These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Human Respiratory Syncytial Virus Memphis 37 Grown in HEp-2 Cells Causes more Severe Disease in Lambs than Virus Grown in Vero Cells  

PubMed Central

Respiratory syncytial virus (RSV) is the most common cause of bronchiolitis in infants and young children. A small percentage of these individuals develop severe and even fatal disease. To better understand the pathogenesis of severe disease and develop therapies unique to the less-developed infant immune system, a model of infant disease is needed. The neonatal lamb pulmonary development and physiology is similar to that of infants, and sheep are susceptible to ovine, bovine, or human strains of RSV. RSV grown in Vero (African green monkey) cells has a truncated attachment G glycoprotein as compared to that grown in HEp-2 cells. We hypothesized that the virus grown in HEp-2 cells would cause more severe clinical symptoms and cause more severe pathology. To confirm the hypothesis, lambs were inoculated simultaneously by two different delivery methods (intranasal and nebulized inoculation) with either Vero-grown or HEp-2-grown RSV Memphis 37 (M37) strain of virus to compare viral infection and disease symptoms. Lambs infected with HEp-2 cell-derived virus by either intranasal or nebulization inoculation had significantly higher levels of viral RNA in lungs as well as greater clinical disease including both gross and histopathologic lesions compared to lambs similarly inoculated with Vero-grown virus. Thus, our results provide convincing in vivo evidence for differences in viral infectivity that corroborate previous in vitro mechanistic studies demonstrating differences in the G glycoprotein expression by RSV grown in Vero cells. PMID:24284879

Derscheid, Rachel J.; van Geelen, Albert; McGill, Jodi L.; Gallup, Jack M.; Cihlar, Tomas; Sacco, Randy E.; Ackermann, Mark R.

2013-01-01

2

A microcarrier cell culture process for propagating rabies virus in Vero cells grown in a stirred bioreactor under fully animal component free conditions.  

PubMed

Rabies virus strain production in Vero cells grown on Cytodex 1 in a 2 L stirred tank bioreactor and in a medium free of components of human or animal origin (VP-SFM) is described. Cell banking procedure in VP-SFM supplemented with an animal components free mixture (10%DMSO+0.1%methylcellulose) was reported and cell growth after revitalization was assessed. Vero cells exhibited growth performances (specific growth rate and cell division number) similar to that obtained in serum containing medium. To design a scalable process that is totally free of animal-derived substances, two proteases: TrypLE Select and Accutase, were assessed as an alternative to trypsin which is routinely used for cell passage. Growth performance of Vero cells grown in VP-SFM and MEM+10% fetal calf serum (FCS) over four passages and subcultivated with either TrypLE Select or Accutase was evaluated. TrypLE Select showed the best performance in terms of specific growth rate and cell division number. Kinetics of cell growth and rabies virus production (LP2061/Vero strain) were investigated in spinner flask and in a 2 L bioreactor. In spinner flask, a maximal cell density level of 1.85x10(6) cells/mL was achieved when the cells were grown in VP-SFM on 2 g/L Cytodex 1. Cell infection experiments conducted at an MOI of 0.3 and without the medium exchange step, typically needed for serum containing rabies virus production, resulted in a maximal virus titer equal to 2x10(7) (Fluorescent Focus Unit) FFU/mL. In stirred tank bioreactor, Vero cell growth in VP-SFM on 3 g/L Cytodex 1 was shown to be sensitive to the aeration mode. Sparging the culture was detrimental for cell growth, whereas cell density level was greatly enhanced when only headspace aeration was used. A cell density level of 2.6x10(6) cells/mL was obtained when the cells were grown on 3g/L Cytodex 1 and in batch culture mode. Cell infection at an MOI of 0.1 without any medium exchange, yielded a maximal rabies virus titer of 2.4x10(7) FFU/mL. Furthermore, Vero cell growth in a 2 L bioreactor using recirculation culture mode during cell proliferation step and perfusion for virus multiplication phase was investigated. In comparison to batch culture, a higher cell density level that was equal to 5x10(6) cells/mL was reached. Cell infection under conditions similar to batch culture, resulted in a maximal virus titer equal to 1.38x10(8) FFU/mL. The potency of the pooled inactivated virus harvests showed an activity of 2.58 IU/mL which was comparable to that obtained in serum supplemented medium. PMID:17307281

Rourou, Samia; van der Ark, Arno; van der Velden, Tiny; Kallel, Héla

2007-05-10

3

Development of an in situ detachment protocol of Vero cells grown on Cytodex1 microcarriers under animal component-free conditions in stirred bioreactor.  

PubMed

Subcultivation of Vero cells grown in a proprietary animal component-free medium named IPT-AFM, on microcarriers, was studied. TrypLE Select, a non-animal-derived protease, was used as an alternative to trypsin for cell passaging. We first studied the effect of increasing concentrations of TrypLE Select toward cell growth and then studied the inactivation of the protease using either soybean trypsin inhibitor (STI) or the soy hydrolysate Hypep 1510, in six-well plates. Data showed that cell growth was impaired by residual level of TrypLE Select; STI was identified as an efficient agent to neutralize this effect. To restore cell growth and inactivate TrypLE Select, STI should be added to the medium at least at 0.2 g L(-1). Cells were also grown in spinner flask on 2 g L(-1) Cytodex1 in IPT-AFM. In these conditions, the cell detachment yield was equal to 78?±?8 %. Furthermore, cells exhibited a typical growth profile when using the dislodged cells to seed a new culture. A cell detachment yield of 70?±?19 % was also achieved when the cells were grown in a 2-L stirred bioreactor in IPT-AFM, on 3 g L(-1) Cytodex1. This protocol can be of great interest to scale-up the process of Vero cells cultivation in IPT-AFM on Cytodex1 from one stirred bioreactor culture to another. PMID:23737305

Rourou, Samia; Riahi, Nesrine; Majoul, Samy; Trabelsi, Khaled; Kallel, Héla

2013-08-01

4

A novel animal-component-free medium for rabies virus production in Vero cells grown on Cytodex 1 microcarriers in a stirred bioreactor.  

PubMed

Vero cells growth and rabies production in IPT-AF medium, a property animal-component-free medium are described in this work. Kinetics of cell growth and rabies virus (strain LP 2061) production were first conducted in spinner flasks. Over eight independent experiments, Vero cell growth in IPT-AF medium, on 2 g/l Cytodex 1 was consistent. An average Cd (cell division number) of 3.3+/-0.4 and a specific growth rate micro of 0.017+/-0.006 h(-1) were achieved. Such performances were comparable to those obtained in serum-containing medium (MEM+10% FCS). Rabies virus production on Vero cells in IPT-AF medium was also optimised in spinner flasks. The effects of multiplicity of infection (MOI), regulation of glucose level at 1 g/l and cell washing step, were investigated. The highest virus titer was achieved when the cells were infected at an MOI of 0.1; this level was equal to 10(7) FFU/ml. The step of medium exchange before cell infection can be omitted; nevertheless in this case glucose level should be maintained at 1 g/l to avoid a decrease of specific virus productivity. Process optimisation in a 2-l stirred bioreactor pointed out that the aeration mode was the prominent parameter that affected cell growth in IPT-AF medium and on Cytodex 1 microcarriers. An acceptable level of cell density (cell density level of 1.5x10(6) cells/ml) was achieved when cells were grown in batch mode and using headspace aeration. Nevertheless, this aeration mode is not optimal for large-scale culture. The addition of Pluronic F68 at 0.1% at 24 h post inoculation as well as the switch from surface aeration mode to the sparged mode, 2 days after the start of the culture, had markedly improved cell growth performance. A cell density level of 5.5x10(6) cells/ml was reached when cells were grown in a 2-l bioreactor, on 3 g/l Cytodex 1 in IPT-AF medium and using the recirculation culture mode. Cell infection at an MOI of 0.1 and using perfused culture, resulted in a maximal virus titer of 3.5x10(7) FFU/ml. The activity of the pooled inactivated rabies virus harvests showed a protective activity that meets WHO requirements. PMID:19521697

Rourou, Samia; van der Ark, Arno; Majoul, Samy; Trabelsi, Khaled; van der Velden, Tiny; Kallel, Héla

2009-11-01

5

A novel animal-component-free medium for rabies virus production in Vero cells grown on Cytodex 1 microcarriers in a stirred bioreactor  

Microsoft Academic Search

Vero cells growth and rabies production in IPT-AF medium, a property animal-component-free medium are described in this work.\\u000a Kinetics of cell growth and rabies virus (strain LP 2061) production were first conducted in spinner flasks. Over eight independent\\u000a experiments, Vero cell growth in IPT-AF medium, on 2 g\\/l Cytodex 1 was consistent. An average Cd (cell division number) of\\u000a 3.3?±?0.4 and

Samia Rourou; Arno van der Ark; Samy Majoul; Khaled Trabelsi; Tiny van der Velden; Héla Kallel

2009-01-01

6

Persistent Infection of Vero Cells by Paramyxoviruses  

Microsoft Academic Search

Summary Two Vero cell lines persistently infected with canine distemper virus (CDV) or with both CDV and canine parainfluenza (CPI) viruses were investigated. Cells in the CPI-CDV cell line were 90–100% positive for CPI antigen and exhibited 10–80% CPI hemadsorption. Cytoplasmic CDV antigen expressed in both singly and dually infected monolayers varied weekly from 1 to 100%. Numerous cytolytic crises

W. Baumgärtner; S. Krakowka; J. R. Blakeslee

1987-01-01

7

African green monkey kidney (Vero) cells provide an alternative host cell system for influenza A and B viruses.  

PubMed

The preparation of live, attenuated human influenza virus vaccines and of large quantities of inactivated vaccines after the emergence or reemergence of a pandemic influenza virus will require an alternative host cell system, because embryonated chicken eggs will likely be insufficient and suboptimal. Preliminary studies indicated that an African green monkey kidney cell line (Vero) is a suitable system for the primary isolation and cultivation of influenza A viruses (E. A. Govorkova, N. V. Kaverin, L. V. Gubareva, B. Meignier, and R. G. Webster, J. Infect. Dis. 172:250-253, 1995). We now demonstrate for the first time that Vero cells are suitable for isolation and productive replication of influenza B viruses and determine the biological and genetic properties of both influenza A and B viruses in Vero cells; additionally, we characterize the receptors on Vero cells compared with those on Madin-Darby canine kidney (MDCK) cells. Sequence analysis indicated that the hemagglutinin of Vero cell-derived influenza B viruses was identical to that of MDCK-grown counterparts but differed from that of egg-grown viruses at amino acid positions 196 to 198. Fluorescence-activated cell sorting analysis showed that although Vero cells possess predominantly alpha2,3 galactose-linked sialic acid, they are fully susceptible to infection with either human influenza A or B viruses. Moreover, all virus-specific polypeptides were synthesized in the same proportions in Vero cells as in MDCK cells. Electron microscopic and immunofluorescence studies confirmed that infected Vero cells undergo the same morphological changes as do other polarized epithelia] cells. Taken together, these results indicate that Vero cell lines could serve as an alternative host system for the cultivation of influenza A and B viruses, providing adequate quantities of either virus to meet the vaccine requirements imposed by an emerging pandemic. PMID:8764064

Govorkova, E A; Murti, G; Meignier, B; de Taisne, C; Webster, R G

1996-08-01

8

African green monkey kidney (Vero) cells provide an alternative host cell system for influenza A and B viruses.  

PubMed Central

The preparation of live, attenuated human influenza virus vaccines and of large quantities of inactivated vaccines after the emergence or reemergence of a pandemic influenza virus will require an alternative host cell system, because embryonated chicken eggs will likely be insufficient and suboptimal. Preliminary studies indicated that an African green monkey kidney cell line (Vero) is a suitable system for the primary isolation and cultivation of influenza A viruses (E. A. Govorkova, N. V. Kaverin, L. V. Gubareva, B. Meignier, and R. G. Webster, J. Infect. Dis. 172:250-253, 1995). We now demonstrate for the first time that Vero cells are suitable for isolation and productive replication of influenza B viruses and determine the biological and genetic properties of both influenza A and B viruses in Vero cells; additionally, we characterize the receptors on Vero cells compared with those on Madin-Darby canine kidney (MDCK) cells. Sequence analysis indicated that the hemagglutinin of Vero cell-derived influenza B viruses was identical to that of MDCK-grown counterparts but differed from that of egg-grown viruses at amino acid positions 196 to 198. Fluorescence-activated cell sorting analysis showed that although Vero cells possess predominantly alpha2,3 galactose-linked sialic acid, they are fully susceptible to infection with either human influenza A or B viruses. Moreover, all virus-specific polypeptides were synthesized in the same proportions in Vero cells as in MDCK cells. Electron microscopic and immunofluorescence studies confirmed that infected Vero cells undergo the same morphological changes as do other polarized epithelia] cells. Taken together, these results indicate that Vero cell lines could serve as an alternative host system for the cultivation of influenza A and B viruses, providing adequate quantities of either virus to meet the vaccine requirements imposed by an emerging pandemic. PMID:8764064

Govorkova, E A; Murti, G; Meignier, B; de Taisne, C; Webster, R G

1996-01-01

9

Interaction of kunjin virus with octyl- d-glucoside extracted Vero cell plasma membrane  

Microsoft Academic Search

Initial experiments using whole cells have shown that there were specific and saturable interactions between kunjin (KUN) virus and receptor molecules on the Vero cell surfaces. Solubilisation of Vero cell plasma membranes with octyl-d-glucoside (OG) yielded an extract which also interacted specifically with KUN virus. This was proven using electron microscopy. When the virus-OG-extract complex was exposed onto Vero cell

David Sankaran; Lionel C. L. Lau; Mah Lee Ng

1997-01-01

10

Detection of Infectious Virus from Field-collected Mosquitoes by Vero Cell Culture Assay  

PubMed Central

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing ?50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population. PMID:21694689

Armstrong, Philip M.; Andreadis, Theodore G.; Finan, Shannon L.; Shepard, John J.; Thomas, Michael C.

2011-01-01

11

Detection of infectious virus from field-collected mosquitoes by vero cell culture assay.  

PubMed

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing ?50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population. PMID:21694689

Armstrong, Philip M; Andreadis, Theodore G; Finan, Shannon L; Shepard, John J; Thomas, Michael C

2011-01-01

12

Pathway of rubella virus infectious entry into Vero cells.  

PubMed

The mechanism and the kinetics of rubella virus (RV) penetration into Vero cells were studied. By using pronase or acid treatment to inactivate virus which had adsorbed to cell membrane but had not been internalized, it was found that a period of 7 h was required in order for all of the adsorbed virus to enter the host cells. Lysosomotropic agents (monensin, methylamine, ammonium chloride and chloroquine) were used to study the mechanism by which RV penetrates host cells. Virus replication was inhibited if treatment of cells with these compounds was performed for at least 9 h after infection. However, if extracellular adsorbed virions were eliminated by acid treatment following removal of the lysosomotropic compounds, RV replication was completely inhibited by treatment with these drugs for any time period after adsorption. This indicated that the prolonged period of treatment with these compounds necessary to inhibit virus replication is due to the slow rate of RV internalization. None of the compounds had any effect on infection initiated by transfection of RV RNA, confirming that these drugs were exerting their inhibitory activity at penetration. The inhibition of RV replication by lysosomotropic compounds indicates that RV penetrates host cells by the endosomal pathway. PMID:8627234

Petruzziello, R; Orsi, N; Macchia, S; Rieti, S; Frey, T K; Mastromarino, P

1996-02-01

13

Susceptibility of the VERO line of African green monkey kidney cells to human enteroviruses  

PubMed Central

The relative susceptibility of VERO cells and primary rhesus monkey kidney cells to 47 prototype strains of human enteroviruses is described. Of these strains, types 4, 14, 16, 17, 18, 21, 31 and 34 and Coxsackie virus A 9 failed to cause CPE in the VERO cells whilst only one, echovirus type 34, failed to cause CPE in the monkey kidney cells. A comparison is given of the efficiency of the two cell cultures for enterovirus isolation from clinical material. Results show that VERO cells are as useful as primary monkey kidney for the isolation of Coxsackie B viruses but less satisfactory for isolating echoviruses. They are satisfactory for the isolation of single types of poliovirus and appear to be more satisfactory than primary monkey kidney cells for the isolation of mixtures of polioviruses. The identification of enteroviruses by neutralization tests in VERO cells is successful. PMID:4361500

Davis, Patricia M.; Phillpotts, R. J.

1974-01-01

14

Assessing the tumorigenic phenotype of VERO cells in adult and newborn nude mice.  

PubMed

VERO cell lines are important substrates for viral vaccine manufacture. The mechanism by which these cells became neoplastically transformed is unknown. During tissue-culture passage, VERO cells can develop the capacity to form tumors. Although at the passage levels (around p140) currently used for vaccine manufacture, VERO cells are non-tumorigenic, questions have been raised about safety issues that might be associated with this capacity to acquire a tumorigenic phenotype. To begin to address these issues, the tumorigenicity of VERO cell lines, derived at different passage levels under different growth conditions, were evaluated in 365-day assays in adult and newborn nude mice. High passage (p>200) VERO cell lines established by random passaging in tissue culture produced tumors in adult (10 out of 27) mice and newborn (21 out of 30) mice, respectively. In contrast, a high passage (p>250) cell line established by passage at sub-confluence produced tumors only in newborn mice (16 out of 30). Progressively growing tumors began forming at 36 days in newborns and at 69 days in adults. Higher tumor incidences and shorter tumor latencies suggest that newborn nude mice may be more sensitive than adults in detecting the expression of a tumorigenic phenotype by some VERO cell lines. PMID:17933552

Manohar, Manu; Orrison, Brian; Peden, Keith; Lewis, Andrew M

2008-01-01

15

The genome landscape of the african green monkey kidney-derived vero cell line.  

PubMed

Continuous cell lines that originate from mammalian tissues serve as not only invaluable tools for life sciences, but also important animal cell substrates for the production of various types of biological pharmaceuticals. Vero cells are susceptible to various types of microbes and toxins and have widely contributed to not only microbiology, but also the production of vaccines for human use. We here showed the genome landscape of a Vero cell line, in which 25,877 putative protein-coding genes were identified in the 2.97-Gb genome sequence. A homozygous ?9-Mb deletion on chromosome 12 caused the loss of the type I interferon gene cluster and cyclin-dependent kinase inhibitor genes in Vero cells. In addition, an ?59-Mb loss of heterozygosity around this deleted region suggested that the homozygosity of the deletion was established by a large-scale conversion. Moreover, a genomic analysis of Vero cells revealed a female Chlorocebus sabaeus origin and proviral variations of the endogenous simian type D retrovirus. These results revealed the genomic basis for the non-tumourigenic permanent Vero cell lineage susceptible to various pathogens and will be useful for generating new sub-lines and developing new tools in the quality control of Vero cells. PMID:25267831

Osada, Naoki; Kohara, Arihiro; Yamaji, Toshiyuki; Hirayama, Noriko; Kasai, Fumio; Sekizuka, Tsuyoshi; Kuroda, Makoto; Hanada, Kentaro

2014-12-01

16

The Genome Landscape of the African Green Monkey Kidney-Derived Vero Cell Line  

PubMed Central

Continuous cell lines that originate from mammalian tissues serve as not only invaluable tools for life sciences, but also important animal cell substrates for the production of various types of biological pharmaceuticals. Vero cells are susceptible to various types of microbes and toxins and have widely contributed to not only microbiology, but also the production of vaccines for human use. We here showed the genome landscape of a Vero cell line, in which 25,877 putative protein-coding genes were identified in the 2.97-Gb genome sequence. A homozygous ?9-Mb deletion on chromosome 12 caused the loss of the type I interferon gene cluster and cyclin-dependent kinase inhibitor genes in Vero cells. In addition, an ?59-Mb loss of heterozygosity around this deleted region suggested that the homozygosity of the deletion was established by a large-scale conversion. Moreover, a genomic analysis of Vero cells revealed a female Chlorocebus sabaeus origin and proviral variations of the endogenous simian type D retrovirus. These results revealed the genomic basis for the non-tumourigenic permanent Vero cell lineage susceptible to various pathogens and will be useful for generating new sub-lines and developing new tools in the quality control of Vero cells. PMID:25267831

Osada, Naoki; Kohara, Arihiro; Yamaji, Toshiyuki; Hirayama, Noriko; Kasai, Fumio; Sekizuka, Tsuyoshi; Kuroda, Makoto; Hanada, Kentaro

2014-01-01

17

Alternative methods of globotrioside production using Vero cells: a microcarrier system procedure  

Microsoft Academic Search

BACKGROUND: Glycolipids are one component of cell membranes, and are found most prevalently at the surface of the plasma membrane. Animal cells take in amphipathic glycosides, which are later glycosylated after assimilation in biosynthetic pathways. Gycosylated glycosides are released outside of cells to the surrounding culture medium. This represents an accessible method of obtaining complex glycosides. RESULTS: Vero cells are

Atsushi Miyagawa; Maria CARMELITA Z. Kasuya; Kenichi Hatanaka

2007-01-01

18

Leucine affects the fibroblastic Vero cells stimulating the cell proliferation and modulating the proteolysis process  

Microsoft Academic Search

Branched-chain amino acids, especially leucine, exert regulatory influences on protein and carbohydrate metabolism, ribosome\\u000a biogenesis and gene expression. This study investigated the effects of leucine in fibroblastic cells analysing viability,\\u000a proliferation, morphology, proteolysis enzymes activities and protein turnover. After exposure to culture medium enriched\\u000a with 25 or 50 ?M leucine for 24, 48 and 72 h, Vero cells have no alterations on

Estela Maria Gonçalves; Maria Cristina Cintra Gomes-Marcondes

2010-01-01

19

Role of membrane phospholipids and glycolipids in the Vero cell surface receptor for rubella virus  

Microsoft Academic Search

Membrane receptors for rubella virus (RV) in Vero cells were studied by means of two different approaches: (i) by enzyme treatment of the whole cell membrane and (ii) by testing the ability of isolated plasma membrane molecules to compete with cells for virus binding. The replication of RV was studied with both indirect immunofluorescence assay and molecular hybridization techniques. Phospholipases

P. Mastromarino; L. Cioè; S. Rieti; N. Orsi

1990-01-01

20

Isolation and propagation of Dengue virus in Vero and BHK-21 cells expressing human DC-SIGN stably.  

