Sample records for vero cells grown

  1. Human Respiratory Syncytial Virus Memphis 37 Grown in HEp-2 Cells Causes more Severe Disease in Lambs than Virus Grown in Vero Cells

    PubMed Central

    Derscheid, Rachel J.; van Geelen, Albert; McGill, Jodi L.; Gallup, Jack M.; Cihlar, Tomas; Sacco, Randy E.; Ackermann, Mark R.

    2013-01-01

    Respiratory syncytial virus (RSV) is the most common cause of bronchiolitis in infants and young children. A small percentage of these individuals develop severe and even fatal disease. To better understand the pathogenesis of severe disease and develop therapies unique to the less-developed infant immune system, a model of infant disease is needed. The neonatal lamb pulmonary development and physiology is similar to that of infants, and sheep are susceptible to ovine, bovine, or human strains of RSV. RSV grown in Vero (African green monkey) cells has a truncated attachment G glycoprotein as compared to that grown in HEp-2 cells. We hypothesized that the virus grown in HEp-2 cells would cause more severe clinical symptoms and cause more severe pathology. To confirm the hypothesis, lambs were inoculated simultaneously by two different delivery methods (intranasal and nebulized inoculation) with either Vero-grown or HEp-2-grown RSV Memphis 37 (M37) strain of virus to compare viral infection and disease symptoms. Lambs infected with HEp-2 cell-derived virus by either intranasal or nebulization inoculation had significantly higher levels of viral RNA in lungs as well as greater clinical disease including both gross and histopathologic lesions compared to lambs similarly inoculated with Vero-grown virus. Thus, our results provide convincing in vivo evidence for differences in viral infectivity that corroborate previous in vitro mechanistic studies demonstrating differences in the G glycoprotein expression by RSV grown in Vero cells. PMID:24284879

  2. A novel animal-component-free medium for rabies virus production in Vero cells grown on Cytodex 1 microcarriers in a stirred bioreactor

    Microsoft Academic Search

    Samia Rourou; Arno van der Ark; Samy Majoul; Khaled Trabelsi; Tiny van der Velden; Héla Kallel

    2009-01-01

    Vero cells growth and rabies production in IPT-AF medium, a property animal-component-free medium are described in this work.\\u000a Kinetics of cell growth and rabies virus (strain LP 2061) production were first conducted in spinner flasks. Over eight independent\\u000a experiments, Vero cell growth in IPT-AF medium, on 2 g\\/l Cytodex 1 was consistent. An average Cd (cell division number) of\\u000a 3.3?±?0.4 and

  3. MicroRNAs as potential biomarkers for VERO cell tumorigenicity.

    PubMed

    Teferedegne, Belete; Macauley, Juliete; Foseh, Gideon; Dragunsky, Eugenia; Chumakov, Konstantin; Murata, Haruhiko; Peden, Keith; Lewis, Andrew M

    2014-08-20

    MicroRNA expression appears to capture the process of neoplastic development in vitro in the VERO line of African green monkey kidney (AGMK) cells (Teferedegne et al. PLoS One 2010;5(12):e14416). In that study, specific miRNA signatures were correlated with the transition, during serial tissue-culture passage, of low-density passaged 10-87 VERO cells from a non-tumorigenic phenotype at passage (p) 148 to a tumorigenic phenotype at p256. In the present study, six miRNAs (miR-376a, miR-654-3p, miR-543, miR-299-3p, miR-134 and miR-369-3p) were chosen from the identified signature miRNAs for evaluation of their use as potential biomarkers to track the progression of neoplastic development in VERO cells. Cells from the 10-87 VERO cell line at passage levels from p148 to p256 were inoculated into newborn and adult athymic nude mice. No tumors were observed in animals inoculated with cells from p148 to p186. In contrast, tumor incidences of 20% developed only in newborn mice that received 10-87 VERO cells at p194, p234 and p256. By qPCR profiling of the signature miRNAs of 10-87 VERO cells from these cell banks, we identified p194 as the level at which signature miRNAs elevated concurrently with the acquisition of tumorigenic phenotype with similar levels expressed beyond this passage. In wound-healing assays at 10-passage intervals between p150 to p250, the cells displayed a progressive increase in migration from p165 to p186; beginning at p194 and higher passages thereafter, the cells exhibited the highest rates of migration. By qPCR analysis, the same signature miRNAs were overexpressed with concomitant acquisition of the tumorigenic phenotype in another lineage of 10-87 VERO cells passaged independently at high density. Correlation between the passages at which the cells expressed a tumorigenic phenotype and the passages representing peaks in expression levels of signature miRNAs indicates that these miRNAs are potential biomarkers for the expression of the VERO cell tumorigenic phenotype. PMID:25024114

  4. VERO cells (cercopithecus aethiops kidney) — growth characteristics and viral susceptibility for use in diagnostic virology

    Microsoft Academic Search

    D. E. Macfarlane; R. G. Sommerville

    1969-01-01

    Summary An investigation of some of the characteristics of the VERO cell line (Cercopithecus aethiops kidney) is reported, in which the suitability of the cells for use in routine diagnostic virology was examined. VERO cells will:1.grow to monolayers as rapidly as other heteroploid cell lines, but will maintain as usable monolayers in conventional maintenance medium for a significantly longer time;2.grow

  5. Can Vero cell co-culture improve in-vitro maturation of bovine oocytes?

    Microsoft Academic Search

    Fariba Moulavi; Sayyed Mortaza Hosseini; Saeid Kazemi Ashtiani; Abdolhossein Shahverdi; Mohammad Hossein Nasr-Esfahani

    2006-01-01

    This study was carried out to evaluate the effect of Vero cell co-culture on developmental competence of immature oocytes. Bovine cumulus–oocyte complexes (COC) were matured in presence or absence of Vero cells. Matured oocytes were inseminated and cultured for up to 9 days. Cleavage percentages were recorded on day 2 after insemination and embryos were evaluated on a daily basis.

  6. The Genome Landscape of the African Green Monkey Kidney-Derived Vero Cell Line

    PubMed Central

    Osada, Naoki; Kohara, Arihiro; Yamaji, Toshiyuki; Hirayama, Noriko; Kasai, Fumio; Sekizuka, Tsuyoshi; Kuroda, Makoto; Hanada, Kentaro

    2014-01-01

    Continuous cell lines that originate from mammalian tissues serve as not only invaluable tools for life sciences, but also important animal cell substrates for the production of various types of biological pharmaceuticals. Vero cells are susceptible to various types of microbes and toxins and have widely contributed to not only microbiology, but also the production of vaccines for human use. We here showed the genome landscape of a Vero cell line, in which 25,877 putative protein-coding genes were identified in the 2.97-Gb genome sequence. A homozygous ?9-Mb deletion on chromosome 12 caused the loss of the type I interferon gene cluster and cyclin-dependent kinase inhibitor genes in Vero cells. In addition, an ?59-Mb loss of heterozygosity around this deleted region suggested that the homozygosity of the deletion was established by a large-scale conversion. Moreover, a genomic analysis of Vero cells revealed a female Chlorocebus sabaeus origin and proviral variations of the endogenous simian type D retrovirus. These results revealed the genomic basis for the non-tumourigenic permanent Vero cell lineage susceptible to various pathogens and will be useful for generating new sub-lines and developing new tools in the quality control of Vero cells. PMID:25267831

  7. Development of a Vero cell DNA reference standard for residual DNA measurement in China.

    PubMed

    Cao, Shouchun; Dong, Guanmu; Tang, Jianrong; Li, Jia; Liu, Jinghua; Shi, Leitai; Li, Changgui; Wang, Junzhi

    2013-02-01

    This collaborative study developed a Vero cell DNA reference for standardizing dot blot hybridization, an assay widely employed to measure residual DNA contents of viral vaccines prepared with Vero cells. High purity of Vero cell DNA was extracted and characterized by Hind III enzyme digestion and DNA sequencing. Then, with a cooperative calibration, the concentration of Vero cell DNA reference bulk solution was determined (64.0 ± 1.9 ?g/mL, OD 260/OD 280 = 1.87) and diluted (40 ng/mL) with Tris-EDTA buffer containing bovine serum albumin as freeze-dried excipients. With industrial filling apparatus, the diluted bulk was loaded into ampoules (0.5 mL each) which were heat sealed after nitrogen filling. Finally, a collaborative study showed that the Vero cell DNA reference could reach a sensitivity of 1 to 5 pg/dot and maintained good stability after accelerated destruction test. The successful establishment of the Vero cell DNA quantitative reference will facilitate the standardization of dot blot hybridization for testing residual host cell DNA. PMID:23291952

  8. A Vero-cell-adapted vaccine donor strain of influenza A virus generated by serial passages.

    PubMed

    Hu, Weibin; Zhang, Hong; Han, Qinglin; Li, Li; Chen, Yixin; Xia, Ningshao; Chen, Ze; Shu, Yuelong; Xu, Ke; Sun, Bing

    2015-01-01

    A cell culture-based vaccine production system is preferred for the large-scale production of influenza vaccines and has advantages for generating vaccines against highly pathogenic influenza A viruses. Vero cells have been widely used in human vaccine manufacturing, and the safety of these cells has been well demonstrated. However, the most commonly used influenza-vaccine donor virus, A/Puerto Rico/8/1934 (PR8) virus, does not grow efficiently in Vero cells. Therefore, we adapted the PR8 virus to Vero cells by continuous passaging, and a high-growth strain was obtained after 20 passages. Sequence analysis and virological assays of the adapted strain revealed that mutations in four viral internal genes (NP, PB1, PA and NS1) were sufficient for adaptation. The recombinant virus harboring these mutations (PR8-4mut) displayed accelerated viral transport into the nucleus and increased RNP activity. Importantly, the PR8-4mut could serve as a backbone donor virus to support the growth of the H7N1, H9N2 and H5N1 avian viruses and the H1N1 and H3N2 human viruses in Vero cells without changing its pathogenicity in either chicken embryos or mice. Thus, our work describes the generation of a Vero-adapted, high-yield PR8-4mut virus that may serve as a promising candidate for an influenza-vaccine donor virus. PMID:25448099

  9. Antiproliferative efficacy of Tabernaemontana divaricata against HEP2 cell line and Vero cell line

    PubMed Central

    Kumar, Arvind; Selvakumar, S.

    2015-01-01

    Background: Laryngeal cancer may also be called cancer of the larynx or laryngeal carcinoma. Conventional plants are a precious source of novel anticancer agents and are still in performance better role in health concern. The study was intended to estimation of the anticancer activity of the chloroformic extract of Tabernaemontana divaricata on the human epidermoid larynx carcinoma cell line (Hep 2). Materials and Method: The aerial parts (leaves, stem, and flowers) of T. divaricata were tested for its inhibitory effect in 96 microplate formats against Hep 2 cell line. The anticancer activity of samples on Hep 2 and Vero was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and various enzymatic parameters like catalase, reduced glutathione (GSH), GSH peroxidase, and superoxide anion scavenging activity. Viable cells were determined by the absorbance at 540 nm. Measurements were performed, and the concentration required for a 50% inhibition of viability (IC50) was determined graphically. The effect of the samples on the proliferation of Hep 2 and Vero cells was expressed as the % cell viability. Results: The extract on Hep 2 cell line up to 7.8 ?g/ml and that IC50 value on Hep 2 cell line was 112 ?g whereas 94 ?g for Vero cell line. Hence, T. divaricata has lesser significant action on Vero cell line. Conclusion: Medicinal plant drug discovery continues to provide new and important leads against various pharmacological targets including cancer. Our results clearly indicate the anticancer property of the medicinal plant T. divaricata against the human laryngeal carcinoma cell lines (Hep 2 cell line).

  10. Impedance monitoring of herpes simplex virus-induced cytopathic effect in Vero cells

    Microsoft Academic Search

    Sungbo Cho; Sybille Becker; Hagen von Briesen; Hagen Thielecke

    2007-01-01

    New regulations like, e.g. the European Registration, Evaluation and Authorization of Chemicals Regulation (the REACH regulation) require efficient and easy to use cell-based systems to get toxicological data of chemicals or to detect viruses in small samples of serum. In this article, we investigate whether the effect of herpes simplex viruses (HSV) on Vero (green monkey kidney) cells can be

  11. Cytotoxic effects of etephon and maleic hydrazide in Vero, Hep2, HepG2 cells.

    PubMed

    Yurdakok, Begum; Baydan, Emine; Okur, Hamza; Gurcan, Ismayil Safa

    2014-10-01

    The toxicity of etephon and maleic hydrazide, used as plant growth regulators in agriculture, were reported as low in mammals in previous studies. However, in vitro cytotoxicity studies in mammalian cells are currently missing to understand their toxicity at molecular level. In the current study, the cytotoxicity of these compounds, were studied in Vero (African green monkey kidney epithelium), HepG2 (human hepatocellular carcinoma), Hep2 (human epidermoid cancer) cells by MTT ((3-(4,5-dimetiltiazol-2-il)-2,5-difeniltetrazolium bromure) and LDH (lactate dehydrogenase) assays. Maleic hydrazide had lower IC50 values for all cell lines compared to ethephon. Least cytotoxic effect treated by ethephon were observed in Vero, followed by HepG2 and Hep2. Similarly maleic hydrazide also showed least cytotoxicity on Vero cells, followed by Hep2 and HepG2 cells (p?Vero cells, followed by HepG2 and Hep2 cells (p?0.868 (p?cells to be supplemented by further studies. PMID:24495230

  12. Tula hantavirus infection of Vero E6 cells induces apoptosis involving caspase 8 activation.

    PubMed

    Li, Xiao-Dong; Kukkonen, Sami; Vapalahti, Olli; Plyusnin, Alexander; Lankinen, Hilkka; Vaheri, Antti

    2004-11-01

    Hantaviruses are known to cause two severe human diseases: haemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome. The mechanisms of pathogenesis of these two diseases are progressively becoming understood. Recently, two hantaviruses, Hantaan and Prospect Hill were reported to cause programmed cell death of Vero E6 cells. This study shows that Tula hantavirus (TULV) infection efficiently triggers an apoptotic programme in infected Vero E6 cells, and that the replication of TULV is required for the activation of caspase 3 and the cleavage of poly (ADP-ribose) polymerase, two molecular hallmarks of apoptosis. The enforced treatment of infected Vero E6 cells with tumour necrosis factor alpha (TNF-alpha), but not interferon alpha (IFN-alpha), advanced the time course of apoptosis. Furthermore, caspase 8 was activated on day 4 post-infection, the same day when caspase 3 was activated. TNF receptor 1 was induced during a late stage of TULV infection. These data suggest that, unlike during influenza A virus infection, TNF-alpha, but not type I IFN-alpha/beta, may contribute significantly to apoptosis in a synergistic manner with TULV propagation. Interestingly, pretreatment with a broad-spectrum caspase inhibitor, z-VAD-fmk, efficiently inhibited apoptosis of TULV-infected Vero E6 cells. Taken together, these results suggest that TULV replication initiates a typical apoptotic programme involving caspase 8 activation. PMID:15483239

  13. Peptides extracted from vero cell cultures overcome the blastocyst block of mouse embryos in a serum-free medium

    Microsoft Academic Search

    Hsin-Fu Chen; Hong-Nerng Ho; Shee-Uan Chen; Kuang-Han Chao; Heng-Ru Lin; Su-Cheng Huang; Tzu-Yao Lee; Yu-Shih Yang

    1994-01-01

    Purpose  \\u000a The aim of this work was to evaluate the effect of a Vero cell coculture system on the development of mouse embryos.\\u000a \\u000a \\u000a \\u000a Methods  \\u000a Mouse embryos were randomly divided and cultured in human tubal fluid (HTF) medium with\\/without Vero cell monolayers, conditioned\\u000a medium (CM) obtained from Vero cell cultures, and HTF medium supplemented with peptides extracted from CM. The concentrated

  14. Protective effect of zinc chloride against cobalt chloride-induced cytotoxicity on vero cells: preliminary results.

    PubMed

    Gürbay, Aylin

    2012-07-01

    The aim of this study was to investigate the possible time- and dose-dependent cytotoxic effects of cobalt chloride on Vero cells. The cultured cells were incubated with different concentrations of cobalt chloride ranging from 0.5 to 1,000 ?M, and cytotoxicity was determined by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) and resazurin assays. Possible protective effects of vitamin E, coenzyme Q(10), and zinc chloride were also tested in this system. A gradual decrease in cell proliferation was observed at concentrations ~? 200 ?M in incubation periods of 24, 48, 72, and 96 h with MTT assay. Exposure of cells to 500 and 1,000 ?M cobalt chloride caused significant decrease in cell survival. A biphasic survival profile of cells was observed at 1-25 ?M concentration range following 96 h of incubation. With resazurin assay, cytotoxicity profile of CoCl(2) was found comparable to the results of MTT assay, particularly at high concentrations and long incubation periods. Dose-dependent cytotoxicity was noted following exposure of cells to ? 250 ?M of CoCl(2) for 24 h and ? 100 ?M concentrations of CoCl(2) for 48-96 h. Pretreatment of cells with ZnCl(2) for 4 or 24 h provided significant protection against cobalt chloride-induced cytotoxicity when measured with MTT assay. However, vitamin E or coenzyme Q(10) was not protective. CoCl(2) had dose- and time-dependent cytotoxic effects in Vero cells. Preventive effect of ZnCl(2) against CoCl(2)-induced cytotoxicity should be considered in detail to define exact mechanism of toxicity in Vero cells. PMID:22281816

  15. [A study of the antiherpetic activity of the chaga mushroom (Inonotus obliquus) extracts in the Vero cells infected with the herpes simplex virus].

    PubMed

    Polkovnikova, M V; Nosik, N N; Garaev, T M; Kondrashina, N G; Finogenova, M P; Shibnev, V A

    2014-01-01

    The chaga mushroom (Inonotus obliquus) contains a wide range of excellent bioactive compounds. However, limited information exists on the antiviral activity of the compounds extracted from chaga. A number of subfractions of chaga were obtained using different solvents and different procedures. The subfractions of chaga extracted with water, alcohol, alkali were tested for their toxicity for the Vero cell culture and antiviral effect in the Vero cells infected with the Herpes simplex virus (HSV), Type 1. It was shown that most of the subfractions were not toxic for the Vero cells and had protective effect on the Vero cells infected with HSV. The subfraction IV in the concentration 5 microg/ml protected the Vero cells from cytodestructive action of HSV and no viral DNA was detected in infected cells treated with chaga extracts. Best protective effect was observed when compound was added before or within one hour after the Vero cells were infected with HSV. PMID:25069286

  16. Tula hantavirus triggers pro-apoptotic signals of ER stress in Vero E6 cells.

    PubMed

    Li, Xiao-Dong; Lankinen, Hilkka; Putkuri, Niina; Vapalahti, Olli; Vaheri, Antti

    2005-03-01

    Tula virus is a member of the Hantavirus genus of the family Bunyaviridae. Viruses of this family have an unusual pattern of intracellular maturation at the ER-Golgi compartment. We recently found that Tula virus, similar to several other hantaviruses, is able to induce apoptosis in cultured cells [Li, X.D., Kukkonen, S., Vapalahti, O., Plyusnin, A., Lankinen, H., Vaheri, A., 2004. Tula hantavirus infection of Vero E6 cells induces apoptosis involving caspase 8 activation. J. Gen. Virol. 85, 3261-3268.]. However, the cellular mechanisms remain to be clarified. In this study, we demonstrate that the progressive replication of Tula virus in Vero E6 cells initiates several death programs that are intimately associated with ER stress: (1) early activation of ER-resident caspase-12; (2) phosphorylation of Jun NH2-terminal kinase (JNK) and its downstream target transcriptional factor, c-jun; (3) induction of the pro-apoptotic transcriptional factor, growth arrest- and DNA damage-inducible gene 153, or C/EBP homologous protein (Gadd153/chop); and (4) changes in the ER-membrane protein BAP31 implying cross-talk with the mitochondrial apoptosis pathway. Furthermore, we confirmed that a sustained ER stress was induced marked by an increased expression of an ER chaperone Grp78/BiP. Taken together, we have identified involvement of ER stress-mediated death program in Tula virus-infected Vero E6 cells which provides a new approach to understand the mechanisms in hantavirus-induced apoptosis. PMID:15708603

  17. Removing residual DNA from Vero-cell culture-derived human rabies vaccine by using nuclease.

    PubMed

    Li, Si-Ming; Bai, Fu-Liang; Xu, Wen-Juan; Yang, Yong-Bi; An, Ying; Li, Tian-He; Yu, Yin-Hang; Li, De-Shan; Wang, Wen-Fei

    2014-09-01

    The clearance of host cell DNA is a critical indicator for Vero-cell culture-derived rabies vaccine. In this study, we evaluated the clearance of DNA in Vero-cell culture-derived rabies vaccine by purification process utilizing ultrafiltration, nuclease digestion, and gel filtration chromatography. The results showed that the bioprocess of using nuclease decreased residual DNA. Dot-blot hybridization analysis showed that the residual host cell DNA was <100 pg/ml in the final product. The residual nuclease in rabies vaccine was less than 0.1 ng/ml protein. The residual nuclease could not paly the biologically active role of digestion of DNA. Experiments of stability showed that the freeze-drying rabies virus vaccine was stable and titers were >5.0 IU/ml. Immunogenicity test and protection experiments indicated mice were greatly induced generation of neutralizing antibodies and invoked protective effects immunized with intraperitoneal injections of the rabies vaccine. These results demonstrated that the residual DNA was removed from virus particles and nuclease was removed by gel filtration chromatography. The date indicated that technology was an efficient method to produce rabies vaccine for human use by using nuclease. PMID:25108516

  18. Real-time Imaging of Rabies Virus Entry into Living Vero cells

    PubMed Central

    Xu, Haijiao; Hao, Xian; Wang, Shaowen; Wang, Zhiyong; Cai, Mingjun; Jiang, Junguang; Qin, Qiwei; Zhang, Maolin; Wang, Hongda

    2015-01-01

    Understanding the mechanism of rabies virus (RABV) infection is vital for prevention and therapy of virulent rabies. However, the infection mechanism remains largely uncharacterized due to the limited methods and viral models. Herein, we utilized a powerful single-virus tracking technique to dynamically and globally visualize the infection process of the live attenuated rabies vaccine strain-SRV9 in living Vero cells. Firstly, it was found that the actin-enriched filopodia is in favor of virus reaching to the cell body. Furthermore, by carrying out drug perturbation experiments, we confirmed that RABV internalization into Vero cells proceeds via classical dynamin-dependent clathrin-mediated endocytosis with requirement for intact actin, but caveolae-dependent endocytosis is not involved. Then, our real-time imaging results unambiguously uncover the characteristics of viral internalization and cellular transport dynamics. In addition, our results directly and quantitatively reveal that the intracellular motility of internalized RABV particles is largely microtubule-dependent. Collectively, our work is crucial for understanding the initial steps of RABV infection, and elucidating the mechanisms of post-infection. Significantly, the results provide profound insight into development of novel and effective antiviral targets. PMID:26148807

  19. Infection of Vero Cells by BK Virus Is Dependent on Caveolae

    PubMed Central

    Eash, Sylvia; Querbes, William; Atwood, Walter J.

    2004-01-01

    Polyomavirus-associated nephropathy occurs in ?5% of renal transplant recipients and results in loss of graft function in 50 to 70% of these patients. The disease is caused by reactivation of the common human polyomavirus BK (BKV) in the transplanted kidney. The early events in productive BKV infection are unknown. In this report, we focus on elucidating the mechanisms of BKV internalization in its target cell. Our data reveal that BKV entry into permissive Vero cells is slow, is independent of clathrin-coated-pit assembly, is dependent on an intact caveolin-1 scaffolding domain, is sensitive to tyrosine kinase inhibition, and requires cholesterol. BKV colocalizes with the caveola-mediated endocytic marker cholera toxin subunit B but not with the clathrin-dependent endocytic marker transferrin. In addition, BKV infectious entry is sensitive to elevation in intracellular pH. These findings indicate that BKV entry into Vero cells occurs by caveola-mediated endocytosis involving a pH-dependent step. PMID:15479799

  20. Identification of diphtheria toxin receptor and a nonproteinous diphtheria toxin-binding molecule in Vero cell membrane

    Microsoft Academic Search

    Eisuke Mekada; Yoshio Okada; Tsuyoshi Uchida

    1988-01-01

    Two substances possessing the ability to bind to diphtheria toxin (DT) were found to be present in a membrane fraction from DT-sensitive Vero cells. One of these substances was found on the basis of its ability to bind DT and inhibit its cytotoxic effect. This inhibitory substance competitively inhibited the bind- ing of DT to Veto cells. However this inhibitor

  1. Cytotoxicity of methanol extracts of Elaeis guineensis on MCF-7 and Vero cell lines

    PubMed Central

    Vijayarathna, Soundararajan; Sasidharan, Sreenivasan

    2012-01-01

    Objective To investigate the cytotoxic effect of Elaeis guineensis methanol extract on MCF-7 and Vero cell. Methods In vitro cytotoxicity was evaluated in by MTT assay. Cell morphological changes were observed by using light microscope. Results The MTT assay indicated that methanol extract of the plant exhibited significant cytotoxic effects on MCF-7. Morphological alteration of the cell lines after exposure with Elaeis guineensis extract were observed under phase contrast microscope in the dose dependent manner. Conclusions The results suggest the probable use of the Elaeis guineensis methanol extract in preparing recipes for cancer-related ailments. Further studies on isolation of metabolites and their in vivo cytotoxicity are under investigation. PMID:23569855

  2. Immunogenicity of single-dose Vero cell-derived Japanese encephalitis vaccine in Japanese adults.

    PubMed

    Takeshita, Nozomi; Lim, Chang-Kweng; Mizuno, Yasutaka; Shimbo, Takuro; Kotaki, Akira; Ujiie, Mugen; Hayakawa, Kayoko; Kato, Yasuyuki; Kanagawa, Shuzo; Kaku, Mitsuo; Takasaki, Tomohiko

    2014-04-01

    In Japan, intensive immunization against Japanese encephalitis (JE) was performed from 1967 to 1976, and regular JE immunization was performed thereafter. However, for Japanese adults facing JE risk, dates of vaccination with new inactivated Vero cell-derived JE vaccine are unavailable. This study investigated how a single dose of Vero cell-derived JE vaccine affects Japanese adults. Neutralizing antibodies were measured pre- and post-JE vaccination in 79 participants (age 40.7 ± 9.4 years), enrolled between October 2009 and March 2011, whose JE-vaccination data were gathered from vaccination records and history taking. Before vaccination, the participants' seroprotection rate (SPR) was 51.9%, whereas SPR after vaccination was 93.7%. The seroconversion rate (SCR), which measures seronegative cases that turn seropositive after vaccination, was 86.8%. The geometric mean titer (GMT) was 14.7 before vaccination and 70.1 after vaccination. Age was a significant difference between seroprotected (42.8 years) and non-seroprotected (38.7 years) groups before vaccination. Then the difference of age, SCR, pre-vaccination GMT, post-vaccination GMT and sex ratio were also significant in participants aged 25-39 years and ?40 years, who represent generations born when Japan's JE-vaccination policy changed. SCR was 100% in participants aged 25-39 years with a vaccination recorded 55.6% in participants aged 25-39 without a vaccination record, and 96.0% in participants aged ?40 years. Thus, more participants aged 25-39 years were seroprotected before vaccination, but SCR was higher in those aged ?40 years. Most Japanese adults can be protected after one-dose vaccination, but this may be insufficient for people aged 25-39 years without recorded JE vaccination. PMID:24485326

  3. Inhibition of puumala and tula hantaviruses in Vero cells by MxA protein.

    PubMed

    Kanerva, M; Melén, K; Vaheri, A; Julkunen, I

    1996-10-01

    Human MxA protein is a type I Interferon-inducible intracytoplasmic protein, which mediates antiviral actions against a variety of negative-strand RNA viruses including influenza A, measles, and vesicular stomatitis viruses. Recently, it has also been shown that several members of the Bunyaviridae family are inhibited by MxA protein. The hantavirus genus in the Bunyaviridae family includes important human pathogenic viruses, e.g., Puumala (PUUV), Hantaan, and Sin Nombre viruses. Tula virus (TULV) is a new member of the genus, but its pathogenicity in man remains to be determined. As assumed by the similarities in replication strategy. MxA would be a good candidate molecule for antiviral action against these viruses, also. To gain more insight into the MxA action on PUUV, we studied PUUV and TULV replication in stably MxA genetransfected Vero cells. We show that MxA protein has the capacity to inhibit both viral protein and RNA accumulation in virus-infected cells. We also studied PUUV and TULV infection in MxA-transfected U-937 cell clones. In these cell lines both hantaviruses grew poorly, independent of whether the cells were expressing MxA or not Whether cell line-specific differences in the antiviral activity of MxA protein against hantaviruses exist cannot be conclusively determined due to the lack of productive infection of PUUV and TULV in U-937 cells. PMID:8862399

  4. VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt.

    PubMed

    Lafon-Hughes, Laura; Vilchez Larrea, Salomé C; Kun, Alejandra; Fernández Villamil, Silvia H

    2014-01-01

    Poly-ADP-ribose (PAR) is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs) and degraded by poly-ADP-ribose-glycohydrolase (PARG). Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair). Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt). In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO). PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications. PMID:25332845

  5. VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt

    PubMed Central

    Vilchez Larrea, Salomé C.; Kun, Alejandra

    2014-01-01

    Poly-ADP-ribose (PAR) is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs) and degraded by poly-ADP-ribose-glycohydrolase (PARG). Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair). Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt). In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO). PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications. PMID:25332845

  6. Chemical mutagenesis of dengue virus type 4 yields mutant viruses which are temperature sensitive in vero cells or human liver cells and attenuated in mice.

    PubMed

    Blaney, J E; Johnson, D H; Firestone, C Y; Hanson, C T; Murphy, B R; Whitehead, S S

    2001-10-01

    A recombinant live attenuated dengue virus type 4 (DEN4) vaccine candidate, 2ADelta30, was found previously to be generally well tolerated in humans, but a rash and an elevation of liver enzymes in the serum occurred in some vaccinees. 2ADelta30, a non-temperature-sensitive (non-ts) virus, contains a 30-nucleotide deletion (Delta30) in the 3' untranslated region (UTR) of the viral genome. In the present study, chemical mutagenesis of DEN4 was utilized to generate attenuating mutations which may be useful in further attenuation of the 2ADelta30 candidate vaccine. Wild-type DEN4 2A virus was grown in Vero cells in the presence of 5-fluorouracil, and a panel of 1,248 clones were isolated. Twenty ts mutant viruses were identified that were ts in both simian Vero and human liver HuH-7 cells (n = 13) or only in HuH-7 cells (n = 7). Each of the 20 ts mutant viruses possessed an attenuation phenotype, as indicated by restricted replication in the brains of 7-day-old mice. The complete nucleotide sequence of the 20 ts mutant viruses identified nucleotide substitutions in structural and nonstructural genes as well as in the 5' and 3' UTRs, with more than one change occurring, in general, per mutant virus. A ts mutation in the NS3 protein (nucleotide position 4995) was introduced into a recombinant DEN4 virus possessing the Delta30 deletion, thereby creating rDEN4Delta30-4995, a recombinant virus which is ts and more attenuated than rDEN4Delta30 virus in the brains of mice. We are assembling a menu of attenuating mutations that should be useful in generating satisfactorily attenuated recombinant dengue vaccine viruses and in increasing our understanding of the pathogenesis of dengue virus. PMID:11559806

  7. Synthesis of Proteins and Glycoproteins in Dengue Type 2 Virus-infected Vero and Aedes albopictus Cells

    Microsoft Academic Search

    GREG W. SMITH; PETER J. WRIGHT

    1985-01-01

    SUMMARY Fifteen proteins were detected in Vero cells infected by dengue type 2 (DEN-2) virus that were not observed in mock-infected cells, namely P98, p82, P67, GP60, gp54, GP46, p30, p28, gp22, GP20, pl8, gpl6, pl5, pl4 and gpl3. With the exceptions of gp54 and gp 13, polypeptides corresponding to those listed above were also observed in DEN-2 virus-infected Aedes

  8. [Evaluation of the infectivity of dengue 1 strains in the HepG2 and Vero cell lines].

    PubMed

    Aguilar Barroso, Alicia; Amin Blanco, Nevis; Morier Díaz, Luis; Pérez Hernández, Ela María

    2005-01-01

    Viral infectivity of Hawaii, 3 Peri and Riberao Pretto dengue 1 strains was evaluated in Vero and HepG2 cell lines by indirect immunofluorescence techniques. Dengue virus cellular tropism in vitro is diverse. They may replicate themselves in a great variety of cellular cultures, whose sensibility to viral infection is variable. The greatest percentage of infected cells in the HepG2 cell line was obtained with the highest multiplicities of infection (0.04 for Hawaii and Riberao Pretto strains and 0.01 for 3 Perú). The highest percentage of infected HepG2 and Vero cells for the studied strains and the greatest titer in the viral overnadant was obtained on the 5th day. Vero cell line was more sensitive to viral infection, since for the same multiplicity values it was detected a higher number of fluorescent cells and a better viral titre in the line of this overnadant than in the HepG2. The best result was obtained with the Hawaii strain that allowed to confirm faster the infection of the studied cellular lines. PMID:17966579

  9. Identification of diphtheria toxin receptor and a nonproteinous diphtheria toxin-binding molecule in Vero cell membrane

    PubMed Central

    1988-01-01

    Two substances possessing the ability to bind to diphtheria toxin (DT) were found to be present in a membrane fraction from DT-sensitive Vero cells. One of these substances was found on the basis of its ability to bind DT and inhibit its cytotoxic effect. This inhibitory substance competitively inhibited the binding of DT to Vero cells. However this inhibitor could not bind to CRM197, the product of a missense mutation in the DT gene, and did not inhibit the binding of CRM197 to Vero cells. Moreover, similar levels of the inhibitory activity were observed in membrane fractions from DT-insensitive mouse cells, suggesting the inhibitor is not the DT receptor which is specifically present in DT-sensitive cells. The second DT-binding substance was found in the same Vero cell membrane preparation by assaying the binding of 125I-labeled CRM197. Such DT-binding activity could not be observed in membrane preparation from mouse L cells. From competition studies using labeled DT and CRM proteins, we conclude that this binding activity is due to the surface receptor for DT. Treatment of these substances with several enzymes revealed that the inhibitor was sensitive to certain RNases but resistant to proteases, whereas the DT receptor was resistant to RNase but sensitive to proteases. The receptor was solubilized and partially purified by chromatography on CM- Sepharose column. Immunoprecipitation and Western blotting analysis of the partially purified receptor revealed that a 14.5-kD protein is the DT receptor, or at least a component of it. PMID:3417759

  10. A single NS2 mutation of K86R promotes PR8 vaccine donor virus growth in Vero cells.

    PubMed

    Zhang, Hong; Han, Qinglin; Ping, Xianqiang; Li, Li; Chang, Chong; Chen, Ze; Shu, Yuelong; Xu, Ke; Sun, Bing

    2015-08-01

    Vaccination is the most effective way to prevent and control infection by influenza viruses, and a cell-culture-based vaccine production system is preferred as the future choice for the large-scale production of influenza vaccines. As one of the WHO-recommended cell lines for producing influenza vaccines, Vero cells do not efficiently support the growth of the current influenza A virus vaccine donor strain, the A/Puerto Rico/8/1934 (PR8) virus. In this study, a single mutation of K86R in the NS2 protein can sufficiently render the high-yielding property to the PR8 virus in Vero cells. Further analysis showed that the later steps in the virus replication cycle were accelerated by NS2K86R mutation, which may relate to an enhanced interaction between NS2K86R and the components of host factor F1Fo-ATPase, FoB and F1?. Because the NS2K86R mutation does not increase PR8 virulence in either mice or embryonated eggs, the PR8-NS2K86R virus could serve as a promising vaccine donor strain in Vero cells. PMID:25817403

  11. Proteome analysis of porcine epidemic diarrhea virus (PEDV)-infected Vero cells.

    PubMed

    Zeng, Songlin; Zhang, Huan; Ding, Zhen; Luo, Rui; An, Kang; Liu, Lianzeng; Bi, Jing; Chen, Huanchun; Xiao, Shaobo; Fang, Liurong

    2015-06-01

    Porcine epidemic diarrhea virus (PEDV) causes an acute, highly contagious, and devastating viral enteric disease with a high mortality rate in suckling pigs. A large-scale outbreak of PED occurred in China in 2010, with PEDV emerging in the United States in 2013 and spreading rapidly, posing significant economic and public health concerns. In this study, LC-MS/MS coupled to iTRAQ labeling was used to quantitatively identify differentially expressed cellular proteins in PEDV-infected Vero cells. We identified 49 differentially expressed cellular proteins, of which 8 were upregulated and 41 downregulated. These differentially expressed proteins were involved in apoptosis, signal transduction, and stress responses. Based on these differentially expressed proteins, we propose that PEDV might utilize apoptosis and extracellular signal regulated kinases pathways for maximum viral replication. Our study is the first attempt to analyze the protein profile of PEDV-infected cells by quantitative proteomics, and we believe our findings provide valuable information with respect to better understanding the host response to PEDV infection. PMID:25604190

  12. Preparation of Japanese encephalitis virus nonstructural protein NS1 obtained from culture fluid of JEV-infected Vero cells

    Microsoft Academic Search

    T. Lee; K. Watanabe; C. Aizawa; A. Nomoto; H. Hashimoto

    1991-01-01

    Summary The Japanese encephalitis virus (JEV) nonstructural protein NS1 was released efficiently into culture fluid of JEV-infected Vero cells. The JEV NS1 protein in the infected culture fluid was found almost as a high-molecular-weight form, probably a dimer form of NS1, and was converted to a monomer by boiling. Large amounts of NS1 protein were accumulated in the infected culture

  13. A Sabin 1 poliovirus-based vaccine vector transfects Vero cells with high efficiency

    PubMed Central

    Li, Changgui

    2007-01-01

    Over the past 40 years, live oral poliovirus (PV) vaccines have contributed to the eradication of wild PV in most countries. These live vaccine strains have a high safety record and can stimulate both cellular and humoral immune responses. As both of these factors are critical characteristics of a good vaccine, we aimed to modify the oral PV vaccines to create a powerful vaccine vector for extraneous antigen expression. In this study, we amplified three separate fragments from the Sabin 1 virus genome by RT-PCR and cloned them into the pGEM-TEasy vector. A cassette containing engineered protease cleavage sites and a polylinker was introduced into one of these fragments (f1) in front of the translation start site. This construction facilitated the insertion of foreign genes into the vector and the subsequent release of their co-translated antigens after digestion by endogenous protease. We also placed a ribozyme (Rz) sequence between the T7 promoter and viral genomic DNA so that in vitro transcription and Rz cleavage recreated the authentic 5? end of the PV genome RNA. Poly(A)40 tails were added to the 3? end of the genome to stabilize the transcribed RNA. The three PV genome fragments and their derivatives were cloned into various types of vectors that were transfected into Vero cells. Virus rescue experiments demonstrated that both the Rz and poly(A)40 elements were required for high transfection efficiency of the vector-derived RNAs. PMID:19003009

  14. Diquat-induced cytotoxicity on Vero and HeLa cell lines: effect of melatonin and dihydromelatonin

    PubMed Central

    Okuliarová, Monika; Ková?ová, Elena; Zeman, Michal

    2014-01-01

    Diquat dibromide is a moderately toxic contact herbicide belonging to the bipyridyl group of redox-active compounds that induce a strong oxidative damage. Melatonin (MEL) can protect against oxidative damage under in vivo conditions, probably through its anti-oxidative capacity and ability to induce expression of anti-oxidative enzymes. The objective of this study was to investigate effects of diquat on viability of Vero and HeLa cells and possible protective effects of MEL and its analogue 2,3-dihydromelatonin (DMEL). Cell viability was evaluated with the MTT test. First, we analyzed dose-dependent effects of diquat on cell viability using the concentration range of 0.1–100 ?M. Second, we used the diquat dose which reduced cell viability by 50% and treated cells with either MEL or DMEL (both in the concentration range of 1–100 ?M) in the presence or absence of diquat. In addition, effects of both diquat and MEL on oxidative stress in HeLa cells were measured by flow cytometry using 2’,7’-dichlorofluorescin diacetate. We confirmed the expected negative effects of diquat on viability of Vero and HeLa cells. Melatonin and DMEL were able to prevent diquat reduced viability of Vero cells in rather low concentrations (1 ?M) and DMEL exerted substantially stronger protective effects than MEL. However in HeLa cells, we did not find the same effects and MEL even reduced their viability. Moreover, treatment of HeLa cells with high concentrations of MEL (100 ?M) exaggerated the pro-oxidative effects of diquat. The results suggest that in addition to the expected anti-oxidative effects, MEL exerts a pro-oxidative action which is cell type and dose dependent. PMID:26109898

  15. Comparison of use of Vero cell line and suspension culture of murine macrophage to attenuation of virulence of Neospora caninum.

    PubMed

    Khordadmehr, Monireh; Namavari, Mehdi; Khodakaram-Tafti, Azizollah; Mansourian, Maryam; Rahimian, Abdollah; Daneshbod, Yahya

    2013-10-01

    In this study the tachyzoite yields of Neospora caninum were compared in two cell lines: Vero (African Green Monkey Kidney) and suspension culture of murine macrophage (J774) cell lines. Then, N. caninum were continuously passaged in these cell lines for 3 months and the effect of host cells on virulence of tachyzoites was assessed by broiler chicken embryonated eggs. Inoculation was performed in the chorioallantoic (CA) liquid of the embryonated eggs with different dilutions (0.5 × 10(4), 1.0 × 10(4), 1.5 × 10(4)) of tachtzoites isolated from these cell cultures. The mortality pattern and pathological changes of the dead embryos and hatched chickens were noted. Tissue samples of brain, liver and heart were examined by histopathological and detection of DNA of parasite by polymerase chain reaction (PCR). Also, consecutive sections of the tissues examined histologically were used for immunohistochemical (IHC) examination. Embryos inoculated with tachyzoites derived from Vero cell line (group V) showed a higher mortality rate (100%) than the embryos that received tachyzoites derived from J774 cell line (group J) (10% mortality rate). The results of this study indicated that the culture of N. caninum in J774 cell led to a marked increase in the number of tachyzoite yields and rapid attenuation in comparison to Vero, so the results were confirmed by IHC and PCR. This study is the first report of the significant effect of host cell on the attenuation of virulence of N. caninum tachyzoites. These findings could potentially provide a practical approach in the mass production of N. caninum tachyzoites, and also in producing live attenuated vaccine. PMID:23684321

  16. Vero microcultures for adenovirus neutralization tests.

    PubMed Central

    Hierholzer, J C; Bingham, P G

    1978-01-01

    A microculture neutralization test is described for measuring specific antibody levels to the 35 human adenovirus serotypes in Vero cells. The test is read at 5 days by macroscopic observation after staining the uninfected cells with crystal violet. The test is performed with a minimum of manipulations and gives serum titers comparable with those obtained in tube macrocultures of monkey kidney, human embryonic kidney, and Vero cells. The Vero microculture neutralization test measures inhibition of adenovirus toxicity, although selected human adenoviruses serially subpassaged in Vero cells were shown to successfully adapt and replicate in the absence of detectable helper viruses. Images PMID:670375

  17. Preclinical evaluation of Vaxfectin-adjuvanted Vero cell-derived seasonal split and pandemic whole virus influenza vaccines.

    PubMed

    Smith, Larry R; Wodal, Walter; Crowe, Brian A; Kerschbaum, Astrid; Bruehl, Peter; Schwendinger, Michael G; Savidis-Dacho, Helga; Sullivan, Sean M; Shlapobersky, Mark; Hartikka, Jukka; Rolland, Alain; Barrett, P Noel; Kistner, Otfried

    2013-06-01

    Increasing the potency and supply of seasonal and pandemic influenza vaccines remains an important unmet medical need which may be effectively accomplished with adjuvanted egg- or cell culture-derived vaccines. Vaxfectin, a cationic lipid-based adjuvant with a favorable safety profile in phase 1 plasmid DNA vaccines trials, was tested in combination with seasonal split, trivalent and pandemic whole virus, monovalent influenza vaccines produced in Vero cell cultures. Comparison of hemagglutination inhibition (HI) antibody titers in Vaxfectin-adjuvanted to nonadjuvanted vaccinated mice and guinea pigs revealed 3- to 20-fold increases in antibody titers against each of the trivalent influenza virus vaccine strains and 2- to 8-fold increases in antibody titers against the monovalent H5N1 influenza virus vaccine strain. With the vaccine doses tested, comparable antibody responses were induced with formulations that were freshly prepared or refrigerated at conventional 2-8°C storage conditions for up to 6 mo. Comparison of T-cell frequencies measured by interferon-gamma ELISPOT assay between groups revealed increases of between 2- to 10-fold for each of the adjuvanted trivalent strains and up to 22-fold higher with monovalent H5N1 strain. Both trivalent and monovalent vaccines were easy to formulate with Vaxfectin by simple mixing. These preclinical data support further testing of Vaxfectin-adjuvanted Vero cell culture vaccines toward clinical studies designed to assess safety and immunogenicity of these vaccines in humans. PMID:23857272

  18. Preclinical evaluation of Vaxfectin®-adjuvanted Vero cell-derived seasonal split and pandemic whole virus influenza vaccines

    PubMed Central

    Smith, Larry R.; Wodal, Walter; Crowe, Brian A.; Kerschbaum, Astrid; Bruehl, Peter; Schwendinger, Michael G.; Savidis-Dacho, Helga; Sullivan, Sean M.; Shlapobersky, Mark; Hartikka, Jukka; Rolland, Alain; Barrett, P. Noel; Kistner, Otfried

    2013-01-01

    Increasing the potency and supply of seasonal and pandemic influenza vaccines remains an important unmet medical need which may be effectively accomplished with adjuvanted egg- or cell culture-derived vaccines. Vaxfectin®, a cationic lipid-based adjuvant with a favorable safety profile in phase 1 plasmid DNA vaccines trials, was tested in combination with seasonal split, trivalent and pandemic whole virus, monovalent influenza vaccines produced in Vero cell cultures. Comparison of hemagglutination inhibition (HI) antibody titers in Vaxfectin®-adjuvanted to nonadjuvanted vaccinated mice and guinea pigs revealed 3- to 20-fold increases in antibody titers against each of the trivalent influenza virus vaccine strains and 2- to 8-fold increases in antibody titers against the monovalent H5N1 influenza virus vaccine strain. With the vaccine doses tested, comparable antibody responses were induced with formulations that were freshly prepared or refrigerated at conventional 2–8°C storage conditions for up to 6 mo. Comparison of T-cell frequencies measured by interferon-gamma ELISPOT assay between groups revealed increases of between 2- to 10-fold for each of the adjuvanted trivalent strains and up to 22-fold higher with monovalent H5N1 strain. Both trivalent and monovalent vaccines were easy to formulate with Vaxfectin® by simple mixing. These preclinical data support further testing of Vaxfectin®-adjuvanted Vero cell culture vaccines toward clinical studies designed to assess safety and immunogenicity of these vaccines in humans. PMID:23857272

  19. Chemical Synthesis, Characterisation, and Biocompatibility of Nanometre Scale Porous Anodic Aluminium Oxide Membranes for Use as a Cell Culture Substrate for the Vero Cell Line: A Preliminary Study

    PubMed Central

    Poinern, Gérrard Eddy Jai; Le, Xuan Thi; Becker, Thomas; Fawcett, Derek

    2014-01-01

    In this preliminary study we investigate for the first time the biomedical potential of using porous anodic aluminium oxide (AAO) membranes as a cell substrate for culturing the Cercopithecus aethiops (African green monkey) Kidney (Vero) epithelial cell line. One advantage of using the inorganic AAO membrane is the presence of nanometre scale pore channels that allow the exchange of molecules and nutrients across the membrane. The size of the pore channels can be preselected by adjusting the controlling parameters of a temperature controlled two-step anodization process. The cellular interaction and response of the Vero cell line with an in-house synthesised AAO membrane, a commercially available membrane, and a glass control were assessed by investigating cell adhesion, morphology, and proliferation over a 72?h period. The number of viable cells proliferating over the respective membrane surfaces revealed that the locally produced in-house AAO membrane had cells numbers similar to the glass control. The study revealed evidence of focal adhesion sites over the surface of the nanoporous membranes and the penetration of cellular extensions into the pore structure as well. The outcome of the study has revealed that nanometre scale porous AAO membranes have the potential to become practical cell culture scaffold substrates with the capability to enhance adhesion and proliferation of Vero cells. PMID:24579077

  20. Chemical synthesis, characterisation, and biocompatibility of nanometre scale porous anodic aluminium oxide membranes for use as a cell culture substrate for the vero cell line: a preliminary study.

    PubMed

    Poinern, Gérrard Eddy Jai; Le, Xuan Thi; O'Dea, Mark; Becker, Thomas; Fawcett, Derek

    2014-01-01

    In this preliminary study we investigate for the first time the biomedical potential of using porous anodic aluminium oxide (AAO) membranes as a cell substrate for culturing the Cercopithecus aethiops (African green monkey) Kidney (Vero) epithelial cell line. One advantage of using the inorganic AAO membrane is the presence of nanometre scale pore channels that allow the exchange of molecules and nutrients across the membrane. The size of the pore channels can be preselected by adjusting the controlling parameters of a temperature controlled two-step anodization process. The cellular interaction and response of the Vero cell line with an in-house synthesised AAO membrane, a commercially available membrane, and a glass control were assessed by investigating cell adhesion, morphology, and proliferation over a 72?h period. The number of viable cells proliferating over the respective membrane surfaces revealed that the locally produced in-house AAO membrane had cells numbers similar to the glass control. The study revealed evidence of focal adhesion sites over the surface of the nanoporous membranes and the penetration of cellular extensions into the pore structure as well. The outcome of the study has revealed that nanometre scale porous AAO membranes have the potential to become practical cell culture scaffold substrates with the capability to enhance adhesion and proliferation of Vero cells. PMID:24579077

  1. Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

    PubMed Central

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel

    2013-01-01

    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  2. High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

    SciTech Connect

    Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People's Republic of China (China)] [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People's Republic of China (China); Wang, Yue, E-mail: euy-tokyo@umin.ac.jp [National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, Yingxin Lane 100, Xicheng District, Beijing 100052, People's Republic of China (China)] [National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, Yingxin Lane 100, Xicheng District, Beijing 100052, People's Republic of China (China); Liao, Guoyang, E-mail: liaogy@21cn.com [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People's Republic of China (China)] [No. 5, Department of Bioproducts, Institute of Medical Biology, Chinese Academy of Medical Science and Pecking Union Medical College, Jiaoling Avenue 935, Kunming, Yunnan Province 650102, People's Republic of China (China)

    2012-05-18

    Highlights: Black-Right-Pointing-Pointer Vero cell-based HPAI H5N1 vaccine with stable high yield. Black-Right-Pointing-Pointer Stable high yield derived from the YNVa H3N2 backbone. Black-Right-Pointing-Pointer H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

  3. Autophagic Cell Death Is Induced by Acetone and Ethyl Acetate Extracts from Eupatorium odoratum In Vitro: Effects on MCF-7 and Vero Cell Lines

    PubMed Central

    Harun, Faizah Bt.; Syed Sahil Jamalullail, Syed Mohsin; Yin, Khoo Boon; Othman, Zulkhairi; Tilwari, Anita; Balaram, Prabha

    2012-01-01

    Eupatorium odoratum (EO) contains many biologically active compounds, the anticancer effects of which are not well documented. This study evaluates the cytotoxic effects and mechanism of action of EO extracts on MCF-7 and Vero cell lines. Evaluation of the cytotoxic activity using MTT assay, morphological alterations, and apoptosis were carried out. Autophagy was evaluated by LC3-A protein expression. Cytotoxic activity, membrane blebbing and ballooning at 24 hours, replacement by mass vacuolation, and double membrane vesicles mimicking autophagy and cell death were observed in the cancer cells. No apoptosis was observed by DNA fragmentation assay. Overexpression of LC3-A protein indicated autophagic cell death. Cell cycle analysis showed G0 and G2/M arrest. The Vero cells did not show significant cell death at concentrations <100??g/mL. These results thus suggest that acetone and ethyl acetate extracts of EO induce cell death through induction of autophagy and hold potential for development as potential anticancer drugs. PMID:22666123

  4. Autophagic cell death is induced by acetone and ethyl acetate extracts from Eupatorium odoratum in vitro: effects on MCF-7 and vero cell lines.

    PubMed

    Harun, Faizah Bt; Syed Sahil Jamalullail, Syed Mohsin; Yin, Khoo Boon; Othman, Zulkhairi; Tilwari, Anita; Balaram, Prabha

    2012-01-01

    Eupatorium odoratum (EO) contains many biologically active compounds, the anticancer effects of which are not well documented. This study evaluates the cytotoxic effects and mechanism of action of EO extracts on MCF-7 and Vero cell lines. Evaluation of the cytotoxic activity using MTT assay, morphological alterations, and apoptosis were carried out. Autophagy was evaluated by LC3-A protein expression. Cytotoxic activity, membrane blebbing and ballooning at 24 hours, replacement by mass vacuolation, and double membrane vesicles mimicking autophagy and cell death were observed in the cancer cells. No apoptosis was observed by DNA fragmentation assay. Overexpression of LC3-A protein indicated autophagic cell death. Cell cycle analysis showed G0 and G2/M arrest. The Vero cells did not show significant cell death at concentrations <100??g/mL. These results thus suggest that acetone and ethyl acetate extracts of EO induce cell death through induction of autophagy and hold potential for development as potential anticancer drugs. PMID:22666123

  5. Photodynamic efficiency of hypericin compared with chlorin and hematoporphyrin derivatives in HEp-2 and Vero epithelial cell lines.

    PubMed

    Bernal, Claudia; Ribeiro, Anderson O; Andrade, Gislaine P; Perussi, Janice R

    2015-06-01

    Hypericin (HY) is a photoactive aromatic dianthraquinone that is considered a potent photodynamic agent. In this study, hypericin and two other photosensitizers, a hematoporphyrin derivative (Photogem(®); PG) and a chlorin derivative (Photodithazine(®); PZ), were compared in terms of their phototoxicity toward two cell lines, HEp-2 and Vero. The median inhibitory concentration (IC50) of each of the photosensitizers was obtained after a 16.2Jcm(-2) dose of irradiation at 630±10nm. The IC50 values were 0.07±0.01 (HY), 1.0±0.2 (PZ), and 9±1?gmL(-1) (PG) in HEp-2 cells and 0.3±0.1 (HY), 1.6±0.2 (PZ) and 11±1?gmL(-1) (PG) in Vero cells, showing that HY is more phototoxic than the others when irradiated at 630nm. If these results are analyzed, simultaneously, with the first-order constant for BSA tryptophan photooxidation, obtained by fluorescence decay (?excitation=280nm), which are 11×10(-3)min(-1)±1. 10(-3)min(-1) (HY), 10×10(-3)min(-1)±1×10(-3)min(-1) (PZ), and 6×10(-3)min(-1)±1×10(-3)min(-1) (PG), it is possible to infer that the photodynamic efficiency alone is not sufficient to explain the higher HY phototoxicity. The lipophilicity is also an important factor for an efficient target cell accumulation and was assessed for all sensitizers through the octanol-water partition coefficient (log P): 1.20±0.02 (HY), -0.62±0.03 (PZ), and -0.9±0.2 (PG). The higher value for HY correlates well with its observed superior efficiency to promote damage at low concentrations and doses. As HY is used for the long-term treatment of mild depression, it is considered safe for humans. This fact and the present results reinforce the great potential of this photosensitizer to replace porphyrin derivatives, with the advantages that mean it could be used as photosensitizer in clinical photodynamic therapy. PMID:25910552

  6. A Basic Study on the Biological Monitoring for Vanadium—Effects of Vanadium on Vero Cells and the Evaluation of Intracellular Vanadium Contents

    Microsoft Academic Search

    Mariko Mochizuki; Eiko Kudo; Mitsuho Kikuchi; Takashi Takano; Yojiro Taniuchi; Tomoya Kitamura; Ryo Hondo; Fukiko Ueda

    2011-01-01

    A high concentration of vanadium (V) has toxic effects on human and animals and is one of environmental pollutants. In the\\u000a present study, we have conducted a fundamental study using cultured Vero cells from monkey kidney for the future environmental\\u000a monitoring. Orthovanadate (VAN), one of V compounds, of 10?10 and 10?8 M did not affect the cell growth although the higher

  7. A polysaccharide fraction from medicinal herb Prunella vulgaris downregulates the expression of herpes simplex virus antigen in Vero cells.

    PubMed

    Chiu, Lawrence Chi-Ming; Zhu, Wen; Ooi, Vincent Eng-Choon

    2004-07-01

    Herpes simplex viruses (HSV) are pathogenic. With the emergence of drug-resistant strains of HSV, new antiviral agents, especially those with different modes of action, are urgently needed. Prunella vulgaris L. (Labiatae), a perennial plant commonly found in China and Europe, has long been used as a folk medicine to cure ailments. In this study, a polysaccharide fraction was prepared from Prunella vulgaris (PPV), and its effects on the expressions of HSV-1 and HSV-2 antigens in their host Vero cells were investigated with flow cytometry. The HSV antigen increased time-dependently in the infected cells, and PPV reduced its expression. The effective concentrations of PPV with 50% reductions of the HSV-1 and HSV-2 antigens were 20.6 and 20.1 microg/ml, respectively. The novelty of PPV is that it also reduces the antigen expression of acyclovir-resistant strain of HSV-1. After incubations with 25-100 microg/ml of PPV the HSV antigen-positive cells were reduced by 24.8-92.6%, respectively, showing that this polysaccharide fraction has a different mode of anti-HSV action from acyclovir. Results from this study show that PPV is effective against both the HSV-1 and HSV-2 infections, and flow cytometry offers a quantitative and highly reproducible anti-HSV drug-susceptibility assay. PMID:15182906

  8. A basic study on the biological monitoring for vanadium-effects of vanadium on Vero cells and the evaluation of intracellular vanadium contents.

    PubMed

    Mochizuki, Mariko; Kudo, Eiko; Kikuchi, Mitsuho; Takano, Takashi; Taniuchi, Yojiro; Kitamura, Tomoya; Hondo, Ryo; Ueda, Fukiko

    2011-07-01

    A high concentration of vanadium (V) has toxic effects on human and animals and is one of environmental pollutants. In the present study, we have conducted a fundamental study using cultured Vero cells from monkey kidney for the future environmental monitoring. Orthovanadate (VAN), one of V compounds, of 10(-10) and 10(-8) M did not affect the cell growth although the higher concentration of above 10(-6) M VAN inhibited the cell growth accompanied with the decrease in cell numbers and morphological changes. Given that the washing method with ice-cold Li is also effective for determination of the cellular Na content, we used this method for the determination of the V content of the Vero cells. The V distributions in Vero cell; in the 10(-3) M VAN solution, extracellular and intracellular were obtained as 1:0.564:0.036 and 1:0.662:0.098 at 60 and 120 min after the treatment of VAN. The intracellular V content was 10% of the applied concentration of VAN. Consequently, it was suggested that V concentration of 10(-7) and 10(-6) M in the tissue and environment, respectively, might become the threshold concentration; a criterion of the environmental contamination when we carry out environmental monitoring. PMID:20556539

  9. Comparison of Vero Cell Assay and PCR as Indicators of the Presence of VerocytotoxigenicEscherichia coliin Bovine and Human Fecal Samples

    Microsoft Academic Search

    K. RAHN; J. B. WILSON; K. A. MCFADDEN; S. C. READ; A. G. ELLIS; S. A. RENWICK; R. C. CLARKE; ANDR. P. JOHNSON

    1996-01-01

    Comparisons were made between Vero cell assay (VCA) and PCR as indicators for the detection of verocy- totoxigenicEscherichiacoli(VTEC;alsoknownasShiga-liketoxin-producingE.coli)andaspredictorsofVTEC isolation from bovine and human fecal samples. Fecal samples were collected as part of a survey on the prevalence of VTEC on dairy farms in southern Ontario (J. B. Wilson et al., J. Infect. Dis., 174:1021-1027, 1996). A total of 2,655 samples

  10. Bicarbonate/chloride antiport in Vero cells: II. Mechanisms for bicarbonate-dependent regulation of intracellular pH

    SciTech Connect

    Olsnes, S.; Ludt, J.; Tonnessen, T.I.; Sandvig, K.

    1987-08-01

    The rates of bicarbonate-dependent uptake and efflux of /sup 22/Na/sup +/ in Vero cells were studied and compared with the uptake and efflux of /sup 36/Cl/sup -/. Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na/sup +/ was much less affected by changes in pH. The bicarbonate-linked uptake of /sup 22/Na/sup +/ was dependent on internal Cl- but not on internal Na/sup +/. At a constant external concentration of HCO/sub 3/-, the amount of /sup 22/Na/sup +/ associated with the cells increased when the internal concentration of HCO/sub 3/- decreased and vice versa, which is compatible with the possibility that the ion pair NaCO/sub 3/- is the transported species and that the transport is symmetric across the membrane. Bicarbonate inhibited the uptake of /sup 36/Cl/sup -/ both in the absence and presence of Na/sup +/. At alkaline internal pH, HCO/sub 3/- stimulated the efflux of /sup 36/Cl/sup -/ from preloaded cells, while at acidic internal pH both Na/sup +/ and HCO/sub 3/- were required to induce /sup 36/Cl/sup -/ efflux. We propose a model for how bicarbonate-dependent regulation of the internal pH may occur. This model implies the existence of two bicarbonate transport mechanisms that, under physiological conditions, transport OH(-)-equivalents in opposite directions across the plasma membrane.

  11. Spectroscopic evaluation of the effect of a red microalgal polysaccharide on herpes-infected Vero cells.

    PubMed

    Huleihel, Mahmoud; Talyshinsky, Marina; Souprun, Yelena; Erukhimovitch, Vitaly

    2003-04-01

    The sulfated polysaccharide obtained from a species of red microalga has proved to be a potent antiviral agent against various members of the herpes family. In the present study, we used microscopic Fourier transform infrared spectroscopy (FT-IR) to investigate differences between normal cells, those infected with herpes viruses, and infected cells treated with red microalgal polysaccharide. FT-IR enables the characterization of cell or tissue pathology based on characteristic molecular vibrational spectra of the cells. The advantage of microscopic FT-IR spectroscopy over conventional FT-IR spectroscopy is that it facilitates inspection of restricted regions of cell cultures or tissue. Our results showed significant spectral differences at early stages of infection between infected and noninfected cells, and between infected cells treated with the polysaccharide and those not treated. In infected cells, there was an impressive decrease in sugar content and a considerable increase in phosphate levels in conjunction with the infection progress. Our results also proved that sugars penetrated and accumulated inside cells treated with the red microalgal polysaccharide. These could have been sugar fragments of low molecular weight present in the polysaccharide solution, despite purification by dialysis. Such sugar accumulation might be responsible for a breakdown in the internal steps of the viral replication cycle. PMID:14658634

  12. Detection of Latent Retroviruses in Vaccine-related Cell Substrates: Investigation of RT Activity Produced by Chemical Induction of Vero Cells.

    PubMed

    Ma, Hailun; Khan, Arifa S

    2011-01-01

    CONFERENCE PROCEEDING Proceedings of the PDA/FDA Adventitious Viruses in Biologics: Detection and Mitigation Strategies Workshop in Bethesda, MD, USA; December 1-3, 2010 Guest Editors: Arifa Khan (Bethesda, MD), Patricia Hughes (Bethesda, MD) and Michael Wiebe (San Francisco, CA) The detection of known and novel viruses is important for cell substrate and vaccine safety. A major challenge is detection of latent viruses such as endogenous retroviruses and oncogenic DNA viruses. We have evaluated activation of endogenous retroviruses in a Vero cell line using chemical induction and various conventional and emerging methods for virus detection and characterization. In addition, infectivity studies were done to determine whether any induced virus particles were replication competent. This approach may be used for enhancing vaccine safety by assessing the presence of potential chemically-inducible, latent viruses in cell substrates to be used for vaccine manufacture. PMID:22294598

  13. Bovine colostrum ultrafiltrate supplemented with adult bovine serum and transferrin: An effective fbs substitute for cultivation of vero and CHO-K1 cells

    Microsoft Academic Search

    Raimo Pakkanen

    1994-01-01

    Summary  A mixture containing an ultrafiltrate fraction (UF) of bovine colostrum (6.7%), adult bovine serum (BS) (1%), and human holo-transferrin\\u000a (hTF) (5 mg\\/liter) was developed for cultivation of Chinese hamster ovary cells (CHO-K1) and African green monkey kidney cells\\u000a (Vero). The growth-supporting activity of the mixture (UF\\/BS\\/hTF) was comparable to that of 1 to 10% fetal bovine serum (FBS)\\u000a and considerably

  14. Reduction of spiked porcine circovirus during the manufacture of a Vero cell-derived vaccine.

    PubMed

    Lackner, Cornelia; Leydold, Sandra M; Modrof, Jens; Farcet, Maria R; Grillberger, Leopold; Schäfer, Birgit; Anderle, Heinz; Kreil, Thomas R

    2014-04-11

    Porcine circovirus-1 (PCV1) was recently identified as a contaminant in live Rotavirus vaccines, which was likely caused by contaminated porcine trypsin. The event triggered the development of new regulatory guidance on the use of porcine trypsin which shall ensure that cell lines and porcine trypsin in use are free from PCV1. In addition, manufacturing processes of biologicals other than live vaccines include virus clearance steps that may prevent and mitigate any potential virus contamination of product. In this work, artificial spiking of down-scaled models for the manufacturing process of an inactivated pandemic influenza virus vaccine were used to investigate inactivation of PCV1 and the physico-chemically related porcine parvovirus (PPV) by formalin and ultraviolet-C (UV-C) treatment as well as removal by the purification step sucrose gradient ultracentrifugation. A PCV1 infectivity assay, using a real-time PCR infectivity readout was established. The formalin treatment (0.05% for 48h) showed substantial inactivation for both PCV1 and PPV with reduction factors of 3.0log10 and 6.8log10, respectively, whereas UV-C treatment resulted in complete PPV (?5.9log10) inactivation already at a dose of 13mJ/cm but merely 1.7log10 at 24mJ/cm(2) for PCV1. The UV-C inactivation results with PPV were confirmed using minute virus of mice (MVM), indicating that parvoviruses are far more sensitive to UV-C than PCV1. The sucrose density gradient ultracentrifugation also contributed to PCV1 clearance with a reduction factor of 2log10. The low pH treatment during the production of procine trypsin was investigated and showed effective inactivation for both PCV1 (4.5log10) and PPV (6.4log10). In conclusion, PCV1 in general appears to be more resistant to virus inactivation than PPV. Still, the inactivated pandemic influenza vaccine manufacturing process provides for robust virus reduction, in addition to the already implemented testing for PCV1 to avoid any contaminations. PMID:24560672

  15. Transcriptional profiling of Vero E6 cells over-expressing SARS-CoV S2 subunit: Insights on viral regulation of apoptosis and proliferation

    SciTech Connect

    Yeung, Y.-S. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: ysyeung@graduate.hku.hk; Yip, C.-W. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: h0024004@hkusua.hku.hk; Hon, C.-C. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: h9826299@hkusua.hku.hk; Chow, Ken Y.C. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: chow@pasteur.fr; Ma, Iris C.M. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: h0105962@hkusua.hku.hk; Zeng Fanya [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: fzeng@hkucc.hku.hk; Leung, Frederick C.C. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: fcleung@hkucc.hku.hk

    2008-02-05

    We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by the diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level.

