutionary conservation between angiosperms and pteridophytes in the role of cytokinins in regulating photomorphogenesis. PMID:15509848

  10. miR-146a Attenuates Inflammatory Pathways Mediated by TLR4/NF-κB and TNFα to Protect Primary Human Retinal Microvascular Endothelial Cells Grown in High Glucose

    PubMed Central

    Ye, Eun-Ah; Steinle, Jena J.


    Pathological mechanisms underlying diabetic retinopathy are still not completely understood. Increased understanding of potential cellular pathways responsive to hyperglycemia is essential to develop novel therapeutic strategies for diabetic retinopathy. A growing body of evidence shows that microRNA (miRNA) play important roles in pathological mechanisms involved in diabetic retinopathy, as well as possessing potential as novel therapeutic targets. The hypothesis of this study was that miR-146a plays a key role in attenuating hyperglycemia-induced inflammatory pathways through reduced TLR4/NF-κB and TNFα signaling in primary human retinal microvascular endothelial cells (REC). We cultured human REC in normal (5 mM) glucose or transferred to high glucose medium (25 mM) for 3 days. Transfection was performed on REC with miRNA mimic (hsa-miR-146a-5p). Our results demonstrate that miR-146a expression was decreased in human REC cultured in high glucose. Overexpression of miR-146a using mimics reduced the levels of TLR4/NF-κB and TNFα in REC cultured in high glucose. Both MyD88-dependent and -independent signaling were decreased by miR-146a overexpression in REC in high glucose conditions. The results suggest that miR-146a is a potential therapeutic target for reducing inflammation in REC through inhibition of TLR4/NF-κB and TNFα. Our study will contribute to understanding of diabetic retinal pathology, as well as providing important clues to develop therapeutics for clinical applications. PMID:26997759

  11. Effect of Photon Fluence Rate on Oxygen Evolution and Uptake by Chlamydomonas reinhardtii Suspensions Grown in Ambient and CO(2)-Enriched Air.


    Sueltemeyer, D F; Klug, K; Fock, H P


    A closed system consisting of an assimilation chamber furnished with a membrane inlet from the liquid phase connected to a mass spectrometer was used to measure O(2) evolution and uptake by Chlamydomonas reinhardtii cells grown in ambient (0.034% CO(2)) or CO(2)-enriched (5% CO(2)) air. At pH = 6.9, 28 degrees C and concentrations of dissolved inorganic carbon (DIC) saturating for photosynthesis, O(2) uptake in the light (U(o)) equaled O(2) production (E(o)) at the light compensation point (15 micromoles photons per square meter per second). E(o) and U(o) increased with increasing photon fluence rate (PFR) but were not rate saturated at 600 micromoles photons per square meter per second, while net O(2) exchange reached a saturation level near 500 micromoles photons per square meter per second which was nearly the same for both, CO(2)-grown and air-grown cells. Comparison of the U(o)/E(o) ratios between air-grown and CO(2)-grown C. reinhardtii showed higher values for air-grown cells at light intensities higher than light compensation. For both, air-grown and CO(2)-grown algae the rates of mitochondrial O(2) uptake in the dark measured immediately before and 5 minutes after illumination were much lower than U(o) at PFR saturating for net photosynthesis. We conclude that noncyclic electron flow from water to NADP(+) and pseudocyclic electron flow via photosystem I to O(2) both significantly contribute to O(2) exchange in the light. In contrast, mitochondrial respiration and photosynthetic carbon oxidation cycle are regarded as minor O(2) consuming reactions in the light in both, air-grown and CO(2)-grown cells. It is suggested that the "extra" O(2) uptake by air-grown algae provides ATP required for the energy dependent CO(2)/HCO(3) (-) concentrating mechanism known to be present in these cells. PMID:16664823

  12. Lethal photosensitization of biofilm-grown bacteria

    NASA Astrophysics Data System (ADS)

    Wilson, Michael


    Antibacterial agents are increasingly being used for the prophylaxis and treatment of oral diseases. As these agents can be rendered ineffective by resistance development in the target organisms there is a need to develop alternative antimicrobial approaches. Light-activated antimicrobial agents release singlet oxygen and free radicals which can kill adjacent bacteria and a wide range of cariogenic and periodontopathogenic bacteria has been shown to be susceptible to such agents. In the oral cavity these organisms are present as biofilms (dental plaques) which are less susceptible to traditional antimicrobial agents than bacterial suspensions. The results of these studies have shown that biofilm-grown oral bacteria are also susceptible to lethal photosensitization although the light energy doses required are grater than those needed to kill the organisms when they are grown as aqueous suspensions.

  13. Auxin represses stomatal development in dark-grown seedlings via Aux/IAA proteins.


    Balcerowicz, Martin; Ranjan, Aashish; Rupprecht, Laura; Fiene, Gabriele; Hoecker, Ute


    Stomatal development is tightly regulated through internal and external factors that are integrated by a complex signalling network. Light represents an external factor that strongly promotes stomata formation. Here, we show that auxin-resistant aux/iaa mutants, e.g. axr3-1, exhibit a de-repression of stomata differentiation in dark-grown seedlings. The higher stomatal index in dark-grown axr3-1 mutants when compared with the wild type is due to increased cell division in the stomatal lineage. Excessive stomata in dark-grown seedlings were also observed in mutants defective in auxin biosynthesis or auxin perception and in seedlings treated with the polar auxin transport inhibitor NPA. Consistent with these findings, exogenous auxin repressed stomata formation in light-grown seedlings. Taken together, these results indicate that auxin is a negative regulator of stomatal development in dark-grown seedlings. Epistasis analysis revealed that axr3-1 acts genetically upstream of the bHLH transcription factors SPCH, MUTE and FAMA, as well as the YDA MAP kinase cascade, but in parallel with the repressor of photomorphogenesis COP1 and the receptor-like protein TMM. The effect of exogenous auxin required the ER family of leucine-rich repeat receptor-like kinases, suggesting that auxin acts at least in part through the ER family. Expression of axr3-1 in the stomatal lineage was insufficient to alter the stomatal index, implying that cell-cell communication is necessary to mediate the effect of auxin. In summary, our results show that auxin signalling contributes to the suppression of stomatal differentiation observed in dark-grown seedlings. PMID:25063454