PubMed

The "standard" methods of isolating dengue virus (DENV) utilize the mosquito cell line C6/36, monkey kidney LLC-MK2 cells, Vero cells, or baby hamster kidney (BHK-21) cells. However, these cells lines lack a particular DENV receptor, known as dendritic cell-specific ICAM-3-grabbing non-integrin (DC-SIGN), which is expressed on immature dendritic cells and monocytes/macrophages. This may result in less efficient virus isolation and propagation. The present study used a lentivirus vector to establish Vero and BHK-21 cell lines (Vero-DC and BHK-DC) that express human DC-SIGN stably. Five DENV strains, each passaged several times in C6/36 cells, replicated more efficiently in Vero-DC and BHK-DC than in the parental Vero or BHK-21 cells. Vero/Vero-DC and BHK-21/BHK-DC were used to isolate virus from buffy coats and plasma samples derived from 13 patients infected with DENV. Most of the viruses showed increased production in cell lines expressing DC-SIGN. However, the isolation rate was lower (15.4-46.2%) than that from C6/36 cells (84.6%). Interestingly, when the viruses were isolated in C6/36 cells prior to infecting Vero/Vero-DC and BHK-21/BHK-DC, the rate of virus production increased markedly, reaching levels higher than those initially achieved in C6/36 cells. These data suggest that Vero-DC and BHK-DC could be useful tools for virus propagation, and that human specimens may contain a factor that interferes with virus growth in mammalian cells. PMID:25205264

Phanthanawiboon, Supranee; A-nuegoonpipat, Atchareeya; Panngarm, Narawan; Limkittikul, Kriengsak; Ikuta, Kazuyoshi; Anantapreecha, Surapee; Kurosu, Takeshi

2014-12-01

21

Abortive Infection of Vero Cells by an Influenza A Virus (FPV)  

Microsoft Academic Search

We have discovered a new type of abortive replication in Vero cells infected with fowl plague virus. In these cells there is an enhanced splicing of the colinear mRNAs of segment 7 and presumably also of segment 8, leading to an extreme overproduction of M2 and NS2 proteins. The cleavage of the hemagglutinin (HA) into HA1 and HA2 and the

Sylvia C. Lau; Christoph Scholtissek

1995-01-01

22

Lipid rafts are involved in SARS-CoV entry into Vero E6 cells  

Microsoft Academic Search

Lipid rafts often serve as an entry site for certain viruses. Here, we report that lipid rafts in Vero E6 cells are involved in the entry of severe acute respiratory syndrome coronavirus (SARS-CoV). Infectivity assay showed the integrity of lipid rafts was required for productive infection of pseudotyped SARS-CoV. Depletion of plasma membrane cholesterol with M?CD relocalized raft-resident marker caveolin-1

Yanning Lu; Ding Xiang Liu; James P. Tam

2008-01-01

23

Extremely low-frequency electromagnetic fields cause DNA strand breaks in normal Vero cells  

E-print Network

Extremely low frequency electromagnetic fields aren't considered as a real carcinogenic agent despite the fact that some studies have showed impairment of the DNA integrity in different cells lines. The aim of this study was evaluation of the late effects of a 100 Hz and 5.6 mT electromagnetic field, applied continuously or discontinuously, on the DNA integrity of Vero cells assessed by alkaline Comet assay and by cell cycle analysis. Normal Vero cells were exposed to extremely low frequency electromagnetic fields (100 Hz, 5.6 mT) for 45 minutes. The Comet assay and cell cycle analysis were performed 48 hours after the treatment. Exposed samples presented an increase of the number of cells with high damaged DNA as compared with non-exposed cells. Quantitative evaluation of the comet assay showed a significantly ($cells. Cell cycle analysis showed an increase of the frequency of the cells in S phase, proving the occurrence of single strand breaks. The most probable mechanism of induction of the registered effects is the production of different types of reactive oxygen species.

Cosmin Teodor Miha; Gabriela Vochita; Florin Brinza; Pincu Rotinberg

2013-01-23

24

African green monkey kidney Vero cells require de novo protein synthesis for efficient herpes simplex virus 1-dependent apoptosis.  

PubMed

During HSV-1 infection, IE gene expression triggers apoptosis, but subsequent synthesis of infected cell proteins blocks apoptotic death from ensuing. This "HSV-1-dependent" apoptosis was identified in HEp-2/HeLa cells infected with wild-type HSV-1 in the presence of an inhibitor of protein synthesis or a virus lacking ICP27 {HSV-1(vBSDelta27)}. Unlike HEp-2/HeLa cells, vBSDelta27-infected Vero cells fail to exhibit dramatic apoptotic morphologies at times prior to 24 hpi. Here, we examined the basis of these different apoptotic responses to HSV-1. We found that infected Vero cells take substantially longer than HEp-2/HeLa cells to display membrane blebbing, chromatin condensation, DNA laddering, and PARP cleavage. Vero, but not HEp-2/HeLa, cells required de novo protein synthesis to exhibit efficient HSV-1-dependent apoptosis, which included changes in mitochondrial membrane potential, and these factors were produced prior to 3 hpi. Vero cells infected with recombinant viruses devoid of the ICP27 and ICP4 proteins alone or both the ICP27 and ICP22 proteins were apoptotic. These results indicate a requirement for cellular or other viral protein synthesis in Vero cells and provide insight into cell type differences in HSV-1-dependent apoptosis. PMID:15892968

Nguyen, Marie L; Kraft, Rachel M; Blaho, John A

2005-06-01

25

Adaptation and growth kinetics study of an Indian isolate of virulent duck enteritis virus in Vero cells.  

PubMed

Duck virus enteritis, also known as duck plague, is a viral infection of ducks caused by duck enteritis virus (DEV). The control of the disease is mainly done by vaccination with chicken embryo adapted live virus that is known to be poorly immunogenic and elicits only partial protection. Further, the embryo propagated vaccine virus pose a threat of harboring other infectious agents. Seeing these limitations, the present study reports for the first time regarding propagation and adaptation of a virulent Indian isolate of duck enteritis virus in Vero cell line. In this study isolation of an outbreak virus from Kerala state was done in chicken embryo fibroblast cell culture (CEF). Then adapted the DEV isolate in the Vero cell line. The characteristic cytopathic effects (CPE) of clumping and fusion of Vero cells were observed starting from the 7th passage onwards. The presence of the virus and its multiplication in Vero cells was confirmed by detection of viral specific DNA and antigen by using polymerase chain reaction (PCR) and indirect immuno fluorescent assay (IIFA), respectively. PCR detection of DEV using self designed primers for US4 (gD) and UL30 (DNA Polymerase) gene has been reported for the in the present study. The kinetics of DEV in Vero cells revealed a maximum infectivity titer of 10(5.6) TCID 50/ml after 48hr of viral infection. Compared to chicken embryo adapted DVE vaccine virus, the Vero cell culture system is free from other infectious agents. So it will be a good candidate for cultivation and propagation of duck enteritis virus vaccine strain. Further research studies are suggested to explore the feasibility of utilizing this Vero cell culture adapted DEV isolate for developing an attenuated vaccine virus against duck virus enteritis. PMID:25450886

Aravind, S; Kamble, Nitin M; Gaikwad, Satish S; Shukla, Sanjeev Kumar; Dey, Sohini; Mohan, C Madhan

2015-01-01

26

Structure-Function Relationship of the Ion Channel Formed by Diphtheria Toxin in Vero Cell Membranes  

Microsoft Academic Search

.   Diphtheria toxin (DT) forms cation selective channels at low pH in cell membranes and planar bilayers. The channels formed\\u000a by wild-type full length toxin (DT-AB), wild-type fragment B (DT-B) and mutants of DT-B were studied in the plasma membrane\\u000a of Vero cells using the patch-clamp technique. The mutations concerned certain negatively charged amino acids within the channel-forming\\u000a transmembrane domain

M. Lanzrein; P. Ø. Falnes; O. Sand; S. Olsnes

1997-01-01

27

Mathematical model of adherent Vero cell growth and poliovirus production in animal component free medium.  

PubMed

Sabin-IPV (or sIPV, inactivated polio vaccine based on attenuated Sabin strains) is anticipated to replace the oral polio vaccine for the endgame in polio eradication. Optimization of sIPV production will lead to a better economically feasible vaccine. To assist process optimization, we studied Sabin type 1 poliovirus (PV) infection kinetics on Vero cells in controlled bioreactor vessels. The aim of our study was to develop a descriptive mathematical model able to capture the dynamics of adherent Vero cell growth and PV infection kinetics in animal component free medium. The model predicts the cell density, metabolites profiles, and viral yields in time. We found that the multiplicity of infection (MOI) and the time of infection (TOI) within the investigated range did not affect maximal PV yields, but they did affect the process time. The latter may be reduced by selecting a low TOI and a high MOI. Additionally, we present a correlation between viral titers and D-antigen, a measure for immunogenicity, of Sabin type 1 PV. The developed model is adequate for further studies of the cell metabolism and infection kinetics and may be used to identify control strategies to increase viral productivity. Increased viral yields reduce costs of polio vaccines with large implications on public health. PMID:25294335

Ursache, Ramona V; Thomassen, Yvonne E; van Eikenhorst, Gerco; Verheijen, Peter J T; Bakker, Wilfried A M

2014-10-01

28

Diphtheria toxin-induced channels in Vero cells selective for monovalent cations  

SciTech Connect

Ion fluxes associated with translocation of diphtheria toxin across the surface membrane of Vero cells were studied. When cells with surface-bound toxin were exposed to low pH to induce toxin entry, the cells became permeable to Na+, K+, H+, choline+, and glucosamine+. There was no increased permeability to Cl-, SO4(-2), glucose, or sucrose, whereas the uptake of /sup 45/Ca2+ was slightly increased. The influx of Ca2+, which appears to be different from that of monovalent cations, was reduced by several inhibitors of anion transport and by verapamil, Mn2+, Co2+, and Ca2+, but not by Mg2+. The toxin-induced fluxes of N+, K+, and protons were inhibited by Cd2+. Cd2+ also protected the cells against intoxication by diphtheria toxin, suggesting that the open cation-selective channel is required for toxin translocation. The involvement of the toxin receptor is discussed.

Sandvig, K.; Olsnes, S.

1988-09-05

29

Morphogenesis of Respiratory Syncytial Virus in a Green Monkey Kidney Cell Line (Vero)  

PubMed Central

The structure and morphogenesis of respiratory syncytial (RS) virus particles in a green monkey kidney cell line (Vero) were examined. Infected cells contained dense intracytoplasmic inclusions composed of filamentous structures. In places where inclusion material was associated with membranes, structural modifications were induced. There was a thickening of the membrane and an addition of projections 12 to 15 nm in length. The same changes were most frequently observed after association of isolated filamentous structures with the cytoplasmic membrane. The budding-off process was clearly visualized. The diameter of mature virus particles varied between 90 and 130 nm and that of the internal component varied between 11 and 15 nm. The similarities between ultrastructural features of cells infected with RS virus and pneumonia virus of mice are pointed out. It is proposed that these two viruses should be classified together in a third subgroup of myxoviruses. Images PMID:4100527

Norrby, Erling; Marusyk, Halyna; Örvell, Claes

1970-01-01

30

Defectiveness of Interferon Production and of Rubella Virus Interference in a Line of African Green Monkey Kidney Cells (Vero)  

PubMed Central

Vero cells, a line of African green monkey kidney cells, failed to produce interferon when infected with Newcastle disease, Sendai, Sindbis, and rubella viruses, although the cells were sensitive to interferon. Further, infection of Vero cells with rubella virus did not result in interference with the replication of echovirus 11, Newcastle disease virus, or vesicular stomatitis virus, even in cultures where virtually every cell was infected with rubella virus. Under the same conditions, BSC-1 cells and other cells of primate origin produced interferon and showed rubella virus interference. The results indicate that the presence of rubella virus in the cell does not in itself exclude multiplication of other viruses and that rubella virus interference appears to be linked to the capability of the cell to produce interferon. PMID:4302013

Desmyter, Jan; Melnick, Joseph L.; Rawls, William E.

1968-01-01

31

Characterization of the 3a Protein of SARS-associated Coronavirus in Infected Vero E6 Cells and SARS Patients  

E-print Network

Characterization of the 3a Protein of SARS-associated Coronavirus in Infected Vero E6 Cells Proteomics was used to identify a protein encoded by ORF 3a in a SARS- associated coronavirus (SARS rights reserved. Keywords: SARS; coronavirus; 3a protein; spike protein; proteome*Corresponding authors

Tian, Weidong

32

VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt  

PubMed Central

Poly-ADP-ribose (PAR) is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs) and degraded by poly-ADP-ribose-glycohydrolase (PARG). Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair). Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt). In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO). PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications. PMID:25332845

Vilchez Larrea, Salomé C.; Kun, Alejandra

2014-01-01

33

Bicarbonate\\/chloride antiport in Vero cells: II. Mechanisms for bicarbonate-dependent regulation of intracellular pH  

Microsoft Academic Search

The rates of bicarbonate-dependent uptake and efflux of ²²Na\\/sup +\\/ in Vero cells were studied and compared with the uptake and efflux of ³⁶Cl⁻. Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na\\/sup +\\/ was much less affected

Sjur Olsnes; Jannikke Ludt; T. I. Tonnessen; Kirsten Sandvig

1987-01-01

34

Lipid rafts are involved in SARS-CoV entry into Vero E6 cells.  

PubMed

Lipid rafts often serve as an entry site for certain viruses. Here, we report that lipid rafts in Vero E6 cells are involved in the entry of severe acute respiratory syndrome coronavirus (SARS-CoV). Infectivity assay showed the integrity of lipid rafts was required for productive infection of pseudotyped SARS-CoV. Depletion of plasma membrane cholesterol with MbetaCD relocalized raft-resident marker caveolin-1 as well as SARS-CoV receptor ACE2 to a nonraft environment, but did not significantly change the surface expression of ACE2. MbetaCD-treatment inhibited infectivity of pseudotyped SARS-CoV by 90%. Biochemical fractionation and confocal imaging confirmed that ACE2 colocalized with raft-resident markers. Furthermore, an ectodomain of SARS-CoV S protein (S1188HA) could associate with lipid rafts after binding to its receptor, and colocalize with raft-resident marker ganglioside GM1. The binding of S1188HA was not affected by depleting plasma membrane cholesterol. Taken together, our results support that lipid rafts serve as an entry port for SARS-CoV. PMID:18279660

Lu, Yanning; Liu, Ding Xiang; Tam, James P

2008-05-01

35

Some ultrastructural effects of persistent infections by the rickettsia Coxiella burnetii in mouse L cells and green monkey kidney (Vero) cells.  

PubMed Central

Mouse fibroblasts (L-929) and Vero (green monkey kidney) cells were infected with the rickettsia Coxiella burnetti, and persistent infections developed and were studied over a 6- to 10-month period. Ultrastructural comparisons were made between the two infected cell types, and both were tested cytochemically for the presence of acid phosphatase, a marker enzyme of lysozymes. Rickettsiae were always observed within vacuoles, and some infected L cells showed flattened endoplasmic reticulum as compared with uninfected cells. Rickettsiae in Vero cells were most often seen in vacuoles containing whorls of membranes ("myelin configurations") which were also seen in uninfected cells. Rickettsiae in Vero cells were pleomorphic, with acid phosphatase reaction product in their periplasmic space. This suggests either rickettsial degradation by lysosomal enzymes which penetrated the cell envelope or a penetration after the rickettsiae were dead. Vacuoles of infected Vero cells showed much more reaction product than that in infected L cells, and most rickettsiae in L cells had a normal appearance and showed no reaction product in their periplasmic space. Images PMID:99368

Burton, P R; Stueckemann, J; Welsh, R M; Paretsky, D

1978-01-01

36

Cell culture (Vero) derived whole virus (H5N1) vaccine based on wild-type virus strain induces cross-protective immune responses  

PubMed Central

The rapid spread and the transmission to humans of avian influenza virus (H5N1) has induced world-wide fears of a new pandemic and raised concerns over the ability of standard influenza vaccine production methods to rapidly supply sufficient amounts of an effective vaccine. We report here on a robust and flexible strategy which uses wild-type virus grown in a continuous cell culture (Vero) system to produce an inactivated whole virus vaccine. Candidate vaccines based on clade 1 and clade 2 influenza H5N1 strains were developed and demonstrated to be highly immunogenic in animal models. The vaccines induce cross-neutralising antibodies, highly cross-reactive T-cell responses and are protective in a mouse challenge model not only against the homologous virus but against other H5N1 strains, including those from another clade. These data indicate that cell culture-grown, whole virus vaccines, based on the wild-type virus, allow the rapid high yield production of a candidate pandemic vaccine. PMID:17614165

Kistner, Otfried; Howard, Keith; Spruth, Martin; Wodal, Walter; Brühl, Peter; Gerencer, Marijan; Crowe, Brian A.; Savidis-Dacho, Helga; Livey, Ian; Reiter, Manfred; Mayerhofer, Ines; Tauer, Christa; Grillberger, Leopold; Mundt, Wolfgang; Falkner, Falko G.; Barrett, P. Noel

2007-01-01

37

Phorbol Esters Isolated from Jatropha Meal Induced Apoptosis-Mediated Inhibition in Proliferation of Chang and Vero Cell Lines  

PubMed Central

The direct feeding of Jatropha meal containing phorbol esters (PEs) indicated mild to severe toxicity symptoms in various organs of different animals. However, limited information is available on cellular and molecular mechanism of toxicity caused by PEs present in Jatropha meal. Thus, the present study was conducted to determine the cytotoxic and mode of action of PEs isolated from Jatropha meal using human hepatocyte (Chang) and African green monkey kidney (Vero) cell lines. The results showed that isolated PEs inhibited cell proliferation in a dose-dependent manner in both cell lines with the CC50 of 125.9 and 110.3 ?g/mL, respectively. These values were compatible to that of phorbol 12-myristate 13-acetate (PMA) values as positive control i.e., 124.5 and 106.3 ?g/mL respectively. Microscopic examination, flow cytometry and DNA fragmentation results confirmed cell death due to apoptosis upon treatment with PEs and PMA at CC50 concentration for 24 h in both cell lines. The Western blot analysis revealed the overexpression of PKC-? and activation of caspase-3 proteins which could be involved in the mechanism of action of PEs and PMA. Consequently, the PEs isolated form Jatropha meal caused toxicity and induced apoptosis-mediated proliferation inhibition toward Chang and Vero cell lines involving over-expression of PKC-? and caspase-3 as their mode of actions. PMID:23203036

Oskoueian, Ehsan; Abdullah, Norhani; Ahmad, Syahida

2012-01-01

38

Generation of High-Yielding Influenza A Viruses in African Green Monkey Kidney (Vero) Cells by Reverse Genetics  

PubMed Central

Influenza A viruses are the cause of annual epidemics of human disease with occasional outbreaks of pandemic proportions. The zoonotic nature of the disease and the vast viral reservoirs in the aquatic birds of the world mean that influenza will not easily be eradicated and that vaccines will continue to be needed. Recent technological advances in reverse genetics methods and limitations of the conventional production of vaccines by using eggs have led to a push to develop cell-based strategies to produce influenza vaccine. Although cell-based systems are being developed, barriers remain that need to be overcome if the potential of these systems is to be fully realized. These barriers include, but are not limited to, potentially poor reproducibility of viral rescue with reverse genetics systems and poor growth kinetics and yields. In this study we present a modified A/Puerto Rico/8/34 (PR8) influenza virus master strain that has improved viral rescue and growth properties in the African green monkey kidney cell line, Vero. The improved properties were mediated by the substitution of the PR8 NS gene for that of a Vero-adapted reassortant virus. The Vero growth kinetics of viruses with H1N1, H3N2, H6N1, and H9N2 hemagglutinin and neuraminidase combinations rescued on the new master strain were significantly enhanced in comparison to those of viruses with the same combinations rescued on the standard PR8 master strain. These improvements pave the way for the reproducible generation of high-yielding human and animal influenza vaccines by reverse genetics methods. Such a means of production has particular relevance to epidemic and pandemic use. PMID:14747549

Ozaki, Hiroichi; Govorkova, Elena A.; Li, Chenghong; Xiong, Xiaoping; Webster, Robert G.; Webby, Richard J.

2004-01-01

39

Generation of high-yielding influenza A viruses in African green monkey kidney (Vero) cells by reverse genetics.  

PubMed

Influenza A viruses are the cause of annual epidemics of human disease with occasional outbreaks of pandemic proportions. The zoonotic nature of the disease and the vast viral reservoirs in the aquatic birds of the world mean that influenza will not easily be eradicated and that vaccines will continue to be needed. Recent technological advances in reverse genetics methods and limitations of the conventional production of vaccines by using eggs have led to a push to develop cell-based strategies to produce influenza vaccine. Although cell-based systems are being developed, barriers remain that need to be overcome if the potential of these systems is to be fully realized. These barriers include, but are not limited to, potentially poor reproducibility of viral rescue with reverse genetics systems and poor growth kinetics and yields. In this study we present a modified A/Puerto Rico/8/34 (PR8) influenza virus master strain that has improved viral rescue and growth properties in the African green monkey kidney cell line, Vero. The improved properties were mediated by the substitution of the PR8 NS gene for that of a Vero-adapted reassortant virus. The Vero growth kinetics of viruses with H1N1, H3N2, H6N1, and H9N2 hemagglutinin and neuraminidase combinations rescued on the new master strain were significantly enhanced in comparison to those of viruses with the same combinations rescued on the standard PR8 master strain. These improvements pave the way for the reproducible generation of high-yielding human and animal influenza vaccines by reverse genetics methods. Such a means of production has particular relevance to epidemic and pandemic use. PMID:14747549

Ozaki, Hiroichi; Govorkova, Elena A; Li, Chenghong; Xiong, Xiaoping; Webster, Robert G; Webby, Richard J

2004-02-01

40

Enhancement of cytotoxicity against Vero E6 cells persistently infected with SARS-CoV by Mycoplasma fermentans.  

PubMed

We previously reported that cells with persistent severe acute respiratory syndrome coronavirus (SARS-CoV) infection were established after apoptotic events. In the present study, we investigated the cytopathic effects of dual infection with SARS-CoV and Mycoplasma fermentans on Vero E6 cells. Dual infection completely killed cells and prevented the establishment of persistent SARS-CoV infection. M. fermentans induced inhibition of cell proliferation, but the cells remained alive. Apoptosis was induced easily in M. fermentans-infected cells, indicating that they were primed for apoptosis. These results indicated that M. fermentans enhances apoptosis in surviving cells that have escaped from SARS-CoV-induced apoptosis. PMID:17277901

Mizutani, T; Fukushi, S; Kenri, T; Sasaki, Y; Ishii, K; Endoh, D; Zamoto, A; Saijo, M; Kurane, I; Morikawa, S

2007-01-01

41

Antiviral potency of mistletoe (Viscum album ssp. album) extracts against human parainfluenza virus type 2 in Vero cells.  