  16. Genetic and phenotypic properties of vero cell-adapted Japanese encephalitis virus SA14-14-2 vaccine strain variants and a recombinant clone, which demonstrates attenuation and immunogenicity in mice.

    PubMed

    Gromowski, Gregory D; Firestone, Cai-Yen; Bustos-Arriaga, José; Whitehead, Stephen S

    2015-01-01

    The live-attenuated Japanese encephalitis virus (JEV) SA14-14-2 vaccine, produced in primary hamster kidney cells, is safe and effective. Past attempts to adapt this virus to replicate in cells that are more favorable for vaccine production resulted in mutations that significantly reduced immunogenicity. In this study, 10 genetically distinct Vero cell-adapted JEV SA14-14-2 variants were isolated and a recombinant wild-type JEV clone, modified to contain the JEV SA14-14-2 polyprotein amino acid sequence, was recovered in Vero cells. A single capsid protein mutation (S66L) was important for Vero cell-adaptation. Mutations were also identified that modulated virus sensitivity to type I interferon-stimulation in Vero cells. A subset of JEV SA14-14-2 variants and the recombinant clone were evaluated in vivo and exhibited levels of attenuation that varied significantly in suckling mice, but were avirulent and highly immunogenic in weanling mice and are promising candidates for the development of a second-generation, recombinant vaccine. PMID:25311701

  17. Antibody response of patients after postexposure rabies vaccination with small intradermal doses of purified chick embryo cell vaccine or purified Vero cell rabies vaccine.

    PubMed Central

    Briggs, D. J.; Banzhoff, A.; Nicolay, U.; Sirikwin, S.; Dumavibhat, B.; Tongswas, S.; Wasi, C.

    2000-01-01

    Although the introduction of tissue culture vaccines for rabies has dramatically improved the immunogenicity and safety of rabies vaccines, they are often prohibitively expensive for developing countries. To examine whether smaller doses of these vaccines could be used, we tested the safety and immunogenicity of purified chick embryo cell vaccine (PCECV) on 211 patients in Thailand with World Health Organization (WHO) category II and III exposures to rabies. The patients presented at two Thai hospitals and were randomized into three groups. Patients in Group 1 received 0.1 ml PCECV intradermally at two sites on days 0, 3, 7, and at one site on days 30 and 90. Group 2 was treated similarly, except that purified Vero cell rabies vaccine (PVRV) was used instead of PCECV. Group 3 received 1.0 ml PCECV intramuscularly on days 0, 3, 7, 14, 30 and 90. After 0, 3, 7, 14, 30 and 90 days serum was collected from the subjects and the geometric mean titres (GMTs) of rabies virus neutralizing antibody determined. After 14 days the GMT of 59 patients vaccinated intradermally with PCECV was equivalent to that of patients who received PVRV. Adverse reactions were more frequent in patients who received vaccines intradermally, indicating the reactions were associated with the route of injection, rather than the vaccine per se. We conclude that PCECV is a safe and highly immunogenic vaccine for postexposure rabies vaccination when administered intradermally in 0.1-ml doses using the two-site method ("2,2,2,0,1,1") recommended by WHO. PMID:10859864

  18. Original article Apoptosis induction in BEFV-infected Vero and MDBK

    E-print Network

    Paris-Sud XI, Université de

    Original article Apoptosis induction in BEFV-infected Vero and MDBK cells through Src-dependent JNK ephemeral fever virus (BEFV)-infected cultured cells could induce caspase-dependent apoptosis. This study and induced apoptosis in Vero and Madin-Darby bovine kidney (MDBK) cells, and a kinetic study showed a higher

  19. Transport of an external Lys-Asp-Glu-Leu (KDEL) protein from the plasma membrane to the endoplasmic reticulum: studies with cholera toxin in Vero cells

    PubMed Central

    1996-01-01

    The A2 chain of cholera toxin (CTX) contains a COOH-terminal Lys-Asp- Glu-Leu (KDEL) sequence. We have, therefore, analyzed by immunofluorescence and by subcellular fractionation in Vero cells whether CTX can used to demonstrate a retrograde transport of KDEL proteins from the Golgi to the ER. Immunofluorescence studies reveal that after a pulse treatment with CTX, the CTX-A and B subunits (CTX-A and CTX-B) reach Golgi-like structures after 15-20 min (maximum after 30 min). Between 30 and 90 min, CTX-A (but not CTX-B) appear in the intermediate compartment and in the ER, whereas the CTX-B are translocated to the lysosomes. Subcellular fractionation studies confirm these results: after CTX uptake for 15 min, CTX-A is associated only with endosomal and Golgi compartments. After 30 min, a small amount of CTX-A appears in the ER in a trypsin-resistant form, and after 60 min, a significant amount appears. CTX-A seems to be transported mainly in its oxidized form (CTX-A1-S-S-CTX-A2) from the Golgi to the ER, where it becomes slowly reduced to form free CTX A1 and CTX-A2, as indicated by experiments in which cells were homogenized 30 and 90 min after the onset of CTX uptake in the presence of N- ethylmaleimide. Nocodazol applied after accumulation of CTX in Golgi inhibits the appearance of CTX-A in the ER and delays the increase of 3',5'cAMP, indicating the participation of microtubules in the retrograde Golgi-ER transport. PMID:8666663

  20. Comparison of the antiproliferative activity of crude ethanol extracts of nine salvia species grown in Jordan against breast cancer cell line models

    PubMed Central

    Abu-Dahab, Rana; Afifi, Fatma; Kasabri, Violet; Majdalawi, Lara; Naffa, Randa

    2012-01-01

    Background: The antiproliferative activity of Salvia species grown in Jordan has not been fully evaluated yet. The aim of this work was to study the antiproliferative activity of crude ethanol extracts from nine Salvia species grown in Jordan against a panel of breast cancer cell lines. Material and Methods: Cytotoxic activity was evaluated in human tumor models of breast cancer; MCF-7, T47D, ZR-75-1, and BT 474 by the sulforhodamine B assay. In addition, the extracts were evaluated using a non-transformed cell line (Vero) and normal fibroblast cells in order to demonstrate their selectivity and safety. Results: From the nice ethanol extracts under investigation, those of S. dominica and S. fruticosa showed an inhibitory concentration of 50% of cells (IC50) in concentrations less than 30?g/mL against the four cell lines under investigation. S. syriaca and S. hormium showed an IC50 below 30?g/ml for two out of the four cell lines. S. fruticosa, S. hormium and S. syriaca showed selectivity in their antiproliferative activity against estrogen receptor positive cell lines with minimal toxicity against normal human periodontal fibroblasts. Phytochemical screening using thin layer chromatography indicated the presence of terpenoids, flavonoids and coumarins in all examined extracts. Conclusion: Three of the plant extracts under investigation exhibited antiproliferative activity against breast cancer cells and were shown to be safe and selective. These could be considered as a potential source for novel anticancer therapy. PMID:24082637

  1. Very high efficiency triple junction solar cells grown by MOVPE

    Microsoft Academic Search

    M. Stan; D. Aiken; B. Cho; A. Cornfeld; J. Diaz; V. Ley; A. Korostyshevsky; P. Patel; P. Sharps; T. Varghese

    2008-01-01

    The GaInP\\/GaInAs\\/Ge triple junction (3J) space cell technology is nearing practical achievable conversion efficiency limits of ?30% under 1-sun AM0 illumination. We present solar cell device-modeling results that indicate the GaInP\\/GaAs\\/GaInAs architecture with optimal bandgap energies will produce an additional 4% output power relative to the present GaInP\\/GaInAs\\/Ge 3J space cell technology. We have grown the GaInP\\/GaAs\\/GaInAs 3J cell on

  2. Heteroepitaxially grown InP solar cells

    Microsoft Academic Search

    I. Weinberg; C. K. Swartz; D. J. Brinker; D. M. Wilt

    1990-01-01

    The properties of InP solar cells, processed by OMCVD on silicon substrates with an intermediate GaAs layer (InP\\/GaAs\\/Si) and on GaAs substrates (InP\\/GaAs), were determined before and after irradiation with 10-MeV protons. The preirradiation transport properties were found to be influenced largely by dislocations occurring at the InP-GaAs interface. A carrier removal rate of 1.8×103 cm-1 was observed after irradiation

  3. Growth of vaccine strains of avian pneumovirus in different cell lines.

    PubMed

    Patnayak, Devi P; Tiwari, A; Goyal, Sagar M

    2005-04-01

    The isolation of avian pneumovirus (APV) (avian metapneumovirus) is usually performed in embryonated chicken eggs or chicken embryo fibroblast cell cultures followed by adaptation in continuous cell lines such as Vero cells. This study was conducted to find a suitable cell line that could be used to propagate vaccine strains of APV to high titre. For this purpose, we compared the growth of two Vero cell-adapted vaccine strains of APV (P63 and ca-APV) in seven different cell types with their growth in Vero cells. The cell types used were BGM-70, MA-104, QT-35, BHK-21, McCoy and DF-1 cells and primary turkey embryo fibroblast cells. When compared with growth in Vero cells, both viruses yielded higher titres in BGM-70 cells, while P63 also produced higher titres in MA-104 cells. In another experiment, the two viruses were grown and titrated in Vero cells under various cell culture conditions, such as age of cells, seeding concentration, and time of harvest. None of these cell culture variables were found to affect virus titres. PMID:16191692

  4. Photosynthetic ability in dark-grown Reboulia hemisphaerica and Barbula unguiculata cells in suspension culture.

    PubMed

    Takio, S; Akita, C; Ngumi, V W; Takami, S

    1990-03-01

    Suspension cultured cells of the liverwort, Reboulia hemisphaerica and of the moss, Barbula unguiculata were independently subcultured in the medium containing 2% glucose in the dark or in the light for more than one year, and the photosynthetic activities of the final cultures were determined. Throughout the culture period light-grown cells of both species contained high amount of chlorophyll (4 to 34 ?g mg(-1) dry weight) and showed a high photosynthetic activity (10 to 84 ?mol O2 mg(-1) chlorophyll h(-1)). Dark-grown cells of R. hemisphaerica showed the same level of chlorophyll content and photosynthetic O2 evolving activity as light-grown cells. Although chlorophyll content in dark-grown B. unguiculata cells was ten-fold lower than that in light-grown cells, the photosynthetic activity of these dark-grown cells was higher than that of light-grown cells based on chlorophyll content. PMID:24232674

  5. Role of Proteus mirabilis MR/P fimbriae and flagella in adhesion, cytotoxicity and genotoxicity induction in T24 and Vero cells.

    PubMed

    Scavone, Paola; Villar, Silvia; Umpiérrez, Ana; Zunino, Pablo

    2015-06-01

    Proteus mirabilis is frequently associated with complicated urinary tract infections (UTI). It is proposed that several virulence factors are associated with P. mirabilis uropathogenicity. The aim of this work was to elucidate genotoxic and cytotoxic effects mediated by MR/P fimbriae and flagella in eukaryotic cells in vitro. Two cell lines (kidney- and bladder-derived) were infected with a clinical wild-type P. mirabilis strain and an MR/P and a flagellar mutant. We evaluated adhesion, genotoxicity and cytotoxicity by microscopy, comet assay and triple staining technique, respectively. Mutant strains displayed lower adhesion rates than the P. mirabilis wild-type strain and were significantly less effective to induce genotoxic and cytotoxic effects compared to the wild type. We report for the first time that P. mirabilis MR/P fimbriae and flagella mediate genotoxic and cytotoxic effects on eukaryotic cells, at least in in vitro conditions. These results could contribute to design new strategies for the control of UTI. PMID:25724892

  6. Cell alignment is induced by cyclic changes in cell length: studies of cells grown in cyclically stretched substrates

    Microsoft Academic Search

    C. Neidlinger-Wilke; E. S. Grood; J. H.-C. Wang; R. A. Brand; L. Claes

    2001-01-01

    Many types of cells, when grown on the surface of a cyclically stretched substrate, align away from the stretch direction. Although cell alignment has been described as an avoidance response to stretch, the specific deformation signal that causes a cell population to become aligned has not been identified. Planar surface deformation is characterized by three strains: two normal strains describe

  7. Polymer electrolyte fuel cell electrodes grown by vapor deposition techniques Pascal Brault*

    E-print Network

    Paris-Sud XI, Université de

    Polymer electrolyte fuel cell electrodes grown by vapor deposition techniques Pascal Brault temperature Solid Polymer Fuel Cells, as Proton Exchange Membrane Fuel Cells (PEMFC), Direct alcohol Fuel Cell (DAFC), Solid Alkaline Membrane Fuel Cell (SAMFC) are promising energy power supplies in the context

  8. Organic solar cells using CVD-grown graphene electrodes

    NASA Astrophysics Data System (ADS)

    Kim, Hobeom; Bae, Sang-Hoon; Han, Tae-Hee; Lim, Kyung-Geun; Ahn, Jong-Hyun; Lee, Tae-Woo

    2014-01-01

    We report on the development of flexible organic solar cells (OSCs) incorporating graphene sheets synthesized by chemical vapor deposition (CVD) as transparent conducting electrodes on polyethylene terephthalate (PET) substrates. A key barrier that must be overcome for the successful fabrication of OSCs with graphene electrodes is the poor-film properties of water-based poly(3,4-ethylenedioxythiphene):poly(styrenesulfonate) (PEDOT:PSS) when coated onto hydrophobic graphene surfaces. To form a uniform PEDOT:PSS film on a graphene surface, we added perfluorinated ionomers (PFI) to pristine PEDOT:PSS to create ‘GraHEL’, which we then successfully spin coated onto the graphene surface. We systematically investigated the effect of number of layers in layer-by-layer stacked graphene anode of an OSC on the performance parameters including the open-circuit voltage (Voc), short-circuit current (Jsc), and fill factor (FF). As the number of graphene layers increased, the FF tended to increase owing to lower sheet resistance, while Jsc tended to decrease owing to the lower light absorption. In light of this trade-off between sheet resistance and transmittance, we determined that three-layer graphene (3LG) represents the best configuration for obtaining the optimal power conversion efficiency (PCE) in OSC anodes, even at suboptimal sheet resistances. We finally developed efficient, flexible OSCs with a PCE of 4.33%, which is the highest efficiency attained so far by an OSC with CVD-grown graphene electrodes to the best of our knowledge.

  9. Organic solar cells using CVD-grown graphene electrodes.

    PubMed

    Kim, Hobeom; Bae, Sang-Hoon; Han, Tae-Hee; Lim, Kyung-Geun; Ahn, Jong-Hyun; Lee, Tae-Woo

    2014-01-10

    We report on the development of flexible organic solar cells (OSCs) incorporating graphene sheets synthesized by chemical vapor deposition (CVD) as transparent conducting electrodes on polyethylene terephthalate (PET) substrates. A key barrier that must be overcome for the successful fabrication of OSCs with graphene electrodes is the poor-film properties of water-based poly(3,4-ethylenedioxythiphene):poly(styrenesulfonate) (PEDOT:PSS) when coated onto hydrophobic graphene surfaces. To form a uniform PEDOT:PSS film on a graphene surface, we added perfluorinated ionomers (PFI) to pristine PEDOT:PSS to create 'GraHEL', which we then successfully spin coated onto the graphene surface. We systematically investigated the effect of number of layers in layer-by-layer stacked graphene anode of an OSC on the performance parameters including the open-circuit voltage (Voc), short-circuit current (Jsc), and fill factor (FF). As the number of graphene layers increased, the FF tended to increase owing to lower sheet resistance, while Jsc tended to decrease owing to the lower light absorption. In light of this trade-off between sheet resistance and transmittance, we determined that three-layer graphene (3LG) represents the best configuration for obtaining the optimal power conversion efficiency (PCE) in OSC anodes, even at suboptimal sheet resistances. We finally developed efficient, flexible OSCs with a PCE of 4.33%, which is the highest efficiency attained so far by an OSC with CVD-grown graphene electrodes to the best of our knowledge. PMID:24334624

  10. Photosynthetic Characteristics of Photoautotrophically Grown Tobacco Callus Cells 1

    PubMed Central

    Berlyn, Mary B.; Zelitch, Israel; Beaudette, Pamela D.

    1978-01-01

    Haploid callus cells of tobacco (Nicotiana tabacum) were grown photoautotrophically on a solid agar medium in the absence of sucrose in Petri plates in an atmosphere of 1% or 3% CO2 in air. The averages of dry weight increases for four to five consecutive passages were 2.3- to 3.6-fold per 3-week passage for different subclones. Photosynthetic 14CO2 assimilation was maximum at about 1% CO2 with half-maximal rates obtained at 0.2% CO2. At saturating CO2 concentration the average rate of CO2 fixation was about 5 ?mole per gram fresh weight per hour or about 125 ?mole per mg of chlorophyll per hour. The existence of an active photorespiratory system in these tissues was established in a number of independent ways. The photosynthetic rate in 0.18% CO2 was inhibited 38 to 50% in 100% O2 compared with 21% O2. Glycolate accumulated at a constant rate in the presence of 5 mm ?-hydroxy-2-pyridinemethanesulfonic acid for 20 minutes in light. This rate was rapid relative to the photosynthetic rate. Glycolate synthesis was three times faster in autotrophic than in heterotrophic cells. [1-14C]Glycolate was rapidly metabolized and the products included 14CO2, [14C]glycine, and [14C]serine, thus demonstrating an active glycolate pathway. Photorespiration was demonstrated directly by measurement of an O2-dependent release of 14CO2 in the light from callus that fixed 14CO2 for about 22 hours. Autotrophic growth in 60% O2 and 0.03% CO2 was slowed and ceased entirely after two or three passages, while heterotrophic growth was unaffected by 60% O2 in the atmosphere. The method of growing autotrophic callus which has an active photorespiratory system should facilitate the selection and analysis of photosynthetic mutants in which photorespiration is regulated. PMID:16660346

  11. Assessment of immunogenic potential of Vero adapted formalin inactivated vaccine derived from novel ECSA genotype of Chikungunya virus

    Microsoft Academic Search

    Mugdha Tiwari; Manmohan Parida; S. R. Santhosh; Mohsin Khan; Paban Kumar Dash; P. V. Lakshmana Rao

    2009-01-01

    The recent resurgence of Chikungunya virus (CHIKV) in India and Indian Ocean Islands with unusual clinical severity is a matter of great public health concern. Despite the fact that CHIKV resurgence is associated with epidemic of unprecedented magnitude, no approved licensed vaccine is currently available. In the present study, a Vero cell adapted purified formalin inactivated prototype vaccine candidate was

  12. Pro-angiogenic Cell Colonies Grown In Vitro from Human Peripheral Blood Mononuclear Cells

    PubMed Central

    Mavromatis, Kreton; Sutcliffe, Diane; Joseph, Giji; Alexander, R. Wayne; Waller, Edmund K.; Quyyumi, Arshed A.; Taylor, W. Robert

    2014-01-01

    Although multiple culture assays have been designed to identify “endothelial progenitor cells” (EPCs), the phenotype of cells grown in culture often remains undefined. We sought to define and characterize the pro-angiogenic cell population within human peripheral blood mononuclear cells. Mononuclear cells were isolated from peripheral blood and grown under angiogenic conditions for 7 days. Formed colonies (CFU-As) were identified and analyzed for proliferation, mRNA and surface antigen expression, tube-forming ability and chromosomal content. Colonies were composed of a heterogeneous group of cells expressing the leukocyte antigens CD45, CD14, and CD3, as well as the endothelial proteins vascular endothelial (VE) cadherin, von Willebrand's Factor (vWF), CD31 and endothelial nitric oxide synthase (eNOS). Colony cells expressed increased levels of pro-angiogenic growth factors, and they formed tubes in Matrigel. In comparison with colonies from the CFU-Hill assay, our assay resulted in a greater number of colonies (19±9 vs. 13±7; p<0.0001) with a substantial number of cells expressing an endothelial phenotype (20.2±7.4% vs. 2.2±1.2% expressing eNOS, p=0006). Chromosomal analysis indicated the colony cells were bone marrow-derived. We, therefore, describe a colony forming unit assay that measures bone marrow-derived circulating mononuclear cells with the capacity to proliferate and mature into proangiogenic leukocytic and endothelial-like cells. This assay, therefore, reflects circulating, bone marrow-derived pro-angiogenic activity. PMID:22904201

  13. High-efficiency GaAs solar cells grown by molecular-beam epitaxy

    SciTech Connect

    Melloch, M.R. (School of Electrical Engineering, Purdue University, West Lafayette, Indiana 47907 (USA)); Tobin, S.P. (Spire Corporation, Patriots Park, Bedford, Massachusetts 01730 (USA)); Stellwag, T.B. (School of Electrical Engineering, Purdue University, West Lafayette, Indiana 47907 (USA)); Bajgar, C. (Spire Corporation, Patriots Park, Bedford, Massachusetts 01730 (USA)); Keshavarzi, A.; Lundstrom, M.S. (School of Electrical Engineering, Purdue University, West Lafayette, Indiana 47907 (USA)); Emery, K. (Solar Energy Research Institute, Golden, Colorado 80401 (USA))

    1990-03-01

    Previously, solar cells fabricated from molecular-beam epitaxually (MBE)-grown material have been inferior in performance to those fabricated from metalorganic chemical vapor deposited (MOCVD) material. We have obtained 1-sun air mass (AM) 1.5 efficiencies of 23.8% for 0.25 cm{sup 2} GaAs solar cells fabricated on MBE-grown material. This is the first solar cell fabricated on MBE material which is of comparable performance to solar cells fabricated on MOCVD material. Details of the MBE system preparation and film growth procedure along with a detailed evaluation of the solar cells will be presented.

  14. Eumelanin Dye-sensitized Solar Cell Grown with Matrix-assisted Pulsed Laser

    E-print Network

    Eumelanin Dye-sensitized Solar Cell Grown with Matrix-assisted Pulsed Laser Evaporation~4 DHICA DHICA #12; III Abstract At present the majority dye-sensitized solar cell research all, and besides provides and does not have other uses for the dye-sensitized solar cell use. In order to improve

  15. Aligned Cell Sheets Grown on Thermo-Responsive Substrates with Microcontact Printed Protein Patterns

    E-print Network

    Aligned Cell Sheets Grown on Thermo-Responsive Substrates with Microcontact Printed Protein for growing and harvesting confluent, aligned cell sheets on PIPAAm-grafted substrates that have been and D). At 24 h, serum was added and cells grew to confluence within a few days, remaining aligned

  16. Characterization of CIGS thin films and solar cells grown with a plasma-cracked Se source

    Microsoft Academic Search

    Shogo Ishizuka; Akimasa Yamada; Paul Fons; Shigeru Niki

    2011-01-01

    The variation observed in rf-plasma cracked radical Se (R-Se) source grown Cu(In, Ga)Se2 (CIGS) film properties and conventional evaporative Se (E-Se) source grown CIGS film properties was studied for the development of industrial production techniques of evaporated CIGS films and CIGS texture control techniques, which are important for the optimization of the CIGS\\/buffer layer interface to yield high cell and

  17. MBE grown GaInNAs solar cells for multijunction applications

    Microsoft Academic Search

    David Jackrel; Homan Yuen; Junxian Fu; Seth Bank; Xiaojun Yu; Zhilong Rao; James S. Harris

    2005-01-01

    Triple-junction cells composed of III-V materials currently hold the world record for photovoltaic efficiency. In order to further increase cell efficiency in the future 4- and 5-junction cells incorporating a sub-cell with a bandgap of roughly 1.0 eV will be required. In this study 1.0 eV bandgap GaInNAs devices grown by solid source molecular beam epitaxy are investigated in terms

  18. GaInNAsSb Solar Cells Grown by Molecular Beam Epitaxy

    Microsoft Academic Search

    David Jackrel; Aaron Ptak; Seth Bank; Homan Yuen; Mark Wistey; Daniel Friedman; Sarah Kurtz; James S. Harris

    2006-01-01

    The first GaInNAsSb solar cells are reported. The dilute nitride antimonide material, grown by molecular beam epitaxy, has a bandgap of 0.92 eV and maintains excellent carrier collection efficiency. Internal quantum efficiency of nearly 80% at maximum is obtained in the narrow bandgap GaInNAsSb cells. The short-circuit current density produced by the GaInNAsSb cells underneath a GaAs sub-cell in a

  19. Sonochemically grown ZnO nanowalls on Graphene layers as Photoanode in Dye sensitized Solar cells.

    E-print Network

    Pala, Nezih

    Sonochemically grown ZnO nanowalls on Graphene layers as Photoanode in Dye sensitized Solar cells whole solar spectrum Graphene can be a very promising material in Dye Sensitized Solar cells (DSSC as photoanode is presented. The effect of Graphene on dye loading and on efficiency of DSSC is quantitatively

  20. Photosynthetic ability in dark-grown Reboulia hemisphaerica and Barbula unguiculata cells in suspension culture

    Microsoft Academic Search

    Susumu Takio; Chikako Akita; Victoria Wambui Ngumi; Shinji Takami

    1990-01-01

    Suspension cultured cells of the liverwort, Reboulia hemisphaerica and of the moss, Barbula unguiculata were independently subcultured in the medium containing 2% glucose in the dark or in the light for more than one year, and the photosynthetic activities of the final cultures were determined. Throughout the culture period light-grown cells of both species contained high amount of chlorophyll (4

  1. Voltage and time-dependent chloride currents in chick skeletal muscle cells grown in tissue culture

    Microsoft Academic Search

    Joy A. Steele

    1989-01-01

    Membrane chloride currents in chick skeletal muscle cells grown in tissue culture were studied by use of the whole cell variation of the patch electrode voltage clamp technique. Small diameter myoballs were obtained by adding colchicine to the growth media. To isolate the currents through the chloride channels, the currents through the sodium, calcium and potassium channels were minimized. With

  2. FINE STRUCTURE OF SMOOTH MUSCLE CELLS GROWN IN TISSUE CULTURE

    Microsoft Academic Search

    GORDON R. CAMPBELL; YASUO UEHARA; GERDA MARK; GEOFFREY BURNSTOCK

    1971-01-01

    The fine structure of smooth muscle cells of the embryo chicken gizzard cultured in mono- layer was studied by phase-contrast optics and electron microscopy . The smooth muscle cells were irregular in shape, but tended to be elongate . The nucleus usually contained prominent nucleoli and was large in relation to the cell body . When fixed with glutaralde- hyde,

  3. Reflectivity and topography of cells grown on glass-coverslips measured with

    E-print Network

    Ovryn, Ben

    Reflectivity and topography of cells grown on glass-coverslips measured with phase-shifted laser by sub-cellular structures from the reflection at the coverslip-buffer interface. The method offers the topography and reflection from calibration spheres and from stress fibers and adhesions in both fixed

  4. Comparison of electrogenic capabilities of microbial fuel cell with different light power on algae grown cathode.

    PubMed

    Juang, D F; Lee, C H; Hsueh, S C

    2012-11-01

    Electricity generation capabilities of microbial fuel cell with different light power on algae grown cathode were compared. Results showed that microbial fuel cell with 6 and 12W power of light always produced higher voltage and power density than with 18 and 26W. Similarly, microbial fuel cell with 6 and 12W of light power always displayed higher Coulombic efficiency and specific power than the one with 18 and 26W. The results also showed that microbial fuel cell with covered anodic chamber always displayed higher voltage, power density, Coulombic efficiency and specific power than the one without covered anodic chamber. Binary quadratic equations can be used to express the relationships between the light power and the voltage, power density, Coulombic efficiency and specific power. Although lower power of light on algae grown cathode and covering anodic chamber will increase system's electricity production, they will not significantly reduce its internal resistance. PMID:22929741

  5. Phosphocholine and choline content of rat sarcoma cells grown in the presence and absence of serum.

    PubMed

    Smith, T A; Eccles, S; Box, G; Titley, J C; Leach, M O; McCready, V R

    1996-01-01

    Rat sarcoma cells were grown in vitro in tissue culture medium (DMEM) supplemented with 10% foetal calf serum for 5 to 8 days followed by serum withdrawal to produce populations of cells with a variety of cell cycle distributions. Phosphocholine (PCho) and choline content and S + G2 fraction were determined. The phosphocholine content of faster growing populations of serum supplemented cells was higher than the slower growing populations. Choline content was not consistently associated with S + G2 fraction. Serum deprivation was accompanied by a decrease in S + G2 fraction after 24 hours but even after 48 hours PCho content was only slightly decreased. PMID:8694506

  6. Reprogramming mediated radio-resistance of 3D-grown cancer cells

    PubMed Central

    Xue, Gang; Ren, Zhenxin; Grabham, Peter W.; Chen, Yaxiong; Zhu, Jiayun; Du, Yarong; Pan, Dong; Li, Xiaoman; Hu, Burong

    2015-01-01

    In vitro 3D growth of tumors is a new cell culture model that more closely mimics the features of the in vivo environment and is being used increasingly in the field of biological and medical research. It has been demonstrated that cancer cells cultured in 3D matrices are more radio-resistant compared with cells in monolayers. However, the mechanisms causing this difference remain unclear. Here we show that cancer cells cultured in a 3D microenvironment demonstrated an increase in cells with stem cell properties. This was confirmed by the finding that cells in 3D cultures upregulated the gene and protein expression of the stem cell reprogramming factors such as OCT4, SOX2, NANOG, LIN28 and miR-302a, compared with cells in monolayers. Moreover, the expression of ?-catenin, a regulating molecule of reprogramming factors, also increased in 3D-grown cancer cells. These findings suggest that cancer cells were reprogrammed to become stem cell–like cancer cells in a 3D growth culture microenvironment. Since cancer stem cell–like cells demonstrate an increased radio-resistance and chemo-resistance, our results offer a new perspective as to why. Our findings shed new light on understanding the features of the 3D growth cell model and its application in basic research into clinical radiotherapy and medicine. PMID:25883172

  7. Effects of method of detachment on electrophoretic mobility of mammalian cells grown in monolayer culture

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    A variety of proteolytic and micolytic enzumes, mechanical procedures, and changes in the ionic environment, especially Ca chelation, are used for dispersal of monolayer grown cells. If either chelating agents or mechanical dispersion are used alone, the cell yield is often low and suspensions of single cells are difficult to obtain. Confluent monolayers treated with EDTA tend to be released from their surfaces in sheets, and clumps of cells remain even after further incubation in EDTA. Crude trypsin is the most popular dispersal agent and is known to contain a variety of contaminating enzymes which contribute to the dispersal of cells. A variety of cell injuries resulting from the activity of proteolytic enzymes are reported. It is shown that crystalline trypsin is least harmful to cell integrity as judged by trypan blue uptake.

  8. Proton irradiated MBE grown GaInP\\/GaAs single junction and tandem solar cells

    Microsoft Academic Search

    A. B. Kazantsev; J. Lammasniemi; R. Jaakkola; M. Pessa; M. Rajatora; R. K. Jain

    1997-01-01

    Degradation characteristics for MBE grown Ga0.51In0.49P and GaAs single junction and Ga0.51In0.49P\\/GaAs tandem solar cells irradiated with 3 MeV and 10 MeV protons with fluences of 1010- 1013 cm-2 are reported. The cell degradation was characterized with illuminated current-voltage (I-V) and spectral response measurements. Minority carrier diffusion length damage coefficients for the GaAs cells for 3 MeV and 10 MeV

  9. CdSe\\/ZzTe heterojunction solar cells grown on GaSb

    Microsoft Academic Search

    S. Wang; D. Ding; R. Scott; J. Chen; M. DiNezza; X. Liu; J. Furdyna; Y.-H. Zhang

    2009-01-01

    This paper reports recent experimental work on single junction II-VI semiconductor heterostructure solar cells consisting of n-type CdSe and p-type ZnTe grown by molecular beam epitaxy on GaSb substrates. The structural and crystalline properties are characterized using high-resolution X-ray diffraction measurements. The current-voltage measurements reveal expected diode-like rectifying characteristics with considerable photo current and strong photovoltaic effects under light illumination.

  10. Cr-MIS solar cells using thin epitaxial silicon grown on poly-silicon substrates

    Microsoft Academic Search

    W. A. Anderson; G. Rajeswaran; V. J. Rao; M. Thayer

    1981-01-01

    Cr-MIS solar cells were fabricated on 18-30 µm epitaxial-Si layers grown on poly-Si substrates. Solar conversion efficiency values ranged from an average of 8.8% to 4.0% depending on choice of substrate. Nonuniformity of certain substrates led to low efficiency values. Interface state density > 5 × 1012\\/cm2-eV contributed to low Vocand high n-factor. Low minority carrier diffusion length caused Jscto

  11. Tilted bulk heterojunction organic photovoltaic cells grown by oblique angle deposition

    Microsoft Academic Search

    Ning Li; Stephen R. Forrest

    2009-01-01

    We demonstrate small molecule bulk heterojunction organic photovoltaic cells using oblique angle vacuum deposition. Obliquely deposited donor chloroaluminum phthalocyanine (ClAlPc) films on indium tin oxide have surface feature sizes of ~30 nm, resulting in ClAlPc\\/C60 donor-acceptor heterojunctions (HJs) with approximately twice the interface area of HJs grown at normal incidence. This results in nearly twice the external quantum efficiency in

  12. Influence of Cell Volume in Multicell Transplant Flats on the Growth of Organically Grown Seedlings of Medicinal Plants

    Microsoft Academic Search

    E. Herrera; N. Tremblay; A. Gosselin

    1996-01-01

    Multi-cell transplant flats were compared to determine the influence of cell volume on the growth and nutritional condition of seedlings of angelica (Angelica archangelica L.), horehound (Marrubium vulgare L.) and thyme (Thymus vulgaris L.) grown in organic media. Plant growth and mineral concentration generally increased with cell volume, though the effect varied with different plant species. An increase in cell

  13. Performance of silicon solar cells fabricated from multiple Czochralski ingots grown by using a single crucible

    NASA Technical Reports Server (NTRS)

    Kachare, A. H.; Uno, F. M.; Miyahira, T.; Lane, R. L.

    1980-01-01

    Results on the performance of solar cells fabricated on wafers from multiple silicon ingots of large diameter, grown by using a single crucible and a sequential melt replenishment Czochralski (CZO) technique are presented. Samples were analyzed for resistivity, dislocation density and impurity content. Solar cells were fabricated from the seed, center and tang end of each ingot to evaluate the growth reproducibility and material quality. The cell efficiency within a given wafer varies by no more than plus or minus 5% of the average value. A small but consistent decrease in the cell efficiency is observed from the first to the fourth ingot grown from a single crucible. This decrease may be related to an increase in impurity content or dislocation density or a combination of both. The efficiency of the cells fabricated from the tang end of the fourth ingot is about 10% lower than that of the control cell. An impurity effects model is employed to correlate this decrease in efficiency with the impurity build-up in the residual melt.

  14. DNA content and differentiation of root apical cells of Brassica rapa plants grown in microgravity.

    PubMed

    Kordyum, E L; Martin, G I; Zaslavsky, V A; Jiao, S; Hilaire, E; Guikema, J A

    1999-07-01

    Root cap is proposed to be a graviperceptive tissue in the plant root, and it is composed of several cell types. One such cell type, the columella cells, are thought to initiate the gravity-induced signal transduction cascade, and these cells arise from the activity of the meristematic zone of the root cap. There is, in fact, a continuum of cells in the central column of the root cap representing the meristematic cells, developing columella cells, mature cells, and those that will soon be sloughed off into the soil. In order to study the functional roles of the root cap cells in gravity-sensing, we compared the ultrastructural organization, differentiation, and DNA content in the meristematic, elongating, and differentiating cells of root tips in Brassica rapa plants grown in space microgravity and at 1g. The experiments were also designed to determine the reactions of root cap cells in both main roots (in which the original root cap was present in an embryonic form within the seed) and lateral roots (in which the root cap formed completely in space after seed germination on orbit) to the space microgravity. This study (ROOTS) was performed in collaboration with the B-PAC experiment on the Space shuttle "Columbia" mission STS-87 (Collaborative US/Ukrainian Experiment (CUE) during November 19-December 5, 1997. PMID:11542985

  15. Influence of chronological aging on the survival and nucleotide content of Saccharomyces cerevisiae cells grown in different conditions: occurrence of a high concentration of UDP-N-acetylglucosamine in stationary cells grown in 2% glucose.

    PubMed

    Osório, Hugo; Silles, Eduardo; Maia, Rita; Peleteiro, Bárbara; Moradas-Ferreira, Pedro; Günther Sillero, María A; Sillero, Antonio

    2005-02-01

    Saccharomyces cerevisiae cells (strain W303) grown in a minimal medium (containing 2% or 0.1% glucose) until exponential or stationary phase, were subjected to chronological aging in water, and yeast viability and nucleotide content were analyzed along several days of nutrient starvation. Cells collected in exponential phase (whether grown in the presence of 0.1% or 2% glucose) were viable up to five days and thereafter the viability decreased linearly with a half-survival rate of around eight days. ATP and other nucleoside triphosphates decreased similarly in both cases. Cells collected in stationary phase, and transferred to water, behaved differently whether grown in 0.1% or in 2% glucose, with a half-survival life of around nine and 28 days respectively. A double mutant in glycogen synthase (gsy1delta gsy2delta) and its isogenic wild-type strain, grown to stationary phase in 2% glucose, presented a similar half-survival life of around eight days. The W303 cells grown to stationary phase in the presence of 2% glucose showed a 7-fold increase of UDP-N-acetylglucosamine (UDP-GlcNAc) as compared with the level present in the cells grown in any of the other three metabolic situations. The nature of UDP-GlcNAc was established by MALDI-TOF ionization analysis. It is also worth noting that the rate of decay of NAD+ was lower than that of ATP in any of the situations here considered. PMID:15691744

  16. Chondrogenesis in aggregates of embryonic limb cells grown in a rotating wall vessel.

    PubMed

    Duke, J; Daane, E; Arizpe, J; Montufar-Solis, D

    1996-01-01

    Previous studies in this lab have shown that chondrogenesis is affected in growth plates of rats exposed to microgravity, and in micromass cultures of embryonic limb mesenchyme differentiating in space. In order to provide a three dimensional aspect not seen in the micromass system, and a tissue homogeneity not possible with explants of limb or limb elements, and to alleviate certain difficulties regarding crew time and stowage, we began culturing embryonic limb cells in Rotating Wall Vessels (RWV). First, these cells were attached to beads, and grown for up to 65 days in a type of RWV known as STLV at the Johnson Space Center. During this time, the cells and beads aggregated and the aggregates continued to increase in size, and differentiated into Alcian blue staining chondrocytes. Because our intent was to use these aggregates for implanting into bony defects in addition to their use in studies of chondrogenic regulation at 1g and microgravity, aggregates of these cells without beads were grown in the commercially available version of the STLV, and their ability to ossify when subcutaneously implanted assessed. PMID:11538632

  17. FRABEL's REIMAGINED at McKEE BOTANICAL GARDEN 350 US FEDERAL HIGHWAY, VERO BEACH

    E-print Network

    Hill, Jeffrey E.

    FRABEL's REIMAGINED at McKEE BOTANICAL GARDEN 350 US FEDERAL HIGHWAY, VERO BEACH TUESDAY, MARCH 12:45 Arrive at McKee Botanical Garden. I will gather all reciprocal garden passes prior to entering) east to US 1. Go North on US 1 to Vero Beach. McKee Botanical Garden is located at 350 US Highway 1

  18. Flexible dye-sensitized solar cells with ZnO nanoparticles grown by Sonochemistry over Graphene/PET substrates.

    E-print Network

    Pala, Nezih

    Flexible dye-sensitized solar cells with ZnO nanoparticles grown by Sonochemistry over Graphene and Engineering University of North Texas, Denton, Texas Flexible Dye sensitized solar cells (FDSSCs) are light characteristics of ZnO nanostructures over Graphene/PET as photoanode for flexible dye sensitized solar cells. #12;

  19. Assessing individual radial junction solar cells over millions on VLS-grown silicon nanowires.

    PubMed

    Yu, Linwei; Rigutti, Lorenzo; Tchernycheva, Maria; Misra, Soumyadeep; Foldyna, Martin; Picardi, Gennaro; Roca i Cabarrocas, Pere

    2013-07-12

    Silicon nanowires (SiNWs) grown on low-cost substrates provide an ideal framework for the monolithic fabrication of radial junction photovoltaics. However, the quality of junction formation over a random matrix of SiNWs, fabricated via a vapor-liquid-solid (VLS) mechanism, has never been assessed in a realistic context. To address this, we probe the current response of individual radial junction solar cells under electron-beam and optical-beam excitations. Excellent current generation from the radial junction units, compared to their planar counterparts, has been recorded, indicating a high junction quality and effective doping in the ultra-thin SiNWs with diameters thinner than 20 nm. Interestingly, we found that the formation of radial junctions by plasma deposition can be quite robust against geometrical disorder and even the crossings of neighboring cell units. These results provide a strong support to the feasibility of building high-quality radial junction solar cells over high-throughput VLS-grown SiNWs on low-cost substrates. PMID:23764545

  20. Ethical analyses of vaccines grown in human cell strains derived from abortion: arguments and Internet search.

    PubMed

    Zimmerman, Richard Kent

    2004-10-22

    The fact that certain vaccines are grown in cell strains derived decades ago from an aborted fetus is a concern for some. To understand such concerns, a standardized search identified internet sites discussing vaccines and abortion. Ethical concerns raised include autonomy, conscience, coherence, and immoral material complicity. Two strategies to analyse moral complicity show that vaccination is ethical: the abortions were past events separated in time, agency, and purpose from vaccine production. Rubella disease during pregnancy results in many miscarriages and malformations. Altruism, the burden of rubella disease, and protection by herd immunity argue for widespread vaccination although autonomous decisions and personal conscience should be respected. PMID:15474714

  1. Resistance of Lung Cancer Cells Grown as Multicellular Tumour Spheroids to Zinc Sulfophthalocyanine Photosensitization

    PubMed Central

    Manoto, Sello Lebohang; Houreld, Nicolette Nadene; Abrahamse, Heidi

    2015-01-01

    Photodynamic therapy (PDT) is phototherapeutic modality used in the treatment of neoplastic and non-neoplastic diseases. The photochemical interaction of light, photosensitizer (PS) and molecular oxygen produces singlet oxygen which induces cell death. Zinc sulfophthalocyanine (ZnPcSmix) has been shown to be effective in A549 monolayers, multicellular tumor spheroids (MCTSs) (250 µm) and not on MCTSs with a size of 500 µm. A549 cells used in this study were grown as MCTSs to a size of 500 µm in order to determine their susceptibility to PDT. ZnPcSmix distribution in MCTSs and nuclear morphology was determined using a fluorescent microscope. Changes in cellular responses were evaluated using cell morphology, viability, proliferation, cytotoxicity, cell death analysis and mitochondrial membrane potential. Untreated MCTSs, showed no changes in cellular morphology, proliferation, cytotoxicity and nuclear morphology. Photoactivated ZnPcSmix also showed no changes in cellular morphology and nuclear morphology. However, photoactivated ZnPcSmix resulted in a significant dose dependant decrease in viability and proliferation as well as an increase in cell membrane damage in MCTSs over time. ZnPcSmix photosensitization induces apoptotic cell death in MCTSs with a size of 500 µm and more resistantance when compared to monolayer cells and MCTSs with a size of 250 µm. PMID:25950764

  2. Enterotoxin production by Vibrio cholerae and Vibrio mimicus grown in continuous culture with microbial cell recycle.

    PubMed Central

    Spira, W M; Fedorka-Cray, P J

    1983-01-01

    We have examined the effect of complete cell recycle on the production of cholera toxin (CT) by Vibrio cholerae and CT-like toxin by Vibrio mimicus in continuous culture fermentations. Complete cell recycle was obtained by filtering culture fluids through Amicon hollow fibers with an exclusion limit of 100,000 daltons (H1P100-20) and returning the concentrated cell slurry to the fermentor. A single 1-liter laboratory fermentor system modified with this recycle loop was capable of producing over 20 liters of cell-free culture filtrate per day. Toxin production in this system was compared with yields obtained in traditional continuous cultures and in shake flask cultures. Yields of CT from V. cholerae 569B in the recycle fermentor were highest at the highest dilution rate employed (1.0 vol/vol per h). The use of complete cell recycle dramatically increased yields over those obtained in continuous culture and equaled those obtained in shake flasks. The concentration of CT in the filtrate was slightly less than half of that measured in culture fluids sampled at the same time. Similarly, V. mimicus 61892 grown in the presence of 50 micrograms of lincomycin per ml produced 280 ng of CT per ml in the recycle fermentor, compared with 210 ng/ml in shake flasks under optimal conditions. The sterile filtrate from this fermentation contained 110 ng/ml. PMID:6357081

  3. Thin base-layer single crystal silicon solar cells with ECR plasma CVD grown emitters

    NASA Astrophysics Data System (ADS)

    Wang, L.; Reehal, H. S.

    2001-08-01

    Thin (~16 µm) base-layer monocrystalline silicon solar cells have been investigated with microcrystalline or epitaxial n-type emitters grown at low temperatures ({<}550 °C) by electron cyclotron resonance (ECR) plasma-enhanced chemical vapour deposition (PECVD). The p-type, 1-2 ?cm, base layers were epitaxially deposited by conventional thermal CVD onto monocrystalline Si p+ substrates. An efficiency of 13.72% was achieved in the best epitaxial emitter cell after ECR hydrogen passivation and the application of a SiNx anti-reflection coating deposited by ECR PECVD. Cells with microcrystalline Si emitters processed in a similar fashion gave a maximum efficiency of 10.73%. The cell performance was analysed using the two-diode model and the solar cell modelling programme PC-1D. The results are presented. It was necessary to invoke a three-layer PC-1D model to obtain self-consistent fits to the light and dark I-V characteristics and spectral response data.

  4. Xylem Development and Cell Wall Changes of Soybean Seedlings Grown in Space

    PubMed Central

    de Micco, Veronica; Aronne, Giovanna; Joseleau, Jean-Paul; Ruel, Katia

    2008-01-01

    Background and Aims Plants growing in altered gravity conditions encounter changes in vascular development and cell wall deposition. The aim of this study was to investigate xylem anatomy and arrangement of cellulose microfibrils in vessel walls of different organs of soybean seedlings grown in Space. Methods Seeds germinated and seedlings grew for 5 d in Space during the Foton-M2 mission. The environmental conditions, other than gravity, of the ground control repeated those experienced in orbit. The seedlings developed in space were compared with those of the control test on the basis of numerous anatomical and ultrastructural parameters such as number of veins, size and shape of vessel lumens, thickness of cell walls and deposition of cellulose microfibrils. Key Results Observations made with light, fluorescence and transmission electron microscopy, together with the quantification of the structural features through digital image analysis, showed that the alterations due to microgravity do not occur at the same level in the various organs of soybean seedlings. The modifications induced by microgravity or by the indirect effect of space-flight conditions, became conspicuous only in developing vessels at the ultrastructural level. The results suggested that the orientation of microfibrils and their assembly in developing vessels are perturbed by microgravity at the beginning of wall deposition, while they are still able to orient and arrange in thicker and ordered structures at later stages of secondary wall deposition. Conclusions The process of proper cell-wall building, although not prevented, is perturbed in Space at the early stage of development. This would explain the almost unaltered anatomy of mature structures, accompanied by a slower growth observed in seedlings grown in Space than on Earth. PMID:18252765

  5. Spheroid Formation and Enhanced Cardiomyogenic Potential of Adipose-Derived Stem Cells Grown on Chitosan

    PubMed Central

    Liu, Bing-Hsien; Yeh, Hsi-Yi; Lin, Yu-Chun; Wang, Min-Hsiung; Chen, David C.; Lee, Bo-Hua

    2013-01-01

    Abstract Mesenchymal stem cells may differentiate into cardiomyocytes and participate in local tissue repair after heart injury. In the current study, rat adipose-derived adult stem cells (ASCs) grown on chitosan membranes were observed to form cell spheroids after 3 days. The cell seeding density and surface modification of chitosan with Arg-Gly-Asp–containing peptide had an influence on the sizes of ASC spheroids. In the absence of induction, these spheroids showed an increased level of cardiac marker gene expression (Gata4, Nkx2-5, Myh6, and Tnnt2) more than 20-fold versus cells on the tissue culture polystyrene (TCPS) dish. Induction by 5-azacytidine or p38 MAP kinase inhibitor (SB202190) did not further increase the cardiac marker gene expression of these spheroids. Moreover, the enhanced cardiomyogenic potential of the spheroids was highly associated with the chitosan substrates. When ASC spheroids were plated onto TCPS with either basal or cardiac induction medium for 9 days, the spheroids spread into a monolayer and the positive effect on cardiomyogenic marker gene expression disappeared. The possible role of calcium ion and the up-regulation of adhesion molecule P-selectin and chemokine receptor Cxcr4 were demonstrated in ASC spheroids. Applying these spheroids to the chronic myocardial infarction animal model showed better functional recovery versus single cells after 12 weeks. Taken together, this study suggested that the ASC spheroids on chitosan may form as a result of calcium ion signaling, and the transplantation of these spheroids may offer a simple method to enhance the efficiency of stem cell–based therapy in myocardial infarction. PMID:23514754

  6. GaSb Thermophotovoltaic Cells Grown on GaAs Substrate Using the Interfacial Misfit Array Method

    NASA Astrophysics Data System (ADS)

    DeMeo, Dante; Shemelya, Corey; Downs, Chandler; Licht, Abigail; Magden, Emir Salih; Rotter, Tom; Dhital, Chetan; Wilson, Stephen; Balakrishnan, Ganesh; Vandervelde, Thomas E.

    2014-04-01

    We present gallium antimonide (GaSb) p-i- n photodiodes for use as thermophotovoltaic (TPV) cells grown on gallium arsenide (100) substrates using the interfacial misfit array method. Devices were grown using molecular beam epitaxy and fabricated using standard microfabrication processes. X-ray diffraction was used to measure the strain, and current-voltage ( I- V) tests were performed to determine the photovoltaic properties of the TPV cells. Energy generation at low efficiencies was achieved, and device performance was critically analyzed.

  7. Properties of ZnO thin films for solar cells grown by chemical bath deposition

    SciTech Connect

    Ortega-Lopez, M.; Morales-Acevedo, A. [Centro de Investigacion y de Estudios Avanzados del IPN (Mexico). Electrical Engineering Dept.

    1997-12-31

    Thin Films of ZnO were deposited by Chemical Bath Deposition. The as grown films are amorphous or polycrystalline depending upon the chemical composition of the aqueous solution and the temperature used for their deposition. After a thermal annealing at temperatures above 300 C the films undergo a chemical phase transformation becoming ZnO. The films before and after the annealings show a bandgap around 4.2 eV and 3.3 eV, respectively. The ZnO films were used to make solar cells on CuInS{sub 2} prepared by chemical spray pyrolysis. Under AM 1.5 illumination, these devices show a short circuit current of the order of 10 mA/cm{sup 2}, an open circuit voltage of 350 mV and efficiency close to 2.2%.

  8. Comparison of SEM processing methods for cultured human lens epithelial cells grown on flat and microcarrier bead substrates.

    PubMed

    Cantu-Crouch, D; Howe, W E; McCartney, M D

    1995-04-01

    The increasing importance of in vitro models has presented new challenges in SEM processing techniques. The present study has evaluated the quality of preservation of cultured human lens epithelial cells processed by critical point, Peldri II, and tert-butyl alcohol drying. Specimens processed by critical point drying produced specimens with severe cracking of cell processes and microcracks across cell membrane surfaces. Peldri II and tert-butyl alcohol drying eliminated breakage of the filopodia and lamellipodia as well as eliminating the microcracks across the apical membrane surface. The morphology of lens epithelial cells grown on Cytodex 3 beads appeared rounded with convoluted membrane surfaces. These morphological features were present for cells processed by all three methods. Cytodex 3 beads were subsequently shown to shrink 52% in diameter during dehydration, which results in an 89% reduction in volume for the bead. Cells grown on Biosilon beads, which do not shrink, had a morphology similar to the cells grown on a flat substrate. These results indicate that Peldri II and tert-butyl alcohol drying offer an attractive alternative to critical point drying when preparing cultured cells for SEM. Interpretation of cultured cell morphology must consider shrinkage of the substrate material as a possible contributor to artifact. PMID:7787240

  9. Carriers transport properties in GaInP solar cells grown by molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Dai, P.; Lu, S. L.; Arimochi, M.; Uchida, S.; Watanabe, T.; Luo, X. D.; Yang, H.

    2014-12-01

    The transport properties of carriers in GaInP solar cells grown by molecular beam epitaxy are investigated by temperature-dependent current-voltage (I-V) measurements. In contrast to GaInP/AlGaInP heterostructure, a long PL decay time is observed in GaInP/AlInP, which is ascribed to a lower interface recombination due to an improved carriers' confinement in the case of the high-energy barrier. However, the series resistance induced by the high potential barrier at GaInP/AlInP interface due to a big valence band offset prevents the improvement of solar cell's performance. An S-shape like I-V characteristic observed at low temperatures indicates that the transport of major carriers is limited by the barrier. A calculation based on the combination of a normal photovoltaic device with a barrier-affected thermal carriers transport explicitly explains this abnormal I-V characteristic. Our study demonstrates the critical role of the barrier-induced series resistance in the determination of solar cell's performance.

  10. Berry extracts exert different antiproliferative effects against cervical and colon cancer cells grown in vitro.

    PubMed

    McDougall, Gordon J; Ross, Heather A; Ikeji, Magnus; Stewart, Derek

    2008-05-14

    Polyphenol-rich berry extracts were screened for their antiproliferative effectiveness using human cervical cancer (HeLa) cells grown in microtiter plates. Rowan berry, raspberry, lingonberry, cloudberry, arctic bramble, and strawberry extracts were effective but blueberry, sea buckthorn, and pomegranate extracts were considerably less effective. The most effective extracts (strawberry > arctic bramble > cloudberry > lingonberry) gave EC 50 values in the range of 25-40 microg/(mL of phenols). These extracts were also effective against human colon cancer (CaCo-2) cells, which were generally more sensitive at low concentrations but conversely less sensitive at higher concentrations. The strawberry, cloudberry, arctic bramble, and the raspberry extracts share common polyphenol constituents, especially the ellagitannins, which have been shown to be effective antiproliferative agents. However, the components underlying the effectiveness of the lingonberry extracts are not known. The lingonberry extracts were fractionated into anthocyanin-rich and tannin-rich fractions by chromatography on Sephadex LH-20. The anthocyanin-rich fraction was considerably less effective than the original extract, whereas the antiproliferative activity was retained in the tannin-rich fraction. The polyphenolic composition of the lingonberry extract was assessed by liquid chromatography-mass spectrometry and was similar to previous reports. The tannin-rich fraction was almost entirely composed of procyanidins of linkage type A and B. Therefore, the antiproliferative activity of lingonberry was caused predominantly by procyanidins. PMID:18412361

  11. Targeting FAK Radiosensitizes 3-Dimensional Grown Human HNSCC Cells Through Reduced Akt1 and MEK1/2 Signaling

    SciTech Connect

    Hehlgans, Stephanie [OncoRay-National Center for Radiation Research in Oncology, Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden (Germany) [OncoRay-National Center for Radiation Research in Oncology, Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden (Germany); Department of Radiotherapy and Oncology, University of Frankfurt, Frankfurt am Main (Germany); Institute of Radiopharmacy, Helmholtz Center Dresden-Rossendorf, Dresden (Germany); Eke, Iris [OncoRay-National Center for Radiation Research in Oncology, Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden (Germany)] [OncoRay-National Center for Radiation Research in Oncology, Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden (Germany); Cordes, Nils, E-mail: Nils.Cordes@OncoRay.de [OncoRay-National Center for Radiation Research in Oncology, Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden (Germany) [OncoRay-National Center for Radiation Research in Oncology, Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden (Germany); Institute of Radiopharmacy, Helmholtz Center Dresden-Rossendorf, Dresden (Germany); Department of Radiation Oncology, University Hospital and Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden (Germany)

    2012-08-01

    Purpose: Focal adhesion kinase (FAK), a main regulator of integrin signaling and cell migration, is frequently overexpressed and hyperphosphorylated in human head-and-neck squamous cell carcinoma (HNSCC). We have previously shown that pharmacologic FAK inhibition leads to radiosensitization of 3-dimensionally grown HNSCC cell lines. To further evaluate the role of FAK in radioresistance and as a potential cancer target, we examined FAK and FAK downstream signaling in HNSCC cell lines grown in more physiologic extracellular matrix-based 3-dimensional cell cultures. Methods and Materials: Seven HNSCC cell lines were grown in 3-dimensional extracellular matrix and the clonogenic radiation survival, expression, and phosphorylation of FAK, paxillin, Akt1, extracellular signal-regulated kinase (ERK)1/2, and MEK1/2 were analyzed after siRNA-mediated knockdown of FAK, Akt1, MEK1, FAK+Akt1, or FAK+MEK1 compared with controls or stable overexpression of FAK. The role of MEK1/2 for clonogenic survival and signaling was investigated using the MEK inhibitor U0126 with or without irradiation. Results: FAK knockdown moderately or significantly enhanced the cellular radiosensitivity of 3-dimensionally grown HNSCC cells. The FAK downstream targets paxillin, Akt1, and ERK1/2 were substantially dephosphorylated under FAK depletion. FAK overexpression, in contrast, increased radiation survival and paxillin, Akt1, and ERK1/2 phosphorylation. The degree of radiosensitization upon Akt1, ERK1/2, or MEK1 depletion or U0126 was superimposable to FAK knockdown. Combination knockdown conditions (ie, Akt1/FAK, MEK1/FAK, or U0126/FAK) failed to provide additional radiosensitization. Conclusions: Our data provide further evidence for FAK as important determinant of radiation survival, which acts in the same signaling axis as Akt1 and ERK1/2. These data strongly support our hypothesis that FAK is a relevant molecular target for HNSCC radiotherapy.

  12. Efficient hydrogen photoproduction by synchronously grown cells of a marine cyanobacterium, Synechococcus sp. Miami BG 043511, under high cell density conditions

    Microsoft Academic Search

    Shuzo Kumazawa; Akira Mitsui

    1994-01-01

    The capability of hydrogen photoproduction under high cell density conditions was examined using synchronously grown cells of nitrogen-fixing Synechococcus sp. Miami BG 043511. Optimum hydrogen yield was obtained when vessels contained 0.2 to 0.3 mg chlorophyll a in 3-mL cell suspension. During a 24-h incubation period, an initial phase of hydrogen and carbon dioxide production and a subsequent phase of

  13. Salicylic acid induces apoptosis in colon carcinoma cells grown in-vitro: Influence of oxygen and salicylic acid concentration

    SciTech Connect

    Zitta, Karina; Meybohm, Patrick; Bein, Berthold; Huang, Ying; Heinrich, Christin; Scholz, Jens; Steinfath, Markus; Albrecht, Martin, E-mail: Albrecht@anaesthesie.uni-kiel.de

    2012-04-15

    In solid tumors the hypoxic environment can promote tumor progression and resistance to therapy. Recently, acetylsalicylic acid a major component of analgesic drugs and its metabolite salicylic acid (SA) have been shown to reduce the risk of colon cancer, but the mechanisms of action remain still unclear. Here we elucidate the effects of physiologically relevant concentrations of SA on colon carcinoma cells (CaCo-2) grown under normoxic and hypoxic conditions. Western blotting, caspase-3/7 apoptosis assays, MTS cell-proliferation assays, LDH cytotoxicity assays and hydrogen peroxide measurements were performed to investigate the effects of 1 and 10 {mu}M SA on CaCo-2 cells grown under normoxic conditions and cells exposed to hypoxia. Under normoxic conditions, SA did not influence cell proliferation or LDH release of CaCo-2 cells. However, caspase-3/7 activity was significantly increased. Under hypoxia, cell proliferation was reduced and LDH release and caspase-3/7 activities were increased. None of these parameters was altered by the addition of SA under hypoxic conditions. Hypoxia increased hydrogen peroxide concentrations 300-fold and SA significantly augmented the release of hydrogen peroxide under normoxic, but not under hypoxic conditions. Phosphorylation of the pro-survival kinases akt and erk1/2 was not changed by SA under hypoxic conditions, whereas under normoxia SA reduced phosphorylation of erk1/2 after 2 hours. We conclude that in colon carcinoma cells effects of SA on apoptosis and cellular signaling are dependent on the availability of oxygen. -- Highlights: Black-Right-Pointing-Pointer Effects of salicylic acid on colon carcinoma cells grown under normoxic and hypoxic conditions Black-Right-Pointing-Pointer Salicylic acid increases caspase-3/7 activity and hydrogen peroxide release under normoxia Black-Right-Pointing-Pointer Salicylic acid decreases pro-survival erk-1/2 phosphorylation under normoxia Black-Right-Pointing-Pointer Salicylic acid does not influence any of the investigated parameters under hypoxia.

  14. Selectively-grown InGaP/GaAs on silicon heterostructures for application to photovoltaic photoelectrolysis cells

    NASA Astrophysics Data System (ADS)

    Mauk, Michael G.; Tata, Anthony N.; Feyock, Bryan W.

    2001-05-01

    Photovoltaic-photoelectrochemical (PV-PEC) cells based on InGaP/GaAs show excellent prospects for efficient production of hydrogen by electrolysis of water using solar energy. We describe a combined close-spaced vapor transport (CSVT)/liquid-phase epitaxy (LPE) process to produce arrays of selectively-grown mesas of InGaP/GaAs on silicon substrates. Unlike other semiconductor devices, the PV-PEC cell is well suited for such selectively-grown, discontinuous heteroepitaxial films. Thus, this device application affords exploiting the potential advantages of selective epitaxy, namely, the substantial reduction of stress and defects caused by thermal expansion and lattice mismatch between the silicon substrate and III-V epilayers.

  15. Properties of polycrystalline GaAs films grown on CMG coverglass for space solar cell application

    Microsoft Academic Search

    Kenji Ogayu; Mitsuru Imaizumi; Tetsuo Soga; Takashi Jimbo; Masayoshi Umeno

    2002-01-01

    Polycrystalline GaAs films have been grown on Pilkington CMG cover-glass as a substrate at relatively low temperature by MOCVD. The substrate temperature (Ts) was varied from 450°C to 550°C, while other conditions were kept constant. Preferential orientation and grain size of the films grown at ?500°C are proved to be [111] and 0.5-1.0?m by XRD and AFM, respectively. Both of

  16. Cu(In,Ga)Se 2 thin-film solar cells grown with cracked selenium

    Microsoft Academic Search

    Masahiro Kawamura; Toshiyuki Fujita; Akira Yamada; Makoto Konagai

    2009-01-01

    Cu(In1?xGax)Se2 (CIGS) films have been grown by using cracked selenium. In conventional evaporation system, the Se atoms were supplied as large clusters (Sex, x>5). However, the size of clusters can be reduced by the thermal cracking. The film qualities grown with small clusters (Sex, x<4) would be improved, since the smaller size molecules easily react with elemental metals, resulting in

  17. Epitaxial Crystal Silicon Absorber Layers and Solar Cells Grown at 1.8 Microns per Minute: Preprint

    SciTech Connect

    Bobela, D. C.; Teplin, C. W.; Young, D. L.; Branz, H. M.; Stradins, P.

    2011-07-01

    We have grown device-quality epitaxial silicon thin films at growth rates up to 1.8 ?m/min, using hot-wire chemical vapor deposition from silane at substrate temperatures below 750 degrees C. At these rates, which are more than 30 times faster than those used by the amorphous and nanocrystalline Si industry, capital costs for large-scale solar cell production would be dramatically reduced, even for cell absorber layers up to 10 ?m thick. We achieved high growth rates by optimizing the three key parameters: silane flow, depletion, and filament geometry, based on our model developed earlier. Hydrogen coverage of the filament surface likely limits silane decomposition and growth rate at high system pressures. No considerable deterioration in PV device performance is observed when grown at high rate, provided that the epitaxial growth is initiated at low rate. A simple mesa device structure (wafer/epi Si/a-Si(i)/a-Si:H(p)/ITO) with a 2.3 um epitaxial silicon absorber layer was grown at 700 nm/min. The finished device had an open-circuit voltage of 0.424 V without hydrogenation treatment.

  18. [The accumulation and degradation dynamics of cyanophycin in cyanobacteria grown in symbiotic associations with plant tissues and cells].

    PubMed

    Gorelova, O A; Kle?menov, S Iu

    2003-01-01

    Five different artificial associations of cyanobacterial cells with the cells or tissues of nightshade and rauwolfia were studied. The associations grown on nitrogen-containing media produced heterocysts. Cyanobacterial cells in the associations retained their ability to take up bound nitrogen from the medium, to store it in the form of cyanophycin granules, and to use them in the process of symbiotic growth. The synthesis and degradation of cyanophycin granules in cyanobacterial cells were more active in the associations than in monocultures. In the symbiotic associations of Chlorogloeopsis fritschii ATCC 27193 with Solanum laciniatum cells and of Nostoc muscorum CALU 304 with the Rauwolfia serpentina callus, heterocysts were produced at 3- to 30-fold higher cyanophycin contents than in cyanobacterial monocultures. In contrast, in the association of N. muscorum CALU 304 with the Solanum dulcamara callus, heterocysts were produced at lower cyanophycin contents than in the N. muscorum CALU 304 monoculture. The degradation of cyanophycin granules in N. muscorum CALU 304 cells grown in associations with plant tissues or cells was subjected to mathematical analysis. The activation of cyanophycin degradation and heterocyst production in the associations N. muscorum CALU 304-R. serpentina and C. fritschii-S. laciniatum was accompanied by an enhanced synthesis of the nitrogen-containing alkaloids in plant cells. The data obtained suggest that an integrated system of nitrogen homeostasis can be formed in symbiotic associations. Depending on the growth stage of an association, its plant member can either stimulate the accumulation of bound nitrogen in vegetative cyanobacterial cells in the form of cyanophycin granules, or activate their degradation, or initiate the formation of heterocysts independently of the cyanobacterial sensory-signalling system. PMID:12901011

  19. 75 FR 65581 - Proposed Amendment and Revocation of Class E Airspace, Vero Beach, FL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-26

    ...Proposed Amendment and Revocation of Class E Airspace, Vero Beach, FL AGENCY: Federal...SUMMARY: This action proposes to amend Class E surface airspace, and airspace extending...feet above the surface, and remove Class E airspace designated as an extension to...