  14. Characterization of Cellulolytic Bacterial Cultures Grown in Different Substrates

    PubMed Central

    Alshelmani, Mohamed Idris; Loh, Teck Chwen; Foo, Hooi Ling; Sazili, Awis Qurni


    Nine aerobic cellulolytic bacterial cultures were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ) and the American Type Culture Collection (ATCC). The objectives of this study were to characterize the cellulolytic bacteria and to determine the optimum moisture ratio required for solid state fermentation (SSF) of palm kernel cake (PKC). The bacteria cultures were grown on reconstituted nutrient broth, incubated at 30°C and agitated at 200 rpm. Carboxymethyl cellulase, xylanase, and mannanase activities were determined using different substrates and after SSF of PKC. The SSF was conducted for 4 and 7 days with inoculum size of 10% (v/w) on different PKC concentration-to-moisture ratios: 1 : 0.2, 1 : 0.3, 1 : 0.4, and 1 : 0.5. Results showed that Bacillus amyloliquefaciens 1067 DSMZ, Bacillus megaterium 9885 ATCC, Paenibacillus curdlanolyticus 10248 DSMZ, and Paenibacillus polymyxa 842 ATCC produced higher enzyme activities as compared to other bacterial cultures grown on different substrates. The cultures mentioned above also produced higher enzyme activities when they were incubated under SSF using PKC as a substrate in different PKC-to-moisture ratios after 4 days of incubation, indicating that these cellulolytic bacteria can be used to degrade and improve the nutrient quality of PKC. PMID:24319380

  15. Characterization of cellulolytic bacterial cultures grown in different substrates.


    Alshelmani, Mohamed Idris; Loh, Teck Chwen; Foo, Hooi Ling; Lau, Wei Hong; Sazili, Awis Qurni


    Nine aerobic cellulolytic bacterial cultures were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ) and the American Type Culture Collection (ATCC). The objectives of this study were to characterize the cellulolytic bacteria and to determine the optimum moisture ratio required for solid state fermentation (SSF) of palm kernel cake (PKC). The bacteria cultures were grown on reconstituted nutrient broth, incubated at 30°C and agitated at 200 rpm. Carboxymethyl cellulase, xylanase, and mannanase activities were determined using different substrates and after SSF of PKC. The SSF was conducted for 4 and 7 days with inoculum size of 10% (v/w) on different PKC concentration-to-moisture ratios: 1 : 0.2, 1 : 0.3, 1 : 0.4, and 1 : 0.5. Results showed that Bacillus amyloliquefaciens 1067 DSMZ, Bacillus megaterium 9885 ATCC, Paenibacillus curdlanolyticus 10248 DSMZ, and Paenibacillus polymyxa 842 ATCC produced higher enzyme activities as compared to other bacterial cultures grown on different substrates. The cultures mentioned above also produced higher enzyme activities when they were incubated under SSF using PKC as a substrate in different PKC-to-moisture ratios after 4 days of incubation, indicating that these cellulolytic bacteria can be used to degrade and improve the nutrient quality of PKC. PMID:24319380

  16. Mineral composition of organically grown tomato

    NASA Astrophysics Data System (ADS)

    Ghambashidze, Giorgi


    In recent years, consumer concerns on environmental and health issues related to food products have increased and, as a result, the demand for organically grown production has grown. Results indicate that consumers concerned about healthy diet and environmental degradation are the most likely to buy organic food, and are willing to pay a high premium. Therefore, it is important to ensure the quality of the produce, especially for highly consumed products. The tomato (Lycopersicon esculentum) is one of the most widely consumed fresh vegetables in the world. It is also widely used by the food industries as a raw material for the production of derived products such as purees or ketchup. Consequently, many investigations have addressed the impact of plant nutrition on the quality of tomato fruit. The concentrations of minerals (P, Na, K, Ca and Mg) and trace elements (Cu, Zn and Mn) were determined in tomatoes grown organically in East Georgia, Marneuli District. The contents of minerals and Mn seem to be in the range as shown in literature. Cu and Zn were found in considerably high amounts in comparison to maximum permissible values established in Georgia. Some correlations were observed between the minerals and trace elements studied. K and Mg were strongly correlated with Cu and Zn. Statistically significant difference have shown also P, K and Mg based between period of sampling.

  17. Morphometric analyses of petioles of seedlings grown in a spaceflight experiment.


    Johnson, Christina M; Subramanian, Aswati; Edelmann, Richard E; Kiss, John Z


    Gravity is a constant unidirectional stimulus on Earth, and gravitropism in plants involves three phases: perception, transduction, and response. In shoots, perception takes place within the endodermis. To investigate the cellular machinery of perception in microgravity, we conducted a spaceflight study with Arabidopsis thaliana seedlings, which were grown in microgravity in darkness using the Biological Research in Canisters (BRIC) hardware during space shuttle mission STS-131. In the 14-day-old etiolated plants, we studied seedling development and the morphological parameters of the endodermal cells in the petiole. Seedlings from the spaceflight experiment (FL) were compared to a ground control (GC), which both were in the BRIC flight hardware. In addition, to assay any potential effects from growth in spaceflight hardware, we performed another control by growing seedlings in Petri dishes in standard laboratory conditions (termed the hardware control, HC). Seed germination was significantly lower in samples grown in flight hardware (FL, GC) compared to the HC. In terms of cellular parameters of endodermal cells, the greatest differences also were between seedlings grown in spaceflight hardware (FL, GC) compared to those grown outside of this hardware (HC). Specifically, the endodermal cells were significantly smaller in seedlings grown in the BRIC system compared to those in the HC. However, a change in the shape of the cell, suggesting alterations in the cell wall, was one parameter that appears to be a true microgravity effect. Taken together, our results suggest that caution must be taken when interpreting results from the increasingly utilized BRIC spaceflight hardware system and that it is important to perform additional ground controls to aid in the analysis of spaceflight experiments. PMID:26376793

  18. Transfer of a human preproinsulin gene containing plasmid into non-pancreatic mammalian cells.


    Walther, R; Leibiger, I; Kiessling, U; Sarrach, D; Zühlke, H


    A recombinant plasmid containing the human preproinsulin gene fused to the mouse metallothionein-I-promoter was transferred into Vero cells from a monkey kidney cell line by protoplast fusion. The transient formation of immunoreactive insulin was demonstrated by RIA and studied in the absence and in the presence of zinc and cadmium ions. The recombinant plasmid was encapsulated into reverse-phase evaporated vesicles and the influence of the sonication time on the encapsulated DNA has been studied. It was demonstrated that, although DNA fragmentation occurs, at least a part of the encapsulated DNA retains its biological activity. PMID:3240289

  19. Sonochemically grown 1D ZnO nanostructures and their applications

    NASA Astrophysics Data System (ADS)

    Bayam, Yavuz; Rodrigues, Debora; Atalay, Ramazan; Zafer, Ceylan; Okur, Salih; Bala, Rukayya K.; Okyay, Tugba O.; Gültekin, Burak; Caha, Ihsan; Tural, Enis E.; Duyar, Sinem; Özbek, Cebrail; Guler, Telat


    Sonochemical growth technique is based upon the chemical effect of ultrasound on chemical reactions. This process is carried out at an ambient atmosphere without the need for a complex experimental set up and additional heating. This method is of significant importance because of it's vital application in various fields. ZnO nanorods were grown on glass substrates without any additional heat or surfactance by sonochemical growth technique. The grown nanostructures were characterized by Raman spectroscopy, scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). Sonochemically grown ZnO nanorod networks were characterized for their antibacterial properties toward B.subtilis. These structures were also characterized for their CO sensing properties and photovoltaic performances for dye sensitized solar cell (DSSC) application. All material characterization and device performances suggest that sonochemsitry can be utilized as an alternative growth method for 1D ZnO nanostructures.