PubMed

Various extracts from the leaves of mistletoe (Viscum album L. ssp. album) were investigated for their antiviral activity on human parainfluenza virus type 2 (HPIV-2) growth in Vero cells. Plant extracts were prepared using distilled water, 50% ethanol, petroleum ether, chloroform and acetone. The 50% effective dose (ED(50)) of aqueous extract for HPIV-2 replication was 0.53 +/- 0.12 micro g/mL, and the antiviral index (AI), which was based on the ratio of the 50% inhibitory concentration (CD(50)) for host cell viability to the ED(50) for parainfluenza virus replication, was 10.05. The aqueous extract was found to be the most selective inhibitor. Furthermore, the aqueous extract at a concentration of 1 micro g/mL was found to inhibit HPIV-2 replication and the virus production was suppressed to more than 99% without any toxic effect on host cells. The chloroform extract was also found to be moderately active. In an effort to further analyse the mechanism of antiviral activity, the effectiveness of the aqueous extract on different steps of virus replication was examined. The antiviral activity could neither be attributed to the direct inactivation of the HPIV-2 nor to the inhibition of adsorption to Vero cells. The active aqueous extract has shown a dose-dependent antiviral activity on virus replication. PMID:12749000

Karagöz, Ali; Onay, Evren; Arda, Nazli; Kuru, Avni

2003-05-01

42

Preclinical evaluation of Vaxfectin®-adjuvanted Vero cell-derived seasonal split and pandemic whole virus influenza vaccines  

PubMed Central

Increasing the potency and supply of seasonal and pandemic influenza vaccines remains an important unmet medical need which may be effectively accomplished with adjuvanted egg- or cell culture-derived vaccines. Vaxfectin®, a cationic lipid-based adjuvant with a favorable safety profile in phase 1 plasmid DNA vaccines trials, was tested in combination with seasonal split, trivalent and pandemic whole virus, monovalent influenza vaccines produced in Vero cell cultures. Comparison of hemagglutination inhibition (HI) antibody titers in Vaxfectin®-adjuvanted to nonadjuvanted vaccinated mice and guinea pigs revealed 3- to 20-fold increases in antibody titers against each of the trivalent influenza virus vaccine strains and 2- to 8-fold increases in antibody titers against the monovalent H5N1 influenza virus vaccine strain. With the vaccine doses tested, comparable antibody responses were induced with formulations that were freshly prepared or refrigerated at conventional 2–8°C storage conditions for up to 6 mo. Comparison of T-cell frequencies measured by interferon-gamma ELISPOT assay between groups revealed increases of between 2- to 10-fold for each of the adjuvanted trivalent strains and up to 22-fold higher with monovalent H5N1 strain. Both trivalent and monovalent vaccines were easy to formulate with Vaxfectin® by simple mixing. These preclinical data support further testing of Vaxfectin®-adjuvanted Vero cell culture vaccines toward clinical studies designed to assess safety and immunogenicity of these vaccines in humans. PMID:23857272

Smith, Larry R.; Wodal, Walter; Crowe, Brian A.; Kerschbaum, Astrid; Bruehl, Peter; Schwendinger, Michael G.; Savidis-Dacho, Helga; Sullivan, Sean M.; Shlapobersky, Mark; Hartikka, Jukka; Rolland, Alain; Barrett, P. Noel; Kistner, Otfried

2013-01-01

43

Chemical Synthesis, Characterisation, and Biocompatibility of Nanometre Scale Porous Anodic Aluminium Oxide Membranes for Use as a Cell Culture Substrate for the Vero Cell Line: A Preliminary Study  

PubMed Central

In this preliminary study we investigate for the first time the biomedical potential of using porous anodic aluminium oxide (AAO) membranes as a cell substrate for culturing the Cercopithecus aethiops (African green monkey) Kidney (Vero) epithelial cell line. One advantage of using the inorganic AAO membrane is the presence of nanometre scale pore channels that allow the exchange of molecules and nutrients across the membrane. The size of the pore channels can be preselected by adjusting the controlling parameters of a temperature controlled two-step anodization process. The cellular interaction and response of the Vero cell line with an in-house synthesised AAO membrane, a commercially available membrane, and a glass control were assessed by investigating cell adhesion, morphology, and proliferation over a 72?h period. The number of viable cells proliferating over the respective membrane surfaces revealed that the locally produced in-house AAO membrane had cells numbers similar to the glass control. The study revealed evidence of focal adhesion sites over the surface of the nanoporous membranes and the penetration of cellular extensions into the pore structure as well. The outcome of the study has revealed that nanometre scale porous AAO membranes have the potential to become practical cell culture scaffold substrates with the capability to enhance adhesion and proliferation of Vero cells. PMID:24579077

Poinern, Gérrard Eddy Jai; Le, Xuan Thi; Becker, Thomas; Fawcett, Derek

2014-01-01

44

Lipid peroxidation induced by bolesatine, a toxin of Boletus satanas: implication in m5dC variation in Vero cells related to inhibition of cell growth.  

PubMed

Bolesatine, a glycoprotein from Boletus satanas Lenz, has previously been shown to be mitogenic in rat and human lymphocytes at very low concentrations, whereas higher concentrations inhibited protein synthesis in vitro and in several in vivo systems. The low concentrations (1-10 ng/ml) of bolesatine were shown to activate protein kinase C (PKC) in vitro (cell-free system) and in Vero cells. In the same time, Vero cells significantly proliferated when incubated with bolesatine concentrations ranging from 1 to 10 ng/ml; the DNA synthesis increased by 27-59% as referred to the control, and InsP3 release increased in a concentration-dependent manner, up to 142%. At higher concentrations, 1-10 micrograms in cell-free systems, bolesatine inhibits protein synthesis by hydrolyzing the nucleoside triphosphates GTP and ATP. In the present work, the implication of other toxic mechanisms, such as lipid peroxidation and active radical production, was investigated in relation to inhibition of cell growth, whereas possible modifications of the ratio m5dC/dC+m5dC were determined in order to correlate with the biphasic action of bolesatine in Vero cells. Low concentrations of bolesatine up to 10 ng/ml do not increase malonaldehyde (MDA) production, while they induce hypomethylation (5.2% as compared to 7.1%). Higher concentrations (above 20 ng/ml) increase MDA production, from 58 ng/mg of cellular proteins to 113 ng/mg at a concentration of 50 ng/ml, for example, and induce hypermethylation in Vero cell DNA. It is concluded that low concentrations of bolesatine that are proliferative induce hypomethylation, which could be one of the pathways whereby bolesatine induces cell proliferation. Higher concentrations which enhance lipid peroxidation also induce hypermethylation. These mechanisms could be at least partly implicated in the pathway whereby bolesatine induces cell death. PMID:8788210

Ennamany, R; Marzetto, S; Saboureau, D; Creppy, E E

1995-12-01

45

[The morphological and karyological characteristics of MDCK and vero (B) cells cultures on plant hydrolyzate-based nutrient media].  

PubMed

MDCK and Vero (B) cell cultures were propagated during 10 passages in the experimental nutrient media containing the soybean powder hydrolyzate prepared using trypsin and bromelain enzymes and the rice powder hydrolysate prepared with trypsin and in the control DMEM and SFM4 MegaVir media. The karyological, morphological, and proliferative characteristics of continuous cultures were examined and compared. The experimental media supplied with 3% fetal bovine serum (FBS) (Gibco, U.S.A.) showed high growth-enhancing properties and failed to affect their morphology. After propagated during 10 passages in the experimental media preserved a stable karyotype. MDCK cell cultures in the nutrient media based on rice and soybean powder hydrolyzates low (2%) in FBS caused no substantial changes in the proliferation indices and morphological and karyological characteristics of cell cultures. PMID:21545033

Mikhailova, G R; Mazurkova, N A; Podchernyaeva, R Ya; Ryabchikova, E I; Troshkova, G P; Shishkina, L N

2011-01-01

46

Enhanced growth of influenza vaccine seed viruses in vero cells mediated by broadening the optimal pH range for virus membrane fusion.  

PubMed

Vaccination is one of the most effective preventive measures to combat influenza. Prospectively, cell culture-based influenza vaccines play an important role for robust vaccine production in both normal settings and urgent situations, such as during the 2009 pandemic. African green monkey Vero cells are recommended by the World Health Organization as a safe substrate for influenza vaccine production for human use. However, the growth of influenza vaccine seed viruses is occasionally suboptimal in Vero cells, which places limitations on their usefulness for enhanced vaccine production. Here, we present a strategy for the development of vaccine seed viruses with enhanced growth in Vero cells by changing an amino acid residue in the stem region of the HA2 subunit of the hemagglutinin (HA) molecule. This mutation optimized the pH for HA-mediated membrane fusion in Vero cells and enhanced virus growth 100 to 1,000 times in the cell line, providing a promising strategy for cell culture-based influenza vaccines. PMID:22090129

Murakami, Shin; Horimoto, Taisuke; Ito, Mutsumi; Takano, Ryo; Katsura, Hiroaki; Shimojima, Masayuki; Kawaoka, Yoshihiro

2012-02-01

47

Isolation of measles virus from clinical specimens using B95a and Vero/hSLAM cell-lines.  

PubMed

The clinical presentation of acute measles is normally quite typical, especially in the presence of Koplik's spots, that laboratory test is seldom required to confirm the diagnosis. However, with wide measles vaccination coverage and the extensive use of immunosuppressive chemotherapy, the diagnosis of atypical manifestations of acute measles may require laboratory confirmation. When compared with B95a cell-line, this study shows that the Vero/hSLAM cell-line is sensitive and is recommended for use in the primary isolation of wild-type measles virus from clinical specimens. Throat swab and urine specimens are the clinical specimens of choice and both are recommended for optimal isolation of measles virus from patients suspected of acute measles virus infection. PMID:19852319

Keniscope, C; Juliana, R; Subri, H; Shangari, S R; Wan Nor Azlina, W A; Hamizah, A; Emmi, E E; Nor Azlina, M D; Norizah, I; Chua, K B

2009-03-01

48

Comparison of N-Glycan Pattern of Recombinant Human Coagulation Factors II and IX Expressed in Chinese Hamster Ovary (CHO) and African Green Monkey (Vero) Cells.  

PubMed

The N-glycan patterns of recombinant human coagulation factors II (rF-II) and IX (rF-IX), derived from both transfected Chinese hamster ovary (CHO) cells and African green monkay (Vero) cells produced at industrial scale, were analyzed by binding to carbohydrate-specific lectins and were compared with the glycan structure of human plasma-derived coagulation factors. Human plasma-derived coagulation factors II (hpF-II) and IX (hpF-IX) exhibited complex-type glycan structures with carbohydrate chains capped with alpha(2-6)-sialic acid. Terminal galactose-beta(1-4)-N-acetylglucosamine units were detected in hpF-IX. Both CHO cell-derived rF-II and rF-IX exhibited complex-type glycosylation and contained alpha(2-3)-sialic acid in addition to terminal galactose-beta(1-4)-N-acetylglucosamine. Vero cell-derived rF-IX exhibited a complex-type glycan structure similar to that of CHO cell-derived rF-IX. In contrast, rF-II produced by Vero cells exhibited a glycan microheterogeneity composed of hybrid-type glycosylation containing "high-mannose" structures and complex-type glycosylation containing alpha(2-3)-sialic acid. Galactose-beta(1-4)-N-acetylglucosamine structures and a low concentration of alpha(2-6)-sialic acid were detected in both microheterogeneity fractions of Vero cell-derived rF-II. Although different in their carbohydrate structures, coagulation factors II and IX obtained recombinantly from both transformed CHO cells and Vero cells exhibited coagulation activities comparable with the plasma-derived proteins. PMID:10608038

Fischer; Mitterer; Dorner; Eibl

1996-01-01

49

Effect of bolesatine on phospholipid/calcium dependent protein kinase in Vero cells and in rat thymus.  

PubMed

Bolesatine, a glycoprotein from Boletus satanas Lenz, has previously been shown to be mitogenic to rat and human lymphocytes at very low concentrations, whereas higher concentrations inhibit protein synthesis in vitro and in several in vivo systems. The mechanism whereby this mitogenic activity occurs was previously unknown. To elucidate this mechanism, the effects of bolesatine have been studied in a cell-free system, VERO cells, and in vivo in rat thymus. In a cell-free system, bolesatine appears to be a direct effector of PKC. The activation is concentration dependent for 1-10 ng/ml. At the same time, VERO cells significantly proliferate when incubated with the bolesatine (3, 5 and 10 ng/ml), since the DNA synthesis increases by 27, 48, and 59%, for respectively, 3, 5 and 10 ng/ml compared with control. Moreover, Bolesatine (5 and 10 ng/ml) induces InsP3 release in a concentration-dependent manner (114 and 142%) as compared to control. In vivo, 24 h after oral administration of bolesatine to rates (20, 100 and 200 microg/kg), PKC activity is significantly increased in thymus. THe most effective doses (100 and 200 microg/kg) give 590-620% increase in cytosolic PKC activity and 85-91% increase in total PKC activity as compared to control. This PKC activation by bolesatine in rat thymus is directly linked to the mitogenic activity observed in vivo. Bolesatine is thus capable of activating the PKC directly and/or indirectly (via InsP3 release) during its mitogenic processes. PMID:8660140

Ennamany, R; Kretz, O; Creppy, E E

1995-01-01

50

Formation of very large conductance channels by Bacillus cereus Nhe in Vero and GH(4) cells identifies NheA + B as the inherent pore-forming structure.  

PubMed

The nonhemolytic enterotoxin (Nhe) produced by Bacillus cereus is a pore-forming toxin consisting of three components, NheA, -B and -C. We have studied effects of Nhe on primate epithelial cells (Vero) and rodent pituitary cells (GH(4)) by measuring release of lactate dehydrogenase (LDH), K(+) efflux and the cytosolic Ca(2+) concentration ([Ca(2+)](i)). Plasma membrane channel events were monitored by patch-clamp recordings. Using strains of B. cereus lacking either NheA or -C, we examined the functional role of the various components. In both cell types, NheA + B + C induced release of LDH and K(+) as well as Ca(2+) influx. A specific monoclonal antibody against NheB abolished LDH release and elevation of [Ca(2+)](i). Exposure to NheA + B caused a similar K(+) efflux and elevation of [Ca(2+)](i) as NheA + B + C in GH(4) cells, whereas in Vero cells the rate of K(+) efflux was reduced by 50% and [Ca(2+)](i) was unaffected. NheB + C had no effect on either cell type. Exposure to NheA + B + C induced large-conductance steps in both cell types, and similar channel insertions were observed in GH(4) cells exposed to NheA + B. In Vero cells, NheA + B induced channels of much smaller conductance. NheB + C failed to insert membrane channels. The conductance of the large channels in GH(4) cells was about 10 nS. This is the largest channel conductance reported in cell membranes under quasi-physiological conditions. In conclusion, NheA and NheB are necessary and sufficient for formation of large-conductance channels in GH(4) cells, whereas in Vero cells such large-conductance channels are in addition dependent on NheC. PMID:20821199

Haug, Trude M; Sand, Sverre L; Sand, Olav; Phung, Danh; Granum, Per E; Hardy, Simon P

2010-09-01

51

MDCK and Vero cells for influenza virus vaccine production: a one-to-one comparison up to lab-scale bioreactor cultivation  

Microsoft Academic Search

Over the last decade, adherent MDCK (Madin Darby canine kidney) and Vero cells have attracted considerable attention for production\\u000a of cell culture-derived influenza vaccines. While numerous publications deal with the design and the optimization of corresponding\\u000a upstream processes, one-to-one comparisons of these cell lines under comparable cultivation conditions have largely been neglected.\\u000a Therefore, a direct comparison of influenza virus production

Yvonne Genzel; Christian Dietzsch; Erdmann Rapp; Jana Schwarzer; Udo Reichl

2010-01-01

52

Formation of Very Large Conductance Channels by Bacillus cereus Nhe in Vero and GH 4 Cells Identifies NheA + B as the Inherent PoreForming Structure  

Microsoft Academic Search

The nonhemolytic enterotoxin (Nhe) produced by Bacillus cereus is a pore-forming toxin consisting of three components, NheA, -B and -C. We have studied effects of Nhe on primate epithelial\\u000a cells (Vero) and rodent pituitary cells (GH4) by measuring release of lactate dehydrogenase (LDH), K+ efflux and the cytosolic Ca2+ concentration ([Ca2+]i). Plasma membrane channel events were monitored by patch-clamp recordings.

Trude M. Haug; Sverre L. Sand; Olav Sand; Danh Phung; Per E. Granum; Simon P. Hardy

2010-01-01

53

Ultrastructural study of the life cycle of Rickettsia slovaca , wild and standard type, cultivated in L929 and vero cell lines  

Microsoft Academic Search

Ultrastructural changes induced by Rickettsia slovaca standard type (ST) and wild type (WT) were examined during their life cycle in L929 and Vero cells. R. slovaca invaded the cytoplasm of the host cell by phagocytosis on the 1st d p.i. Rickettsiae adhering to the cytoplasmic membrane\\u000a were engulfed by cellular extensions and occurred in phagocytic vacuoles. Binary fission of rickettsia

V. Boldiš; J. Štrus; E. Kocianová; M. Tušek-Žnidari?; K. Štefanidesová; E. Špitalská

2009-01-01

54

Apoptosis induction in BEFV-infected Vero and MDBK cells through Src-dependent JNK activation regulates caspase-3 and mitochondria pathways.  

PubMed

Our previous report demonstrated that bovine ephemeral fever virus (BEFV)-infected cultured cells could induce caspase-dependent apoptosis. This study aims to further elucidate how BEFV activates the caspase cascade in bovine cells. BEFV replicated and induced apoptosis in Vero and Madin-Darby bovine kidney (MDBK) cells, and a kinetic study showed a higher efficiency of replication and a greater apoptosis induction ability of BEFV in Vero cells. Src and c-Jun N-terminal kinase (JNK) inhibitor, but not extracellular signal-regulated kinase (ERK) or p38 inhibitor, alleviated BEFV-mediated cytopathic effect and apoptosis. In BEFV-infected Vero and MDBK cells, BEFV directly induced Src tyrosine-418 phosphorylation and JNK phosphorylation and kinase activity, which was inhibited specifically by SU6656 and SP600125, respectively. The caspase cascade and its downstream effectors, Poly (ADP-ribose) polymerase (PARP) and DFF45, were also activated simultaneously upon BEFV infection. In addition, cytochrome c, but not Smac/DIABLO, was released gradually from mitochondria after BEFV infection. SU6656 suppressed Src, JNK, and caspase-3 and -9 activation, as well as PARP and DFF45 cleavage; SP600125 reduced JNK and caspase-3 and -9 activation, as well as PARP and DFF45 cleavage. Taken together, these results strongly support the hypothesis that a Src-dependent JNK signaling pathway plays a key role in BEFV-induced apoptosis. The molecular mechanism identified in our study may provide useful information for the treatment of BEFV. PMID:19846041

Chen, Chun-Yen; Chang, Chin-Yang; Liu, Hung-Jen; Liao, Ming-Huei; Chang, Chi-I; Hsu, Jue-Liang; Shih, Wen-Ling

2010-01-01

55

Nonreplicating Vaccinia Virus Vectors Expressing the H5 Influenza Virus Hemagglutinin Produced in Modified Vero Cells Induce Robust Protection?  

PubMed Central

The timely development of safe and effective vaccines against avian influenza virus of the H5N1 subtype will be of the utmost importance in the event of a pandemic. Our aim was first to develop a safe live vaccine which induces both humoral and cell-mediated immune responses against human H5N1 influenza viruses and second, since the supply of embryonated eggs for traditional influenza vaccine production may be endangered in a pandemic, an egg-independent production procedure based on a permanent cell line. In the present article, the generation of a complementing Vero cell line suitable for the production of safe poxviral vaccines is described. This cell line was used to produce a replication-deficient vaccinia virus vector H5N1 live vaccine, dVV-HA5, expressing the hemagglutinin of a virulent clade 1 H5N1 strain. This experimental vaccine was compared with a formalin-inactivated whole-virus vaccine based on the same clade and with different replicating poxvirus-vectored vaccines. Mice were immunized to assess protective immunity after high-dose challenge with the highly virulent A/Vietnam/1203/2004(H5N1) strain. A single dose of the defective live vaccine induced complete protection from lethal homologous virus challenge and also full cross-protection against clade 0 and 2 challenge viruses. Neutralizing antibody levels were comparable to those induced by the inactivated vaccine. Unlike the whole-virus vaccine, the dVV-HA5 vaccine induced substantial amounts of gamma interferon-secreting CD8 T cells. Thus, the nonreplicating recombinant vaccinia virus vectors are promising vaccine candidates that induce a broad immune response and can be produced in an egg-independent and adjuvant-independent manner in a proven vector system. PMID:19279103

Mayrhofer, Josef; Coulibaly, Sogue; Hessel, Annett; Holzer, Georg W.; Schwendinger, Michael; Brühl, Peter; Gerencer, Marijan; Crowe, Brian A.; Shuo, Shen; Hong, Wanjing; Tan, Yee Joo; Dietrich, Barbara; Sabarth, Nicolas; Savidis-Dacho, Helga; Kistner, Otfried; Barrett, P. Noel; Falkner, Falko G.

2009-01-01

56

Innate and adaptive cellular immunity in flavivirus-naïve human recipients of a live-attenuated dengue serotype 3 vaccine produced in Vero cells (VDV3)  

Microsoft Academic Search

VDV3, a clonal derivative of the Mahidol live-attenuated dengue 3 vaccine was prepared in Vero cells. Despite satisfactory preclinical evaluation, VDV3 was reactogenic in humans. We explored whether immunological mechanisms contributed to this outcome by monitoring innate and adaptive cellular immune responses for 28 days after vaccination. While no variations were seen in serum IL12 or TNF? levels, a high

Violette Sanchez; Sophie Gimenez; Brian Tomlinson; Paul K. S. Chan; G. Neil Thomas; Remi Forrat; Laurent Chambonneau; Florence Deauvieau; Jean Lang; Bruno Guy

2006-01-01

57

Transport of an external Lys-Asp-Glu-Leu (KDEL) protein from the plasma membrane to the endoplasmic reticulum: studies with cholera toxin in Vero cells  

Microsoft Academic Search

The A2 chain of cholera toxin (CTX) contains a COOH-terminal Lys-Asp-Glu-Leu (KDEL) se- quence. We have, therefore, analyzed by immunofluo- rescence and by subcellular fractionation in Vero cells whether CTX can be used to demonstrate a retrograde transport of KDEL proteins from the Golgi to the ER. Immunofluorescen ce studies reveal that after a pulse treatment with CTX, the CTX-A

Irina V. Majoul; Philippe I. H. Bastiaens; Hans-Dieter SSling

1996-01-01

58

Comparison of Madin-Darby canine kidney cells (MDCK) with a green monkey continuous cell line (Vero) and human lung embryonated cells (MRC-5) in the isolation of influenza A virus from nasopharyngeal aspirates by shell vial culture.  