  20. 2.0–2.1 eV GaxIn1?xP solar cells grown on relaxed GaAsP step grades

    Microsoft Academic Search

    Myles A. Steiner; Ryan M. France; Mark W. Wanlass; John F. Geisz; Waldo J. Olavarria; Jeffrey J. Carapella; Anna Duda; Manuel J. Romero; Carl R. Osterwald; Paul Ciszek; Darius Kuciauskas

    2010-01-01

    A high quality solar cell with a bandgap in the range of 2.0-2.1 eV may enable the development of four- and five-junction solar cells for terrestrial and space applications. In this paper we describe a set of 2.0-2.1 eV nVp solar cells fabricated from Gaxln1-xP and grown on compositional step-grades of GaAs1-yPy, on GaAs substrates. Cells were grown by atmospheric

  1. Pemetrexed alters folate phenotype and inflammatory profile in EA.hy 926 cells grown under low-folate conditions.

    PubMed

    Hammons, Andrea L; Summers, Carolyn M; Jochems, Jeanine; Arora, Jasbir S; Zhang, Suhong; Blair, Ian A; Whitehead, Alexander S

    2012-12-01

    Elevated homocysteine is a risk marker for several major human pathologies. Emerging evidence suggests that perturbations of folate/homocysteine metabolism can directly modify production of inflammatory mediators. Pemetrexed acts by inhibiting thymidylate synthetase (TYMS), dihydrofolate reductase (DHFR), and glycinamide ribonucleotide formyltransferase (GARFT). EA.hy 926 cells grown under low ("Lo") and high ("Hi") folate conditions were treated with pemetrexed. The concentrations of several intracellular folate derivatives were measured using LC-MRM/MS. Lo cells had lower total folate concentrations and a different distribution of the intracellular folate derivatives than Hi cells. Treatment with pemetrexed caused a decrease in individual folate analytes. Microarray analysis showed that several genes were significantly up or down-regulated in pemetrexed treated Lo cells. Several of the significantly up-regulated transcripts were inflammatory. Changes in transcript levels of selected targets, including C3, IL-8, and DHFR, were confirmed by quantitative RT-PCR. C3 and IL-8 transcript levels were increased in pemetrexed-treated Lo cells relative to Lo controls; DHFR transcript levels were decreased. In Lo cells, IL-8 and C3 protein concentrations were increased following pemetrexed treatment. Pemetrexed drug treatment was shown in this study to have effects that lead to an increase in pro-inflammatory mediators in Lo cells. No such changes were observed in Hi cells, suggesting that pemetrexed could not modify the inflammatory profile in the context of cellular folate sufficiency. PMID:22975265

  2. Pemetrexed alters folate phenotype and inflammatory profile in EA.hy 926 cells grown under low-folate conditions

    PubMed Central

    Hammons, Andrea L.; Summers, Carolyn M.; Jochems, Jeanine; Arora, Jasbir S.; Zhang, Suhong; Blair, Ian A.; Whitehead, Alexander S.

    2014-01-01

    Elevated homocysteine is a risk marker for several major human pathologies. Emerging evidence suggests that perturbations of folate/homocysteine metabolism can directly modify production of inflammatory mediators. Pemetrexed acts by inhibiting thymidylate synthetase (TYMS), dihydrofolate reductase (DHFR), and glycinamide ribonucleotide formyltransferase (GARFT). EA.hy 926 cells grown under low (“Lo”) and high (“Hi”) folate conditions were treated with pemetrexed. The concentrations of several intracellular folate derivatives were measured using LC-MRM/MS. Lo cells had lower total folate concentrations and a different distribution of the intracellular folate derivatives than Hi cells. Treatment with pemetrexed caused a decrease in individual folate analytes. Microarray analysis showed that several genes were significantly up or down-regulated in pemetrexed treated Lo cells. Several of the significantly up-regulated transcripts were inflammatory. Changes in transcript levels of selected targets, including C3, IL-8, and DHFR, were confirmed by quantitative RT-PCR. C3 and IL-8 transcript levels were increased in pemetrexed-treated Lo cells relative to Lo controls; DHFR transcript levels were decreased. In Lo cells, IL-8 and C3 protein concentrations were increased following pemetrexed treatment. Pemetrexed drug treatment was shown in this study to have effects that lead to an increase in pro-inflammatory mediators in Lo cells. No such changes were observed in Hi cells, suggesting that pemetrexed could not modify the inflammatory profile in the context of cellular folate sufficiency. PMID:22975265

  3. Properties of ZnO thin films for solar cells grown by chemical bath deposition

    Microsoft Academic Search

    M. Ortega-Lopez; A. Morales-Acevedo

    1997-01-01

    Thin films of ZnO were deposited by chemical bath deposition. The “as grown” films are amorphous or polycrystalline depending upon the chemical composition of the aqueous solution and the temperature used for their deposition. After a thermal annealing at temperatures above 300°C, the films undergo a chemical phase transformation becoming ZnO. The films before and after the annealing show a

  4. The density of apical cells of dark-grown protonemata of the moss Ceratodon purpureus

    Microsoft Academic Search

    J. M. Schwuchow; V. D. Kern; T. Wagner; F. D. Sack

    2000-01-01

    Summary Determinations of plant or algal cell density (cell mass divided by volume) have rarely accounted for the extracellular matrix or shrinkage during isolation. Three techniques were used to indirectly estimate the density of intact apical cells from protonemata of the mossCeratodon purpureus. First, the volume fraction of each cell component was determined by stereology, and published values for component

  5. Role of Shiga/Vero toxins in pathogenesis

    PubMed Central

    Obata, Fumiko; Obrig, Tom

    2014-01-01

    Shiga toxin (Stx) is the primary cause of severe host responses including renal and central nervous system (CNS) disease in Shiga toxin-producing E. coli (STEC) infections. The interaction of Stx with different eukaryotic cell types is described. Host responses to Stx and bacterial lipopolysaccharide (LPS) are compared as related to the features of the STEC-associated Hemolytic Uremic Syndrome (HUS). Data derived from animal models of HUS and CNS disease, in vivo, and eukaryotic cells, in vitro, are evaluated in relation to HUS disease of humans. PMID:25530918

  6. Division of chloroplast nucleoids and replication of chloroplast DNA during the cell cycle of Dunaliella salina grown under blue and red light

    Microsoft Academic Search

    V. Zachleder; E. S. Kuptsova; D. A. Los; V. Cepfik; Š. Kubín; J. M. Shapizugov; V. E. Semenenko

    1989-01-01

    Summary Synchronous cultures of the algaDunaliella salina were grown in blue or red light. The relationships between replication of chloroplast DNA, cell size, cell age and the number of chloroplast nucleoids were studied. The replication of chloroplast DNA and the division of chloroplast nucleoids occurred in two separate periods of the chloroplast cycle. DNA replication was concomitant with that in

  7. The differentiation of follicular-like cells from the epithelium of Rathke's pouch grown in vitro.

    PubMed

    Frémont, P H; Ferrand, R

    1980-01-01

    The epithelial rudiment of 4 day-old quail embryo adenohypophysis, cultivated in vitro under conditions allowing glandular differentiation, displays peripheral cells that progressively acquire follicular cell features. They elongate, develop numerous microvilli, junctional complexes, interlocking membranes and bundles of microfilaments. These follicular-like cells derive from peripheral epithelial cells that, in situ, become glandular. These results show that follicular cells can develop from undifferentiated cells. They undergo this pathway of development, in all likelihood, as a result of perturbations in their microenvironment. PMID:7457922

  8. Characterization of normal human embryo cells grown to over 100 population doublings

    Microsoft Academic Search

    J. A. Poiley; R. F. Schuman; R. J. Pienta

    1978-01-01

    Summary  Normal human embryonic cells were subcultured for over 100 population doublings without modification of the basic medium.\\u000a The cells were evaluated for growth rate, confluent density, chromosome stability, growth in soft agar, ability to hydrolyze\\u000a casein and tumorigenicity. The cells possessed the characteristics of normal cells. The batch of serum used to supplement\\u000a the medium was found to be of

  9. Basal Cell Carcinomas Grown in Nude Mice Produce and Deposit Fibronectin in the Extracellular Matrix

    Microsoft Academic Search

    Ronald E. Grimwood; Charles F. Ferris; Larry D. Nielsen; J. Clark Huff; Richard A. F. Clark

    1986-01-01

    Epidermal cells in vitro produce and deposit fibronectin (FN) in the pericellular matrix. Such FN production by epidermal cells may be involved in vivo in wound reepithelialization, tissue morphogenesis, and growth of epithelial tumors. The purpose of this study was to examine whether the FN, previously shown to be within and surrounding human basal cell carcinoma (BCC) lobules, was in

  10. Phosgene effects on F-actin in cells grown from pulmonary tissues

    SciTech Connect

    Werrlein, R.J.; Madren-Whalley, J.; Kirby, S.D.

    1993-05-13

    Confocal laser microscopy has been used to study the effects of phosgene on cells of the lung. Results suggest that the F-actin cytoskeleton is a molecular target and sensitive indicator of phosgene toxicity. Ovine pulmonary artery endothelial cells, exposed at 0.145 to 5.39 x LCT(50) for sheep (3300 ppm.min) showed dose response decreases in F-actin content. Doses of 0.145 and 0.265 LCT(50) caused a significant (p < .01) 25% and 42% decrease in average F-actin per cell. Dense peripheral bands (DPBs) became indistinct at > or = 1.2 LCT(50) and disappeared at > or = 2.3 LCT(50). Organization of stress fibers was parallel to the cell's long axis and was not disrupted by < 1.21 LCT(50). In secretory cells from rat tracheal explants, studies indicate a threshold of resistance to phosgene at doses < 0.2 LCT(50). However, phosgene in excess of 0.2 LCT(50) produced precipitous decreases in secretory cell F-actin. Mature, contiguous populations of untreated secretory cells contained well defined DPBs and tightly connected cell-to-cell boundaries. Exposures to 1.0 and 1.5 LCT(50) did not disrupt boundaries between secretory cells but did cause separation of boundaries between secretory and other cell types. We conclude that concentration and organization are separate aspects of phosgene's effects on F-actin and that the lesions produced are cell-type specific.

  11. A low-cost method to test cytotoxic effects of Crotalus vegrandis (Serpentes: Viperidae) venom on kidney cell cultures.

    PubMed

    Girón, María E; Aguilar, Irma; Romero, Lisandro; Sánchez, Elda E; Pérez, John C; Rodriguez-Acosta, Alexis

    2005-01-01

    The pathogenesis of the renal lesion upon envenomation by snakebite has been related to myolysis, hemolysis, hypotension and/or direct venom nephrotoxicity caused by the venom. Both primary and continuous cell culture systems provide an in vitro alternative for quantitative evaluation of the toxicity of snake venoms. Crude Crotalus vegrandis venom was fractionated by molecular exclusion chromatography. The toxicity of C. vegrandis crude venom, hemorrhagic, and neurotoxic fractions were evaluated on mouse primary renal cells and a continuous cell line of Vero cells maintained in vitro. Cells were isolated from murine renal cortex and were grown in 96 well plates with Dulbecco's Modified Essential Medium (DMEM) and challenged with crude and venom fractions. The murine renal cortex cells exhibited epithelial morphology and the majority showed smooth muscle actin determined by immune-staining. The cytotoxicity was evaluated by the tetrazolium colorimetric method. Cell viability was less for crude venom, followed by the hemorrhagic and neurotoxic fractions with a CT50 of 4.93, 18.41 and 50.22 microg/mL, respectively. The Vero cell cultures seemed to be more sensitive with a CT50 of 2.9 and 1.4 microg/mL for crude venom and the hemorrhagic peak, respectively. The results of this study show the potential of using cell culture system to evaluate venom toxicity. PMID:16021288

  12. Effects of substrate conductivity on cell morphogenesis and proliferation using tailored, atomic layer deposition-grown ZnO thin films

    PubMed Central

    Choi, Won Jin; Jung, Jongjin; Lee, Sujin; Chung, Yoon Jang; Yang, Cheol-Soo; Lee, Young Kuk; Lee, You-Seop; Park, Joung Kyu; Ko, Hyuk Wan; Lee, Jeong-O

    2015-01-01

    We demonstrate that ZnO films grown by atomic layer deposition (ALD) can be employed as a substrate to explore the effects of electrical conductivity on cell adhesion, proliferation, and morphogenesis. ZnO substrates with precisely tunable electrical conductivity were fabricated on glass substrates using ALD deposition. The electrical conductivity of the film increased linearly with increasing duration of the ZnO deposition cycle (thickness), whereas other physical characteristics, such as surface energy and roughness, tended to saturate at a certain value. Differences in conductivity dramatically affected the behavior of SF295 glioblastoma cells grown on ZnO films, with high conductivity (thick) ZnO films causing growth arrest and producing SF295 cell morphologies distinct from those cultured on insulating substrates. Based on simple electrostatic calculations, we propose that cells grown on highly conductive substrates may strongly adhere to the substrate without focal-adhesion complex formation, owing to the enhanced electrostatic interaction between cells and the substrate. Thus, the inactivation of focal adhesions leads to cell proliferation arrest. Taken together, the work presented here confirms that substrates with high conductivity disturb the cell-substrate interaction, producing cascading effects on cellular morphogenesis and disrupting proliferation, and suggests that ALD-grown ZnO offers a single-variable method for uniquely tailoring conductivity. PMID:25897486

  13. Enzymatic Detachment of Therapeutic Mesenchymal Stromal Cells Grown on Glass Carriers in a Bioreactor

    PubMed Central

    Salzig, Denise; Schmiermund, Alexandra; P. Grace, Pablo; Elseberg, Christiane; Weber, Christian; Czermak, Peter

    2013-01-01

    Cell therapies require the in vitro expansion of adherent cells such as mesenchymal stromal cells (hMSCs) in bioreactor systems or other culture environments, followed by cell harvest. As hMSCs are strictly adherent cells, cell harvest requires cell detachment. The use of hMSCs for cell therapy requires GMP production in accordance with the guidelines for advanced therapeutic medical products. Therefore, several GMP-conform available proteolytic enzymes were investigated for their ability to promote hMSC detachment. An allogeneic hMSC cell line (hMSC-TERT) that is used in clinical trials in the form of alginate cell capsules was chosen as a model. This study investigated the influence of several factors on the outcome of proteolytic hMSC-TERT detachment. Therefore, hMSC-TERT detachment was analyzed in different cultivation systems (static, dynamic) and in combination with further cell processing including encapsulation. Only two of the commercially available enzymes (AccutaseTM, TrypZeanTM) that fulfill all process requirements (commercial availability, cost, GMP conditions during manufacturing and non-animal origin) are found to be generally suitable for detaching hMSC-TERT. Combining cell detachment with encapsulation demonstrated a high impact of the experimental set up on cell damage. It was preferable to reduce the temperature during detachment and limit the detachment time to a maximum of 20 minutes. Cell detachment in static systems was not comparable with detachment in dynamic systems. Detachment yields in dynamic systems were lower and cell damage was higher for the same experimental conditions. Finally, only TrypZeanTM seemed to be suitable for the detachment of hMSC-TERT from dynamic reactor systems. PMID:24478807

  14. Thyrotropin dependent and independent thyroid cell lines selected from FRTL-5 derived tumors grown in nude mice

    SciTech Connect

    Ossendorp, F.A.; Bruning, P.F.; Schuuring, E.M.; Van Den Brink, J.A.; van der Heide, D.; De Vijlder, J.J.; De Bruin, T.W. (Netherlands Cancer Institute, Amsterdam (Netherlands))

    1990-07-01

    FRTL-5 cells were used to set up a thyroid tumor model system in C3H nu/nu mice. FRTL-5 tumors could be grown in nude mice provided serum TSH levels were elevated. Persistent TSH elevation was obtained by administration of Na131I, rendering the mice hypothyroid. After 4 weeks FRTL-5 cells were injected sc resulting in tumor growth within 2 weeks in eight out of eight mice. Although the tumors showed an apparently undifferentiated histology, lacking normal follicular structures, they were functional since the tumors were capable of concentrating (131)iodine, as demonstrated by nuclear imaging. From one of the tumors a new cell line was isolated (FRTL-5/T) that, like the parental FRTL-5 cell line, was TSH dependent for growth. In a control group of six euthyroid nude mice FRTL-5 tumor growth could not be obtained with one exception. After 3 months one animal developed a small tumor that grew rapidly thereafter. This tumor was easily transplantable in other euthyroid nude mice, showed an undifferentiated histology, and was nonfunctional, as it could not concentrate (131)iodine. From this tumor two cell lines were derived: one cultured in the presence of TSH (FRTL-5/TP) and one in the absence of TSH (FRTL-5/TA). The cell lines were analyzed for TSH responsive functions and TSH receptor expression. Responsiveness to TSH in FRTL-5/T and the parental FRTL-5 cell line were similar for most thyroid specific functions tested. However, FRTL-5/T was less sensitive than FRTL-5 for TSH induced (3H)thymidine incorporation. Both cell lines had two classes of TSH binding sites with high and low affinity respectively. FRTL-5/TP and FRTL-5/TA were both able to grow in TSH free medium and were nonresponsive to TSH in vitro, as tested for (3H)thymidine and (3H)uridine incorporation, iodine uptake, thyroglobulin iodination, and thyroglobulin secretion.

  15. Positioning effects on quantum dot solar cells grown by molecular beam epitaxy

    SciTech Connect

    Zhou, D.; Sharma, G.; Fimland, B. O. [Department of Electronics and Telecommunications, Norwegian University of Science and Technology (NTNU), NO-7491 Trondheim (Norway); Vullum, P. E.; Thomassen, S. F.; Holmestad, R.; Reenaas, T. W. [Department of Physics, Norwegian University of Science and Technology (NTNU), NO-7491 Trondheim (Norway)

    2010-02-22

    We report current-voltage and spectral response characteristics of high density InAs/GaAs quantum dot (QD) solar cells with different positions where dots are located. The short circuit current density (J{sub sc}), open circuit voltage (V{sub oc}), and external quantum efficiency of these cells under air mass 1.5 are presented and compared with a GaAs reference cell. An extended photoresponse in contrast to the GaAs reference cell was confirmed for all these cells. The effect of inserting QD layers into emitter and base region on device performance is shown. The J{sub sc} is reduced, while the V{sub oc} is maintained. The cell with QDs located toward the base side shows better performance, confirmed by both current-voltage and spectral response measurements.

  16. Xylose and Glucose Utilization by Bacteroides xylanolyticus X5-1 Cells Grown in Batch and Continuous Culture

    PubMed Central

    Biesterveld, Steef; Oude Elferink, Stefanie J. W. H.; Zehnder, Alexander J. B.; Stams, Alfons J. M.

    1994-01-01

    During cultivation on a mixture of xylose and glucose, Bacteroides xylanolyticus X5-1 showed neither diauxic growth nor a substrate preference. Xylose-limited continuous-culture cells were able to consume xylose and glucose both as single substrates and as mixed substrates without any lag phase. When glucose was the growth-limiting substrate, the microorganism was unable to consume xylose. However, in the presence of a small amount of glucose or pyruvate, xylose was utilized after a short lag phase. In glucose-limited cells, xylose isomerase was present at low activity but xylulose kinase activity could not be detected. On addition of a mixture of xylose and glucose, xylose isomerase was induced immediately and xylulose kinase was induced after about 30 min. The induction of the two enzymes was sensitive to chloramphenicol, showing de novo synthesis. Xylose uptake in glucose-grown cells was very low, but the uptake rate could be increased when incubated with a xylose-glucose mixture. The increase in the uptake rate was not affected by chloramphenicol, indicating that a constitutive uptake system had to be activated. The inability of B. xylanolyticus X5-1 cells undergoing glucose-limited continuous culture to induce the xylose catabolic pathway after the addition of only xylose probably was caused by energy limitation. PMID:16349187

  17. An Easy-To-Handle Microfluidic Device Suitable for Immunohistochemical Procedures in Mammalian Cells Grown Under Flow Conditions

    PubMed Central

    Fede, C.; Fortunati, I.; Petrelli, L.; Guidolin, D.; De Caro, R.; Ferrante, C.; Albertin, G.

    2014-01-01

    Microfluidics, the technology that manipulates small amount of fluids in microscale complex devices, has undergone a remarkable development during the last decade, by targeting a significant range of applications, including biological tests and single-cell analysis, and by displaying many advantages such as reduced reagent consumption, decreased costs and faster analysis. Furthermore, the introduction of microfluidic tools has revolutionized the study of vascular functions, because the controlled three-dimensional environment and the continuous perfusion provided by the microdevice allow simulating the physiological characteristics of the circulatory system. Researchers interested in the study of vascular physiology, however, are often hampered by the difficulty in handling reduced number of cells after growth in these devices. This work shows how to apply different protocols commonly used in biology, such as the immunofluorescence technique, to cells grown in reversibly-bound microfluidic devices, obtaining results comparable to those retrieved under static conditions in multiwells. In this way, we are able to combine the advantages of microfluidic, i.e., application of continuous flow and shear stress, with classical protocols for the study of endothelial cells. PMID:24998924

  18. The density of apical cells of dark-grown protonemata of the moss Ceratodon purpureus.

    PubMed

    Schwuchow, J M; Kern, V D; Wagner, T; Sack, F D

    2000-01-01

    Determinations of plant or algal cell density (cell mass divided by volume) have rarely accounted for the extracellular matrix or shrinkage during isolation. Three techniques were used to indirectly estimate the density of intact apical cells from protonemata of the moss Ceratodon purpureus. First, the volume fraction of each cell component was determined by stereology, and published values for component density were used to extrapolate to the entire cell. Second, protonemal tips were immersed in bovine serum albumin solutions of different densities, and then the equilibrium density was corrected for the mass of the cell wall. Third, apical cell protoplasts were centrifuged in low-osmolarity gradients, and values were corrected for shrinkage during protoplast isolation. Values from centrifugation (1.004 to 1.015 g/cm3) were considerably lower than from other methods (1.046 to 1.085 g/cm3). This work appears to provide the first corrected estimates of the density of any plant cell. It also documents a method for the isolation of protoplasts specifically from apical cells of protonemal filaments. PMID:11543390

  19. DMEM. H1299 cells were a gift from J. Chen and were grown in RPMI. All transfections were carried out using Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen) or

    E-print Network

    Babu, M. Madan

    DMEM. H1299 cells were a gift from J. Chen and were grown in RPMI. All transfections were carried) of pCMV­Flag­COP1 or pCMV­Flag­COP1DRING and treated with 50 mM ALLN for 6 h before cell collection where indicated. For reporter assays, Saos-2 or H1299 cells were transiently transfected with 150 ng

  20. Effects of thiourea concentration on CdS thin films grown by chemical bath deposition for CdTe solar cells

    Microsoft Academic Search

    R. Mendozaperez; G. Santanarodriguez; J. Sastrehernandez; A. Moralesacevedo; A. Ariascarbajal; O. Vigilgalan; J. C. Alonso; G. Contreraspuente

    2005-01-01

    We study the effects of thiourea concentration on CdS thin films deposited by chemical bath deposition (CBD), submitted to post-thermal treatments of CdCl2, and its effect on the characteristics of CdS\\/CdTe solar cells. We compare these cells with similar ones fabricated with CdS-films grown by Close Space Vapor Transport (CSVT). The CBD-CdS cells shows higher open circuit voltage (Voc) and

  1. Thin crystalline silicon solar cells based on epitaxial films grown at 165C by RF PECVD

    E-print Network

    whereas highly doped wafer behave like electric contact, as confirmed by external quantum efficiency measurements and simulations. A best conversion efficiency of 7% is obtained for a 2.4 µm thick cell passivation and is deleterious to the efficiency of heterojunctions solar cells [4-6]. Nevertheless, we have

  2. Thin crystalline silicon solar cells based on epitaxial films grown at 165C by RF PECVD

    E-print Network

    whereas highly doped wafer behave like electric contact, as confirmed by external quantum efficiency measurements and simulations. A best conversion efficiency of 7% is obtained for a 2.4 µm thick cell to the efficiency of heterojunctions solar cells [4-6]. Nevertheless, we have shown that if the interface between

  3. Identification of morphological differences between avian influenza A viruses grown in chicken and duck cells.

    PubMed

    Al-Mubarak, Firas; Daly, Janet; Christie, Denise; Fountain, Donna; Dunham, Stephen P

    2015-03-01

    Although wild ducks are considered to be the major reservoirs for most influenza A virus subtypes, they are typically resistant to the effects of the infection. In contrast, certain influenza viruses may be highly pathogenic in other avian hosts such as chickens and turkeys, causing severe illness and death. Following in vitro infection of chicken and duck embryo fibroblasts (CEF and DEF) with low pathogenic avian influenza (LPAI) viruses, duck cells die more rapidly and produce fewer infectious virions than chicken cells. In the current study, the morphology of viruses produced from CEF and DEF cells infected with low pathogenic avian H2N3 was examined. Transmission electron microscopy showed that viruses budding from duck cells were elongated, while chicken cells produced mostly spherical virions; similar differences were observed in viral supernatants. Sequencing of the influenza genome of chicken- and duck-derived H2N3 LPAI revealed no differences, implicating host cell determinants as responsible for differences in virus morphology. Both DEF and CEF cells produced filamentous virions of equine H3N8 (where virus morphology is determined by the matrix gene). DEF cells produced filamentous or short filament virions of equine H3N8 and avian H2N3, respectively, even after actin disruption with cytochalasin D. These findings suggest that cellular factors other than actin are responsible for the formation of filamentous virions in DEF cells. The formation of elongated virions in duck cells may account for the reduced number of infectious virions produced and could have implications for virus transmission or maintenance in the reservoir host. PMID:25613009

  4. Heteroepitaxial film silicon solar cell grown on Ni-W foils

    SciTech Connect

    Wee, Sung Hun [ORNL; Cantoni, Claudia [ORNL; Fanning, Thomas [Ampulse Corporation; Teplin, Charles [National Renewable Energy Laboratory (NREL); Bogorin, Daniela Florentina [ORNL; Bornstein, Jon [Ampulse Corporation; Bowers, Karen [Ampulse Corporation; Schroeter, [Ampulse Corporation; Hasoon, Falah [National Renewable Energy Laboratory (NREL); Branz, Howard [National Renewable Energy Laboratory (NREL); Paranthaman, Mariappan Parans [ORNL; Goyal, Amit [ORNL

    2013-01-01

    Today, silicon-wafer-based technology dominates the photovoltaic (PV) industry because it enables high efficiency, is produced from abundant, non-toxic materials and is proven in the PV marketplace.[1] However, costs associated with the wafer itself limit ultimate cost reductions.[1,2] PV based on absorber layers of crystalline Si with only 2 to 10 m thickness are a promising route to reduce these costs, while maintaining efficiencies above 15%.[3-5] With the goal of fabricating low-cost film crystalline Si (c-Si), recent research has explored wafer peeling,[6,7] crystallization of amorphous silicon films on glass,[4,8-10] and seed and epitaxy approaches.[3,5,11] In this third approach, one initially forms a seed layer that establishes the grain size and crystalline order. The Si layer is then grown heteroepitaxially on the seed layer, so that it replicates the seed crystal structure. In all of these film c-Si approaches, the critical challenge is to grow c-Si with adequate material quality: specifically, the diffusion length (LD) must be at least three times the film thickness.[12] In polycrystalline Si films, grain boundaries (GBs) are recombination-active and significantly reduce LD. This adverse effects of GBs motivates research into growth of large grained c-Si [13,14] (for a low density of GBs) and biaxially-textured c-Si [11] (for low-angle GBs).

  5. A market analysis for high efficiency multi-junction solar cells grown on SiGe

    E-print Network

    Judkins, Zachara Steele

    2007-01-01

    Applications, markets and a cost model are presented for III-V multi-junction solar cells built on compositionally graded SiGe buffer layers currently being developed by professors Steven Ringell of Ohio State University ...

  6. Cryofixation of epithelial cells grown on sapphire coverslips by impact freezing.

    PubMed

    Reipert, S; Fischer, I; Wiche, G

    2003-02-01

    Rapid cryofixation of cells cultured on coverslips without the use of chemical fixatives has proved advantageous for the immunolocalization of antigens by electron microscopy. Here, we demonstrate the application of sapphire-attached tissue culture cells (PtK2 epithelial cells and mouse myoblasts) to metal-mirror impact freezing. The potential of the Leica EM-CPC cryoworkstation for routine freezing and for safe transfer of the cryofrozen samples into a sapphire disc magazine for freeze-substitution (SD-FS unit) has been exploited. Subsequently, the SD-FS unit has been tested for its use in methanol freeze-substitution and low temperature embedding for immunoelectron microscopy. The structural preservation of Lowicryl HM20-embedded cells has been assessed as being free of damage by large ice crystals. PMID:12588524

  7. Quantifying the syncytialisation of human placental trophoblast BeWo cells grown in vitro.

    PubMed

    Kudo, Yoshiki; Boyd, C A R; Kimura, Hiroshi; Cook, P R; Redman, C W G; Sargent, I L

    2003-04-01

    We have generated lines of BeWo cells that constitutively and stably express either histone H2B tagged with the green fluorescent protein (GFP), or the mitochondrial targeting sequence of subunit VIII of cytochrome c oxidase fused with a red fluorescent protein; one line has nuclei that fluoresce green, the other mitochondria that fluoresce red. Expression of these tagged proteins has no effect on the rates of DNA, RNA and protein synthesis, or on the amounts of human chorionic gonadotropin (hCG) secreted after treatment with forskolin. We used fluorescence-activated cell sorting (FACS) to monitor the extent of cell fusion (syncytialisation) between these two lines; fused cells are readily and accurately detected by their green/red fluorescence. This assay should prove useful in the investigation of the molecular mechanisms involved in trophoblast syncytialisation. PMID:12676351

  8. Changes in cell wall architecture of wheat coleoptiles grown under continuous hypergravity conditions

    NASA Astrophysics Data System (ADS)

    Wakabayashi, K.; Soga, K.; Kamisaka, S.; Hoson, T.

    Modifications of cell wall structure of wheat coleoptiles in response to continuous hypergravity (300 g) treatment were investigated. Length of coleoptiles exposed to hypergravity for 2-4 days from germination stage was 60-70% of that of 1 g control. The net amounts of cell wall polysaccharides, such as hemicellulose and cellulose, of hypergravity-treated coleoptiles increased as much as those of 1 g control coleoptiles during the incubation period. As a result, the levels of cell wall polysaccharides per unit length of coleoptile, which mean the thickness of cell walls, largely increased under hypergravity conditions. Particularly, the amounts of hemicellulosic polymers with middle molecular mass (0.2-1 MDa) largely increased from day 2 to 3 under hypergravity conditions. The major sugar components of the hemicellulose fraction are arabinose, xylose and glucose. The ratios of arabinose and xylose to glucose were higher in hypergravity-treated coleoptiles than in control coleoptiles. The fractionation of hemicellulosic polymers into the neutral and acidic polymers by the anion-exchange column showed that the levels of acidic polymers (mainly composed of arabinoxylans) in cell walls of hypergravity-treated coleoptiles were higher than those of control coleoptiles. In addition to wall polysaccharides, the amounts of cell wall-bound phenolics, such as ferulic acid and diferulic acid, substantially increased during the incubation period both in 1 g control and hypergravity-treated coleoptiles. Especially, the levels of diferulic acid which cross-links hemicellulosic polymers were higher in hypergravity-treated coleoptiles than in control coleoptiles during the incubation period. These results suggest that hypergravity stimuli from the germination stage bias the type of synthesized hemicellulosic polysaccharides, although they do not restrict the net synthesis of cell wall constituents in wheat coleoptiles. The stimulation of the synthesis of arabinoxylans and of the formation of DFA, and also the resultant cell wall thickening may contribute to plant resistance to gravity stimuli.

  9. Low temperature grown ZnO@TiO{sub 2} core shell nanorod arrays for dye sensitized solar cell application

    SciTech Connect

    Goh, Gregory Kia Liang [Institute of Materials Research and Engineering, A*STAR (Agency for Science, Technology, and Research), 3 Research Link, 117602 Singapore (Singapore); Le, Hong Quang, E-mail: lehq@imre.a-star.edu.sg [Institute of Materials Research and Engineering, A*STAR (Agency for Science, Technology, and Research), 3 Research Link, 117602 Singapore (Singapore); Huang, Tang Jiao; Hui, Benjamin Tan Tiong [Department of Materials Science and Engineering (DMSE), Faculty of Engineering National University of Singapore (NUS) BLK E3A, #04-10, 7 Engineering Drive 1, Singapore 117574 (Singapore)

    2014-06-01

    High aspect ratio ZnO nanorod arrays were synthesized on fluorine-doped tin oxide glasses via a low temperature solution method. By adjusting the growth condition and adding polyethylenimine, ZnO nanorod arrays with tunable length were successfully achieved. The ZnO@TiO{sub 2} core shells structures were realized by a fast growth method of immersion into a (NH{sub 4}){sub 2}·TiF{sub 6} solution. Transmission electron microscopy, X-ray Diffraction and energy dispersive X-ray measurements all confirmed the existence of a titania shell uniformly covering the ZnO nanorod's surface. Results of solar cell testing showed that addition of a TiO{sub 2} shell to the ZnO nanorod significantly increased short circuit current (from 4.2 to 5.2 mA/cm{sup 2}), open circuit voltage (from 0.6 V to 0.8 V) and fill factor (from 42.8% to 73.02%). The overall cell efficiency jumped from 1.1% for bare ZnO nanorod to 3.03% for a ZnO@TiO{sub 2} core shell structured solar cell with a 18–22 nm shell thickness, a nearly threefold increase. - Graphical abstract: The synthesis process of coating TiO{sub 2} shell onto ZnO nanorod core is shown schematically. A thin, uniform, and conformal shell had been grown on the surface of the ZnO core after immersing in the (NH{sub 4}){sub 2}·TiF{sub 6} solution for 5–15 min. - Highlights: • ZnO@TiO{sub 2} core shell nanorod has been grown on FTO substrate using low temperature solution method. • TEM, XRD, EDX results confirmed the existing of titana shell, uniformly covered rod's surface. • TiO{sub 2} shell suppressed recombination, demonstrated significant enhancement in cell's efficiency. • Core shell DSSC's efficiency achieved as high as 3.03%, 3 times higher than that of ZnO nanorods.

  10. Melanoma Spheroids Grown Under Neural Crest Cell Conditions Are Highly Plastic Migratory\\/Invasive Tumor Cells Endowed with Immunomodulator Function

    Microsoft Academic Search

    Kiran Ramgolam; Jessica Lauriol; Claude Lalou; Laura Lauden; Laurence Michel; Abdel-Majid Khatib; Fawzi Aoudjit; Dominique Charron; Catherine Alcaide-Loridan; Reem; Pierre de la Grange

    2011-01-01

    Background: The aggressiveness of melanoma tumors is likely to rely on their well-recognized heterogeneity and plasticity. Melanoma comprises multi-subpopulations of cancer cells some of which may possess stem cell-like properties. Although useful, the sphere-formation assay to identify stem cell-like or tumor initiating cell subpopulations in melanoma has been challenged, and it is unclear if this model can predict a functional

  11. GaAsPN-based PIN solar cells MBE-grown on GaP substrates: toward the III-V/Si tandem solar cell

    NASA Astrophysics Data System (ADS)

    Da Silva, M.; Almosni, S.; Cornet, C.; Létoublon, A.; Levallois, C.; Rale, P.; Lombez, L.; Guillemoles, J.-F.; Durand, O.

    2015-03-01

    GaAsPN semiconductors are promising material for the elaboration of high efficiencies tandem solar cells on silicon substrates. GaAsPN diluted nitride alloy is studied as the top junction material due to its perfect lattice matching with the Si substrate and its ideal bandgap energy allowing a perfect current matching with the Si bottom cell. We review our recent progress in materials development of the GaAsPN alloy and our recent studies of some of the different building blocks toward the elaboration of a PIN solar cell. A lattice matched (with a GaP(001) substrate, as a first step toward the elaboration on a Si substrate) 1?m-thick GaAsPN alloy has been grown by MBE. After a post-growth annealing step, this alloy displays a strong absorption around 1.8-1.9 eV, and efficient photoluminescence at room temperature suitable for the elaboration of the targeted solar cell top junction. Early stage GaAsPN PIN solar cells prototypes have been grown on GaP (001) substrates, with 2 different absorber thicknesses (1?m and 0.3?m). The external quantum efficiencies and the I-V curves show that carriers have been extracted from the GaAsPN alloy absorbers, with an open-circuit voltage of 1.18 V, while displaying low short circuit currents meaning that the GaAsPN structural properties needs a further optimization. A better carrier extraction has been observed with the absorber displaying the smallest thickness, which is coherent with a low carriers diffusion length in our GaAsPN compound. Considering all the pathways for improvement, the efficiency obtained under AM1.5G is however promising.

  12. Carbon Assimilation in Photoheterotrophic Cells of Peanut (Arachis hypogaea L.) Grown in Still Nutrient Medium 1

    PubMed Central

    Seeni, S.; Gnanam, A.

    1982-01-01

    The relative transport of photosynthetic and dark carboxylation products in photoheterotrophic cells of Arachis hypogaea L. var. TMV-3 at varied phases of growth were determined. Despite the presence of an equally competent photosynthetic apparatus as determined from 14CO2 incorporation rates in the dark and light, pulse-chase experiments revealed little or no change in the radioactivity of the C3 intermediates but rapid disappearance of label from the dark carbon assimilates (malate and other tricarboxylic acid cycle intermediates) with a simultaneous increase in the aminoacid pool in early log-phase (10 days old) cells. However, significant flow of carbon through the photosynthetic intermediates resulting in the accumulation of sugars occurred in the late log-phase (34 days old) cells. Limitation of exogenous sugar in the nutrient milieu and depletion of reserve carbohydrates stored in starch of the chloroplasts of the cells were considered as the decisive factors in promoting transport of C3 cycle intermediates through the reductive pentose phosphate pathway in photoheterotrophic cells. The observed drain of radioactivity even from the small amounts of tricarboxylic acid cycle intermediates synthesized during photosynthesis into glutamate indicated that the transport of carbon through the nonautotrophic pathway is not controlled by these factors. Images Fig. 1 PMID:16662582

  13. Space concentrator solar cells based on multilayer LPE grown AlGaAs/GaAs heterostructure

    NASA Technical Reports Server (NTRS)

    Khvostikov, V. P.; Larionov, V. R.; Paleeva, E. V.; Sorokina, S. V.; Chosta, O. I.; Shvarts, M. Z.; Zimogorova, N. S.

    1995-01-01

    The high efficiency solar cells based on multilayer AlGaAs/GaAs heterostructures, prepared by low temperature liquid phase epitaxy (LPE), were developed and tested. An investigation of the low temperature LPE process for the crystallization of AlGaAs heterostructures of as high as 24.0 to 24.7 percent under AMO conditions at concentration ratios of 20 to 100x, were reached. Developed solar cells show substantial radiation resistance to the damage induced by 3.75 MeV electrons.

  14. High efficiency GaAs-Ge tandem solar cells grown by MOCVD

    NASA Technical Reports Server (NTRS)

    Vernon, S. M.; Tobin, S. P.; Bajgar, C.; Haven, Victor E.; Geoffroy, L. M.; Lillington, D. R.; Hart, R. E., Jr.

    1989-01-01

    High conversion efficiency and low weight are obviously desirable for solar cells intended for space applications. One promising structure is GaAs on Ge. The advantages of using Ge wafers as substrates include the following: they offer high efficiency by forming a two-junction tandem cell; low weight combined with superior strength allows usage of thin (3 mil) wafers; and they are a good substrate for GaAs, being lattice matched, thermal expansion matched, and available as large-area wafers.

  15. Genotoxic Effects of Low- and High-LET Radiation on Human Epithelial Cells Grown in 2-D Versus 3-D Culture

    NASA Technical Reports Server (NTRS)

    Patel, Z. S.; Cucinotta, F. A.; Huff, J. L.

    2011-01-01

    Risk estimation for radiation-induced cancer relies heavily on human epidemiology data obtained from terrestrial irradiation incidents from sources such as medical and occupational exposures as well as from the atomic bomb survivors. No such data exists for exposures to the types and doses of high-LET radiation that will be encountered during space travel; therefore, risk assessment for space radiation requires the use of data derived from cell culture and animal models. The use of experimental models that most accurately replicate the response of human tissues is critical for precision in risk projections. This work compares the genotoxic effects of radiation on normal human epithelial cells grown in standard 2-D monolayer culture compared to 3-D organotypic co-culture conditions. These 3-D organotypic models mimic the morphological features, differentiation markers, and growth characteristics of fully-differentiated normal human tissue and are reproducible using defined components. Cultures were irradiated with 2 Gy low-LET gamma rays or varying doses of high-LET particle radiation and genotoxic damage was measured using a modified cytokinesis block micronucleus assay. Our results revealed a 2-fold increase in residual damage in 2 Gy gamma irradiated cells grown under organotypic culture conditions compared to monolayer culture. Irradiation with high-LET particle radiation gave similar results, while background levels of damage were comparable under both scenarios. These observations may be related to the phenomenon of "multicellular resistance" where cancer cells grown as 3-D spheroids or in vivo exhibit an increased resistance to killing by chemotherapeutic agents compared to the same cells grown in 2-D culture. A variety of factors are likely involved in mediating this process, including increased cell-cell communication, microenvironment influences, and changes in cell cycle kinetics that may promote survival of damaged cells in 3-D culture that would otherwise die or be rendered reproductively inactive in 2-D culture.

  16. Carrier Transport in Polycrystalline Silicon Thin Film Solar Cells Grown on a Highly Textured Structure

    Microsoft Academic Search

    Shinya Honda; Hideyuki Takakura; Yoshihiro Hamakawa; Riza Muhida; Tomohiro Kawamura; Tomokazu Harano; Toshihiko Toyama; Hiroaki Okamoto

    2004-01-01

    Photovoltaic performance of polycrystalline silicon (poly-Si) thin film solar cells deposited by plasma enhanced chemical vapor deposition at a low temperature of ˜200°C have been investigated as a function of surface structures of textured substrates, which are needed for enhancing the light trapping effect. With increasing surface roughness of the substrate, the light trapping effect is increased, while the photovoltaic

  17. Quantifying the syncytialisation of human placental trophoblast BeWo cells grown in vitro

    Microsoft Academic Search

    Yoshiki Kudo; C. A. R. Boyd; Hiroshi Kimura; P. R. Cook; C. W. G. Redman; I. L. Sargent

    2003-01-01

    We have generated lines of BeWo cells that constitutively and stably express either histone H2B tagged with the green fluorescent protein (GFP), or the mitochondrial targeting sequence of subunit VIII of cytochrome c oxidase fused with a red fluorescent protein; one line has nuclei that fluoresce green, the other mitochondria that fluoresce red. Expression of these tagged proteins has no

  18. Clonal vaccinia virus grown in cell culture as a new smallpox vaccine

    Microsoft Academic Search

    Jian Liu; Konstantin V Pugachev; Gwendolyn A Myers; Brie Coughlin; Paul S Blum; Richard Nichols; Casey Johnson; John Cruz; Jeffrey S Kennedy; Francis A Ennis; Richard Weltzin; Thomas P Monath

    2003-01-01

    Although the smallpox virus was eradicated over 20 years ago, its potential release through bioterrorism has generated renewed interest in vaccination. To develop a modern smallpox vaccine, we have adapted vaccinia virus that was derived from the existing Dryvax vaccine for growth in a human diploid cell line. We characterized six cloned and one uncloned vaccine candidates. One clone, designated

  19. Production of somatic cell nuclear transfer embryos using in vitro-grown and in vitro-matured oocytes in rabbits.

    PubMed

    Sugimoto, Hironobu; Kida, Yuta; Oh, Noriyoshi; Kitada, Kensaku; Matsumoto, Kazuya; Saeki, Kazuhiro; Taniguchi, Takeshi; Hosoi, Yoshihiko

    2015-08-01

    We examined growing oocytes collected from follicles remaining in superovulated rabbit ovaries, that were grown (in vitro growth, IVG) and matured (in vitro maturation, IVM) in vitro. We produced somatic cell nuclear transfer (SCNT) embryos using the mature oocytes and examined whether these embryos have the ability to develop to the blastocyst stage. In addition, we examined the effects of trichostatin A (TSA), a histone deacetylase inhibitor (HDACi), on the developmental competence of SCNT embryos derived from IVG-IVM oocytes. After growth for 7 days and maturation for 14-16 h in vitro, the growing oocytes reached the metaphase II stage (51.4%). After SCNT, these reconstructed embryos reached the blastocyst stage (20%). Furthermore, the rate of development to the blastocyst stage and the number of cells in the blastocysts in SCNT embryos derived from IVG-IVM oocytes were significantly higher for TSA-treated embryos compared with TSA-untreated embryos (40.6 versus 21.4% and 353.1 ± 59.1 versus 202.5 ± 54.6, P < 0.05). These results indicate that rabbit SCNT embryos using IVG-IVM oocytes have the developmental competence to reach the blastocyst stage. PMID:24666637

  20. Hybrid solar cells based on dc magnetron sputtered films of n-ITO on APMOVPE grown p-InP

    NASA Technical Reports Server (NTRS)

    Coutts, T. J.; Li, X.; Wanlass, M. W.; Emery, K. A.; Gessert, T. A.

    1988-01-01

    Hybrid indium-tin-oxide (ITO)/InP solar cells are discussed. The cells are constructed by dc magnetron sputter deposition of ITO onto high-quality InP films grown by atmospheric pressure metal-organic vapor-phase epitaxy (APMOVPE). A record efficiency of 18.9 percent, measured under standard Solar Energy Research Institute reporting conditions, has been obtained. The p-InP surface is shown to be type converted, principally by the ITO, but with the extent of conversion being modified by the nature of the sputtering gas. The deposition process, in itself, is not responsible for the type conversion. Dark currents have been suppressed by more than three orders of magnitude by the addition of hydrogen to the sputtering gas during deposition of a thin (5 nm) interface layer. Without this layer, and using only the more usual argon/oxygen mixture, the devices had poorer efficiencies and were unstable. A discussion of associated quantum efficiencies and capacitance/voltage measurements is also presented from which it is concluded that further improvements in efficiency will result from better control over the type-conversion process.

  1. Osteoprotegerin (OPG) Production by Cells in the Osteoblast Lineage is Regulated by Pulsed Electromagnetic Fields in Cultures Grown on Calcium Phosphate Substrates

    Microsoft Academic Search

    Zvi Schwartz; Maya Fisher; Christoph H. Lohmann; Bruce J. Simon; Barbara D. Boyan

    2009-01-01

    Pulsed electromagnetic fields (PEMF) used clinically to stimulate bone formation enhance the osteogenic effects of BMP-2 on\\u000a human mesenchymal stem cells (MSCs) if the MSCs are grown in osteogenic medium and are cultured on calcium phosphate (CaP)\\u000a surfaces rather than tissue culture polystyrene plastic (TCPS). This study tested if PEMF’s effects on cells in the osteoblast\\u000a lineage are substrate dependent

  2. Loss of capacity for acid-induced wall loosening as the principal cause of the cessation of cell enlargement in light-grown bean leaves

    Microsoft Academic Search

    Elizabeth Van Volkenburgh; Marian G. Schmidt; Robert E. Cleland

    1985-01-01

    Cell enlargement in primary leaves of bean (Phaseolus vulgaris L.) can be induced, free of cell divisions, by exposure of 10-d-old, red-light-grown seedlings to white light. The absolute rate of leaf expansion increases until day 12, then decreases until the leaves reached mature size on day 18. The cause of the reduction in growth rate following day 12 has been

  3. Heteroepitaxial Film Silicon Solar Cell Grown on Ni-W Foils

    SciTech Connect

    Wee, S. H.; Cantoni, C.; Fanning, T. R.; Teplin, C. W.; Bogorin, D. F.; Bornstein, J.; Bowers, K.; Schroeter, P.; Hasoon, F.; Branz, H. M.; Paranthaman, M. P.; Goyal, A.

    2012-03-01

    Heteroepitaxial semiconductor films on low-cost, flexible metal foil templates are a potential route to inexpensive, high-efficiency solar cells. Here, we report epitaxial growth of Si films on low-cost, flexible, biaxially-textured Ni-W substrates. A robust buffer architecture comprised of multiple epitaxial oxide layers has been developed to grow high quality, heteroepitaxial Si films without any undesired reaction between the Si film and the metal substrate and with a single biaxial texture. XRD analysis including {omega}-scans, {phi}-scans, and pole figures confirms that the buffers and silicon are all epitaxial, with excellent cube-on-cube epitaxy. A photo-conversion efficiency of 1.1% is demonstrated from a proof-of-concept heteroepitaxial film Si solar cell.

  4. Development of III-V dilute nitride-based solar cells grown by chemical beam epitaxy

    Microsoft Academic Search

    Aristotelis Fotkatzikis

    2007-01-01

    The peculiar properties of III-V dilute nitrides, namely the substantial reduction of the energy bandgap and the increase of the electron effective mass upon the introduction of a small amount of nitrogen in the III-V matrix, make them ideal candidates for solar cell applications. Specifically, the use of 1.0--1.25 eV GaInAsN subcells has been proposed as a potential way of

  5. Molecular and immunological characterization of three strains of Anaplasma marginale grown in cultured tick cells.

    PubMed

    Lis, Katarzyna; Fernández de Mera, Isabel G; Popara, Marina; Cabezas-Cruz, Alejandro; Ayllón, Nieves; Zweygarth, Erich; Passos, Lygia M F; Broniszewska, Marzena; Villar, Margarita; Kocan, Katherine M; Ribeiro, Mucio F B; Pfister, Kurt; de la Fuente, José

    2015-06-01

    Anaplasma marginale is an economically important tick-borne pathogen of cattle that causes bovine anaplasmosis. A wide range of geographic strains of A. marginale have been isolated from cattle, several of which have been characterized using genomics and proteomics. While many of these strains have been propagated in tick lines, comparative analyses after propagation in tick cells have not been reported. The overall purpose of this research therefore was to compare the degree of conservation of selected genes after propagation in tick cell culture among A. marginale strains from the U.S. (the Virginia strain) and Brazil (UFMG1 and UFMG2 strains). The genes studied herein included those which encode the proteins HSP70 and SODB involved in heat shock and stress responses, respectively, and two genes that encode major surface proteins MSP4 and MSP5. Strain identities were first confirmed by sequencing the tandem repeats of the msp1a gene which encodes for the adhesin, MSP1a. The results of these studies demonstrated that the genes encoding for both stress response and heat shock proteins were highly conserved among the three A. marginale strains. Antibodies specific for MSP4, MSP5, SODB and HSP70 proteins were used to further characterize the A. marginale strains, and they reacted with all of these strains propagated in tick cell culture, providing further evidence for antigenic conservation. Although antigenic differences were not found among the three A. marginale strains, multi-locus sequence analysis (MLSA) performed with nucleotide sequences of these genes demonstrated that the A. marginale Brazilian and U.S. strains fall in different clades. These results showed that phylogenetically distant strains of A. marginale are antigenically conserved, even after several in vitro passages, supporting the use of some of the above conserved proteins as candidates for universal vaccines. PMID:25943785

  6. Dye-sensitized solar cell employing zinc oxide aggregates grown in the presence of lithium

    DOEpatents

    Zhang, Qifeng; Cao, Guozhong

    2013-10-15

    Provided are a novel ZnO dye-sensitized solar cell and method of fabricating the same. In one embodiment, deliberately added lithium ions are used to mediate the growth of ZnO aggregates. The use of lithium provides ZnO aggregates that have advantageous microstructure, morphology, crystallinity, and operational characteristics. Employing lithium during aggregate synthesis results in a polydisperse collection of ZnO aggregates favorable for porosity and light scattering. The resulting nanocrystallites forming the aggregates have improved crystallinity and more favorable facets for dye molecule absorption. The lithium synthesis improves the surface stability of ZnO in acidic dyes. The procedures developed and disclosed herein also help ensure the formation of an aggregate film that has a high homogeneity of thickness, a high packing density, a high specific surface area, and good electrical contact between the film and the fluorine-doped tin oxide electrode and among the aggregate particles.

  7. Enhanced-Depletion-Width GaInNAs Solar Cells Grown by Molecular-Beam Epitaxy

    SciTech Connect

    Ptak, A. J.; Friedman, D. J.

    2005-01-01

    The 3-junction, GaInP2/GaAs/Ge solar cell is a non-optimized structure due to excess light falling on the Ge junction. Because of this, a fourth junction inserted between the GaAs and Ge subcells could use the excess light and provide an increase in device efficiency. Unfortunately, the leading candidate material, GaInNAs, suffers from very low minority-carrier diffusion lengths compared to its parent compound, GaAs. These low diffusion lengths do not allow for the collection of adequate current to keep the overall 4-junction structure current matched. If the currents generated from the GaInNAs subcell are increased, the possibility exists for practical efficiencies of greater than 40% from this structure.

  8. Alterations in cell pigmentation, protein expression, and photosynthetic capacity of the cyanobacterium Oscillatoria tenuis grown under low iron conditions.

    PubMed

    Trick, C G; Wilhelm, S W; Brown, C M

    1995-12-01

    To better describe the iron-limited nutrient status of aquatic photosynthetic microorganisms, we examined the effects of iron limitation on pigment content, maximum rates of photosynthetic oxygen evolution, and respiratory oxygen consumption in the filamentous cyanobacterium Oscillatoria tenuis Ag. Within the range of iron (4.2 x 10(-5)-5.1 x 10(-9) M FeCl3), growth rates were not limited by photosynthetic capacity but rather by another, as of yet undetermined, iron-requiring cellular function. We have also investigated membrane proteins that are induced when the cells are grown in low iron medium. Using membrane fractionation techniques we were able to recognize specific proteins localized in the outer membrane and periplasmic space of O. tenuis. The recovery of growth rates at low iron levels occurred in parallel with the induction of these proteins and the production of extracellular siderophores. The additional iron acquired by this high affinity transport system did not reestablish photosynthesis in O. tenuis to the iron-satiated level but did reestablish growth to iron-replete levels. Oscillatoria tenuis appears to invoke an alternate physiology to compensate for iron deficiency. PMID:8542553

  9. Highly transparent and conductive indium tin oxide thin films for solar cells grown by reactive thermal evaporation at low temperature

    NASA Astrophysics Data System (ADS)

    Du, Jian; Chen, Xin-liang; Liu, Cai-chi; Ni, Jian; Hou, Guo-fu; Zhao, Ying; Zhang, Xiao-dan

    2014-04-01

    Transparent conductive tin-doped indium oxide (In2O3:Sn, ITO) thin films with various Sn-doping concentrations have been prepared using the low cost reactive thermal evaporation (RTE) technique at a low growth temperature of ~160 °C. The structural characteristics, optical and electrical properties of the ITO thin films were investigated. These polycrystalline ITO films exhibited preferential orientation along (222) plane and possessed low resistivities ranging from 3.51 to 5.71 × 10-4 ? cm. The decreased mobility was attributed to the scattering by ionized and neutral impurities at high doping concentrations. The optimized ITO thin film deposited with 6.0 wt% Sn-doping concentration exhibited a high average transparency of 87 % in the wavelength range of 380-900 nm and a low resistivity of 3.74 × 10-4 ? cm with a high Hall mobility of 47 cm2 V-1s-1. A hydrogenated amorphous silicon and silicon-germanium (a-Si:H/a-SiGe:H) double-junction solar cell fabricated with the RTE-grown ITO electrodes presented a conversion efficiency of 10.51 %.

  10. Clonal vaccinia virus grown in cell culture fully protects monkeys from lethal monkeypox challenge.

    PubMed

    Marriott, Kathleen A; Parkinson, Christopher V; Morefield, Samantha I; Davenport, Robert; Nichols, Richard; Monath, Thomas P

    2008-01-24

    The potential use of smallpox as an agent of bioterrorism has renewed interest in the development of a modern vaccine capable of replacing the standard Dryvax vaccine. Vaccinia virus (ACAM2000), clonally isolated from Dryvax and manufactured in cell culture, was tested for immunogenicity and protective activity in a non-human primate model. Cynomolgus monkeys vaccinated with ACAM2000, Dryvax, or ACAM2000 diluent (control) were challenged 2 months post-vaccination with a lethal, intravenous dose of monkeypox virus. ACAM2000 proved immunogenic and efficacious in protecting against lethal monkeypox challenge, as evident from a lack of post-challenge viral replication, and the absence of any significant clinical signs attributable to monkeypox infection. This protection correlated (with) neutralizing antibody titers equivalent to those generated in the Dryvax group post-vaccination, as well as a similar significant increase in the presence of neutralizing antibodies post-challenge. Control animals showed no signs of vaccine-induced seroconversion, displayed post-challenge tissue-associated viral replication and viremia, and developed severe monkeypox-specific clinical symptoms. The protective efficacy of ACAM2000 was found to be equivalent to the currently approved vaccine, Dryvax. PMID:18077063

  11. Variable temperature carrier dynamics in bulk (In)GaAsNSb materials grown by MOVPE for multi-junction solar cells

    NASA Astrophysics Data System (ADS)

    Sin, Yongkun; Lingley, Zachary; LaLumondiere, Stephen; Wells, Nathan; Lotshaw, William; Moss, Steven C.; Kim, Tae Wan; Mawst, Luke J.; Kuech, Thomas F.

    2014-03-01

    III-V multi-junction solar cells are typically based on a triple-junction design that consists of an InGaP top junction, a GaAs middle junction, and a bottom junction that employs a 1 - 1.25 eV material grown on GaAs substrates. The most promising 1 - 1.25 eV material that is currently under extensive investigation is bulk dilute nitride such as (In)GaAsNSb lattice matched to GaAs substrates. The approach utilizing dilute nitrides has a great potential to achieve high performance triple-junction solar cells as recently demonstrated by Wiemer, et al., who achieved a record efficiency of 43.5% from multi-junction solar cells including MBE-grown dilute nitride materials [1]. Although MOVPE is a preferred technique over MBE for III-V multi-junction solar cell manufacturing, MOVPEgrown dilute nitride research is at its infancy compared to MBE-grown dilute nitride. In particular, carrier dynamics studies are indispensible in the optimization of MOVPE materials growth parameters to obtain improved solar cell performance. For the present study, we employed time-resolved photoluminescence (TR-PL) techniques to study carrier dynamics in MOVPE-grown bulk dilute nitride InGaAsN materials (Eg = 1 - 1.25 eV at RT) lattice matched to GaAs substrates. In contrast to our earlier samples that showed high background C doping densities, our current samples grown using different metalorganic precursors at higher growth temperatures showed a significantly reduced background doping density of ~ 1017 /cm3. We studied carrier dynamics in (In)GaAsNSb double heterostructures (DH) with different N compositions at room temperature. Post-growth annealing yielded significant improvements in carrier lifetimes of (In)GaAsNSb double heterostructure (DH) samples. Carrier dynamics at various temperatures between 10 K and RT were also studied from (In)GaAsNSb DH samples including those samples grown on different orientation substrates.

  12. Expression Profile of Drug and Nutrient Absorption Related Genes in Madin-Darby Canine Kidney (MDCK) Cells Grown under Differentiation Conditions.

    PubMed

    Quan, Yong; Jin, Yisheng; Faria, Teresa N; Tilford, Charles A; He, Aiqing; Wall, Doris A; Smith, Ronald L; Vig, Balvinder S

    2012-01-01

    The expression levels of genes involved in drug and nutrient absorption were evaluated in the Madin-Darby Canine Kidney (MDCK) in vitro drug absorption model. MDCK cells were grown on plastic surfaces (for 3 days) or on Transwell® membranes (for 3, 5, 7, and 9 days). The expression profile of genes including ABC transporters, SLC transporters, and cytochrome P450 (CYP) enzymes was determined using the Affymetrix® Canine GeneChip®. Expression of genes whose probe sets passed a stringent confirmation process was examined. Expression of a few transporter (MDR1, PEPT1 and PEPT2) genes in MDCK cells was confirmed by RT-PCR. The overall gene expression profile was strongly influenced by the type of support the cells were grown on. After 3 days of growth, expression of 28% of the genes was statistically different (1.5-fold cutoff, p < 0.05) between the cells grown on plastic and Transwell® membranes. When cells were differentiated on Transwell® membranes, large changes in gene expression profile were observed during the early stages, which then stabilized after 5-7 days. Only a small number of genes encoding drug absorption related SLC, ABC, and CYP were detected in MDCK cells, and most of them exhibited low hybridization signals. Results from this study provide valuable reference information on endogenous gene expression in MDCK cells that could assist in design of drug-transporter and/or drug-enzyme interaction studies, and help interpret the contributions of various transporters and metabolic enzymes in studies with MDCK cells. PMID:24300234

  13. Expression Profile of Drug and Nutrient Absorption Related Genes in Madin-Darby Canine Kidney (MDCK) Cells Grown under Differentiation Conditions

    PubMed Central

    Quan, Yong; Jin, Yisheng; Faria, Teresa N.; Tilford, Charles A.; He, Aiqing; Wall, Doris A.; Smith, Ronald L.; Vig, Balvinder S.

    2012-01-01

    The expression levels of genes involved in drug and nutrient absorption were evaluated in the Madin-Darby Canine Kidney (MDCK) in vitro drug absorption model. MDCK cells were grown on plastic surfaces (for 3 days) or on Transwell® membranes (for 3, 5, 7, and 9 days). The expression profile of genes including ABC transporters, SLC transporters, and cytochrome P450 (CYP) enzymes was determined using the Affymetrix® Canine GeneChip®. Expression of genes whose probe sets passed a stringent confirmation process was examined. Expression of a few transporter (MDR1, PEPT1 and PEPT2) genes in MDCK cells was confirmed by RT-PCR. The overall gene expression profile was strongly influenced by the type of support the cells were grown on. After 3 days of growth, expression of 28% of the genes was statistically different (1.5-fold cutoff, p < 0.05) between the cells grown on plastic and Transwell® membranes. When cells were differentiated on Transwell® membranes, large changes in gene expression profile were observed during the early stages, which then stabilized after 5–7 days. Only a small number of genes encoding drug absorption related SLC, ABC, and CYP were detected in MDCK cells, and most of them exhibited low hybridization signals. Results from this study provide valuable reference information on endogenous gene expression in MDCK cells that could assist in design of drug-transporter and/or drug-enzyme interaction studies, and help interpret the contributions of various transporters and metabolic enzymes in studies with MDCK cells. PMID:24300234

  14. Changes of ribulose bisphosphate carboxylase/oxygenase content, ribulose bisphosphate concentration, and photosynthetic activity during adaptation of high-CO/sub 2/ grown cells to low-CO/sub 2/ conditions in Chlorella pyrenoidosa

    SciTech Connect

    Yokota, A.; Canvin, D.T.

    1986-02-01

    Changes of some photosynthetic properties of high-CO/sub 2/ grown cells of Chlorella pyrenoidosa during adaptation to low-CO/sub 2/ conditions have been investigated. The K/sub m/ value of photosynthesis of the high-CO/sub 2/ grown cells for dissolved inorganic carbon was 3.3 millimolar and decreased to 25 to 30 micromolar within 4 hours after transferring to air. In the presence of saturating CO/sub 2/ concentrations the photosynthetic activity of the high-CO/sub 2/ grown cells was 1.5 times as high as that of the low-CO/sub 2/ grown cells. There was a significant rise of the photosynthetic activity during adaptation of the high-CO/sub 2/ grown cells to air, followed by a steady decrease. The activity of ribulose 1,5-bisphosphate carboxylase/oxygenase in both the high and low-CO/sub 2/ grown cells was close to the photosynthetic activity of the cells. The concentration of ribulose 1,5-bisphosphate (RuBP) was higher in the low-CO/sub 2/ adapting and low-CO/sub 2/ grown celsl than in the high-CO/sub 2/ grown cells regardless of the photosynthetic rate. This seems to be due to an increased RuBP regeneration activity during adaptation followed by maintenance of the new higher concentration. The RuBP level always exceeded the concentration of ribulose 1,5-bisphosphate carboxylase/oxygenase RuBP binding sites in both the high- and low-CO/sub 2/ grown cells at any dissolved inorganic carbon concentration.

  15. Earliest art in the Americas: incised image of a proboscidean on a mineralized extinct animal bone from Vero Beach, Florida

    Microsoft Academic Search

    Barbara A. Purdy; Kevin S. Jones; John J. Mecholsky; Gerald Bourne; Richard C. Hulbert; Bruce J. MacFadden; Krista L. Church; Michael W. Warren; Thomas F. Jorstad; Dennis J. Stanford; Melvin J. Wachowiak; Robert J. Speakman

    2011-01-01

    A fragmented fossil bone incised with the figure of a proboscidean was recently found at Vero Beach, Florida near the location where Late Pleistocene fauna and human bones were recovered from 1913 to 1916. This engraving may represent the oldest and only existing example of Terminal Pleistocene art depicting a proboscidean in the Americas. Because of the uniqueness, rarity, and

  16. Progress in the Efficiency of Wide-Gap Cu(In1-xGax)Se2 Solar Cells Using CIGSe Layers Grown in Water Vapor

    Microsoft Academic Search

    Shogo Ishizuka; Keiichiro Sakurai; Akimasa Yamada; Hajime Shibata; Koji Matsubara; Minoru Yonemura; Satoshi Nakamura; Hisayuki Nakanishi; Takeshi Kojima; Shigeru Niki

    2005-01-01

    Progress in the performance of wide-gap Cu(In1-xGax)Se2 (CIGSe) solar cells for x values around 0.5 has been demonstrated using CIGSe layers grown in the presence of water vapor. While CIGSe thin films deposited in the presence of water vapor showed variations in electrical properties such as increases in hole carrier density and a consequent enhancement of p-type conductivity, no significant

  17. High external quantum efficiency and fill-factor InGaN\\/GaN heterojunction solar cells grown by NH3-based molecular beam epitaxy

    Microsoft Academic Search

    J. R. Lang; C. J. Neufeld; C. A. Hurni; S. C. Cruz; E. Matioli; U. K. Mishra; J. S. Speck

    2011-01-01

    High external quantum efficiency (EQE) p-i-n heterojunction solar cells grown by NH3-based molecular beam epitaxy are presented. EQE values including optical losses are greater than 50% with fill-factors over 72% when illuminated with a 1 sun AM0 spectrum. Optical absorption measurements in conjunction with EQE measurements indicate an internal quantum efficiency greater than 90% for the InGaN absorbing layer. By

  18. Production of eicosapentaenoic acid (EPA) in Monodus subterraneus grown in a helical tubular photobioreactor as affected by cell density and light intensity

    Microsoft Academic Search

    Congming Lu; Krishna Rao; David Hall; Avigad Vonshak

    2001-01-01

    The effect of cell density (1–4.5 g L-1) and light intensity (44 and 82 µmol m-2 s-1) on fatty acid composition andeicosapentaenoic acid (EPA, 20:5 ?3) production was studied ina semi-continuous culture of Monodus subterraneus grown in a helicaltubular photobioreactor (`Biocoil') under laboratory conditions. Under lowlight, the highest proportion of EPA (31.5% of total fatty acids) and EPAcontent (3.5% of

  19. Magnesium doping of efficient GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition

    NASA Technical Reports Server (NTRS)

    Lewis, C. R.; Ford, C. W.; Werthen, J. G.

    1984-01-01

    Magnesium has been substituted for zinc in GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition (MOCVD). Bis(cyclopentadienyl)magnesium (Cp2Mg) is used as the MOCVD transport agent for Mg. Full retention of excellent material quality and efficient cell performance results. The substitution of Mg for Zn would enhance the abruptness and reproducibility of doping profiles, and facilitate high temperature processing and operation, due to the much lower diffusion coefficient of Mg, relative to Zn, in these materials.