  20. Lipid accumulation by Rhodococcus rhodochrous grown on glucose.


    Shields-Menard, Sara A; Amirsadeghi, Marta; Sukhbaatar, Badamkhand; Revellame, Emmanuel; Hernandez, Rafael; Donaldson, Janet R; French, W Todd


    Biodiesel is an alternative fuel made from costly vegetable oil feedstocks. Some microorganisms can accumulate lipids when nutrients are limited and carbon is in excess. Rhodococcus rhodochrous is a gram-positive bacterium most often used in bioremediation or acrylamide production. The purpose of this study was to investigate and characterize the lipid accumulation capabilities of R. rhodochrous. Shake flasks and a large-scale fermentation were used to cultivate R. rhodochrous in varying concentrations of glucose. R. rhodochrous achieved almost 50 % of dry cell mass as lipid when grown in 20 g/L of glucose. Wax esters and triglycerides were identified in R. rhodochrous lipid extract. The transesterified extractables of R. rhodochrous consisted of mostly palmitic (35 %) and oleic (42 %) acid methyl esters. This study shows R. rhodochrous to be an oleaginous bacterium with potential for application in alternative fuels. PMID:25656153

  1. Listeria monocytogenes Grown at 7°C Shows Reduced Acid Survival and an Altered Transcriptional Response to Acid Shock Compared to L. monocytogenes Grown at 37°C

    PubMed Central

    Ivy, R. A.; Wiedmann, M.


    Survival of the food-borne pathogen Listeria monocytogenes in acidic environments (e.g., in the human stomach) is vital to its transmission. Refrigerated, ready-to-eat foods have been sources of listeriosis outbreaks. The purpose of this study was to determine whether growth at a low temperature (i.e., 7°C) affects L. monocytogenes survival or gene transcription after exposure to a simulated gastric environment (i.e., acid shock at 37°C). L. monocytogenes cells grown at 7°C were less resistant to artificial gastric fluid (AGF) or acidified brain heart infusion broth (ABHI) than bacteria grown at higher temperatures (i.e., 30°C or 37°C). For L. monocytogenes grown at 7°C, stationary-phase cells were more resistant to ABHI than log-phase cells, indicating that both temperature and growth phase affect acid survival. Microarray transcriptomic analysis revealed that the number and functional categories of genes differentially expressed after acid shock differed according to both growth temperature and growth phase. The acid response of L. monocytogenes grown to log phase at 37°C involved stress-related transcriptional regulators (i.e., σB, σH, CtsR, and HrcA), some of which have been implicated in adaptation to the intracellular environment. In contrast, for bacteria grown at 7°C to stationary phase, acid exposure did not result in differential expression of the stress regulons examined. However, two large operons encoding bacteriophage-like proteins were induced, suggesting lysogenic prophage induction. The adaptive transcriptional response observed in 37°C-grown cells was largely absent in 7°C-grown cells, suggesting that temperatures commonly encountered during food storage and distribution affect the ability of L. monocytogenes to survive gastric passage and ultimately cause disease. PMID:22447604

  2. Three distinct quinoprotein alcohol dehydrogenases are expressed when Pseudomonas putida is grown on different alcohols.

    PubMed Central

    Toyama, H; Fujii, A; Matsushita, K; Shinagawa, E; Ameyama, M; Adachi, O


    A bacterial strain that can utilize several kinds of alcohols as its sole carbon and energy sources was isolated from soil and tentatively identified as Pseudomonas putida HK5. Three distinct dye-linked alcohol dehydrogenases (ADHs), each of which contained the prosthetic group pyrroloquinoline quinone (PQQ), were formed in the soluble fractions of this strain grown on different alcohols. ADH I was formed most abundantly in the cells grown on ethanol and was similar to the quinoprotein ADH reported for P. putida (H. Grisch and M. Rupp, Antonie Leeuwenhoek 56:35-45, 1989) except for its isoelectric point. The other two ADHs, ADH IIB and ADH IIG, were formed separately in the cells grown on 1-butanol and 1,2-propanediol, respectively. Both of these enzymes contained heme c in addition to PQQ and functioned as quinohemoprotein dehydrogenases. Potassium ferricyanide was an available electron acceptor for ADHs IIB and IIG but not for ADH I. The molecular weights were estimated to be 69,000 for ADH IIB and 72,000 for ADH IIG, and both enzymes were shown to be monomers. Antibodies raised against each of the purified ADHs could distinguish the ADHs from one another. Immunoblot analysis showed that ADH I was detected in cells grown on each alcohol tested, but ethanol was the most effective inducer. ADH IIB was formed in the cells grown on alcohols of medium chain length and also on 1,3-butanediol. Induction of ADH IIG was restricted to 1,2-propanediol or glycerol, of which the former alcohol was more effective. These results from immunoblot analysis correlated well with the substrate specificities of the respective enzymes. Thus, three distinct quinoprotein ADHs were shown to be synthesized by a single bacterium under different growth conditions. PMID:7730276

  3. Cytotoxicity of municipal solid waste incinerator ash wastes toward mammalian kidney cell lines.


    Huang, Wu-Jang; Tsai, Jia-Lin; Liao, Ming-Huei


    In this study, three municipal solid waste incinerator (MSWI) ash wastes-bottom ash, scrubber residue, and baghouse ash-were extracted using a toxicity characteristic leaching procedure (TCLP) extractant. These so-called final TCLP extracts were applied to African green monkey kidney cells (Vero), baby hamster kidney cells (BHK-21), and pig kidney cells (PK-15), multi-well absorption reader analysis was performed to test how the cytotoxicity of the incineration ashes would affect the digestive systems of animals. Ion-coupled plasma analyses indicated that the baghouse ash extract possessed the highest pH and heavy metal concentration, its cytotoxicity was also the highest. In contrast, the bottom ash and the scrubber residue exhibited very low cytotoxicities. The cytotoxicities of mixtures of baghouse ash and scrubber residue toward the three tested cell lines increased as the relative ratio of the baghouse ash increased, especially for the Vero cells. The slight cytotoxicity of the scrubber residue arose mainly from the presence of Cr species, whereas the high cytotoxicity of the baghouse ash resulted from its high content of heavy metals and alkali ions. In addition, it appears that the dissolved total organic carbon content of these ash wastes can reduce the cytotoxicity of ash wastes that collect in animal cells. PMID:18329068

  4. Magnetization dynamics of cobalt grown on graphene

    NASA Astrophysics Data System (ADS)

    Berger, A. J.; Amamou, W.; White, S. P.; Adur, R.; Pu, Y.; Kawakami, R. K.; Hammel, P. C.