PubMed

We report a comparative study of the MDCK, Vero, and MRC-5 cell lines in the isolation of the influenza A (IA) virus. We studied 746 samples in which 63 IA viruses were isolated. The MDCK line displayed 100% sensitivity, the Vero line displayed 71.4%, and the MRC-5 displayed 57.1%. The MDCK line showed a statistically significant difference with respect to the Vero line (P = 0.001) and the MRC-5 line (P = 0.001). The quantitative sensitivity analysis showed the MDCK line to be superior to the other lines. It seems that the MDCK line is still one of the most recommendable for the isolation of the IA virus from respiratory samples. PMID:9196221

Reina, J; Fernandez-Baca, V; Blanco, I; Munar, M

1997-07-01

59

Comparison of Madin-Darby canine kidney cells (MDCK) with a green monkey continuous cell line (Vero) and human lung embryonated cells (MRC-5) in the isolation of influenza A virus from nasopharyngeal aspirates by shell vial culture.  

PubMed Central

We report a comparative study of the MDCK, Vero, and MRC-5 cell lines in the isolation of the influenza A (IA) virus. We studied 746 samples in which 63 IA viruses were isolated. The MDCK line displayed 100% sensitivity, the Vero line displayed 71.4%, and the MRC-5 displayed 57.1%. The MDCK line showed a statistically significant difference with respect to the Vero line (P = 0.001) and the MRC-5 line (P = 0.001). The quantitative sensitivity analysis showed the MDCK line to be superior to the other lines. It seems that the MDCK line is still one of the most recommendable for the isolation of the IA virus from respiratory samples. PMID:9196221

Reina, J; Fernandez-Baca, V; Blanco, I; Munar, M

1997-01-01

60

Bicarbonate/chloride antiport in Vero cells: II. Mechanisms for bicarbonate-dependent regulation of intracellular pH  

SciTech Connect

The rates of bicarbonate-dependent uptake and efflux of /sup 22/Na/sup +/ in Vero cells were studied and compared with the uptake and efflux of /sup 36/Cl/sup -/. Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na/sup +/ was much less affected by changes in pH. The bicarbonate-linked uptake of /sup 22/Na/sup +/ was dependent on internal Cl- but not on internal Na/sup +/. At a constant external concentration of HCO/sub 3/-, the amount of /sup 22/Na/sup +/ associated with the cells increased when the internal concentration of HCO/sub 3/- decreased and vice versa, which is compatible with the possibility that the ion pair NaCO/sub 3/- is the transported species and that the transport is symmetric across the membrane. Bicarbonate inhibited the uptake of /sup 36/Cl/sup -/ both in the absence and presence of Na/sup +/. At alkaline internal pH, HCO/sub 3/- stimulated the efflux of /sup 36/Cl/sup -/ from preloaded cells, while at acidic internal pH both Na/sup +/ and HCO/sub 3/- were required to induce /sup 36/Cl/sup -/ efflux. We propose a model for how bicarbonate-dependent regulation of the internal pH may occur. This model implies the existence of two bicarbonate transport mechanisms that, under physiological conditions, transport OH(-)-equivalents in opposite directions across the plasma membrane.

Olsnes, S.; Ludt, J.; Tonnessen, T.I.; Sandvig, K.

1987-08-01

61

Ultrastructural study of the life cycle of Rickettsia slovaca, wild and standard type, cultivated in L929 and Vero cell lines.  

PubMed

Ultrastructural changes induced by Rickettsia slovaca standard type (ST) and wild type (WT) were examined during their life cycle in L929 and Vero cells. R. slovaca invaded the cytoplasm of the host cell by phagocytosis on the 1st d p.i. Rickettsiae adhering to the cytoplasmic membrane were engulfed by cellular extensions and occurred in phagocytic vacuoles. Binary fission of rickettsia was observed. The nuclear chromatin of eukaryotic cells was rearranged and condensed during 3rd and 6th d p.i. Finally, loss of the plasma membrane integrity, destruction of cytoplasm and nucleus resulted in cell lysis. Degeneration of the host cell caused by WT and ST was observed after 4 and 5 d p.i. in L929 cells and after 3 and 6 d p.i. in Vero cells, respectively. WT type was able to penetrate into the nucleus of the host cell and was responsible for dilatation of the perinuclear space and endoplasmic reticulum, causing more pronounced and different cytopathological changes than the ST. PMID:19418250

Boldis, V; Strus, J; Kocianová, E; Tusek-Znidaric, M; Stefanidesová, K; Spitalská, E

2009-01-01

62

Transcriptional profiling of Vero E6 cells over-expressing SARS-CoV S2 subunit: Insights on viral regulation of apoptosis and proliferation  

SciTech Connect

We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by the diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level.

Yeung, Y.-S. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: ysyeung@graduate.hku.hk; Yip, C.-W. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: h0024004@hkusua.hku.hk; Hon, C.-C. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: h9826299@hkusua.hku.hk; Chow, Ken Y.C. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: chow@pasteur.fr; Ma, Iris C.M. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: h0105962@hkusua.hku.hk; Zeng Fanya [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: fzeng@hkucc.hku.hk; Leung, Frederick C.C. [Department of Zoology, Kadoorie Biological Science Building, University of Hong Kong, Hong Kong (China)], E-mail: fcleung@hkucc.hku.hk

2008-02-05

63

Development of Eimeria bovis in vitro: suitability of several bovine, human and porcine endothelial cell lines, bovine fetal gastrointestinal, Madin-Darby bovine kidney (MDBK) and African green monkey kidney (VERO) cells.  

PubMed

Several bovine, human and porcine endothelial cell lines, bovine fetal gastrointestinal cells (BFGC), Madin-Darby bovine kidney (MDBK) and African green monkey kidney (VERO) cells were exposed in vitro to sporozoites of Eimeria bovis. Parasites invaded all cells used and changed their shape to more stumpy forms within 12 h. Sporozoites left their host cells and invaded new ones frequently within the first 12 h post-infection. Further development took place only in bovine cells, although parasites survived in the other cells for at least 3 weeks. Within the non-bovine cells, conspicuously enlarged parasitophorous vacuoles developed in VERO cells and reached a diameter of 15-20 microm. The best development to first generation schizonts with regard both to time required to mature, to schizont size and to merozoite yields was observed in BFGC, followed by bovine umbilical vein and bovine spleen lymphatic endothelial cells. MDBK cells were less suitable. The life cycle was completed (development of oocysts) only occasionally in BFGC. Results are considered under several aspects. Thus, infected VERO cells may represent a suitable tool for studying the parasitophorous vacuole, while infected endothelial cells represent a system quite narrow to the in vivo situation and should allow basic studies on parasite/host cell interactions and BFGC can be used for the mass production of E. bovis first generation merozoites. PMID:11999015

Hermosilla, C; Barbisch, B; Heise, A; Kowalik, S; Zahner, H

2002-04-01

64

Insulin-like growth factor-binding proteins produced by Vero cells, human oviductal cells and human endometrial cells, and the role of insulin-like growth factor-binding protein-3 in mouse embryo co-culture systems.  

PubMed

Co-culturing embryos on helper cells can mimic the in-vivo environment, thereby enhancing embryo development in vitro. Insulin-like growth factors (IGF) and their binding proteins (IGFBP) also enhance embryo development. To investigate the kinds of IGFBP produced by various cell monolayers and the effects of IGFBP-3 on mouse embryo co-culture systems, 2-cell ICR mouse embryos were cultured in either human tubal fluid medium alone or in the presence of Vero cells, human oviductal cells or endometrial cells. The helper cells were analysed immunohistochemically to investigate the types of IGFBP produced by various cell monolayers. The concentrations of IGF-I and IGFBP-3 in media obtained from the culture of embryos alone, cells alone or cells plus embryos were determined by radioimmunoassays. On day 7, more blastocysts hatched in the co-culture groups (73% in the Vero cell group, 76% in the endometrial cell group and 74% in the oviductal cell group) than in the control group (43%) (P < 0.0001). The results of immunohistochemistry revealed that (i) all three cell groups produced a lot of IGFBP-1, -2 and -3, but only a little of IGFBP-4 and -5; and (ii) IGFBP-1, -2, and -3 were present in blastocysts in either the presence or absence of helper cells. The IGF-I secreted by cell monolayers or embryos was undetectable (detection limit 0.83 microg/l). The IGFBP-3 concentrations in media obtained from co-cultured embryos and cells were significantly higher than in media without embryos (median values in oviductal cell culture medium, 165 versus 127 microg/l, P = 0.04; median values in endometrial cell culture medium, 277.5 versus 183.5 microg/1, P = 0. 0002; median values in Vero cell culture medium, 219 versus 120 microg/l, P = 0.011). Although IGFBP-3 concentration in the medium that contained embryos alone was undetectable by radioimmunoassay (detection limit 1.1 microg/l), immunohistochemistry demonstrated the presence of IGFBP-3 in the embryos. Co-culture in systems in which there was an increased production of IGFBP-3 led to an improved development of mouse embryos. IGFBP can improve the binding of IGF to cell surface receptors of target tissue, and thus enhance the effect of limited IGF concentrations in promoting embryo development in a co-culture system. We conclude that Vero cells, human endometrial cells and oviductal cells produce IGFBP-1, -2, -3, -4 and -5. IGFBP-3 may play a role in embryotrophic potential by either regulating the action of IGF or directly enhancing embryo development. PMID:8671440

Lai, Y M; Wang, H S; Lee, C L; Lee, J D; Huang, H Y; Chang, F H; Lee, J F; Soong, Y K

1996-06-01

65

Genetic and Phenotypic Properties of Vero Cell-Adapted Japanese Encephalitis Virus SA14-14-2 Vaccine Strain Variants and a Recombinant Clone, Which Demonstrates Attenuation and Immunogenicity in Mice.  

PubMed

The live-attenuated Japanese encephalitis virus (JEV) SA14-14-2 vaccine, produced in primary hamster kidney cells, is safe and effective. Past attempts to adapt this virus to replicate in cells that are more favorable for vaccine production resulted in mutations that significantly reduced immunogenicity. In this study, 10 genetically distinct Vero cell-adapted JEV SA14-14-2 variants were isolated and a recombinant wild-type JEV clone, modified to contain the JEV SA14-14-2 polyprotein amino acid sequence, was recovered in Vero cells. A single capsid protein mutation (S66L) was important for Vero cell-adaptation. Mutations were also identified that modulated virus sensitivity to type I interferon-stimulation in Vero cells. A subset of JEV SA14-14-2 variants and the recombinant clone were evaluated in vivo and exhibited levels of attenuation that varied significantly in suckling mice, but were avirulent and highly immunogenic in weanling mice and are promising candidates for the development of a second-generation, recombinant vaccine. PMID:25311701

Gromowski, Gregory D; Firestone, Cai-Yen; Bustos-Arriaga, José; Whitehead, Stephen S

2015-01-01

66

Preparation and characterization of an anti-inflammatory agent based on a zinc-layered hydroxide-salicylate nanohybrid and its effect on viability of Vero-3 cells  

PubMed Central

A new organic-inorganic nanohybrid based on zinc-layered hydroxide intercalated with an anti-inflammatory agent was synthesized through direct reaction of salicylic acid at various concentrations with commercially available zinc oxide. The basal spacing of the pure phase nanohybrid was 15.73 Å, with the salicylate anions arranged in a monolayer form and an angle of 57 degrees between the zinc-layered hydroxide interlayers. Fourier transform infrared study further confirmed intercalation of salicylate into the interlayers of zinc-layered hydroxide. The loading of salicylate in the nanohybrid was estimated to be around 29.66%, and the nanohybrid exhibited the properties of a mesoporous-type material, with greatly enhanced thermal stability of the salicylate compared with its free counterpart. In vitro cytotoxicity assay revealed that free salicylic acid, pure zinc oxide, and the nanohybrid have a mild effect on viability of African green monkey kidney (Vero-3) cells. PMID:23345976

Ramli, Munirah; Hussein, Mohd Zobir; Yusoff, Khatijah

2013-01-01

67

In vitro assessment of the cytotoxicity of nisin, pediocin, and selected colicins on simian virus 40-transfected human colon and Vero monkey kidney cells with trypan blue staining viability assays.  

PubMed

Gram-positive bacterial bacteriocins (nisin and pediocin) and gram-negative bacterial bacteriocins (colicins [Col] E1, E3, E6, E7, and K) were evaluated for cytotoxicity against cultured simian virus 40-transfected human colon (SV40-HC) and Vero monkey kidney (Vero) cells. Bacteriocin-treated cells were assessed for viability by trypan blue staining. Monolayers of SV40-HC and Vero cells were cultured in tissue culture plates (35 degrees C, 10% CO2 in humidified air) with the use of Dulbecco's modified Eagle's medium supplemented with 10% (vol/vol) calf serum. Actively growing cells in the log phase (ca. 10(4) cells per ml) were treated with individual partially purified bacteriocin preparations at 170, 350, and 700 activity units per ml. Duplicate culture plates for each bacteriocin treatment and untreated controls were withdrawn after 16, 32, and 48 h of incubation. Cells were dissociated with trypsin and treated with trypan blue and were then counted in a hemocytometer with the use of a phase-contrast microscope. Viability assays indicated dose-dependent toxicity for some bacteriocins. Nisin, pediocin, and Col E6 were the most cytotoxic bacteriocins; SV40-HC cells demonstrated greater sensitivity than Vero cells did. Some bacteriocins can be toxic to mammalian cells; therefore, bacteriocins intended for use as biopreservatives must be evaluated for toxicity to mammalian cells and for other toxicities. Col E1, Col E3, Col E7, and Col K demonstrated little toxicity at the activities tested, indicating that they are safe and thus have potential for use as food biopreservatives. PMID:12747695

Murinda, S E; Rashid, K A; Roberts, R F

2003-05-01

68

Diphtheria toxin at low pH depolarizes the membrane, increases the membrane conductance and induces a new type of ion channel in Vero cells.  

PubMed Central

Receptor-dependent translocation of diphtheria toxin across the surface membrane of Vero cells was studied using patch clamp techniques. Translocation was induced by exposing cells with surface-bound toxin to low pH. Whole cell current and voltage clamp recordings showed that toxin translocation was associated with membrane depolarization and increased membrane conductance. The conductance increase was voltage independent, with a reversal potential of approximately 15 mV. This value was unaffected by changing the Cl- gradient across the membrane and microfluorometric measurements showed that the cytosolic Ca2+ concentration was only marginally elevated by the translocation. The conductance increase is thus mainly due to monovalent cations. Exposing outside-out and cell-attached patches with bound toxin to low pH induced a new type of ion channel in the membrane. The channel current was inward at negative membrane potentials and the single channel conductance was approximately 30 pS. This value is about three times larger than for receptor-independent channels induced by diphtheria toxin or toxin fragments in artificial lipid membranes. PMID:7523112

Eriksen, S; Olsnes, S; Sandvig, K; Sand, O

1994-01-01

69

Colon tumor cells grown in NASA Bioreactor  

NASA Technical Reports Server (NTRS)

These photos compare the results of colon carcinoma cells grown in a NASA Bioreactor flown on the STS-70 Space Shuttle in 1995 flight and ground control experiments. The cells grown in microgravity (left) have aggregated to form masses that are larger and more similar to tissue found in the body than the cells cultured on the ground (right). The principal investigator is Milburn Jessup of the University of Texas M. D. Anderson Cancer Center. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Cell constructs grown in a rotating bioreactor on Earth (left) eventually become too large to stay suspended in the nutrient media. In the microgravity of orbit, the cells stay suspended. Rotation then is needed for gentle stirring to replenish the media around the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Credit: NASA and University of Texas M. D. Anderson Cancer Center.

2001-01-01

70

Protective effect of methanol extract from citrus press cakes prepared by far-infrared radiation drying on H2O2-mediated oxidative damage in Vero cells  

PubMed Central

In the present study, a suitable drying method was developed for citrus press cakes (CPCs), which are produced as a by-product in citrus juice plants, and the protective effect of methanol extract of CPCs prepared by far-infrared radiation (FIR) drying against H2O2-induced DNA damage was evaluated versus that of freeze-dried CPCs. Methanol extract of FIR-dried CPCs exhibited comparatively good ROS scavenging activity versus the freeze-dried CPCs at the concentration of 100 µg/mL. The extract strongly enhanced the cell viability against H2O2-induced oxidative damage in Vero cells. Lipid peroxidation inhibitory activity of the extract from FIR-dried CPCs was comparable to that of the extract from freeze-dried CPCs. This sample also exhibited good protective effects against H2O2-mediated cell apoptosis as demonstrated by decreased apoptotic body formation in the nuclear staining with Hoechst 33342. In the comet assay, the CPC extracts exhibited strong inhibitory effects against H2O2-mediated DNA damage in a dose-dependent manner. Thus, this study demonstrated that FIR drying effectively preserves CPC as a functionally important natural antioxidant source and the FIR drying can be adapted for drying CPCs and is more economical for massive production than freeze drying. PMID:22125675

Wijesinghe, W.A.J.P.; Senevirathne, Mahinda; Oh, Myung-Cheol

2011-01-01

71

Lactobacillus plantarum isolated from kefir protects vero cells from cytotoxicity by type-II shiga toxin from Escherichia coli O157:H7.  

PubMed

Kefir is a fermented-milk beverage originating and widely consumed in the Caucasus as well as in Eastern Europe and is a source of bacteria with potential probiotic properties. Enterohaemorrhagic Escherichia coli producing Shiga toxin is commonly associated with food-transmitted diseases; the most prevalent serotype causing epidemics is Esch. coli O157:H7. The aim of this study was to evaluate the antagonism of Lactobacillus plantarum isolated from kefir against the action on Vero cells of supernatants of the Esch. coli O157:H7 strain 69160 expressing the type-II Shiga toxin (Stx2) and to study the role of the Lactobacillus cell wall in that inhibition. Spent culture supernatants of Esch. coli O157:H7 strain 69160 led to cytotoxic effects on cultured eukaryotic cells as evidenced by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-bromide-cleavage assay or by lactate-dehyrogenase release. Lb. plantarum CIDCA 83114 reduced the cytotoxic activity of Stx present in strain-69160 supernatants, and this protection was markedly higher than those of Lactobacillus kefir CIDCA 83113 and 8348 and Lb. delbrueckii subsp. bulgaricus CIDCA 333. This antagonism of cytotoxicity was mimicked by Lb. plantarum cell walls but was reduced after heating or protease treatments, thus indicating a protein or peptide as being involved in the protection mechanism. The cell surface of the lactobacilli bound the subunit B of Stx thereby decreasing the cytotoxicity. These interactions could constitute the first step in preventing the damage induced by Esch. coli O157:H7 supernatants, thus representing a valuable means of potentially mitigating the noxious effects of this food pathogen. PMID:23186804

Kakisu, Emiliano; Abraham, Analía G; Farinati, Carla Tironi; Ibarra, Cristina; De Antoni, Graciela L

2013-02-01

72

Bovine Milk Inhibits Both Adhesion of Helicobacter pylori to Sulfatide and Helicobacter pylori-Induced Vacuolation of Vero Cells  

Microsoft Academic Search

Adhesion of Helicobacter pylori to gastricmucosal cells is an initial important step incolonization and infection. To study adhesion, weinvestigated whether milk inhibits the adhesion ofHelicobacter pylori to sulfatide, an acidicglycosphingolipid that exists in human gastric mucosaand to which Helicobacter pylori adheres. As a measureof functional significance, we also studied whether milkinhibits Helicobacter pylori-induced vacuolation of Verocells. We used sulfatide-coated polystyrene

Yoshiyuki Hata; Toru Kita; Motonobu Murakami

1999-01-01

73

Nonreplicating Vaccinia Virus Vectors Expressing the H5 Influenza Virus Hemagglutinin Produced in Modified Vero Cells Induce Robust Protection  

Microsoft Academic Search

The timely development of safe and effective vaccines against avian influenza virus of the H5N1 subtype will be of the utmost importance in the event of a pandemic. Our aim was first to develop a safe live vaccine which induces both humoral and cell-mediated immune responses against human H5N1 influenza viruses and second, since the supply of embryonated eggs for

Josef Mayrhofer; Sogue Coulibaly; Annett Hessel; Georg W. Holzer; Michael Schwendinger; Peter Bruhl; Marijan Gerencer; Brian A. Crowe; Shen Shuo; Wanjing Hong; Yee Joo Tan; Barbara Dietrich; Nicolas Sabarth; Helga Savidis-Dacho; Otfried Kistner; P. Noel Barrett; Falko G. Falkner

2009-01-01

74

Comparative study on the cytotoxicity of different Myrtaceae essential oils on cultured vero and RC-37 cells.  

PubMed

Medicinally and commercially important essential oils from the family Myrtaceae, i.e. cajuput, clove, kanuka and manuka were phytochemically analysed by GC-MS. Cytotoxicity of these essential oils was evaluated in a standard neutral red assay. Maximum noncytotoxic concentrations for cajuput oil and clove oil were determined at 0.006%, kanuka oil and manuka oil were more cytotoxic with a maximum noncytotoxic concentration of 0.001%. The compounds alpha-pinene, eugenol and leptospermone demonstrated maximum noncytotoxic concentrations at dilutions of 0.001%, 0.003% and 0.001%, respectively. However, the terpene 1,8-cineole was about 100 times less toxic to cultured cells with a maximum noncytotoxic concentration of 0.1% and a TC50 value of 0.44%. Manuka essential oil exhibited high levels of virucidal activity against HSV-1 as well against drug-resistant HSV-1 isolates in viral suspension tests. Determination of cytotoxicity of natural products is an important prerequisite for application in cosmetic and health care products and in antiviral tests. PMID:19069246

Schnitzler, P; Wiesenhofer, K; Reichling, J

2008-11-01

75

Cell culture (Vero) derived whole virus (H5N1) vaccine based on wild-type virus strain induces cross-protective immune responses  

Microsoft Academic Search

The rapid spread and the transmission to humans of avian influenza virus (H5N1) have induced world-wide fears of a new pandemic and raised concerns over the ability of standard influenza vaccine production methods to rapidly supply sufficient amounts of an effective vaccine. We report here on a robust and flexible strategy which uses wild-type virus grown in a continuous cell

Otfried Kistner; M. Keith Howard; Martin Spruth; Walter Wodal; Peter Brühl; Marijan Gerencer; Brian A. Crowe; Helga Savidis-Dacho; Ian Livey; Manfred Reiter; Ines Mayerhofer; Christa Tauer; Leopold Grillberger; Wolfgang Mundt; Falko G. Falkner; P. Noel Barrett

2007-01-01

76

The specific activities of Shiga-like toxin type II (SLT-II) and SLT-II-related toxins of enterohemorrhagic Escherichia coli differ when measured by Vero cell cytotoxicity but not by mouse lethality.  