  20. Investigations of high-performance GaAs solar cells grown on Ge-Si1-xGex-Si substrates

    Microsoft Academic Search

    Carrie L. Andre; John A. Carlin; John J. Boeckl; David M. Wilt; M. A. Smith; A. J. Pitera; M. L. Lee; Eugene A. Fitzgerald; Steven A. Ringel

    2005-01-01

    High-performance p+\\/n GaAs solar cells were grown and processed on compositionally graded Ge-Si1-xGex-Si (SiGe) substrates. Total area efficiencies of 18.1% under the AM1.5-G spectrum were measured for 0.0444 cm2 solar cells. This high efficiency is attributed to the very high open-circuit voltages (980 mV (AM0) and 973 mV (AM1.5-G)) that were achieved by the reduction in threading dislocation density enabled

  1. SU-E-J-129: A Strategy to Consolidate the Image Database of a VERO Unit Into a Radiotherapy Management System

    SciTech Connect

    Yan, Y; Medin, P; Yordy, J; Zhao, B; Jiang, S [UT Southwestern Medical Center, Dallas, TX (United States)

    2014-06-01

    Purpose: To present a strategy to integrate the imaging database of a VERO unit with a treatment management system (TMS) to improve clinical workflow and consolidate image data to facilitate clinical quality control and documentation. Methods: A VERO unit is equipped with both kV and MV imaging capabilities for IGRT treatments. It has its own imaging database behind a firewall. It has been a challenge to transfer images on this unit to a TMS in a radiation therapy clinic so that registered images can be reviewed remotely with an approval or rejection record. In this study, a software system, iPump-VERO, was developed to connect VERO and a TMS in our clinic. The patient database folder on the VERO unit was mapped to a read-only folder on a file server outside VERO firewall. The application runs on a regular computer with the read access to the patient database folder. It finds the latest registered images and fuses them in one of six predefined patterns before sends them via DICOM connection to the TMS. The residual image registration errors will be overlaid on the fused image to facilitate image review. Results: The fused images of either registered kV planar images or CBCT images are fully DICOM compatible. A sentinel module is built to sense new registered images with negligible computing resources from the VERO ExacTrac imaging computer. It takes a few seconds to fuse registered images and send them to the TMS. The whole process is automated without any human intervention. Conclusion: Transferring images in DICOM connection is the easiest way to consolidate images of various sources in your TMS. Technically the attending does not have to go to the VERO treatment console to review image registration prior delivery. It is a useful tool for a busy clinic with a VERO unit.

  2. Mitochondrial membrane potential measurement of H9c2 cells grown in high-glucose and galactose-containing media does not provide additional predictivity towards mitochondrial assessment.

    PubMed

    Rana, Payal; Nadanaciva, Sashi; Will, Yvonne

    2011-03-01

    Drug-induced mitochondrial toxicity is a contributing factor to many organ toxicities. The fact that some, but not all members of a particular drug class can induce mitochondrial dysfunction has necessitated the need for predictive screens within the drug development process. One of these screens is a cell viability assay done in two types of media, one containing high-glucose, the other, galactose. Since galactose-grown cells are more susceptible to mitochondrial toxicants than high-glucose-grown cells, this assay distinguishes compounds that cause toxicity primarily through mitochondrial targets from those that cause multifactorial toxicity. However, the assay does not show if compounds that cause multifactorial toxicity cause impairment on mitochondria. To address this problem, we investigated if multiplexing the assay with mitochondrial membrane potential measurements using the fluorescent dye, JC-1, could provide further information. We tested 28 drugs in the multiplexed assay and found that, although mitochondrial toxicants could be detected, no additional information was revealed about compounds that caused multifactorial toxicity. Hence, measurements with JC-1 did not provide additional information beyond what was detected using the cell viability assay. We conclude that even though the multiplexed assay is useful for HTS applications, it provides no additional value over the high-glucose-galactose cell viability assay. PMID:21126567

  3. Toxigenicity of culture filtrates of Salmonella enteritidis isolates on three mammalian cell lines.

    PubMed

    Hariharan, H; Heaney, S B; Singer, J T

    1995-07-01

    Culture filtrates of 28 Salmonella enteritidis isolates were tested for toxicity on Vero-, CHO-, and human foreskin fibroblast (HFF) cells. Cytopathic effects on HFF cells were extensive, and were observed even with some filtrates diluted 1:256. Vero cells showed effects with filtrates diluted up to 1:16, and CHO cells gave weak or no reaction. All isolates produced iron-binding siderophores as determined by reactions on chrome-azurol-S medium. PMID:7553360

  4. ZnO nanowires array grown on Ga-doped ZnO single crystal for dye-sensitized solar cells

    PubMed Central

    Hu, Qichang; Li, Yafeng; Huang, Feng; Zhang, Zhaojun; Ding, Kai; Wei, Mingdeng; Lin, Zhang

    2015-01-01

    High quality ZnO nanowires arrays were homoepitaxial grown on Ga-doped ZnO single crystal (GZOSC), which have the advantages of high conductivity, high carrier mobility and high thermal stability. When it was employed as a photoanode in the DSSCs, the cell exhibited a 1.44% power-conversion efficiency under the illumination of one sun (AM 1.5G). The performance is superior to our ZnO nanowires/FTO based DSSCs under the same condition. This enhanced performance is mainly attributed to the perfect interface between the ZnO nanowires and the GZOSC substrate that contributes to lower carrier scattering and recombination rates compared with that grown on traditional FTO substrate. PMID:26099568

  5. ZnO nanowires array grown on Ga-doped ZnO single crystal for dye-sensitized solar cells.

    PubMed

    Hu, Qichang; Li, Yafeng; Huang, Feng; Zhang, Zhaojun; Ding, Kai; Wei, Mingdeng; Lin, Zhang

    2015-01-01

    High quality ZnO nanowires arrays were homoepitaxial grown on Ga-doped ZnO single crystal (GZOSC), which have the advantages of high conductivity, high carrier mobility and high thermal stability. When it was employed as a photoanode in the DSSCs, the cell exhibited a 1.44% power-conversion efficiency under the illumination of one sun (AM 1.5G). The performance is superior to our ZnO nanowires/FTO based DSSCs under the same condition. This enhanced performance is mainly attributed to the perfect interface between the ZnO nanowires and the GZOSC substrate that contributes to lower carrier scattering and recombination rates compared with that grown on traditional FTO substrate. PMID:26099568

  6. Fabrication of hydrogenated amorphous Si/crystalline Si1?xGex (x ? 0.84) heterojunction solar cells grown by solid source molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Oshima, Ryuji; Yamanaka, Mitsuyuki; Kawanami, Hitoshi; Sakata, Isao; Matsubara, Koji; Sugaya, Takeyoshi

    2015-01-01

    We characterized hydrogenated amorphous Si/single-crystalline Si1?xGex heterojunction solar cells grown on Si substrates with Ge content (x) between 0.49 and 0.84 in an effort to develop materials with a bandgap range of 0.9–1.0 eV for solar applications. We showed that 3-µm-thick Si0.16Ge0.84 films grown by molecular-beam epitaxy on a virtual substrate composed of buffer layers with stepwise gradation of their composition have an almost fully strain-relaxed condition and a low dislocation density, less than 105 cm?2. An absorption edge extending up to 1300 nm and an increased quantum efficiency were observed in Si1?xGex cells with x = 0.49, 0.70, and 0.84. Consequently, the short-circuit current density increased non-linearly with Ge content, being 14.0 and 24.0 mA/cm2 for 3-µm-thick Si and Si0.16Ge0.84 cells, respectively.

  7. A vero cell derived combined vaccine against sheep pox and Peste des Petits ruminants for sheep

    Microsoft Academic Search

    S. S. Chaudhary; K. D. Pandey; R. P. Singh; P. C. Verma; P. K. Gupta

    2009-01-01

    The combined sheep pox and Peste des Petits ruminants (PPR) vaccine was prepared in lyophilized form containing recommended doses of both vaccine viruses. Safety and immunogenicity of this combined vaccine was evaluated in sheep. Sheep immunized subcutaneously with 1ml of live attenuated vaccine consisting of 103TCID50 each of sheep pox virus (SPV) Romanian Fanar (RF) strain and Peste des Petits

  8. Antiherpevirus activity of Artemisia arborescens essential oil and inhibition of lateral diffusion in Vero cells

    Microsoft Academic Search

    Manuela Saddi; Adriana Sanna; Filippo Cottiglia; Lorenza Chisu; Laura Casu; Leonardo Bonsignore; Alessandro De Logu

    2007-01-01

    BACKGROUND: New prophylactic and therapeutic tools are needed for the treatment of herpes simplex virus infections. Several essential oils have shown to possess antiviral activity in vitro against a wide spectrum of viruses. AIM: The present study was assess to investigate the activities of the essential oil obtained from leaves of Artemisia arborescens against HSV-1 and HSV-2 METHODS: The cytotoxicity

  9. Comparison of single junction AlGaInP and GaInP solar cells grown by molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Masuda, Taizo; Tomasulo, Stephanie; Lang, Jordan R.; Lee, Minjoo Larry

    2015-03-01

    We have investigated ˜2.0 eV (AlxGa1-x)0.51In0.49P and ˜1.9 eV Ga0.51In0.49P single junction solar cells grown on both on-axis and misoriented GaAs substrates by molecular beam epitaxy (MBE). Although lattice-matched (AlxGa1-x)0.51In0.49P solar cells are highly attractive for space and concentrator photovoltaics, there have been few reports on the MBE growth of such cells. In this work, we demonstrate open circuit voltages (Voc) ranging from 1.29 to 1.30 V for Ga0.51In0.49P cells, and 1.35-1.37 V for (AlxGa1-x)0.51In0.49P cells. Growth on misoriented substrates enabled the bandgap-voltage offset (Woc = Eg/q - Voc) of Ga0.51In0.49P cells to decrease from ˜575 mV to ˜565 mV, while that of (AlxGa1-x)0.51In0.49P cells remained nearly constant at 620 mV. The constant Woc as a function of substrate offcut for (AlxGa1-x)0.51In0.49P implies greater losses from non-radiative recombination compared with the Ga0.51In0.49P devices. In addition to larger Woc values, the (AlxGa1-x)0.51In0.49P cells exhibited significantly lower internal quantum efficiency (IQE) values than Ga0.51In0.49P cells due to recombination at the emitter/window layer interface. A thin emitter design is experimentally shown to be highly effective in improving IQE, particularly at short wavelengths. Our work shows that with further optimization of both cell structure and growth conditions, MBE-grown (AlxGa1-x)0.51In0.49P will be a promising wide-bandgap candidate material for high-efficiency, lattice-matched multi-junction solar cells.

  10. Identification of chikungunya virus interacting proteins in mammalian cells.

    PubMed

    Paingankar, Mandar S; Arankalle, Vidya A

    2014-06-01

    Identification and characterization of virus host interactions is an essential step for the development of novel antiviral strategies. Very few studies have been targeted towards identification of chikungunya virus (CHIKV) interacting host proteins. In current study, virus overlay protein binding assay (VOPBA) and matrix-assisted laser desorption/ ionization time of flight analysis (MALDI TOF/TOF) were employed for the identification of CHIKV binding proteins in mammalian cells. HSP70 and actin were identified as virus binding proteins in HEK-293T and Vero-E6 cells, whereas STAT-2 was identified as an additional protein in Vero-E6 cells. Pre-incubation with anti-HSP70 antibody and miRNA silencing of HSP70 significantly reduced the CHIKV production in HEK-293T and Vero-E6 cells at early time points. These results suggest that CHIKV exploits the housekeeping molecules such as actin, HSP70 and STAT-2 to establish infection in the mammalian cells. PMID:24845503

  11. Significant changes in cell and chloroplast development in young wheat leaves (Triticum aestivum cv Hereward) grown in elevated CO{sub 2}

    SciTech Connect

    Robertson, E.J.; Leech, R.M. [Univ. of York, Heslington (United Kingdom)

    1995-01-01

    Cell and chloroplast development were characterized in young Triticum aestivum cv Hereward leaves grown at ambient (350 {mu}L L{sup {minus}1}) or at elevated (650 {mu}L L{sup {minus}1}) CO{sub 2}. In elevated CO{sub 2}, cell and chloroplast expansion was accelerated by 10 and 25%, respectively, in the first leaf of 7-d-old wheat plants without disruption to the leaf developmental pattern. Elevated CO{sub 2} did not affect the number of chloroplasts in relation to mesophyll cell size or the linear relationship between chloroplast number or size and mesophyll cell size. No major changes in leaf anatomy or in chloroplast ultrastructure were detected as a result of growth in elevated CO{sub 2}, but there was a marked reduction in starch accumulation. In leaf sections fluorescently tagged antisera were used to visualize and quantitate the amount of cytochrome f, the {alpha}- and {beta}-subunits of the coupling factor 1 in ATP synthase, D1 protein of the photosystem II reaction center, the 33-kD protein of the extrinsic oxygen-evolving complex, subunit II of photosystem I, and ribulose-1,5-biphosphate carboxylase/oxygenase. A significant finding was that in 10 to 20% of the mesophyll cells grown in elevated CO{sub 2} the 33-kD protein of the extrinsic oxygen-evolving complex of photosystem II and cytochrome f were deficient by 75%, but the other proteins accumulated normally. 29 refs., 6 figs., 2 tabs.

  12. Fast growth rate GaAs and InGaP for MOCVD grown triple junction solar cells

    Microsoft Academic Search

    C. Ebert; A. Parekh; Z. Pulwin; W. Zhang; D. Lee; D. Byrnes

    2010-01-01

    Triple junction solar cells (TJSC) are the highest efficiency solar cells available today and are utilized in space and concentrator photovoltaic terrestrial applications. These cells are manufactured using metalorganic chemical vapor deposition (MOCVD) in large scale commercial reactors. Since TJSC process time is largely driven by the growth of the (In)GaAs middle cell and InGaP top cell, increasing the MOCVD

  13. Stable expression of hepatitis B virus genome in a primate kidney cell

    Microsoft Academic Search

    H. Takeshima; M. Namiki; J. Inokoshi; T. Lee; A. Abe; Y. Suzuki; S. ?mura

    1989-01-01

    Summary Transfection of Vero cells with cloned hepatitis B virus (HBV) DNA resulted in the secretion of hepatitis B surface protein (HBsAg) and core proteins (HBc\\/eAg). Syntheses of both viral antigens in the transformed Vero cells continued for at least 50 days after cultivation. HBsAg particles were composed of many spherical and some filamentous particles containing both pre-S1 and pre-S2

  14. Polysaccharide multilayer nanoencapsulation of insulin-producing beta-cells grown as pseudoislets for potential cellular delivery of insulin.

    PubMed

    Zhi, Zheng-liang; Liu, Bo; Jones, Peter M; Pickup, John C

    2010-03-01

    This paper describes the use of a layer-by-layer nanocoating technique for the encapsulation of insulin-producing pancreatic beta-cell spheroids (pseudoislets) within chitosan/alginate multilayers. We used pseudoislets self-organized from a population of the insulinoma cell line MIN6, derived from a transgenic mouse expressing the large T-antigen of SV40 in pancreatic beta-cells, as an experimental model for the study of cell nanoencapsulation. The maintenance of spheroid morphology and retention of cell viability and metabolic functionality was demonstrated postencapsulation. By depositing an additional protein-repelling phosphorylcholine-modified chondroitin-4-sulfate layer, the coatings were found to shield effectively access of large molecules of the immune systems to the antigen-presenting cell surfaces. Transmission electron microscopy analysis of the encapsulated pseudoislets revealed that the coating did not damage the cell structure. In addition, nanoencapsulation permits the cells to respond to changes in extracellular glucose and other insulin secretagogues by releasing insulin with a profile similar to that of nonencapsulated cells. These results suggest that this nanofilm encapsulation technique has the characteristics required for the efficient transplantation of cellular engineered beta-cells as a cell replacement therapy for type 1 diabetes. This encapsulation method is general in scope and has implications for use in a variety of cellular therapeutics employing engineered tissues from cells generated in vitro from various sources, including those using genetic and cellular engineering techniques. PMID:20108955

  15. GaInNAs Structures Grown by MBE for High-Efficiency Solar Cells: Final Report; 25 June 1999--24 August 2002

    SciTech Connect

    Tu, C. W.

    2003-08-01

    The focus of this work is to improve the quality of GaInNAs by advanced thin-film growth techniques, such as digital-alloy growth techniques and migration-enhanced epitaxy (MEE). The other focus is to further investigate the properties of such materials, which are potentially beneficial for high-efficiency, multijunction solar cells. 400-nm-thick strain-compensated Ga0.92In0.08As/GaN0.03As0.97 short-period superlattices (SPSLs) are grown lattice-matched to GaAs substrates. The photoluminescence (PL) intensity of digital alloys is 3 times higher than that of random alloys at room temperature, and the improvement is even greater at low temperature, by a factor of about 12. The room-temperature PL intensity of the GaInNAs quantum well grown by the strained InAs/GaN0.023As SPSL growth mode is higher by a factor 5 as compare to the continuous growth mode. The SPSL growth method allows for independent adjustment of the In-to-Ga ratio without group III competition. MEE reduces the low-energy tail of PL, and PL peaks become more intense and sharper. The twin peaks photoluminescence of GaNAs grown on GaAs was observed at room temperature. The peaks splitting increase with increase in nitrogen alloy content. The strain-induced splitting of light-hole and heavy-hole bands of tensile-strained GaNAs is proposed as an explanation of such behavior.

  16. Photocurrent enhancement in In 0.53Ga 0.47As solar cells grown on InP/SiO II/Si transferred epitaxial templates

    NASA Astrophysics Data System (ADS)

    Zahler, James M.; Tanabe, Katsuaki; Ladous, Corinne; Pinnington, Tom; Newman, Frederick D.; Atwater, Harry A.

    2007-09-01

    InP/Si engineered substrates formed by wafer bonding and layer transfer have the potential to significantly reduce the cost and weight of III-V compound semiconductor solar cells. InP/Si substrates were prepared by He implantation of InP prior to bonding to a thermally oxidized Si substrate and annealing to exfoliate an InP thin film. Following thinning of the transferred InP film to remove surface damage caused by the implantation and exfoliation process, InGaAs solar cells lattice-matched to bulk InP were grown on these substrates using metal-organic chemical vapor deposition. The photovoltaic current-voltage characteristics of the InGaAs cells fabricated on the wafer-bonded InP/Si substrates were comparable to those synthesized on commercially available epi-ready InP substrates, and had a ~20% higher short-circuit current which we attribute to the high reflectivity of the InP/SiO II/Si bonding interface. This work provides an initial demonstration of wafer-bonded InP/Si substrates as an alternative to bulk InP substrates for solar cell applications.

  17. Human RPE Stem Cells Grown into Polarized RPE Monolayers on a Polyester Matrix Are Maintained after Grafting into Rabbit Subretinal Space

    PubMed Central

    Stanzel, Boris V.; Liu, Zengping; Somboonthanakij, Sudawadee; Wongsawad, Warapat; Brinken, Ralf; Eter, Nicole; Corneo, Barbara; Holz, Frank G.; Temple, Sally; Stern, Jeffrey H.; Blenkinsop, Timothy A.

    2014-01-01

    Summary Transplantation of the retinal pigment epithelium (RPE) is being developed as a cell-replacement therapy for age-related macular degeneration. Human embryonic stem cell (hESC) and induced pluripotent stem cell (iPSC)-derived RPE are currently translating toward clinic. We introduce the adult human RPE stem cell (hRPESC) as an alternative RPE source. Polarized monolayers of adult hRPESC-derived RPE grown on polyester (PET) membranes had near-native characteristics. Trephined pieces of RPE monolayers on PET were transplanted subretinally in the rabbit, a large-eyed animal model. After 4 days, retinal edema was observed above the implant, detected by spectral domain optical coherence tomography (SD-OCT) and fundoscopy. At 1 week, retinal atrophy overlying the fetal or adult transplant was observed, remaining stable thereafter. Histology obtained 4 weeks after implantation confirmed a continuous polarized human RPE monolayer on PET. Taken together, the xeno-RPE survived with retained characteristics in the subretinal space. These experiments support that adult hRPESC-derived RPE are a potential source for transplantation therapies. PMID:24511471

  18. Effects of radiation of InP cells epitaxially grown on Si and GaAs substrates

    Microsoft Academic Search

    I. Weinberg; C. K. Swartz; D. J. Brinker; D. M. Wilt

    1990-01-01

    The properties of heteroepitaxial InP cells were determined both before and after 10-MeV proton irradiations. Numerical values, obtained for the diffusion and recombination components of the reverse saturation currents, were found to be consistent with the distribution of dislocations. The radiation resistance of the heteroepitaxial cells was significantly greater than that observed for n\\/p homoepitaxial InP cells. The carrier removal

  19. Effects of radiation of InP cells epitaxially grown on Si and GaAs substrates

    Microsoft Academic Search

    I. Weinberg; C. K. Swartz; D. J. Brinker; D. M. Wilt

    1990-01-01

    The properties of heteroepitaxial InP solar cells were determined both before and after 10 MeV proton irradiations. Numerical values, obtained for the diffusion and recombination components of the reverse saturation currents, were found to be consistent with the distribution of dislocations. The radiation resistance of the heteroepitaxial cells was significantly greater than that observed for n\\/p homoepitaxial InP cells. The

  20. Influence of sodium and potassium ions on acid production by washed cells of Streptococcus mutans ingbritt and Streptococcus sanguis NCTC 7865 grown in a chemostat.

    PubMed

    Marsh, P D; Williamson, M I; Keevil, C W; McDermid, A S; Ellwood, D C

    1982-05-01

    A comparison was made of acid production by cells of Streptococcus mutans Ingbritt and S. sanguis NCTC 7865 that had been washed twice and incubated in different concentrations of sodium and potassium ions. Organisms were grown under defined conditions in a chemostat under both glucose limitation and glucose excess conditions at a dilution rate of 0.1 h(-1) (mean generation time, 6.9 h). Acid production after a pulse of glucose, sucrose, and fructose was measured by pH fall experiments and as a rate at pH 7.0. S. mutans produced more acid than S. sanguis as measured by either criterion, although statistically faster rates of acid production and lower terminal pH values were obtained when cells of both species were suspended in KCl rather than in NaCl, with 200 mM KCl resulting in the lowest terminal pH in pH fall experiments. Sodium ions inhibited acid production: 183 mM NaCl reduced the glycolytic rates of S. mutans and S. sanguis metabolizing glucose at pH 7.0 in 135 mM KCl by 39 and 33%, respectively. The most pronounced stimulatory effect of potassium on acid production was by washed cells of S. sanguis that had been grown under arginine and under phosphate limitation. The pH fell by a further 0.86 and 1.21 pH units, respectively, and to below the critical pH for enamel demineralization when these cells were metabolizing glucose in 135 mM KCl compared with the same concentration of NaCl. This enhancement of acid production was not due to potassium translocation, as had been suggested previously, because no movement of potassium ions across the cell membrane could be detected. An alternative explanation is proposed in which sodium ions are excluded from the cell at the expense of membrane energy, i.e., the proton motive force, which could otherwise be used for the transport of sugars. PMID:7085068

  1. Influence of Sodium and Potassium Ions on Acid Production by Washed Cells of Streptococcus mutans Ingbritt and Streptococcus sanguis NCTC 7865 Grown in a Chemostat

    PubMed Central

    Marsh, Philip D.; Williamson, Michael I.; Keevil, C. William; McDermid, Ann S.; Ellwood, Derek C.

    1982-01-01

    A comparison was made of acid production by cells of Streptococcus mutans Ingbritt and S. sanguis NCTC 7865 that had been washed twice and incubated in different concentrations of sodium and potassium ions. Organisms were grown under defined conditions in a chemostat under both glucose limitation and glucose excess conditions at a dilution rate of 0.1 h?1 (mean generation time, 6.9 h). Acid production after a pulse of glucose, sucrose, and fructose was measured by pH fall experiments and as a rate at pH 7.0. S. mutans produced more acid than S. sanguis as measured by either criterion, although statistically faster rates of acid production and lower terminal pH values were obtained when cells of both species were suspended in KCl rather than in NaCl, with 200 mM KCl resulting in the lowest terminal pH in pH fall experiments. Sodium ions inhibited acid production: 183 mM NaCl reduced the glycolytic rates of S. mutans and S. sanguis metabolizing glucose at pH 7.0 in 135 mM KCl by 39 and 33%, respectively. The most pronounced stimulatory effect of potassium on acid production was by washed cells of S. sanguis that had been grown under arginine and under phosphate limitation. The pH fell by a further 0.86 and 1.21 pH units, respectively, and to below the critical pH for enamel demineralization when these cells were metabolizing glucose in 135 mM KCl compared with the same concentration of NaCl. This enhancement of acid production was not due to potassium translocation, as had been suggested previously, because no movement of potassium ions across the cell membrane could be detected. An alternative explanation is proposed in which sodium ions are excluded from the cell at the expense of membrane energy, i.e., the proton motive force, which could otherwise be used for the transport of sugars. PMID:7085068

  2. High external quantum efficiency and fill-factor InGaN/GaN heterojunction solar cells grown by NH{sub 3}-based molecular beam epitaxy

    SciTech Connect

    Lang, J. R.; Hurni, C. A.; Cruz, S. C.; Matioli, E.; Speck, J. S. [Department of Materials, University of California, Santa Barbara, California 93106 (United States); Neufeld, C. J.; Mishra, U. K. [Department of Electrical and Computer Engineering, University of California, Santa Barbara, California 93106 (United States)

    2011-03-28

    High external quantum efficiency (EQE) p-i-n heterojunction solar cells grown by NH{sub 3}-based molecular beam epitaxy are presented. EQE values including optical losses are greater than 50% with fill-factors over 72% when illuminated with a 1 sun AM0 spectrum. Optical absorption measurements in conjunction with EQE measurements indicate an internal quantum efficiency greater than 90% for the InGaN absorbing layer. By adjusting the thickness of the top p-type GaN window contact layer, it is shown that the short-wavelength (<365 nm) quantum efficiency is limited by the minority carrier diffusion length in highly Mg-doped p-GaN.

  3. Effects of the aspect ratio on the dye adsorption of ZnO nanorods grown by using a sonochemical method for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Choi, Seok Cheol; Yun, Won Suk; Sohn, Sang Ho; Oh, Sang Jin

    2012-11-01

    Well-aligned ZnO nanorods for the photoelectrode of dye-sensitized solar cells (DSSCs) were grown via a sonochemical method, and the effects of their aspect ratios on the dye adsorption in DSSCs were studied. The control of the aspect ratio of well-aligned ZnO nanorods was performed by tuning the mole concentration of zinc acetate dehydrate in the range of 0.04-0.06M. The dye amounts adsorbed in the ZnO nanorods were estimated from the UV-Visible absorbance by using the Beer-Lambert law. The efficiency of DSSCs with ZnO nanorods was measured to investigate the effects of the aspect ratio of the ZnO nanorods on the dye adsorption properties. A change in the aspect ratio of the ZnO nanorods was founded to yield a change in their dye adsorption ability, resulting in a change in the efficiency of the DSSCs.

  4. Vorinostat enhances the radiosensitivity of a breast cancer brain metastatic cell line grown in vitro and as intracranial xenografts

    PubMed Central

    Baschnagel, Andrew; Russo, Andrea; Burgan, William E.; Carter, Donna; Beam, Katie; Palmieri, Diane; Steeg, Patricia S.; Tofilon, Philip; Camphausen, Kevin

    2012-01-01

    Vorinostat (suberoylanilide hydroxamic acid), a histone deacetylase inhibitor, is currently undergoing clinical evaluation as therapy for cancer. We investigated the effects of vorinostat on tumor cell radiosensitivity in a breast cancer brain metastasis model using MDA-MB-231-BR cells. In vitro radiosensitivity was evaluated using clonogenic assay. Cell cycle distribution and apoptosis was measured using flow cytometry. DNA damage and repair was evaluated using ?H2AX. Mitotic catastrophe was measured by immunostaining. Growth delay and intracranial xenograft models were used to evaluate the in vivo tumor radiosensitivity. Cells exposed to vorinostat for 16 hours before and maintained in the medium after irradiation had an increase in radiosensitivity with a dose enhancement factor of 1.57. ?H2AX, as an indicator of double-strand breaks, had significantly more foci per cell in the vorinostat plus irradiation group. Mitotic catastrophe, measured at 72 hours, was significantly increased in cells receiving vorinostat plus irradiation. Irradiation of s.c. MDA-MB-231-BR tumors in mice treated with vorinostat resulted in an increase in radiation-induced tumor growth delay. Most importantly, animals with intracranial tumor implants lived the longest after combination treatment. These results indicate that vorinostat enhances tumor cell radiosensitivity in vitro and in vivo. There was a greater than additive improvement in survival in our intracranial model. Combining vorinostat with radiation may be a potential treatment option for patients with breast cancer who develop brain metastases. PMID:19509253

  5. Vorinostat enhances the radiosensitivity of a breast cancer brain metastatic cell line grown in vitro and as intracranial xenografts.

    PubMed

    Baschnagel, Andrew; Russo, Andrea; Burgan, William E; Carter, Donna; Beam, Katie; Palmieri, Diane; Steeg, Patricia S; Tofilon, Philip; Camphausen, Kevin

    2009-06-01

    Vorinostat (suberoylanilide hydroxamic acid), a histone deacetylase inhibitor, is currently undergoing clinical evaluation as therapy for cancer. We investigated the effects of vorinostat on tumor cell radiosensitivity in a breast cancer brain metastasis model using MDA-MB-231-BR cells. In vitro radiosensitivity was evaluated using clonogenic assay. Cell cycle distribution and apoptosis was measured using flow cytometry. DNA damage and repair was evaluated using gammaH2AX. Mitotic catastrophe was measured by immunostaining. Growth delay and intracranial xenograft models were used to evaluate the in vivo tumor radiosensitivity. Cells exposed to vorinostat for 16 hours before and maintained in the medium after irradiation had an increase in radiosensitivity with a dose enhancement factor of 1.57. gammaH2AX, as an indicator of double-strand breaks, had significantly more foci per cell in the vorinostat plus irradiation group. Mitotic catastrophe, measured at 72 hours, was significantly increased in cells receiving vorinostat plus irradiation. Irradiation of s.c. MDA-MB-231-BR tumors in mice treated with vorinostat resulted in an increase in radiation-induced tumor growth delay. Most importantly, animals with intracranial tumor implants lived the longest after combination treatment. These results indicate that vorinostat enhances tumor cell radiosensitivity in vitro and in vivo. There was a greater than additive improvement in survival in our intracranial model. Combining vorinostat with radiation may be a potential treatment option for patients with breast cancer who develop brain metastases. PMID:19509253

  6. Stability of single and tandem junction a-Si:H solar cells grown using the ECR process

    SciTech Connect

    Dalal, V.L.; Maxson, T.; Girvan, R.; Haroon, S.

    1997-07-01

    The authors report on the fabrication and stability tests of single junction a-Si:H, and tandem junction a-Si:H/A-Si:H solar cells using the ECR process under high hydrogen dilution (H-ECR process). They show that devices with high fill factors can be made using the H-ECR process. They also report on the stability studies of the solar cells under 1 and 2-sun illumination conditions. The solar cells show very little degradation even after 500 hours of illumination under 2 x sunlight illumination.

  7. Lipid content and fatty acid composition of green algae Scenedesmus obliquus grown in a constant cell density apparatus

    NASA Technical Reports Server (NTRS)

    Choi, K. J.; Nakhost, Z.; Barzana, E.; Karel, M.

    1987-01-01

    The lipids of alga Scenedesmus obliquus grown under controlled conditions were separated and fractionated by column and thin-layer chromatography, and fatty acid composition of each lipid component was studied by gas-liquid chromatography (GLC). Total lipids were 11.17%, and neutral lipid, glycolipid and phospholipid fractions were 7.24%, 2.45% and 1.48% on a dry weight basis, respectively. The major neutral lipids were diglycerides, triglycerides, free sterols, hydrocarbons and sterol esters. The glycolipids were: monogalactosyl diglyceride, digalactosyl diglyceride, esterified sterol glycoside, and sterol glycoside. The phospholipids included: phosphatidyl choline, phosphatidyl glycerol and phosphatidyl ethanolamine. Fourteen fatty acids were identified in the four lipid fractions by GLC. The main fatty acids were C18:2, C16:0, C18:3(alpha), C18:1, C16:3, C16:1, and C16:4. Total unsaturated fatty acid and essential fatty acid compositions of the total algal lipids were 80% and 38%, respectively.

  8. The polyGeVero® software for fast and easy computation of 3D radiotherapy dosimetry data

    NASA Astrophysics Data System (ADS)

    Kozicki, Marek; Maras, Piotr

    2015-01-01

    The polyGeVero® software package was elaborated for calculations of 3D dosimetry data such as the polymer gel dosimetry. It comprises four workspaces designed for: i) calculating calibrations, ii) storing calibrations in a database, iii) calculating dose distribution 3D cubes, iv) comparing two datasets e.g. a measured one with a 3D dosimetry with a calculated one with the aid of a treatment planning system. To accomplish calculations the software was equipped with a number of tools such as the brachytherapy isotopes database, brachytherapy dose versus distance calculation based on the line approximation approach, automatic spatial alignment of two 3D dose cubes for comparison purposes, 3D gamma index, 3D gamma angle, 3D dose difference, Pearson's coefficient, histograms calculations, isodoses superimposition for two datasets, and profiles calculations in any desired direction. This communication is to briefly present the main functions of the software and report on the speed of calculations performed by polyGeVero®.

  9. Gallium phosphide epitaxial films for silicon-based multi-junction solar cells grown by liquid phase epitaxy

    Microsoft Academic Search

    Susan R. Huang; Xuesong Lu; A. Barnett; R. L. Opila

    2010-01-01

    The growth of thin layers of III-V semiconductors on a silicon platform for multijunction solar cell applications has the benefits of reduced materials cost and standing on the well-developed silicon integrated circuit and solar cell technology. A prime candidate for developing such a platform is gallium phosphide (GaP) because it has a 0.37% lattice mismatch with Si which is favorable

  10. Retinoic acid modulates the radiosensitivity of head-and-neck squamous carcinoma cells grown in collagen gel

    Microsoft Academic Search

    Lorenzo Rossi; Renzo Corvò

    2002-01-01

    Purpose: Collagen gels are increasingly regarded as reliable scaffolds for studying cells in vitro, displaying the same three-dimensional network of collagen fibers as encountered in vivo. As a contribution to therapeutic control of head-and-neck cancer, we grew HSCO86 cells in collagen gel and assessed their behavior in the presence of retinoic acid (RA) and radiation.Methods and Materials: The malignant epithelial

  11. Effects of radiation of InP cells epitaxially grown on Si and GaAs substrates

    NASA Technical Reports Server (NTRS)

    Weinberg, I.; Swartz, C. K.; Brinker, D. J.; Wilt, D. M.

    1990-01-01

    The properties of heteroepitaxial InP cells were determined both before and after 10-MeV proton irradiations. Numerical values, obtained for the diffusion and recombination components of the reverse saturation currents, were found to be consistent with the distribution of dislocations. The radiation resistance of the heteroepitaxial cells was significantly greater than that observed for n/p homoepitaxial InP cells. The carrier removal rate, obtained by C-V measurements, was 1800/cm for 10-MeV protons compared with 2.2/cm for 1-MeV electrons. The high carrier removal rate was found to have no significant effect on the cell's series resistance. It was concluded that the heteroepitaxial cell performance is dominated by the high dislocation density attributable to lattice constant mismatch. Although the efficiencies of the present cells are low, the recent achievement of 13.7 percent AM0 efficiencies using a GaAs substrate demonstrates the marked improvement that can be attained using more appropriate transition layers.

  12. High-efficiency Al sub 0. 22 Ga sub 0. 78 As solar cells grown by molecular beam epitaxy

    SciTech Connect

    Melloch, M.R. (School of Electrical Engineering, Purdue University, West Lafayette, Indiana 47907 (USA)); Tobin, S.P.; Bajgar, C. (Spire Corporation, Patriots Park, Bedford, MA (USA)); Keshavarzi, A.; Stellwag, T.B.; Lush, G.B.; Lundstrom, M.S. (School of Electrical Engineering, Purdue University, West Lafayette, IN (USA)); Emery, K. (Solar Energy Research Institute, Golden, CO (USA))

    1990-07-02

    The quality of {ital pn} junction photodetectors made of Al{sub 0.2}Ga{sub 0.8}As has been investigated as a first step in the optimization of tandem solar cells. We have obtained 1 sun AM1.5 efficiencies of 16.1% for 0.25 cm{sup 2} Al{sub 0.22}Ga{sub 0.78}As solar cells fabricated from molecular beam epitaxy (MBE) material. This efficiency is 3.2 percentage points higher than the previously best reported efficiency of 12.9% for an Al{sub 0.2}Ga{sub 0.8}As solar cell fabricated from MBE material.

  13. Inductively coupled plasma grown semiconductor films for low cost solar cells with improved light-soaking stability

    NASA Astrophysics Data System (ADS)

    Shen, Chang-Hong; Shieh, Jia-Min; Huang, Jung Y.; Kuo, Hao-Chung; Hsu, Chih-Wei; Dai, Bau-Tong; Lee, Ching-Ting; Pan, Ci-Ling; Yang, Fu-Liang

    2011-07-01

    We investigate the performance of a single-junction amorphous Si (a-Si) solar cell fabricated with inductively coupled plasma (ICP) deposition technique. The high-density plasma resulting from high dissociation capacity of ICP enables good-quality hydrogenated Si films to be synthesized at low temperatures. High-density ICP also promotes the diffusion of reactive radicals on substrates and forms a-Si:H films with low defect density (˜3 × 1015 cm-3). We demonstrate single-junction a-Si solar cells with a conversion efficiency of 9.6% and improved light-soaking stability. This low thermal-budget thin-film technique could open up the feasibility of efficient thin film solar cells on flexible substrates.

  14. Stem Cells Grown in Osteogenic Medium on PLGA, PLGA/HA, and Titanium Scaffolds for Surgical Applications

    PubMed Central

    Asti, Annalia; Gastaldi, Giulia; Dorati, Rossella; Saino, Enrica; Conti, Bice; Visai, Livia; Benazzo, Francesco

    2010-01-01

    Pluripotent adipose tissue-derived stem cells (hASCs) can differentiate into various mesodermal cell types such as osteoblasts, chondroblasts, and myoblasts. We isolated hASCs from subcutaneous adipose tissue during orthopaedic surgery and induced the osteogenic differentiation for 28 days on three different synthetic scaffolds such as polylactide-co-glycolide (PLGA), polylactide-co-glycolide/hydroxyapatite (PLGA/HA), and trabecular titanium scaffolds (Ti6Al4V). Pore size can influence certain criteria such as cell attachment, infiltration, and vascularization. The aim of this study was to investigate the performance of PLGA and PLGA/HA scaffolds with a higher porosity, ranging between 75% and 84%, with respect to Ti scaffolds but with smaller pore size, seeded with hASCs to develop a model that could be used in the treatment of bone defects and fractures. Osteogenesis was assessed by ELISA quantitation of extracellular matrix protein expression, von Kossa staining, X-ray microanalysis, and scanning electron microscopy. The higher amount of protein matrix on the Ti scaffold with respect to PLGA and PLGA/HA leads to the conclusion that not only the type of material but the structure significantly affects cell proliferation. PMID:21234383

  15. Hap4p overexpression in glucose-grown Saccharomyces cerevisiae induces cells to enter a novel metabolic state

    Microsoft Academic Search

    Romeo Lascaris; Harmen J Bussemaker; André Boorsma; Matt Piper; Hans van der Spek; Les Grivell; Jolanda Blom

    2002-01-01

    BACKGROUND: Metabolic and regulatory gene networks generally tend to be stable. However, we have recently shown that overexpression of the transcriptional activator Hap4p in yeast causes cells to move to a state characterized by increased respiratory activity. To understand why overexpression of HAP4 is able to override the signals that normally result in glucose repression of mitochondrial function, we analyzed

  16. Biofilm-grown Burkholderia cepacia complex cells survive antibiotic treatment by avoiding production of reactive oxygen species.

    PubMed

    Van Acker, Heleen; Sass, Andrea; Bazzini, Silvia; De Roy, Karen; Udine, Claudia; Messiaen, Thomas; Riccardi, Giovanna; Boon, Nico; Nelis, Hans J; Mahenthiralingam, Eshwar; Coenye, Tom

    2013-01-01

    The presence of persister cells has been proposed as a factor in biofilm resilience. In the present study we investigated whether persister cells are present in Burkholderia cepacia complex (Bcc) biofilms, what the molecular basis of antimicrobial tolerance in Bcc persisters is, and how persisters can be eradicated from Bcc biofilms. After treatment of Bcc biofilms with high concentrations of various antibiotics often a small subpopulation survived. To investigate the molecular mechanism of tolerance in this subpopulation, Burkholderia cenocepacia biofilms were treated with 1024 µg/ml of tobramycin. Using ROS-specific staining and flow cytometry, we showed that tobramycin increased ROS production in treated sessile cells. However, approximately 0.1% of all sessile cells survived the treatment. A transcriptome analysis showed that several genes from the tricarboxylic acid cycle and genes involved in the electron transport chain were downregulated. In contrast, genes from the glyoxylate shunt were upregulated. These data indicate that protection against ROS is important for the survival of persisters. To confirm this, we determined the number of persisters in biofilms formed by catalase mutants. The persister fraction in ?katA and ?katB biofilms was significantly reduced, confirming the role of ROS detoxification in persister survival. Pretreatment of B. cenocepacia biofilms with itaconate, an inhibitor of isocitrate lyase (ICL), the first enzyme in the glyoxylate shunt, reduced the persister fraction approx. 10-fold when the biofilms were subsequently treated with tobramycin. In conclusion, most Bcc biofilms contain a significant fraction of persisters that survive treatment with high doses of tobramycin. The surviving persister cells downregulate the TCA cycle to avoid production of ROS and at the same time activate an alternative pathway, the glyoxylate shunt. This pathway may present a novel target for combination therapy. PMID:23516582

  17. Exogenous ACE2 Expression Allows Refractory Cell Lines To Support Severe Acute Respiratory Syndrome Coronavirus Replication

    PubMed Central

    Mossel, Eric C.; Huang, Cheng; Narayanan, Krishna; Makino, Shinji; Tesh, Robert B.; Peters, C. J.

    2005-01-01

    Of 30 cell lines and primary cells examined, productive severe acute respiratory syndrome coronavirus (Urbani strain) (SARS-CoV) infection after low-multiplicity inoculation was detected in only six: three African green monkey kidney epithelial cell lines (Vero, Vero E6, and MA104), a human colon epithelial line (CaCo-2), a porcine kidney epithelial line [PK(15)], and mink lung epithelial cells (Mv 1 Lu). SARS-CoV produced a lytic infection in Vero, Vero E6, and MA104 cells, but there was no visible cytopathic effect in Caco-2, Mv 1 Lu, or PK(15) cells. Multistep growth kinetics were identical in Vero E6 and MA104 cells, with maximum titer reached 24 h postinoculation (hpi). Virus titer was maximal 96 hpi in CaCo-2 cells, and virus was continually produced from infected CaCo-2 cells for at least 6 weeks after infection. CaCo-2 was the only human cell type of 13 tested that supported efficient SARS-CoV replication. Expression of the SARS-CoV receptor, angiotensin-converting enzyme 2 (ACE2), resulted in SARS-CoV replication in all refractory cell lines examined. Titers achieved were variable and dependent upon the method of ACE2 expression. PMID:15731278

  18. Activity of mitochondrially synthesized reporter proteins is lower than that of imported proteins and is increased by lowering cAMP in glucose-grown Saccharomyces cerevisiae cells.

    PubMed Central

    Demlow, Christina M; Fox, Thomas D

    2003-01-01

    We selected for increased phenotypic expression of a synthetic cox2::arg8m-G66S reporter gene inserted into Saccharomyces cerevisiae mtDNA in place of COX2. Recessive mutations in ras2 and cyr1, as well as elevated dosage of PDE2, allowed cox2::arg8m-G66S to support Arg prototrophy. Each of these genetic alterations should decrease cellular cAMP levels. The resulting signal was transduced through redundant action of the three cAMP-dependent protein kinases, TPK1, TPK2, and TPK3. ras2 had little or no effect on the level of wild-type Arg8p encoded by cox2::ARG8m, but did increase Arg8p activity, as judged by growth phenotype. ras2 also caused increased fluorescence in cells carrying the synthetic cox3::GFPm reporter in mtDNA, but had little effect on the steady-state level of GFP polypeptide detected immunologically. Thus, decreased cAMP levels did not affect the synthesis of mitochondrially coded protein reporters in glucose-grown cells, but rather elevated activities in the matrix that promote efficient folding. Furthermore, we show that when Arg8p is synthesized in the cytoplasm and imported into mitochondria, it has greater activity than when it is synthesized in the matrix. Thus, mitochondrially synthesized proteins may not have the same access to matrix chaperones as cytoplasmically synthesized proteins emerging from the import apparatus. PMID:14668357

  19. Stoichiometry controlled conversion efficiency in nanostructured heterojunction solar cell of CdS\\/CuInS X Se 2? X grown by chemical ion exchange method at room temperature

    Microsoft Academic Search

    Rajesh A. Joshi; Vidya S. Taur; Anil V. Ghule; Ramphal Sharma

    2011-01-01

    Here in the present paper, we report on growth of stoichiometric and nonstoichiometric nanostructured heterojunction solar cell of CdS\\/CuInSXSe2–X varying X from 0 to 2 in the interval of 0.5 using cost effective, simple, chemical ion exchange method at room temperature on ITO glass substrate. The as-grown varying composition solar cells annealed at 200°C in air and characterized for structural,

  20. Cellular and molecular events during chondrogenesis of human mesenchymal stromal cells grown in a three-dimensional hyaluronan based scaffold

    Microsoft Academic Search

    Gina Lisignoli; Sandra Cristino; Anna Piacentini; Stefania Toneguzzi; Francesco Grassi; Carola Cavallo; Nicoletta Zini; Liliana Solimando; Nadir Mario Maraldi; Andrea Facchini

    2005-01-01

    Mesenchymal stromal cells (MSCs) seem to be a good alternative to chondrocytes for cartilage regeneration. To obtain new information on the sequence of cellular and molecular events during in vitro chondrogenic differentiation we analysed MSCs on a widely used hyaluronic acid biomaterial (Hyaff®-11). Cellular differentiation was induced using two different concentrations of TGF?1 (10 and 20ng\\/ml) and the process was

  1. High efficiency CdS\\/CdTe solar cells from solution-grown CdS films

    Microsoft Academic Search

    T. L. Chu; S. S. Chu; C. Ferekides; C. Q. Wu; C. Wang

    1991-01-01

    Adherent thin films of CdS were deposited on glass and SnO2 :F\\/glass substrates from an aqueous solution, and the important process parameters were investigated. The deposited films show high optical transmission at sub-bandgap wavelengths and high photoconductivity ratios. Thin-film CdS\\/CdTe solar cells have been prepared by depositing p-CdTe films onto CdS-SnO2:F\\/glass substrates by close-spaced sublimation. Junction photovoltage spectroscopy has been

  2. InGaAs/GaAsP strain balanced multi-quantum wires grown on misoriented GaAs substrates for high efficiency solar cells

    SciTech Connect

    Alonso-Álvarez, D.; Thomas, T.; Führer, M.; Hylton, N. P.; Ekins-Daukes, N. J. [Department of Physics, Imperial College, London SW7 2BZ (United Kingdom); Lackner, D.; Philipps, S. P.; Bett, A. W. [Fraunhofer Institute for Solar Energy Systems ISE, Heidenhofstrasse 2, 79110 Freiburg (Germany); Sodabanlu, H.; Fujii, H.; Watanabe, K.; Sugiyama, M. [Department of Electrical Engineering and Information Systems, The University of Tokyo, Tokyo (Japan); Nasi, L.; Campanini, M. [CNR-IMEM Sezione di Parma, Parco Area delle Scienze 37/A, 43010 Fontanini-Parma (Italy)

    2014-08-25

    Quantum wires (QWRs) form naturally when growing strain balanced InGaAs/GaAsP multi-quantum wells (MQW) on GaAs [100] 6° misoriented substrates under the usual growth conditions. The presence of wires instead of wells could have several unexpected consequences for the performance of the MQW solar cells, both positive and negative, that need to be assessed to achieve high conversion efficiencies. In this letter, we study QWR properties from the point of view of their performance as solar cells by means of transmission electron microscopy, time resolved photoluminescence and external quantum efficiency (EQE) using polarised light. We find that these QWRs have longer lifetimes than nominally identical QWs grown on exact [100] GaAs substrates, of up to 1??s, at any level of illumination. We attribute this effect to an asymmetric carrier escape from the nanostructures leading to a strong 1D-photo-charging, keeping electrons confined along the wire and holes in the barriers. In principle, these extended lifetimes could be exploited to enhance carrier collection and reduce dark current losses. Light absorption by these QWRs is 1.6 times weaker than QWs, as revealed by EQE measurements, which emphasises the need for more layers of nanostructures or the use light trapping techniques. Contrary to what we expected, QWR show very low absorption anisotropy, only 3.5%, which was the main drawback a priori of this nanostructure. We attribute this to a reduced lateral confinement inside the wires. These results encourage further study and optimization of QWRs for high efficiency solar cells.

  3. Regulation of Cell Division, Biofilm Formation, and Virulence by FlhC in Escherichia coli O157:H7 Grown on Meat?†

    PubMed Central

    Sule, Preeti; Horne, Shelley M.; Logue, Catherine M.; Prüß, Birgit M.

    2011-01-01

    To understand the continuous problems that Escherichia coli O157:H7 causes as food pathogen, this study assessed global gene regulation in bacteria growing on meat. Since FlhD/FlhC of E. coli K-12 laboratory strains was previously established as a major control point in transducing signals from the environment to several cellular processes, this study compared the expression pattern of an E. coli O157:H7 parent strain to that of its isogenic flhC mutant. This was done with bacteria that had been grown on meat. Microarray experiments revealed 287 putative targets of FlhC. Real-time PCR was performed as an alternative estimate of transcription and confirmed microarray data for 13 out of 15 genes tested (87%). The confirmed genes are representative of cellular functions, such as central metabolism, cell division, biofilm formation, and pathogenicity. An additional 13 genes from the same cellular functions that had not been hypothesized as being regulated by FlhC by the microarray experiment were tested with real-time PCR and also exhibited higher expression levels in the flhC mutant than in the parent strain. Physiological experiments were performed and confirmed that FlhC reduced the cell division rate, the amount of biofilm biomass, and pathogenicity in a chicken embryo lethality model. Altogether, this study provides valuable insight into the complex regulatory network of the pathogen that enables its survival under various environmental conditions. This information may be used to develop strategies that could be used to reduce the number of cells or pathogenicity of E. coli O157:H7 on meat by interfering with the signal transduction pathways. PMID:21498760

  4. Inhibition of vimentin or B1 integrin reverts morphology of prostate tumor cells grown in laminin-rich extracellular matrix gels and reduces tumor growth in vivo

    SciTech Connect

    Zhang, Xueping; Fournier, Marcia V; Ware, Joy L; Bissell, Mina J; Yacoub, Adly; Zehner, Zendra E

    2008-06-12

    Prostate epithelial cells grown embedded in laminin-rich extracellular matrix (lrECM) undergo morphologic changes that closely resemble their architecture in vivo. In this study, growth characteristics of three human prostate epithelial sublines derived from the same cellular lineage, but displaying different tumorigenic and metastatic properties in vivo, were assessed in three-dimensional lrECM gels. M12, a highly tumorigenic and metastatic subline, was derived from the immortalized, prostate epithelial P69 cell line by selection in athymic, nude mice and found to contain a deletion of 19p-q13.1. The stable reintroduction of an intact human chromosome 19 into M12 resulted in a poorly tumorigenic subline, designated F6. When embedded in lrECM gels, the parental, nontumorigenic P69 line produced acini with clearly defined lumena. Immunostaining with antibodies to {beta}-catenin, E-cadherin, or {alpha}6 and {beta}1 integrins showed polarization typical of glandular epithelium. In contrast, the metastatic M12 subline produced highly disorganized cells with no evidence of polarization. The F6 subline reverted to acini-like structures exhibiting basal polarity marked with integrins. Reducing either vimentin levels via small interfering RNA interference or the expression of {alpha}6 and {beta}1 integrins by the addition of blocking antibodies, reorganized the M12 subline into forming polarized acini. The loss of vimentin significantly reduced M12-Vim tumor growth when assessed by s.c. injection in athymic mice. Thus, tumorigenicity in vivo correlated with disorganized growth in three-dimensional lrECM gels. These studies suggest that the levels of vimentin and {beta}1 integrin play a key role in the homeostasis of the normal acinus in prostate and that their dysregulation may lead to tumorigenesis. [Mol Cancer Ther 2009;8(3):499-508].

  5. Adenosine accelerates the healing of diabetic ischemic ulcers by improving autophagy of endothelial progenitor cells grown on a biomaterial

    PubMed Central

    Chen, Wen; Wu, Yangxiao; Li, Li; Yang, Mingcan; Shen, Lei; Liu, Ge; Tan, Ju; Zeng, Wen; Zhu, Chuhong

    2015-01-01

    Endothelial progenitor cells (EPCs) seeded on biomaterials can effectively promote diabetic ischemic wound healing. However, the function of transplanted EPCs is negatively affected by a high-glucose and ischemic microenvironment. Our experiments showed that EPC autophagy was inhibited and mitochondrial membrane potential (MMP) was increased in diabetic patients, while adenosine treatment decreased the energy requirements and increased the autophagy levels of EPCs. In animal experiments, we transplanted a biomaterial seeded with EPCs onto the surface of diabetic wounds and found that adenosine-stimulated EPCs effectively promoted wound healing. Increased microvascular genesis and survival of the transplanted cells were also observed in the adenosine-stimulated groups. Interestingly, our study showed that adenosine increased the autophagy of the transplanted EPCs seeded onto the biomaterial and maintained EPC survival at 48 and 96?hours. Moreover, we observed that adenosine induced EPC differentiation through increasing the level of autophagy. In conclusion, our study indicated that adenosine-stimulated EPCs seeded onto a biomaterial significantly improved wound healing in diabetic mice; mechanistically, adenosine might maintain EPC survival and differentiation by increasing high glucose-inhibited EPC autophagy and maintaining cellular energy metabolism. PMID:26108983

  6. Adenosine accelerates the healing of diabetic ischemic ulcers by improving autophagy of endothelial progenitor cells grown on a biomaterial.

    PubMed

    Chen, Wen; Wu, Yangxiao; Li, Li; Yang, Mingcan; Shen, Lei; Liu, Ge; Tan, Ju; Zeng, Wen; Zhu, Chuhong

    2015-01-01

    Endothelial progenitor cells (EPCs) seeded on biomaterials can effectively promote diabetic ischemic wound healing. However, the function of transplanted EPCs is negatively affected by a high-glucose and ischemic microenvironment. Our experiments showed that EPC autophagy was inhibited and mitochondrial membrane potential (MMP) was increased in diabetic patients, while adenosine treatment decreased the energy requirements and increased the autophagy levels of EPCs. In animal experiments, we transplanted a biomaterial seeded with EPCs onto the surface of diabetic wounds and found that adenosine-stimulated EPCs effectively promoted wound healing. Increased microvascular genesis and survival of the transplanted cells were also observed in the adenosine-stimulated groups. Interestingly, our study showed that adenosine increased the autophagy of the transplanted EPCs seeded onto the biomaterial and maintained EPC survival at 48 and 96?hours. Moreover, we observed that adenosine induced EPC differentiation through increasing the level of autophagy. In conclusion, our study indicated that adenosine-stimulated EPCs seeded onto a biomaterial significantly improved wound healing in diabetic mice; mechanistically, adenosine might maintain EPC survival and differentiation by increasing high glucose-inhibited EPC autophagy and maintaining cellular energy metabolism. PMID:26108983

  7. Multi-stacked InAs/GaAs quantum dots grown with different growth modes for quantum dot solar cells

    NASA Astrophysics Data System (ADS)

    Kim, Yeongho; Ban, Keun-Yong; Honsberg, Christiana B.

    2015-06-01

    We have studied the material properties and device performance of InAs/GaAs quantum dot solar cells (QDSCs) made using three different QD growth modes: Stranski-Krastanov (S-K), quasi-monolayer (QML), and sub-monolayer (SML) growth modes. All QDSCs show an extended external quantum efficiency (EQE) at near infrared wavelengths of 950-1070 nm from the QD absorption. Compared to the S-K and SML QDSCs, the QML QDSC with a higher strain exhibits a poor EQE response in the wavelength region of 300-880 nm due to increased non-radiative recombination. The conversion efficiency of the S-K and SML QDSCs exceeds that of the reference cell (13.4%) without QDs due to an enhanced photocurrent (>16% increase) produced by the silicon doped QD stacks. However, as expected from the EQE of the QML QDSC, the increase of strain-induced crystalline defects greatly degrades the photocurrent and open-circuit voltage, leading to the lowest conversion efficiency (8.9%).

  8. Immunological studies in patients with chronic active hepatitis. Cytotoxic activity of lymphocytes to autochthonous liver cells grown in tissue culture.

    PubMed Central

    Paronetto, F; Vernace, S

    1975-01-01

    The cytotoxic activity of lymphocytes against autochthonous liver cells was studied in patients with chronic liver diseases and in controls. Cytotoxicity of lymphocytes was observed in eight of ten patients with chronic active hepatitis, two patients with chronic persistent hepatitis, one patient with primary biliary cirrhosis, one patient with alcoholic hepatitis and carcinoma of the pancreas, and in three of five patients with acute viral hepatitis, but not in seven patients without liver alteration or with miscellaneous liver diseases. Serum was not cytotoxic, but in three patients it decreased the cytotoxicity of lymphocytes. Cytotoxicity was seen in both HBAg-positive and HBAg-negative patients, appears to be influenced by therapy, and does not correlate with autoantibodies. These data support the hypothesis of an aggressive activity of lymphocytes in certain liver diseases. PMID:1204242

  9. Alteration of cell cycle progression by Sindbis virus infection.

    PubMed

    Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa; Shirasawa, Hiroshi

    2015-07-10

    We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G1 phase preferred to proliferate during S/G2 phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G1 phase than in cells infected during S/G2 phase. PMID:25976675

  10. The role of connexins in the differentiation of NT2 cells in Sertoli-NT2 cell tissue constructs grown in the rotating wall bioreactor.

    PubMed

    Shamekh, R; Cameron, D F; Willing, A E; Saporta, S

    2006-04-01

    Neural transplantation is developing as a successful treatment for neurodegenerative diseases such as Parkinson's disease. The human Ntera-2/D1 (NT2) cell line is an attractive alternative to the use of human fetal neurons as a cell source for transplantation. We have explored combining NT2 cells, as a neuronal source, and Sertoli cells, which may act as a graft facilitator to enhance neuronal survival and differentiation, and ameliorate the host immune response, into a tissue construct for use in cell replacement therapy for neurodegenerative disease. This Sertoli-NT2-aggregated cell (SNAC) tissue construct is formed in the high aspect ratio vessel (HARV) bioreactor. NT2 cells differentiate to dopaminergic NT2N neurons within the SNAC tissue construct without retinoic acid. We report here that the gap junction protein connexin 43 is decreased among differentiated NT2N neurons. Inhibition of connexin 43 with 18beta glycyrrhetinic acid and carbenoxolone, a glycyrrhetinic acid derivative, during formation of the SNAC tissue constructs disrupts the differentiation of NT2 cells. Therefore, connexin 43 is important in the differentiation of NT2 cells in the SNAC tissue construct. PMID:16328273

  11. Mesoporous Ni0.85Se Nanospheres Grown in Situ on Graphene with High Performance in Dye-Sensitized Solar Cells.

    PubMed

    Zhang, Xiao; Yang, Yuxiao; Guo, Shengqi; Hu, Fangzhong; Liu, Lu

    2015-04-29

    Mesoporous Ni0.85Se nanospheres grown on graphene were synthesized via the hydrothermal approach. Because of the exceptional electron-transfer pathway of graphene and the excellent catalytic ability of the mesoporous Ni0.85Se nanospheres, the nanocomposites exhibited excellent electrocatalytic property as the counter electrode (CE) of dye-sensitized solar cells. More catalytic active sites, better charge-transfer ability and faster reaction velocity of Ni0.85Se@RGO (RGO = reduced graphene oxide) CE led to faster and more complete I3(-) reduction than Pt, Ni0.85Se, and RGO CEs. Furthermore, the power conversion efficiency of Ni0.85Se@RGO CE reached 7.82%, which is higher than that of Pt CE (7.54%). Electrochemical impedance spectra, cyclic voltammetry, and Tafel polarization were obtained to demonstrate positive synergetic effect between Ni0.85Se and RGO, as well as the higher catalytic activity and the better charge-transfer ability of Ni0.85Se@RGO compared with Pt CE. PMID:25850447

  12. Optical and electrical characterization of CdS-Glycine thin films with ammonia free buffer grown at different temperatures for solar cells applications

    NASA Astrophysics Data System (ADS)

    Berman-Mendoza, D.; Quiñones-Urías, D.; Ferra-González, S.; Vera-Marquina, A.; Rojas-Hernández, A.; Gómez Fuentes, R.; García-Juárez, A.; Leal-Cruz, A. L.; Ramos-Carrasco, A.

    2013-11-01

    In this work we report the fabrication and electro-optical characterization of CdS thin films using glycine as complexing agent with ammonia and ammonia free buffer by the Chemical Bath Deposition (CBD) method. The CdS thin films were grown at different temperatures of 50, 60, 70 and 80 °C in a thermal water bath. The morphology of these films was determined using atomic force microscopy; the resultant films were homogeneous, well adhered to the substrate, and specularly reflecting with a varying color depending on the deposition temperature. Transmittance and reflectance measurements of thermally treated CdS films were carried to study the effect of the ammonia buffer on its optical properties and bandgap. The crystallinity of the CdS thin films was determined by means of X Ray diffraction measurements. Therefore, for this study, an ammonia-free complexing agent has been taken for the deposition of CdS. Among different methods, which are being used for the preparation of CdS films, Chemical Bath Deposition (CBD) is the most attractive due to its low cost, easy to handle and large possibilities regarding doping and deposition on various substrates. In particular it can be used to easily obtain field effect devices by depositing CdS thin films over a SiO2/Si substrate. Heterostructures with interesting physical properties can be imagined, realized and tested in this way.. Structures CdS/PbS also were realized and have shown good solar cell characteristics.

  13. Acquisition of cell-cell fusion activity by amino acid substitutions in spike protein determines the infectivity of a coronavirus in cultured cells.

    PubMed

    Yamada, Yoshiyuki; Liu, Xiao Bo; Fang, Shou Guo; Tay, Felicia P L; Liu, Ding Xiang

    2009-01-01

    Coronavirus host and cell specificities are determined by specific interactions between the viral spike (S) protein and host cell receptor(s). Avian coronavirus infectious bronchitis (IBV) has been adapted to embryonated chicken eggs, primary chicken kidney (CK) cells, monkey kidney cell line Vero, and other human and animal cells. Here we report that acquisition of the cell-cell fusion activity by amino acid mutations in the S protein determines the infectivity of IBV in cultured cells. Expression of S protein derived from Vero- and CK-adapted strains showed efficient induction of membrane fusion. However, expression of S protein cloned from the third passage of IBV in chicken embryo (EP3) did not show apparent syncytia formation. By construction of chimeric S constructs and site-directed mutagenesis, a point mutation (L857-F) at amino acid position 857 in the heptad repeat 1 region of S protein was shown to be responsible for its acquisition of the cell-cell fusion activity. Furthermore, a G405-D point mutation in the S1 domain, which was acquired during further propagation of Vero-adapted IBV in Vero cells, could enhance the cell-cell fusion activity of the protein. Re-introduction of L857 back to the S gene of Vero-adapted IBV allowed recovery of variants that contain the introduced L857. However, compensatory mutations in S1 and some distant regions of S2 were required for restoration of the cell-cell fusion activity of S protein carrying L857 and for the infectivity of the recovered variants in cultured cells. This study demonstrates that acquisition of the cell-cell fusion activity in S protein determines the selection and/or adaptation of a coronavirus from chicken embryo to cultured cells of human and animal origins. PMID:19572016

  14. Carrier dynamics in bulk 1eV InGaAsNSb materials and epitaxial lift off GaAs-InAlGaP layers grown by MOVPE for multi-junction solar cells

    NASA Astrophysics Data System (ADS)

    Sin, Yongkun; LaLumondiere, Stephen; Lotshaw, William; Moss, Steven C.; Kim, Tae Wan; Forghani, Kamran; Mawst, Luke J.; Kuech, Thomas F.; Tatavarti, Rao; Wibowo, Andree; Pan, Noren

    2013-03-01

    III-V multi-junction solar cells are based on a triple-junction design that consists of an InGaP top junction, a GaAs middle junction, and a bottom junction that employs either a 1eV material grown on the GaAs substrate or InGaAs grown on the Ge substrate. The most promising 1 eV material that is currently under extensive investigation is bulk dilute nitride such as InGaAsN(Sb) lattice matched to GaAs substrates. Both approaches utilizing dilute nitrides and lattice-mismatched InGaAs layers have a potential to achieve high performance triple-junction solar cells. In addition, it will be beneficial for both commercial and space applications if III-V triple-junction solar cells can significantly reduce weight and can be manufactured cost effectively while maintaining high efficiency. The most attractive approach to achieve these goals is to employ full-wafer epitaxial lift off (ELO) technology, which can eliminate the substrate weight and also enable multiple substrate re-usages. For the present study, we employed time-resolved photoluminescence (TR-PL) techniques to study carrier dynamics in MOVPE-grown bulk dilute nitride layers lattice matched to GaAs substrates, where carrier lifetime measurements are crucial in optimizing MOVPE materials growth. We studied carrier dynamics in InGaAsN(Sb) layers with different amounts of N incorporated. Carrier lifetimes were also measured from InGaAsN(Sb) layers at different stages of post-growth thermal annealing steps. Post-growth annealing yielded significant improvements in carrier lifetimes of InGaAsNSb double hetero-structure (DH) samples compared to InGaAsN DH samples possibly due to the surfactant effect of Sb. In addition, we studied carrier dynamics in MOVPE-grown GaAs-InAl(Ga)P layers grown on GaAs substrates. The structures were grown on top of a thin AlAs release layer, which allowed epitaxial layers grown on top of the AlAs layer to be removed from the substrate. The GaAs layers had various doping densities and thicknesses. We present our TR-PL results from both pre- and post-ELO processed GaAs-InAl(Ga)P samples.

  15. Investigation of anodic and chemical oxides grown on p-type InP with applications to surface passivation for n(+)-p solar cell fabrication

    NASA Technical Reports Server (NTRS)

    Faur, Maria; Faur, Mircea; Goradia, Manju; Goradia, Chandra; Jenkins, Phillip; Jayne, Douglas; Weinberg, Irving

    1991-01-01

    Most of the previously reported InP anodic oxides were grown on a n-type InP with applications to fabrication of MISFET structures and were described as a mixture of In2O3 and P2O5 stoichiometric compounds or nonstoichiometric phases which have properties similar to crystalline compounds In(OH)3, InPO4, and In(PO3)3. Details of the compositional change of the anodic oxides grown under different anodization conditions were previously reported. The use of P-rich oxides grown either by anodic or chemical oxidation are investigated for surface passivation of p-type InP and as a protective cap during junction formation by closed-ampoule sulfur diffusion. The investigation is based on but not limited to correlations between PL intensity and X-ray photoelectron spectroscopy (XPS) chemical composition data.