    Ferromagnetic resonance (FMR) spin pumping is a rapidly growing field which has demonstrated promising results in a variety of material systems. This technique utilizes the resonant precession of magnetization in a ferromagnet to inject spin into an adjacent non-magnetic material. Spin pumping into graphene is attractive on account of its exceptional spin transport properties. This article reports on FMR characterization of cobalt grown on chemical vapor deposition graphene and examines the validity of linewidth broadening as an indicator of spin pumping. In comparison to cobalt samples without graphene, direct contact cobalt-on-graphene exhibits increased FMR linewidth—an often used signature of spin pumping. Similar results are obtained in Co/MgO/graphene structures, where a 1 nm MgO layer acts as a tunnel barrier. However, magnetometry, magnetic force microscopy, and Kerr microscopy measurements demonstrate increased magnetic disorder in cobalt grown on graphene, perhaps due to changes in the growth process and an increase in defects. This magnetic disorder may account for the observed linewidth enhancement due to effects such as two-magnon scattering or mosaicity. As such, it is not possible to conclude successful spin injection into graphene from FMR linewidth measurements alone.

  5. Magnetization dynamics of cobalt grown on graphene

    SciTech Connect

    Berger, A. J.; White, S. P.; Adur, R.; Pu, Y.; Hammel, P. C.; Amamou, W.; Kawakami, R. K.


    Ferromagnetic resonance (FMR) spin pumping is a rapidly growing field which has demonstrated promising results in a variety of material systems. This technique utilizes the resonant precession of magnetization in a ferromagnet to inject spin into an adjacent non-magnetic material. Spin pumping into graphene is attractive on account of its exceptional spin transport properties. This article reports on FMR characterization of cobalt grown on chemical vapor deposition graphene and examines the validity of linewidth broadening as an indicator of spin pumping. In comparison to cobalt samples without graphene, direct contact cobalt-on-graphene exhibits increased FMR linewidth—an often used signature of spin pumping. Similar results are obtained in Co/MgO/graphene structures, where a 1 nm MgO layer acts as a tunnel barrier. However, magnetometry, magnetic force microscopy, and Kerr microscopy measurements demonstrate increased magnetic disorder in cobalt grown on graphene, perhaps due to changes in the growth process and an increase in defects. This magnetic disorder may account for the observed linewidth enhancement due to effects such as two-magnon scattering or mosaicity. As such, it is not possible to conclude successful spin injection into graphene from FMR linewidth measurements alone.

  6. Increase of translatable mRNA for major microsomal proteins in n-alkane-grown Candida maltosa

    SciTech Connect

    Sunairi, M.; Watabe, K.; Takagi, M.; Yano, K.


    In an n-alkane-assimilating Candida sp., transfer from glucose- to n-alkane-containing medium induced changes in the microsomal proteins, and several distinctive polypeptides were demonstrated in the solubilized microsomal fraction derived from n-alkane-grown cells. Long-term-labeling and pulse-labeling experiments in vivo demonstrated the synthesis of the specific microsomal polypeptides. The polypeptides were synthesized as in vitro translation products directed by polyadenylated RNA extracted from n-alkane-grown cells. Two major polypeptides were partially purified from the microsomal fraction from n-alkane-grown cells, and antiserum was prepared in a rabbit. Immunoprecipitation of these two polypeptides was accompanied by an increase in the amount of translatable mRNA. The molecular weights of the polypeptides derived from long-term-labeling, pulse-labeling and in vitro translation experiments appeared to be identical.

  7. Fe(III) reduction activity and cytochrome content of Shewanella putrefaciens grown on ten compounds as sole terminal electron acceptor.


    Blakeney, M D; Moulaei, T; DiChristina, T J


    Shewanella putrefaciens was grown on a series of ten alternate compounds as sole terminal electron acceptor. Each cell type was analyzed for Fe(III) reduction activity, absorbance maxima in reduced-minus-oxidized difference spectra and heme-containing protein content. High-rate Fe(III) reduction activity, pronounced difference maxima at 521 and 551 nm and a predominant 29.3 kDa heme-containing protein expressed by cells grown on Fe(III), Mn(IV), U(VI), SO3(2-) and S2O3(2-), but not by cells grown on O2, NO3, NO2-, TMAO or fumarate. These results suggest that microbial Fe(III) reduction activity is enhanced by anaerobic growth on metals and sulfur compounds, yet is limited under all other terminal electron-accepting conditions. PMID:10950190

  8. Reduction of soluble and insoluble iron forms by membrane fractions of Shewanella oneidensis grown under aerobic and anaerobic conditions.


    Ruebush, Shane S; Brantley, Susan L; Tien, Ming


    The effect of iron substrates and growth conditions on in vitro dissimilatory iron reduction by membrane fractions of Shewanella oneidensis MR-1 was characterized. Membrane fractions were separated by sucrose density gradients from cultures grown with O(2), fumarate, and aqueous ferric citrate as the terminal electron acceptor. Marker enzyme assays and two-dimensional gel electrophoresis demonstrated the high degree of separation between the outer and cytosolic membrane. Protein expression pattern was similar between chelated iron- and fumarate-grown cultures, but dissimilar for oxygen-grown cultures. Formate-dependent ferric reductase activity was assayed with citrate-Fe(3+), ferrozine-Fe(3+), and insoluble goethite as electron acceptors. No activity was detected in aerobic cultures. For fumarate and chelated iron-grown cells, the specific activity for the reduction of soluble iron was highest in the cytosolic membrane. The reduction of ferrozine-Fe(3+) was greater than the reduction of citrate-Fe(3+). With goethite, the specific activity was highest in the total membrane fraction (containing both cytosolic and outer membrane), indicating participation of the outer membrane components in electron flow. Heme protein content and specific activity for iron reduction was highest with chelated iron-grown cultures with no heme proteins in aerobically grown membrane fractions. Western blots showed that CymA, a heme protein involved in iron reduction, expression was also higher in iron-grown cultures compared to fumarate- or aerobic-grown cultures. To study these processes, it is important to use cultures grown with chelated Fe(3+) as the electron acceptor and to assay ferric reductase activity using goethite as the substrate. PMID:16597999

  9. Antiviral susceptibility testing with a cell line which expresses beta-galactosidase after infection with herpes simplex virus.