PubMed Central

Characteristically, enterohemorrhagic Escherichia coli (EHEC) strains produce Shiga-like toxin type I (SLT-I), SLT-II, or both of these immunologically distinct cytotoxins. No antigenic or receptor-binding variants of SLT-I have been identified, but a number of SLT-II-related toxins have been described. Because EHEC O91:H21 strain B2F1, which produces two SLT-II-related toxins, is exquisitely virulent in an orally infected, streptomycin-treated mouse model (oral 50% lethal dose [LD50], < 10 organisms), we asked whether the pathogenicity of strain B2F1 was a consequence of SLT-II-related toxin production. For this purpose, we compared the lethality of orally administered E. coli DH5 alpha (Strr) strains that produced different cytotoxic levels of SLT-II, SLT-IIvha (cloned from B2F1), SLT-IIvhb (also cloned from B2F1), or SLT-IIc (cloned from EHEC O157:H7 strain E32511) on Vero cells. We also calculated the specific activities of purified SLT-IIvhb and SLT-II in intraperitoneally injected mice and on Vero cells. The two purified toxins were equally toxic for mice, but SLT-IIvhb was approximately 100-fold less active than SLT-II on Vero cells and bound to the glycolipid receptor Gb3 with lower affinity than did SLT-II. In addition, characterization of SLT-II-related toxin-binding (B) subunit mutants generated in this study revealed that the reduced in vitro cytotoxic levels of the SLT-II-related toxins were due to Asn-16 in the B subunit. Taken together, these findings do not support the idea that B2F1 is uniquely virulent because of the in vivo toxicity of SLT-II-related toxins but do demonstrate differences in in vitro cytotoxic activity among the SLT-II group produced by human EHEC isolates. Images PMID:8300218

Lindgren, S W; Samuel, J E; Schmitt, C K; O'Brien, A D

1994-01-01

77

Quantitative Proteomics Using Stable Isotope Labeling with Amino Acids in Cell Culture Reveals Changes in the Cytoplasmic, Nuclear, and Nucleolar Proteomes in Vero Cells Infected with the Coronavirus Infectious Bronchitis Virus*  

PubMed Central

Virus-host interactions involve complex interplay between viral and host factors, rendering them an ideal target for proteomic analysis. Here we detail a high throughput quantitative proteomics analysis of Vero cells infected with the coronavirus infectious bronchitis virus (IBV), a positive strand RNA virus that replicates in the cytoplasm. Stable isotope labeling with amino acids in cell culture (SILAC) was used in conjunction with LC-MS/MS to identify and quantify 1830 cellular and two viral proteins from IBV-infected cells. Fractionation of cells into cytoplasmic, nuclear, and nucleolar extracts was used to reduce sample complexity and provide information on the trafficking of proteins between the different compartments. Each fraction showed a proportion of proteins exhibiting ?2-fold changes in abundance. Ingenuity Pathway Analysis revealed that proteins that changed in response to infection could be grouped into different functional categories. These included proteins regulated by NF-?B- and AP-1-dependent pathways and proteins involved in the cytoskeleton and molecular motors. A luciferase-based reporter gene assay was used to validate the up-regulation of AP-1- and NF-?B-dependent transcription in IBV-infected cells and confirmed using immunofluorescence. Immunofluorescence was used to validate changes in the subcellular localization of vimentin and myosin VI in IBV-infected cells. The proteomics analysis also confirmed the presence of the viral nucleocapsid protein as localizing in the cytoplasm, nucleus, and nucleolus and the viral membrane protein in the cytoplasmic fraction. This research is the first application of SILAC to study total host cell proteome changes in response to positive sense RNA virus infection and illustrates the versatility of this technique as applied to infectious disease research. PMID:20467043

Emmott, Edward; Rodgers, Mark A.; Macdonald, Andrew; McCrory, Sarah; Ajuh, Paul; Hiscox, Julian A.

2010-01-01

78

Opposite effects of two different strains of equine herpesvirus 1 infection on cytoskeleton composition in equine dermal ED and African green monkey kidney Vero cell lines: application of scanning cytometry and confocal-microscopy-based image analysis in a quantitative study.  

PubMed

Viruses can reorganize the cytoskeleton and restructure the host cell transport machinery. During infection viruses use different cellular cues and signals to enlist the cytoskeleton for their mission. However, each virus specifically affects the cytoskeleton structure. Thus, the aim of our study was to investigate the cytoskeletal changes in homologous equine dermal (ED) and heterologous Vero cell lines infected with either equine herpesvirus 1 (EHV-1) strain Rac-H or Jan-E. We found that Rac-H strain disrupted actin fibers and reduced F-actin level in ED cells, whereas the virus did not influence Vero cell cytoskeleton. Conversely, the Jan-E strain induced polymerization of both F-actin and MT in Vero cells, but not in ED cells. Confocal-microscopy analysis revealed that alpha-tubulin colocalized with viral antigen in ED cells infected with either Rac-H or Jan-E viruses. Alterations in F-actin and alpha-tubulin were evaluated by confocal microscopy, Microimage analysis and scanning cytometry. This unique combination allowed precise interpretation of confocal-based images showing the cellular events induced by EHV-1. We conclude that examination of viral-induced pathogenic effects in species specific cell lines is more symptomatic than in heterologous cell lines. PMID:20349252

Turowska, A; Pajak, B; Godlewski, M M; Dzieciatkowski, T; Chmielewska, A; Tucholska, A; Banbura, M

2010-05-01

79

Safety and Immunogenicity of a Vero Cell Culture-Derived Whole-Virus H5N1 Influenza Vaccine in Chronically Ill and Immunocompromised Patients  

PubMed Central

The development of vaccines against H5N1 influenza A viruses is a cornerstone of pandemic preparedness. Clinical trials of H5N1 vaccines have been undertaken in healthy subjects, but studies in risk groups have been lacking. In this study, the immunogenicity and safety of a nonadjuvanted cell culture-derived whole-virus H5N1 vaccine were assessed in chronically ill and immunocompromised adults. Subjects received two priming immunizations with a clade 1 A/Vietnam H5N1 influenza vaccine, and a subset also received a booster immunization with a clade 2.1 A/Indonesia H5N1 vaccine 12 to 24 months later. The antibody responses in the two populations were assessed by virus neutralization and single radial hemolysis assays. The T-cell responses in a subset of immunocompromised patients were assessed by enzyme-linked immunosorbent spot assay (ELISPOT). The priming and the booster vaccinations were safe and well tolerated in the two risk populations, and adverse reactions were predominantly mild and transient. The priming immunizations induced neutralizing antibody titers of ?1:20 against the A/Vietnam strain in 64.2% of the chronically ill and 41.5% of the immunocompromised subjects. After the booster vaccination, neutralizing antibody titers of ?1:20 against the A/Vietnam and A/Indonesia strains were achieved in 77.5% and 70.8%, respectively, of chronically ill subjects and in 71.6% and 67.5%, respectively, of immunocompromised subjects. The T-cell responses against the two H5N1 strains increased significantly over the baseline values. Substantial heterosubtypic T-cell responses were elicited against the 2009 pandemic H1N1 virus and seasonal A(H1N1), A(H3N2), and B subtypes. There was a significant correlation between T-cell responses and neutralizing antibody titers. These data indicate that nonadjuvanted whole-virus cell culture-derived H5N1 influenza vaccines are suitable for immunizing chronically ill and immunocompromised populations. (This study is registered at ClinicalTrials.gov under registration no. NCT00711295.) PMID:24739978

van der Velden, Maikel V. W.; Geisberger, Alexander; Dvorak, Thomas; Portsmouth, Daniel; Fritz, Richard; Crowe, Brian A.; Herr, Wolfgang; Distler, Eva; Wagner, Eva M.; Zeitlinger, Markus; Sauermann, Robert; Stephan, Christoph; Ehrlich, Hartmut J.; Barrett, P. Noel

2014-01-01

80

Involvement of caspase and reactive oxygen species in cyanobacterial toxin anatoxin-a-induced cytotoxicity and apoptosis in rat thymocytes and Vero cells  

Microsoft Academic Search

. The hepatotoxins and neurotoxins produced by bloom-forming cyanobacteria have been the cause of human and animal health hazards and even death. The most common cyanobacterial neurotoxin is anatoxin-a, and intoxications by these toxins can be fatal through muscular paralysis causing respiratory arrest. We report here anatoxin-a-induced apoptosis in two non-neuronal cells, viz. cultured rat thymocytes and African green monkey

P. V. Lakshmana Rao; R. Bhattacharya; Nidhi Gupta; M. M. Parida; A. S. B. Bhaskar; Rupa Dubey

2002-01-01

81

Organic solar cells using CVD-grown graphene electrodes  

NASA Astrophysics Data System (ADS)

We report on the development of flexible organic solar cells (OSCs) incorporating graphene sheets synthesized by chemical vapor deposition (CVD) as transparent conducting electrodes on polyethylene terephthalate (PET) substrates. A key barrier that must be overcome for the successful fabrication of OSCs with graphene electrodes is the poor-film properties of water-based poly(3,4-ethylenedioxythiphene):poly(styrenesulfonate) (PEDOT:PSS) when coated onto hydrophobic graphene surfaces. To form a uniform PEDOT:PSS film on a graphene surface, we added perfluorinated ionomers (PFI) to pristine PEDOT:PSS to create ‘GraHEL’, which we then successfully spin coated onto the graphene surface. We systematically investigated the effect of number of layers in layer-by-layer stacked graphene anode of an OSC on the performance parameters including the open-circuit voltage (Voc), short-circuit current (Jsc), and fill factor (FF). As the number of graphene layers increased, the FF tended to increase owing to lower sheet resistance, while Jsc tended to decrease owing to the lower light absorption. In light of this trade-off between sheet resistance and transmittance, we determined that three-layer graphene (3LG) represents the best configuration for obtaining the optimal power conversion efficiency (PCE) in OSC anodes, even at suboptimal sheet resistances. We finally developed efficient, flexible OSCs with a PCE of 4.33%, which is the highest efficiency attained so far by an OSC with CVD-grown graphene electrodes to the best of our knowledge.

Kim, Hobeom; Bae, Sang-Hoon; Han, Tae-Hee; Lim, Kyung-Geun; Ahn, Jong-Hyun; Lee, Tae-Woo

2014-01-01

82

Interaction between wall deposition and cell elongation in dark-grown hypocotyl cells in Arabidopsis.  

PubMed

A central problem in plant biology is how cell expansion is coordinated with wall synthesis. We have studied growth and wall deposition in epidermal cells of dark-grown Arabidopsis hypocotyls. Cells elongated in a biphasic pattern, slowly first and rapidly thereafter. The growth acceleration was initiated at the hypocotyl base and propagated acropetally. Using transmission and scanning electron microscopy, we analyzed walls in slowly and rapidly growing cells in 4-d-old dark-grown seedlings. We observed thick walls in slowly growing cells and thin walls in rapidly growing cells, which indicates that the rate of cell wall synthesis was not coupled to the cell elongation rate. The thick walls showed a polylamellated architecture, whereas polysaccharides in thin walls were axially oriented. Interestingly, innermost cellulose microfibrils were transversely oriented in both slowly and rapidly growing cells. This suggested that transversely deposited microfibrils reoriented in deeper layers of the expanding wall. No growth acceleration, only slow growth, was observed in the cellulose synthase mutant cesA6(prc1-1) or in seedlings, which had been treated with the cellulose synthesis inhibitor isoxaben. In these seedlings, innermost microfibrils were transversely oriented and not randomized as has been reported for other cellulose-deficient mutants or following treatment with dichlorobenzonitrile. Interestingly, isoxaben treatment after the initiation of the growth acceleration in the hypocotyl did not affect subsequent cell elongation. Together, these results show that rapid cell elongation, which involves extensive remodeling of the cell wall polymer network, depends on normal cellulose deposition during the slow growth phase. PMID:15181211

Refrégier, Guislaine; Pelletier, Sandra; Jaillard, Danielle; Höfte, Herman

2004-06-01

83

Feasibility of using the Vero SBRT system for intracranial SRS.  

PubMed

The Vero SBRT system was benchmarked in a planning study against the Novalis SRS system for quality of delivered dose distributions to intracranial lesions and assessing the Vero system's capacity for SRS. A total of 27 patients with one brain lesion treated on the Novalis system, with 3 mm leaf width MLC and C-arm gantry, were replanned for Vero, with a 5 mm leaf width MLC mounted on an O-ring gantry allowing rotations around both the horizontal and vertical axis. The Novalis dynamic conformal arc (DCA) planning included vertex arcs, using 90° couch rotation. These vertex arcs cannot be reproduced with Vero due to the mechanical limitations of the O-ring gantry. Alternative class solutions were investigated for the Vero. Additionally, to distinguish between the effect of MLC leaf width and different beam arrangements on dose distributions, the Vero class solutions were also applied for Novalis. In addition, the added value of noncoplanar IMRT was investigated in this study. Quality of the achieved dose distributions was expressed in the conformity index (CI) and gradient index (GI), and compared using a paired Student's t-test with statistical significance for p-values ? 0.05. For lesions larger than 5 cm3, no statistical significant difference in conformity was observed between Vero and Novalis, but for smaller lesions, the dose distributions showed a significantly better conformity for the Novalis (?CI = 13.74%, p = 0.0002) mainly due to the smaller MLC leaf width. Using IMRT on Vero reduces this conformity difference to nonsignificant levels. The cutoff for achieving a GI around 3, characterizing a sharp dose falloff outside the target volume was 4 cm3 for Novalis and 7 cm3 for Vero using DCA technique. Using noncoplanar IMRT, this threshold was reduced to 3 cm3 for the Vero system. The smaller MLC and the presence of the vertex fields allow the Novalis system to better conform the dose around the lesion and to obtain steeper dose falloff outside the lesion. Comparable dosimetric characteristics can be achieved with Vero for lesions larger than 3 cm3 and using IMRT. PMID:24423838

Burghelea, Manuela; Verellen, Dirk; Gevaert, Thierry; Depuydt, Tom; Poels, Kenneth; Simon, Viorica; De Ridder, Mark

2014-01-01

84

A GaAs/GaInP dual junction solar cell grown by molecular beam epitaxy  

NASA Astrophysics Data System (ADS)

We report the recent result of GaAs/GaInP dual-junction solar cells grown by all solid-state molecular-beam-epitaxy (MBE). The device structure consists of a GaIn0.48P homojunction grown epitaxially upon a GaAs homojunction, with an interconnected GaAs tunnel junction. A photovoltaic conversion efficiency of 27% under the AM1.5 globe light intensity is realized for a GaAs/GaInP dual-junction solar cell, while the efficiencies of 26% and 16.6% are reached for a GaAs bottom cell and a GaInP top cell, respectively. The energy loss mechanism of our GaAs/GaInP tandem dual-junction solar cells is discussed. It is demonstrated that the MBE-grown phosphide-containing III—V compound semiconductor solar cell is very promising for achieving high energy conversion efficiency.

Pan, Dai; Shulong, Lu; Lian, Ji; Wei, He; Lifeng, Bian; Hui, Yang; Arimochi, M.; Yoshida, H.; Uchida, S.; Ikeda, M.

2013-10-01

85

Aligned Cell Sheets Grown on Thermo-Responsive Substrates with Microcontact Printed Protein Patterns  

E-print Network

Aligned Cell Sheets Grown on Thermo-Responsive Substrates with Microcontact Printed Protein­4] but ideally, engineered tissues would be made entirely of biological components. Cell sheet engineering techniques address this challenge as they rely on cells to produce their own extracellular matrix (ECM).[5

86

Cyclic-radiation response of murine fibrosarcoma cells grown as pulmonary nodules  

Microsoft Academic Search

The radiation age response of murine fibrosarcoma (FSa) cells grown as pulmonary nodules in CâHf\\/Kam mice was determined. FSa cells were irradiated in vivo either with 10 Gy as 14 day-old lung tumors (i.e., artificial macrometastases) prior to cell separation or with 5 Gy as single cells trapped in the lungs of recipient mice (i.e., artificial micrometastases) following cell separation

David J. Grdina; Nancy Hunter

1982-01-01

87

Intracytoplasmic membrane, phospholipid, and sterol content of Methylobacterium organophilum cells grown under different conditions.  

PubMed Central

Intracytoplasmic membranes were present in Methylobacterium organophilum when cells were grown with methane, but not methanol or glucose, as the sole carbon and energy source. Cells grown with methane as the carbon and energy source and low levels of dissolved oxygen had the greatest amount of intracytoplasmic membrane. Cells grown with increased levels of dissolved oxygen had less intracytoplasmic membrane. The amount of total lipid correlated with the amount of membrane material observed in thin sections. The individual phospholipids varied in amount, but the same four were present in M. organophilum grown with different substrates and oxygen levels. Phosphatidyl choline was present as a major component of the phospholipids. Sterols were present, and they differed from those in the type I methylotroph Methylococcus capsulatus. The relative amounts of different sterols and squalene changed with the substrate provided for growth. The greatest amounts of sterols were found in methane-grown cells grown at low levels of dissolved oxygen. None of the unusual or usual membrane components assayed was uniquely present in the intracytoplasmic membranes. Images PMID:96093

Patt, T E; Hanson, R S

1978-01-01

88

A shift to 50°C provokes death in distinct ways for glucose- and oleate-grown cells of Yarrowia lipolytica.  

PubMed

Based on the observation that shocks provoked by heat or amphiphilic compounds present some similarities, this work aims at studying whether cells grown on oleate (amphiphilic pre-stress) acquire a tolerance to heat shock. In rich media, changing glucose for oleate significantly enhanced the cell resistance to the shock, however, cells grown on a minimal oleate medium lost their ability to grow on agar with the same kinetic than glucose-grown cells (more than 7-log decrease in 18 min compared with 3-log for oleate-grown cells). Despite this difference in kinetics, the sequence of events was similar for oleate-grown cells maintained at 50°C with a (1) loss of ability to form colonies at 27°C, (2) loss of membrane integrity and (3) lysis (observed only for some minimal-oleate-grown cells). Glucose-grown cells underwent different changes. Their membranes, which were less fluid, lost their integrity as well and cells were rapidly inactivated. But, surprisingly, their nuclear DNA was not stained by propidium iodide and other cationic fluorescent DNA-specific probes but became stainable by hydrophobic ones. Moreover, they underwent a dramatic increase in membrane viscosity. The evolution of lipid bodies during the heat shock depended also on the growth medium. In glucose-grown cells, they seemed to coalesce with the nuclear membrane whereas for oleate-grown cells, they coalesced together forming big droplets which could be released in the medium. In some rare cases of oleate-grown cells, lipid bodies were fragmented and occupied all the cell volume. These results show that heat triggers programmed cell death with uncommon hallmarks for glucose-grown cells and necrosis for methyl-oleate-grown cells. PMID:21863313

Ta, Thi Minh Ngoc; Cao-Hoang, Lan; Romero-Guido, Cynthia; Lourdin, Morgane; Phan-Thi, Hanh; Goudot, Sébastien; Marechal, Pierre-André; Waché, Yves

2012-03-01

89

Fabrication of PECVD grown n-i-p silicon nanowire solar cells  

Microsoft Academic Search

Silicon nanowires have been shown to have strong light trapping properties making them a promising photovoltaic material. In this study, silicon nanowires, grown by RF plasma enhanced chemical vapor deposition (PECVD), are incorporated as the absorbing layer in n-i-p solar cells. Silicon nanowires are fabricated at a temperature of 375 °C by Vapor Liquid Solid (VLS) method. Nanowire solar cells

M. M. Adachi; K. S. Karim

2010-01-01

90

Single cell protein production by photosynthetic bacteria grown on the clarified effluents of biogas plant  

Microsoft Academic Search

Anaerobically digested cow dung was separated by centrifugation into solid residue and liquid supernatant fractions. Clarified supernatant fraction, rich in volatile fatty acids, supported the growth of photosynthetic bacteria. Single cell protein from different photosynthetic bacteria, grown on clarified supernatant, was found to be rich in essential and sulphur amino acids. Rhodopseudomonas capsulata produced the best single cell protein.

Sudhanshu Vrati; G. B. Pant

1984-01-01

91

Endocytic activity of Sertoli cells grown in bicameral culture chambers  

SciTech Connect

Immature rat Sertoli cells were cultured for 7 to 14 days on Millipore filters impregnated with a reconstituted basement membrane extract in dual-environment (bicameral) culture chambers. Electron microscopy of the cultured cells revealed the presence of rod-shaped mitochondria, Golgi apparatus, rough endoplasmic reticulum, and Sertoli-Sertoli tight junctions, typical of these cells in vivo. The endocytic activity of both the apical and basal surfaces of the Sertoli cells was examined by either adding alpha 2-macroglobulin (alpha 2-M) conjugated to 20 nm gold particles to the apical chamber or by adding /sup 125/I labeled alpha 2-M to the basal chamber. During endocytosis from the apical surface of Sertoli cells, the alpha 2-M-gold particles were bound initially to coated pits and then internalized into coated vesicles within 5 minutes. After 10 minutes, the alpha 2-M-gold was found in multi-vesicular bodies (MVBs) and by 30 minutes it was present in the lysosomes. The proportion of alpha 2-M-gold found within endocytic cell organelles after 1 hour of uptake was used to estimate the approximate time that this ligand spent in each type of organelle. The alpha 2-M-gold was present in coated pits, coated vesicles, multivesicular bodies, and lysosomes for approximately 3, 11, 22, and 24 minutes, respectively. This indicates that the initial stages of endocytosis are rapid, whereas MVBs and lysosomes are relatively long-lived.

Dai, R.X.; Djakiew, D.; Dym, M.