  16. Effect of black tea extract on herpes simplex virus-1 infection of cultured cells

    PubMed Central

    2013-01-01

    Background The purpose of this investigation was to determine if black tea extract (BTE), consisting primarily of flavanol compounds called theaflavins, could inhibit herpes simplex virus type-1 (HSV-1) infection in cultured A549 (human epithelial) and Vero cells. Methods The effect of BTE both on A549 and Vero cultured cells and on HSV-1 was assessed by using phase contrast and fluorescent microscopy, and cell viability and proliferation assays. After establishing the maximum non-cytotoxic concentration of BTE, A549 and Vero cells and HSV-1 virions were treated with varying concentrations of BTE, respectively. A549 and Vero cells were infected with HSV-1 with green fluorescent protein (GFP) insert at the UL46 gene. The effect of infectivity was determined by viral DNA extraction followed by PCR, plaque assays, adsorption assays, and electrophoresis of PCR products. Results BTE was not cytotoxic to A549 and Vero cells, as confirmed by cell viability and proliferation assays, in which BTE treated groups paralleled the positive control group. For both cell lines, plaque assays and fluorescent microscopy indicated an inverse relationship between BTE concentration (from 0.14 ?M – 1.4 mM) and HSV-1 infectivity. Specifically, PCR and electrophoresis showed a reduction in the viral genome following treatment with BTE. In addition, there was a noticeable decrease in the amount of viral plaques for BTE treated samples in the adsorption assays. Conclusions BTE consisting primarily of theaflavins is not cytotoxic and can reduce or block the production of infectious HSV-1 virions in cultured A549 and Vero cells, thus inhibiting the infectivity of the virus by interfering in the attachment, penetration and viral DNA replication of HSV-1 particles. These findings indicate that BTE enriched with theaflavins has the potential to be developed as a safe, therapeutic antiviral agent to prevent the spread of HSV-1. PMID:23777309

  17. Establishment of cell lines with increased susceptibility to EV71/CA16 by stable overexpression of SCARB2

    PubMed Central

    2013-01-01

    Background Human enterovirus type 71 (EV71) and Coxsackievirus A group type 16 (CA16) belong to human Enterovirus species A of the family Picornaviridae. These viruses are recognized as the major pathogens responsible for epidemics of hand-foot-mouth disease (HFMD), which presents with fever and vesicular eruptions of palms, soles of the feet or mouth. Human scavenger receptor class B, member 2 (SCARB2) has been identified as the receptor for both EV71 and CA16, as overexpression of SCARB2 in cells can enhance virus replication significantly. Methods In this study, we used a lentivirus packaging vector to transduce the SCARB2 gene into human embryonic kidney cells (293), human rhabdomyosarcoma cells (RD) and African green monkey kidney cells (Vero) to create stable expression lines. Expression of SCARB2 in the resulting three transgenic cell lines was confirmed by real-time RT-PCR, immunofluorescence and flow cytometry. Results Levels of SCARB2 mRNA determined by real-time RT-PCR in 293-SCARB2 (293S) or RD-SCARB2 (RDS) transgenic cell lines were approximately 2?×?102 times higher than those in 293 and RD cells, respectively, and three times higher in Vero-SCARB2 (VeroS) than in Vero cells. Furthermore, EV71 and CA16 virus titers in 293S and RDS cells were 102–103-fold higher (detected in RD cell) than those in the parental cells, and a 10-fold higher titer of EV71 was achieved in VeroS cells compared with that in Vero cells. Conclusions We established for the first time three cell lines stably overexpressing SCARB2, which showed drastic increases in susceptibility to EV71/CA16 infection. These optimal cell lines may be utilized to develop inactivated vaccines for EV71/CA16 and facilitate rapid detection and isolation of HFMD pathogens or other Enterovirus serotypes. Furthermore, these stable cell lines also can serve as tools to facilitate drug screenings as well as molecular studies on virus-host interactions and pathogenesis of causative agents for HFMD. PMID:23919614

  18. Virological and Serological Findings in Rousettus aegyptiacus Experimentally Inoculated with Vero Cells-Adapted Hogan Strain of Marburg Virus

    PubMed Central

    Paweska, Janusz T.; Jansen van Vuren, Petrus; Masumu, Justin; Leman, Patricia A.; Grobbelaar, Antoinette A.; Birkhead, Monica; Clift, Sarah; Swanepoel, Robert; Kemp, Alan

    2012-01-01

    The Egyptian fruit bat, Rousettus aegyptiacus, is currently regarded as a potential reservoir host for Marburg virus (MARV). However, the modes of transmission, the level of viral replication, tissue tropism and viral shedding pattern remains to be described. Captive-bred R. aegyptiacus, including adult males, females and pups were exposed to MARV by different inoculation routes. Blood, tissues, feces and urine from 9 bats inoculated by combination of nasal and oral routes were all negative for the virus and ELISA IgG antibody could not be demonstrated for up to 21 days post inoculation (p.i.). In 21 bats inoculated by a combination of intraperitoneal/subcutaneous route, viremia and the presence of MARV in different tissues was detected on days 2–9 p.i., and IgG antibody on days 9–21 p.i. In 3 bats inoculated subcutaneously, viremia was detected on days 5 and 8 (termination of experiment), with virus isolation from different organs. MARV could not be detected in urine, feces or oral swabs in any of the 3 experimental groups. However, it was detected in tissues which might contribute to horizontal or vertical transmission, e.g. lung, intestines, kidney, bladder, salivary glands, and female reproductive tract. Viremia lasting at least 5 days could also facilitate MARV mechanical transmission by blood sucking arthropods and infections of susceptible vertebrate hosts by direct contact with infected blood. All bats were clinically normal and no gross pathology was identified on post mortem examination. This work confirms the susceptibility of R. aegyptiacus to infection with MARV irrespective of sex and age and contributes to establishing a bat-filovirus experimental model. Further studies are required to uncover the mode of MARV transmission, and to investigate the putative role of R. aegyptiacus as a reservoir host. PMID:23029039

  19. Improved photoresponsivity of semiconducting BaSi{sub 2} epitaxial films grown on a tunnel junction for thin-film solar cells

    SciTech Connect

    Du, Weijie; Suzuno, Mitsushi; Ajmal Khan, M.; Toh, Katsuaki; Baba, Masakazu; Nakamura, Kotaro; Toko, Kaoru [Institute of Applied Physics, University of Tsukuba, 1-1-1 Tennohdai, Tsukuba, Ibaraki 305-8573 (Japan); Usami, Noritaka [Institute for Materials Research, Tohoku University, Sendai, Miyagi 980-8577 (Japan); Japan Science and Technology Agency, CREST, Chiyoda-ku, Tokyo 102-0075 (Japan); Suemasu, Takashi [Institute of Applied Physics, University of Tsukuba, 1-1-1 Tennohdai, Tsukuba, Ibaraki 305-8573 (Japan); Japan Science and Technology Agency, CREST, Chiyoda-ku, Tokyo 102-0075 (Japan)

    2012-04-09

    The highest photoresponsivity and an internal quantum efficiency exceeding 70% at 1.55 eV were achieved for 400 nm thick undoped n-type BaSi{sub 2} epitaxial layers formed on a n{sup +}-BaSi{sub 2}/p{sup +}-Si tunnel junction (TJ) on Si(111). The diffusion of Sb atoms was effectively suppressed by an intermediate polycrystalline Si layer grown by solid phase epitaxy, located between the TJ and undoped BaSi{sub 2} layers.

  20. Effects of electron and proton irradiations on n/p and p/n GaAs cells grown by MOCVD

    NASA Technical Reports Server (NTRS)

    Weinberg, Irving; Swartz, Clifford K.; Hart, Russell E., Jr.

    1987-01-01

    State-of-the-art n/p and p/n heteroface GaAs cells, processed by metal organic chemical vapor deposition, were irradiated by 1 MeV electrons and 37 MeV protons and their performance determined as a function of fluence. It was found that the p/n cells were more radiation resistant than the n/p cells. The increased loss in the n/p cells was attributed to increases in series resistance and losses in the p-region resulting from the irradiation. The greater loss in fill factor observed for the n/p cells introduces the possibility that the presently observed superiority of the p/n cells may not be an intrinsic property of this configuration in GaAs.

  1. Osmotic Properties of Spheroplasts from Saccharomyces cerevisiae Grown at Different Temperatures

    PubMed Central

    Diamond, R. J.; Rose, A. H.

    1970-01-01

    Spheroplasts were prepared from cells of Saccharomyces cerevisiae NCYC 366, grown at 30 or 15 C, by incubating cells with snail-gut juice after pretreatment with 2-mercaptoethanol. Walls of cells grown batchwise or in continuous culture at 15 C were more resistant to digestion with snail juice than walls on cells grown under the same conditions as 30 C. Spheroplasts lysed when suspended in hypotonic solutions of mannitol. The resistance of spheroplasts to osmotic lysis tended to increase when the test temperature was lowered below 30 C. The increased resistance was greater with spheroplasts from cells grown at 15 C. Cations, especially Ca2+, protected spheroplasts against osmotic lysis. In general, the protective effects, measured at 30 C, were smaller with spheroplasts from cells grown at 15 C compared with 30 C. Citrate and ethylenediaminetetraacetate (EDTA) decreased the resistance of spheroplasts to osmotic lysis. On the whole, the decrease was greater with spheroplasts from cells grown at 30 C rather than 15 C. In the presence of EDTA, spheroplasts from cells grown at 30 C were less resistant to osmotic lysis at 5 C than at 30 C; when spheroplasts from cells grown at 15 C were similarly examined, they were more resistant to lysis at 5 C than at 30 C. Spheroplast membranes from cells grown at 15 C had slightly but significantly greater contents of Mg2+, Ca2+, K+, and Na+ compared with spheroplast membranes from cells grown at 15 C. Mg2+ and Ca2+ were more easily extracted with EDTA from membranes of 30 C-grown cells than from 15 C-grown cells. PMID:4986757

  2. Lipid peroxidation and activities of tyrosine aminotransferase and glutamine synthetase in hepatoma and glioma cells grown in bovine colostrum-supplemented medium

    Microsoft Academic Search

    Lena Odland; Stefan Wallin; Erik Walum

    1986-01-01

    Summary  The growth stimulating properties of bovine serum and colostrum were compared in rat hepatoma (HTC) and glioma (C6) cell cultures.\\u000a A colostrum concentration of 2% was optimal for HTc cells, which then reached a terminal density 40% of that in serum-supplemented\\u000a medium. The corresponding figures for C6 cells were 10 and 81%, respectively. After 4 d in culture, levels of

  3. Novel Cell-Based Method To Detect Shiga Toxin 2 from Escherichia coli O157:H7 and Inhibitors of Toxin Activity?

    PubMed Central

    Quiñones, Beatriz; Massey, Shane; Friedman, Mendel; Swimley, Michelle S.; Teter, Ken

    2009-01-01

    Escherichia coli O157:H7 is a leading cause of food-borne illness. This human pathogen produces Shiga toxins (Stx1 and Stx2) which inhibit protein synthesis by inactivating ribosome function. The present study describes a novel cell-based assay to detect Stx2 and inhibitors of toxin activity. A Vero cell line harboring a destabilized variant (half-life, 2 h) of the enhanced green fluorescent protein (d2EGFP) was used to monitor the toxin-induced inhibition of protein synthesis. This Vero-d2EGFP cell line produced a fluorescent signal which could be detected by microscopy or with a plate reader. However, a greatly attenuated fluorescent signal was detected in Vero-d2EGFP cells that had been incubated overnight with either purified Stx2 or a cell-free culture supernatant from Stx1- and Stx2-producing E. coli O157:H7. Dose-response curves demonstrated that the Stx2-induced inhibition of enhanced green fluorescent protein fluorescence mirrored the Stx2-induced inhibition of overall protein synthesis and identified a picogram-per-milliliter threshold for toxin detection. To establish our Vero-d2EGFP assay as a useful tool for the identification of toxin inhibitors, we screened a panel of plant compounds for antitoxin activities. Fluorescent signals were maintained when Vero-d2EGFP cells were exposed to Stx1- and Stx2-containing medium in the presence of either grape seed or grape pomace extract. The antitoxin properties of the grape extracts were confirmed with an independent toxicity assay that monitored the overall level of protein synthesis in cells treated with purified Stx2. These results indicate that the Vero-d2EGFP fluorescence assay is an accurate and sensitive method to detect Stx2 activity and can be utilized to identify toxin inhibitors. PMID:19139230

  4. Differences in Chlamydia trachomatis Serovar E Growth Rate in Polarized Endometrial and Endocervical Epithelial Cells Grown in Three-Dimensional Culture?

    PubMed Central

    Guseva, Natalia V.; Dessus-Babus, Sophie; Moore, Cheryl G.; Whittimore, Judy D.; Wyrick, Priscilla B.

    2007-01-01

    In vitro studies of obligate intracellular chlamydia biology and pathogenesis are highly dependent on the use of experimental models and growth conditions that mimic the mucosal architecture and environment these pathogens encounter during natural infections. In this study, the growth of Chlamydia trachomatis genital serovar E was monitored in mouse fibroblast McCoy cells and compared to more relevant host human epithelial endometrium-derived HEC-1B and cervix-derived HeLa cells, seeded and polarized on collagen-coated microcarrier beads, using a three-dimensional culture system. Microscopy analysis of these cell lines prior to infection revealed morphological differences reminiscent of their in vivo architecture. Upon infection, early chlamydial inclusion distribution was uniform in McCoy cells but patchy in both epithelial cell lines. Although no difference in chlamydial attachment to or entry into the two genital epithelial cell lines was noted, active bacterial genome replication and transcription, as well as initial transformation of elementary bodies to reticulate bodies, were detected earlier in HEC-1B than in HeLa cells, suggesting a faster growth, which led to higher progeny counts and titers in HEC-1B cells upon completion of the developmental cycle. Chlamydial development in the less relevant McCoy cells was very similar to that in HeLa cells, although higher progeny counts were obtained. In conclusion, this three-dimensional bead culture system represents an improved model for harvesting large quantities of infectious chlamydia progeny from their more natural polarized epithelial host cells. PMID:17088348

  5. A Molecular Mimic of Phosphorylated Prolactin Markedly Reduced Tumor Incidence and Size When DU145 Human Prostate Cancer Cells Were Grown in Nude Mice1

    Microsoft Academic Search

    Xiaolei Xu; Eva Kreye; C. Benson Kuo; Ameae M. Walker

    2001-01-01

    Others have demonstrated the presence of an autocrine prolactin (PRL) growth loop in the normal human prostate. In this study we have used three human prostate cancer cell lines but have focused on the androgen- independent human prostate cancer cell line, DU145, to ask: (a) whether this autocrine growth loop is maintained beyond the loss of androgen sensitivity in the

  6. Differential reactivities of the Arachis hypogaea (peanut) and Vicia villosa B4 lectins with human ovarian carcinoma cells, grown either in vitro or in vivo xenograft model

    Microsoft Academic Search

    Dody Avichezer; Ruth Arnon

    1996-01-01

    PNA and VVA B4 recognize the tumor-associated T antigen and its immediate precursor Tn, respectively. We found that both lectins are highly reactive in vitro, with human ovarian carcinoma cell lines, but only VVA B4 bound significantly to breast and oral cancer cells. This binding is inhibited by specific monosaccharides. The lectin binding receptors were purified, revealing a glycoprotein of

  7. FL Med Ent Lab -Vero Beach http://hr.ifas.ufl.edu/Race%20&%20Gender%20Profiles%202003/rec's/... 1 of 1 1/31/2007 8:57 AM

    E-print Network

    Jawitz, James W.

    FL Med Ent Lab - Vero Beach http://hr.ifas.ufl.edu/Race%20&%20Gender%20Profiles%202003/rec's/... 1 In (Dept) 1 1 Total 7 2 0 0 1 0 0 0 10 Percentage of Race and Gender # % # % White Male 7 70% White 9 90

  8. Morphological and molecular changes in the unicellular green alga Dunaliella salina grown under supplemental UV-B radiation: cell characteristics and Photosystem II damage and repair properties

    Microsoft Academic Search

    Antonio Masi; Anastasios Melis

    1997-01-01

    The effect of supplemental UV-B radiation during growth in the green alga Dunaliella salina was investigated. At the cellular level, supplemental UV-B radiation induced a doubling of the cell volume, a phenomenon attributed to a slow-down in the rate of cell division. At the thylakoid mebrane level, supplemetal UV-B radiation induced photodamage to the 32 kDa (D1) and 34 kDa

  9. Detection of mRNA of nprM in Bacillus megaterium ATCC 14581 grown in soil by whole-cell hybridization

    Microsoft Academic Search

    Wolfgang Hönerlage; Dittmar Hahn; Josef Zeyer

    1995-01-01

    Transcripts of nprM, the gene encoding the major extracellular protease of Bacillus megaterium ATCC 14581, were detected by both Northern blot analysis and whole-cell hybridization with digoxigenin-labeled in vitro ranscripts throughout the exponential growth phase and the early stationary phase. In cells of the late stationary phase, only low amounts of transcripts were observed with the two techniques. No transcripts

  10. Microhardness studies of vapour grown tin (II) sulfide single crystals

    NASA Astrophysics Data System (ADS)

    Hegde, S. S.; Kunjomana, A. G.; Ramesh, K.

    2015-06-01

    Earth abundant tin sulfide (SnS) has attracted considerable attention as a possible absorber material for low-cost solar cells due to its favourable optoelectronic properties. Single crystals of SnS were grown by physical vapour deposition (PVD) technique. Microindentation studies were carried out on the cleaved surfaces of the crystals to understand their mechanical behaviour. Microhardness increased initially with the load, giving sharp maximum at 15 g. Quenching effect has increased the microhardness, while annealing reduced the microhardness of grown crystals. The hardness values of as-grown, annealed and quenched samples at 15 g load are computed to be 99.69, 44.52 and 106.29 kg/mm2 respectively. The microhardness of PVD grown crystals are high compared to CdTe, a leading low-cost PV material. The as-grown faces are found to be fracture resistant.

  11. Prostate tumor grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    2001-01-01

    This prostate cancer construct was grown during NASA-sponsored bioreactor studies on Earth. Cells are attached to a biodegradable plastic lattice that gives them a head start in growth. Prostate tumor cells are to be grown in a NASA-sponsored Bioreactor experiment aboard the STS-107 Research-1 mission in 2002. Dr. Leland Chung of the University of Virginia is the principal investigator. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Credit: NASA and the University of Virginia.

  12. [The effect of poly(3-hydroxybutyrate) modification by poly(ethylene glycol) on the viability of cells grown on the polymer films].

    PubMed

    Zharkova, I I; Bonartsev, A P; Boskhomdzhiev, A P; Efremov, Iu M; Bagrov, D V; Makhina, T K; Myshkina, V L; Voinova, V V; Iakovlev, S G; Filatova, E V; Zernov, A L; Andreeva, N V; Ivanov, E A; Bonartseva, G A; Sha?tan, K V

    2012-01-01

    A biodegradable polymer of bacterial origin, poly(3-hydroxybutyrate) (PHB), is intensively studied as biomaterial for tissue engineering. However, factors determining its biocompatibility still require better understanding. To analyze the PHB films biocompatibility, the polymer material was modified by hydrophilic polymer, poly(ethylene glycol) 300 (PEG). The blends PHB/PEG with different PEG content (10, 20, 30 and 50%) were produced by subsequent incubation in water resulted in removal of 95% PEG. The surface roughness and hydrophilicity were studied by atomic force microscopy (AFM) and contact angle "water-polymer" measurement, respectively. The film biocompatibility on cell culture of COS-1 fibroblasts was studied in vitro. It was shown that both roughness and hydrophobicity are directly proportional to initial PEG content in the PHB/PEG blends. The growth rate of COS-1 fibroblasts on polymer films is determined by combination of two basic physicochemical properties of the polymer surface: the roughness and hydrophilicity. The optimal roughness requred for COS-1 cells growth is the average roughness more than 25 nm, whereas the limit values of the contact angle "water-polymer" that was responsible for relatively high cell viability were not found. These data indicate that the film surface roughness had the greatest effect on the cell growth, whereas the increase in the polymer surface hydrophilicity caused the additional positive effect on viability of attached cells. Thus, the modification of PHB polymer material by PEG resulted in the improved viability of cells cultivated on the polymer films in vitro. The obtained data can be used for development of such medical devices as surgeon patches and periodontal membranes. PMID:23289300

  13. Migration of Mitochondria to Viral Assembly Sites in African Swine Fever Virus-Infected Cells

    Microsoft Academic Search

    GEMA ROJO; MARGARITA CHAMORRO; MARIA L. SALAS; ELADIO VINUELA; Severo Ochoa; Consejo Superior de Investigaciones

    1998-01-01

    An examination by electron microscopy of the viral assembly sites in Vero cells infected with African swine fever virus showed the presence of large clusters of mitochondria located in their proximity. These clusters surround viral factories that contain assembling particles but not factories where only precursor membranes are seen. Immunofluorescence microscopy revealed that these accumulations of mitochondria are originated by

  14. Transparent Conducting ZnO:B Thin Films Grown by Ultraviolet Light Assisted Metal Organic Chemical Vapor Deposition Using Triethylboron for Cu(In,Ga)Se2 Solar Cells

    NASA Astrophysics Data System (ADS)

    Kobayashi, Taizo; Yamauchi, Kotaro; Mise, Takahiro; Nakada, Tokio

    2012-10-01

    High-efficiency cadmium-free Cu(In,Ga)Se2 (CIGS) thin-film solar cells have been fabricated using a zinc compound buffer layer deposited by the chemical bath deposition (CBD) process. However, the zinc compound buffer layers such as ZnS(O,OH) are prone to plasma-induced damage during the subsequent ZnO sputtering process. A process causing less damage such as metal-organic chemical vapor deposition (MOCVD) is thus required for ZnO-based transparent conducting oxide (TCO) layers. In the present work, the boron-doped zinc oxide (ZnO:B) films were grown by MOCVD using diethyl zinc (DEZ), H2O, and low-toxicity triethylboron (TEB). An UV-assisted MOCVD process was developed in order to reduce the resistivity of ZnO:B films. As a result, the resisitivity significantly decreased together with the increased electron mobility and carrier concentration. The comparison of performance was also carried out for the ZnS(O,OH)/CIGS solar cells with MOCVD-deposited ZnO:B and sputter-deposited ZnO:Al window layers.

  15. Dependence of the recombination in thin-film Si solar cells grown by ion-assisted deposition on the crystallographic orientation of the substrate

    Microsoft Academic Search

    D. H Neuhaus; N.-P Harder; S Oelting; R Bardos; A. B Sproul; P Widenborg; A. G Aberle

    2002-01-01

    One promising strategy for achieving high-quality polycrystalline silicon thin-film solar cells on glass is based on low-temperature ion-assisted deposition for epitaxial thickening of a thin, large-grained seeding layer on glass. The crystal growth on the seeding layer is influenced by various factors, amongst which the crystal orientation of the grains plays a substantial role. In this paper we investigate how

  16. Investigation of the role of glycans for the biological activity of Semliki Forest virus grown in Aedes albopictus cells using inhibitors of asparagine-linked oligosaccharides trimming

    Microsoft Academic Search

    Hussein Y. Naim; H. Koblet

    1988-01-01

    Summary The effects of N-linked-oligosaccharide-processing inhibitors on the formation of Semliki Forest virus (SFV) in C 6\\/36 Aedes albopictus cells were investigated. The glycosidase inhibitors deoxynojirimycin, deoxymannojirimycin and swainsonine prevented the formation of Endo-H resistant structures, but had little effect on virus formation and on the biological activities of the virus. Tunicamycin greatly inhibited virus formation, but had little effect

  17. Photocurrent enhancement in In0.53Ga0.47As solar cells grown on InP\\/SiO2\\/Si transferred epitaxial templates

    Microsoft Academic Search

    James M. Zahler; Katsuaki Tanabe; Corinne Ladous; Tom Pinnington; Frederick D. Newman; Harry A. Atwater

    2007-01-01

    InP\\/Si engineered substrates formed by wafer bonding and layer transfer have the potential to significantly reduce the cost and weight of III-V compound semiconductor solar cells. InP\\/Si substrates were prepared by He implantation of InP prior to bonding to a thermally oxidized Si substrate and annealing to exfoliate an InP thin film. Following thinning of the transferred InP film to

  18. Alterations of leaf cell ultrastructures and AFLP DNA profiles in Earth-grown tomato plants propagated from long-term six years Mir-flown seeds

    NASA Astrophysics Data System (ADS)

    Liu, Min; Xue, Huai; Pan, Yi; Zhang, Chunhua; Lu, Jinying

    Leaf cell ultrastructures and DNA variations in the firstand the second-generation of Earthgrown tomato (Lycopersicon esculentun Mill) plants that had been endured a long-term six years spaceflight in the Mir were compared to their ground-based control plants, under observations with a Transmission Electron Microscope and the Amplification Fragment Length Polymorphism (AFLP) analysis. For alterations in the morphological ultrastructures, one plant among the 11 first-generation plants generated from 30 Mir-flown seeds had a three-layered palisade cell structure, while other 10 first-generation plants and all ground-based controls had one-layered palisade cell structure in leaves. Starch grains were larger and in clusters, numbers of starch grains increased in the chloroplasts in the Mir-flown plants. Leaf cells became contracted and deformed, and cell shape patterns were different in the Mir-flown plants. For the leaf genomic DNA alterations, 34 DNA bands were polymorphic with a 1.32% polymorphism among 2582 DNA bands in the first-generation Mir-flown plants. Band types in the spaceflight treated plants were also different from those in the ground-based control. Of 11 survived first-generation plants, 7 spaceflight treated plants (Plant Nos. 1-6 and No. 9) had a same 7 polymorphic bands and a same 0.27%DNA mutation. The DNA mutation rate was greatest in Plants No.10 and No.7 (0.90% and 0.94%), less in Plant No.11 (0.31%) and least in Plant No.8 (0.20%). For the 38 send-generation plants propagated from the No. 5 Mir-flown seed, 6 DNA bands were polymorphic with a 0.23% polymorphism among 2564 amplified DNA bands. Among those 38 second-generation plants amplified by primer pair (E4: ACC, M8: CTT), one DNA band disappeared in 29 second-generation plants and in the original Mir-flown No. 5 plant, compared to the ground-base controls. Among the 38 second-generation plants generated from the Mir-flown No. 5 seed, the DNA band types of 29 second-generation plants were different from that of the ground-base controls and had a same 6 polymorphic bands and a same 0.23% DNA mutation. For the 49 second-generation plants derived from the Mir-flown No. 6 seed, 7 DNA bands were polymorphic with 0.27% polymorphism among 2564 amplified DNA bands. With only one exception among those 49 second-generation plants amplified by primer pair (E3: ACA, M3: CAG), one DNA band disappeared in 48 second-generation plants and in the original Mir-flown No. 6 plant, compared to the ground-based controls. Among the 49 second-generation plants generated from the Mir-flown No. 6 seed, the DNA band types of 48 second-generation plants were different from that of the ground-base controls and had a same 7 polymorphic bands and a same 0.27% DNA mutation. Our results indicated that leaf cell ultrastructures had been altered and heredity variations had been induced by seeds being exposed to a long-term outer-space environment. Further research is needed to elucidate the dynamics and mechanisms resulting in such variations. Plant biology studies in the space environment may open potential approaches to induce mutations and to screen new plant varieties by ground-based selections among spaceflight treated seeds or seedlings.

  19. Late transient expression of human hepatitis B virus genes in monkey cells.

    PubMed Central

    Colbère-Garapin, F; Horodniceanu, F; Kourilsky, P; Garapin, A C

    1983-01-01

    The expression of human hepatitis B virus (HBV) surface (HBS) and e (HBe) antigens has been studied comparatively in monkey and mouse cell lines co-transfected with HBV DNA and the dominant selective marker aminoglycoside 3'-phosphotransferase gene. We have found that the kinetics and stability of expression of the HBS gene varies with the cell lines used. Only a late transient expression of both HBS and HBe is observed between 1 and 5 weeks after transfection in monkey kidney Vero cells transfected with the complete HBV genome, while a permanent expression of HBS and HBe is obtained in mouse cells. HBS and HBe are excreted into the cell culture medium. HBe is expressed in cells transfected with the complete HBV genome, but not with isolated HBS gene. In clones of Vero cells transformed with the HBS gene, HBV sequences were rearranged or lost. Images Fig. 6. PMID:11894903

  20. Production and characterization of high-titer serum-free cell culture grown hepatitis C virus particles of genotype 1-6.

    PubMed

    Mathiesen, Christian K; Jensen, Tanja B; Prentoe, Jannick; Krarup, Henrik; Nicosia, Alfredo; Law, Mansun; Bukh, Jens; Gottwein, Judith M

    2014-06-01

    Recently, cell culture systems producing hepatitis C virus particles (HCVcc) were developed. Establishment of serum-free culture conditions is expected to facilitate development of a whole-virus inactivated HCV vaccine. We describe generation of genotype 1-6 serum-free HCVcc (sf-HCVcc) from Huh7.5 hepatoma cells cultured in adenovirus expression medium. Compared to HCVcc, sf-HCVcc showed 0.6-2.1 log10 higher infectivity titers (4.7-6.2 log10 Focus Forming Units/mL), possibly due to increased release and specific infectivity of sf-HCVcc. In contrast to HCVcc, sf-HCVcc had a homogeneous single-peak density profile. Entry of sf-HCVcc depended on HCV co-receptors CD81, LDLr, and SR-BI, and clathrin-mediated endocytosis. HCVcc and sf-HCVcc were neutralized similarly by chronic-phase patient sera and by human monoclonal antibodies targeting conformational epitopes. Thus, we developed serum-free culture systems producing high-titer single-density sf-HCVcc, showing similar biological properties as HCVcc. This methodology has the potential to advance HCV vaccine development and to facilitate biophysical studies of HCV. PMID:24928051

  1. Production and Characterization of High-Titer Serum-Free Cell Culture Grown Hepatitis C Virus Particles of Genotype 1–6

    PubMed Central

    Mathiesen, Christian K.; Jensen, Tanja B.; Prentoe, Jannick; Krarup, Henrik; Nicosia, Alfredo; Law, Mansun; Bukh, Jens; Gottwein, Judith M.

    2015-01-01

    Recently, cell culture systems producing hepatitis C virus particles (HCVcc) were developed. Establishment of serum-free culture conditions is expected to facilitate development of a whole-virus inactivated HCV vaccine. We describe generation of genotype 1–6 serum-free HCVcc (sf-HCVcc) from Huh7.5 hepatoma cells cultured in adenovirus expression medium. Compared to HCVcc, sf-HCVcc showed 0.6 to 2.1 log10 higher infectivity titers (4.7–6.2 log10 Focus Forming Units/mL), possibly due to increased release and specific infectivity of sf-HCVcc. In contrast to HCVcc, sf-HCVcc had a homogeneous single-peak density profile. Entry of sf-HCVcc depended on HCV co-receptors CD81, LDLr, and SR-BI, and clathrin-mediated endocytosis. HCVcc and sf-HCVcc were neutralized similarly by chronic-phase patient sera and by human monoclonal antibodies targeting conformational epitopes. Thus, we developed serum-free culture systems producing high-titer single-density sf-HCVcc, showing similar biological properties as HCVcc. This methodology has the potential to advance HCV vaccine development and to facilitate biophysical studies of HCV. PMID:24928051

  2. Formation Mechanism of Crack and Pore Occurred in a Zirconia Electrolyte Film Having Solid Oxide Fuel Cell Grown by ECR Plasma CVD Method

    NASA Astrophysics Data System (ADS)

    Semizo, Makoto; Miich, Tomoaki; Nagata, Akiyoshi

    Formation mechanism of a crack and pore occurred in zirconia electrolyte film having solid oxide fuel cell, that the film prepared by the microwave plasma-enhanced chemical vapor deposition, was studied based on dependence on annealing treatment and substrate temperature. It is found that a crack and pore is restrained at annealing treatment in a vacuum, although it occurs in atmospheric. A crack is formed at grain boundary by occurrence of pore in the film, and a large crack observes at a higher substrate temperature. Moreover in the film prepared without substrate heating, a crack and pore did not also occur at annealing treatment. As a result, it is supposed that formation of a crack and pore is occurred at getting oxygen gas or moisture in atmospheric into the film.

  3. Influence of iron on proliferation and cell cycle kinetics on cultured malignant and nonmalignant cells.

    PubMed

    Flajsig, I; Poljak-Blazi, M

    1990-01-01

    The presence of an iron-containing complex (FSC, ferric sorbitol citrate) in medium inhibited proliferation of malignant (KB. GHC) cells: but did not appreciably alter the proliferation of normal (HBS, Vero) cells. Flow cytometric analysis showed considerable differences of malignant and normal cell growth kinetics. With addition of 200 microM Fe in FSC, malignant cell proliferation was suppressed. An increased number of cells in G1 and early S phase suggested that iron excess blocked the cell cycle before beginning of DNA synthesis. PMID:2216302

  4. Wide-spectrum Mg and Ga co-doped ZnO TCO thin films for solar cells grown via magnetron sputtering with H2 introduction

    NASA Astrophysics Data System (ADS)

    Chen, Xin-liang; Liu, Jie-ming; Ni, Jian; Zhao, Ying; Zhang, Xiao-dan

    2015-02-01

    Wide-spectrum Mg and Ga co-doped ZnO transparent conductive oxide (TCO) thin films are deposited via magnetron sputtering at various H2 flow rates on glass substrates. The structural, electrical, and optical properties of MGZO thin films are investigated with different H2 flow rates. The experiment results show that the MGZO thin films are polycrystalline with a hexagonal wurtzite structure exhibiting a preferred (0 0 2) crystal plane orientation. The carrier concentration remarkably increases from 5.15 × 1019 cm-3 to 2.12 × 1020 cm-3 with increasing the H2 flow rate from 0 sccm to 4.0 sccm and then decreases when further increasing the H2 flow rate. The glass/MGZO thin film deposited at the H2 flow rate of 4.0 sccm exhibits the lowest resistivity of 1.96 × 10-3 ? cm (film thickness d ? 548 nm) and an average transmittance (Ta) of 80.5% in the wavelength range from 340 nm to 1100 nm. Optical measurements indicate that the optical band gap (Eg) of MGZO thin films varies from 3.45 eV to 3.78 eV with adjusting H2 flow rate from 0 sccm to 12.0 sccm. The obtained MGZO thin films with an appropriate thickness are preliminarily applied in p-i-n type hydrogenated amorphous silicon (a-Si:H) thin film solar cells. The a-Si:H solar cell with MGZO layer presents higher quantum efficiency in the short wavelength region than that with GZO layer, resulting from widened optical band gap.

  5. Use of SLAM and PVRL4 and Identification of Pro-HB-EGF as Cell Entry Receptors for Wild Type Phocine Distemper Virus

    PubMed Central

    Reaney, Katherine; Tangy, Frederic; Cosby, Sara Louise

    2014-01-01

    Signalling lymphocyte activation molecule (SLAM) has been identified as an immune cell receptor for the morbilliviruses, measles (MV), canine distemper (CDV), rinderpest and peste des petits ruminants (PPRV) viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4), also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV) remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt) MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG) and the tetraspan proteins, integrin ? and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF),for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO) cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin ? antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation. PMID:25171206

  6. Use of SLAM and PVRL4 and identification of pro-HB-EGF as cell entry receptors for wild type phocine distemper virus.

    PubMed

    Melia, Mary M; Earle, John Philip; Abdullah, Haniah; Reaney, Katherine; Tangy, Frederic; Cosby, Sara Louise

    2014-01-01

    Signalling lymphocyte activation molecule (SLAM) has been identified as an immune cell receptor for the morbilliviruses, measles (MV), canine distemper (CDV), rinderpest and peste des petits ruminants (PPRV) viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4), also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV) remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt) MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG) and the tetraspan proteins, integrin ? and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF),for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO) cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin ? antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation. PMID:25171206

  7. Correlation between Phylogroups and Intracellular Proteomes of Propionibacterium acnes and Differences in the Protein Expression Profiles between Anaerobically and Aerobically Grown Cells

    PubMed Central

    Dekio, Itaru; Culak, Renata; Ball, Graham; Gharbia, Saheer; Shah, Haroun N.

    2013-01-01

    Propionibacterium acnes is one of the dominant commensals on the human skin and also an opportunistic pathogen in relation to acne, sarcoidosis, prostate cancer, and various infections. Recent investigations using housekeeping and virulence genes have revealed that the species consists of three major evolutionary clades (types I, II, and III). In order to investigate protein expression differences between these phylogroups, proteomic profiles of 21 strains of P. acnes were investigated. The proteins extracted from cells cultured under anaerobic and aerobic conditions were analysed using a SELDI-TOF mass spectrometer, high-resolution capillary gel electrophoresis, and LC-MS/ MS. The SELDI spectral profiles were visualised as a heat map and a dendrogram, which resulted in four proteomic groups. Strains belonging to type I were represented in the proteome Group A, while Group B contained type III strains. Groups C and D contained mixtures of types I and II. Each of these groups was not influenced by differences in culture conditions. Under anoxic growth conditions, a type IB strain yielded high expressions of some proteins, such as methylmalonyl-CoA epimerase and the Christie-Atkins-Munch-Petersen (CAMP) factor. The present study revealed good congruence between genomic and proteomic data suggesting that the microenvironment of each subtype may influence protein expression. PMID:23878795

  8. Poly(N-vinylpyrrolidone)-decorated reduced graphene oxide with ZnO grown in situ as a cathode buffer layer for polymer solar cells.

    PubMed

    Hu, Ting; Chen, Lie; Yuan, Kai; Chen, Yiwang

    2014-12-15

    A ZnO@reduced graphene oxide-poly(N-vinylpyrrolidone) (ZnO@RGO-PVP) nanocomposite, prepared by in situ growth of ZnO nanoparticles on PVP-decorated RGO (RGO-PVP) was developed as a cathode buffer layer for improving the performance of polymer solar cells (PSCs). PVP not only favors homogeneous distribution of the RGO through the strong ?-? interactions between graphene and PVP molecules, but also acts as a stabilizer and bridge to control the in situ growth of sol-gel-derived ZnO nanoparticles on the surface of the graphene. At the same time, RGO provides a conductive connection for independent dispersion of ZnO nanoparticles to form uniform nanoclusters with fewer domain boundaries and surface traps. Moreover, the LUMO level of ZnO is effectively improved by modification with RGO-PVP. Compared to bare ZnO, a ZnO@RGO-PVP cathode buffer layer substantially reduces the recombination of carriers, increases the electrical conductivity, and enhances electron extraction. Consequently, the power conversion efficiency of an inverted device based on thieno[3,4-b]thiophene/benzodithiophene (PTB7):[6,6]-phenyl C71 -butyric acid methyl ester (PC71 BM) with ZnO@RGO-PVP as cathode buffer layer was greatly improved to 7.5?% with improved long-term stability. The results reveal that ZnO@RGO-PVP is universally applicable as a cathode buffer layer for improving the performance of PSCs. PMID:25345881

  9. Extremely low-frequency electromagnetic fields cause DNA strand breaks in normal cells

    PubMed Central

    2014-01-01

    Background Extremely low frequency electromagnetic fields aren’t considered as a real carcinogenic agent despite the fact that some studies have showed impairment of the DNA integrity in different cells lines. The aim of this study was evaluation of the late effects of a 100 Hz and 5.6 mT electromagnetic field, applied continuously or discontinuously, on the DNA integrity of Vero cells assessed by alkaline Comet assay and by cell cycle analysis. Normal Vero cells were exposed to extremely low frequency electromagnetic fields (100 Hz, 5.6 mT) for 45 minutes. The Comet assay and cell cycle analysis were performed 48 hours after the treatment. Results Exposed samples presented an increase of the number of cells with high damaged DNA as compared with non-exposed cells. Quantitative evaluation of the comet assay showed a significantly (<0.001) increase of the tail lengths, of the quantity of DNA in tail and of Olive tail moments, respectively. Cell cycle analysis showed an increase of the frequency of the cells in S phase, proving the occurrence of single strand breaks. The most probable mechanism of induction of the registered effects is the production of different types of reactive oxygen species. Conclusions The analysis of the registered comet indices and of cell cycle showed that extremely low frequency electromagnetic field of 100 Hz and 5.6 mT had a genotoxic impact on Vero cells. PMID:24401758

  10. Nucleolus in clinostat-grown plants

    SciTech Connect

    Shen-Miller, J.; Dannenhoffer, J. (Univ. of California, Los Angeles (United States)); Hinchman, R. (Argonne National Lab., IL (United States))

    1991-05-01

    The clinostat is an apparatus that is used to mimic zero gravity in studies of plant growth in the absence of gravitropic response. Clinostat-grown tissue cultures of carrot exhibit significant increases both in the number of nuclei containing more than one nucleolus and in nucleolar volume. Oat seedlings germinated and grown on clinostats exhibit a decreased rate of shoot elongation, increased tissue sensitivity to applied auxin, and an increased response to gravitropic stimulation. Clinostat treatment clearly affects plant metabolism. The nucleolus is the region in the nucleus where ribosome synthesis and assembly take place. The 18S, 5.8S, and 25S ribosomal genes, in tandem units, are located in the nucleolus. Ribosomes orchestrate the production of all proteins that are necessary for the maintenance of cell growth, development, and survival. A full study of the effects of nullification of gravitropism, by clinostat rotation, on nucleolar development in barley has been initiated. The authors study developmental changes of nucleolar number and diameter in clinostat-grown root tissues. Preliminary results show that barley roots exhibit changes in nucleolar number and diameter. Growth rates of barley root and shoot also appear to be reduced, in measurements of both length and weight.

  11. Reduced virulence of Pseudomonas aeruginosa grown in the presence of benzalkonium chloride.

    PubMed Central

    Adair, F W; Liauw, H L; Geftic, S G; Gelzer, J

    1975-01-01

    Resistant cells of Pseudomonas aeruginosa ATCC 9027 which were grown in the presence of 1 mg of benzalkonium chloride (BC) per ml caused only a mild conjunctivitis when they were dropped onto the scratched corneas of rabbits. In contrast, cells of the BC-sensitive parent strain induced a severe keratoconjunctivitis. In addition, the BC-grown cells also had a reduced capacity to produce kidney infections in mice as compared to the parent strain. BC-grown cells acted as weak complex antigens which conferred slight protection against lethal doses of BC-grown cells. No cross-protection to cells of the parent strain occurred. The data indicate that growth in the presence of BC results in cells with reduced virulence. Images PMID:809470

  12. Cytotoxicity of municipal solid waste incinerator ash wastes toward mammalian kidney cell lines

    Microsoft Academic Search

    Wu-Jang Huang; Jia-Lin Tsai; Ming-Huei Liao

    2008-01-01

    In this study, three municipal solid waste incinerator (MSWI) ash wastes—bottom ash, scrubber residue, and baghouse ash—were extracted using a toxicity characteristic leaching procedure (TCLP) extractant. These so-called final TCLP extracts were applied to African green monkey kidney cells (Vero), baby hamster kidney cells (BHK-21), and pig kidney cells (PK-15), multi-well absorption reader analysis was performed to test how the

  13. Investigation of the uptake of drugs, carcinogens and mutagens by individual mammalian cells using a scanning proton microprobe

    NASA Astrophysics Data System (ADS)

    Cholewa, M.; Turnbull, I. F.; Legge, G. J. F.; Weigold, H.; Marcuccio, S. M.; Holan, G.; Tomlinson, E.; Wright, P. J.; Dillon, C. T.; Lay, P. A.; Bonin, A. M.

    1995-09-01

    The use of micro-PIXE [1] in measuring the quantitative uptake of drugs containing metal atoms by individual Vero cells (African green monkey kidney cell line) and V79 Chinese hamster lung cells is demonstrated. One class of drugs, heteropolytungstates, which are being assessed for activity against the HIV virus, were studied using Vero cells. The cellular uptake of a series of chromium compounds, including carcinogens and mutagens, in which the metal oxidation state was either (III), (V) or (VI), was measured using V79 cells. It was found that, unlike any other techniques, scanning proton microprobe (SPM) offers both the sensitivity and spatial resolution to carry out unicellular analysis. The use of cultured cell lines in these analyses was shown to have distinct advantages over cells such as peripheral blood lymphocytes (PBLs).

  14. Tumor cell-selective antiproliferative effect of the extract from Morinda citrifolia fruits.

    PubMed

    Arpornsuwan, Teerakul; Punjanon, Tadsanee

    2006-06-01

    The methanol extract from Morinda citrifolia fruits was tested for cytotoxicity activity on the MTT assay. The appearance of cytotoxic changes after exposure to the extract was in a concentration dependent manner. The median lethal concentrations (LC(50)) of the extract in baby hamster kidney (BHK) cells, African green monkey kidney (Vero) cells and human laryngeal carcinoma (Hep2) cells were found to be 2.5, 3 and 5 mg/mL, respectively. A concentration of 0.1 mg/mL of crude extract exhibited cytotoxic activity against breast cancer (MCF7) and neuroblastoma (LAN5) cell lines at 29% and 36%, respectively. The same concentration of extract showed no toxicity to Vero and very little toxicity to BHK (6%) and Hep2 (13%) cells. PMID:16619339

  15. Bioengineered Dental Tissues Grown in the Rat Jaw

    Microsoft Academic Search

    S. E. Duailibi; M. T. Duailibi; W. Zhang; R. Asrican; J. P. Vacanti; P. C. Yelick

    2008-01-01

    Our long-term objective is to develop methods to form, in the jaw, bioengineered replacement teeth that exhibit physical properties and functions similar to those of natural teeth. Our results show that cultured rat tooth bud cells, seeded onto biodegradable scaffolds, implanted into the jaws of adult rat hosts and grown for 12 weeks, formed small, organized, bioengineered tooth crowns, containing

  16. Fast Plants Grown in Light and Dark

    NSDL National Science Digital Library

    Lauffer, Hedi Baxter

    Photograph of two five-day-old Standard Fast Plants grown in Bottle Growing Systems--one grown with full light, one grown in the dark. This is a good example of a quick way to stimulate discussion about the matter and energy sources and needs that germinating seeds have in comparison to seedlings or plants.

  17. Dermacentor marginatus and Ixodes ricinus ticks versus L929 and Vero cell lines in Rickettsia slovaca life cycle evaluated by quantitative real time PCR

    Microsoft Academic Search

    Vojtech Boldiš; Eva Špitalská

    2010-01-01

    Ticks transmit many different pathogens to animals, humans and their pets. Rickettsia slovaca, as a member of the spotted-fever-group rickettsiae is an agent of the human disease Tick-borne lymphadenopathy (TIBOLA),\\u000a also called Dermacentor-borne necrosis erythema and lymphadenopathy (DEBONEL), which occurs from the Mediterranean to central Europe, transmitted\\u000a by Dermacentor reticulatus and Dermacentor marginatus (Acari: Ixodidae). In this study, quantitative real

  18. Interfaces of ZnO Nanowires Grown on Semiconducting Surfaces Joysurya Basu, R. Divakar, Julia Deneen, Xinyu Wang,* Heiko O. Jacobs,* C. Barry

    E-print Network

    Jacobs, Heiko O.

    Interfaces of ZnO Nanowires Grown on Semiconducting Surfaces Joysurya Basu, R. Divakar, Julia The large direct band gap of ZnO makes it an important semiconductor. ZnO can be grown in the form applications such as heterojunction solar cells. Aligned nanowires of ZnO can be grown on semiconductor

  19. High-efficiency solar cells fabricated from direct-current magnetron sputtered n-indium tin oxide onto p-InP grown by atmospheric pressure metalorganic vapor phase epitaxy

    NASA Technical Reports Server (NTRS)

    Li, X.; Wanlass, M. W.; Gessert, T. A.; Emery, K. A.; Coutts, T. J.

    1989-01-01

    An attempt is made to improve device efficiencies by depositing indium tin oxide onto epitaxially grown p-InP on p(+)-InP substrates. This leads to a reduction in the device series resistance, high-quality reproducible surfaces, and an improvement in the transport properties of the base layer. Moreover, many of the facets associated with badly characterized bulk liquid encapsulated Czochralski substrates used in previous investigations are removed in this way.

  20. Strain Variation in Glycosaminoglycan Recognition Influences Cell-Type-Specific Binding by Lyme Disease Spirochetes

    Microsoft Academic Search

    NIKHAT PARVEEN; DOUGLAS ROBBINS; JOHN M. LEONG

    1999-01-01

    Lyme disease, a chronic multisystemic disorder that can affect the skin, heart, joints, and nervous system is caused by Borrelia burgdorferi sensu lato. Lyme disease spirochetes were previously shown to bind glycosamino- glycans (GAGs). In the current study, the GAG-binding properties of eight Lyme disease strains were deter- mined. Binding by two high-passage HB19 derivatives to Vero cells could not

  1. Direct evidence that HSV DNA damaged by Ultra Violet (UV) irradiation can be repaired in a cell type dependent manner

    PubMed Central

    Millhouse, Scott; Wang, Xiaohe; Fraser, Nigel W.; Faber, Lisa; Block, Timothy M.

    2012-01-01

    Infection of permissive cells, in tissue culture, with herpes simplex virus (HSV) has been reported to induce host DNA damage repair responses that are necessary for efficient viral replication. However, direct repair of the damaged viral DNA has not, to our knowledge, been shown. In this report, we detect and determine the amount of damaged HSV-1 DNA, following introduction of experimentally damaged HSV genomes into tissue cultures of permissive Vero, NGF differentiated PC12 cells and primary rat neurons, using a method of detection introduced here. The results show that HSV-1 strain 17 DNA containing UV-induced DNA damage is efficiently repaired, in Vero, but not NGF differentiated PC12 cells. The primary rat neuronal cultures were capable of repairing the damaged viral DNA, but with much less efficiency than did the permissive Vero cells. Moreover, by conducting the experiments with either an inhibitor of the HSV polymerase (phosphonoacetic acid [PAA]) or with a replication defective DNA polymerase mutant virus, HP66, the results suggest that repair can occur in the absence of a functional viral polymerase, although polymerase function seems to enhance the efficiency of the repair, in a replication independent manner. The possible significance of varying cell type mediated repair of viral DNA to viral pathogenesis is discussed. PMID:22581427

  2. The Herpes Simplex Virus Type 1 Regulatory Protein ICP27 Is Required for the Prevention of Apoptosis in Infected Human Cells

    Microsoft Academic Search

    MARTINE AUBERT; JOHN A. BLAHO

    1999-01-01

    The herpes simplex virus type 1 (HSV-1) ICP27 protein is an immediate-early or a protein which is essential for the optimal expression of late genes as well as the synthesis of viral DNA in cultures of Vero cells. Our specific goal was to characterize the replication of a virus incapable of synthesizing ICP27 in cultured human cells. We found that

  3. Entry and Survival ofLeishmania amazonensisAmastigotes within Phagolysosome-like Vacuoles That ShelterCoxiella burnetii in Chinese Hamster Ovary Cells

    Microsoft Academic Search

    PATRICIA S. T. VERAS; CATHERINE MOULIA; CHARLES DAUGUET; CECILE T. TUNIS; MONIQUE THIBON; ANDMICHEL RABINOVITCH

    1995-01-01

    Coxiella burnetii, a rickettsia, and Leishmania amazonensis, a protozoan flagellate, lodge in their host cells within large phagolysosome-like vacuoles. In the present study, C. burnetii-infected Vero or CHO cells were superinfected withL. amazonensisamastigotes to determine if these parasites can home to and survive within heterologous vacuoles. Six hours after superinfection,Leishmaniaamastigotes were located almost exclusively within largeCoxiella-containing vacuoles. Thereafter, the numbers

  4. SU-E-J-70: Feasibility Study of Dynamic Arc and IMRT Treatment Plans Utilizing Vero Treatment Unit and IPlan Planning Computer for SRS/FSRT Brain Cancer Patients

    SciTech Connect

    Huh, S; Lee, S; Dagan, R; Malyapa, R; Mendenhall, N; Mendenhall, W; Ho, M; Hough, D; Yam, M; Li, Z [UFPTI, Jacksonville, FL (United States)

    2014-06-01

    Purpose: To investigate the feasibility of utilizing Dynamic Arc (DA) and IMRT with 5mm MLC leaf of VERO treatment unit for SRS/FSRT brain cancer patients with non-invasive stereotactic treatments. The DA and IMRT plans using the VERO unit (BrainLab Inc, USA) are compared with cone-based planning and proton plans to evaluate their dosimetric advantages. Methods: The Vero treatment has unique features like no rotational or translational movements of the table during treatments, Dynamic Arc/IMRT, tracking of IR markers, limitation of Ring rotation. Accuracies of the image fusions using CBCT, orthogonal x-rays, and CT are evaluated less than ? 0.7mm with a custom-made target phantom with 18 hidden targets. 1mm margin is given to GTV to determine PTV for planning constraints considering all the uncertainties of planning computer and mechanical uncertainties of the treatment unit. Also, double-scattering proton plans with 6F to 9F beams and typical clinical parameters, multiple isocenter plans with 6 to 21 isocenters, and DA/IMRT plans are evaluated to investigate the dosimetric advantages of the DA/IMRT for complex shape of targets. Results: 3 Groups of the patients are divided: (1) Group A (complex target shape), CI's are same for IMRT, and DGI of the proton plan are better by 9.5% than that of the IMRT, (2) Group B, CI of the DA plans (1.91+/?0.4) are better than cone-based plan, while DGI of the DA plan is 4.60+/?1.1 is better than cone-based plan (5.32+/?1.4), (3) Group C (small spherical targets), CI of the DA and cone-based plans are almost the same. Conclusion: For small spherical targets, cone-based plans are superior to other 2 plans: DS proton and DA plans. For complex or irregular plans, dynamic and IMRT plans are comparable to cone-based and proton plans for complex targets.

  5. Harvesting microalgae grown on wastewater.

    PubMed

    Udom, Innocent; Zaribaf, Behnaz H; Halfhide, Trina; Gillie, Benjamin; Dalrymple, Omatoyo; Zhang, Qiong; Ergas, Sarina J

    2013-07-01

    The costs and life cycle impacts of microalgae harvesting for biofuel production were investigated. Algae were grown in semi-continuous culture in pilot-scale photobioreactors under natural light with anaerobic digester centrate as the feed source. Algae suspensions were collected and the optimal coagulant dosages for metal salts (alum, ferric chloride), cationic polymer (Zetag 8819), anionic polymer (E-38) and natural coagulants (Moringa Oleifera and Opuntia ficus-indica cactus) were determined using jar tests. The relative dewaterability of the algae cake was estimated by centrifugation. Alum, ferric chloride and cationic polymer could all achieve >91% algae recovery at optimal dosages. Life cycle assessment (LCA) and cost analysis results revealed that cationic polymer had the lowest cost but the highest environmental impacts, while ferric chloride had the highest cost and lowest environmental impacts. Based on the LCA results, belt presses are the recommended algae dewatering technology prior to oil extraction. PMID:23648758

  6. Tissue grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Cells from kidneys lose some of their special features in conventional culture but form spheres replete with specialized cell microvilli (hair) and synthesize hormones that may be clinically useful. Ground-based research studies have demonstrated that both normal and neoplastic cells and tissues recreate many of the characteristics in the NASA bioreactor that they display in vivo. Proximal kidney tubule cells that normally have rich apically oriented microvilli with intercellular clefts in the kidney do not form any of these structures in conventional two-dimensional monolayer culture. However, when normal proximal renal tubule cells are cultured in three-dimensions in the bioreactor, both the microvilli and the intercellular clefts form. This is important because, when the morphology is recreated, the function is more likely also to be rejuvenated. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC).

  7. Anomalous Mn depth profiles for GaMnAs/GaAs,,001... thin films grown by molecular beam epitaxy

    E-print Network

    Thibado, Paul M.

    Anomalous Mn depth profiles for GaMnAs/GaAs,,001... thin films grown by molecular beam epitaxy J. F 2007 Mn concentration depth profiles in Mn-doped GaAs thin films grown at substrate temperatures of 580 and 250 °C using various Mn cell temperatures have been investigated with dynamic secondary ion mass

  8. Olivine LiCoPO4 phase grown LiCoO2 cathode material for high density Li batteries

    E-print Network

    Cho, Jaephil

    Olivine LiCoPO4 phase grown LiCoO2 cathode material for high density Li batteries Hyunjung Lee olivine LiCoPO4, grown in LiCoO2 at 4.4 V, did not exhibit thermal runaway with a cell surface temperature

  9. Full-grown oocytes from Xenopus laevis resume growth when placed in culture

    Microsoft Academic Search

    R. A. Wallace; Z. Misulovin; L. D. Etkin

    1981-01-01

    When most full-grown, follicle cell-invested oocytes from Xenopus laevis are placed in an appropriate culture medium, they resume growth and remain physiologically healthy for at least 2 to 3 weeks. Rates of growth by full-grown oocytes in vitro generally approximate and can even exceed the most rapid growth rate achieved by vitellogenic oocytes in vivo. Resumption of oocyte growth can

  10. Journal of Crystal Growth 241 (2002) 4550 Boron doping of silicon layers grown by liquid phase epitaxy

    E-print Network

    2002-01-01

    ; B1. Boron; B1. Silicon; B3. Solar cells 1. Introduction Thin film silicon solar cells film solar cell applications as it allows the growth of a back surface field and a lightly doped bulk a reduced consumption of silicon compared with wafer based cells. Thin film layers have been grown

  11. Vitamin C content of organically grown produce

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organically grown produce is the fastest growing sector of fresh market sales in the U.S. While accounting for only 3% of total produce sales, it is growing by 20% per year. There has been much debate over the relative health merits of organically grown fruits and vegetables. Most consumers believ...

  12. Oxidation of Methyl tertButyl Ether by Alkane Hydroxylase in Dicyclopropylketone-Induced and n-Octane-Grown Pseudomonas putida GPo1

    Microsoft Academic Search

    Christy A. Smith; Michael R. Hyman

    2004-01-01

    The alkane hydroxylase enzyme system in Pseudomonas putida GPo1 has previously been reported to be unreactive toward the gasoline oxygenate methyl tert-butyl ether (MTBE). We have reexamined this finding by using cells of strain GPo1 grown in rich medium containing dicyclopropylketone (DCPK), a potent gratuitous inducer of alkane hydroxylase activity. Cells grown with DCPK oxidized MTBE and generated stoichiometric quantities

  13. A Recombinant Measles Vaccine Virus Expressing Wild-Type Glycoproteins: Consequences for Viral Spread and Cell Tropism

    PubMed Central

    Johnston, Ian C. D.; ter Meulen, V.; Schneider-Schaulies, Jürgen; Schneider-Schaulies, Sibylle

    1999-01-01

    Wild-type, lymphotropic strains of measles virus (MV) and tissue culture-adapted MV vaccine strains possess different cell tropisms. This observation has led to attempts to identify the viral receptors and to characterize the functions of the MV glycoproteins. We have functionally analyzed the interactions of MV hemagglutinin (H) and fusion (F) proteins of vaccine (Edmonston) and wild-type (WTF) strains in different combinations in transfected cells. Cell-cell fusion occurs when both Edmonston F and H proteins are expressed in HeLa or Vero cells. The expression of WTF glycoproteins in HeLa cells did not result in syncytia, yet they fused efficiently with cells of lymphocytic origin. To further investigate the role of the MV glycoproteins in virus cell entry and also the role of other viral proteins in cell tropism, we generated recombinant vaccine MVs containing one or both glycoproteins from WTF. These viruses were viable and grew similarly in lymphocytic cells. Recombinant viruses expressing the WTFH protein showed a restricted spread in HeLa cells but spread efficiently in Vero cells. Parental WTF remained restricted in both cell types. Therefore, not only differential receptor usage but also other cell-specific factors are important in determining MV cell tropism. PMID:10400788

  14. A recombinant measles vaccine virus expressing wild-type glycoproteins: consequences for viral spread and cell tropism.

    PubMed

    Johnston, I C; ter Meulen, V; Schneider-Schaulies, J; Schneider-Schaulies, S

    1999-08-01

    Wild-type, lymphotropic strains of measles virus (MV) and tissue culture-adapted MV vaccine strains possess different cell tropisms. This observation has led to attempts to identify the viral receptors and to characterize the functions of the MV glycoproteins. We have functionally analyzed the interactions of MV hemagglutinin (H) and fusion (F) proteins of vaccine (Edmonston) and wild-type (WTF) strains in different combinations in transfected cells. Cell-cell fusion occurs when both Edmonston F and H proteins are expressed in HeLa or Vero cells. The expression of WTF glycoproteins in HeLa cells did not result in syncytia, yet they fused efficiently with cells of lymphocytic origin. To further investigate the role of the MV glycoproteins in virus cell entry and also the role of other viral proteins in cell tropism, we generated recombinant vaccine MVs containing one or both glycoproteins from WTF. These viruses were viable and grew similarly in lymphocytic cells. Recombinant viruses expressing the WTFH protein showed a restricted spread in HeLa cells but spread efficiently in Vero cells. Parental WTF remained restricted in both cell types. Therefore, not only differential receptor usage but also other cell-specific factors are important in determining MV cell tropism. PMID:10400788

  15. MBE grown iron-based nanostructures

    NASA Astrophysics Data System (ADS)

    Lok, Shu Kin

    Interest in magnetic nanostructures has increased rapidly because of their potential applications in a number of magnetic nanotechnologies such as high-density magnetic recording media, magnetic field sensors, magnetic nanoprobes for spin-polarized microscopy and cell manipulation in biomedical technology. Successful incorporation of ferromagnetic nanostructures in semiconductors may open a new area in spintronic applications. In this study, two kinds of Fe-based nanostructures were grown by the molecular beam epitaxy (MBE) technique, namely, Fe quantum dots (QDs) and Fe nanowires (NWs). For Fe QDs, a multilayer magnetic QD sample containing 5 layers of Fe QDs embedded in 6 layers of ZnS spacer was grown on a GaP(100) substrate. High resolution transmission electron microscopy (HRTEM) observations reveal that the Fe QDs are single crystalline with spherical shape of diameters around 3 to 4 nm and area density of 1.5 x 1012 cm-2 . Its zero-field cooled (ZFC) and field cooled (FC) curves measured at low field (100 Oe) show the magnetic relaxation effect with a blocking temperature around 26 K. The hysteresis loop measured at 5 K shows a coercivity of 83 Oe, confirming the slow relaxation process and coercivity enhancement attributed to the nanoparticle nature of the sample. To study the transport property of Fe QDs, a Au/ZnS/Fe-QDs/ZnS/n+-GaAs Schottky-barrier structure containing 5 layers of Fe QDs was fabricated on a n+-GaAs(100) substrate. Its current-voltage (I-V) characteristics measured from 5 to 295 K display negative differential resistance (NDR) for temperature . 50 K, which is caused by the presence of Fe QDs. The highest peak-to-valley current ratio obtained at 5 K is as high as 15:1. Staircase-like I-V characteristic was also observed at low temperature in some devices fabricated from this structure. Possible mechanisms that can account for the observed unusual I-V characteristics in this structure were discussed. Two types of self-assembled Fe NWs were grown on ZnS/GaP(100) surface under high growth/annealing temperature. The Type-A Fe NWs orient along the ZnS[110] direction with irregular shape, while the type-B Fe NWs orient along either the ZnS[180] or [810] direction with seemingly straight shape. Detailed HRTEM and selected area diffraction (SAD) studies reveal that both types were single-crystalline with their elongated axis along the Fe<100> direction family possibly due to the fact that the easy axis of Fe is along this direction. We have proposed a mean-field model to explain the slight misalignment of the type-B Fe NWs. The I-V characteristic of a single type-B Fe NW measured at room temperature displays a straight line nature corresponding to a resistivity about 2.3 x 10-7Om.

  16. Microwave Heating Inactivates Shiga Toxin (Stx2) in Reconstituted Fat-Free Milk and Adversely Affects the Nutritional Value of Cell Culture Medium.

    PubMed

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel

    2014-03-26

    Microwave exposure is a convenient and widely used method for defrosting, heating, and cooking numerous foods. Microwave cooking is also reported to kill pathogenic microorganisms that often contaminate food. In this study, we tested whether microwaves would inactivate the toxicity of Shiga toxin 2 (Stx2) added to 5% reconstituted fat-free milk administered to monkey kidney Vero cells. Heating of milk spiked with Stx2 in a microwave oven using a 10% duty cycle (cycle period of 30 s) for a total of 165 kJ energy or thermal heating (pasteurization), widely used to kill pathogenic bacteria, did not destroy the biological effect of the toxin in the Vero cells. However, conventional heating of milk to 95 °C for 5 min or at an increased microwave energy of 198 kJ reduced the Stx2 activity. Gel electrophoresis showed that exposure of the protein toxin to high-energy microwaves resulted in the degradation of its original structure. In addition, two independent assays showed that exposure of the cell culture medium to microwave energy of 198 kJ completely destroyed the nutritional value of the culture medium used to grow the Vero cells, possibly by damaging susceptible essential nutrients present in the medium. These observations suggest that microwave heating has the potential to destroy the Shiga toxin in liquid food. PMID:24669932

  17. Materials science: Semiconductors grown large and thin

    NASA Astrophysics Data System (ADS)

    Marks, Tobin J.; Hersam, Mark C.

    2015-04-01

    Atomically thin layers of semiconductors called transition-metal dichalcogenides have been grown uniformly on the square-centimetre scale -- paving the way for the ultimate miniaturization of electronic applications. See Letter p.656

  18. Some karyological observations on plants grown in space

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.; Oconnor, S. A.

    1982-01-01

    Experiments were conducted to assess whether cell division in a plant root would be affected by prolonged exposure to microgravity. Root materials from sunflower, oat, and mung bean plants grown on STS-2 and STS-3 were utilized for the experiments. It is found that all oat, sunflower, and mung seedlings showed a reduced number of cells in division as they went through their first cell division cycle on earth when compared to their ground controls. A significant number of oat, mung, and sunflower plantlets exhibited random root orientation and the lack of strictly orthotropic growth of their shoot systems in the flight samples. In addition, it is found that the mung roots were apparently least affected in terms of their cytology despite the fact that their roots were often randomly oriented.

  19. TR146 cells grown on filters as a model of human buccal epithelium: IV. Permeability of water, mannitol, testosterone and beta-adrenoceptor antagonists. Comparison to human, monkey and porcine buccal mucosa.

    PubMed

    Nielsen, H M; Rassing, M R

    2000-01-25

    The objective of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium. For this purpose, the permeability of water, mannitol and testosterone across the TR146 cell culture model was compared to the permeability across human, monkey and porcine buccal mucosa. Further, the permeability rates of ten beta-adrenoceptor antagonists (acebutolol, alprenolol, atenolol, labetalol, metoprolol, oxprenolol, pindolol, propranolol, timolol and tertatolol) across the TR146 cell culture model and porcine buccal mucosa were related to their lipophilicity (logD(oct; 7.4)) and capacity factor (k') and to their polar water accessible surface area (PWASA). For water, mannitol, testosterone and some of the beta-adrenoceptor antagonists, the permeability enhancement across the TR146 cell culture model in the presence of sodium glycocholate (GC) was determined. The mannitol and testosterone permeability across the TR146 cell culture model could be related to the permeability across porcine and human buccal mucosa. The permeability of the beta-adrenoceptor antagonists across the TR146 cell culture model varied between 2.2 x 10(-6) cm/s (atenolol) and 165 x 10(-6) cm/s (metoprolol). For propranolol the cellular permeability value (P(c)) was lower than expected, probably due to accumulation in the TR146 cell layers. Limited correlation of permeability with k' was observed both for the TR146 cell culture model and the porcine buccal mucosa, although the porcine permeability values were approximately 100 times less than the values determined with the TR146 cell culture model. The permeability values were also found to decrease with increasing PWASA. The PWASA value seemed to be more predictable for permeability than k'. The presence of 12.5 mM GC increased the permeability only for the hydrophilic atenolol, which may help explain the mechanism for GC-induced enhancement. The present results indicate that the TR146 cell culture model can be used as an in vitro model for permeability studies and mechanistic studies of human buccal drug delivery of drugs with different lipophilicity. PMID:10692640

  20. Comparison Of LEC-Grown And VGF-Grown GaSb

    NASA Astrophysics Data System (ADS)

    Reijnen, L.; Brunton, R.; Grant, I. R.