    PubMed Central

    Tebas, P; Stabell, E C; Olivo, P D


    Despite increasing concern about drug-resistant herpes simplex virus (HSV), antiviral susceptibility testing is not routinely performed by most clinical virology laboratories. This omission is in large part because the most widely accepted method, the plaque reduction assay (PRA), is cumbersome to perform and results are rarely available in time to influence treatment. We report here the development of a sensitivity test for HSV which utilizes a cell line (VeroICP6LacZ#7) that expresses beta-galactosidase activity after infection with HSV such that infected cells can be detected by histochemical staining. We designed an assay in which 10-fold dilutions of virus stocks with undetermined titers were inoculated onto VeroICP6LacZ#7 cells in a 24-well tissue culture dish. Forty-eight hours after infection, the cell monolayers were histochemically stained. Plaques appear blue against a clear background and are thus easily visualized at 48 h. As with the standard PRA, the 50% inhibitory concentration (IC50) was reported as the concentration of an antiviral drug that reduces the number of plaques by 50%. Evaluation of 10 well-characterized laboratory strains and 12 clinical HSV isolates showed that the IC50 determined by this method correlated in all instances with the IC50 determined by the PRA. This method is easy to use and eliminates the need to determine the titer of the virus, and results are available within 48 h of the detection of the virus. VeroICP6Lac#7 cells are a useful tool for performing HSV antiviral susceptibility testing and could be used in a number of different formats to facilitate the identification of drug-resistant isolates of HSV. PMID:7574517

  10. Cell lines that support replication of a novel herpes simplex virus 1 U{sub L}31 deletion mutant can properly target U{sub L}34 protein to the nuclear rim in the absence of U{sub L}31

    SciTech Connect

    Liang Li; Tanaka, Michiko; Kawaguchi, Yasushi; Baines, Joel D. . E-mail:


    Previous results indicated that the herpes simplex virus 1 (HSV-1) U{sub L}31 gene is necessary and sufficient for localization of the U{sub L}34 protein exclusively to the nuclear membrane of infected Hep2 cells. In the current studies, a bacterial artificial chromosome containing the entire HSV-1 strain F genome was used to construct a recombinant viral genome in which a gene encoding kanamycin resistance was inserted in place of 262 codons of the 306 codon U{sub L}31 open reading frame. The deletion virus produced virus titers approximately 10- to 50-fold lower in rabbit skin cells, more than 2000-fold lower in Vero cells, and more than 1500-fold lower in CV1 cells, compared to a virus bearing a restored U{sub L}31 gene. The replication of the U{sub L}31 deletion virus was restored on U{sub L}31-complementing cell lines derived either from rabbit skin cells or CV1 cells. Confocal microscopy indicated that the majority of U{sub L}34 protein localized aberrantly in the cytoplasm and nucleoplasm of Vero cells and CV1 cells, whereas U{sub L}34 protein localized at the nuclear membrane in rabbit skin cells, and U{sub L}31 complementing CV1 cells infected with the U{sub L}31 deletion virus. We conclude that rabbit skin cells encode a function that allows proper localization of U{sub L}34 protein to the nuclear membrane. We speculate that this function partially complements that of U{sub L}31 and may explain why U{sub L}31 is less critical for replication in rabbit skin cells as opposed to Vero and CV1 cells.

  11. Gene expression by the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough grown on an iron electrode under cathodic protection conditions.


    Caffrey, Sean M; Park, Hyung Soo; Been, Jenny; Gordon, Paul; Sensen, Christoph W; Voordouw, Gerrit


    The genome sequence of the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough was reanalyzed to design unique 70-mer oligonucleotide probes against 2,824 probable protein-coding regions. These included three genes not previously annotated, including one that encodes a c-type cytochrome. Using microarrays printed with these 70-mer probes, we analyzed the gene expression profile of wild-type D. vulgaris grown on cathodic hydrogen, generated at an iron electrode surface with an imposed negative potential of -1.1 V (cathodic protection conditions). The gene expression profile of cells grown on cathodic hydrogen was compared to that of cells grown with gaseous hydrogen bubbling through the culture. Relative to the latter, the electrode-grown cells overexpressed two hydrogenases, the hyn-1 genes for [NiFe] hydrogenase 1 and the hyd genes, encoding [Fe] hydrogenase. The hmc genes for the high-molecular-weight cytochrome complex, which allows electron flow from the hydrogenases across the cytoplasmic membrane, were also overexpressed. In contrast, cells grown on gaseous hydrogen overexpressed the hys genes for [NiFeSe] hydrogenase. Cells growing on the electrode also overexpressed genes encoding proteins which promote biofilm formation. Although the gene expression profiles for these two modes of growth were distinct, they were more closely related to each other than to that for cells grown in a lactate- and sulfate-containing medium. Electrochemically measured corrosion rates were lower for iron electrodes covered with hyn-1, hyd, and hmc mutant biofilms than for wild-type biofilms. This confirms the importance, suggested by the gene expression studies, of the corresponding gene products in D. vulgaris-mediated iron corrosion. PMID:18310429

  12. Magnetic and structural properties of MBE-grown oxidic multilayers

    SciTech Connect

    Bloemen, P.J.H.; Heijden, P.A.A. van der; Kohlhepp, J.T.; Jonge, W.J.M. de; Wolf, R.M.; Stegge, J. aan de; Reinders, A.; Jungblut, R.M.; Zaag, P.J. van der


    Multilayers composed of oxides including Fe{sub 3}O{sub 4}, Co{sub x}Fe{sub 3{minus}x}O{sub 4}, CoO, NiO and MgO have been grown epitaxially by MBE on MgO(100) single crystal substrates. These structures can be grown with a high crystallinity in the form of flat layers having sharp interfaces. RHEED studies which commonly yielded sharp streaks accompanied by Kikuchi lines show that, for instance, growth of CoO on Fe{sub 3}O{sub 4} changes the RHEED pattern form from that consistent with a spinel structure to that of a rocksalt structure within about one and a half unit cell of CoO. STM studies on a 400 {angstrom} Fe{sub 3}O{sub 4} layer displaying atomic resolution enabled us to identify the origin of the reconstruction that one commonly observes in the RHEED and LEED patterns for magnetite. Regarding important fundamental magnetic parameters, relevant thickness dependencies were mapped out using localized magneto-optical Kerr effect experiments performed on several samples that routinely included one or multiple wedge shaped layers. These studies revealed the existence of a region in the Fe{sub 3}O{sub 4} layer near the interfaces which exhibits no net magnetic moment, strain driven perpendicular orientated magnetization for the CoO/Fe{sub 3}O{sub 4}(100) and CoO/Co{sub x}Fe{sub 3{minus}x}O{sub 4}(100) bilayer systems, and information on the thickness dependence of the magnetic interlayer coupling across an MgO spacer layer.

  13. Enhancement of Immune Activation Activities of Spirulina maxima Grown in Deep-Sea Water

    PubMed Central

    Choi, Woon Yong; Kang, Do Hyung; Lee, Hyeon Yong


    In this study, the immuno-modulatory and anticancer activities of marine algae, Spirulina maxima grown in deep-sea water (DSW), were investigated. It was found that the extract of S. maxima, cultured in DSW, effectively suppressed the expression of Bcl2 in A549 cells as well as inhibiting various human cancer cells with concentration dependency, which possibly implies that the extracts may play more important roles in controlling cancer cell growth. The secretion of cytokines IL-6 and TNF-α from human B cells was also greatly increased, compared to those of the extract grown in conventional sea-water. The growth of Human Natural Killer (NK) cells in the presence of the extracts from DSW was significantly higher (12.2 × 104 viable cells/mL) when compared to the control (1.1 × 104 viable cells/mL). Based on HPLC analysis, the increase in the biological activities of the extracts from DSW was caused by considerably high amounts of β-carotene and ascorbic acid because the DSW contained high concentrations and good ratios of several key minerals for biosynthesizing β-carotene and ascorbic acid, as well as maintaining high cell growth. PMID:23743830