1987-07-01

92

Plastid distribution in columella cells of a starchless Arabidopsis mutant grown in microgravity  

NASA Technical Reports Server (NTRS)

Wild-type and starchless Arabidopsis thaliana mutant seedlings (TC7) were grown and fixed in the microgravity environment of a U.S. Space Shuttle spaceflight. Computer image analysis of longitudinal sections from columella cells suggest a different plastid positioning mechanism for mutant and wild-type in the absence of gravity.

Hilaire, E.; Paulsen, A. Q.; Brown, C. S.; Guikema, J. A.; Spooner, B. S. (Principal Investigator)

1997-01-01

93

GENERAL CELL STAINING PROTOCOL FOR FLOW CYTOMETRY 1) Except for cells grown in culture, cells obtained directly from tissues must first be resolved to  

E-print Network

. Carefully aspirate supernatant from cell pellet and resuspend pellet in 100ul of 1st reagent in stainingGENERAL CELL STAINING PROTOCOL FOR FLOW CYTOMETRY 1) Except for cells grown in culture, cells obtained directly from tissues must first be resolved to a single cell suspension by means of mechanical

Oliver, Douglas L.

94

Comparison of electrogenic capabilities of microbial fuel cell with different light power on algae grown cathode.  

PubMed

Electricity generation capabilities of microbial fuel cell with different light power on algae grown cathode were compared. Results showed that microbial fuel cell with 6 and 12W power of light always produced higher voltage and power density than with 18 and 26W. Similarly, microbial fuel cell with 6 and 12W of light power always displayed higher Coulombic efficiency and specific power than the one with 18 and 26W. The results also showed that microbial fuel cell with covered anodic chamber always displayed higher voltage, power density, Coulombic efficiency and specific power than the one without covered anodic chamber. Binary quadratic equations can be used to express the relationships between the light power and the voltage, power density, Coulombic efficiency and specific power. Although lower power of light on algae grown cathode and covering anodic chamber will increase system's electricity production, they will not significantly reduce its internal resistance. PMID:22929741

Juang, D F; Lee, C H; Hsueh, S C

2012-11-01

95

Detailed Structural and Quantitative Analysis Reveals the Spatial Organization of the Cell Walls of in Vivo Grown Mycobacterium leprae and in Vitro Grown Mycobacterium tuberculosis*  

PubMed Central

The cell wall of mycobacteria consists of an outer membrane, analogous to that of Gram-negative bacteria, attached to the peptidoglycan (PG) via a connecting polysaccharide arabinogalactan (AG). Although the primary structure of these components is fairly well deciphered, issues such as the coverage of the PG layer by covalently attached mycolates in the outer membrane and the spatial details of the mycolic acid attachment to the arabinan have remained unknown. It is also not understood how these components work together to lead to the classical acid-fast staining of mycobacteria. Because the majority of Mycobacterium tuberculosis bacteria in established experimental animal infections are acid-fast negative, clearly cell wall changes are occurring. To address both the spatial properties of mycobacterial cell walls and to begin to study the differences between bacteria grown in animals and cultures, the cell walls of Mycobacterium leprae grown in armadillos was characterized and compared with that of M. tuberculosis grown in culture. Most fundamentally, it was determined that the cell wall of M. leprae contained significantly more mycolic acids attached to PG than that of in vitro grown M. tuberculosis (mycolate:PG ratios of 21:10 versus 16:10, respectively). In keeping with this difference, more arabinogalactan (AG) molecules, linking the mycolic acids to PG, were found. Differences in the structures of the AG were also found; the AG of M. leprae is smaller than that of M. tuberculosis, although the same basic structural motifs are retained. PMID:21555513

Bhamidi, Suresh; Scherman, Michael S.; Jones, Victoria; Crick, Dean C.; Belisle, John T.; Brennan, Patrick J.; McNeil, Michael R.

2011-01-01

96

Commissioning and initial stereotactic ablative radiotherapy experience with Vero.  

PubMed

The purpose of this study is to describe the comprehensive commissioning process and initial clinical performance of the Vero linear accelerator, a new radiotherapy device recently installed at UT Southwestern Medical Center specifically developed for delivery of image-guided stereotactic ablative radiotherapy (SABR). The Vero system utilizes a ring gantry to integrate a beam delivery platform with image guidance systems. The ring is capable of rotating ± 60° about the vertical axis to facilitate noncoplanar beam arrangements ideal for SABR delivery. The beam delivery platform consists of a 6 MV C-band linac with a 60 leaf MLC projecting a maximum field size of 15 × 15 cm² at isocenter. The Vero planning and delivery systems support a range of treatment techniques, including fixed beam conformal, dynamic conformal arcs, fixed gantry IMRT in either SMLC (step-and-shoot) or DMLC (dynamic) delivery, and hybrid arcs, which combines dynamic conformal arcs and fixed beam IMRT delivery. The accelerator and treatment head are mounted on a gimbal mechanism that allows the linac and MLC to pivot in two dimensions for tumor tracking. Two orthogonal kV imaging subsystems built into the ring facilitate both stereoscopic and volumetric (CBCT) image guidance. The system is also equipped with an always-active electronic portal imaging device (EPID). We present our commissioning process and initial clinical experience focusing on SABR applications with the Vero, including: (1) beam data acquisition; (2) dosimetric commissioning of the treatment planning system, including evaluation of a Monte Carlo algorithm in a specially-designed anthropomorphic thorax phantom; (3) validation using the Radiological Physics Center thorax, head and neck (IMRT), and spine credentialing phantoms; (4) end-to-end evaluation of IGRT localization accuracy; (5) ongoing system performance, including isocenter stability; and (6) clinical SABR applications. PMID:24710458

Solberg, Timothy D; Medin, Paul M; Ramirez, Ezequiel; Ding, Chuxiong; Foster, Ryan D; Yordy, John

2014-01-01

97

Lithium Induces ER Stress and N-Glycan Modification in Galactose-Grown Jurkat Cells  

PubMed Central

We previously reported that lithium had a significant impact on Ca2+ regulation and induced unfolded protein response (UPR) in yeast cells grown on galactose due to inhibition of phosphoglucomutase (PGM), however the exact mechanism has not been established yet. In this study, we analysed lithium's effect in galactose-fed cells to clarify whether these ER-related changes are the result of a relative hypoglycemic state. Furthermore, we investigated whether the alterations in galactose metabolism impact protein post-translational modifications. Thus, Jurkat cells were incubated in glucose or galactose containing media with or without lithium treatment. We found that galactose-fed and lithium treated cells showed better survivability than fasting cells. We also found higher UDP-Hexose and glycogen levels in these cells compared to fasting cells. On the other hand, the UPR (X-box binding protein 1 mRNA levels) of galactose-fed and lithium treated cells was even greater than in fasting cells. We also found increased amount of proteins that contained N-linked N-acetyl-glucosamine, similar to what was reported in fasting cells by a recent study. Our results demonstrate that lithium treatment of galactose-fed cells can induce stress responses similar to hypoglycemia, however cell survival is still secured by alternative pathways. We propose that clarifying this process might be an important addition toward the better understanding of the molecular mechanisms that regulate ER-associated stress response. PMID:23894652

Kátai, Emese; Yahiro, Rikki K. K.; Poór, Viktor S.; Montskó, Gergely; Zrínyi, Zita; Kovács, Gábor L.; Miseta, Attila

2013-01-01

98

Cyclic-radiation response of murine fibrosarcoma cells grown as pulmonary nodules  

SciTech Connect

The radiation age response of murine fibrosarcoma (FSa) cells grown as pulmonary nodules in C/sub 3/Hf/Kam mice was determined. FSa cells were irradiated in vivo either with 10 Gy as 14 day-old lung tumors (i.e., artificial macrometastases) prior to cell separation or with 5 Gy as single cells trapped in the lungs of recipient mice (i.e., artificial micrometastases) following cell separation and synchronization by centrifugal elutriation. Flow microfluorometry (FMF) was used to determine cell-cycle parameters and the relative synchrony of the separated populations, as well as the percent contamination of normal diploid cells in each of the tumor cell populations. Tumor populations containing up to 90% G/sub 1/, 60% S-, and 75% G/sub 2/+M-phase tumor cells were obtained. Cell clonogenicity, determined using a lung colony assay, ranged from 0.7 to 6% for control FSa cells from the various elutriator fractions. The radiation sensitivity of these separated cell populations varied by a factor of 6, regardless of whether the cells were irradiated as artificial micro or macro-metastases. In each experiment, tumor populations most enriched in s-phase cells exhibited the greatest radiation sensitivity. To confirm that these populations were highly enriched in S-phase cells and to demonstrate that they were more radiosensitive than FSa cells in other parts of the cell cycle, the elutriated tumor populations were exposed to either suicide labeling by high specific activity tritiated thymidine or hydroxyurea. The resultant age response curves were qualitatively similar to those obtained following irradiation and reflected the S-phase sensitivity of FSa cells to these agents.

Grdina, D.J.; Hunter, N.

1982-10-01

99

Epitaxially grown polycrystalline silicon thin-film solar cells on solid-phase crystallised seed layers  

NASA Astrophysics Data System (ADS)

This paper presents the fabrication of poly-Si thin film solar cells on glass substrates using seed layer approach. The solid-phase crystallised P-doped seed layer is not only used as the crystalline template for the epitaxial growth but also as the emitter for the solar cell structure. This paper investigates two important factors, surface cleaning and intragrain defects elimination for the seed layer, which can greatly influence the epitaxial grown solar cell performance. Shorter incubation and crystallisation time is observed using a simplified RCA cleaning than the other two wet chemical cleaning methods, indicating a cleaner seed layer surface is achieved. Cross sectional transmission microscope images confirm a crystallographic transferal of information from the simplified RCA cleaned seed layer into the epi-layer. RTA for the SPC seed layer can effectively eliminate the intragrain defects in the seed layer and improve structural quality of both of the seed layer and the epi-layer. Consequently, epitaxial grown poly-Si solar cell on the RTA treated seed layer shows better solar cell efficiency, Voc and Jsc than the one on the seed layer without RTA treatment.

Li, Wei; Varlamov, Sergey; Xue, Chaowei

2014-09-01

100

Cyclic-radiation response of murine fibrosarcoma cells grown as pulmonary nodules  

SciTech Connect

The radiation age response of murine fibrosarcoma (FSa) cells grown as pulmonary nudules in C/sub 3/Hf/Kam mice was determined. FSa cells were irradiated in vivo either with 10 Gy as 14 day-old lung tumors (i.e., artifical micrometastases) following cell separation and synchronization by centrifugal elutriation. Flow microfluorometry (FMF) was used to determine cell-cycle parameters and the relative synchrony of the separated populations, as well as the percent contamination of normal diploid cells in each of the tumor cells populations. Tumor populations containing up to 90% G/sub 1/-, 60% S-, and 75% G/sub 2/+M-phase tumor cells were obtained. Cell clonogenicity, determined using a lung colony assay, ranged from 0.7 to 6% for control FSa cells from the various elutriator fractions. The radiation sensitivity of these separated cell populations varied by a factor of 6, regardless of whether the cells were irradiated as artifical micro or macro-metastases. In each experiment, tumor population most enriched in S-phase cells exhibited the greatest radiation sensitivity. To confirm that these populations were highly enriched in S-phase cells and to demonstrate that they were more radiosensitive than FSa cells in other parts of the cell cycle, the elutriated tumor population were exposed to either suicide labeling by high specific activity tritated thymidine or hydroxyurea. The resultant age response curves were qualitatively similar to those obtained following irradiation and reflected the S-phase sensitivity of FSa cells to these agents.

Grdina, D.J.; Hunter, N.

1982-10-01

101

AlGaAs quantum-well solar cell junctions on beryllium telluride grown on silicon  

NASA Astrophysics Data System (ADS)

A bandgap combination of 1.7 eV and 1.1 eV offers the highest theoretical efficiency for a series-connected tandem-junction solar cell. The monolithic structure of aluminum gallium arsenide grown on silicon is a natural implementation, but has long-standing crystal-quality challenges such as lattice mismatch and island growth of AlGaAs. We address the growth issues by use of an interlayer of BeTe on silicon. AlGaAs grown on BeTe has a strong tendency for island formation, which is suppressed by low-temperature growth initiation. A barrier for electrical transport at the p-BeTe/p-AlGaAs interface is also reduced by low-temperature growth, and BeTe anneal under arsenic rather than tellurium flux. Al0.15Ga0.85As-GaAs multiple quantum-well p-i-n junction structures were grown on both Si/BeTe and GaAs substrates for electrical characterization. In preliminary results, the short-circuit photocurrent JSC and open-circuit voltage VOC is lower in the Si/BeTe based junction than the GaAs based junction, with about twice the fractional reduction of VOC than of JSC. A graded-bandgap emitter structure with different n+GaAs top contact layer thicknesses exhibited JSC reduction less than 15%.

Clark, Kevin; Maldonado, Eduardo; Amir, Fatima; Bate, Robert; Kirk, Wiley

2007-03-01

102

Mesenchymal traits are selected along with stem features in breast cancer cells grown as mammospheres  

PubMed Central

Increasing evidence indicates that invasive properties of breast cancers rely on gain of mesenchymal and stem features, which has suggested that the dual targeting of these phenotypes may represent an appealing therapeutic strategy. It is known that the fraction of stem cells can be enriched by culturing breast cancer cells as mammospheres (MS), but whether these pro-stem conditions favor also the expansion of cells provided of mesenchymal features is still undefined. In the attempt to shed light on this issue, we compared the phenotypes of a panel of 10 breast cancer cell lines representative of distinct subtypes (luminal, HER2-positive, basal-like and claudin-low), grown in adherent conditions and as mammospheres. Under MS-proficient conditions, the increment in the fraction of stem-like cells was associated to upregulation of the mesenchymal marker Vimentin and downregulation of the epithelial markers expressed by luminal cells (E-cadherin, KRT18, KRT19, ESR1). Luminal cells tended also to upregulate the myoepithelial marker CD10. Taken together, our data indicate that MS-proficient conditions do favor mesenchymal/myoepithelial features, and indicate that the use of mammospheres as an in vitro tumor model may efficiently allow the exploitation of therapeutic approaches aimed at targeting aggressive tumors that have undergone epithelial-to-mesenchymal transition. PMID:23095640

Borgna, Silvia; Armellin, Michela; di Gennaro, Alessandra; Maestro, Roberta; Santarosa, Manuela

2012-01-01

103

Zinc Oxide Grown by CVD Process as Transparent Contact for Thin Film Solar Cell Applications  

NASA Astrophysics Data System (ADS)

Metalorganic chemical vapor deposition of ZnO films (MOCVD) [1] started to be comprehensively investigated in the 1980s, when thin film industries were looking for ZnO deposition processes especially useful for large-scale coatings at high growth rates. Later on, when TCO for thin film solar cells started to be developed, another advantage of growing TCO films by the CVD process has been highlighted: the surface roughness. Indeed, a large number of studies on CVD ZnO revealed that an as-grown rough surface cn be obtained with this deposition process [2-4]. A rough surface induces a light scattering effect, which can significantly improve light trapping (and therefore current photo-generation) within thin film silicon solar cells. The CVD process, indeed, directly leads to as-grown rough ZnO films without any post-etching step (the latter is often introduced to obtain a rough surface, when working with as-deposited flat sputtered ZnO). This fact could turn out to be a significant advantage when upscaling the manufacturing process for actual commercial production of thin film solar modules. The zinc and oxygen sources for CVD growth of ZnO films are given in Table 6.1.

Faÿ, S.; Shah, A.

104

Characterization of Epitaxial Film Silicon Solar Cells Grown on Seeded Display Glass: Preprint  

SciTech Connect

We report characterizations of epitaxial film crystal silicon (c-Si) solar cells with open-circuit voltages (Voc) above 560 mV. The 2-um absorber cells are grown by low-temperature (<750 degrees C) hot-wire CVD (HWCVD) on Corning EAGLE XG display glass coated with a layer-transferred (LT) Si seed. The high Voc is a result of low-defect epitaxial Si (epi-Si) growth and effective hydrogen passivation of defects. The quality of HWCVD epitaxial growth on seeded glass substrates depends on the crystallographic quality of the seed and the morphology of the epitaxial growth surface. Heterojunction devices consist of glass/c-Si LT seed/ epi n+ Si:P/epi n- Si:P/intrinsic a-Si:H/p+ a-Si:H/ITO. Similar devices grown on electronically 'dead' n+ wafers have given Voc {approx}630 mV and {approx}8% efficiency with no light trapping features. Here we study the effects of the seed surface polish on epi-Si quality, how hydrogenation influences the device character, and the dominant junction transport physics.

Young, D. L.; Grover, S.; Teplin, C.; Stradins, P.; LaSalvia, V.; Chuang, T. K.; Couillard, J. G.; Branz, H. M.

2012-06-01

105

Comparison of Chloroflexus aurantiacus strain J-10-fl proteomes of cells grown chemoheterotrophically and photoheterotrophically  

SciTech Connect

Chloroflexus aurantiacus J-10-fl is a thermophilic green bacterium, a filamentous anoxygenic phototroph, and the model organism of the phylum Chloroflexi. We applied high-throughput, liquid chromatography-mass spectrometry in a global quantitative proteomics investigation of C. aurantiacus cells grown under oxic (chemoorganoheterotrophically) and anoxic (photoorganoheterotrophically) redox states. Our global analysis identified 13,524 high-confidence peptides that matched to 1,286 annotated proteins, 242 of which were either uniquely identified or significantly increased in abundance under anoxic culture conditions. Fifty-three of the 242 proteins are previously characterized photosynthesis-related proteins, including chlorosome proteins, proteins involved in the bacteriochlorophyll biosynthesis, 3-hydroxypropionate (3-OHP) CO2 fixation pathway, and components of electron transport chains. The remaining 190 proteins have not previously been reported. Of these, five proteins were found to be encoded by genes from a novel operon and observed only in photoheterotrophically grown cells. These proteins candidates may prove useful in further deciphering the phototrophic physiology of C. aurantiacus and other filamentous anoxygenic phototrophs.

Cao, Li; Bryant, Donald A.; Schepmoes, Athena A.; Vogl, Kajetan; Smith, Richard D.; Lipton, Mary S.; Callister, Stephen J.

2012-01-17

106

Electron-cytochemical study of Ca2+ in cotyledon cells of soybean seedlings grown in microgravity  

NASA Technical Reports Server (NTRS)

Microgravity and horizontal clinorotation are known to cause the rearrangement of the structural-functional organization of plant cells, leading to accelerated aging. Altered gravity conditions resulted in an increase in the droplets volume in cells and the destruction of chloroplast structure in Arabidopsis thaliana plants, an enhancement of cytosolic autophagaous processes, an increase in the respiration rate and a greater number of multimolecular forms of succinate- and malate dehydrogenases in cells of the Funaria hygrometrica protonema and Chlorella vulgaris, and changes in calcium balance of cells. Because ethylene is known to be involved in cell aging and microgravity appears to speed the process, and because soybean seedlings grown in space produce higher ethylene levels we asked: 1) does an acceleration of soybean cotyledon cell development and aging occur in microgravity? 2) what roles do Ca2+ ions and the enhanced ethylene level play in these events? Therefore, the goal of our investigation was to examine of the interaction of microgravity and ethylene on the localization of Ca2+ in cotyledon mesophyll of soybean seedlings.

Nedukha, O.; Brown, C. S.; Kordyum, E.; Piastuch, W. C.; Guikema, J. A. (Principal Investigator)

1999-01-01

107

33 CFR 110.73b - Indian River at Vero Beach, Fla.  

Code of Federal Regulations, 2013 CFR

...2013-07-01 2013-07-01 false Indian River at Vero Beach, Fla. 110.73b Section 110.73b Navigation and Navigable...Special Anchorage Areas § 110.73b Indian River at Vero Beach, Fla. (a) Area A. Beginning at a point located on the...

2013-07-01

108

33 CFR 110.73b - Indian River at Vero Beach, Fla.  

Code of Federal Regulations, 2011 CFR

...2011-07-01 2011-07-01 false Indian River at Vero Beach, Fla. 110.73b Section 110.73b Navigation and Navigable...Special Anchorage Areas § 110.73b Indian River at Vero Beach, Fla. (a) Area A. Beginning at a point located on the...

2011-07-01

109

33 CFR 110.73b - Indian River at Vero Beach, Fla.  

Code of Federal Regulations, 2012 CFR

...2012-07-01 2012-07-01 false Indian River at Vero Beach, Fla. 110.73b Section 110.73b Navigation and Navigable...Special Anchorage Areas § 110.73b Indian River at Vero Beach, Fla. (a) Area A. Beginning at a point located on the...

2012-07-01

110

33 CFR 110.73b - Indian River at Vero Beach, Fla.  

Code of Federal Regulations, 2014 CFR

...2014-07-01 2014-07-01 false Indian River at Vero Beach, Fla. 110.73b Section 110.73b Navigation and Navigable...Special Anchorage Areas § 110.73b Indian River at Vero Beach, Fla. (a) Area A. Beginning at a point located on the...

2014-07-01

111

FRABEL's REIMAGINED at McKEE BOTANICAL GARDEN 350 US FEDERAL HIGHWAY, VERO BEACH  

E-print Network

FRABEL's REIMAGINED at McKEE BOTANICAL GARDEN 350 US FEDERAL HIGHWAY, VERO BEACH TUESDAY, MARCH 12:45 Arrive at McKee Botanical Garden. I will gather all reciprocal garden passes prior to entering) east to US 1. Go North on US 1 to Vero Beach. McKee Botanical Garden is located at 350 US Highway 1

Hill, Jeffrey E.

112

Phase III Clinical Trials Comparing the Immunogenicity and Safety of the Vero Cell-Derived Japanese Encephalitis Vaccine Encevac with Those of Mouse Brain-Derived Vaccine by Using the Beijing-1 Strain  

PubMed Central

The immunogenicity and safety of an inactivated cell culture Japanese encephalitis vaccine (CC-JEV) were compared with those of an inactivated mouse brain-derived Japanese encephalitis vaccine (MB-JEV) in phase III clinical multicenter trials conducted in children. The vaccines contain the same Japanese encephalitis virus strain, the Beijing-1 strain. Two independent clinical trials (trials 1 and 2) were conducted. Trial 1 was conducted in 468 healthy children. Each subject was injected with 17 ?g per dose of either CC-JEV or MB-JEV, and the immunogenicity and safety of the vaccines were investigated. Trial 1 showed that CC-JEV was more immunogenic and reactive than MB-JEV at the same dose. Therefore, to adjust the immunogenicity of CC-JEV to that of MB-JEV, a vaccine that has had a good track record regarding its efficacy for a long time, trial 2 was conducted in 484 healthy children. To improve the stability, CC-JEV was converted from a liquid type to a freeze-dried type of vaccine. Each subject was injected subcutaneously with either 4 ?g per dose of CC-JEV, 8 ?g per dose of CC-JEV, or 17 ?g per dose of MB-JEV twice, at an interval of 2 to 4 weeks, followed by an additional booster immunization 1 to 15 months after the primary immunization. Based on the results of trial 2, 4 ?g per dose of the freeze-dried CC-JEV (under the label Encevac) was selected as a substitute for the MB-JEV. Encevac was approved and launched in 2011 and has since been in use as a 2nd-generation Japanese encephalitis vaccine in Japan. (These studies have been registered at the JapicCTI under registration no. JapicCTI-132063 and JapicCTI-080586 for trials 1 and 2, respectively.) PMID:24334689

Miyazaki, Chiaki; Okada, Kenji; Ozaki, Takao; Hirose, Mizuo; Iribe, Kaneshige; Ishikawa, Yuji; Togashi, Takehiro; Ueda, Kohji

2014-01-01

113

? integrin targeting for radiosensitization of three-dimensionally grown human head and neck squamous cell carcinoma cells.  