    2004-11-01

    GaSb 2? diameter ingots doped with Tellurium have been grown by Vertical Gradient Freeze (VGF) on a (1 0 0) orientation. The ingots were grown in quartz crucibles with the use of an encapsulant and both 6 mm diameter and 50 mm diameter seeds. Twinning in the seed or in the cone of the crucible occurred in almost all cases when a 6 mm diameter seed was used, while using full-diameter (50 mm ID) seeds with a carefully controlled diameter resulted in single-crystal growth. The quality of the VGF-grown GaSb:Te from both 6 mm and full-diameter seeds has been compared to our commercially produced Liquid Encapsulated Czochralski (LEC) grown GaSb. The donor density and raman spectra of the VGF-grown GaSb are comparable to the electronic properties of LEC-grown GaSb, but slightly lower mobilities for the VGF-material are observed. The etch pit density (EPD) in VGF-grown GaSb from 6 mm diameter seeds is extremely low, around 5 per cm2. As expected the EPD of LEC-grown GaSb is significantly higher, due to the higher stress induced in the material during growth. Interestingly, the EPD for GaSb grown by VGF from full diameter seeds is comparable to the EPD from LEC-grown material. It is believed that seeding in VGF-growth induces stress and, therefore, a higher EPD. The use of small seeds ensures that dislocations can grow out. The crystal quality of the three materials is compared by comparing the X-ray rocking curves. LEC-grown GaSb and VGF-grown GaSb from full-diameter and 6 mm diameter seeds show a FWHM of 14.6, 15.1, and 20.7 arcsec, respectively.

  1. Establishment of Fruit Bat Cells (Rousettus aegyptiacus) as a Model System for the Investigation of Filoviral Infection

    PubMed Central

    Krähling, Verena; Dolnik, Olga; Kolesnikova, Larissa; Schmidt-Chanasit, Jonas; Jordan, Ingo; Sandig, Volker; Günther, Stephan; Becker, Stephan

    2010-01-01

    Background The fruit bat species Rousettus aegyptiacus was identified as a potential reservoir for the highly pathogenic filovirus Marburg virus. To establish a basis for a molecular understanding of the biology of filoviruses in the reservoir host, we have adapted a set of molecular tools for investigation of filovirus replication in a recently developed cell line, R06E, derived from the species Rousettus aegyptiacus. Methodology/Principal Findings Upon infection with Ebola or Marburg viruses, R06E cells produced viral titers comparable to VeroE6 cells, as shown by TCID50 analysis. Electron microscopic analysis of infected cells revealed morphological signs of filovirus infection as described for human- and monkey-derived cell lines. Using R06E cells, we detected an unusually high amount of intracellular viral proteins, which correlated with the accumulation of high numbers of filoviral nucleocapsids in the cytoplasm. We established protocols to produce Marburg infectious virus-like particles from R06E cells, which were then used to infect naïve target cells to investigate primary transcription. This was not possible with other cell lines previously tested. Moreover, we established protocols to reliably rescue recombinant Marburg viruses from R06E cells. Conclusion/Significance These data indicated that R06E cells are highly suitable to investigate the biology of filoviruses in cells derived from their presumed reservoir. PMID:20808767

  2. Dynamic Contrast-Enhanced Magnetic Resonance Imaging Rapidly Indicates Vessel Regression in Human Squamous Cell Carcinomas Grown in Nude Mice Caused by VEGF Receptor 2 Blockade with DC101

    Microsoft Academic Search

    Fabian Kiessling; Nabeel Farhan; Matthias P. Lichy; Silvia Vosseler; Melanie Heilmann; Martin Krix; Peter Bohlen; Dan W. Miller; Margareta M. Mueller; Wolfhard Semmler; Norbert E. Fusenig; Stefan Delorme

    2004-01-01

    The purpose of our study was the investigation of early changes in tumor vascularization during antiangiogen- ic therapy with the vascular endothelial growth factor (VEGF) receptor 2 antibody (DC101) using dynamic contrast-enhanced magnetic resonance imaging (DCE MRI). Subcutaneous heterotransplants of human skin squamous cell carcinomas in nude mice were treated with DC101. Animals were examined before and repeat- edly during

  3. Morphology of fibroblasts grown on substrates formed by dielectrophoretically aligned carbon nanotubes

    PubMed Central

    Yuen, Felix L.-Y.; Zak, Gene; Waldman, Stephen D.

    2007-01-01

    Multiwall carbon nanotube templates formed on the surfaces of planar interdigitated microelectrode arrays by means of AC electric field-guided assembly are being explored as potential substrates for tissue engineering. The objective of the present study is to examine whether surface patterns of aligned multiwall carbon nanotubes can have an effect on cell growth, morphology, and alignment. Bovine fibroblasts grown on aligned carbon nanotubes for a period of 2 weeks were found to have raised bodies and pronounced cell extensions for anchoring themselves to the substrate similar to that of the cells found in native tissues. On the other hand, cells grown on various control surfaces had a flat, circular morphology. The cell cultures were visualized by means of SEM imaging and the resulting morphologies were statistically analyzed and compared. PMID:19002836

  4. Mechanoresponses of human primary osteoblasts grown on carbon nanotubes.

    PubMed

    Kroustalli, A; Kotsikoris, V; Karamitri, A; Topouzis, S; Deligianni, D

    2015-03-01

    Bone mechanotransduction is strongly influenced by the biomaterial properties. A good understanding of these mechanosensory mechanisms in bone has the potential to provide new strategies in the highly evolving field of bone tissue engineering. The aim of the present investigation was to study the interactive effects of local mechanical stimuli on multiwalled carbon nanotubes (MWCNTs)/osteoblast interface, using an in vitro model that allows the study of cell growth, attachment and differentiation. Strain was applied at physiological levels [strain magnitudes 500 microstrain (??), at frequency of load application 0.5 Hz]. The effect of mechanical strain and substrate was thus studied by measuring the messenger RNA expression of alkaline phosphatase, vinculin, collagen 1A, and integrins ?1, ?3, ?4, and ?v, using real-time quantitative polymerase chain reaction. The osteoblasts grown on MWCNTs displayed quick adaptation to the new environment by modulating the expression of key adhesion integrins. Furthermore, the addition of mechanical strain interplayed with the extracellular matrix and was efficiently transduced by cells grown on MWCNTs, providing stronger adhesion and survival. MWCNTs are therefore a material perfectly compatible with osteoblast differentiation, adhesion, and growth, and should be further evaluated, to derive new-generation biomaterial scaffolds for the treatment of skeletal defects which require bone reconstruction. PMID:24910375

  5. Effect of beta-lactams on peptidoglycan metabolism of Haemophilus influenzae grown in animals.

    PubMed Central

    Rousseau, N; Dargis, M; Gourde, P; Beauchamp, D; Malouin, F

    1992-01-01

    We have examined bacterial determinants that influence beta-lactam activity in Haemophilus influenzae cells cultivated in a system that reproduces in vivo growth conditions. Bacteria grown in diffusion chambers were recovered from the peritoneal cavities of rats, and their cell properties were compared with those of bacteria grown in broth cultures by various tests performed in vitro. The rate of peptidoglycan synthesis was measured as the incorporation of [14C]alanine into cell wall material in the presence of chloramphenicol. The total incorporation of [14C]alanine into peptidoglycan was markedly increased in cells grown in rats prior to the assay but was efficiently reduced by the beta-lactams. The extent of cross-linking was lower in the peptidoglycan of in vivo-grown bacteria, as estimated by sodium dodecyl sulfate- to trichloroacetic acid-insoluble radioactive cell wall material ratios. A whole-cell labeling assay with 125I-penicillin was used to characterize the penicillin-binding proteins (PBPs). Four PBPs showed a striking reduction in the binding of the labeled penicillin in cells grown in rats. Such changes resembled the PBP alterations seen in beta-lactamase-negative clinical strains that were resistant to the beta-lactams. Although ampicillin and moxalactam showed delayed inhibitory activities in vitro for cells collected from rats, cells recovered from beta-lactam-treated rats showed evidence of antibiotic effectiveness (binding of the beta-lactams to PBPs in vivo and altered morphology), and the killing of cells exposed to antibiotics in broth or in peritoneal fluid was equally good. Finally, the frequencies of spontaneous resistance or tolerance to ampicillin or moxalactam were estimated, and there was no significant difference for in vitro- or in vivo-grown cells. These data demonstrated that the cultivation of H. influenzae in animals created changes in PBPs and the overall peptidoglycan metabolism. Such alterations did not impair the bactericidal activities of the beta-lactams, although they resulted in delayed bacterial inhibition, a phenomenon that may have important consequences in antibiotherapy. Images PMID:1444294

  6. Stability of Detached Grown Germanium Single Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Volz, M. P.; Cobb, S. D.; Motakef, S.; Szofran, F. R.; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years especially, under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 microns, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 microns. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be discussed in detail.

  7. Stability of Detached Grown Germanium Single Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Volz, M. P.; Cobb, S. D.; Vujisic, L.; Szofran, F. R.; Rose, M. Franklin (Technical Monitor)

    2001-01-01

    Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years, especially under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 micrometers, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5 mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 micrometers. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be discussed in detail.

  8. Cytochemical localization of catalase activity in methanol-grown Hansenula polymorpha

    Microsoft Academic Search

    J. P. van Dijken; M. Veenhuis; C. A. Vermeulen; W. Harder

    1975-01-01

    The localization of peroxidase activity in methanol-grown cells of the yeast Hansenula polymorpha has been studied by a method based on cytochemical staining with diaminobenzidine (DAB). The oxidation product of DAB occurred in microbodies, which characteristically develop during growth on methanol, and in the intracristate space of the mitochondria.

  9. Outer membrane and porin characteristics of Serratia marcescens grown in vitro and in rat intraperitoneal diffusion chambers.

    PubMed Central

    Malouin, F; Campbell, G D; Halpenny, M; Becker, G W; Parr, T R

    1990-01-01

    The composition and antibiotic permeability barrier of the outer membrane of Serratia marcescens were assessed in cells grown in vivo and in vitro. Intraperitoneal diffusion chambers implanted in rats were used for the in vivo cultivation of bacteria. Outer membranes isolated from log-phase bacterial cells recovered from these chambers were compared with membranes isolated from cells grown in vitro. Analysis revealed that the suspected 41-kilodalton porin and the OmpA protein were recovered on sodium dodecyl sulfate-polyacrylamide gels in equal quantities. Several high-molecular-weight proteins, thought to be iron starvation induced, appeared in the diffusion chamber-grown cells. The outer membrane permeability barriers to cephaloridine were similar in in vivo- and in vitro-grown cells based on permeability coefficient calculations. The permeability coefficient of cephaloridine in S. marcescens cells (30.3 x 10(-5) to 38.9 x 10(-5) cm s-1) was greater than that obtained for an Escherichia coli strain expressing only porin OmpC but smaller than those obtained for the E. coli wild type and a strain expressing only porin OmpF. Functional characterization of the suspected porin was performed by using the planar lipid bilayer technology. The sodium dodecyl sulfate-0.4 M NaCl-soluble porin from both in vitro- and in vivo-grown cells showed an average single-channel conductance in 1 M KCl of 1.6. A partial amino acid sequence (19 residues) was obtained for the S. marcescens porin. The sequence showed a very high homology to the E. coli OmpC porin. These data identified the S. marcescens outer membrane 41-kilodalton protein as a porin by both functional and amino acid analyses. Also, the methodology used allowed for efficient growth and recovery of diffusion chamber-grown bacterial cells and permitted identification of specific in vivo-induced changes in bacterial cell membrane composition. Images PMID:2157667

  10. Different host-cell shutoff strategies related to the matrix protein lead to persistence of vesicular stomatitis virus mutants on fibroblast cells.

    PubMed

    Desforges, M; Charron, J; Bérard, S; Beausoleil, S; Stojdl, D F; Despars, G; Laverdière, B; Bell, J C; Talbot, P J; Stanners, C P; Poliquin, L

    2001-07-01

    Acute infection of fibroblastic cell lines by the Indiana strain of vesicular stomatitis virus (VSV) usually induces dramatic cytopathic effects and shutoff of cellular gene expression. We have compared a series of independent mutants with differences in shutoff induction and found that M was mutated either in the N-terminus (M(51)R) or C-terminus (V(221)F and S(226)R). Furthermore, only double mutants (M mutation and a ts mutation related or not to M) were able to persist on fibroblast cell lines at 39 degrees C. A more detailed investigation of the infection was performed for the mutants T1026, TP3 and G31, differing in their host shutoff effects related to M protein. Viral activity in persistently infected mouse L-929 and monkey Vero cell lines was followed by viral proteins detection, RNA synthesis throughout infection and finally detection of infectious particles. All three mutants cause extensive CPE followed by emergence of persistently infected cells on Vero cells. The same thing is seen on L-929 cells except for T1026 which causes little CPE. Taken together, the results form a basis of further studies to clarify how various viral and cellular factors interact in the establishment of a persistent infection by VSV mutants. PMID:11376849

  11. Enhanced phosphate uptake and polyphosphate accumulation in Burkholderia cepacia grown under low-pH conditions

    Microsoft Academic Search

    A. Mullan; J. P. Quinn; J. W. McGrath

    2002-01-01

    Of bacterial cells in a sample of activated sludge, 34% contained detectable intracellular polyphosphate inclusions following\\u000a Neisser staining when grown on glucose\\/mineral salts medium at pH 5.5; at pH 7.5 only 7% of cells visibly accumulated polyphosphate.\\u000a In a sludge isolate of Burkholderia cepacia chosen for further study, maximal removal of phosphate and accumulation of polyphosphate occurred at pH 5.5;

  12. Triclinic deformation of InGaN layers grown on vicinal surface of GaN (00.1) substrates

    NASA Astrophysics Data System (ADS)

    Krysko, M.; Domagala, J. Z.; Czernecki, R.; Leszczynski, M.

    2013-09-01

    We report on a triclinic unit cell deformation of fully strained InGaN layers grown on vicinal GaN (00.1) substrates. The samples were examined using the high-resolution X-ray diffraction (HR XRD) using a set of asymmetrical reflections and one symmetrical reflection of 00.2. The substrate miscut induced triclinic deformation of the layer unit cells, breaking the hexagonal symmetry. The experimental results are compared with predictions of the theory of elasticity. We formulate equations for unit cell parameters of layers grown on substrates cut in any direction, based on the equations given by Romanov et al. [J. Appl. Phys. 100, 023522 (2006)]. Additionally, the paper provides a recipe of the XRD measurements necessary to establish unit cell parameters (useful for composition determination of ternary compounds) of the hexagonal mismatched layers grown on off-axis substrates.

  13. Efflux Of Nitrate From Hydroponically Grown Wheat

    NASA Technical Reports Server (NTRS)

    Huffaker, R. C.; Aslam, M.; Ward, M. R.

    1992-01-01

    Report describes experiments to measure influx, and efflux of nitrate from hydroponically grown wheat seedlings. Ratio between efflux and influx greater in darkness than in light; increased with concentration of nitrate in nutrient solution. On basis of experiments, authors suggest nutrient solution optimized at lowest possible concentration of nitrate.

  14. Rice Plants Grown With and Without Endophytes

    USGS Multimedia Gallery

    These rice plants show the difference in growth of rice plants exposed to salt when grown with and without endophytes, which are mutually beneficial microscopic fungi that live in most plants. The plant on the left was colonized with a fungi that made it salt-tolerant, but it wasn't exposed to ...

  15. ACTION OF CYTOCHALASIN D ON CELLS OF ESTABLISHED LINES

    PubMed Central

    Miranda, Armand F.; Godman, Gabriel C.; Deitch, Arline D.; Tanenbaum, Stuart W.

    1974-01-01

    HeLa, Vero, L, HEp2, and MDBK cells respond immediately to 0.2–0.5 µg/ml cytochalasin D (CD) with sustained contraction (contracture), loss of microvilli, expression of endoplasmic contents (zeiosis), nuclear protrusion, and extension of cytoplasmic processes. The development of these changes is depicted, and the dose-response patterns in these cell lines are described. MDBK is generally most resistant and HeLa most sensitive to these effects of CD. Cells in G1 are most sensitive to CD; responsiveness decreases progressively during early S and is least in mid S through G2. CD inhibits transport of [14C]deoxyglucose in HeLa by about 45% but has no significant effect on hexose uptake in Vero and MDBK; sugar transport is thus apparently unrelated to any morphologic effect of CD. Although spreading and attachment are impeded, CD does not decrease and may even enhance the adhesiveness of established monolayers. Contraction appears to be a primary early effect of CD, upon which other visible changes follow. It is prevented by some inhibitors of energy metabolism (deoxyglucose and dinitrophenol) and does not occur in glycerinated models without ATP. The possible bases of the contractile response to CD are discussed. Although direct or indirect action of CD on some microfilaments may occur, a generalized structural disruption of contractile filaments by CD is considered unlikely. PMID:4208074

  16. Growth of dissociated rat cerebellar cells using serum-free supplemented media and varied transferrin concentrations

    Microsoft Academic Search

    Anne Messer; Joseph E. Mazurkiewicz; Paul Maskin

    1981-01-01

    Dissociated neonatal rat cerebellar cells were grown on medium supplemented with 10% horse serum (HS) and compared with those grown using a serum-free supplemented (SFS) medium, modified from Bottenstein and Sato (1979). containing insulin, transferrin, progesterone, putrescine, and selenium (after an initial 24 hr in 10% horse serum). Cells survived for several weeks using either medium. Cells grown in SFS

  17. Behavior and ultrastructure of in vitro ageing mouse embryo fibroblasts grown in collagen gels.

    PubMed

    van Lerberghe, N; van Gansen, P

    1986-04-01

    We have compared the behaviour and the ultrastructure of embryonic mouse fibroblasts embedded into collagen gels at early, middle and late population doubling levels (PDL). Late mouse fibroblasts were able to induce gel contraction with a greater efficiency than young cells. We did not find any differences in the organization of these gels. Electron microscope observations on gels containing fibroblasts of different PDL showed that the collagen lattice induced new specific and distinct phenotypes. The well-known ultrastructural differences between young and late fibroblasts grown on plastic substrates were less prominent when these cells were embedded into collagen gels. The late fibroblasts grown into gels kept their large size and their lobulated nuclei and resembled fibroblasts grown on plastic surfaces. However, dramatic changes were observed in their pattern of microfilaments, in the dispersion of their chromatin and in their ergastoplasmic structure; these characteristics observed in late fibroblasts grown into gels were close to those of young cells. The new phenotypes of young, middle-aged and late fibroblasts in the collagen gels seemed to be stable and did not display the characteristics of an older phenotype on continued incubation. When the fibroblasts left the gel, they returned to their initial phenotype. PMID:3724249

  18. Characterization of Cellulolytic Bacterial Cultures Grown in Different Substrates

    PubMed Central

    Alshelmani, Mohamed Idris; Loh, Teck Chwen; Foo, Hooi Ling; Sazili, Awis Qurni

    2013-01-01

    Nine aerobic cellulolytic bacterial cultures were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ) and the American Type Culture Collection (ATCC). The objectives of this study were to characterize the cellulolytic bacteria and to determine the optimum moisture ratio required for solid state fermentation (SSF) of palm kernel cake (PKC). The bacteria cultures were grown on reconstituted nutrient broth, incubated at 30°C and agitated at 200?rpm. Carboxymethyl cellulase, xylanase, and mannanase activities were determined using different substrates and after SSF of PKC. The SSF was conducted for 4 and 7 days with inoculum size of 10% (v/w) on different PKC concentration-to-moisture ratios: 1?:?0.2, 1?:?0.3, 1?:?0.4, and 1?:?0.5. Results showed that Bacillus amyloliquefaciens 1067?DSMZ, Bacillus megaterium 9885?ATCC, Paenibacillus curdlanolyticus 10248?DSMZ, and Paenibacillus polymyxa 842?ATCC produced higher enzyme activities as compared to other bacterial cultures grown on different substrates. The cultures mentioned above also produced higher enzyme activities when they were incubated under SSF using PKC as a substrate in different PKC-to-moisture ratios after 4 days of incubation, indicating that these cellulolytic bacteria can be used to degrade and improve the nutrient quality of PKC. PMID:24319380

  19. Three distinct quinoprotein alcohol dehydrogenases are expressed when Pseudomonas putida is grown on different alcohols.

    PubMed Central

    Toyama, H; Fujii, A; Matsushita, K; Shinagawa, E; Ameyama, M; Adachi, O

    1995-01-01

    A bacterial strain that can utilize several kinds of alcohols as its sole carbon and energy sources was isolated from soil and tentatively identified as Pseudomonas putida HK5. Three distinct dye-linked alcohol dehydrogenases (ADHs), each of which contained the prosthetic group pyrroloquinoline quinone (PQQ), were formed in the soluble fractions of this strain grown on different alcohols. ADH I was formed most abundantly in the cells grown on ethanol and was similar to the quinoprotein ADH reported for P. putida (H. Görisch and M. Rupp, Antonie Leeuwenhoek 56:35-45, 1989) except for its isoelectric point. The other two ADHs, ADH IIB and ADH IIG, were formed separately in the cells grown on 1-butanol and 1,2-propanediol, respectively. Both of these enzymes contained heme c in addition to PQQ and functioned as quinohemoprotein dehydrogenases. Potassium ferricyanide was an available electron acceptor for ADHs IIB and IIG but not for ADH I. The molecular weights were estimated to be 69,000 for ADH IIB and 72,000 for ADH IIG, and both enzymes were shown to be monomers. Antibodies raised against each of the purified ADHs could distinguish the ADHs from one another. Immunoblot analysis showed that ADH I was detected in cells grown on each alcohol tested, but ethanol was the most effective inducer. ADH IIB was formed in the cells grown on alcohols of medium chain length and also on 1,3-butanediol. Induction of ADH IIG was restricted to 1,2-propanediol or glycerol, of which the former alcohol was more effective. These results from immunoblot analysis correlated well with the substrate specificities of the respective enzymes. Thus, three distinct quinoprotein ADHs were shown to be synthesized by a single bacterium under different growth conditions. PMID:7730276

  20. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...grown from late blooms. Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat tails”), or may be misshapen or slightly rough. Such pears do not ripen properly for ordinary canning...

  1. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...grown from late blooms. Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat tails”), or may be misshapen or slightly rough. Such pears do not ripen properly for ordinary canning...

  2. Electrical currents through full-grown and maturing Xenopus oocytes.

    PubMed Central

    Robinson, K R

    1979-01-01

    An extracellular vibrating electrode was used to map the current pattern around Xenopus laevis oocytes. Current was found to enter the animal hemisphere and leave the vegetal hemisphere; in fully grown oocytes from which the follicle cells had been removed, the maximal current density was about 1 microamperemeter/cm2. This current decreased to nearly zero in response to progesterone and several other maturation-producing agents. In the case of progesterone, the decline began within a few minutes of the addition of the hormone and proceeded with a half-time of about 20 min. An analysis of the effects on the current of the removal or addition of various ions and drugs led to the inference that the major current-carrying ion was chloride and that the chloride permeability was controlled by calcium. PMID:284407

  3. Counting molecular-beam grown graphene layers

    SciTech Connect

    Plaut, Annette S. [School of Physics, University of Exeter, Exeter EX4 4QL (United Kingdom)] [School of Physics, University of Exeter, Exeter EX4 4QL (United Kingdom); Wurstbauer, Ulrich [Department of Physics, Columbia University, New York, New York 10027 (United States)] [Department of Physics, Columbia University, New York, New York 10027 (United States); Pinczuk, Aron [Department of Physics, Columbia University, New York, New York 10027 (United States) [Department of Physics, Columbia University, New York, New York 10027 (United States); Department of Applied Physics and Applied Mathematics, Columbia University, New York, New York 10027 (United States); Garcia, Jorge M. [MBE Lab, IMM-Instituto de Microelectronica de Madrid (CNM-CSIC), Madrid, E-28760 (Spain)] [MBE Lab, IMM-Instituto de Microelectronica de Madrid (CNM-CSIC), Madrid, E-28760 (Spain); Pfeiffer, Loren N. [Electrical Engineering Department, Princeton University, New Jersey 08544 (United States)] [Electrical Engineering Department, Princeton University, New Jersey 08544 (United States)

    2013-06-17

    We have used the ratio of the integrated intensity of graphene's Raman G peak to that of the silicon substrate's first-order optical phonon peak, accurately to determine the number of graphene layers across our molecular-beam (MB) grown graphene films. We find that these results agree well both, with those from our own exfoliated single and few-layer graphene flakes, and with the results of Koh et al.[ACS Nano 5, 269 (2011)]. We hence distinguish regions of single-, bi-, tri-, four-layer, etc., graphene, consecutively, as we scan coarsely across our MB-grown graphene. This is the first, but crucial, step to being able to grow, by such molecular-beam-techniques, a specified number of large-area graphene layers, to order.

  4. Nanoelectronic biosensors based on CVD grown graphene

    Microsoft Academic Search

    Yinxi Huang; Xiaochen Dong; Yumeng Shi; Chang Ming Li; Lain-Jong Li; Peng Chen

    2010-01-01

    Graphene, a single-atom-thick and two-dimensional carbon material, has attracted great attention recently. Because of its unique electrical, physical, and optical properties, graphene has great potential to be a novel alternative to carbon nanotubes in biosensing. We demonstrate the use of large-sized CVD grown graphene films configured as field-effect transistors for real-time biomolecular sensing. Glucose or glutamate molecules were detected by

  5. Bacterial decontamination of on-grown Artemia

    Microsoft Academic Search

    Anthony Tolomei; Chris Burke; Bradley Crear; Jeremy Carson

    2004-01-01

    The bacterial load of on-grown Artemia was manipulated using a variety of commercially available enrichment DHA boosters, selected algal species (Skeletonema costatum; Nannochloropsis oculata; Tetraselmis suecica; Chaetoceros muelleri), and ozone to decontaminate enteric and external surfaces, respectively. Enrichment in C. muelleri over a 6-h period, with an additional algal exchange mid-enrichment, provided the most efficient method for enteric decontamination as

  6. Characterization of the Initial Reactions during the Cometabolic Oxidation of Methyl tertButyl Ether by Propane-Grown Mycobacterium vaccae JOB5

    Microsoft Academic Search

    Christy A. Smith; Kirk T. O'Reilly; Michael R. Hyman

    2003-01-01

    The initial reactions in the cometabolic oxidation of the gasoline oxygenate, methyl tert-butyl ether (MTBE), by Mycobacterium vaccae JOB5 have been characterized. Two products, tert-butyl formate (TBF) and tert-butyl alcohol (TBA), rapidly accumulated extracellularly when propane-grown cells were incubated with MTBE. Lower rates of TBF and TBA production from MTBE were also observed with cells grown on 1- or 2-propanol,

  7. Secondary Ion Mass Spectrometry of Vapor-Liquid-Solid Grown,

    E-print Network

    Atwater, Harry

    ) tomography has been used to probe the concentration of Au in 100 nm diameter Si wires grown by chemical vapor) scanning transmission electron microscopy (STEM) has been used to spatially localize single Au atoms within 15 nm diameter Si wires grown by CVD at 450 °C,14 as well as 30 nm diameter Si wires grown

  8. Solar Cells

    NASA Technical Reports Server (NTRS)

    1983-01-01

    The Heat Exchanger Method (HEM) produces high efficiency crystal ingots in an automated well-insulated furnace offering low equipment, labor and energy costs. The "grown" silicon crystals are used to make solar cells, or photovoltaic cells which convert sunlight directly into electricity. The HEM method is used by Crystal Systems, Inc. and was developed under a NASA/Jet Propulsion Laboratory contract. The square wafers which are the result of the process are sold to companies manufacturing solar panels.

  9. The virion N protein of infectious bronchitis virus is more phosphorylated than the N protein from infected cell lysates

    SciTech Connect

    Jayaram, Jyothi [Department of Veterinary Pathobiology, Texas A and M University, College Station, TX 77843-4467 (United States); Department of Biology, Texas A and M University, College Station, TX 77843-3258 (United States); Youn, Soonjeon [Department of Veterinary Pathobiology, Texas A and M University, College Station, TX 77843-4467 (United States); Collisson, Ellen W. [Department of Veterinary Pathobiology, Texas A and M University, College Station, TX 77843-4467 (United States)]. E-mail: ecollisson@cvm.tamu.edu

    2005-08-15

    Because phosphorylation of the infectious bronchitis virus (IBV) nucleocapsid protein (N) may regulate its multiple roles in viral replication, the dynamics of N phosphorylation were examined. {sup 32}P-orthophosphate labeling and Western blot analyses confirmed that N was the only viral protein that was phosphorylated. Pulse labeling with {sup 32}P-orthophosphate indicated that the IBV N protein was phosphorylated in the virion, as well as at all times during infection in either chicken embryo kidney cells or Vero cells. Pulse-chase analyses followed by immunoprecipitation of IBV N proteins using rabbit anti-IBV N polyclonal antibody demonstrated that the phosphate on the N protein was stable for at least 1 h. Simultaneous labeling with {sup 32}P-orthophosphate and {sup 3}H-leucine identified a 3.5-fold increase in the {sup 32}P:{sup 3}H counts per minute (cpm) ratio of N in the virion as compared to the {sup 32}P:{sup 3}H cpm ratio of N in the cell lysates from chicken embryo kidney cells, whereas in Vero cells the {sup 32}P:{sup 3}H cpm ratio of N from the virion was 10.5-fold greater than the {sup 32}P:{sup 3}H cpm ratio of N from the cell lysates. These studies are consistent with the phosphorylation of the IBV N playing a role in assembly or maturation of the viral particle.

  10. Growth and heavy metals accumulation potential of microalgae grown in sewage wastewater and petrochemical effluents.

    PubMed

    Ajayan, K V; Selvaraju, M; Thirugnanamoorthy, K

    2011-08-15

    Microalgae exhibit a number of heavy metal uptake process by different metabolism. In this study, the ability of microalgae for removal of heavy metal from wastewater was studied. Growth and biochemical contents of microalgae were determined by spectrophotometer. Heavy metal analysis of wastewater effluents were performed by atomic absorption spectrophotometer before and after treatment at laboratory scale. The growth of Scenedesmus bijuga and Oscillatoria quadripunctulata in sewage wastewater was higher than those grown in synthetic medium. Whereas, the growth of S. bijuga and O. quadripunctulata in sterilized petrochemical effluents was slightly lower than that grown in the standard synthetic medium. The chlorophyll, carotenoid and protein content of S. bijuga and O. quadripunctulata grown in sterilized sewage wastewater were higher than those grown in the standard medium. Similarly S. bijuga and O. quadripunctulata grown in sterilized petrochemical effluents showed lower contents of pigments and protein than those grown in sewage and synthetic medium. Heavy metals copper, cobalt, lead and zinc were removed by 37-50, 20.3-33.3, 34.6-100 and 32.1-100%, respectively from sewage wastewater and petrochemical effluent using Ocillatoria culture. The metal absorption by S. bijuga were (Cu, Co, Pb, Zn) 60-50, 29.6-66, 15.4-25 and 42.9-50%, respectively from sewage and petrochemical effluents. Both species showed high level of heavy metal removal efficiency and metal sorption efficiency of both microalgae depended on the type of biosorbent, the physiological status of the cells, availability of heavy metal, concentration of heavy metal and chemical composition of wastewater. PMID:22545355

  11. Revised stereochemistry of ficifolidione and its biological activities against insects and cells.

    PubMed

    Nishiwaki, Hisashi; Fujiwara, Satomi; Wukirsari, Tuti; Iwamoto, Hiroyuki; Mori, Shigeki; Nishi, Kosuke; Sugahara, Takuya; Yamauchi, Satoshi; Shuto, Yoshihiro

    2015-01-23

    Ficifolidione (1), a moderately active insecticidal compound from two species of Myrtaceae, and its derivatives were synthesized to evaluate their insecticidal activity. X-ray crystallographic analyses and specific rotation values of ficifolidione and its C-4 (2) demonstrated that the structure of ficifolidione differs from the reported absolute structure; that is, the C-4 configuration of ficifolidione should have an S configuration. The reported insecticidal activity of ficifolidione (1) and its C-4 epimer (2) against adult houseflies (Musca domestica), mosquito larvae (Culex pipiens), and cutworms (Spodoptera litura) was not observed. The cytotoxicities of ficifolidione and its derivatives (1-4) against four cell lines, Sf9, Colon26, HL60, and Vero, were also measured because ficifolidione has a phloroglucinol-derived moiety, a motif that is often present in the structure of cytotoxic chemicals. Compound 1 exhibited IC50 values of ca. 32, 9, 3, and 12 ?M for Sf9, Colon26, HL60, and Vero cells, respectively, indicating that ficifolidione possesses selective cytotoxicity against the four cell lines. In HL60 cells treated with 1, DNA fragmentation and the activation of procaspase 3 were observed, suggesting that the cytotoxicity is induced by apoptosis. PMID:25495518

  12. Quantitative Schlieren analysis applied to holograms of crystals grown on Spacelab 3

    NASA Technical Reports Server (NTRS)

    Brooks, Howard L.

    1986-01-01

    In order to extract additional information about crystals grown in the microgravity environment of Spacelab, a quantitative schlieren analysis technique was developed for use in a Holography Ground System of the Fluid Experiment System. Utilizing the Unidex position controller, it was possible to measure deviation angles produced by refractive index gradients of 0.5 milliradians. Additionally, refractive index gradient maps for any recorded time during the crystal growth were drawn and used to create solute concentration maps for the environment around the crystal. The technique was applied to flight holograms of Cell 204 of the Fluid Experiment System that were recorded during the Spacelab 3 mission on STS 51B. A triglycine sulfate crystal was grown under isothermal conditions in the cell and the data gathered with the quantitative schlieren analysis technique is consistent with a diffusion limited growth process.

  13. Magnetic and structural properties of MBE-grown oxidic multilayers

    SciTech Connect

    Bloemen, P.J.H.; Heijden, P.A.A. van der; Kohlhepp, J.T.; Jonge, W.J.M. de [Eindhoven Univ. of Technology (Netherlands). Dept. of Physics; Wolf, R.M.; Stegge, J. aan de; Reinders, A.; Jungblut, R.M.; Zaag, P.J. van der [Philips Research Labs., Eindhoven (Netherlands)

    1996-11-01

    Multilayers composed of oxides including Fe{sub 3}O{sub 4}, Co{sub x}Fe{sub 3{minus}x}O{sub 4}, CoO, NiO and MgO have been grown epitaxially by MBE on MgO(100) single crystal substrates. These structures can be grown with a high crystallinity in the form of flat layers having sharp interfaces. RHEED studies which commonly yielded sharp streaks accompanied by Kikuchi lines show that, for instance, growth of CoO on Fe{sub 3}O{sub 4} changes the RHEED pattern form from that consistent with a spinel structure to that of a rocksalt structure within about one and a half unit cell of CoO. STM studies on a 400 {angstrom} Fe{sub 3}O{sub 4} layer displaying atomic resolution enabled us to identify the origin of the reconstruction that one commonly observes in the RHEED and LEED patterns for magnetite. Regarding important fundamental magnetic parameters, relevant thickness dependencies were mapped out using localized magneto-optical Kerr effect experiments performed on several samples that routinely included one or multiple wedge shaped layers. These studies revealed the existence of a region in the Fe{sub 3}O{sub 4} layer near the interfaces which exhibits no net magnetic moment, strain driven perpendicular orientated magnetization for the CoO/Fe{sub 3}O{sub 4}(100) and CoO/Co{sub x}Fe{sub 3{minus}x}O{sub 4}(100) bilayer systems, and information on the thickness dependence of the magnetic interlayer coupling across an MgO spacer layer.

  14. Nine new diterpenes from the leaves of plantation-grown Cunninghamia lanceolata.

    PubMed

    Zhao, Shuangshuang; Ling, Junhong; Li, Zhanlin; Wang, Silong; Hu, Jiangchun; Wang, Nan

    2015-04-01

    Nine new diterpenes named lanceolatanol hydroperoxide (1), epilanceolatanol hydroperoxide (2), lanceolatanoic acid hydroperoxide (3), epilanceolatanoic acid hydroperoxide (4), lanceolatanol (5), lanceolatanoic acid (6), 11-acetoxylanceolatanoic acid (7), 11-acetoxylanceolatanoic acid methyl ester (8) and epoxyhinokiol (13) were characterized from the leaves of plantation-grown Cunninghamia lanceolata along with twelve known compounds. The compounds were evaluated for their growth inhibitory activities against the human prostate cell line (PC-3). PMID:25736997

  15. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    PubMed Central

    Khan, J.A.; Rathore, R.S.; Khan, S.; Ahmad, I.

    2013-01-01

    Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 ?L and 50 ?L of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes. PMID:24516442

  16. Magnetization dynamics of cobalt grown on graphene

    SciTech Connect

    Berger, A. J.; White, S. P.; Adur, R.; Pu, Y.; Hammel, P. C., E-mail: hammel@physics.osu.edu [Department of Physics, The Ohio State University, Columbus, Ohio 43210 (United States); Amamou, W. [Department of Physics and Astronomy, University of California, Riverside, California 92521 (United States); Kawakami, R. K. [Department of Physics, The Ohio State University, Columbus, Ohio 43210 (United States); Department of Physics and Astronomy, University of California, Riverside, California 92521 (United States)

    2014-05-07

    Ferromagnetic resonance (FMR) spin pumping is a rapidly growing field which has demonstrated promising results in a variety of material systems. This technique utilizes the resonant precession of magnetization in a ferromagnet to inject spin into an adjacent non-magnetic material. Spin pumping into graphene is attractive on account of its exceptional spin transport properties. This article reports on FMR characterization of cobalt grown on chemical vapor deposition graphene and examines the validity of linewidth broadening as an indicator of spin pumping. In comparison to cobalt samples without graphene, direct contact cobalt-on-graphene exhibits increased FMR linewidth—an often used signature of spin pumping. Similar results are obtained in Co/MgO/graphene structures, where a 1?nm MgO layer acts as a tunnel barrier. However, magnetometry, magnetic force microscopy, and Kerr microscopy measurements demonstrate increased magnetic disorder in cobalt grown on graphene, perhaps due to changes in the growth process and an increase in defects. This magnetic disorder may account for the observed linewidth enhancement due to effects such as two-magnon scattering or mosaicity. As such, it is not possible to conclude successful spin injection into graphene from FMR linewidth measurements alone.

  17. A low-temperature-grown TiO2-based device for the flexible stacked RRAM application.

    PubMed

    Jeong, Hu Young; Kim, Yong In; Lee, Jeong Yong; Choi, Sung-Yool

    2010-03-19

    Flexible TiO(2) crossbar memory device arrays were fabricated on plastic substrates using amorphous titanium oxide thin films grown by the low-temperature plasma-enhanced atomic layer deposition method. Al/ TiO(2)/Al memory cells on polyethersulfone (PES) showed an enhanced endurance property (up to 10(4) cycles) and low switching voltages compared to the cells on rigid substrates. The multi-stacked memory arrays were constructed by forming the additional Al/ TiO(2)/Al layer on the first memory device layer. Memory cells on each layer exhibited stable switching characteristics and mechanical robustness without interlayer cell-to-cell interference. PMID:20173248

  18. A low-temperature-grown TiO2-based device for the flexible stacked RRAM application

    NASA Astrophysics Data System (ADS)

    Jeong, Hu Young; In Kim, Yong; Lee, Jeong Yong; Choi, Sung-Yool

    2010-03-01

    Flexible TiO2 crossbar memory device arrays were fabricated on plastic substrates using amorphous titanium oxide thin films grown by the low-temperature plasma-enhanced atomic layer deposition method. Al/ TiO2 /Al memory cells on polyethersulfone (PES) showed an enhanced endurance property (up to 104 cycles) and low switching voltages compared to the cells on rigid substrates. The multi-stacked memory arrays were constructed by forming the additional Al/ TiO2 /Al layer on the first memory device layer. Memory cells on each layer exhibited stable switching characteristics and mechanical robustness without interlayer cell-to-cell interference.

  19. Establishment and characterization of a new Aedes aegypti (L.) (Diptera: Culicidae) cell line with special emphasis on virus susceptibility.

    PubMed

    Sudeep, A B; Parashar, Deepti; Jadi, Ramesh S; Basu, Atanu; Mokashi, Chetan; Arankalle, Vidya A; Mishra, Akhilesh C

    2009-10-01

    A new cell line from the neonate larvae of Aedes aegypti (L) mosquito was established and characterized. The cell line at the 50th passage (P) level consisted of three prominent cell types, i.e., epithelial-like cells (92%), fibroblast-like cells (7%), and giant cells ( approximately 1%). Karyological analysis showed diploid (2n = 6) number of chromosomes in >75% cells at P-50. The growth kinetics studied at 52nd passage level showed approximately tenfold increase in cell number over a 10-d study period. The species specificity studies using DNA amplification fingerprinting profile analysis using RAPD primers demonstrated 100% homology with the host profile showing the integrity of the cell line. Electron microscopy revealed the absence of mycoplasma or other adventitious agents. The cell line supported the multiplication of seven arboviruses, i.e., Chikungunya (CHIK), Japanese encephalitis, West Nile, dengue 2 (DEN-2), Chandipura, vesicular stomatitis, and Chittoor viruses. The cell line did not replicate Ganjam and Kaisodi viruses. CHIK virus yield in the new cell line was approximately 3log and 0.5log 50% tissue culture infective dose (TCID(50))/mL higher than Vero E6 and C6/36 cell lines, respectively. In the case of DEN-2 virus, it yielded 1log TCID(50)/mL higher than Vero E6, but lesser than C6/36 cell line. Due to its high susceptibility to a broad spectrum of viruses, the new cell line may find application in virus isolation during epidemics and in antigen production. PMID:19533252

  20. Multicellularity and Antibiotic Resistance in Klebsiella pneumoniae Grown Under Bloodstream-Mimicking Fluid Dynamic Conditions

    PubMed Central

    Thornton, Margaret M.; Chung-Esaki, Hangyul M.; Irvin, Charlene B.; Bortz, David M.; Solomon, Michael J.; Younger, John G.

    2012-01-01

    Background.?While the importance of fluid dynamical conditions is well recognized in the growth of biofilms, their role during bacteremia is unknown. We examined the impact of physiological fluid shear forces on the development of multicellular aggregates of Klebsiella pneumoniae. Methods.?Wild-type and O-antigen or capsular mutants of K. pneumoniae were grown as broth culture in a Taylor-Couette flow cell configured to provide continuous shear forces comparable to those encountered in the human arterial circulation (ie, on the order of 1.0 Pa). The size distribution and antibiotic resistance of aggregates formed in this apparatus were determined, as was their ability to persist in the bloodstream of mice following intravenous injection. Results.?Unlike growth in shaking flasks, bacteria grown in the test apparatus readily formed aggregates, a phenotype largely absent in capsular mutants and to a lesser degree in O-antigen mutants. Aggregates were found to persist in the bloodstream of mice. Importantly, organisms grown under physiological shear were found to have an antibiotic resistance phenotype intermediate between that of fully planktonic and biofilm states. Conclusions.?When grown under intravascular-magnitude fluid dynamic conditions, K. pneumoniae spontaneously develops into multicellular aggregates that are capable of persisting in the circulation and exhibit increased antibiotic resistance. PMID:22711903

  1. Porcine epidemic diarrhea virus uses cell-surface heparan sulfate as an attachment factor.

    PubMed

    Huan, Chang-Chao; Wang, Yue; Ni, Bo; Wang, Rui; Huang, Li; Ren, Xiao-Feng; Tong, Guang-Zhi; Ding, Chan; Fan, Hong-Jie; Mao, Xiang

    2015-07-01

    It is well known that many viruses use heparan sulfate as the initial attachment factor. In the present study, we determined whether porcine epidemic diarrhea virus (PEDV), an emerging veterinary virus, infects Vero cells by attaching to heparan sulfate. Western blot analysis, real-time PCR, and plaque formation assay revealed that PEDV infection was inhibited when the virus was pretreated with heparin (an analogue of heparan sulfate). There was no inhibitory effect when the cells were pre-incubated with heparin. We next demonstrated that enzymatic removal of the highly sulfated domain of heparan sulfate by heparinase I treatment inhibited PEDV infection. We also confirmed that sodium chlorate, which interferes with heparan sulfate biosynthesis, also inhibited PEDV infection. Furthermore, we examined the effect of two heparin derivatives with different types of sulfation on PEDV infection. The data suggested de-N-sulfated heparin, but not N-acetyl-de-O-sulfated heparin, inhibits PEDV infection. In summary, our studies revealed that heparan sulfate acts as the attachment factor of PEDV in Vero cells. PMID:25896095

  2. Localization and activities of nitrogenase, glutamine synthetase and glutamate synthase in Azotobacter vinelandii grown in oxygen-controlled continuous culture

    Microsoft Academic Search

    D. Riickel; J. J. Hernando; E. Vakalopoulou; E. Post; J. Oelze

    1983-01-01

    Azotobacter vinelandii was grown in oxygen-controlled continuous cultures under conditions of dinitrogen fixation. Different oxygen concentrations were adjusted with air. Cell-free extracts were employed to study the oxygen dependency of the intracellular distribution and activity of the following enzymes: nitrogenase, glutamine synthetase and glutamate synthase. Nitrogenase was localized exclusively in the soluble fraction. Its activity increased steeply when the oxygen

  3. Respiratory capacities of mitochondria of Saccharomyces cerevisiae CBS 8066 and Candida utilis CBS 621 grown under glucose limitation

    Microsoft Academic Search

    Hendrik van Urk; Peter M. Bruinenberg; Marten Veenhuis; W. Alexander Scheffers; Johannes P. van Dijken

    1989-01-01

    A comparative study was made of the in vitro respiratory capacity of mitochondria isolated from Saccharomyces cerevisiae and Candida utilis grown in glucose-limited chemostat cultures. An electron-microscopic analysis of whole cells revealed that the volume density of mitochondria was the same in both yeasts. Mitochondria from both organisms exhibited respiratory control with NADH, pyruvate + malate, 2-oxoglutarate + acetate or

  4. Plasma-Mediated Inactivation of Pseudomonas aeruginosa Biofilms Grown on Borosilicate Surfaces under Continuous Culture System

    PubMed Central

    Vandervoort, Kurt G.; Brelles-Mariño, Graciela

    2014-01-01

    Biofilms are microbial communities attached to a surface and embedded in a matrix composed of exopolysaccharides and excreted nucleic acids. Bacterial biofilms are responsible for undesirable effects such as disease, prostheses colonization, biofouling, equipment damage, and pipe plugging. Biofilms are also more resilient than free-living cells to regular sterilization methods and therefore it is indispensable to develop better ways to control and remove them. The use of gas discharge plasmas is a good alternative since plasmas contain a mixture of reactive agents well-known for their decontamination potential against free microorganisms. We have previously reported that Pseudomonas aeruginosa biofilms were inactivated after a 1-min plasma exposure. We determined that the adhesiveness and the thickness of Pseudomonas biofilms grown on borosilicate were reduced. We also reported sequential morphological changes and loss of viability upon plasma treatment. However, the studies were carried out in batch cultures. The use of a continuous culture results in a more homogenous environment ensuring reproducible biofilm growth. The aim of this work was to study plasma-mediated inactivation of P. aeruginosa biofilms grown on borosilicate in a continuous culture system. In this paper we show that biofilms grown on glass under continuous culture can be inactivated by using gas discharge plasma. Both biofilm architecture and cell culturabilty are impacted by the plasma treatment. The inactivation kinetics is similar to previously described ones and cells go through sequential changes ranging from minimal modification without loss of viability at short plasma exposure times, to major structure and viability loss at longer exposure times. We report that changes in biofilm structure leading to the loss of culturability and viability are related to a decrease of the biofilm matrix adhesiveness. To our knowledge, there has been no attempt to evaluate the inactivation/sterilization of biofilms grown in a continuous system. PMID:25302815

  5. Plasma-mediated inactivation of Pseudomonas aeruginosa biofilms grown on borosilicate surfaces under continuous culture system.

    PubMed

    Vandervoort, Kurt G; Brelles-Mariño, Graciela

    2014-01-01

    Biofilms are microbial communities attached to a surface and embedded in a matrix composed of exopolysaccharides and excreted nucleic acids. Bacterial biofilms are responsible for undesirable effects such as disease, prostheses colonization, biofouling, equipment damage, and pipe plugging. Biofilms are also more resilient than free-living cells to regular sterilization methods and therefore it is indispensable to develop better ways to control and remove them. The use of gas discharge plasmas is a good alternative since plasmas contain a mixture of reactive agents well-known for their decontamination potential against free microorganisms. We have previously reported that Pseudomonas aeruginosa biofilms were inactivated after a 1-min plasma exposure. We determined that the adhesiveness and the thickness of Pseudomonas biofilms grown on borosilicate were reduced. We also reported sequential morphological changes and loss of viability upon plasma treatment. However, the studies were carried out in batch cultures. The use of a continuous culture results in a more homogenous environment ensuring reproducible biofilm growth. The aim of this work was to study plasma-mediated inactivation of P. aeruginosa biofilms grown on borosilicate in a continuous culture system. In this paper we show that biofilms grown on glass under continuous culture can be inactivated by using gas discharge plasma. Both biofilm architecture and cell culturability are impacted by the plasma treatment. The inactivation kinetics is similar to previously described ones and cells go through sequential changes ranging from minimal modification without loss of viability at short plasma exposure times, to major structure and viability loss at longer exposure times. We report that changes in biofilm structure leading to the loss of culturability and viability are related to a decrease of the biofilm matrix adhesiveness. To our knowledge, there has been no attempt to evaluate the inactivation/sterilization of biofilms grown in a continuous system. PMID:25302815

  6. Perfect crystals grown from imperfect interfaces

    PubMed Central

    Falub, Claudiu V.; Medu?a, Mojmír; Chrastina, Daniel; Isa, Fabio; Marzegalli, Anna; Kreiliger, Thomas; Taboada, Alfonso G.; Isella, Giovanni; Miglio, Leo; Dommann, Alex; von Känel, Hans

    2013-01-01

    The fabrication of advanced devices increasingly requires materials with different properties to be combined in the form of monolithic heterostructures. In practice this means growing epitaxial semiconductor layers on substrates often greatly differing in lattice parameters and thermal expansion coefficients. With increasing layer thickness the relaxation of misfit and thermal strains may cause dislocations, substrate bowing and even layer cracking. Minimizing these drawbacks is therefore essential for heterostructures based on thick layers to be of any use for device fabrication. Here we prove by scanning X-ray nanodiffraction that mismatched Ge crystals epitaxially grown on deeply patterned Si substrates evolve into perfect structures away from the heavily dislocated interface. We show that relaxing thermal and misfit strains result just in lattice bending and tiny crystal tilts. We may thus expect a new concept in which continuous layers are replaced by quasi-continuous crystal arrays to lead to dramatically improved physical properties. PMID:23880632

  7. Induced superconductivity in graphene grown on rhenium.

    PubMed

    Tonnoir, C; Kimouche, A; Coraux, J; Magaud, L; Delsol, B; Gilles, B; Chapelier, C

    2013-12-13

    We report a new way to strongly couple graphene to a superconductor. The graphene monolayer has been grown directly on top of a superconducting Re(0001) thin film and characterized by scanning tunneling microscopy and spectroscopy. We observed a moiré pattern due to the mismatch between Re and graphene lattice parameters that we have simulated with ab initio calculations. The density of states around the Fermi energy appears to be position dependent on this moiré pattern. Tunneling spectroscopy performed at 50 mK shows that the superconducting behavior of graphene on Re is well described by the Bardeen-Cooper-Schrieffer theory and stands for a very good interface between the graphene and its metallic substrate. PMID:24483689

  8. Vapor grown carbon fiber (VGCF) composites

    SciTech Connect

    Ciminelli, D.L.; Kearns, K.M. [Wright Laboratory, Wright-Patterson AFB, OH (United States); Ragland, W.R. [Univ. of Dayton Research Institute, Dayton, OH (United States)

    1996-12-31

    Vapor grown carbon fibers (VGCF) offer a unique opportunity for carbon fiber composites to expand into a multitude of new markets due to their low cost of only $3 to 5 per pound. Additionally, VGCFs are extremely graphitic and have demonstrated the highest thermal conductivity of any graphite material. Pyrograf-III{reg_sign}, a VGCF produced by Applied Sciences, Inc (ASI), is a small diameter (0.1 {mu}m) fiber with a high aspect ratio (100- 1000). The primary interest of the work is for thermal management applications. The focus of the work has been developing novel process methodologies for these unusual fibers using phenolic and epoxy resin to produce low cost composites. The development of VGCF composites is being performed through a Cooperative Research and Development Agreement (CRDA) between ASI and the Materials Directorate (WL/ML), Wright Laboratory, United States Air Force.

  9. Cell cultures of the wild sunflower Helianthus maximiliani schrader: growth and secondary metabolite synthesis.

    PubMed

    Roewer, I; Mabry, T J

    1988-05-01

    Callus cultures derived from leaves, stem, sepals and ray flowers and cell suspension cultures of Helianthus maximiliani Schrader were established and analysed for their phytochemicals. Dark-grown cultures were found to synthesize small amounts of non-toxic, polycyclic diterpenoids when grown on modified MS-medium, while ?-sitosterol and palmitic acid were found in dark- and light-grown cultures. Red light irradiation did not enhance terpenoid production compared to dark- and light-grown cells. PMID:24241598

  10. Recent results in characterization of melt-grown and quench-melt- grown YBCO superconductors

    SciTech Connect

    Balachandran, U.; Poeppel, R.B. (Argonne National Lab., IL (United States)); Gangopadhyay, A.K. (Northwestern Univ., Evanston, IL (United States). Dept. of Materials Science and Engineering)

    1992-02-01

    From the standpoint of applications, melt-grown (MG) and quench-melt-grown (QMG) bulk YBCO superconductors are of considerable interest. In this paper, we studied the intragranular critical current density (J{sub c}), the apparent pinning potential (U{sub o}), and the irreversibility temperature (T{sub irr}) of MG and QMG samples and compared the results to those for conventionally sintered YBCO. A systematic increase in U{sub o} and a slower drop in J{sub c} with temperature indicate a systematic improvement in flux-pinning properties in progressing from the sintered YBCO to QMG and MG samples. Weaker pinning is observed in the QMG YBCO than in the MG samples.

  11. Properties of 1.3 ?m InGaNAs laser material grown by MBE using a N 2\\/Ar RF plasma

    Microsoft Academic Search

    J. A Gupta; P. J Barrios; G. C Aers; R. L Williams; J Ramsey; Z. R Wasilewski

    2003-01-01

    InGaNAs single quantum well laser diodes were grown on GaAs substrates using solid-source molecular beam epitaxy with N2\\/Ar gas mixtures in an radio-frequency (RF) plasma cell. The structures employ GaNAs barriers which reduce the quantum confinement and extend the room temperature stimulated emission wavelength to 1.36 ?m. Test quantum well structures were grown with and without these barriers to demonstrate

  12. A Three-Dimensional Comparison of Tick-Borne Flavivirus Infection in Mammalian and Tick Cell Lines

    PubMed Central

    Offerdahl, Danielle K.; Dorward, David W.; Hansen, Bryan T.; Bloom, Marshall E.

    2012-01-01

    Tick-borne flaviviruses (TBFV) are sustained in nature through cycling between mammalian and tick hosts. In this study, we used African green monkey kidney cells (Vero) and Ixodes scapularis tick cells (ISE6) to compare virus-induced changes in mammalian and arthropod cells. Using confocal microscopy, transmission electron microscopy (TEM), and electron tomography (ET), we examined viral protein distribution and the ultrastructural changes that occur during TBFV infection. Within host cells, flaviviruses cause complex rearrangement of cellular membranes for the purpose of virus replication. Virus infection was accompanied by a marked expansion in endoplasmic reticulum (ER) staining and markers for TBFV replication were localized mainly to the ER in both cell lines. TEM of Vero cells showed membrane-bound vesicles enclosed in a network of dilated, anastomosing ER cisternae. Virions were seen within the ER and were sometimes in paracrystalline arrays. Tubular structures or elongated vesicles were occasionally noted. In acutely and persistently infected ISE6 cells, membrane proliferation and vesicles were also noted; however, the extent of membrane expansion and the abundance of vesicles were lower and no viral particles were observed. Tubular profiles were far more prevalent in persistently infected ISE6 cells than in acutely infected cells. By ET, tubular profiles, in persistently infected tick cells, had a cross-sectional diameter of 60–100 nm, reached up to 800 nm in length, were closed at the ends, and were often arranged in fascicle-like bundles, shrouded with ER membrane. Our experiments provide analysis of viral protein localization within the context of both mammalian and arthropod cell lines as well as both acute and persistent arthropod cell infection. Additionally, we show for the first time 3D flavivirus infection in a vector cell line and the first ET of persistent flavivirus infection. PMID:23112871

  13. Designing cell lines for viral vaccine production: Where do we stand?

    PubMed

    Genzel, Yvonne

    2015-05-01

    Established animal cells, such as Vero, Madin Darby canine kidney (MDCK) or chicken embryo fibroblasts (CEFs), are still the main cell lines used for viral vaccine production, although new "designer cells" have been available for some years. These designer cell lines were specifically developed as a cell substrate for one application and are well characterized. Later screening for other possible applications widened the product range. These cells grow in suspension in chemically defined media under controlled conditions and can be used for up to 100 passages. Scale-up is easier and current process options allow cultivation in disposable bioreactors at cell concentrations higher than 1×10(7) cells/mL. This review covers the limitations of established cell lines and discusses the requirements and screening options for new host cells. Currently available designer cells for viral vaccine production (PER.C6, CAP, AGE1.CR, EB66 cells), together with other new cell lines (PBS-1, QOR/2E11, SogE, MFF-8C1 cells) that were recently described as possible cell substrates are presented. Using current process knowledge and cell line development tools, future upstream processing could resemble today's Chinese hamster ovary (CHO) cell processes for monoclonal antibody production: small scale bioreactors (disposable) in perfusion or fed-batch mode with cell concentrations above 1×10(8) cells/mL. PMID:25903999

  14. 29 CFR 780.813 - “County where cotton is grown.”

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 false âCounty where cotton is grown.â 780.813 Section 780...STANDARDS ACT Employment in Ginning of Cotton and Processing of Sugar Beets, Sugar-Beet...Section 13(b)(15) County Where Cotton Is Grown in Commercial Quantities...

  15. 29 CFR 780.813 - “County where cotton is grown.”

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...2011-07-01 false âCounty where cotton is grown.â 780.813 Section 780...STANDARDS ACT Employment in Ginning of Cotton and Processing of Sugar Beets, Sugar-Beet...Section 13(b)(15) County Where Cotton Is Grown in Commercial Quantities...

  16. 76 FR 16323 - Irish Potatoes Grown in Washington; Continuance Referendum

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-23

    ...AMS-FV-11-0010; FV11-946-1 CR] Irish Potatoes Grown in Washington; Continuance Referendum...be conducted among eligible Washington potato growers to determine whether they favor...order regulating the handling of Irish potatoes grown in Washington. DATES: The...

  17. Breakdown Current Density of CVD-Grown Multilayer Graphene Interconnects

    Microsoft Academic Search

    Kyeong-Jae Lee; Anantha P. Chandrakasan; Jing Kong

    2011-01-01

    Graphene wires have been fabricated from large-area multilayer graphene sheets grown by chemical vapor deposition. As the methane concentration increases, a larger percentage of thicker graphene layers are grown. The multilayer graphene sheets have an average thickness of 10-20 nm with sheet resistances between 500 and 1000 ?\\/sq. The sheet resistance shows a strong correlation with the average surface roughness.

  18. Thermoelectic properties of CVD grown large area graphene

    Microsoft Academic Search

    Andriy Sherehiy

    2010-01-01

    This thesis is based on experimental work on thermoelectric properties of CVD grown large area graphene. The thermoelectric power (TEP) of CVD (Chemical Vapor Deposition) grown large area graphene transferred onto a Si\\/SiO 2_substrate was measured by simply attaching two miniature thermocouples and a resistive heater. Availability of such large area graphene facilitates straight forward TEP measurement without the use

  19. Quality characteristics of the radish grown under reduced atmospheric pressure

    Microsoft Academic Search

    Lanfang H. Levine; Patricia A. Bisbee; Jeffrey T. Richards; Michele N. Birmele; Ronald L. Prior; Michele Perchonok; Mike Dixon; Neil C. Yorio; Gary W. Stutte; Raymond M. Wheeler

    2008-01-01

    This study addresses whether reduced atmospheric pressure (hypobaria) affects the quality traits of radish grown under such environments. Radish (Raphanus sativus L. cv. Cherry Bomb Hybrid II) plants were grown hydroponically in specially designed hypobaric plant growth chambers at three atmospheric pressures; 33, 66, and 96 kPa (control). Oxygen and carbon dioxide partial pressures were maintained constant at 21 and

  20. Carboxylate metabolism in sugar beet plants grown with excess Zn

    Microsoft Academic Search

    R. Sagardoy; F. Morales; R. Rellán-Álvarez; A. Abadía; J. Abadía; A. F. López-Millán

    2011-01-01

    The effects of Zn excess on carboxylate metabolism were investigated in sugar beet (Beta vulgaris L.) plants grown hydroponically in a growth chamber. Root extracts of plants grown with 50 or 100?M Zn in the nutrient solution showed increases in several enzymatic activities related to organic acid metabolism, including citrate synthase and phosphoenolpyruvate carboxylase, when compared to activities in control

  1. BRIEF REPORT Morphology of fibroblasts grown on substrates formed

    E-print Network

    Waldman, Stephen D.

    , and alignment. Bovine fibroblasts grown on aligned carbon nano- tubes for a period of 2 weeks were found to have. Vertically grown multiwall carbon nano- tubes (MWNTs) on the surface of a silicon substrate can carbon nanotubes Felix L.-Y. Yuen Æ Gene Zak Æ Stephen D. Waldman Æ Aristides Docoslis Received: 15 May

  2. APIVT-Grown Silicon Thin Layers and PV Devices: Preprint

    SciTech Connect

    Wang, T. H.; Ciszek, T. F.; Page, M. R.; Bauer, R. E.; Wang, Q.; Landry, M. D.

    2002-05-01

    Large-grained (5-20 ..mu..m) polycrystalline silicon layers have been grown at intermediate temperatures of 750-950C directly on foreign substrates without a seeding layer by iodine vapor transport at atmospheric pressure with rates as high as 3 mm/min. A model is constructed to explain the atypical temperature dependence of growth rate. We have also used this technique to grow high-quality epitaxial layers on heavily doped CZ-Si and on upgraded MG-Si substrates. Possible solar cell structures of thin-layer polycrystalline silicon on foreign substrates with light trapping have been examined, compared, and optimized by two-dimensional device simulations. The effects of grain boundary re-combination on device performance are presented for two grain sizes of 2 and 20 mm. We found that 104 cm/s recombination velocity is adequate for 20-m m grain-sized thin silicon, whereas a very low recombination velocity of 103 cm/s must be accomplished in order to achieve reasonable performance for a 2- mm grain-sized polycrystalline silicon device.

  3. Secretomic survey of Trichoderma harzianum grown on plant biomass substrates.

    PubMed

    Gómez-Mendoza, Diana Paola; Junqueira, Magno; do Vale, Luis Henrique Ferreira; Domont, Gilberto Barbosa; Ferreira Filho, Edivaldo Ximenes; Sousa, Marcelo Valle de; Ricart, Carlos André Ornelas

    2014-04-01

    The present work aims at characterizing T. harzianum secretome when the fungus is grown in synthetic medium supplemented with one of the four substrates: glucose, cellulose, xylan, and sugarcane bagasse (SB). The characterization was done by enzymatic assays and proteomic analysis using 2-DE/MALDI-TOF and gel-free shotgun LC-MS/MS. The results showed that SB induced the highest cellulolytic and xylanolytic activities when compared with the other substrates, while remarkable differences in terms of number and distribution of protein spots in 2-DE gels were also observed among the samples. Additionally, treatment of the secretomes with PNGase F revealed that most spot trails in 2-DE gels corresponded to N-glycosylated proteoforms. The LC-MS/MS analysis of the samples identified 626 different protein groups, including carbohydrate-active enzymes and accessory, noncatalytic, and cell-wall-associated proteins. Although the SB-induced secretome displayed the highest cellulolytic and xylanolytic activities, it did not correspond to a higher proteome complexity because CM-cellulose-induced secretome was significantly more diverse. Among the identified proteins, 73% were exclusive to one condition, while only 5% were present in all samples. Therefore, this study disclosed the variation of T. harzianum secretome in response to different substrates and revealed the diversity of the fungus enzymatic toolbox. PMID:24593137

  4. Successful transfer of plasmid DNA into in vitro cells transfected with an inorganic plasmid-Mg/Al-LDH nanobiocomposite material as a vector for gene expression

    NASA Astrophysics Data System (ADS)

    Jaffri Masarudin, Mas; Yusoff, Khatijah; Rahim, Raha Abdul; Zobir Hussein, Mohd

    2009-01-01

    The delivery of a full plasmid, encoding the green fluorescent protein gene into African monkey kidney (Vero3) cells, was successfully achieved using nanobiocomposites based on layered double hydroxides. This demonstrated the potential of using the system as an alternative DNA delivery vector. Intercalation of the circular plasmid DNA, pEGFP-N2, into Mg/Al-NO3- layered double hydroxides (LDH) was accomplished through anion exchange routes to form the nanobiocomposite material. The host was previously synthesized at the Mg2+ to Al3+ molar ratio Ri = 2 and subsequently intercalated with plasmid DNA. Size expansion of the interlamellae host from 8.8 Å in LDH to 42 Å was observed in the resulting nanobiocomposite, indicating stable hybridization of the plasmid DNA. The powder x-ray diffraction (PXRD) results, supplemented with Fourier-transform infrared (FTIR) spectroscopy, compositional and electrophoresis studies confirmed the encapsulation episode of the biomaterial. In order to elucidate the use of this resulting nanobiocomposite as a delivery vector, an MTT assay was performed to determine any cytotoxic effects of the host towards cells. The intercalated pEGFP-N2 anion was later successfully recovered through acidification with HNO3 after treatment with DNA-degrading enzymes, thus also showing the ability of the LDH host to protect the intercalated biomaterial from degradation. Cell transfection studies on Vero3 cells were then performed, where cells transfected with the nanobiocomposite exhibited fluorescence as early as 12 h post-treatment compared to naked delivery of the plasmid itself.

  5. Changes in enzyme activities and distributions during glucose de-repression and respiratory adaptation of anaerobically grown Saccharomyces carlsbergensis

    PubMed Central

    Cartledge, T. G.; Lloyd, D.