  14. Growth and heavy metals accumulation potential of microalgae grown in sewage wastewater and petrochemical effluents.


    Ajayan, K V; Selvaraju, M; Thirugnanamoorthy, K


    Microalgae exhibit a number of heavy metal uptake process by different metabolism. In this study, the ability of microalgae for removal of heavy metal from wastewater was studied. Growth and biochemical contents of microalgae were determined by spectrophotometer. Heavy metal analysis of wastewater effluents were performed by atomic absorption spectrophotometer before and after treatment at laboratory scale. The growth of Scenedesmus bijuga and Oscillatoria quadripunctulata in sewage wastewater was higher than those grown in synthetic medium. Whereas, the growth of S. bijuga and O. quadripunctulata in sterilized petrochemical effluents was slightly lower than that grown in the standard synthetic medium. The chlorophyll, carotenoid and protein content of S. bijuga and O. quadripunctulata grown in sterilized sewage wastewater were higher than those grown in the standard medium. Similarly S. bijuga and O. quadripunctulata grown in sterilized petrochemical effluents showed lower contents of pigments and protein than those grown in sewage and synthetic medium. Heavy metals copper, cobalt, lead and zinc were removed by 37-50, 20.3-33.3, 34.6-100 and 32.1-100%, respectively from sewage wastewater and petrochemical effluent using Ocillatoria culture. The metal absorption by S. bijuga were (Cu, Co, Pb, Zn) 60-50, 29.6-66, 15.4-25 and 42.9-50%, respectively from sewage and petrochemical effluents. Both species showed high level of heavy metal removal efficiency and metal sorption efficiency of both microalgae depended on the type of biosorbent, the physiological status of the cells, availability of heavy metal, concentration of heavy metal and chemical composition of wastewater. PMID:22545355

  15. Hexagonal boron nitride grown by MOVPE

    NASA Astrophysics Data System (ADS)

    Kobayashi, Y.; Akasaka, T.; Makimoto, T.


    Hexagonal boron nitride (h-BN) has a potential for optical device applications in the deep ultraviolet spectral region. For several decades, only amorphous and turbostratic boron nitride (BN) films had been grown by chemical vapor deposition and metalorganic vapor phase epitaxy. By introducing flow-rate modulation epitaxy (FME), which enables us to reduce parasitic reactions and lower the optimal growth temperature, we have succeeded in growing single-phase h-BN epitaxial films on nearly lattice-matched (1 1 1) Ni substrates. The h-BN epitaxial films exhibit near-band-gap ultraviolet luminescence at a wavelength of 227 nm in cathodoluminescence at room temperature. The combination of FME and the lattice-matched substrate paves the way for the epitaxial growth of high-quality h-BN.

  16. Perfect crystals grown from imperfect interfaces

    PubMed Central

    Falub, Claudiu V.; Meduňa, Mojmír; Chrastina, Daniel; Isa, Fabio; Marzegalli, Anna; Kreiliger, Thomas; Taboada, Alfonso G.; Isella, Giovanni; Miglio, Leo; Dommann, Alex; von Känel, Hans


    The fabrication of advanced devices increasingly requires materials with different properties to be combined in the form of monolithic heterostructures. In practice this means growing epitaxial semiconductor layers on substrates often greatly differing in lattice parameters and thermal expansion coefficients. With increasing layer thickness the relaxation of misfit and thermal strains may cause dislocations, substrate bowing and even layer cracking. Minimizing these drawbacks is therefore essential for heterostructures based on thick layers to be of any use for device fabrication. Here we prove by scanning X-ray nanodiffraction that mismatched Ge crystals epitaxially grown on deeply patterned Si substrates evolve into perfect structures away from the heavily dislocated interface. We show that relaxing thermal and misfit strains result just in lattice bending and tiny crystal tilts. We may thus expect a new concept in which continuous layers are replaced by quasi-continuous crystal arrays to lead to dramatically improved physical properties. PMID:23880632

  17. Nanolasers grown on silicon-based MOSFETs.


    Lu, Fanglu; Tran, Thai-Truong D; Ko, Wai Son; Ng, Kar Wei; Chen, Roger; Chang-Hasnain, Connie


    We report novel indium gallium arsenide (InGaAs) nanopillar lasers that are monolithically grown on (100)-silicon-based functional metal-oxide-semiconductor field effect transistors (MOSFETs) at low temperature (410 °C). The MOSFETs maintain their performance after the nanopillar growth, providing a direct demonstration of complementary metal-oxide-semiconudctor (CMOS) compatibility. Room-temperature operation of optically pumped lasers is also achieved. To our knowledge, this is the first time that monolithically integrated lasers and transistors have been shown to work on the same silicon chip, serving as a proof-of-concept that such integration can be extended to more complicated CMOS integrated circuits. PMID:22714204

  18. Vapor grown carbon fiber (VGCF) composites

    SciTech Connect

    Ciminelli, D.L.; Kearns, K.M.; Ragland, W.R.


    Vapor grown carbon fibers (VGCF) offer a unique opportunity for carbon fiber composites to expand into a multitude of new markets due to their low cost of only $3 to 5 per pound. Additionally, VGCFs are extremely graphitic and have demonstrated the highest thermal conductivity of any graphite material. Pyrograf-III{reg_sign}, a VGCF produced by Applied Sciences, Inc (ASI), is a small diameter (0.1 {mu}m) fiber with a high aspect ratio (100- 1000). The primary interest of the work is for thermal management applications. The focus of the work has been developing novel process methodologies for these unusual fibers using phenolic and epoxy resin to produce low cost composites. The development of VGCF composites is being performed through a Cooperative Research and Development Agreement (CRDA) between ASI and the Materials Directorate (WL/ML), Wright Laboratory, United States Air Force.

  19. Learning about Cancer by Studying Stem Cells


    ... Science Home Page Learning About Cancer by Studying Stem Cells By Sharon Reynolds Posted January 8, 2014 Normally, ... of them are exploring the process by studying stem cells. Modeling Early Pancreatic Cancer Pancreatic cancer cells grown ...