PubMed

Integrin cell adhesion molecules play a crucial role in tumor cell resistance to radio- and chemotherapy and are therefore considered attractive targets for cancer therapy. Here, we assessed the role of ?1 integrin-interacting ? integrin subunits in more physiological three-dimensional extracellular matrix grown head and neck squamous cell carcinoma (HNSCC) cell cultures for evaluating cytotoxic and radiosensitizing potential. ?2, ?3, ?5 and ?6 integrins, which are overexpressed in HNSCC according to Oncomine database analysis, were coprecipitated with ?1 integrin. More potently than ?2, ?5 or ?6 integrin inhibition, siRNA-based ?3 integrin targeting resulted in reduced clonogenic cell survival, induced apoptosis and enhanced radiosensitivity. These events were associated with diminished phosphorylation of Akt, Cortactin and Paxillin. Cell line-dependently, simultaneous ?3 and ?1 integrin inhibition led to higher cytotoxicity and radiosensitization than ?3 integrin blocking alone. Stable overexpression of wild-type and constitutively active forms of the integrin signaling mediator focal adhesion kinase (FAK) revealed FAK as a key determinant of ?3 integrin depletion-mediated radiosensitization. Our findings show that ?3 integrin is essentially involved in HNSCC cell radioresistance and critical for a modified cellular radiosensitivity along with ?1 integrins. PMID:25497870

Steglich, Anne; Vehlow, Anne; Eke, Iris; Cordes, Nils

2015-02-28

114

Carriers transport properties in GaInP solar cells grown by molecular beam epitaxy  

NASA Astrophysics Data System (ADS)

The transport properties of carriers in GaInP solar cells grown by molecular beam epitaxy are investigated by temperature-dependent current-voltage (I-V) measurements. In contrast to GaInP/AlGaInP heterostructure, a long PL decay time is observed in GaInP/AlInP, which is ascribed to a lower interface recombination due to an improved carriers' confinement in the case of the high-energy barrier. However, the series resistance induced by the high potential barrier at GaInP/AlInP interface due to a big valence band offset prevents the improvement of solar cell's performance. An S-shape like I-V characteristic observed at low temperatures indicates that the transport of major carriers is limited by the barrier. A calculation based on the combination of a normal photovoltaic device with a barrier-affected thermal carriers transport explicitly explains this abnormal I-V characteristic. Our study demonstrates the critical role of the barrier-induced series resistance in the determination of solar cell's performance.

Dai, P.; Lu, S. L.; Arimochi, M.; Uchida, S.; Watanabe, T.; Luo, X. D.; Yang, H.

2014-12-01

115

A complement-fixing antigen from Trypanosoma cruzi grown in cell cultures.  

PubMed

A complement-fixing (CF) antigen was prepared from amastigotes and trypomastigotes of Trypanosoma cruzi (Ernestina strain) grown in beef embryo cell cultures. Multiple lots of the antigen, which consisted of a supernate of washed and disrupted organisms, required material from 10(6) to 10(7) total organism per ml for optimum CF activity. Antibody at dilutions up to 1:256 was demonstrable in various sera from infected animals or patients. Contaminating beef cells from infected cultures were shown to be partly responsible for crossreactions of the antigen by CF with sera from cases of cutaneous leishmaniasis in whom concomitant infection with T. cruzi could be excluded. There were no cross-reactions with syphilitic sera and the frequency of positive reactions with normal sera was very low. Some characterisitics of the antigen included stability to storage at -20 degrees C and -70 degrees C for months, inactivation at 60 degrees C and by lyophilization, and an estimated molecular size of between 50,000 and 100,000 on the basis of membrane filtration. PMID:65921

Neva, F A; Gam, A A

1977-01-01

116

Radial junction amorphous silicon solar cells on PECVD-grown silicon nanowires.  

PubMed

Constructing radial junction hydrogenated amorphous silicon (a-Si:H) solar cells on top of silicon nanowires (SiNWs) represents a promising approach towards high performance and cost-effective thin film photovoltaics. We here develop an all-in situ strategy to grow SiNWs, via a vapour-liquid-solid (VLS) mechanism on top of ZnO-coated glass substrate, in a plasma-enhanced chemical vapour deposition (PECVD) reactor. Controlling the distribution of indium catalyst drops allows us to tailor the as-grown SiNW arrays into suitable size and density, which in turn results in both a sufficient light trapping effect and a suitable arrangement allowing for conformal coverage of SiNWs by subsequent a-Si:H layers. We then demonstrate the fabrication of radial junction solar cells and carry on a parametric study designed to shed light on the absorption and quantum efficiency response, as functions of the intrinsic a-Si:H layer thickness and the density of SiNWs. These results lay a solid foundation for future structural optimization and performance ramp-up of the radial junction thin film a-Si:H photovoltaics. PMID:22539188

Yu, Linwei; O'Donnell, Benedict; Foldyna, Martin; Roca i Cabarrocas, Pere

2012-05-17

117

Hybrid solar cells based on DC magnetron sputtered films of n-ITO on APMOVPE grown p-InP  

Microsoft Academic Search

Hybrid indium-tin-oxide (ITO)\\/InP solar cells are discussed. The cells are constructed by DC magnetron sputter deposition of ITO onto high-quality InP films grown by atmospheric pressure metal-organic vapor-phase epitaxy (APMOVPE). A record efficiency of 18.9%, measured under standard Solar Energy Research Institute reporting conditions, has been obtained. The p-InP surface is shown to be type converted, principally by the ITO,

T. J. Coutts; X. Li; M. W. Wanlass; K. A. Emery; T. A. Gessert

1988-01-01

118

Enhanced conversion efficiency of InGaN multiple quantum well solar cells grown on a patterned sapphire substrate  

NASA Astrophysics Data System (ADS)

This study demonstrated the enhanced conversion efficiency of an indium gallium nitride (InGaN) multiple quantum well (MQW) solar cell fabricated on a patterned sapphire substrate (PSS). Compared to conventional solar cells grown on a planar sapphire substrate, threading dislocation defects were found to be reduced from 1.28 × 109 to 3.62 × 108 cm-2, leading to an increase in short-circuit current density (JSC = 1.09 mA.cm-2) of approximately 60%. In addition, the open-circuit voltage and fill factor (VOC = 2.05 V; FF = 51%) of the solar cells grown on PSS were nearly identical to those of conventional devices. The enhanced performance is primarily due to improvements in the crystalline quality of the epitaxial layers, reducing the trapping of photogenerated electrons and holes by nonradiative recombination centers in MQW, with a corresponding increase in the transport efficiency of the carriers outside the device.

Lee, Ya-Ju; Lee, Min-Hung; Cheng, Chun-Mao; Yang, Chia-Hao

2011-06-01

119

Proteomic analysis of Staphylococcus aureus biofilm cells grown under physiologically relevant fluid shear stress conditions  

PubMed Central

Background The biofilm forming bacterium Staphylococcus aureus is responsible for maladies ranging from severe skin infection to major diseases such as bacteremia, endocarditis and osteomyelitis. A flow displacement system was used to grow S. aureus biofilms in four physiologically relevant fluid shear rates (50, 100, 500 and 1000 s-1) to identify proteins that are associated with biofilm. Results Global protein expressions from the membrane and cytosolic fractions of S. aureus biofilm cells grown under the above shear rate conditions are reported. Sixteen proteins in the membrane-enriched fraction and eight proteins in the cytosolic fraction showed significantly altered expression (p?

2014-01-01

120

The functional expression of human bone-derived cells grown on rapidly resorbable calcium phosphate ceramics.  

PubMed

The use of biodegradable bone substitutes is advantageous for alveolar ridge augmentation, since it avoids second-site surgery for autograft harvesting. This study examines the effect of novel, rapidly resorbable calcium phosphates on the expression of bone-related genes and proteins by human bone-derived cells (HBDC) and compares this behavior to that of tricalciumphosphate (TCP). Test materials were alpha-TCP, and four materials which were created from beta-Rhenanite and its derivatives: R1-beta-Rhenanite (CaNaPO(4)); R1/M2 composed of CaNaPO(4) and MgNaPO(4); R1+SiO(2) composed of CaNaPO(4) and 9% SiO(2) (wt%); and R17-Ca(2)KNa(PO(4))(2). HBDC were grown on the substrata for 3, 5, 7, 14 and 21 days, counted and probed for various mRNAs and proteins (Type I collagen, osteocalcin, osteopontin, osteonectin, alkaline phosphatase and bone sialoprotein). All substrata supported continuous cellular growth for 21 days. At day 21, surfaces of R1+SiO(2) and R17 had the highest number of HBDC. At 14 and 21 days, cells on R1 and on R1+SiO(2) displayed significantly enhanced expression of all osteogenic proteins. Since all novel calcium phosphates supported cellular proliferation together with expression of bone-related proteins at least as much as TCP, these ceramics can be regarded as potential bone substitutes. R1 and R1+SiO(2) had the most effect on osteoblastic differentiation, thus suggesting that these materials may possess a higher potency to enhance osteogenesis than TCP. PMID:14585721

Knabe, C; Berger, G; Gildenhaar, R; Howlett, C R; Markovic, B; Zreiqat, H

2004-01-01

121

Rubella Virus Maturation and Production in Two Host Cell Systems  

Microsoft Academic Search

Summary When inoculated at the same MOI, Vero cells released a larger amount of infectious rubella virus into the culture medium than did BHK21 cells. However, BHK21 cells (in monolayer or in suspension) produced more intracellular infectious virus than Vero cells when tested 24 h after infection. Maturation of the virus in BHK21 cells occurred at the plasma membrane and,

Gilbert Bardeletti; Jacques Tektoff; Danièle Gautheron

1979-01-01

122

Guggulsterone production in cell suspension cultures of the guggul tree, Commiphora wightii, grown in shake-flasks and bioreactors.  

PubMed

Cell suspension cultures of Commiphora wightii, grown in modified MS medium containing 2,4-dichlorophenoxyacetic acid (0.5 mg l(-1)) and kinetin (0.25 mg l(-1)), produced approximately 5 microg guggulsterone g(-1) dry wt. In a 2 l stirred tank bioreactor, the biomass was 5.5 g l(-1) and total guggulsterone was 36 microg l(-1). PMID:17354018

Mathur, Meeta; Ramawat, K G

2007-06-01

123

Accumulation of a novel glycolipid and a betaine lipid in cells of Rhodobacter sphaeroides grown under phosphate limitation.  

PubMed

Cells of the photosynthetic bacterium Rhodobacter sphaeroides grown under phosphate-limiting conditions accumulated nonphosphorous glycolipids and lipids carrying head groups derived from amino acids. Concomitantly, the relative amount of phosphoglycerolipids decreased from 90 to 22 mol% of total polar lipids in the membranes. Two lipids, not detectable in cells grown under standard conditions, were synthesized during phosphate-limited growth. Fast atom bombardment mass spectroscopy, exact mass measurements, 1H NMR spectroscopy, sugar composition analysis, and methylation analysis of the predominant glycolipid led to the identification of the novel compound 1,2-di-O-acyl-3-O-[alpha-D-glucopyranosyl-(1-->4)-O-beta-D-galactopyr anosyl]glycerol. The second lipid was identified as the betaine lipid 1,2-di-O-acyl-[4'-(N,N,N-trimethyl)-homoserine]glycerol by cochromatography employing an authentic standard from Chlamydomonas reinhardtii, fast atom bombardment mass spectroscopy, exact mass measurements, and 1H NMR spectroscopy. Prior to this observation, the occurrence of this lipid was thought to be restricted to lower plants and algae. Apparently, these newly synthesized nonphosphorous lipids, in addition to the sulfo- and the ornithine lipid also found in R. sphaeroides grown under optimal conditions, take over the role of phosphoglycerolipids in phosphate-deprived cells. PMID:7872771

Benning, C; Huang, Z H; Gage, D A

1995-02-20

124

Growth and characterization of Czochralski-grown n and p-type GaAs for space solar cell substrates  

NASA Technical Reports Server (NTRS)

Progress in LEC (liquid encapsulated Czochralski) crystal growth techniques for producing high-quality, 3-inch-diameter, n- and p-type GaAs crystals suitable for solar cell applications is described. The LEC crystals with low dislocation densities and background impurities, high electrical mobilities, good dopant uniformity, and long diffusion lengths were reproducibly grown through control of the material synthesis, growth and doping conditions. The capability for producing these large-area, high-quality substrates should positively impact the manufacturability of highly efficiency, low cost, radiation-hard GaAs solar cells.

Chen, R. T.

1983-01-01

125

Study of a 1?eV GaNAsSb photovoltaic cell grown on a silicon substrate  

SciTech Connect

We report the performance of a 1?eV GaNAsSb photovoltaic cell grown on a Si substrate with a SiGe graded buffer grown using molecular beam epitaxy. For comparison, the performance of a similar 1?eV GaN{sub 0.018}As{sub 0.897}Sb{sub 0.085} photovoltaic cell grown on a GaAs substrate was also reported. Both devices were in situ annealed at 700?°C for 5?min, and a significant performance improvement over our previous result was observed. The device on the GaAs substrate showed a low open circuit voltage (V{sub OC}) of 0.42?V and a short circuit current density (J{sub SC}) of 23.4?mA/cm{sup 2} while the device on the Si substrate showed a V{sub OC} of 0.39?V and a J{sub SC} of 21.3?mA/cm{sup 2}. Both devices delivered a quantum efficiency of 50%–55% without any anti-reflection coating.

Tan, K. H.; Loke, W. K.; Wicaksono, S.; Li, D.; Leong, Y. R.; Yoon, S. F. [School of Electrical and Electronic Engineering, Nanyang Technological University, Nanyang Avenue, Singapore 639798 (Singapore)] [School of Electrical and Electronic Engineering, Nanyang Technological University, Nanyang Avenue, Singapore 639798 (Singapore); Sharma, P.; Milakovich, T.; Bulsara, M. T.; Fitzgerald, E. A. [Massachusetts Institute of Technology, 77 Massachusetts Ave., Cambridge, Massachusetts 02139 (United States)] [Massachusetts Institute of Technology, 77 Massachusetts Ave., Cambridge, Massachusetts 02139 (United States)

2014-03-10

126

Single Junction InGaP/GaAs Solar Cells Grown on Si Substrates using SiGe Buffer Layers  

NASA Technical Reports Server (NTRS)

Single junction InGaP/GaAs solar cells displaying high efficiency and record high open circuit voltage values have been grown by metalorganic chemical vapor deposition on Ge/graded SiGe/Si substrates. Open circuit voltages as high as 980 mV under AM0 conditions have been verified to result from a single GaAs junction, with no evidence of Ge-related sub-cell photoresponse. Current AM0 efficiencies of close to 16% have been measured for a large number of small area cells, whose performance is limited by non-fundamental current losses due to significant surface reflection resulting from greater than 10% front surface metal coverage and wafer handling during the growth sequence for these prototype cells. It is shown that at the material quality currently achieved for GaAs grown on Ge/SiGe/Si substrates, namely a 10 nanosecond minority carrier lifetime that results from complete elimination of anti-phase domains and maintaining a threading dislocation density of approximately 8 x 10(exp 5) per square centimeter, 19-20% AM0 single junction GaAs cells are imminent. Experiments show that the high performance is not degraded for larger area cells, with identical open circuit voltages and higher short circuit current (due to reduced front metal coverage) values being demonstrated, indicating that large area scaling is possible in the near term. Comparison to a simple model indicates that the voltage output of these GaAs on Si cells follows ideal behavior expected for lattice mismatched devices, demonstrating that unaccounted for defects and issues that have plagued other methods to epitaxially integrate III-V cells with Si are resolved using SiGe buffers and proper GaAs nucleation methods. These early results already show the enormous and realistic potential of the virtual SiGe substrate approach for generating high efficiency, lightweight and strong III-V solar cells.

Ringel, S. A.; Carlin, J. A.; Andre, C. L.; Hudait, M. K.; Gonzalez, M.; Wilt, D. M.; Clark, E. B.; Jenkins, P.; Scheiman, D.; Allerman, A.

2002-01-01

127

[The accumulation and degradation dynamics of cyanophycin in cyanobacteria grown in symbiotic associations with plant tissues and cells].  

PubMed

Five different artificial associations of cyanobacterial cells with the cells or tissues of nightshade and rauwolfia were studied. The associations grown on nitrogen-containing media produced heterocysts. Cyanobacterial cells in the associations retained their ability to take up bound nitrogen from the medium, to store it in the form of cyanophycin granules, and to use them in the process of symbiotic growth. The synthesis and degradation of cyanophycin granules in cyanobacterial cells were more active in the associations than in monocultures. In the symbiotic associations of Chlorogloeopsis fritschii ATCC 27193 with Solanum laciniatum cells and of Nostoc muscorum CALU 304 with the Rauwolfia serpentina callus, heterocysts were produced at 3- to 30-fold higher cyanophycin contents than in cyanobacterial monocultures. In contrast, in the association of N. muscorum CALU 304 with the Solanum dulcamara callus, heterocysts were produced at lower cyanophycin contents than in the N. muscorum CALU 304 monoculture. The degradation of cyanophycin granules in N. muscorum CALU 304 cells grown in associations with plant tissues or cells was subjected to mathematical analysis. The activation of cyanophycin degradation and heterocyst production in the associations N. muscorum CALU 304-R. serpentina and C. fritschii-S. laciniatum was accompanied by an enhanced synthesis of the nitrogen-containing alkaloids in plant cells. The data obtained suggest that an integrated system of nitrogen homeostasis can be formed in symbiotic associations. Depending on the growth stage of an association, its plant member can either stimulate the accumulation of bound nitrogen in vegetative cyanobacterial cells in the form of cyanophycin granules, or activate their degradation, or initiate the formation of heterocysts independently of the cyanobacterial sensory-signalling system. PMID:12901011

Gorelova, O A; Kle?menov, S Iu

2003-01-01

128

Beta 1 integrin binding plays a role in the constant traction force generation in response to varying stiffness for cells grown on mature cardiac extracellular matrix.  

PubMed

We have previously reported a unique response of traction force generation for cells grown on mature cardiac ECM, where traction force was constant over a range of stiffnesses. In this study we sought to further investigate the role of the complex mixture of ECM on this response and assess the potential mechanism behind it. Using traction force microscopy, we measured cellular traction forces and stresses for mesenchymal stem cells (MSCs) grown on polyacrylamide gels at a range of stiffnesses (9, 25, or 48kPa) containing either adult rat heart ECM, different singular ECM proteins including collagen I, fibronectin, and laminin, or ECM mimics comprised of varying amounts of collagen I, fibronectin, and laminin. We also measured the expression of integrins on these different substrates as well as probed for ?1 integrin binding. There was no significant change in traction force generation for cells grown on the adult ECM, as previously reported, whereas cells grown on singular ECM protein substrates had increased traction force generation with an increase in substrate stiffness. Cells grown on ECM mimics containing collagen I, fibronectin and laminin were found to be reminiscent of the traction forces generated by cells grown on native ECM. Integrin expression generally increased with increasing stiffness except for the ?1 integrin, potentially implicating it as playing a role in the response to adult cardiac ECM. We inhibited binding through the ?1 integrin on cells grown on the adult ECM and found that the inhibition of ?1 binding led to a return to the typical response of increasing traction force generation with increasing stiffness. Our data demonstrates that cells grown on the mature cardiac ECM are able to circumvent typical stiffness related cellular behaviors, likely through ?1 integrin binding to the complex composition. PMID:25220424

Gershlak, Joshua R; Black, Lauren D

2015-01-15

129

Microsecond minority carrier lifetimes in HWCVD-grown films and implications for thin film solar cells  

E-print Network

-wire deposition; Silicon; Photoconductive decay; Photovoltaics 1. Introduction We propose the design for thin filmMicrosecond minority carrier lifetimes in HWCVD-grown films and implications for thin film solar design for thin-film photovoltaics. D 2005 Elsevier B.V. All rights reserved. Keywords: Hot

Atwater, Harry

130

Purification and catalytic properties of two catechol 1,2-dioxygenase isozymes from benzoate-grown cells of Acinetobacter radioresistens.  