    1973-01-01

    1. During anaerobic glucose de-repression the respiration rate of whole cells of Saccharomyces carlsbergensis remained constant and was insensitive to antimycin A but was inhibited by 30% by KCN. Aeration of cells for 1 h led to increased respiration rate which was inhibited by 80% by antimycin A or KCN. 2. Homogenates were prepared from sphaeroplasts of anaerobically grown, glucose de-repressed cells and the distribution of marker enzymes was investigated after zonal centrifugation on sucrose gradients containing MgCl2. These homogenates contained no detectable cytochrome c oxidase or catalase activity. The complex density distributions of NADH– and NADPH–cytochrome c oxidoreductases and adenosine triphosphatase(s) [ATPase(s)] were very different from those of anaerobically grown, glucose-repressed cells. 3. The specific activity of total ATPase was lowered and sensitivity to oligomycin decreased from 58 to 7% during de-repression. 4. Cytochrome c oxidase and catalase activities were detectable in homogenates of cells after 10min aeration. Zonal centrifugation indicated complex, broad sedimentable distributions of all enzyme activities assayed; the peaks of activity were at 1.27g/ml. 5. Centrifugation of homogenates of cells adapted for 30min and 3 h indicated a shift of density of the major sedimentable peak from 1.25g/ml (30min) to 1.235g/ml (3 h). After 30min adaptation a minor zone of oligomycin-sensitive ATPase and 15% of the total cytochrome c oxidase activities were detected at ?=1.12g/l; these particles together with those of higher density containing cytochrome c oxidase, ATPase and NADH–cytochrome c oxidoreductase activities were all sedimented at 105g-min. 6. Electron microscopy indicated that the mitochondria-like structures of anaerobically grown, glucose-de-repressed cells were similar to those of repressed cells. After 10min of respiratory adaptation highly organized mitochondria were evident which resembled the condensed forms of mitochondria of aerobically grown, glucose-de-repressed cells. High-density zonal fractions of homogenates of cells after adaptation also contained numerous electron-dense vesicles 0.05–0.2?m in diameter. 7. The possibility that the `promitochondria' of anaerobically grown cells may not be the direct structural precursors of fully functional mitochondria is discussed. ImagesPLATE 1PLATE 2 PMID:4353383

  6. Irrigation frequency alters nutrient uptake in container-grown Rhododendron plants grown with different rates of nitrogen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The influence of irrigation frequency (same amount of water per day given at different times) on nutrient uptake of container-grown evergreen Rhododendron ‘P.J.M. Compact’ (PJM) and ‘English Roseum’ (ER) and deciduous Rhododendron ‘Gibraltar’ (AZ) grown with different rates of nitrogen (N) fertilize...

  7. In vitro cytotoxicity study of agave americana, strychnos nuxvomica and areca catechu extracts using mcf-7 cell line.

    PubMed

    Anajwala, Chetan C; Patel, Rajesh M; Dakhara, Sanjay L; Jariwala, Jitesh K

    2010-04-01

    Research is focusing on the search for new types of natural chemotherapeutic agent that is plant based medicines which are proving to be excellent sources of new compounds. In present research study, an attempt was made to prove cytotoxicity activity of various parts of medicinal plants such as Agave americana, Strychnos nuxvomica and Areca catechu using MCF-7 and Vero cell line. Various parts of the medicinal plants were extracted by soxhlet apparatus using solvents likes methanol and water. By trypan blue dye exclusion method, Viability of MCF-7 and Vero cell lines were 85.50 and 81.13%, respectively. IC(50) value of methanol extract of Agave americana leaves and aqueous extract of Areca catechu fruits were found to be 545.9 & 826.1 ?g/ml by SRB assay and 775.1 & 1461pg/ml by MTT assay, respectively, against MCF-7 cell line. From cytotoxicity study data by SRB and MTT assay, it revealed that methanol extract of Agave americana and aqueous extract of Areca catechu are potent cytotoxic. PMID:22247852

  8. IN VITRO CYTOTOXICITY STUDY OF AGAVE AMERICANA, STRYCHNOS NUXVOMICA AND ARECA CATECHU EXTRACTS USING MCF-7 CELL LINE

    PubMed Central

    Anajwala, Chetan C.; Patel, Rajesh M.; Dakhara, Sanjay L.; Jariwala, Jitesh K.

    2010-01-01

    Research is focusing on the search for new types of natural chemotherapeutic agent that is plant based medicines which are proving to be excellent sources of new compounds. In present research study, an attempt was made to prove cytotoxicity activity of various parts of medicinal plants such as Agave americana, Strychnos nuxvomica and Areca catechu using MCF-7 and Vero cell line. Various parts of the medicinal plants were extracted by soxhlet apparatus using solvents likes methanol and water. By trypan blue dye exclusion method, Viability of MCF-7 and Vero cell lines were 85.50 and 81.13%, respectively. IC50 value of methanol extract of Agave americana leaves and aqueous extract of Areca catechu fruits were found to be 545.9 & 826.1 ?g/ml by SRB assay and 775.1 & 1461pg/ml by MTT assay, respectively, against MCF-7 cell line. From cytotoxicity study data by SRB and MTT assay, it revealed that methanol extract of Agave americana and aqueous extract of Areca catechu are potent cytotoxic. PMID:22247852

  9. Method for fabricating silicon cells

    DOEpatents

    Ruby, Douglas S. (Albuquerque, NM); Basore, Paul A. (Albuquerque, NM); Schubert, W. Kent (Albuquerque, NM)

    1998-08-11

    A process for making high-efficiency solar cells. This is accomplished by forming a diffusion junction and a passivating oxide layer in a single high-temperature process step. The invention includes the class of solar cells made using this process, including high-efficiency solar cells made using Czochralski-grown silicon.

  10. Optimization of electrotransfection conditions of mammalian cells with different biological features.

    PubMed

    Guo, Huichen; Hao, Rongzeng; Wei, Yanquan; Sun, Dehui; Sun, Shiqi; Zhang, Zhencang

    2012-12-01

    We introduced eukaryotic expression plasmid pEGFP-N1 encoding green fluorescent protein (GFP) genes into cells with different biological features through electroporation. The effects of conditions, including voltage, capacitor flow, pulse cycle, DNA dosage and buffer, on transfection efficiency were investigated based on fluorescent microscopy and posttransfection survival rate of cells by staining with trypan blue. Better electrotransfection outcomes were achieved in the following epithelial cells: Vero cells at 300 V/850 ?F, PK15 cells at 300 V/500 ?F, MDCK cells at 200 V/600 ?F, F81 cells at 200 V/500 ?F, cancer cells MB49 at 300 V/400 ?F, Hela cells at 200 V/450 ?F, HF-29 cells at 300 V/800 ?F and B16F1 cells at 200 V/650 ?F. Among fibroblast cells, better electrotransfection was achieved in BHK21 cells at 300 V/600 ?F and ST cells at 200 V/750 ?F. RPMI-1640 medium without antibiotics and serum demonstrated higher electrotransfection efficiency and cell survival rate than other cell culture media as electroporation buffer. Our findings further prove that electroporation transfection is an effective method for genetic transfection. Cells with different biological features require varying transfection conditions to obtain higher transfection efficiency of target genes. PMID:22836669

  11. Localization of cytochromes to the outer membrane of anaerobically grown Shewanella putrefaciens MR-1.

    PubMed Central

    Myers, C R; Myers, J M

    1992-01-01

    In gram-negative bacteria, numerous cell functions, including respiration-linked electron transport, have been ascribed to the cytoplasmic membrane. Gram-negative bacteria which use solid substrates (e.g., oxidized manganese or iron) as terminal electron acceptors for anaerobic respiration are presented with a unique problem: they must somehow establish an electron transport link across the outer membrane between large particulate metal oxides and the electron transport chain in the cytoplasmic membrane. When the metal-reducing bacterium Shewanella putrefaciens MR-1 is grown under anaerobic conditions and membrane fractions are purified from cells lysed by an EDTA-lysozyme-polyoxyethylene cetyl ether (Brij 58) protocol, approximately 80% of its membrane-bound cytochromes are localized in its outer membrane. These outer membrane cytochromes could not be dislodged by treatment with chaotropic agents or by increased concentrations of the nonionic detergent Brij 58, suggesting that they are integral membrane proteins. Cytochrome distribution in cells lysed by a French press protocol confirm the localization of cytochromes to the outer membrane of anaerobically grown cells. This novel cytochrome distribution could play a key role in the anaerobic respiratory capabilities of this bacterium, especially in its ability to mediate manganese and iron reduction. Images PMID:1592800

  12. How effectively does a clinostat mimic the ultrastructural effects of microgravity on plant cells?

    NASA Technical Reports Server (NTRS)

    Moore, R.

    1990-01-01

    Columella cells of seedlings of Zea mays L. cv. Bear Hybrid grown in the microgravity of orbital flight allocate significantly larger relative-volumes to hyaloplasm and lipid bodies, and significantly smaller relative-volumes to dictyosomes, plastids, and starch than do columella cells of seedlings grown at 1 g. The ultrastructure of columella cells of seedlings grown at 1 g and on a rotating clinostat is not significantly different. However, the ultrastructure of cells exposed to these treatments differs significantly from that of seedlings grown in microgravity. These results indicate that the actions of a rotating clinostat do not mimic the ultrastructural effects of microgravity in columella cells of Z. mays.

  13. Two orders of magnitude reduction in the temperature dependent resistivity of Ga1-xMnxAs grown on (6 3 1) GaAs insulating substrates

    NASA Astrophysics Data System (ADS)

    Rangel-Kuopp, Victor-Tapio; Martinez-Velis, Isaac; Gallardo-Hernandez, Salvador; Lopez-Lopez, Maximo

    2013-12-01

    The temperature dependent van der Pauw (T-Pauw) technique was used to investigate the resistivity of three Ga1-xMnxAs layers grown on (6 3 1) GaAs semi-insulating substrates. The samples had Mn concentration of 3.52×l020 cm-3, 5.05×1020 cm-3 and 1.12×l021 cm-3, corresponding to Mn cell effusion temperature TMn of 700 °C, 715 °C and 745 °C, respectively. They were compared to samples grown under the same conditions but on (0 0 1) GaAs semi-insulating substrates. For the sample grown at TMn=700 °C on a (6 3 1) substrate, a two orders of magnitude decrease in the resistivity is observed, when compared with the sample grown on a (0 0 1) substrate. For the sample grown at TMn=715 °C the decrease is approximately four times, while for the sample grown at TMn=745 °C the decrease is approximately forty times. We plotted the resistivities as a function of temperature in Arrhenius plots, where we extracted two activation energies, the smallest one between 6 and 11 meV, and the largest one between 25 and 183 meV. Both activation energies increased as TMn increased. These results are in agreement with SIMS analysis where we observed that manganese concentration in the (6 3 1) orientation growth is around two order of magnitude larger than in the samples grown in the (0 0 1) orientation substrate.

  14. Carbon Nanotube Microarrays Grown on Nanoflake Substrates

    NASA Technical Reports Server (NTRS)

    Schmidt, Howard K.; Hauge, Robert H.; Pint, Cary; Pheasant, Sean

    2013-01-01

    This innovation consists of a new composition of matter where single-walled carbon nanotubes (SWNTs) are grown in aligned arrays from nanostructured flakes that are coated in Fe catalyst. This method of growth of aligned SWNTs, which can yield well over 400 percent SWNT mass per unit substrate mass, exceeds current yields for entangled SWNT growth. In addition, processing can be performed with minimal wet etching treatments, leaving aligned SWNTs with superior properties over those that exist in entangled mats. The alignment of the nanotubes is similar to that achieved in vertically aligned nanotubes, which are called "carpets. " Because these flakes are grown in a state where they are airborne in a reactor, these flakes, after growing SWNTs, are termed "flying carpets. " These flakes are created in a roll-to-roll evaporator system, where three subsequent evaporations are performed on a 100-ft (approx. =30-m) roll of Mylar. The first layer is composed of a water-soluble "release layer, " which can be a material such as NaCl. After depositing NaCl, the second layer involves 40 nm of supporting layer material . either Al2O3 or MgO. The thickness of the layer can be tuned to synthesize flakes that are larger or smaller than those obtained with a 40-nm deposition. Finally, the third layer consists of a thin Fe catalyst layer with a thickness of 0.5 nm. The thickness of this layer ultimately determines the diameter of SWNT growth, and a layer that is too thick will result in the growth of multiwalled carbon nanotubes instead of single-wall nanotubes. However, between a thickness of 0.5 nm to 1 nm, single-walled carbon nanotubes are known to be the primary constituent. After this three-layer deposition process, the Mylar is rolled through a bath of water, which allows catalyst-coated flakes to detach from the Mylar. The flakes are then collected and dried. The method described here for making such flakes is analogous to that which is used to make birefringent ink that is coated on U.S. currency. After deposition, the growth is carried out in a hot-filament chemical vapor deposition apparatus. A tungsten hot filament placed in the flow of H2 at a temperature greater than 1,600 C creates atomic hydrogen, which serves to reduce the Fe catalyst into a metallic state. The catalyst can now precipitate SWNTs in the presence of growth gases. The gases used for the experiments reported are C2H2, H2O, and H2, at rates of 2, 2, and 400 standard cubic centimeters per minute (sccm), respectively. In order to retain the flakes, a cage is constructed by spot welding stainless steel or copper mesh to form an enclosed area, in which the flakes are placed prior to growth. This allows growth gases and atomic hydrogen to reach the flakes, but does not allow the flakes, which rapidly nucleate SWNTs, to escape from the cage.

  15. 7 CFR 989.157 - Raisins produced from grapes grown outside of California.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...2012-01-01 false Raisins produced from grapes grown outside of California. 989...OF AGRICULTURE RAISINS PRODUCED FROM GRAPES GROWN IN CALIFORNIA Administrative Rules... § 989.157 Raisins produced from grapes grown outside of California....

  16. 7 CFR 989.157 - Raisins produced from grapes grown outside of California.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...2014-01-01 false Raisins produced from grapes grown outside of California. 989...OF AGRICULTURE RAISINS PRODUCED FROM GRAPES GROWN IN CALIFORNIA Administrative Rules... § 989.157 Raisins produced from grapes grown outside of California....

  17. 7 CFR 989.157 - Raisins produced from grapes grown outside of California.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...2013-01-01 false Raisins produced from grapes grown outside of California. 989...OF AGRICULTURE RAISINS PRODUCED FROM GRAPES GROWN IN CALIFORNIA Administrative Rules... § 989.157 Raisins produced from grapes grown outside of California....

  18. Retargeting Clostridium difficile Toxin B to Neuronal Cells as a Potential Vehicle for Cytosolic Delivery of Therapeutic Biomolecules to Treat Botulism

    PubMed Central

    Krautz-Peterson, Greice; Zhang, Yongrong; Chen, Kevin; Oyler, George A.; Feng, Hanping; Shoemaker, Charles B.

    2012-01-01

    Botulinum neurotoxins (BoNTs) deliver a protease to neurons which can cause a flaccid paralysis called botulism. Development of botulism antidotes will require neuronal delivery of agents that inhibit or destroy the BoNT protease. Here, we investigated the potential of engineering Clostridium difficile toxin B (TcdB) as a neuronal delivery vehicle by testing two recombinant TcdB chimeras. For AGT-TcdB chimera, an alkyltransferase (AGT) was appended to the N-terminal glucosyltransferase (GT) of TcdB. Recombinant AGT-TcdB had alkyltransferase activity, and the chimera was nearly as toxic to Vero cells as wild-type TcdB, suggesting efficient cytosolic delivery of the AGT/GT fusion. For AGT-TcdB-BoNT/A-Hc, the receptor-binding domain (RBD) of TcdB was replaced by the equivalent RBD from BoNT/A (BoNT/A-Hc). AGT-TcdB-BoNT/A-Hc was >25-fold more toxic to neuronal cells and >25-fold less toxic to Vero cells than AGT-TcdB. Thus, TcdB can be engineered for cytosolic delivery of biomolecules and improved targeting of neuronal cells. PMID:21941543

  19. Diamond films grown from fullerene precursors

    SciTech Connect

    Gruen, D.M.; Zuiker, C.D.; Krauss, A.R.

    1995-07-01

    Fullerene precursors have been shown to result in the growth of diamond films from argon microwave plasmas. In contradistinction to most diamond films grown using conventional methane-hydrogen mixtures, the fullerene-generated films are nanocrystalline and smooth on the nanometer scale. They have recently been shown to have friction coefficients approaching the values of natural diamond. It is clearly important to understand the development of surface morphology during film growth from fullerene precursors and to elucidate the factors leading to surface roughness when hydrogen is present in the chemical vapor deposition (CVD) gas mixtures. To achieve these goals, we are measuring surface reflectivity of diamond films growing on silicon substrates over a wide range of plasma processing conditions. A model for the interpretation of the laser interferometric data has been developed, which allows one to determine film growth rate, rms surface roughness, and bulk losses due to scattering and absorption. The rms roughness values determined by reflectivity are in good agreement with atomic force microscope (AFM) measurements. A number of techniques, including high-resolution transmission electron microscopy (HRTEM) and near-edge x-ray absorption find structure (NEXAFS) measurements, have been used to characterize the films. A mechanism for diamond-film growth involving the C{sub 2} molecule as a growth species will be presented. The mechanism is based on (1) the observation that the optical emission spectra of the fullerene- containing plasmas are dominated by the Swan bands of C{sub 2} and (2) the ability of C{sub 2} to insert directly into C-H and C-C bonds with low activation barriers, as shown by recent theoretical calculations of reactions of C{sub 2} with carbon clusters.

  20. Stability of the Parainfluenza Virus 5 Genome Revealed by Deep Sequencing of Strains Isolated from Different Hosts and following Passage in Cell Culture

    PubMed Central

    Rima, Bert K.; Gatherer, Derek; Young, Daniel F.; Norsted, Hanna; Davison, Andrew J.

    2014-01-01

    ABSTRACT The strain diversity of a rubulavirus, parainfluenza virus 5 (PIV5), was investigated by comparing 11 newly determined and 6 previously published genome sequences. These sequences represent 15 PIV5 strains, of which 6 were isolated from humans, 1 was from monkeys, 2 were from pigs, and 6 were from dogs. Strain diversity is remarkably low, regardless of host, year of isolation, or geographical origin; a total of 7.8% of nucleotides are variable, and the average pairwise difference between strains is 2.1%. Variation is distributed unevenly across the PIV5 genome, but no convincing evidence of selection for antibody-mediated evasion in hemagglutinin-neuraminidase was found. The finding that some canine and porcine, but not primate, strains are mutated in the SH gene, and do not produce SH, raised the possibility that dogs (or pigs) may not be the natural host of PIV5. The genetic stability of PIV5 was also demonstrated during serial passage of one strain (W3) in Vero cells at a high multiplicity of infection, under conditions of competition with large proportions of defective interfering genomes. A similar observation was made for a strain W3 mutant (PIV5V?C) lacking V gene function, in which the dominant changes were related to pseudoreversion in this gene. The mutations detected in PIV5V?C during pseudoreversion, and also those characterizing the SH gene in canine and porcine strains, predominantly involved U-to-C transitions. This suggests an important role for biased hypermutation via an adenosine deaminase, RNA-specific (ADAR)-like activity. IMPORTANCE Here we report the sequence variation of 16 different isolates of parainfluenza virus 5 (PIV5) that were isolated from a number of species, including humans, monkeys, dogs, and pigs, over 4 decades. Surprisingly, strain diversity was remarkably low, regardless of host, year of isolation, or geographical origin. Variation was distributed unevenly across the PIV5 genome, but no convincing evidence of immune or host selection was found. This overall genome stability of PIV5 was also observed when the virus was grown in the laboratory, and the genome stayed remarkably constant even during the selection of virus mutants. Some of the canine isolates had lost their ability to encode one of the viral proteins, termed SH, suggesting that although PIV5 commonly infects dogs, dogs may not be the natural host for PIV5. PMID:24453358

  1. Comparative effectiveness of a clinostat and a slow-turning lateral vessel at mimicking the ultrastructural effects of microgravity in plant cells

    NASA Technical Reports Server (NTRS)

    Moore, R.

    1990-01-01

    The object of this research was to determine how effectively the actions of a clinostat and a fluid-filled, slow-turning lateral vessel (STLV) mimic the ultrastructural effects of microgravity in plant cells. We accomplished this by qualitatively and quantitatively comparing the ultrastructures of cells grown on clinostats and in an STLV with those of cells grown at 1 g and in microgravity aboard the Space Shuttle Columbia. Columella cells of Brassica perviridis seedlings grown in microgravity and in an STLV have similar structures. Both contain significantly more lipid bodies, less starch, and fewer dictyosomes than columella cells of seedlings grown at 1 g. Cells of seedlings grown on clinostats have significantly different ultrastructures from those grown in microgravity or in an STLV, indicating that clinostats do not mimic microgravity at the ultrastructural level. The similar structures of columella cells of seedlings grown in an STLV and in microgravity suggest that an STLV effectively mimics microgravity at the ultrastructural level.

  2. Auxin Transport Is Required for Hypocotyl Elongation in Light-Grown but Not Dark-Grown Arabidopsis1

    PubMed Central

    Jensen, Philip J.; Hangarter, Roger P.; Estelle, Mark

    1998-01-01

    Many auxin responses are dependent on redistribution and/or polar transport of indoleacetic acid. Polar transport of auxin can be inhibited through the application of phytotropins such as 1-naphthylphthalamic acid (NPA). When Arabidopsis thaliana seedlings were grown in the light on medium containing 1.0 ?m NPA, hypocotyl and root elongation and gravitropism were strongly inhibited. When grown in darkness, however, NPA disrupted the gravity response but did not affect elongation. The extent of inhibition of hypocotyl elongation by NPA increased in a fluence-rate-dependent manner to a maximum of about 75% inhibition at 50 ?mol m?2 s?1 of white light. Plants grown under continuous blue or far-red light showed NPA-induced hypocotyl inhibition similar to that of white-light-grown plants. Plants grown under continuous red light showed less NPA-induced inhibition. Analysis of photoreceptor mutants indicates the involvement of phytochrome and cryptochrome in mediating this NPA response. Hypocotyls of some auxin-resistant mutants had decreased sensitivity to NPA in the light, but etiolated seedlings of these mutants were similar in length to the wild type. These results indicate that light has a significant effect on NPA-induced inhibition in Arabidopsis, and suggest that auxin has a more important role in elongation responses in light-grown than in dark-grown seedlings. PMID:9489005

  3. Nerve Growth Factor Receptors on Cultured Rat Schwann Cells

    Microsoft Academic Search

    Peter S. DiStefano; Eugene M. Johnson

    1988-01-01

    Neonatal rat Schwann ceils were grown in tissue culture and assayed for NGF receptors with time in culture. NGF receptor levels on freshly prepared Schwann cells (day 0) were low but increased dramatically during the first week in culture. Characterization of 1a51-NGF binding to resuspended cells grown for 4 d in culture revealed that binding was not sat- urable at

  4. Tailoring the optical characteristics of microsized InP nanoneedles directly grown on silicon.

    PubMed

    Li, Kun; Sun, Hao; Ren, Fan; Ng, Kar Wei; Tran, Thai-Truong D; Chen, Roger; Chang-Hasnain, Connie J

    2014-01-01

    Nanoscale self-assembly offers a pathway to realize heterogeneous integration of III-V materials on silicon. However, for III-V nanowires directly grown on silicon, dislocation-free single-crystal quality could only be attained below certain critical dimensions. We recently reported a new approach that overcomes this size constraint, demonstrating the growth of single-crystal InGaAs/GaAs and InP nanoneedles with the base diameters exceeding 1 ?m. Here, we report distinct optical characteristics of InP nanoneedles which are varied from mostly zincblende, zincblende/wurtzite-mixed, to pure wurtzite crystalline phase. We achieved, for the first time, pure single-crystal wurtzite-phase InP nanoneedles grown on silicon with bandgaps of 80 meV larger than that of zincblende-phase InP. Being able to attain excellent material quality while scaling up in size promises outstanding device performance of these nanoneedles. At room temperature, a high internal quantum efficiency of 25% and optically pumped lasing are demonstrated for single nanoneedle as-grown on silicon substrate. Recombination dynamics proves the excellent surface quality of the InP nanoneedles, which paves the way toward achieving multijunction photovoltaic cells, long-wavelength heterostructure lasers, and advanced photonic integrated circuits. PMID:24299042

  5. Survival of Potentially Pathogenic Human-Associated Bacteria in the Rhizosphere of Hydroponically Grown Wheat

    NASA Technical Reports Server (NTRS)

    Morales, Anabelle; Garland, Jay L.; Lim, Daniel V.

    1996-01-01

    Plants may serve as reservoirs for human-associated bacteria (H-AB) in long-term space missions containing bioregenerative life support systems. The current study examined the abilities of five human-associated potential pathogens, Pseudomonas aeruginosa, Pseudomonas cepacia, Staphylococcus aureus, Streptococcus pyogenes, and Escherichia coli, to colonize and grow in the rhizosphere of hydroponically grown wheat, a candidate crop for life support. All of these bacteria have been recovered from past NASA missions and present potential problems for future missions. The abilities of these organisms to adhere to the roots of axenic five-day-old wheat (Triticum aestivum L. cv. Yecora rojo) were evaluated by enumeration of the attached organisms after a one hour incubation of roots in a suspension (approximately 10(exp 8 cu/ml)) of the H-AB. Results showed that a greater percentage of P. aeruginosa cells adhered to the wheat roots than the other four H-AB. Similarly incubated seedlings were also grown under attempted axenic conditions for seven days to examine the potential of each organism to proliferate in the rhizosphere (root colonization capacity). P. cepacia and P. aeruginosa showed considerable growth. E. coli and S. aureus showed no significant growth, and S. pyogenes died off in the wheat rhizosphere. Studies examining the effects of competition on the survival of these microorganisms indicated that P. aeruginosa was the only organism that survived in the rhizosphere of hydroponically grown wheat in the presence of different levels of microbial competition.

  6. Cryopreservation of in vitro grown shoot tips

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter in Plant Cell Culture, Development and Biotechnology describes student laboratory exercises for cryopreservation of the growing shoot tips of plants in liquid nitrogen. It includes two exercises involving step by step protocols for use with shoot tips. Vitrification (fast freezing) an...

  7. At last, a medical website designed for grown-ups

    MedlinePLUS

    ... At last, a medical website designed for grown-ups Past Issues / Winter 2007 Table of Contents For ... U.S. Department of Health and Human Services. For up-to-date health information tailor-made just for ...

  8. GaN grown on nano-patterned sapphire substrates

    NASA Astrophysics Data System (ADS)

    Jing, Kong; Meixin, Feng; Jin, Cai; Hui, Wang; Huaibing, Wang; Hui, Yang

    2015-04-01

    High-quality gallium nitride (GaN) film was grown on nano-patterned sapphire substrates (NPSS) and investigated using XRD and SEM. It was found that the optimum thickness of the GaN buffer layer on the NPSS is 15 nm, which is thinner than that on micro-patterned sapphire substrates (MPSS). An interesting phenomenon was observed for GaN film grown on NPSS:GaN mainly grows on the trench regions and little grows on the sidewalls of the patterns at the initial growth stage, which is dramatically different from GaN grown on MPSS. In addition, the electrical and optical properties of LEDs grown on NPSS were characterized. Project supported by the Suzhou Nanojoin Photonics Co., Ltd and the High-Tech Achievements Transformation of Jiangsu Province, China (No.BA2012010).

  9. Screening the antiangiogenic activity of medicinal plants grown and sold in Jordan.

    PubMed

    Zihlif, Malek; Afifi, Fatma; Muhtaseb, Ruba; Al-Khatib, Sondos; Abaza, Ismail; Naffa, Randa

    2012-02-01

    Angiogenesis is essential for the growth, invasion, and metastasis of most solid tumors and has become a valuable pharmacological target for cancer prevention and treatment. This study was performed to assess the antiangiogenic activity of 31 medicinal plants grown and sold in Jordan. The antiangiogenic activity was assessed using the rat aortic ring assay. Out of 31 extracts, 15 extracts showed more than 50?% inhibition of the blood vessels outgrowth from the primary tissue explants (p?=?0.000). Three of these 15 extracts showed a potential cytotoxic effect on normal fibroblast cells. Four extracts shared antiangiogenic and antiproliferative activity towards MCF7 breast cancer cell lines. Eight extracts demonstrated selective antiangiogenic activity. This is the first report demonstrating the potential antiangiogenic activity of Artemisia judaica, Aloysia citriodora, Salvia egyptiaca, and Calendula arvensis. Some extracts with antiangiogenic activity exhibited selectivity against the endothelial cells proliferation, demonstrating a direct inhibitory activity against the key step in tumor angiogenesis. PMID:22174075

  10. Synthesis and characterization of pectin derivative with antitumor property against Caco-2 colon cancer cells.

    PubMed

    Almeida, Elizângela A M S; Facchi, Suelen P; Martins, Alessandro F; Nocchi, Samara; Schuquel, Ivânia T A; Nakamura, Celso V; Rubira, Adley F; Muniz, Edvani C

    2015-01-22

    New pectin derivative (Pec-MA) was obtained in specific reaction conditions. The presence of maleoyl groups in Pec-MA structure was confirmed by (1)H NMR and FTIR spectroscopy. The substitution degree of Pec-MA (DS=24%) was determined by (1)H NMR. The properties of Pec-MA were investigated through WAXS, TGA/DTG, SEM and zeta potential techniques. The Pec-MA presented amorphous characteristics and higher-thermal stability compared to raw pectin (Pec). In addition, considerable morphological differences between Pec-MA and Pec were observed by SEM. The cytotoxic effect on the Caco-2 cells showed that the Pec-MA significantly inhibited the growth of colon cancer cells whereas the Pec-MA does not show any cytotoxic effect on the VERO healthy cells. This result opens new perspectives for the manufacture of biomaterials based on Pec with anti-tumor properties. PMID:25439878

  11. Characterization of Escherichia coli MG1655 grown in a low-shear modeled microgravity environment

    PubMed Central

    Tucker, Don L; Ott, C Mark; Huff, Stephen; Fofanov, Yuriy; Pierson, Duane L; Willson, Richard C; Fox, George E

    2007-01-01

    Background Extra-cellular shear force is an important environmental parameter that is significant both medically and in the space environment. Escherichia coli cells grown in a low-shear modeled microgravity (LSMMG) environment produced in a high aspect rotating vessel (HARV) were subjected to transcriptional and physiological analysis. Results Aerobic LSMMG cultures were grown in rich (LB) and minimal (MOPS + glucose) medium with a normal gravity vector HARV control. Reproducible changes in transcription were seen, but no specific LSMMG responsive genes were identified. Instead, absence of shear and a randomized gravity vector appears to cause local extra-cellular environmental changes, which elicit reproducible cellular responses. In minimal media, the majority of the significantly up- or down-regulated genes of known function were associated with the cell envelope. In rich medium, most LSMMG down-regulated genes were involved in translation. No observable changes in post-culture stress responses and antibiotic sensitivity were seen in cells immediately after exposure to LSMMG. Comparison with earlier studies of Salmonella enterica serovar Typhimurium conducted under similar growth conditions, revealed essentially no similarity in the genes that were significantly up- or down-regulated. Conclusion Comparison of these results to previous studies suggests that different organisms may dramatically differ in their responses to medically significant low-shear and space environments. Depending on their specific response, some organisms, such as Salmonella, may become preadapted in a manner that predisposes them to increased virulence. PMID:17343762

  12. Magnetoresistance enhancement in epitaxial magnetite films grown on vicinal substrates

    Microsoft Academic Search

    S. K. Arora; R. G. S. Sofin; I. V. Shvets

    2005-01-01

    The magnetoresistance (MR) behavior of epitaxial magnetite Fe3O4 grown on low-vicinal (small miscut) and high-vicinal (large miscut) MgO substrates is compared. Magnetization measurements on Fe3O4 films on high-vicinal substrates showed reduced magnetic moment as compared with the films grown on low-vicinal MgO, which correlates well with the expected reduction in magnetic moment due to step edge induced additional antiphase boundaries

  13. Structural transformation of vapor grown carbon nanofibers studied by HRTEM

    Microsoft Academic Search

    Joseph G. Lawrence; Lesley M. Berhan; Arunan Nadarajah

    2008-01-01

    Vapor grown carbon nanofibers have been extensively manufactured and investigated in recent years. In this study commercially\\u000a available vapor grown carbon nanofibers subjected to different processing and post processing conditions were studied employing\\u000a high resolution TEM images. The analysis showed that the fibers consist primarily of conical nanofibers, but can contain a\\u000a significant amount of bamboo nanofibers. Most conical nanofibers

  14. Quality characteristics of the radish grown under reduced atmospheric pressure

    Microsoft Academic Search

    Lanfang H. Levine; Patricia A. Bisbee; Jeffrey T. Richards; Michele N. Birmele; Ronald L. Prior; Michele Perchonok; Mike Dixon; Neil C. Yorio; Gary W. Stutte; Raymond M. Wheeler

    2008-01-01

    This study addresses whether reduced atmospheric pressure (hypobaria) affects the quality traits of radish grown under such environments. Radish (Raphanus sativus L. cv. Cherry Bomb Hybrid II) plants were grown hydroponically in specially designed hypobaric plant growth chambers at three atmospheric pressures; 33, 66, and 96kPa (control). Oxygen and carbon dioxide partial pressures were maintained constant at 21 and 0.12kPa,

  15. Characterization of crotonate grown Clostridium kluyveri by its assimilatory metabolism

    Microsoft Academic Search

    Rudolf K. Thauer; Kurt Jungermann; Joseph Wenning; Karl Decker

    1968-01-01

    Considerable behavioral differences were observed during growth of Clostridium kluyveri on ethanol-acetate and on crotonate media. The identity of the crotonate grown Clostridium with the ethanol grown Clostridium kluyveri was therefore established by three characteristic biosynthetic routes: 1. ribose is synthesized from CO2 and acetate via pyruvate, triose phosphate and a non-oxidative pentose phosphate pathway, 2. reduced one-carbon units are

  16. Photoemission electronic states of epitaxially grown magnetite films

    Microsoft Academic Search

    R. Zalecki; A. Ko?odziejczyk; J. Korecki; N. Spiridis; M. Zaj?c; A. Koz?owski; Z. K?kol; D. Antolak

    2007-01-01

    The valence band photoemission spectra of epitaxially grown 300? single crystalline magnetite films were measured by the angle-resolved ultraviolet photoemission spectroscopy (ARUPS) at 300K. The samples were grown either on MgO(001) (B termination) or on (001) Fe (iron-rich A termination), thus intentionally presenting different surface stoichiometry, i.e. also different surface electronic states. Four main features of the electron photoemission at

  17. Magnesium diffusion profile in GaN grown by MOVPE

    Microsoft Academic Search

    Z. Benzarti; I. Halidou; Z. Bougrioua; T. Boufaden; B. El Jani

    2008-01-01

    The diffusion of magnesium has been studied in GaN layers grown on sapphire substrate by atmospheric pressure metalorganic vapor-phase-epitaxy (MOVPE) in a “home-made” reactor. Secondary Ion Mass Spectroscopy (SIMS) was used to visualise the Mg profiles in two kinds of multi-sublayer GaN structures. One structure was grown with a variable flow of Ga precursor (TMG) and the second one with

  18. Terahertz Photomixing in Low-Temperature-Grown GaAs

    Microsoft Academic Search

    E. R. Brown; S. Verghese; K. A. McIntosh

    1998-01-01

    ABSTRACT Low-temperature-grown (LTG) GaAs offers the combination of sub-picosecond photocarrier lifetime and high breakdown,electric field (> 5x105 V\\/cm), and is grown in epitaxial films having excellent quality for microelectronic fabrication. A THz photoconductive,mixer (photomixer) is formed on these films by patterning low-capacitance planar electrodes coupled to a coplanar antenna. The photomixer is conveniently pumped,by two frequency-offsetdiode-laser beams focused on the

  19. Structural, thermal and dielectric properties of cobaltous malonate single crystals grown in limited diffusion media

    Microsoft Academic Search

    A. Lincy; V. Mahalakshmi; A. J. Tinto; J. Thomas; K. V. Saban

    2010-01-01

    Well-faceted crystals of cobaltous malonate (C6 H12 Co2 O12) have been grown by the controlled diffusion of ionic species in hydrosilica gel. Single crystal X-ray diffraction studies show that the crystal belongs to the monoclinic system with space group C2\\/m. The unit cell dimensions are a=12.6301(9)Å, b=7.3857(9)Å, c=7.2945(7)Å, ?=?=90°, ?=120.193(9)°. The functional groups, elucidated from the FT-IR spectrum, are in

  20. Electronic transport through in situ grown ultra-thin BaTiO3 films

    SciTech Connect

    Shin, Junsoo [ORNL; Kalinin, Sergei V [ORNL; Plummer, E Ward [ORNL; Baddorf, Arthur P [ORNL

    2009-01-01

    Polarization-mediated transport properties of ultra-thin (4 and 10 unit cells) fully strained polar BaTiO3 films are studied by Scanning Tunneling Microscopy and Spectroscopy. High quality films are grown on SrRuO3/SrTiO3 by pulsed laser deposition and characterized in situ in ultrahigh vacuum. Previous structural measurements have shown that these films are polarized. Current-Voltage curves exhibit features at ~ 2.5 V, which show hysteresis consistent with bias-induced polarization switching. The intensity and voltage of the features indicate a stochastic process. These features are not observed on non-polarized films.

  1. Comparisons among species of Alexandrium (Dinophyceae) grown in nitrogen- or phosphorus-limiting batch culture

    Microsoft Academic Search

    K. Flynn; K. J. Jones

    1996-01-01

    Three species of the dinoflagellate genusAlexandrium (Halim)-two strains of toxic.A. minutum, one each of nontoxicA. tamarense andA. affini-were grown in batch culture in either a low-nitrogen or a low-phosphate medium. Maximum carbon-specific growth rates forA. tamarense were lower (at -1) than for the other strains, which all exceeded 0.38 d-1. C-quotas (C content per cell) during exponential growth were similar

  2. In Vitro Assessment of Cadmium Bioavailability in Chinese Cabbage Grown on Different Soils and Its Toxic Effects on Human Health

    PubMed Central

    Aziz, Rukhsanda; Rafiq, Muhammad Tariq; He, Zhenli; Liu, Di; Sun, Kewang; Xiaoe, Yang

    2015-01-01

    The minimum concentration of cadmium (Cd), by Chinese cabbage grown on Cd contaminated soils that can initiate toxicity in human liver cells using in vitro digestion coupled with Caco-2/HL-7702 cell models was studied. Cadmium bioaccessibility in the gastric phase for yellow soil (YS) cabbage (40.84%) and calcareous soil (CS) cabbage (21.54%) was significantly higher than small intestinal phase with the corresponding values of 21.2% and 11.11%, respectively. Cadmium bioavailability was higher in YS cabbage (5.27%–14.66%) than in CS cabbage (1.12%–9.64%). Cadmium concentrations (>0.74??g) transported from YS and CS cabbage were able to induce oxidative (MDA, H2O2) stress by inhibiting antioxidant (SOD, GPx) enzyme activities in human liver cells (HL-7702). Additionally the study revealed that the ingestion of Cd contaminated Chinese cabbage grown in acidic soil (yellow soil) weakened the antioxidant defense system under all levels of contamination (2, 6, and 9?mg·kg?1) which ultimately escalated the oxidative stress in liver cells; however, in case of CS cabbage, a marked oxidative stress was observed only at 9?mg?kg?1 Cd level of soil. Therefore, it is necessary to monitor Cd concentrations in leafy vegetables grown on acidic soils to minimize human health risk.

  3. Low temperature-induced accumulation of eicosapentaenoic acids in Marchantia polymorpha cells

    Microsoft Academic Search

    Makoto Saruwatari; Susumu Takio; Kanji Ono

    1999-01-01

    The composition of fatty acids in suspension-cultured cells from the liverwort Marchantia polymorpha L. grown at 25 and 15°C was analyzed. The liverwort cells grown at 25°C contained approximately 18% linolenic acid (18:3?3), 11% arachidonic acid (20:4?6) and 3% eicosapentaenoic acid (20:5?3) as percentages of total fatty acids. When the cells were grown at 15°C, the relative amounts of 18:3

  4. Defect density characterization of detached-grown germanium crystals

    NASA Astrophysics Data System (ADS)

    Schweizer, M.; Cobb, S. D.; Volz, M. P.; Szoke, J.; Szofran, F. R.

    2002-02-01

    Several (1 1 1)-oriented, Ga-doped germanium crystals were grown in pyrolytic boron nitride (pBN) containers by the Bridgman and the detached Bridgman growth techniques. Growth experiments in closed-bottom pBN containers resulted in nearly completely detached-grown crystals, because the gas pressure below the melt can build up to a higher pressure than above the melt. With open-bottom tubes the gas pressure above and below the melt is balanced during the experiment, and thus no additional force supports the detachment. In this case the crystals grew attached to the wall. Etch pit density (EPD) measurements along the axial growth direction indicated a strong improvement of the crystal quality of the detached-grown samples compared to the attached samples. Starting in the seed with an EPD of 6-8×10 3 cm -2 it decreased in the detached-grown crystals continuously to about 200-500 cm -2. No significant radial difference between the EPD on the edge and the middle of these crystals exists. In the attached grown samples the EPD increases up to a value of about 2-4×10 4 cm -2 (near the edge) and up to 1×10 4 cm -2 in the middle of the sample. Thus the difference between the detached- and the attached-grown crystals with respect to the EPD is approximately two orders of magnitude.

  5. Defect Density Characterization of Detached-Grown Germanium Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Cobb, S. D.; Volz, M. P.; Szoke, J.; Szofran, F. R.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    Several (111)-oriented, Ga-doped germanium crystals were grown in pyrolytic boron nitride (pBN) containers by the Bridgman and the detached Bridgman growth techniques. Growth experiments in closed-bottom pBN containers resulted in nearly completely detached-grown crystals, because the gas pressure below the melt can build up to a higher pressure than above the melt. With open-bottom tubes the gas pressure above and below the melt is balanced during the experiment, and thus no additional force supports the detachment. In this case the crystals grew attached to the wall. Etch pit density (EPD) measurements along the axial growth direction indicated a strong improvement of the crystal quality of the detached-grown samples compared to the attached samples. Starting in the seed with an EPD of 6-8 x 10(exp 3)/square cm it decreased in the detached-grown crystals continuously to about 200-500/square cm . No significant radial difference between the EPD on the edge and the middle of the crystal exists. In the attached grown samples the EPD increases up to a value of about 2-4 x 10(exp 4)/square cm (near the edge) and up to 1 x 10(exp 4)/square cm in the middle of the sample. Thus the difference between the detached- and the attached-grown crystals with respect to the EPD is approximately two orders of magnitude.

  6. 76 FR 16609 - Proposed Information Collection; Comment Request; Identification of Human Cell Lines Project

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-24

    ...ASN-0002 Authentication of Human Cell Lines: Standardization...Development Organization Workgroup. Human cell line samples are cells taken from a human being that can be grown in...can be used for scientific experiments, as examples of the...

  7. A Polarised Population of Dynamic Microtubules Mediates Homeostatic Length Control in Animal Cells

    Microsoft Academic Search

    Remigio Picone; Xiaoyun Ren; Kenzo D. Ivanovitch; Jon D. W. Clarke; Rachel A. McKendry; Buzz Baum

    2010-01-01

    An analysis of cells grown on micro-patterned lines, and of cells during zebrafish development, identifies a population of microtubules that align along the long axis of cells to mediate homeostatic length control.

  8. Comparison of full-length genomics sequences between dengue virus serotype 3, parental strain, and its derivatives, and B-cell epitopes prediction from envelope region.

    PubMed

    Thaisonthi, Siriwattana; Rabablert, Jundee; Yoksan, Sutee

    2013-01-01

    Biological markers are normally used to evaluate the candidate of live-attenuated dengue vaccines. D3V 16562 Vero 23 and D3V 16562 Vero 33 which were derivatives of D3V 16562, parental strain, showed the similar biological data. We used molecular techniques and computational tools to evaluate these derivatives. The nucleotide and amino acid sequences of the derivatives were compared to their parent. The secondary structures of untranslated regions and B-cell epitopes were predicted. The results showed that nucleotide substitutions mostly occurred in NS5 and NS5 of V2 was unusual because of amino acid change at 3349 (tryptophan ?stop codon). The nucleotide substitutions in 5'UTR, prM, E, NS1, NS2A, NS3, and 3'UTR were 4, 1, 2, 2, 1, 3, and 2, respectively. The secondary structure of 5'UTR of V2 was different from P and V1. The secondary structure of 3'UTR of V2 was similar to P and certainly distinct from V1. Furthermore, B-cell epitopes prediction revealed that there were 21 epitopes of envelope and the interesting epitope was at position 297-309 because it was in domain III in which the neutralizing antibody is induced. For this study, the attenuation of derivatives was caused by the nucleotide substitutions in 5'UTR, 3'UTR, and NS5 regions. The genotypic data and B-cell epitope make the derivatives attractive for the chimeric and peptide DENV vaccine development. PMID:23904739

  9. E. P. R. CHARACTERIZATION OF p-TYPE AS GROWN AND Cl-COMPENSATED THM GROWN CdTe

    E-print Network

    Boyer, Edmond

    199 E. P. R. CHARACTERIZATION OF p-TYPE AS GROWN AND Cl-COMPENSATED THM GROWN CdTe A. GOLTZENE électronique ont été observés dans du CdTe de haute résistivité, de type p ; à 4 K, on observe toujours des intense à g = 1,830 ± 0,002. Dans CdTe, fortement dopé au Cl, une raie à g = 2,003 ± 0,001 est déjà

  10. Degradative inactivation of the peroxisomal enzyme, alcohol oxidase, during adaptation of methanol-grown Candida boidinii to ethanol.

    PubMed Central

    Hill, D J; Hann, A C; Lloyd, D

    1985-01-01

    Adaptation of methanol-grown C. boidinii to ethanol-utilization in non-growing cells resulted in decreased activity of the peroxisomal enzyme alcohol oxidase. Re-appearance of alcohol oxidase activity was dependent on protein synthesis de novo. Degradation of alcohol oxidase protein was shown to parallel the decrease in activity. Adaptation of methanol-grown cells to ethanol-utilization resulted in increased absorbance due to cytochromes and decreased absorbance due to flavoprotein. Decrease in alcohol oxidase activity was associated with loss of the flavin coenzyme, FAD, from the organisms and the appearance of flavins (FAD, FMN, riboflavin) in the surrounding medium. Electron microscopic observations showed that general degradation of whole peroxisomes rather than specific loss of crystalline cores (alcohol oxidase protein) occurred during the adaptation. Images PMID:3911950

  11. Superlattice structures grown by molecular beam epitaxy

    SciTech Connect

    Dawson, L.R.

    1984-01-01

    Recent advances in the preparation of superlattice structures have made it possible to tailor the optical, electrical and metallurgical properties of semiconductors in ways that could strongly impact the performance of advanced concept, multijunction photovoltaic devices. The interfacial strain in lattice-mismatched superlattices (strained-layer superlattices) offers a method of eliminating the large numbers of misfit defects usually present in the mismatched bulk alloy semiconductors needed for optimum high performance cells. Extensive characterization of such structures indicates excellent optical, electrical, and metallurgical quality in spite of the large number of strained interfaces. Junction photodetectors fabricated from such materials show peak internal quantum efficiency in excess of 70%.

  12. Radiation effects on p+n InP junctions grown by MOCVD

    NASA Technical Reports Server (NTRS)

    Messenger, Scott R.; Walters, Robert J.; Panunto, M. J.; Summers, Geoffrey P.

    1994-01-01

    The superior radiation resistance of InP over other solar cell materials such as Si or GaAs has prompted the development of InP cells for space applications. The early research on radiation effects in InP was performed by Yamaguchi and co-workers who showed that, in diffused p-InP junctions, radiation-induced defects were readily annealed both thermally and by injection, which was accompanied by significant cell recovery. More recent research efforts have been made using p-InP grown by metalorganic chemical vapor deposition (MOCVD). While similar deep level transient spectroscopy (DLTS) results were found for radiation induced defects in these cells and in diffused junctions, significant differences existed in the annealing characteristics. After injection annealing at room temperature, Yamaguchi noticed an almost complete recovery of the photovoltaic parameters, while the MOCVD samples showed only minimal annealing. In searching for an explanation of the different annealing behavior of diffused junctions and those grown by MOCVD, several possibilities have been considered. One possibility is the difference in the emitter structure. The diffused junctions have S-doped graded emitters with widths of approximately 0.3 micrometers, while the MOCVD emitters are often doped with Si and have widths of approximately 300A (0.03 micrometers). The difference in the emitter thickness can have important effects, e.g. a larger fraction of the total photocurrent is generated in the n-type material for thicker emitters. Therefore the properties of the n-InP material may explain the difference in the observed overall annealing behavior of the cells.

  13. Analysis of the exopolysaccharides produced by Lactobacillus delbrueckii subsp. bulgaricus NCFB 2772 grown in continuous culture on glucose and fructose

    Microsoft Academic Search

    G. J. Grobben; W. H. M. van Casteren; H. A. Schols; A. Oosterveld; G. Sala; M. R. Smith; J. Sikkema; J. A. M. de Bont

    1997-01-01

    The exopolysaccharides produced by Lactobacillus delbrueckii subsp. bulgaricus NCFB 2772 grown in defined medium were investigated. At equal cell densities, the strain produced 95?mg l?1 exopolysaccharides with glucose and 30?mg l?1 with fructose as the carbohydrate source. High-performance size-exclusion chromatography of the exopolysaccharides produced\\u000a on glucose showed the presence of two fractions with relative molecular masses (M\\u000a r) of 1.7?×?106

  14. Photosynthetic characteristics of planktonic blue-green algae: The response of twenty strains grown under high and low light

    Microsoft Academic Search

    R. H. Foy; C. E. Gibson

    1982-01-01

    The relationship between photosynthetic rate and irradiance was measured for 20 strains of blue-green algae from the genera Anabaena, Aphanizomenon and Oscillatoria. Cells were grown at 20°C under 6:18 light-dark at 30 or 150 µE m s. Under high light the mean light saturated rate of photosynthesis (Pmax) of the Oscillatoria cultures was 14·8 mg O2 mg Chl a h,

  15. Variation in the Fine Structure of a Marine Achromobacter and a Marine Pseudomonad Grown Under Selected Nutritional and Temperature Regimes

    PubMed Central

    Wiebe, William J.; Chapman, George B.

    1968-01-01

    Certain features of the fine structure of a marine achromobacter and a marine pseudomonad were dependent upon the conditions of growth. Cells of achromobacter grown at 10 C in a low peptone-seawater (SW) medium displayed the characteristic morphology of the achromobacter: a regularly undulant outer element of the cell wall and a planar inner element, tightly packed ribonucleoprotein (RNP) particles in the cytoplasm, deoxyribonucleic acid (DNA) disposed in a lobate manner, and dense inclusion bodies. Few mesosomes, however, were seen. Cells of achromobacter grown at 10 C in a high peptone-SW medium had larger and more highly organized mesosomes. At 22 C, in a low peptone-SW medium, no mesosomes were seen, but the inclusions were more frequently seen and were larger in the achromobacter cells. At 22 C, in a high peptone-SW medium, these cells revealed the greatest variation in cellular morphology. They contained both small and large mesosomes, or no mesosomes, and both small and large inclusions, or no inclusions. Pseudomonad cells at 10 C in a low peptone-SW medium revealed a typical gram-negative morphology: double-layered, irregularly undulant cell wall; more nearly planar cytoplasmic membrane; densely stained, lightly packed RNP particles; finely fibrillar, axially disposed DNA; simple mesosomes. At 10 C, in a high peptone-SW medium, pseudomonad cells revealed associated strands of material and intracytoplasmic ringlike structures. At 22 C, in a low peptone-SW medium, pseudomonad cells had a more undulant cell-wall and a more nearly planar cytoplasmic membrane. At 22 C, in a high peptone-SW medium, these cells revealed prominent blebs of the cell wall. Images PMID:5650088

  16. Enhanced Productivity of a Lutein-Enriched Novel Acidophile Microalga Grown on Urea

    PubMed Central

    Casal, Carlos; Cuaresma, Maria; Vega, Jose Maria; Vilchez, Carlos

    2011-01-01

    Coccomyxa acidophila is an extremophile eukaryotic microalga isolated from the Tinto River mining area in Huelva, Spain. Coccomyxa acidophila accumulates relevant amounts of ?-carotene and lutein, well-known carotenoids with many biotechnological applications, especially in food and health-related industries. The acidic culture medium (pH < 2.5) that prevents outdoor cultivation from non-desired microorganism growth is one of the main advantages of acidophile microalgae production. Conversely, acidophile microalgae growth rates are usually very low compared to common microalgae growth rates. In this work, we show that mixotrophic cultivation on urea efficiently enhances growth and productivity of an acidophile microalga up to typical values for common microalgae, therefore approaching acidophile algal production towards suitable conditions for feasible outdoor production. Algal productivity and potential for carotenoid accumulation were analyzed as a function of the nitrogen source supplied. Several nitrogen conditions were assayed: nitrogen starvation, nitrate and/or nitrite, ammonia and urea. Among them, urea clearly led to the best cell growth (~4 × 108 cells/mL at the end of log phase). Ammonium led to the maximum chlorophyll and carotenoid content per volume unit (220 ?g·mL·1 and 35 ?g·mL·1, respectively). Interestingly, no significant differences in growth rates were found in cultures grown on urea as C and N source, with respect to those cultures grown on nitrate and CO2 as nitrogen and carbon sources (control cultures). Lutein accumulated up to 3.55 mg·g·1 in the mixotrophic cultures grown on urea. In addition, algal growth in a shaded culture revealed the first evidence for an active xanthophylls cycle operative in acidophile microalgae. PMID:21339944

  17. Characteristics of Candida albicans Biofilms Grown in a Synthetic Urine Medium?

    PubMed Central

    Uppuluri, Priya; Dinakaran, Hemamalini; Thomas, Derek P.; Chaturvedi, Ashok K.; Lopez-Ribot, Jose L.

    2009-01-01

    Urinary tract infections (UTIs) are the most common type of nosocomial infection, and Candida albicans is the most frequent organism causing fungal UTIs. Presence of an indwelling urinary catheter represents a significant risk factor for UTIs. Furthermore, these infections are frequently associated with the formation of biofilms on the surface of these catheters. Here, we describe the characterization of C. albicans biofilms formed in vitro using synthetic urine (SU) medium and the frequently used RPMI medium and compare the results. Biofilms of C. albicans strain SC5314 were formed in 96-well microtiter plates and on silicon elastomer pieces using both SU and RPMI media. Biofilm formation was monitored by microscopy and a colorimetric XTT [2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] reduction assay. As in biofilms grown in RPMI medium, time course studies revealed that biofilm formation using SU medium occurred after an initial adherence phase, followed by growth, proliferation, and maturation. However, microscopy techniques revealed that the architectural complexity of biofilms formed in SU medium was lower than that observed for those formed using RPMI medium. In particular, the level of filamentation of cells within the biofilms formed in SU medium was diminished compared to those in the biofilms grown in RPMI medium. This observation was also corroborated by expression profiling of five filamentation-associated genes using quantitative real-time reverse transcriptase PCR. Sessile C. albicans cells were resistant to fluconazole and amphotericin B, irrespective of the medium used to form the biofilms. However, caspofungin exhibited potent in vitro activity at therapeutic levels against C. albicans biofilms grown in both SU and RPMI media. PMID:19794044

  18. Defect studies in 4H- Silicon Carbide PVT grown bulk crystals, CVD grown epilayers and devices

    NASA Astrophysics Data System (ADS)

    Byrappa, Shayan M.

    Silicon Carbide [SiC] which exists as more than 200 different polytypes is known for superior high temperature and high power applications in comparison to conventional semiconductor materials like Silicon and Germanium. The material finds plethora of applications in a diverse fields due to its unique properties like large energy bandgap, high thermal conductivity and high electric breakdown field. Though inundated with superior properties the potential of this material has not been utilized fully due to impeding factors such as defects especially the crystalline ones which limit their performance greatly. Lots of research has been going on for decades to reduce these defects and there has been subsequent improvement in the quality as the diameter of SiC commercial wafers has reached 150mm from 25mm since its inception. The main focus of this thesis has been to study yield limiting defect structures in conjunction with several leading companies and national labs using advanced characterization tools especially the Synchrotron source. The in depth analysis of SiC has led to development of strategies to reduce or eliminate the density of defects by studying how the defects nucleate, replicate and interact in the material. The strategies discussed to reduce defects were proposed after careful deliberation and analysis of PVT grown bulk crystals and CVD grown epilayers. Following are some of the results of the study: [1] Macrostep overgrowth mechanism in SiC was used to study the deflection of threading defects onto the basal plane resulting in stacking faults. Four types of stacking faults associated with deflection of c/c+a threading defects have been observed to be present in 76mm, 100mm and 150mm diameter wafers. The PVT grown bulk crystals and CVD grown epilayers in study were subjected to contrast studies using synchrotron white beam X-ray topography [SWBXT]. The SWBXT image contrast studies of these stacking faults with comparison of calculated phase shifts for postulated fault vectors by macrostep overgrowth of surface outcrops, has revealed faults to be of four types of which one of the following are discussed in detail which is the Shockley faults. The fault vector were determined by taking into account the contrast from stacking faults in SWBXT undergoing phase shift as the X-ray wave fields cross the fault plane. The deflected dislocations onto the basal plane were responsible for the stacking faults and were observed to be detrimental to the devices grown on them as they replicate to the epilayer. In the wafers studied at different stages of the SiC crystal boule resulted in reduction of threading defects as they at certain stage get deflected out of the crystal causing drop of defects density. [2] A novel technique known as the Ray Tracing Simulation was used to determine the sense of c/c+a dislocations obtained via Grazing-Incidence X-ray Topography. Determination of the complete sense and burgers vector of these dislocations was very important to augment our proposed models on stacking faults associated with these defects. Orientation contrast mechanism in X- ray diffraction topography was previously determined to be the dominant factor in SiC by our group and the same principles were used for the simulation. The results were surmised after extensive comparison between experimental and simulation images for the c+2a defects. [3] With the BPD density down to a record level of few hundred per square centimeter in several wafers in multiple regions made it possible to observe the conversion of sessile Threading Edge Dislocations [TED] to glissile BPDs with this repeating multiple times. Previously the high density of Basal Plane Dislocations [BPD] prevented from discerning the details accurately in the SiC images taken by SWBXT. The contribution of SWBXT in accurately categorizing the nature of dislocations in SiC has enabled the crystal growth community to incorporate strategies to mitigate their influence. One of them has been recognizing BPDs as deformation induced defects which have led to the development of

  19. Influence of growth conditions on the composition of cell wall polysaccharides from cultured tobacco cells

    Microsoft Academic Search

    W. Blaschek; G. Franz

    1983-01-01

    The sugar composition of cell wall polysaccharides of two tobacco varieties obtained from mesophyll, regenerating protoplasts and cells grown under various conditions were compared. Regenerating protoplasts developed an unusual cell wall with a low cellulose and a high non-cellulosic glucan content. In the presence of different phytohormones compact and friable calli were obtained with cell walls containing low and high

  20. Counting Legionella cells within single amoeba host cells

    EPA Science Inventory

    Here we present the first attempt to quantify L. pneumophila cell numbers within individual amoebae hosts that may be released into engineered water systems. The maximum numbers of culturable L. pneumophila cells grown within Acanthamoeba polyphaga and Naegleria fowleri were 134...

  1. Counting Legionella cells within single amoeba host cells.

    PubMed

    Buse, Helen Y; Ashbolt, Nicholas J

    2012-03-01

    Here we present the first attempt to quantify Legionella pneumophila cell numbers within individual amoeba hosts that may be released into engineered water systems. The maximum numbers of culturable L. pneumophila cells grown within Acanthamoeba polyphaga and Naegleria fowleri were 1,348 (mean, 329) and 385 (mean, 44) CFU trophozoite(-1), respectively. PMID:22226955

  2. Growth and photosynthetic responses of wheat plants grown in space

    NASA Technical Reports Server (NTRS)

    Tripathy, B. C.; Brown, C. S.; Levine, H. G.; Krikorian, A. D.

    1996-01-01

    Growth and photosynthesis of wheat (Triticum aestivum L. cv Super Dwarf) plants grown onboard the space shuttle Discovery for 10 d were examined. Compared to ground control plants, the shoot fresh weight of space-grown seedlings decreased by 25%. Postflight measurements of the O2 evolution/photosynthetic photon flux density response curves of leaf samples revealed that the CO2-saturated photosynthetic rate at saturating light intensities in space-grown plants declined 25% relative to the rate in ground control plants. The relative quantum yield of CO2-saturated photosynthetic O2 evolution measured at limiting light intensities was not significantly affected. In space-grown plants, the light compensation point of the leaves increased by 33%, which likely was due to an increase (27%) in leaf dark-respiration rates. Related experiments with thylakoids isolated from space-grown plants showed that the light-saturated photosynthetic electron transport rate from H2O through photosystems II and I was reduced by 28%. These results demonstrate that photosynthetic functions are affected by the microgravity environment.

  3. Diversity in Butane Monooxygenases among Butane-Grown Bacteria

    PubMed Central

    Hamamura, Natsuko; Storfa, Ryan T.; Semprini, Lewis; Arp, Daniel J.

    1999-01-01

    Butane monooxygenases of butane-grown Pseudomonas butanovora, Mycobacterium vaccae JOB5, and an environmental isolate, CF8, were compared at the physiological level. The presence of butane monooxygenases in these bacteria was indicated by the following results. (i) O2 was required for butane degradation. (ii) 1-Butanol was produced during butane degradation. (iii) Acetylene inhibited both butane oxidation and 1-butanol production. The responses to the known monooxygenase inactivator, ethylene, and inhibitor, allyl thiourea (ATU), discriminated butane degradation among the three bacteria. Ethylene irreversibly inactivated butane oxidation by P. butanovora but not by M. vaccae or CF8. In contrast, butane oxidation by only CF8 was strongly inhibited by ATU. In all three strains of butane-grown bacteria, specific polypeptides were labeled in the presence of [14C]acetylene. The [14C]acetylene labeling patterns were different among the three bacteria. Exposure of lactate-grown CF8 and P. butanovora and glucose-grown M. vaccae to butane induced butane oxidation activity as well as the specific acetylene-binding polypeptides. Ammonia was oxidized by all three bacteria. P. butanovora oxidized ammonia to hydroxylamine, while CF8 and M. vaccae produced nitrite. All three bacteria oxidized ethylene to ethylene oxide. Methane oxidation was not detected by any of the bacteria. The results indicate the presence of three distinct butane monooxygenases in butane-grown P. butanovora, M. vaccae, and CF8. PMID:10508093

  4. Diversity in butane monooxygenases among butane-grown bacteria.

    PubMed

    Hamamura, N; Storfa, R T; Semprini, L; Arp, D J

    1999-10-01

    Butane monooxygenases of butane-grown Pseudomonas butanovora, Mycobacterium vaccae JOB5, and an environmental isolate, CF8, were compared at the physiological level. The presence of butane monooxygenases in these bacteria was indicated by the following results. (i) O(2) was required for butane degradation. (ii) 1-Butanol was produced during butane degradation. (iii) Acetylene inhibited both butane oxidation and 1-butanol production. The responses to the known monooxygenase inactivator, ethylene, and inhibitor, allyl thiourea (ATU), discriminated butane degradation among the three bacteria. Ethylene irreversibly inactivated butane oxidation by P. butanovora but not by M. vaccae or CF8. In contrast, butane oxidation by only CF8 was strongly inhibited by ATU. In all three strains of butane-grown bacteria, specific polypeptides were labeled in the presence of [(14)C]acetylene. The [(14)C]acetylene labeling patterns were different among the three bacteria. Exposure of lactate-grown CF8 and P. butanovora and glucose-grown M. vaccae to butane induced butane oxidation activity as well as the specific acetylene-binding polypeptides. Ammonia was oxidized by all three bacteria. P. butanovora oxidized ammonia to hydroxylamine, while CF8 and M. vaccae produced nitrite. All three bacteria oxidized ethylene to ethylene oxide. Methane oxidation was not detected by any of the bacteria. The results indicate the presence of three distinct butane monooxygenases in butane-grown P. butanovora, M. vaccae, and CF8. PMID:10508093

  5. Entrapment of Bacteria in Fluid Inclusions in Laboratory-Grown Halite

    NASA Astrophysics Data System (ADS)

    Adamski, James C.; Roberts, Jennifer A.; Goldstein, Robert H.

    2006-08-01

    Cells of the bacterium Pseudomonas aeruginosa, which were genetically modified to produce green fluorescent protein, were entrapped in fluid inclusions in laboratory-grown halite. The bacteria were used to inoculate NaCl-saturated aqueous solutions, which were allowed to evaporate and precipitate halite. The number, size, and distribution of fluid inclusions were highly variable, but did not appear to be affected by the presence of the bacteria. Many of the inclusions in crystals from inoculated solutions contained cells in populations ranging from two to 20. Microbial attachment to crystal surfaces was neither evident nor necessary for entrapment. Cells occurred exclusively within fluid inclusions and were not present in the crystal matrix. In both the inclusions and the hypersaline solution, the cells fluoresced and twitched, which indicates that the bacteria might have remained viable after entrapment. The fluorescence continued up to 13 months after entrapment, which indicates that little degradation of the bacteria occurred over that time interval. The entrapment, fluorescence, and preservation of cells were independent of the volume of hypersaline solution used or whether the solutions were completely evaporated prior to crystal extraction. The results of this study have a wide range of implications for the long-term survival of microorganisms in fluid inclusions and their detection through petrography. The results also demonstrate the preservation potential for microbes in hypersaline fluid inclusions, which could allow cells to survive harsh conditions of space, the deep geologic past, or burial in sedimentary basins.

  6. Characteristics of GaSb and GaInSb layers grown by metalorganic vapor phase epitaxy

    SciTech Connect

    Ehsani, H.; Bhat, I.; Hitchcock, C.; Borrego, J.; Gutmann, R. [Rensselaer Polytechnic Inst., Troy, NY (United States)

    1995-07-01

    GaInSb and GaSb layers have been grown on GaSb and GaAs substrates using metalorganic vapor phase epitaxy (MOVPE) with trimethylgallium, trimethylindium and trimethylantimony as the sources. As grown layers are p type with the carrier concentration in the mid 10{sup 16} cm{sup {minus}3} range. N type layers are grown using diethyltellurium as the Te source. Incorporation of Te in high concentration showed compensation and secondary ion mass spectrometry (SIMS) result showed that only 2.5% of Te are active when 2 {times} 10{sup 19} cm{sup {minus}3} of Te was incorporated. The carrier concentration measured in n type samples increases as the temperature is lowered. This is explained by the presence of second band close to the conduction band minima. Silane which is a common n type dopant in GaAs and other III-V systems is shown to behave like p type in GaInSb. P-n junction structures have been grown on GaSb substrates to fabricate TPV cells.

  7. Anatomical features of pepper plants (Capsicum annuum L.) grown under red light-emitting diodes supplemented with blue or far-red light

    NASA Technical Reports Server (NTRS)

    Schuerger, A. C.; Brown, C. S.; Stryjewski, E. C.

    1997-01-01

    Pepper plants (Capsicum annuum L. cv., Hungarian Wax) were grown under metal halide (MH) lamps or light-emitting diode (LED) arrays with different spectra to determine the effects of light quality on plant anatomy of leaves and stems. One LED (660) array supplied 90% red light at 660 nm (25nm band-width at half-peak height) and 1% far-red light between 700-800nm. A second LED (660/735) array supplied 83% red light at 660nm and 17% far-red light at 735nm (25nm band-width at half-peak height). A third LED (660/blue) array supplied 98% red light at 660nm, 1% blue light between 350-550nm, and 1% far-red light between 700-800nm. Control plants were grown under broad spectrum metal halide lamps. Plants were gron at a mean photon flux (300-800nm) of 330 micromol m-2 s-1 under a 12 h day-night photoperiod. Significant anatomical changes in stem and leaf morphologies were observed in plants grown under the LED arrays compared to plants grown under the broad-spectrum MH lamp. Cross-sectional areas of pepper stems, thickness of secondary xylem, numbers of intraxylary phloem bundles in the periphery of stem pith tissues, leaf thickness, numbers of choloplasts per palisade mesophyll cell, and thickness of palisade and spongy mesophyll tissues were greatest in peppers grown under MH lamps, intermediate in plants grown under the 660/blue LED array, and lowest in peppers grown under the 660 or 660/735 LED arrays. Most anatomical features of pepper stems and leaves were similar among plants grown under 660 or 660/735 LED arrays. The effects of spectral quality on anatomical changes in stem and leaf tissues of peppers generally correlate to the amount of blue light present in the primary light source.