  20. van der Waals Heterostructures Grown by MBE

    NASA Astrophysics Data System (ADS)

    Hinkle, Christopher

    In this work, we demonstrate the high-quality MBE heterostructure growth of various layered 2D materials by van der Waals epitaxy (VDWE). The coupling of different types of van der Waals materials including transition metal dichalcogenide thin films (e.g., WSe2, WTe2, HfSe2) , insulating hexagonal boron nitride (h-BN), and topological insulators (e.g., Bi2Se3) allows for the fabrication of novel electronic devices that take advantage of unique quantum confinement and spin-based characteristics. The relaxed lattice-matching criteria of van der Waals epitaxy has allowed for high-quality heterostructure growth with atomically abrupt interfaces, allowing us to couple these materials based primarily on their band alignment and electronic properties. We will discuss the impact of sample preparation, surface reactivity, and lattice mismatch of various substrates (sapphire, graphene, TMDs, Bi2Se3) on the growth mode and quality of the films and will discuss our studies of substrate temperature and flux rates on the resultant growth and grain size. Structural and chemical characterization was conducted via reflection high energy electron diffraction (RHEED, X-ray diffraction (XRD), transmission electron microscopy (TEM), scanning tunneling microscopy/spectroscopy (STM/S), atomic force microscopy (AFM), X-ray photoelectron spectroscopy (XPS), and Raman spectroscopy. Experimentally determined band alignments have been determined and compared with first-principles calculations allowing the design of novel low-power logic and magnetic memory devices. Initial results from the electrical characterization of these grown thin films and some simple devices will also be presented. These VDWE grown layered 2D materials show significant potential for fabricating novel heterostructures with tunable band alignments and magnetic properties for a variety of nanoelectronic and optoelectronic applications.

  1. Effects of sulfated fucan, ascophyllan, from the brown Alga Ascophyllum nodosum on various cell lines: a comparative study on ascophyllan and fucoidan.


    Jiang, Zedong; Okimura, Takasi; Yokose, Takeshi; Yamasaki, Yasuhiro; Yamaguchi, Kenichi; Oda, Tatsuya


    The effects of fucose-containing sulfated polysaccharides, ascophyllan and fucoidan, isolated from the brown alga Ascophyllum nodosum, on the growth of various cell lines (MDCK, Vero, PtK(1), CHO, HeLa, and XC) were investigated. In a colony formation assay, ascophyllan and fucoidan showed potent cytotoxic effects on Vero and XC cells, while other cell lines were relatively resistant to these polysaccharides. Almost no significant effects of these polysaccharides were observed in the cell lines tested using the Alamar blue cytotoxicity assay over 48 h with varying initial cell densities (2500-20,000 cells/well) in growth medium. Interestingly, a significant growth promoting effect of ascophyllan on MDCK cells was observed, whereas treatment with fucoidan showed growth suppressive effects on this cell line under the same experimental conditions. These results suggest that ascophyllan is distinguishable from fucoidan in terms of their bioactivities. This is the first report of the growth promoting effects of a sulfated fucan on a mammalian cell line under normal growth conditions. PMID:20541128

  2. Quantitative Schlieren analysis applied to holograms of crystals grown on Spacelab 3

    NASA Technical Reports Server (NTRS)

    Brooks, Howard L.


    In order to extract additional information about crystals grown in the microgravity environment of Spacelab, a quantitative schlieren analysis technique was developed for use in a Holography Ground System of the Fluid Experiment System. Utilizing the Unidex position controller, it was possible to measure deviation angles produced by refractive index gradients of 0.5 milliradians. Additionally, refractive index gradient maps for any recorded time during the crystal growth were drawn and used to create solute concentration maps for the environment around the crystal. The technique was applied to flight holograms of Cell 204 of the Fluid Experiment System that were recorded during the Spacelab 3 mission on STS 51B. A triglycine sulfate crystal was grown under isothermal conditions in the cell and the data gathered with the quantitative schlieren analysis technique is consistent with a diffusion limited growth process.

  3. Full-grown oocytes from Xenopus laevis resume growth when placed in culture

    SciTech Connect

    Wallace, R.A.; Misulovin, Z.; Etkin, L.D.


    When most full-grown, follicle cell-invested oocytes from Xenopus laevis are placed in an appropriate culture medium, they resume growth and remain physiologically healthy for at least 2 to 3 weeks. Rates of growth by full-grown oocytes in vitro generally approximate and can even exceed the most rapid growth rate achieved by vitellogenic oocytes in vivo. Resumption of oocyte growth can be correlated with the loss of investing follicle cells, which under normal conditions appear to interfere with vitellogenin and nutrient access to the oocyte. The final size reached by the oocyte within the ovary is thus not an intrinsic property of the oocyte but is extrinsically imposed by the somatic environment.

  4. Production of fertile offspring from oocytes grown in vitro by nuclear transfer in cattle.


    Hirao, Yuji; Naruse, Kenji; Kaneda, Masahiro; Somfai, Tamas; Iga, Kosuke; Shimizu, Manabu; Akagi, Satoshi; Cao, Feng; Kono, Tomohiro; Nagai, Takashi; Takenouchi, Naoki


    Because of recent advancements in reproductive technology, oocytes have attained an increasingly enriched value as a unique cell population in the production of offspring. The growing oocytes in the ovary are an immediate potential source that serve this need; however, complete oocyte growth before use is crucial. Our research objective was to create in vitro-grown (IVG) oocytes that would have the ability to perform specialized activities, including nuclear reprogramming, as an alternative to in vivo-grown oocytes. Bovine oocyte-granulosa cell complexes with a mean oocyte diameter of approximately 100 μm were cultured on Millicell membrane inserts, with culture medium supplemented with 4% polyvinylpyrrolidone (molecular weight, 360,000), 20 ng/ml androstenedione, 2 mM hypoxanthine, and 5 ng/ml bone morphogenetic protein 7. Oocyte viability after the 14-day culture period was 95%, and there was a 71% increase in oocyte volume. Upon induction of oocyte maturation, 61% of the IVG oocytes extruded a polar body. Eighty-four percent of the reconstructed IVG oocytes that used cumulus cells as donor cells underwent cleavage, and half of them became blastocysts. DNA methylation analyses of the satellite I and II regions of the blastocysts revealed a similar highly methylated status in the cloned embryos derived from in vivo-grown and IVG oocytes. Finally, one of the nine embryos reconstructed from the IVG oocytes developed into a living calf following embryo transfer. Fertility of the offspring was confirmed. In conclusion, the potential of a proportion of the IVG oocytes was comparable to that of in vivo-grown oocytes. PMID:23884646

  5. The virion N protein of infectious bronchitis virus is more phosphorylated than the N protein from infected cell lysates

    SciTech Connect

    Jayaram, Jyothi; Youn, Soonjeon; Collisson, Ellen W. . E-mail:


    Because phosphorylation of the infectious bronchitis virus (IBV) nucleocapsid protein (N) may regulate its multiple roles in viral replication, the dynamics of N phosphorylation were examined. {sup 32}P-orthophosphate labeling and Western blot analyses confirmed that N was the only viral protein that was phosphorylated. Pulse labeling with {sup 32}P-orthophosphate indicated that the IBV N protein was phosphorylated in the virion, as well as at all times during infection in either chicken embryo kidney cells or Vero cells. Pulse-chase analyses followed by immunoprecipitation of IBV N proteins using rabbit anti-IBV N polyclonal antibody demonstrated that the phosphate on the N protein was stable for at least 1 h. Simultaneous labeling with {sup 32}P-orthophosphate and {sup 3}H-leucine identified a 3.5-fold increase in the {sup 32}P:{sup 3}H counts per minute (cpm) ratio of N in the virion as compared to the {sup 32}P:{sup 3}H cpm ratio of N in the cell lysates from chicken embryo kidney cells, whereas in Vero cells the {sup 32}P:{sup 3}H cpm ratio of N from the virion was 10.5-fold greater than the {sup 32}P:{sup 3}H cpm ratio of N from the cell lysates. These studies are consistent with the phosphorylation of the IBV N playing a role in assembly or maturation of the viral particle.