  8. Generation of dendritic cell-based vaccines for cancer therapy

    Microsoft Academic Search

    G Reinhard; A Märten; S M Kiske; F Feil; T Bieber; I G H Schmidt-Wolf; IGH Schmidt-Wolf

    2002-01-01

    Dendritic cells play a major role in the generation of immunity against tumour cells. They can be grown under various culture conditions, which influence the phenotypical and functional properties of dendritic cells and thereby the consecutive immune response mainly executed by T cells. Here we discuss various conditions, which are important during generation and administration of dendritic cells to elicit

  9. Gravity, chromosomes, and organized development in aseptically cultured plant cells

    NASA Technical Reports Server (NTRS)

    Krikorian, Abraham D.

    1993-01-01

    The objectives of the PCR experiment are: to test the hypothesis that microgravity will in fact affect the pattern and developmental progression of embryogenically competent plant cells from one well-defined, critical stage to another; to determine the effects of microgravity in growth and differentiation of embryogenic carrot cells grown in cell culture; to determine whether microgravity or the space environment fosters an instability of the differentiated state; and to determine whether mitosis and chromosome behavior are adversely affected by microgravity. The methods employed will consist of the following: special embryogenically competent carrot cell cultures will be grown in cell culture chambers provided by NASDA; four cell culture chambers will be used to grow cells in liquid medium; two dishes (plant cell culture dishes) will be used to grow cells on a semi-solid agar support; progression to later embryonic stages will be induced in space via crew intervention and by media manipulation in the case of liquid grown cell cultures; progression to later stages in case of semi-solid cultures will not need crew intervention; embryo stages will be fixed at a specific interval (day 6) in flight only in the case of liquid-grown cultures; and some living cells and somatic embryos will be returned for continued post-flight development and 'grown-out.' These will derive from the semi-solid grown cultures.

  10. Characterization of cell lines stably transfected with rubella virus replicons

    SciTech Connect

    Tzeng, Wen-Pin; Xu, Jie [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States)] [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States); Frey, Teryl K., E-mail: tfrey@gsu.edu [Department of Biology, Georgia State University, P.O. Box 4010, Atlanta GA 30302-4010 (United States)

    2012-07-20

    Rubella virus (RUBV) replicons expressing a drug resistance gene and a gene of interest were used to select cell lines uniformly harboring the replicon. Replicons expressing GFP and a virus capsid protein GFP fusion (C-GFP) were compared. Vero or BHK cells transfected with either replicon survived drug selection and grew into a monolayer. However, survival was {approx}9-fold greater following transfection with the C-GFP-replicon than with the GFP-expressing replicon and while the C-GFP-replicon cells grew similarly to non-transfected cells, the GFP-replicon cells grew slower. Neither was due to the ability of the CP to enhance RNA synthesis but survival during drug selection was correlated with the ability of CP to inhibit apoptosis. Additionally, C-GFP-replicon cells were not cured of the replicon in the absence of drug selection. Interferon-alpha suppressed replicon RNA and protein synthesis, but did not cure the cells, explaining in part the ability of RUBV to establish persistent infections.

  11. Chloroform cometabolism by butane-grown CF8, Pseudomonas butanovora, and Mycobacterium vaccae JOB5 and methane-grown Methylosinus trichosporium

    E-print Network

    Semprini, Lewis

    Chloroform cometabolism by butane-grown CF8, Pseudomonas butanovora, and Mycobacterium vaccae JOB5 AND ENVIRONMENTAL MICROBIOLOGY 63 (9): 3607-3613 SEP 1997 Abstract: Chloroform (CF) degradation by a butane-grown enrichment culture, CF8, was compared to that by butane-grown Pseudomonas butanovora and Mycobacterium vaccae

  12. Effect of temperature on the growth and cell wall chemistry of a facultative thermophilic Bacillus.

    PubMed

    Novitsky, T J; Chan, M; Himes, R H; Akagi, J M

    1974-02-01

    The morphology and cell wall composition of Bacillus coagulans, a facultative thermophile, were examined as a function of growth temperature. The morphology of the organism varied when it was grown at different temperatures; at 37 C the organism grew as individual cells which increased in length with increasing growth temperature. At 55 C it grew in long chains of cells. Cell wall prepared from cells grown at 37 C contained 44% teichoic acid by weight, whereas cells grown at 55 C contained 29% teichoic acid. Teichoic acid from these cells was a polymer of glycerol phosphate containing galactose and ester alanine. The ratio of ester alanine to phosphate was significantly higher in cell walls and teichoic acid from 37 C-grown cells compared with those from 55 C-grown cells. Other differences observed were that cells grown at 55 C contained a lower level of autolytic ability, produced cell walls which bound more Mg(2+), and contained less peptide cross-bridging in its peptidoglycan layer than cells grown at 37 C. PMID:4129996

  13. Changes in the antenna size of Photosystem I and Photosystem II in Synechococcus sp. strain PCC 7942 grown in the presence of SANDOZ 9785 — a Photosystem II inhibitor

    Microsoft Academic Search

    Madhulika Srivastava; Devaki Bhaya; Salil Bose

    1994-01-01

    SANDOZ 9785, also known as BASF 13.338, is a pyridazinone derivative that inhibits Photosystem II (PS II) activity leading to an imbalance in the rate of electron transport through the photosystems. Synechococcus sp. strain PCC 7942 cells grown in the presence of sublethal concentration of SANDOZ 9785 (SAN 9785) for 48 hours exhibited a 20% decrease in Chl a per

  14. Mouse Lymphoma Cells with Different Radiosensitivities

    Microsoft Academic Search

    P. Alexander

    1961-01-01

    FISCHER1 devised a medium in which murine leukæmia cells (L 5178 Y) can be grown in free culture starting from a single cell. These cells have retained their strain specificity and they will grow only in DBA\\/2 mice where they give rise to ascites and solid tumours. A logarithmically growing culture was obtained 24 hr. after transfer of the ascites

  15. Increased Production of Tumor Necrosis Factor-a by Glial Cells Exposed to Simulated Ischemia or Elevated Hydrostatic Pressure Induces Apoptosis in Cocultured Retinal Ganglion Cells

    Microsoft Academic Search

    Gulgun Tezel; Martin B. Wax

    2000-01-01

    Although glial cells in the optic nerve head undergo a reactivation process in glaucoma, the role of glial cells during glaucomatous neurodegeneration of retinal ganglion cells is unknown. Using a coculture system in which retinal ganglion cells and glial cells are grown on different layers but share the same culture medium, we studied the influences of glial cells on survival

  16. Uptake of human pharmaceuticals by plants grown under hydroponic conditions

    Microsoft Academic Search

    Patrick A. Herklotz; Prakash Gurung; Brian Vanden Heuvel; Chad A. Kinney

    2010-01-01

    Cabbage (Brassica rapa var. pekinensis) and Wisconsin Fast Plants (Brassica rapa) were chosen for a proof of concept study to determine the potential uptake and accumulation of human pharmaceuticals by plants. These plants were grown hydroponically under high-pressure sodium lamps in one of two groups including a control and test group exposed to pharmaceuticals. The control plants were irrigated with

  17. Dieldrin uptake by vegetable crops grown in contaminated soils

    Microsoft Academic Search

    Lucia Donnarumma; Valter Pompi; Alessandro Faraci; Elisa Conte

    2009-01-01

    The aim of these trials was to study the distribution of dieldrin in soil and its translocation to roots and the aerial parts of vegetable crops grown in greenhouses and fields. The main objectives were to characterize dieldrin accumulation in plant tissues in relation to the levels of soil contamination; uptake capability among plants belonging to different species, varieties and

  18. Yield performance of cowpea plant introductions grown in calcareous soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cowpea or Southernpea [Vigna unguiculata (L.) Walp.] is an important legume crop used as a feed for livestock, as a green vegetable and for consumption of its dry beans which provide 22-25% protein. The crop is very sensitive to alkaline soil conditions. When grown at a soil pH of 7.5 or higher, co...

  19. Phenolic Content and Antioxidant Capacities of Alabama – Grown Thornless Blackberries

    Microsoft Academic Search

    Ming-Wei S. Kao; Floyd M. Woods; William A. Dozier; Robert C. Ebel; Monte Nesbitt; Junbae Jee; Deacue Fields

    2008-01-01

    Total phenolics (TPH), flavonoids (TF), monomeric anthocyanins (ACY), and Vitamin C Equivalent Antioxidant Capacities (VCEAC) utilizing ABTS and DPPH radical scavenging assays were determined for five fully ripened blackberries cultivars (‘Loch Ness’, ‘Navaho’, ‘Arapaho’, ‘Apache’, and ‘Triple Crown’) of Rubus spp. grown in Alabama. The ABTS and DPPH methods were highly correlated (R?=?0.897) and the ABTS method was better for

  20. Scanning tunneling spectroscopy of chemical vapor deposition grown graphene

    Microsoft Academic Search

    Daniel Cormode; Collin Reynolds; Brian Leroy

    2011-01-01

    The electronic properties of CVD grown graphene were investigated by scanning tunneling microscopy. Mono and multi layered samples were prepared by growth on copper and transferred to 300 nm SiO2 substrates. Raman spectroscopy mapping was used to determine the thickness of the samples as well as characterize regions of higher disorder as evidenced by an increased D peak. The samples

  1. STM and STS studies of CVD grown graphene nanoribbons

    Microsoft Academic Search

    Xiaoting Jia; Minghu Pan; Sreekar Bhaviripudi; Vincent Meunier; Jing Kong; Mildred Dresselhaus

    2011-01-01

    Graphene nanoribbons (GNRs) are quasi one dimensional structures which have unique transport properties, and have a potential to open a bandgap at small ribbon widths. They have been extensively studied in recent years due to their high potential for future electronics applications. We have experimentally found some GNRs in our CVD grown graphene layers. In this work, we investigated the

  2. Yield performance of cowpea genotypes grown in alkaline soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cowpea or Southernpea [Vigna unguiculata (L.) Walp.] is an important legume crop used as a feed for livestock, as a green vegetable and for consumption of its dry beans which provide 22-25% protein. The crop is very sensitive to alkaline soil conditions. When grown at soil pH of 7.5 or higher, cowp...

  3. Textured strontium ferrite thin films grown by PLD

    Microsoft Academic Search

    T Garc??a; E. de Posada; L. Ponce; J. L. Sanchez; S D??az; E. Pedrero; F. Fernandez; P. Bartolo-Perez; J. L. Pena; R. Diamant; J. A. M. Pereira

    2001-01-01

    Textured strontium ferrite thin films has been grown at room temperature using a Nd:YAG laser. The spectroscopic study of the produced plasma revealed that the expansion velocities of the species are of the order of 106 cm\\/s, which could explain the obtained texture. The stoichiometric analysis shows a small oxygen reduction in the films due to the absence of a

  4. MBE-grown InGaAs photocathodes

    Microsoft Academic Search

    Loig E. Bourree; David R. Chasse; P. L. Stephan Thamban; Robert Glosser

    2003-01-01

    The material constitution of modern photocathodes (i.e. third generation) has remained a constant for almost two decades. The active GaAs layer is grown by metal organic chemical vapor deposition (MOCVD) and processed to create a negative electron affinity (NEA) surface for photoemission. Thus, these types of cathodes are limited in their spectral response by the band gap energy of the

  5. Spectrophotometric phytochrome measurements in light-grown Avena sativa L

    Microsoft Academic Search

    Merten Jabben I; Gerald F. Deitzer

    1978-01-01

    Phytochrome was studied spectrophotometrically in Avena sativa L. seedlings that had been grown for 6 d in continous white fluorescent light from lamps. Greening was prevented through the use of the herbicide San 9789. When placed in the light, phytochrome (Ptot) decreased with first order kinetics (t1\\/2 ˜ 2 h) but reached a stable low level (˜2.5% of the dark

  6. Assessment of virus infection in cultured cells using metabolic monitoring.

    PubMed

    Singhvi, R; Markusen, J F; Ky, B; Horvath, B J; Aunins, J G

    1996-01-01

    A rapid, in-process assessment of virus replication is disired to quickly investigate the effects of process parameters on virus infection, and to monitor consistency of process in routine manufacturing of viral vaccines. Live virus potency assays are generally based on plaque formation, cytopathic effect, or antigen production (TCID(50)) and can take days to weeks to complete. Interestingly, when infected with viruses, cultured cells undergo changes in cellular metabolism that can be easily measured. These phenomena appear to be common as they has been observed in a variety of virus-host systems, e.g., in insect cells infected with baculovirus, Vero cells infected with Rotavirus, MRC-5 cells infected with Hepatitis A virus, and MRC-5 cells infected with the Varicella Zoster Virus (VZV). In this article, changes in glycolytic metabolism of MRC-5 cells as a result of CVZ infection are described. Both glucose consumption and lactate production in VZV infected MRC-5 cells are significantly elevated in comparison to uninfected cells. Based on this result, a rapid, in-process assay to follow VZV infection has been developed. The relative increase in lactate production in infected cells (?) increases as the infection progresses and then plateaus as the infection peaks. This plateau correlates with time of peak virus titer and could be used as a harvest triggering parameter in a virus production process.X(u) = cell density of uninfected cellsX(i) = cell density of infected cellsX(T) = total cell densityL(i) = cumulative lactate production in infected culturesL(u) = cumulative lactate production in uninfected culturesq(Li) = specific lactate production of infected cellsq(Lu) = specific lactate production of uninfected cellsk(1), K(2) = constants. PMID:22358917

  7. Activities of drug combinations against Mycobacterium tuberculosis grown in aerobic and hypoxic acidic conditions.

    PubMed

    Piccaro, Giovanni; Giannoni, Federico; Filippini, Perla; Mustazzolu, Alessandro; Fattorini, Lanfranco

    2013-03-01

    Mycobacterium tuberculosis is exposed to hypoxia and acidity within granulomatous lesions. In this study, an acidic culture model of M. tuberculosis was used to test drug activity against aerobic 5-day-old (A5) and hypoxic 5-, 12-, and 19-day-old (H5, H12, and H19, respectively) bacilli after 7, 14, and 21 days of exposure. In A cultures, CFU and pH rapidly increased, while in H cultures growth stopped and pH increased slightly. Ten drugs were tested: rifampin (R), isoniazid (I), pyrazinamide (Z), ethambutol (E), moxifloxacin (MX), amikacin (AK), metronidazole (MZ), nitazoxanide (NZ), niclosamide (NC), and PA-824 (PA). Rifampin was the most active against A5, H5, H12, and H19 bacilli. Moxifloxacin and AK efficiently killed A5 and H5 cells, I was active mostly against A5 cells, Z was most active against H12 and H19 cells, and E showed low activity. Among nitrocompounds, NZ, NC, and PA were effective against A5, H5, H12, and H19 cells, while MZ was active against H12 and H19 cells. To kill all A and H cells, A5- and H5-active agents R, MX, and AK were used in combination with MZ, NZ, NC, or PA, in comparison with R-I-Z-E, currently used for human therapy. Mycobacterial viability was determined by CFU and a sensitive test in broth (day to positivity, MGIT 960 system). As shown by lack of regrowth in MGIT, the most potent combination was R-MX-AK-PA, which killed all A5, H5, H12, and H19 cells in 14 days. These observations demonstrate the sterilizing effect of drug combinations against cells of different M. tuberculosis stages grown in aerobic and hypoxic acidic conditions. PMID:23295931

  8. Anti-idiotypic antibodies mimicking glycoprotein D of herpes simplex virus identify a cellular protein required for virus spread from cell to cell and virus-induced polykaryocytosis.

    PubMed Central

    Huang, T; Campadelli-Fiume, G

    1996-01-01

    Glycoprotein D (gD) of herpes simplex virus 1 (HSV-1) is required for stable attachment and penetration of the virus into susceptible cells after initial binding. We derived anti-idiotypic antibodies to the neutralizing monoclonal antibody HD1 to gD of HSV-1. These antibodies have the properties expected of antibodies against a gD receptor. Specifically, they bind to the surface of HEp-2, Vero, and HeLa cells susceptible to HSV infection and specifically react with a Mr 62,000 protein in these and other (143TK- and BHK) cell lines. They neutralize virion infectivity, drastically decrease plaque formation by impairing cell-to-cell spread of virions, and reduce polykaryocytosis induced by strain HFEM, which carries a syncytial (syn-) mutation. They do not affect HSV growth in a single-step cycle and plaque formation by an unrelated virus, indicating that they specifically affect the interaction of HSV gD) with a cell surface receptor. We conclude that the Mr 62,000 cell surface protein interacts with gD to enable spread of HSV-1 from cell to cell and virus-induced polykaryocytosis. Images Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8700845

  9. A symmetrical bi-electrode electrochemical technique for high-efficiency transfer of CVD-grown graphene

    NASA Astrophysics Data System (ADS)

    Shi, Liangjing; Liu, Yangqiao; Yang, Fan; Gao, Lian; Sun, Jing

    2014-04-01

    Graphene transfer is a critical process in the journey from CVD-grown graphene to device application. The current transfer techniques use a chemical-etching method to oxidize the metal catalyst, which is heavily time-consuming and involves a high material cost. In this study, a highly efficient symmetrical bi-electrode technique has been developed to simultaneously delaminate the CVD-grown graphene from the metal catalyst at both the anode and cathode of the electrolytic cell. Raman spectra, UV-visible transmittance, and four-probe measurements confirm that this transfer process is nondestructive and can produce similar electrical properties to those produced by the conventional metal-etching transfer method. This bi-electrode transfer technique possesses the advantages of high efficiency, recyclable use of metal catalyst, and high electrical conductivity, and it can be potentially applied for industrial applications.

  10. A symmetrical bi-electrode electrochemical technique for high-efficiency transfer of CVD-grown graphene.

    PubMed

    Shi, Liangjing; Liu, Yangqiao; Yang, Fan; Gao, Lian; Sun, Jing

    2014-04-11

    Graphene transfer is a critical process in the journey from CVD-grown graphene to device application. The current transfer techniques use a chemical-etching method to oxidize the metal catalyst, which is heavily time-consuming and involves a high material cost. In this study, a highly efficient symmetrical bi-electrode technique has been developed to simultaneously delaminate the CVD-grown graphene from the metal catalyst at both the anode and cathode of the electrolytic cell. Raman spectra, UV-visible transmittance, and four-probe measurements confirm that this transfer process is nondestructive and can produce similar electrical properties to those produced by the conventional metal-etching transfer method. This bi-electrode transfer technique possesses the advantages of high efficiency, recyclable use of metal catalyst, and high electrical conductivity, and it can be potentially applied for industrial applications. PMID:24633412

  11. Anticancer Activity of Certain Herbs and Spices on the Cervical Epithelial Carcinoma (HeLa) Cell Line

    PubMed Central

    Berrington, Danielle; Lall, Namrita

    2012-01-01

    Acetone extracts of selected plant species were evaluated for their in vitro cytotoxicity against a noncancerous African green monkey kidney (Vero) cell line and an adenocarcinoma cervical cancer (HeLa) cell line. The plants studied were Origanum vulgare L. (Oregano), Rosmarinus officinalis L. (Upright and ground cove rosemary), Lavandula spica L. (Lavender), Laurus nobilis L. (Bay leaf), Thymus vulgaris L. (Thyme), Lavandula x intermedia L. (Margaret Roberts Lavender), Petroselinum crispum Mill. (Curly leaved parsley), Foeniculum vulgare Mill. (Fennel), and Capsicum annuum L. (Paprika). Antioxidant activity was determined using a quantitative DPPH (1,1-diphenyl-2-picryl hydrazyl) assay. The rosemary species exhibited effective radical scavenging capacity with 50% inhibitory concentration (IC50) of 3.48 ± 0.218??g/mL and 10.84 ± 0.125??g/mL and vitamin C equivalents of 0.351?g and 1.09?g for McConnell's Blue and Tuscan Blue, respectively. Cytotoxicity was measured using XTT (Sodium 3?-[1-(phenyl amino-carbonyl)-3,4-tetrazolium]-bis-[4-methoxy-6-nitro] benzene sulfonic acid hydrate) colorimetric assay. Only L. nobilis and O. vulgare exhibited pronounced effects on the HeLa cell line. Dose-dependent studies revealed IC50 of 34.46 ± 0.48??g/mL and 126.3 ± 1.00??g/mL on the HeLa cells and on the Vero cells 124.1??g/mL ± 18.26 and 163.8??g/mL ± 2.95 for L. nobilis and O. vulgare, respectively. Light (eosin and haematoxylin staining) and confocal microscopy (Hoechst 33342, acridine orange, and propidium iodide staining) were used to evaluate the cytotoxic mechanism of action for L. nobilis and O. vulgare. PMID:22649474

  12. Anticancer Activity of Certain Herbs and Spices on the Cervical Epithelial Carcinoma (HeLa) Cell Line.

    PubMed

    Berrington, Danielle; Lall, Namrita

    2012-01-01

    Acetone extracts of selected plant species were evaluated for their in vitro cytotoxicity against a noncancerous African green monkey kidney (Vero) cell line and an adenocarcinoma cervical cancer (HeLa) cell line. The plants studied were Origanum vulgare L. (Oregano), Rosmarinus officinalis L. (Upright and ground cove rosemary), Lavandula spica L. (Lavender), Laurus nobilis L. (Bay leaf), Thymus vulgaris L. (Thyme), Lavandula x intermedia L. (Margaret Roberts Lavender), Petroselinum crispum Mill. (Curly leaved parsley), Foeniculum vulgare Mill. (Fennel), and Capsicum annuum L. (Paprika). Antioxidant activity was determined using a quantitative DPPH (1,1-diphenyl-2-picryl hydrazyl) assay. The rosemary species exhibited effective radical scavenging capacity with 50% inhibitory concentration (IC(50)) of 3.48 ± 0.218??g/mL and 10.84 ± 0.125??g/mL and vitamin C equivalents of 0.351?g and 1.09?g for McConnell's Blue and Tuscan Blue, respectively. Cytotoxicity was measured using XTT (Sodium 3'-[1-(phenyl amino-carbonyl)-3,4-tetrazolium]-bis-[4-methoxy-6-nitro] benzene sulfonic acid hydrate) colorimetric assay. Only L. nobilis and O. vulgare exhibited pronounced effects on the HeLa cell line. Dose-dependent studies revealed IC(50) of 34.46 ± 0.48??g/mL and 126.3 ± 1.00??g/mL on the HeLa cells and on the Vero cells 124.1??g/mL ± 18.26 and 163.8??g/mL ± 2.95 for L. nobilis and O. vulgare, respectively. Light (eosin and haematoxylin staining) and confocal microscopy (Hoechst 33342, acridine orange, and propidium iodide staining) were used to evaluate the cytotoxic mechanism of action for L. nobilis and O. vulgare. PMID:22649474

  13. A red tide alga grown under ocean acidification upregulates its tolerance to lower pH by increasing its photophysiological functions

    NASA Astrophysics Data System (ADS)

    Chen, S.; Beardall, J.; Gao, K.

    2014-09-01

    Phaeocystis globosa, a red tide alga, often forms blooms in or adjacent to coastal waters and experiences changes in pH and seawater carbonate chemistry caused by either diel/periodic fluctuation in biological activity, human activity or, in the longer term, ocean acidification due to atmospheric CO2 rise. We examined the photosynthetic physiology of this species while growing it under different pH levels induced by CO2 enrichment and investigated its acclimation to carbonate chemistry changes under different light levels. Short-term exposure to reduced pHnbs (7.70) decreased the alga's photosynthesis and light use efficiency. However, acclimation to the reduced pH level for 1-19 generations led to recovered photosynthetic activity, being equivalent to that of cells grown under pH 8.07 (control), though such acclimation required a different time span (number of generations) under different light regimes. The low-pH-grown cells increased their contents of chlorophyll and carotenoids with prolonged acclimation to the acidification, with increased photosynthetic quantum yield and decreased non-photochemical quenching. The specific growth rate of the low-pH-grown cells also increased to emulate that grown under the ambient pH level. This study clearly shows that {Phaeocystis globosa} is able to acclimate to seawater acidification by increasing its energy capture and decreasing its non-photochemical energy loss.

  14. A red tide alga grown under ocean acidification up-regulates its tolerance to lower pH by increasing its photophysiological functions

    NASA Astrophysics Data System (ADS)

    Chen, S.-W.; Beardall, J.; Gao, K.-S.

    2014-05-01

    Phaeocystis globosa, a red tide alga, often forms blooms in or adjacent to coastal waters and experiences changes of pH and seawater carbonate chemistry caused by either diel/periodic fluctuation in biological activity, human activity or, in the longer term, ocean acidification due to atmospheric CO2 rise. We examined the photosynthetic physiology of this species while growing it under different pH levels induced by CO2 enrichment and investigated its acclimation to carbonate chemistry changes under different light levels. Short-term exposure to reduced pHnbs (7.70) decreased the alga's photosynthesis and light use efficiency. However, acclimation to the reduced pH level for 1-19 generations led to recovered photosynthetic activity, being equivalent to that of cells grown under pH 8.07 (control), though such acclimation required a different time span (number of generations) under different light regimes. The low-pH grown cells increased their contents of chlorophyll and carotenoids with prolonged acclimation to the acidification, with increased photosynthetic quantum yield and decreased non-photochemical quenching. The specific growth rate of the low-pH grown cells also increased to emulate that grown under the ambient pH level. This study clearly shows that Phaeocystis globosa is able to acclimate to seawater acidification by increasing its energy capture and decreasing its non-photochemcial energy loss.

  15. 23.9% monolithic multijunction solar cell

    Microsoft Academic Search

    G. F. Virshup; B.-C. Chung; J. G. Werthen

    1988-01-01

    A monolithically grown two-junction solar cell has been fabricated which produces 23.9% efficiency under AM1.5 global conditions and 22.3% under AM0 conditions. These are the highest one-sun efficiencies reported to date for both AM0 and AM1.5. The Al.35Ga.65As (1.93 eV) top cell and the GaAs (1.42 eV) bottom cell were grown by metal-organic chemical vapor deposition on GaAs substrates. Cell

  16. Graviperception of lentil seedling roots grown in space (Spacelab D1 Mission).

    PubMed

    Perbal, G; Driss-Ecole, D; Rutin, J; Salle, G

    1987-01-01

    The growth and graviresponsiveness of roots were investigated in lentil seedlings (Lens culinaris L. cv. Verte du Puy) grown (1) in microgravity, (2) on a 1 g centrifuge in space, (3) in microgravity and then placed on the 1 g centrifuge for 3 h, (4) on the ground. Dry seeds were hydrated in space (except for the ground control) and incubated for 25 h at 22 degrees C in darkness. At the end of the experiment, the seedlings were photographed and fixed in glutaraldehyde in a Biorack glove box. Root length was similar for seedlings grown in space and for the ground and the 1 g centrifuge controls. The direction of root growth in the microgravity sample deviated strongly from the initial orientation of the roots of the dry seeds. This deviation could be due to spontaneous curvatures similar to those observed on clinostats. When lentil seedlings were first grown in microgravity for 25 h and then placed on the 1 g centrifuge for 3 h, their roots bent strongly under the effect of the centrifugal acceleration. The amplitude of root curvature on the centrifuge was not significantly different from that observed on ground controls growing in the vertical position and placed in the horizontal position for 3 h. The gravisensitivity of statocytes differentiated in microgravity was similar to that of statocytes differentiated on earth. There were no qualitative differences in the ultrastructural features of the gravisensing cells in microgravity and in the 1 g centrifuge and ground controls. However, the distribution of statoliths in the gravisensing cells was different in microgravity: most of them were observed in the proximal part of these cells. Thus, these organelles were not distributed at random, which is in contradiction with results obtained with clinostats. The distal complex of endoplasmic reticulum in the statocytes was not in contact with the amyloplasts. Contact and pressure of amyloplasts on the tubules were not prerequisites for gravisensing. The results obtained are not in agreement with the hypothesis that the distal endoplasmic reticulum would be the transducer of the action of the statoliths. PMID:11539054

  17. Hyaluronan and proximal tubular cell migration

    Microsoft Academic Search

    TAKAFUMI ITO; JOHN D WILLIAMS; SAPHWAN AL-ASSAF; Glyn O. Phillips; Aled O. Phillips

    2004-01-01

    Hyaluronan and proximal tubular cell migration.BackgroundThe ubiquitous polysaccharide hyaluronan has been associated with both acute renal injury and progressive renal disease. The aim of this study was to examine the effect of hyaluronan on proximal tubular cell migration.MethodsThe proximal tubular cell line, HK-2 cells, were grown in monolayer culture, and cell migration following addition of hyaluronan characterized in an in

  18. Comparative proteomic analysis of genetically modified maize grown under different agroecosystems conditions in Brazil

    PubMed Central

    2013-01-01

    Background Profiling technologies allow the simultaneous measurement and comparison of thousands of cell components without prior knowledge of their identity. In the present study, we used two-dimensional gel electrophoresis combined with mass spectrometry to evaluate protein expression of Brazilian genetically modified maize hybrid grown under different agroecosystems conditions. To this effect, leaf samples were subjected to comparative analysis using the near-isogenic non-GM hybrid as the comparator. Results In the first stage of the analysis, the main sources of variation in the dataset were identified by using Principal Components Analysis which correlated most of the variation to the different agroecosystems conditions. Comparative analysis within each field revealed a total of thirty two differentially expressed proteins between GM and non-GM samples that were identified and their molecular functions were mainly assigned to carbohydrate and energy metabolism, genetic information processing and stress response. Conclusions To the best of our knowledge this study represents the first evidence of protein identities with differentially expressed isoforms in Brazilian MON810 genetic background hybrid grown under field conditions. As global databases on outputs from “omics” analysis become available, these could provide a highly desirable benchmark for safety assessments. PMID:24304660

  19. Genome-wide transcriptome analysis of Clavibacter michiganensis subsp. michiganensis grown in xylem mimicking medium.

    PubMed

    Hiery, Eva; Adam, Susanne; Reid, Stephen; Hofmann, Jörg; Sonnewald, Sophia; Burkovski, Andreas

    2013-12-01

    The interaction between Clavibacter michiganensis subsp. michiganensis with its host, the tomato plant (Solanum lycopersicum), is poorly understood and only few virulence factors are known. While studying of the bacteria in planta is time-consuming and difficult, the analysis in vitro would facilitate research. Therefore, a xylem mimicking medium (XMM) for C. michiganensis subsp. michiganensis was established in this study based on an apoplast medium for Xanthomonas campestris pv. vesicatoria. In contrast to the apoplast medium, XMM contains no sugars, but amino acids which serve as nitrogen and carbon source. As a result, growth in XMM induced transcriptional changes of genes encoding putative sugar, amino acid and iron uptake systems. In summary, mRNA levels of about 8% of all C. michiganensis subsp. michiganensis genes were changed when XMM-grown bacteria were compared to M9 minimal medium-grown cells. Almost no transcriptional changes of genes encoding hydrolytic enzymes were detected, leading to the idea that XMM reflects the situation in the beginning of infection and therefore allows the characterization of virulence factors in this early stage of infection. The addition of the plant wound substance acetosyringone to the XMM medium led to a change in transcript amount, including genes coding for proteins involved in protein transport, iron uptake and regulation processes. PMID:24060828

  20. The plasma membrane proteome of maize roots grown under low and high iron conditions.

    PubMed

    Hopff, David; Wienkoop, Stefanie; Lüthje, Sabine

    2013-10-01

    Iron (Fe) homeostasis is essential for life and has been intensively investigated for dicots, while our knowledge for species in the Poaceae is fragmentary. This study presents the first proteome analysis (LC-MS/MS) of plasma membranes isolated from roots of 18-day old maize (Zea mays L.). Plants were grown under low and high Fe conditions in hydroponic culture. In total, 227 proteins were identified in control plants, whereas 204 proteins were identified in Fe deficient plants and 251 proteins in plants grown under high Fe conditions. Proteins were sorted by functional classes, and most of the identified proteins were classified as signaling proteins. A significant number of PM-bound redox proteins could be identified including quinone reductases, heme and copper-containing proteins. Most of these components were constitutive, and others could hint at an involvement of redox signaling and redox homeostasis by change in abundance. Energy metabolism and translation seem to be crucial in Fe homeostasis. The response to Fe deficiency includes proteins involved in development, whereas membrane remodeling and assembly and/or repair of Fe-S clusters is discussed for Fe toxicity. The general stress response appears to involve proteins related to oxidative stress, growth regulation, an increased rigidity and synthesis of cell walls and adaption of nutrient uptake and/or translocation. This article is part of a Special Issue entitled: Plant Proteomics in Europe. PMID:23353019

  1. Vertically Aligned ZnO Nanorods Grown by Low-Temperature Solution Processing

    NASA Astrophysics Data System (ADS)

    Lee, Sunghee; Roy, Biplab Kumar; Cho, Junghyun

    2013-05-01

    Zinc oxide (ZnO) films consisting of vertically aligned nanorods were hydrothermally grown on a seed layer at 90 °C using two precursors (zinc acetate, zinc nitrate). The microstructures and growth kinetics of ZnO films from various processing conditions were investigated to correlate to photovoltaic (PV) properties. For this, dye-sensitized solar cells (DSSCs) were assembled. Vertically grown nanorods exhibited the (002) out-of-plane texture and its size, alignment, density, and growth rate could be controlled by both solution and seed layer conditions. In particular, the stepwise deposition implemented by changing precursor solution every 2 h exhibited a higher power conversion efficiency (˜2.3% for 1.55-µm-thick ZnO film) than the continuous deposition. The zinc acetate seed layer cured as low as 100 °C enabled the templated growth of ZnO nanorods with an efficiency of ˜1.7% (for thickness of 1.4 µm). This will allow current low-temperature processing to be adopted for the fabrication of low-cost flexible PV devices.

  2. Incorporation of Cu and Al in thin layer silicon grown from Cu-Al-Si

    SciTech Connect

    Wang, T.H.; Ciszek, T.F. [National Renewable Energy Laboratory, 1617 Cole Blvd., Golden, Colorado 80401 (United States of America)

    1997-02-01

    Cu and Al concentrations in silicon thin layers grown from Cu-Al-Si are determined by segregation at the solid-liquid interface, and for the fast diffusing Cu, also at the free silicon surface. Using the multicomponent regular solution model and experimental results, we found that Si-Al and Si-Cu interactions in the liquid solution are repulsive, and Al-Cu interaction is attractive. As a result, Al incorporation as a function of Cu and Al compositions in the growth solution is determined at about 900{degree}C. Up to 0.2{Omega}{center_dot}cm P-type resistivities caused by Al doping are achieved because of suppression of Al incorporation by Cu, yet with a substantial amount of Al still present in the liquid for substrate surface-oxide removal. On the other hand, Cu concentration in the grown layers is reduced by Al in the liquid during growth and by surface segregation after growth. The surface segregation phenomenon can be conveniently used to getter Cu from the bulk of silicon layers so that its concentration ({approximately}10{sup 16}cm{sup {minus}3}) is much lower than its solubility (2.5{times}10{sup 17}cm{sup {minus}3}) at the layer growth temperature and the reported 10{sup 17}cm{sup {minus}3} degradation onset for solar-cell performance. {copyright} {ital 1997 American Institute of Physics.}

  3. Channel length specific broadspectral photosensitivity of robust chemically grown CdS photodetector

    NASA Astrophysics Data System (ADS)

    Sharma, Alka; Kaur, Mandeep; Bhattacharyya, Biplab; Karuppiah, Stalin; Singh, Surinder P.; Senguttuvan, T. D.; Husale, Sudhir

    2015-04-01

    CdS grown by chemical bath deposition (CBD) technique is very simple, robust, economical method and has potential large scale applications in solar cells, photovoltaic, photodetectors, sensors and optoelectronic devices. Here we report channel lengths (CLs) specific broadspectral photoresponse properties of commonly grown robust CdS films by CBD. The broadspectral dependent current flow has been observed in all CLs and the rise and decay times have been measured in milliseconds for visible wavelengths (400-700nm). The rise time curves showed linear dependency when measured for CLs 300, 500 and 700nm and non-linearity was observed for CLs 7?m, 45?m and 350?m. We have noticed that decrease in channel lengths down to nanometers (300 nm) increases the response time. Three steps decay time has been noticed for all CLs. The shorter channels (nm) showed two trends in decay time, small increase for wavelengths <550nm and significant increase for wavelengths >550nm. Finally, CLs specific broadspectral photosensitivity has been investigated which indicates the device geometry and fabrication method play an important role for defining the CdS based photodetectors or simulating the characteristics of a photodetector.

  4. Sludge-Grown Algae for Culturing Aquatic Organisms: Part I. Algal Growth in Sludge Extracts

    PubMed

    Hung; Chiu; Wong

    1996-05-01

    This project is aimed at studying the feasibility of using sewage sludge to prepare culture media for microalgae (Chlorella-HKBU) and the use of the sludge-grown algae as a feed for some aquatic organisms. Part I of the project included results on preparing sludge extracts and their use on algal culture. By comparing two culturing techniques, "aeration" and "shaking," it was noted that both lag and log phases were shortened in the aeration system. A subsequent experiment noted that algal growth subject to aeration rates of 1.0 and 1.5 liters/min had similar lag and log phases. In addition, both aeration rates had a significantly higher (P<0.05) final cell density than that of 0.5 liters/min. A detailed study on the variation of growth conditions on the algal growth was done. The results indicated that pH values of all the cultures declined below 5 at day 12. The removal rates of ammonia N ranged from 62% to 70%. The sludge-grown algae contained a rather substantial amount of heavy metals (&mgr;g/g): Zn 289-581, Cu 443-682, Ni 310-963, Mn 96-126, Cr 25-118, and Fe 438-653. This implied that the rather high levels of heavy metals may impose adverse effects on higher trophic organisms. PMID:8661607

  5. Sludge-grown algae for culturing aquatic organisms: Part I. Algal growth in sludge extracts

    NASA Astrophysics Data System (ADS)

    Hung, K. M.; Chiu, S. T.; Wong, M. H.

    1996-05-01

    This project is aimed at studying the feasibility of using sewage sludge to prepare culture media for microalgae ( Chlorella-HKBU) and the use of the sludge-grown algae as a feed for some aquatic organisms. Part I of the project included results on preparing sludge extracts and their use on algal culture. By comparing two culturing techniques, “aeration” and “shaking,” it was noted that both lag and log phases were shortened in the aeration system. A subsequent experiment noted that algal growth subject to aeration rates of 1.0 and 1.5 liters/min had similar lag and log phases. In addition, both aeration rates had a significantly higher ( P < 0.05) final cell density than that of 0.5 liters/min. A detailed study on the variation of growth conditions on the algal growth was done. The results indicated that pH values of all the cultures declined below 5 at day 12. The removal rates of ammonia N ranged from 62% to 70%. The sludge-grown algae contained a rather substantial amount of heavy metals (µg/g): Zn 289 581, Cu 443 682, Ni 310 963, Mn 96 126, Cr 25 118, and Fe 438 653. This implied that the rather high levels of heavy metals may impose adverse effects on higher trophic organisms.

  6. EFFECT OF PHOSPHORUS CONCENTRATION ON THE GROWTH OF CATTAIL CALLUS CELLS

    EPA Science Inventory

    This investigation examined the growth of Typha latifolia (cattail) callus cells grown in 5 different (0, 11, 22, 33, 44, jg/L(-1) phosphosur concentrations. The cells were grown for two successive subcultures on semi-solid media, and subsequently in suspension culture with the s...

  7. Propagation of Arthropod-Borne Rickettsia spp. in Two Mosquito Cell Lines

    Microsoft Academic Search

    Joyce M. Sakamoto; Abdu F. Azad

    2007-01-01

    Rickettsiae are obligate intracellular alphaproteobacteria that include pathogenic species in the spotted fever, typhus, and transitional groups. The development of a standardized cell line in which diverse rickettsiae can be grown and compared would be highly advantageous to investigate the differences among and between pathogenic and nonpathogenic species of rickettsiae. Although several rickettsial species have been grown in tick cells,

  8. Comparative characteristic of mitochondria ultrastructural organization in Chlorella cells under altered gravity conditions

    Microsoft Academic Search

    A. F. Popova

    2003-01-01

    Results from experiments that used cells from the unicellular alga Chlorella vulgaris (strain Larg-1) grown on a clinostat, demonstrated the occurrence of rearrangements in cellular organelles, including changes in the mitochondrial ultrastructure compared to controls. Changes in mitochondrial structure were observed in auto- and heterotrophic regimes of cells grown in altered gravity conditions, especially in long-term experiments. The mitochondrial rearrangements

  9. THE CELL CYCLE OF SYMBIOTIC CHLORELLA H. THE EFFECT OF CONTINUOUS DARKNESS

    Microsoft Academic Search

    P. J. McAULEY

    1985-01-01

    SUMMARY When green hydra were grown in continuous darkness the mean cell size of their symbiotic algae was smaller than when grown in light and numbers of algae per digestive cell were reduced. The former was due to a reduction in size at which the algae divided, and the latter to a loss of synchrony of algal mitosis with that

  10. Characteristics of the Freshwater Cyanobacterium Microcystis aeruginosa Grown in Iron-Limited Continuous Culture

    PubMed Central

    Dang, T. C.; Fujii, M.; Rose, A. L.; Bligh, M.

    2012-01-01

    A continuous culturing system (chemostat) made of metal-free materials was successfully developed and used to maintain Fe-limited cultures of Microcystis aeruginosa PCC7806 at nanomolar iron (Fe) concentrations (20 to 50 nM total Fe). EDTA was used to maintain Fe in solution, with bioavailable Fe controlled by absorption of light by the ferric EDTA complex and resultant reduction of Fe(III) to Fe(II). A kinetic model describing Fe transformations and biological uptake was applied to determine the biologically available form of Fe (i.e., unchelated ferrous iron) that is produced by photoreductive dissociation of the ferric EDTA complex. Prediction by chemostat theory modified to account for the light-mediated formation of bioavailable Fe rather than total Fe was in good agreement with growth characteristics of M. aeruginosa under Fe limitation. The cellular Fe quota increased with increasing dilution rates in a manner consistent with the Droop theory. Short-term Fe uptake assays using cells maintained at steady state indicated that M. aeruginosa cells vary their maximum Fe uptake rate (?max) depending on the degree of Fe stress. The rate of Fe uptake was lower for cells grown under conditions of lower Fe availability (i.e., lower dilution rate), suggesting that cells in the continuous cultures adjusted to Fe limitation by decreasing ?max while maintaining a constant affinity for Fe. PMID:22210212

  11. Enhancement of hydrogen photoproduction by marine chromatium sp. Miami PBS 1071 grown in molecular nitrogen

    SciTech Connect

    Ohta, Y.; Mitsui, A.

    1980-01-01

    The marine Chromatium sp. Miami PSB 1071 was grown on molecular nitrogen as the sole source of nitrogen. These cells exhibited active hydrogen production in the light from hydrogen donor substances such as thiosulfate, sulfide, acetate, fumarate, malate and succinate. Hydrogen was produced as 2 to 3 times higher rates when two donor substances, succinate and thiosulfate (or succinate and sulfide) were used together. Hydrogen production rates as high as 6 ..mu..moles hydrogen/mg protein/hr were observed in cells from the middle of the logarithmic growth phase cells. These rates were 6 to 10 times higher than those of stationary growth phase cells. Hydrogen production was light dependent and hydrogen was consumed in the dark at a slower rate. High rates of hydrogen production were observed at seawater salinities and high light intensities. The response of growth and nitrogen fixation in this strain to environmental regulation suggest that it could be successfully used in saltwater based bio-solar hydrogen production systems.

  12. A hantavirus causing hemorrhagic fever with renal syndrome requires gC1qR/p32 for efficient cell binding and infection

    SciTech Connect

    Choi, Yun [Mogam Research Institute, 341 Pojungdong, Yongin, 449-910 (Korea, Republic of); Kwon, Young-Chan [School of Life Sciences and Biotechnology, Korea University, 5-1 Anamdong, Seoul, 136-701 (Korea, Republic of); Kim, Soo-In [School of Life Sciences and Biotechnology, Korea University, 5-1 Anamdong, Seoul, 136-701 (Korea, Republic of); Mogam Research Institute, 341 Pojungdong, Yongin, 449-910 (Korea, Republic of); Park, Jung-Min [Mogam Research Institute, 341 Pojungdong, Yongin, 449-910 (Korea, Republic of); Lee, Kyung-Hee [School of Life Sciences and Biotechnology, Korea University, 5-1 Anamdong, Seoul, 136-701 (Korea, Republic of); Ahn, Byung-Yoon [School of Life Sciences and Biotechnology, Korea University, 5-1 Anamdong, Seoul, 136-701 (Korea, Republic of)], E-mail: ahnbyung@korea.ac.kr

    2008-11-25

    Hantaan virus (HTNV) is a pathogenic hantavirus that causes hemorrhagic fever with renal syndrome (HFRS). HTNV infection is mediated by {alpha}v{beta}3 integrin. We used protein blots of Vero E6 cell homogenates to demonstrate that radiolabeled HTNV virions bind to gC1qR/p32, the acidic 32-kDa protein known as the receptor for the globular head domain of complement C1q. RNAi-mediated suppression of gC1qR/p32 markedly reduced HTNV binding and infection in human lung epithelial A549 cells. Conversely, transient expression of either simian or human gC1qR/p32 rendered non-permissive CHO cells susceptible to HTNV infection. These results suggest an important role for gC1qR/p32 in HTNV infection and pathogenesis.

  13. PRODUCING CONTINUOUSLY GROWING DUCK AND AVIAN CELL LINES FROM PRIMAY AVIAN CELLS 

    E-print Network

    Franklin, Zachary 1986-

    2012-05-02

    , the cells were grown in 48-well plates and treated with the carcinogen, 3-methylcholanthrene, at varying concentrations and times. Upon addition of the carcinogen some cells began to show morphological changes and in a few wells giant cells appeared. Some...

  14. Propagation and Immortalization of Human Lens Epithelial Cells in Culture

    Microsoft Academic Search

    Usha P. Andley; Johng S. Rhim; Leo T. Chylack; Timothy P. Fleming

    Purpose. To establish primary and immortalized cell cultures of human lens epithelial cells for a model system investigating human lens epithelial physiology and cataract. Methods. Human lens epithelial cells in culture were grown by isolating epithelium fragments from infant human lenses from patients who underwent treatment for retinopathy of prema- turity and by allowing epithelial cells to grow from explants.

  15. Cell Phone Use by Adults with Intellectual Disabilities

    ERIC Educational Resources Information Center

    Bryen, Diane Nelson; Carey, Allison; Friedman, Mark

    2007-01-01

    Although cell phone use has grown dramatically, there is a gap in cell phone access between people with disabilities and the general public. The importance of cell phone use among people with intellectual disabilities and studies about use of cell phones by adults with intellectual disabilities was described. Our goal was to determine the extent…

  16. Ensuring the safety of vaccine cell substrates by massively parallel sequencing of the transcriptome.

    PubMed

    Onions, D; Côté, C; Love, B; Toms, B; Koduri, S; Armstrong, A; Chang, A; Kolman, J

    2011-09-22

    Massively parallel, deep, sequencing of the transcriptome coupled with algorithmic analysis to identify adventitious agents (MP-Seq™) is an important adjunct in ensuring the safety of cells used in vaccine production. Such cells may harbour novel viruses whose sequences are unknown or latent viruses that are only expressed following stress to the cells. MP-Seq is an unbiased and comprehensive method to identify such viruses and other adventitious agents without prior knowledge of the nature of those agents. Here we demonstrate its utility as part of an integrated approach to identify and characterise potential contaminants within commonly used virus and vaccine production cell lines. Through this analysis, in combination with more traditional approaches, we have excluded the presence of porcine circoviruses in the ATCC Vero cell bank (CCL-81), however, we found that a full length betaretrovirus related to SRV can be expressed in these cells, a factor that may be of importance in the production of certain vaccines. Similarly, insect cells are proving to be valuable for the production of virus like particles and sub-unit vaccines, but they can harbour a range of latent viruses. We show that following MP-Seq of the Trichoplusia ni (High Five cell line) transcriptome we were able to detect a contaminating, latent nodavirus and identify an expressed errantivirus genome. Collectively, these studies have reinforced the role of MP-Seq as an integral tool for the identification of contaminating agents in vaccine cell substrates. PMID:21651935

  17. The influence of gravity on the formation of amyloplasts in columella cells of Zea mays L

    NASA Technical Reports Server (NTRS)

    Moore, R.; Fondren, W. M.; Koon, E. C.; Wang, C. L.

    1986-01-01

    Columella (i.e., putative graviperceptive) cells of Zea mays seedlings grown in the microgravity of outer space allocate significantly less volume to putative statoliths (amyloplasts) than do columella cells of Earth-grown seedlings. Amyloplasts of flight-grown seedlings are significantly smaller than those of ground controls, as is the average volume of individual starch grains. Similarly, the relative volume of starch in amyloplasts in columella cells of flight-grown seedlings is significantly less than that of Earth-grown seedlings. Microgravity does not significantly alter the volume of columella cells, the average number of amyloplasts per columella cell, or the number of starch grains per amyloplast. These results are discussed relative to the influence of gravity on cellular and organellar structure.

  18. HYPOCHLORITE-SERUM REACTION PRODUCTS INHIBIT PORCINE VASCULAR ENDOTHELIAL CELL GROWTH IN CULTURE

    EPA Science Inventory

    In vitro toxicity studies were initiated in order to determine if chlorination affects vascular endothelial cells. Twelfth to twentieth passage porcine aortic vascular endothelial cells (PAE) were grown to confluency and replated in the presence of complete media (Eagle's minimum...

  19. Integrated platform for functional monitoring of biomimetic heart sheets derived from human pluripotent stem cells

    E-print Network

    Fowlkes, Charless

    facilitate important concerted mechanical contraction and electrical propagation. To recapitulate, the effects of two drugs, E-4031 and isoprenaline, were examined. Cardiac cells supplemented with E-4031 contractile frequency and acceleration. Interestingly, cells grown on the biomimetic substrate were more

  20. Utilization of carbohydrates by Thermomonospora sp. Grown on glucose, cellobiose, and cellulose

    SciTech Connect

    Moreira, A.R.; Phillips, J.A.; Humphrey, A.E.

    1981-01-01

    Thermomonospora was grown on glucose, cellobiose, and cellulose in order to study its growth characteristics with different carbohydrate substrates and to assess the validity of some of the assumptions made in a previously proposed model for the cellulose fermentation with this microorganism. The N and protein contents of the cells are essentially constant during the fermentation and independent of the C source when glucose or cellobiose are utilized. Under O starvation conditions it was shown that unidentifiable organic compound(s) accumulate(s) in the culture broth. Culture fluorescence was an excellent variable for monitoring and control of the fermentation process. This microorganism showed a preference for crystalline cellulose (Avicel) as substrate although it grows readily on a more amorphous cellulose (Solka Floc). The production of extracellular protein is growth related. Data were obtained confirming the decrease in the number of active adsorption sites as the cause for the decrease in the cellulose digestion rate.

  1. Oxidative stress in entomopathogenic fungi grown on insect-like hydrocarbons.

    PubMed

    Huarte-Bonnet, Carla; Juárez, M Patricia; Pedrini, Nicolás

    2014-10-01

    Entomopathogenic fungi mostly attack their insect hosts by penetration through the cuticle. The outermost insect surface is covered by a lipid-rich layer, usually composed of very long chain hydrocarbons. These fungi are apt to grow on straight chain hydrocarbons (alkanes) as the sole carbon source. Insect-like hydrocarbons are first hydroxylated by a microsomal P450 monooxygenase system, and then fully catabolized by peroxisomal ?-oxidation reactions in Beauveria bassiana. In this review, we will discuss lipid metabolism adaptations in alkane-grown fungi, and how an oxidative stress scenario is established under these conditions. Fungi have to pay a high cost for hydrocarbon utilization; high levels of reactive oxygen species are produced and a concomitant antioxidant response is triggered in fungal cells to cope with this drawback. PMID:25274493

  2. Membrane cytochromes of Escherichia coli grown aerobically and anaerobically with nitrate.

    PubMed Central

    Hackett, N R; Bragg, P D

    1983-01-01

    Redox titration has been coupled to spectroscopic techniques, enzyme fractionation, and the use of mutants to examine the cytochrome composition of the membranes from cells grown aerobically and anaerobically with nitrate. A combination of techniques was found to be necessary to resolve the cytochromes. At least six b-type cytochromes were present. Besides cytochromes bfdh and bnr, components of the formate dehydrogenase-nitrate reductase pathway, cytochromes b556, b555, b562, and o, characteristic of aerobic respiratory pathways, were present. The midpoint oxidation-reduction potentials of the aerobic b-type cytochromes suggested that the sequence of electron transfer is: cytochrome b556 leads to b555 leads to b562 leads to O2. PMID:6341359

  3. TEM study of diamond films grown from fullerene precursors

    SciTech Connect

    Csencsits, R.; Gruen, D.M.; Krauss, A.R.; Zuiker, C.

    1995-11-01

    Transmission Electron Microscope (TEM) techniques are applied to study the microstructure of diamond films grown from fullerene precursors. Electron diffraction and electron energy loss spectra (EELS) collected from the diamond films correspond to that of bulk diamond. Microdiffraction, high resolution images and EELS help determine that the first diamond grains that nucleate from fullerene precursors generally form on a thin amorphous carbon interlayer and seldom directly on the silicon substrate. Grain size measurements reveal nanocrystalline diamond grains. Cross section TEM images show that the nanocrystalline diamond grains are equiaxed and not columnar nor dendritic. The microstructure of small equiaxed grains throughout the film thickness is believed responsible for the very smooth surfaces of diamond films grown from fullerene precursors.

  4. Present and future applications of magnetic nanostructures grown by FEBID

    NASA Astrophysics Data System (ADS)

    De Teresa, J. M.; Fernández-Pacheco, A.

    2014-12-01

    Currently, magnetic nanostructures are routinely grown by focused electron beam induced deposition (FEBID). In the present article, we review the milestones produced in the topic in the past as well as the future applications of this technology. Regarding past milestones, we highlight the achievement of high-purity cobalt and iron deposits, the high lateral resolution obtained, the growth of 3D magnetic deposits, the exploration of magnetic alloys and the application of magnetic deposits for Hall sensing and in domain-wall conduit and magnetologic devices. With respect to future perspectives of the topic, we emphasize the potential role of magnetic nanostructures grown by FEBID for applications related to highly integrated 2D arrays, 3D nanowires devices, fabrication of advanced scanning-probe systems, basic studies of magnetic structures and their dynamics, small sensors (including biosensors) and new applications brought by magnetic alloys and even exchange biased systems.

  5. Nanophotonic integrated circuits from nanoresonators grown on silicon

    NASA Astrophysics Data System (ADS)

    Chen, Roger; Ng, Kar Wei; Ko, Wai Son; Parekh, Devang; Lu, Fanglu; Tran, Thai-Truong D.; Li, Kun; Chang-Hasnain, Connie

    2014-07-01

    Harnessing light with photonic circuits promises to catalyse powerful new technologies much like electronic circuits have in the past. Analogous to Moore’s law, complexity and functionality of photonic integrated circuits depend on device size and performance scale. Semiconductor nanostructures offer an attractive approach to miniaturize photonics. However, shrinking photonics has come at great cost to performance, and assembling such devices into functional photonic circuits has remained an unfulfilled feat. Here we demonstrate an on-chip optical link constructed from InGaAs nanoresonators grown directly on a silicon substrate. Using nanoresonators, we show a complete toolkit of circuit elements including light emitters, photodetectors and a photovoltaic power supply. Devices operate with gigahertz bandwidths while consuming subpicojoule energy per bit, vastly eclipsing performance of prior nanostructure-based optoelectronics. Additionally, electrically driven stimulated emission from an as-grown nanostructure is presented for the first time. These results reveal a roadmap towards future ultradense nanophotonic integrated circuits.

  6. Radial segregation in VGF-RMF grown germanium

    NASA Astrophysics Data System (ADS)

    Bellmann, M. P.; Pätzold, O.; Gärtner, G.; Möller, H. J.; Stelter, M.

    2009-03-01

    In this paper experimental results of the radial dopant segregation in Ge:Ga single crystals grown by the vertical gradient freeze technique with a rotating magnetic field are presented. The segregation is analysed on the basis of the carrier concentration measured by means of Hall effect and Fourier transform infrared (FTIR) spectroscopy. In growth without the field the carrier concentration increases towards the axis, whereas much more uniform radial concentration profiles are found in crystals grown under the influence of the rotating field indicating a pronounced impact of the melt flow on the dopant segregation. Apparently, the accumulation of the Ga solute near the centre of the melt during growth under natural buoyancy is reduced by the electromagnetically induced flow. This phenomenon is discussed with respect to analytical and numerical results published recently.

  7. Nanophotonic integrated circuits from nanoresonators grown on silicon.

    PubMed

    Chen, Roger; Ng, Kar Wei; Ko, Wai Son; Parekh, Devang; Lu, Fanglu; Tran, Thai-Truong D; Li, Kun; Chang-Hasnain, Connie

    2014-01-01

    Harnessing light with photonic circuits promises to catalyse powerful new technologies much like electronic circuits have in the past. Analogous to Moore's law, complexity and functionality of photonic integrated circuits depend on device size and performance scale. Semiconductor nanostructures offer an attractive approach to miniaturize photonics. However, shrinking photonics has come at great cost to performance, and assembling such devices into functional photonic circuits has remained an unfulfilled feat. Here we demonstrate an on-chip optical link constructed from InGaAs nanoresonators grown directly on a silicon substrate. Using nanoresonators, we show a complete toolkit of circuit elements including light emitters, photodetectors and a photovoltaic power supply. Devices operate with gigahertz bandwidths while consuming subpicojoule energy per bit, vastly eclipsing performance of prior nanostructure-based optoelectronics. Additionally, electrically driven stimulated emission from an as-grown nanostructure is presented for the first time. These results reveal a roadmap towards future ultradense nanophotonic integrated circuits. PMID:24999601

  8. Electron diffraction studies on CVD grown bi-layered graphene

    NASA Astrophysics Data System (ADS)

    Lingam, Kiran; Karakaya, Mehmet; Podila, Ramakrishna; Quin, Haijun; Rao, Apparao; Dept. of Physics and Astronomy, Clemson University, Clemson, SC USA 29634. Team; Advanced Materials Research Laboratories, Clemson University, Anderson, SC USA 29625 Collaboration

    2013-03-01

    Graphene has generated enormous interest in the scientific community due to its peculiar properties like electron mobility, thermal conductivity etc. Several recent reports on exfoliated graphene emphasized the role of layer stacking on the electronic and optical properties of graphene in case of bi-layered and few layered graphene and several synthesis techniques like chemical vapor deposition (CVD) on Copper foils are employed to prepare graphene for applications at a large scale. However, a correlated study pertinent to the stacking order in CVD grown graphene is still unclear. In this work, using a combination of Raman spectroscopy and selected area electron diffraction analysis we analyzed the preferred misorientation angles in a CVD grown bi-layered graphene and also the role of Cu crystal facets on the graphene stacking order will be presented.

  9. Magneto-transport of large CVD-grown graphene

    Microsoft Academic Search

    Eric Whiteway; Victor Yu; Josianne Lefebvre; Robert Gagnon; Michael Hilke

    2010-01-01

    We present magnetoresistance measurements on large scale monolayer graphene grown by chemical vapor deposition (CVD) on copper. The graphene layer was transferred onto SiO2\\/Si via PMMA and thermal release tape for transport measurements. The resulting centimeter-sized graphene samples were measured at temperatures down to 30mK in a magnetic field. We observe a very sharp peak in resistance at zero field,

  10. Electronic properties of CVD graphene grown on copper

    Microsoft Academic Search

    Helin Cao; Qingkai Yu; Luis A. Jauregui; Jifa Tian; Wei Wu; Zhihong Liu; Romaneh Jalilian; Daniel K. Benjamin; Zhigang Jiang; Jiming Bao; Steven S. Pei; Yong P. Chen

    2010-01-01

    We report the electronic properties of graphene grown by chemical vapor deposition (CVD) on copper foils at ambient pressure. Large size graphene films (4 inch*4 inch) are synthesized and transferred to SiO2\\/Si substrate. Raman mapping demonstrates that the films consist primarily of monolayer graphene (up to ˜90% area coverage). Low temperature transport measurements are performed on devices made from such

  11. Thermoelectric properties of CVD grown large area graphene

    Microsoft Academic Search

    Andriy Sherehiy; Ruwantha Jayasinghe; Robert Stallard; Gamini Sumanasekera; Anton Sidorov; Daniel Benjamin; Zhigang Jiang; Qingkai Yu; Wei Wu; Jiming Bao; Zhihong Liu; Steven Pei; Yong Chen

    2010-01-01

    The thermoelectric power (TEP) of CVD (Chemical Vapor Deposition) grown large area graphene transferred onto a Si\\/SiO2 substrate was measured by simply attaching two miniature thermocouples and a resistive heater. Availability of such large area graphene facilitates straight forward TEP measurement without the use of any microfabrication processes. All investigated graphene samples showed a positive TEP ˜ + 30 muV\\/K

  12. Spectral Response of THM Grown CdZnTe Crystals

    Microsoft Academic Search

    Henry Chen; Salah A. Awadalla; Fraser Harris; Pinghe Lu; Robert Redden; Glenn Bindley; Antonio Copete; Jaesub Hong; Jonathan Grindlay; Mark Amman; Julie S. Lee; Paul Luke; Irfan Kuvvetli; Carl Budtz-Jorgensen

    2008-01-01

    The spectral response of several crystals grown by the Traveling Heater Method (THM) were investigated. An energy resolution of 0.98% for a Pseudo Frisch-Grid of 4 times 4 times 9 mm3 and 2.1% FWHM for a coplanar-grid of size 11 times 11 times 5 mm3 were measured using 137Cs-662 keV. In addition a 4% FWHM at 122 keV has also

  13. Nano transfer and nanoreplication using deterministically grown sacrificial nanotemplates

    DOEpatents

    Melechko, Anatoli V. (Oak Ridge, TN); McKnight, Timothy E. (Greenback, TN); Guillorn, Michael A. (Ithaca, NY); Ilic, Bojan (Ithaca, NY); Merkulov, Vladimir I. (Knoxville, TX); Doktycz, Mitchel J. (Knoxville, TN); Lowndes, Douglas H. (Knoxville, TN); Simpson, Michael L. (Knoxville, TN)

    2012-03-27

    Methods, manufactures, machines and compositions are described for nanotransfer and nanoreplication using deterministically grown sacrificial nanotemplates. An apparatus, includes a substrate and a nanoconduit material coupled to a surface of the substrate. The substrate defines an aperture and the nanoconduit material defines a nanoconduit that is i) contiguous with the aperture and ii) aligned substantially non-parallel to a plane defined by the surface of the substrate.

  14. Diversity in Butane Monooxygenases among Butane-Grown Bacteria

    Microsoft Academic Search

    NATSUKO HAMAMURA; RYAN T. STORFA; LEWIS SEMPRINI; DANIEL J. ARP

    1999-01-01

    Butane monooxygenases of butane-grown Pseudomonas butanovora, Mycobacterium vaccae JOB5, and an environmental isolate, CF8, were compared at the physiological level. The presence of butane monooxygenases in these bacteria was indicated by the following results. (i) O2 was required for butane degradation. (ii) 1-Butanol was produced during butane degradation. (iii) Acetylene inhibited both butane oxidation and 1-butanol production. The responses to

  15. Fungicidal control of Phthium Aphanidermatum in hydroponically grown tomatoes 

    E-print Network

    Acra, Michel Aftim

    1979-01-01

    FUNGICIDAL CONTROL OF PYTHIUM APHANIDERMATUM IN HYDROPONICALLY GROMN TOMATOES A Thesis by MICHEL AFTIM ACRA Submitted to the Graduate College of Texas AILM University in partial fulfillment of the requirement for the degree of MASTER... OF SCIENCE December 1979 Major Subject: Horticulture FUNGICIDAL CONTROL OF PYTHIUM APHANIDERMATUM IN HYDROPONICALLY GROWN TOMATOES A Thesis by MICHEL AFTIM ACRA Approved as to style and content by: (Co~as n of Com ' pe (Co-Chairman of~ ommittee...

  16. Arsenic uptake and speciation in vegetables grown under greenhouse conditions

    Microsoft Academic Search

    E. Smith; A. L. Juhasz; J. Weber

    2009-01-01

    The accumulation of arsenic (As) by vegetables is a potential human exposure pathway. The speciation of As in vegetables is\\u000a an important consideration due to the varying toxicity of different As species. In this study, common Australian garden vegetables\\u000a were hydroponically grown with As-contaminated irrigation water to determine the uptake and species of As present in vegetable\\u000a tissue. The highest

  17. Multilayer Permalloy films grown by molecular-beam epitaxy

    Microsoft Academic Search

    K. Rook; A. M. Zeltser; J. O. Artman; D. E. Laughlin; M. H. Kryder; R. M. Chrenko

    1991-01-01

    Single and multilayer [111]-textured films of Permalloy and Cu were grown by molecular-beam epitaxy (MBE) on (111) Si substrates. The magnetic properties of the films were measured by ferromagnetic resonance and M-H loop tracer. The microstructure was observed by transmission electron microscopy, reflection high-energy electron diffraction, and x-ray diffraction. Even the single-layer films had lower easy axis coercivity Hce (≊0.6

  18. Preparation of vapor-grown carbon fibers from deoiled asphalt

    Microsoft Academic Search

    Yongzhen Yang; Xuguang Liu; Bingshe Xu; Tianbao Li

    2006-01-01

    Vapor-grown carbon fibers (VGCFs) with high-purity have been successfully prepared from the thermal cracking of deoiled asphalt (DOA) with ferrocene as catalyst by chemical vapor deposition (CVD) in argon atmosphere and characterized systematically by field-emission scanning electron microscopy (FE-SEM), high resolution transmission electron microscopy (HRTEM) and X-ray diffraction (XRD) techniques. Results showed that VGCFs with a diameter of 150–200nm and

  19. Furnace grown gate oxynitride using nitric oxide (NO)

    Microsoft Academic Search

    Yoshio Okada; Philip J. Tobin; Kimberly G. Reid; Rama I. Hegde; Bikas Maiti; Sergio A. Ajuria

    1994-01-01

    Gate oxynitride was grown in NO for the first time. This approach can provide a tight N accumulation near the Si\\/SiO2 interface. Much lower thermal budget is required for an NO process than for an N2O process to produce an oxynitride with useful properties. Submicron MOSFET's with NO oxynitride showed superior current drive characteristics and comparable hot carrier immunity to

  20. pH sensor properties of electrochemically grown iridium oxide

    Microsoft Academic Search

    W. Olthuis; M. A. M. Robben; P. Bergveld; M. Bos; Linden van der W. E

    1990-01-01

    The open-circuit potential of an electrochemically grown iridium oxide film is measured and shows a pH sensitivity between ?60 and ?80 mV\\/pH. This sensitivity is found to depend on the state of oxidation of the iridium oxide film; for a higher state of oxidation (or more of the oxide in the high valence state), the sensitivity is also higher. This