  6. Predicting thermal inactivation in media of different pH of Salmonella grown at different temperatures.


    Mañas, Pilar; Pagán, Rafael; Raso, Javier; Condón, Santiago


    The influence of the growth temperature and the pH of the heating medium on the heat resistance at different temperatures of Salmonella typhimurium ATCC 13311 was studied and described mathematically. The shift of the growth temperature from 10 to 37 degrees C increased heat resistance of S. typhimurium fourfold. The pH of the heating medium at which heat resistance was maximum was pH 6 for cells grown at 37 degrees C, but changed with growth temperature. The alkalinization of the heating medium from pH 6 to pH 7.7 decreased the heat resistance of cells grown at 37 degrees C by a factor of 3. Neither the growth temperature nor the pH modified the z values significantly (4.9 degrees C). The decimal reduction times at different treatment temperatures, in buffers of different pH of cells of S. typhimurium grown at different temperatures, were accurately described by a mathematical equation (correlation coefficient of 0.97). This equation was also tested for Salmonella senftenberg 775W (ATCC 43845) and Salmonella enteritidis ATCC 13076, strains in which the correlation coefficients between the observed and the theoretically calculated values were 0.91 and 0.98, respectively. PMID:12927706

  7. Metabolic responses of Rhodococcus erythropolis PR4 grown on diesel oil and various hydrocarbons.


    Laczi, Krisztián; Kis, Ágnes; Horváth, Balázs; Maróti, Gergely; Hegedüs, Botond; Perei, Katalin; Rákhely, Gábor


    Rhodococcus erythropolis PR4 is able to degrade diesel oil, normal-, iso- and cycloparaffins and aromatic compounds. The complete DNA content of the strain was previously sequenced and numerous oxygenase genes were identified. In order to identify the key elements participating in biodegradation of various hydrocarbons, we performed a comparative whole transcriptome analysis of cells grown on hexadecane, diesel oil and acetate. The transcriptomic data for the most prominent genes were validated by RT-qPCR. The expression of two genes coding for alkane-1-monooxygenase enzymes was highly upregulated in the presence of hydrocarbon substrates. The transcription of eight phylogenetically diverse cytochrome P450 (cyp) genes was upregulated in the presence of diesel oil. The transcript levels of various oxygenase genes were determined in cells grown in an artificial mixture, containing hexadecane, cycloparaffin and aromatic compounds and six cyp genes were induced by this hydrocarbon mixture. Five of them were not upregulated by linear and branched hydrocarbons. The expression of fatty acid synthase I genes was downregulated by hydrocarbon substrates, indicating the utilization of external alkanes for fatty acid synthesis. Moreover, the transcription of genes involved in siderophore synthesis, iron transport and exopolysaccharide biosynthesis was also upregulated, indicating their important role in hydrocarbon metabolism. Based on the results, complex metabolic response profiles were established for cells grown on various hydrocarbons. Our results represent a functional annotation of a rhodococcal genome, provide deeper insight into molecular events in diesel/hydrocarbon utilization and suggest novel target genes for environmental monitoring projects. PMID:26346267

  8. Multicellularity and Antibiotic Resistance in Klebsiella pneumoniae Grown Under Bloodstream-Mimicking Fluid Dynamic Conditions

    PubMed Central

    Thornton, Margaret M.; Chung-Esaki, Hangyul M.; Irvin, Charlene B.; Bortz, David M.; Solomon, Michael J.; Younger, John G.


    Background. While the importance of fluid dynamical conditions is well recognized in the growth of biofilms, their role during bacteremia is unknown. We examined the impact of physiological fluid shear forces on the development of multicellular aggregates of Klebsiella pneumoniae. Methods. Wild-type and O-antigen or capsular mutants of K. pneumoniae were grown as broth culture in a Taylor-Couette flow cell configured to provide continuous shear forces comparable to those encountered in the human arterial circulation (ie, on the order of 1.0 Pa). The size distribution and antibiotic resistance of aggregates formed in this apparatus were determined, as was their ability to persist in the bloodstream of mice following intravenous injection. Results. Unlike growth in shaking flasks, bacteria grown in the test apparatus readily formed aggregates, a phenotype largely absent in capsular mutants and to a lesser degree in O-antigen mutants. Aggregates were found to persist in the bloodstream of mice. Importantly, organisms grown under physiological shear were found to have an antibiotic resistance phenotype intermediate between that of fully planktonic and biofilm states. Conclusions. When grown under intravascular-magnitude fluid dynamic conditions, K. pneumoniae spontaneously develops into multicellular aggregates that are capable of persisting in the circulation and exhibit increased antibiotic resistance. PMID:22711903

  9. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    PubMed Central

    Khan, J.A.; Rathore, R.S.; Khan, S.; Ahmad, I.


    Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 ?L and 50 ?L of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes. PMID:24516442

  10. Solar Cells

    NASA Technical Reports Server (NTRS)


    The Heat Exchanger Method (HEM) produces high efficiency crystal ingots in an automated well-insulated furnace offering low equipment, labor and energy costs. The "grown" silicon crystals are used to make solar cells, or photovoltaic cells which convert sunlight directly into electricity. The HEM method is used by Crystal Systems, Inc. and was developed under a NASA/Jet Propulsion Laboratory contract. The square wafers which are the result of the process are sold to companies manufacturing solar panels.

  11. Silicon samples grown under reduced melt convection

    NASA Astrophysics Data System (ADS)

    Binetti, S.; Gonik, M.; Le Donne, A.; Croel, A.


    In any crystallization process, convection rules the formation and distribution of impurities and precipitates. Silicon is actually a well studied material; however the distribution of impurities and their related precipitation processes are still not investigated from the point of view of diffusion and segregation phenomena. In principle, experimentation under microgravity can contribute to a better understanding of the processes occurring during solidification since the chemical segregation and distribution of impurities can be studied under purely diffusive transport conditions. In ground experiments, the effect of a reduced melt convection growth process and its effect on the crystal quality could be studied growing silicon by the Axial Heating Process (AHP). For this purpose, a modified Float Zone (FZ) technique using an additional AHP heater submerged into the melt was applied in this work to grow silicon single crystal. The obtained samples were inspected by resistivity measurements and spectroscopic techniques (PL, FT-IR). The spatial distribution of the dopant along the ingot obtained by local resistivity measurements was compared with a theoretical distribution of dopant. PL measurements confirm the high quality level of the grown ingots and infrared spectroscopy reveals low carbon and oxygen concentration. Such an approach seems to be very promising also for solar grade Si solidification for PV applications.