PubMed

Two catechol 1,2-dioxygenase (C1,2O) isozymes (IsoA and IsoB) have been purified to homogeneity from a strain of Acinetobacter radioresistens grown on benzoate as the sole carbon and energy source. IsoA and IsoB are both homodimers composed of a single type of subunit with molecular mass of 38,600 and 37,700, Da respectively. In conditions of low ionic strength, IsoA can aggregate as a trimer, in contrast to IsoB, which maintains the dimeric structure, as also supported by the kinetic parameters (Hill numbers). IsoA is identical to the enzyme previously purified from the same bacterium grown on phenol, whereas the IsoB is selectively expressed using benzoate as carbon source. This is the first evidence of the presence of differently expressed C1,2O isozymes in A. radioresistens or more generally of multiple C1,2O isozymes in benzoate-grown Acinetobacter cells. Purified IsoA and IsoB contain approximately 1 iron(III) ion per subunit and both show electronic absorbance and EPR features typical of Fe(III) intradiol dioxygenases. The kinetic properties of the two enzymes such as the specificities toward substituted catechols, the main catalytic parameters, and their behavior in the presence of different kind of inhibitors are, unexpectedly, very similar, in contrast to most of the previously known dioxygenase isozymes. PMID:11307956

Briganti, F; Pessione, E; Giunta, C; Mazzoli, R; Scozzafava, A

2000-11-01

131

Biotransformation of d-Limonene to (+) trans-Carveol by Toluene-Grown Rhodococcus opacus PWD4 Cells  

PubMed Central

The toluene-degrading strain Rhodococcus opacus PWD4 was found to hydroxylate d-limonene exclusively in the 6-position, yielding enantiomerically pure (+) trans-carveol and traces of (+) carvone. This biotransformation was studied using cells cultivated in chemostat culture with toluene as a carbon and energy source. The maximal specific activity of (+) trans-carveol formation was 14.7 U (g of cells [dry weight])?1, and the final yield was 94 to 97%. Toluene was found to be a strong competitive inhibitor of the d-limonene conversion. Glucose-grown cells did not form any trans-carveol from d-limonene. These results suggest that one of the enzymes involved in toluene degradation is responsible for this allylic monohydroxylation. Another toluene degrader (Rhodococcus globerulus PWD8) had a lower specific activity but was found to oxidize most of the formed trans-carveol to (+) carvone, allowing for the biocatalytic production of this flavor compound. PMID:11375201

Duetz, Wouter A.; Fjällman, Ann H. M.; Ren, Shuyu; Jourdat, Catherine; Witholt, Bernard

2001-01-01

132

2.0–2.1 eV GaxIn1?xP solar cells grown on relaxed GaAsP step grades  

Microsoft Academic Search

A high quality solar cell with a bandgap in the range of 2.0-2.1 eV may enable the development of four- and five-junction solar cells for terrestrial and space applications. In this paper we describe a set of 2.0-2.1 eV nVp solar cells fabricated from Gaxln1-xP and grown on compositional step-grades of GaAs1-yPy, on GaAs substrates. Cells were grown by atmospheric

Myles A. Steiner; Ryan M. France; Mark W. Wanlass; John F. Geisz; Waldo J. Olavarria; Jeffrey J. Carapella; Anna Duda; Manuel J. Romero; Carl R. Osterwald; Paul Ciszek; Darius Kuciauskas

2010-01-01

133

Cu(In,Ga)Se 2 thin-film solar cells grown with cracked selenium  

NASA Astrophysics Data System (ADS)

Cu(In 1-xGa x)Se 2 (CIGS) films have been grown by using cracked selenium. In conventional evaporation system, the Se atoms were supplied as large clusters (Se x, x>5). However, the size of clusters can be reduced by the thermal cracking. The film qualities grown with small clusters (Se x, x<4) would be improved, since the smaller size molecules easily react with elemental metals, resulting in the reduction of selenium vacancies and the enhancement of surface migration. The CIGS films were deposited by the three-stage method with cracked selenium, and the films were evaluated by SEM, XRD, EDX, C- V measurement and admittance spectroscopy. It was found from the C- V characteristics that the carrier concentrations of the CIGS films grown with cracked selenium were increased with increasing the cracking temperature. The result clearly showed that the use of cracked selenium was effective for reduction of selenium vacancies. The conversion efficiency of 15.4% was obtained by using cracked selenium at a cracking temperature of 500 °C.

Kawamura, Masahiro; Fujita, Toshiyuki; Yamada, Akira; Konagai, Makoto

2009-01-01

134

"allometry" Deterministic Approaches in Cell Size, Cell Number and Crude Fiber Content Related to the Physical Quality of Kangkong (Ipomoea reptans) Grown Under Different Plant Density Pressures  

NASA Astrophysics Data System (ADS)

Kangkong, especially the upland type (Ipomoea reptans) is popularly consumed as a vegetable dish in the South East Asian countries for its quality related to Vitamins (A and C) and crude fiber contents. Higher fiber contents would prevent from the occurrence of colon cancer and diverticular disease. With young stem edible portion, its cell number and size contribute to the stem crude fiber content. The mathematical approach of allometry of cell size, number, and fiber content of stem could be used in determining the 'best' plant density pressure in producing the quality young stem to be consumed. Basically, allometry is the ratio of relative increment (growth or change) rates of two parameters, or the change rate associated to the log of measured variables relationship. Kangkog grown equal or lower than 55 plants m-2 produced bigger individual plant and good quality (physical) kangkong leafy vegetable, but with lower total yield per unit area as compared to those grown at higher densities.

Selamat, A.; Atiman, S. A.; Puteh, A.; Abdullah, N. A. P.; Mohamed, M. T. M.; Zulkeefli, A. A.; Othman, S.

135

High-efficiency GaAs and GaInP solar cells grown by all solid-state molecular-beam-epitaxy.  

PubMed

We report the initial results of GaAs and GaInP solar cells grown by all solid-state molecular-beam-epitaxy (MBE) technique. For GaAs single-junction solar cell, with the application of AlInP as the window layer and GaInP as the back surface field layer, the photovoltaic conversion efficiency of 26% at one sun concentration and air mass 1.5 global (AM1.5G) is realized. The efficiency of 16.4% is also reached for GaInP solar cell. Our results demonstrate that the MBE-grown phosphide-contained III-V compound semiconductor solar cell can be quite comparable to the metal-organic-chemical-vapor-deposition-grown high-efficiency solar cell. PMID:22040124

Lu, Shulong; Ji, Lian; He, Wei; Dai, Pan; Yang, Hui; Arimochi, Masayuki; Yoshida, Hiroshi; Uchida, Shiro; Ikeda, Masao

2011-01-01

136

75 FR 79293 - Amendment and Revocation of Class E Airspace; Vero Beach, FL  

Federal Register 2010, 2011, 2012, 2013, 2014

...10-ASO-33] Amendment and Revocation of Class E Airspace; Vero Beach, FL AGENCY: Federal...SUMMARY: This action amends Class E surface airspace, and airspace extending...feet above the surface, and removes Class E airspace designated as an extension to...

2010-12-20

137

75 FR 65581 - Proposed Amendment and Revocation of Class E Airspace, Vero Beach, FL  

Federal Register 2010, 2011, 2012, 2013, 2014

...Proposed Amendment and Revocation of Class E Airspace, Vero Beach, FL AGENCY: Federal...SUMMARY: This action proposes to amend Class E surface airspace, and airspace extending...feet above the surface, and remove Class E airspace designated as an extension to...

2010-10-26

138

Temperature coefficients and radiation induced DLTS spectra of MOCVD grown n(+)p InP solar cells  

NASA Technical Reports Server (NTRS)

The effects of temperature and radiation on n(+)p InP solar cells and mesa diodes grown by metallorganic chemical vapor deposition (MOCVD) were studied. It was shown that MOCVD is capable of consistently producing good quality InP solar cells with Eff greater than 19 percent which display excellent radiation resistance due to minority carrier injection and thermal annealing. It was also shown that universal predictions of InP device performance based on measurements of a small group of test samples can be expected to be quite accurate, and that the degradation of an InP device due to any incident particle spectrum should be predictable from a measurement following a single low energy proton irradiation.

Walters, Robert J.; Statler, Richard L.; Summers, Geoffrey P.

1991-01-01

139

Dye-sensitized solar cells with vertically aligned TiO2 nanowire arrays grown on carbon fibers.  

PubMed

One-dimensional semiconductor TiO2 nanowires (TNWs) have received widespread attention from solar cell and related optoelectronics scientists. The controllable synthesis of ordered TNW arrays on arbitrary substrates would benefit both fundamental research and practical applications. Herein, vertically aligned TNW arrays in situ grown on carbon fiber (CF) substrates through a facile, controllable, and seed-assisted thermal process is presented. Also, hierarchical TiO2 -nanoparticle/TNW arrays were prepared that favor both the dye loading and depressed charge recombination of the CF/TNW photoanode. An impressive conversion efficiency of 2.48 % (under air mass 1.5 global illumination) and an apparent efficiency of 4.18 % (with a diffuse board) due to the 3D light harvesting of the wire solar cell were achieved. Moreover, efficient and inexpensive wire solar cells made from all-CF electrodes and completely flexible CF-based wire solar cells were demonstrated, taking into account actual application requirements. This work may provide an intriguing avenue for the pursuit of lightweight, cost-effective, and high-performance flexible/wearable solar cells. PMID:24488679

Cai, Xin; Wu, Hongwei; Hou, Shaocong; Peng, Ming; Yu, Xiao; Zou, Dechun

2014-02-01

140

Antigenic Protein In Microgravity-Grown Human Mixed Mullerian Tumor (LN1) Cells Preserved In RNA Stabilizing Agent  

NASA Technical Reports Server (NTRS)

Cells treated with RNAlater(TradeMark) have previously been shown to contain antigenic proteins that can be visualized using Western blot analysis. These proteins seem to be stable for several months when stored in RNA stabilizer at 4 C. Antigenic protein can be recovered from cells that have been processed using an Ambion RNAqueous(Registered TradeMark) kit to remove RNA. In this set of experiments, human mixed Mullerian tumor (LN1) cells grown on the International Space Station during Expedition 3 were examined for antigenic stability after removal of RNA. The cells were stored for three months in RNAlater(TradeMark) and RNA was extracted. The RNA filtrate Containing the protein was precipitated, washed, and suspended in buffer containing sodium dodecyl sulfate (SDS). Samples containing equal concentrations of protein were loaded onto SDS-polyacrylamide gels. Proteins were separated by electrophoresis and transferred by Western blot to polyvinylidene fluoride (PVDF) membrane. The Western blots were stained with an enhanced chemiluminescent ECL(Registered TradeMark)Plus detection kit (Amersham) and scanned using a Storm 840 gel image analyzer (Amersham, Molecular Dynamics). ImageQuant(Registered TradeMark)a software was used to quantify the densities of the protein bands. The ground control and flight LN1 cell samples showed a similar staining pattern over time with antibodies to vimentin, glyceraldehyde-3-phosphate dehydrogenase, and epithelial membrane antigens.

Hammond, Dianne K.; Becker, Jeanne; Holubec, K.; Baker, T. L.; Love, J. E.

2004-01-01

141

Enzymatic detachment of therapeutic mesenchymal stromal cells grown on glass carriers in a bioreactor.  

PubMed

Cell therapies require the in vitro expansion of adherent cells such as mesenchymal stromal cells (hMSCs) in bioreactor systems or other culture environments, followed by cell harvest. As hMSCs are strictly adherent cells, cell harvest requires cell detachment. The use of hMSCs for cell therapy requires GMP production in accordance with the guidelines for advanced therapeutic medical products. Therefore, several GMP-conform available proteolytic enzymes were investigated for their ability to promote hMSC detachment. An allogeneic hMSC cell line (hMSC-TERT) that is used in clinical trials in the form of alginate cell capsules was chosen as a model. This study investigated the influence of several factors on the outcome of proteolytic hMSC-TERT detachment. Therefore, hMSC-TERT detachment was analyzed in different cultivation systems (static, dynamic) and in combination with further cell processing including encapsulation. Only two of the commercially available enzymes (AccutaseTM, TrypZeanTM) that fulfill all process requirements (commercial availability, cost, GMP conditions during manufacturing and non-animal origin) are found to be generally suitable for detaching hMSC-TERT. Combining cell detachment with encapsulation demonstrated a high impact of the experimental set up on cell damage. It was preferable to reduce the temperature during detachment and limit the detachment time to a maximum of 20 minutes. Cell detachment in static systems was not comparable with detachment in dynamic systems. Detachment yields in dynamic systems were lower and cell damage was higher for the same experimental conditions. Finally, only TrypZeanTM seemed to be suitable for the detachment of hMSC-TERT from dynamic reactor systems. PMID:24478807

Salzig, Denise; Schmiermund, Alexandra; P Grace, Pablo; Elseberg, Christiane; Weber, Christian; Czermak, Peter

2013-01-01

142

Epitaxially Grown Collagen Fibrils Reveal Diversity in Contact Guidance Behavior among Cancer Cells.  

PubMed

Invasion of cancer cells into the surrounding tissue is an important step during cancer progression and is driven by cell migration. Cell migration can be random, but often it is directed by various cues such as aligned fibers composed of extracellular matrix (ECM), a process called contact guidance. During contact guidance, aligned fibers bias migration along the long axis of the fibers. These aligned fibers of ECM are commonly composed of type I collagen, an abundant structural protein around tumors. In this paper, we epitaxially grew several different patterns of organized type I collagen on mica and compared the morphology and contact guidance behavior of two invasive breast cancer cell lines (MDA-MB-231 and MTLn3 cells). Others have shown that these cells randomly migrate in qualitatively different ways. MDA-MB-231 cells exert large traction forces, tightly adhere to the ECM, and migrate with spindle-shaped morphology and thus adopt a mesenchymal mode of migration. MTLn3 cells exert small traction forces, loosely adhere to the ECM, and migrate with a more rounded morphology and thus adopt an amoeboid mode of migration. As the degree of alignment of type I collagen fibrils increases, cells become more elongated and engage in more directed contact guidance. MDA-MB-231 cells perceive the directional signal of highly aligned type I collagen fibrils with high fidelity, elongating to large extents and migrating directionally. Interestingly, behavior in MTLn3 cells differs. While highly aligned type I collagen fibril patterns facilitate spreading and random migration of MTLn3 cells, they do not support elongation or directed migration. Thus, different contact guidance cues bias cell migration differently and the fidelity of contact guidance is cell type dependent, suggesting that ECM alignment is a permissive cue for contact guidance, but requires a cell to have certain properties to interpret that cue. PMID:25531276

Wang, Juan; Petefish, Joseph W; Hillier, Andrew C; Schneider, Ian C

2015-01-13

143

Enzymatic Detachment of Therapeutic Mesenchymal Stromal Cells Grown on Glass Carriers in a Bioreactor  

PubMed Central

Cell therapies require the in vitro expansion of adherent cells such as mesenchymal stromal cells (hMSCs) in bioreactor systems or other culture environments, followed by cell harvest. As hMSCs are strictly adherent cells, cell harvest requires cell detachment. The use of hMSCs for cell therapy requires GMP production in accordance with the guidelines for advanced therapeutic medical products. Therefore, several GMP-conform available proteolytic enzymes were investigated for their ability to promote hMSC detachment. An allogeneic hMSC cell line (hMSC-TERT) that is used in clinical trials in the form of alginate cell capsules was chosen as a model. This study investigated the influence of several factors on the outcome of proteolytic hMSC-TERT detachment. Therefore, hMSC-TERT detachment was analyzed in different cultivation systems (static, dynamic) and in combination with further cell processing including encapsulation. Only two of the commercially available enzymes (AccutaseTM, TrypZeanTM) that fulfill all process requirements (commercial availability, cost, GMP conditions during manufacturing and non-animal origin) are found to be generally suitable for detaching hMSC-TERT. Combining cell detachment with encapsulation demonstrated a high impact of the experimental set up on cell damage. It was preferable to reduce the temperature during detachment and limit the detachment time to a maximum of 20 minutes. Cell detachment in static systems was not comparable with detachment in dynamic systems. Detachment yields in dynamic systems were lower and cell damage was higher for the same experimental conditions. Finally, only TrypZeanTM seemed to be suitable for the detachment of hMSC-TERT from dynamic reactor systems. PMID:24478807

Salzig, Denise; Schmiermund, Alexandra; P. Grace, Pablo; Elseberg, Christiane; Weber, Christian; Czermak, Peter

2013-01-01

144

Positioning effects on quantum dot solar cells grown by molecular beam epitaxy  

SciTech Connect

We report current-voltage and spectral response characteristics of high density InAs/GaAs quantum dot (QD) solar cells with different positions where dots are located. The short circuit current density (J{sub sc}), open circuit voltage (V{sub oc}), and external quantum efficiency of these cells under air mass 1.5 are presented and compared with a GaAs reference cell. An extended photoresponse in contrast to the GaAs reference cell was confirmed for all these cells. The effect of inserting QD layers into emitter and base region on device performance is shown. The J{sub sc} is reduced, while the V{sub oc} is maintained. The cell with QDs located toward the base side shows better performance, confirmed by both current-voltage and spectral response measurements.

Zhou, D.; Sharma, G.; Fimland, B. O. [Department of Electronics and Telecommunications, Norwegian University of Science and Technology (NTNU), NO-7491 Trondheim (Norway); Vullum, P. E.; Thomassen, S. F.; Holmestad, R.; Reenaas, T. W. [Department of Physics, Norwegian University of Science and Technology (NTNU), NO-7491 Trondheim (Norway)

2010-02-22

145

Method of measuring nitric oxide release by vascular endothelial cells grown in microfluidic channels  

NASA Astrophysics Data System (ADS)

In this paper, a simple and versatile method is presented which enables detection of nitric oxide (NO) released from vascular endothelial cells (ECs) cultured in microfluidic structures. The culturing system and NO measurement method allow cell shape to be controlled in a non-invasive manner using microfluidic structures while NO release is monitored for cell shape versus function studies. The culturing system consists of arrays of polydimethylsiloxane (PDMS) fluidic channels 120 micrometers in depth and ranging from 100 micrometers to 3 mm in width. The number of channels in each array is varied to yield a constant cell culture surface area (75 mm2) independent of channel width. The channel surfaces are collagen-coated and ECs are cultured to confluence within the channels. A cell scraper is then used to scrape extraneous cells cultured between channels, and NO measurements are made 18 to 24 hours later. A chemiluminescence-based sensor system (NOA 280i, Sievers NO Analyzer) is utilized to measure sample NO. Initial results indicate that NO concentrations can be measured from different microfluidic channel-containing samples using this method. It is shown that there is no significant difference in NO concentration derived from channels of different widths even though the degree of cell elongation varies due to physical constraint by microfluidic channel walls. However, cells treated with TNF? release more NO than untreated cells in fluidic channels, which is comparable to the function of ECs cultured in conventional culturing systems such as culturing dishes.

Hosseinpour, S.; Liu, A. C.; Barakat, A. I.; Choy, J. C.; Gray, B. L.

2014-03-01

146

The density of apical cells of dark-grown protonemata of the moss Ceratodon purpureus  

NASA Technical Reports Server (NTRS)

Determinations of plant or algal cell density (cell mass divided by volume) have rarely accounted for the extracellular matrix or shrinkage during isolation. Three techniques were used to indirectly estimate the density of intact apical cells from protonemata of the moss Ceratodon purpureus. First, the volume fraction of each cell component was determined by stereology, and published values for component density were used to extrapolate to the entire cell. Second, protonemal tips were immersed in bovine serum albumin solutions of different densities, and then the equilibrium density was corrected for the mass of the cell wall. Third, apical cell protoplasts were centrifuged in low-osmolarity gradients, and values were corrected for shrinkage during protoplast isolation. Values from centrifugation (1.004 to 1.015 g/cm3) were considerably lower than from other methods (1.046 to 1.085 g/cm3). This work appears to provide the first corrected estimates of the density of any plant cell. It also documents a method for the isolation of protoplasts specifically from apical cells of protonemal filaments.

Schwuchow, J. M.; Kern, V. D.; Wagner, T.; Sack, F. D.

2000-01-01

147

Single-junction GaAsP solar cells grown on SiGe graded buffers on Si  

NASA Astrophysics Data System (ADS)

We have investigated the microstructure and device characteristics of GaAs0.82P0.18 solar cells grown on Si0.20Ge0.80/Si graded buffers. Anti-phase domains (APDs) were largely self-annihilated within the In0.39Ga0.61P initiation layer although a low density of APDs was found to propagate to the surface. A combination of techniques was used to show that the GaAs0.82P0.18 cells have a threading dislocation density of 1.2 ± 0.2 × 107 cm-2. Despite these extended defects, the devices exhibited high open-circuit voltages of 1.10-1.12 V. These results indicate that cascading a GaAs0.82P0.18 top cell with a lower-bandgap Si0.20Ge0.80 cell is a promising approach for high-efficiency dual-junction devices on low-cost Si substrates.

Faucher, J.; Gerger, A.; Tomasulo, S.; Ebert, C.; Lochtefeld, A.; Barnett, A.; Lee, M. L.

2013-11-01

148

MG63 osteoblast-like cells exhibit different behavior when grown on electrospun collagen matrix versus electrospun gelatin matrix.  

PubMed

Electrospinning is a simple and efficient method of fabricating a non-woven polymeric nanofiber matrix. However, using fluorinated alcohols as a solvent for the electrospinning of proteins often results in protein denaturation. TEM and circular dichroism analysis indicated a massive loss of triple-helical collagen from an electrospun collagen (EC) matrix, and the random coils were similar to those found in gelatin. Nevertheless, from mechanical testing we found the Young's modulus and ultimate tensile stresses of EC matrices were significantly higher than electrospun gelatin (EG) matrices because matrix stiffness can affect many cell behaviors such as cell adhesion, proliferation and differentiation. We hypothesize that the difference of matrix stiffness between EC and EG will affect intracellular signaling through the mechano-transducers Rho kinase (ROCK) and focal adhesion kinase (FAK) and subsequently regulates the osteogenic phenotype of MG63 osteoblast-like cells. From the results, we found there was no significant difference between the EC and EG matrices with respect to either cell attachment or proliferation rate. However, the gene expression levels of OPN, type I collagen, ALP, and OCN were significantly higher in MG63 osteoblast-like cells grown on the EC than in those grown on the EG. In addition, the phosphorylation levels of Y397-FAK, ERK1/2, BSP, and OPN proteins, as well as ALP activity, were also higher on the EC than on the EG. We further inhibited ROCK activation with Y27632 during differentiation to investigate its effects on matrix-mediated osteogenic differentiation. Results showed the extent of mineralization was decreased with inhibition after induction. Moreover, there is no significant difference between EC and EG. From the results of the protein levels of phosphorylated Y397-FAK, ERK1/2, BSP and OPN, ALP activity and mineral deposition, we speculate that the mechanism that influences the osteogenic differentiation of MG63 osteoblast-like cells on EC and EG is matrix stiffness and via ROCK-FAK-ERK1/2. PMID:22319618

Tsai, Shiao-Wen; Liou, Hau-Min; Lin, Cheng-Jie; Kuo, Ko-Liang; Hung, Yi-Sheng; Weng, Ru-Chun; Hsu, Fu-Yin

2012-01-01

149

Photosynthetic carbon metabolism in photoautotrophic cell suspension cultures grown at low and high CO sub 2  

SciTech Connect

Photosynthetic carbon metabolism was characterized in four photoautotrophic cell suspension cultures. There was no apparent difference between two soybeans (Glycine max) and one cotton (Gossypium hirsutum) cell line which required 5% CO{sub 2} for growth, and a unique cotton cell line that grows at ambient CO{sub 2} (660 microliters per liter). Photosynthetic characteristics in all four lines were more like C{sub 3} mesophyll leaf cells than the cell suspension cultures previously studied. The pattern of {sup 14}C-labeling reflected the high ratio of ribulosebisphosphate carboxylase to phosphoenolpyruvate carboxylase activity and showed that CO{sub 2} fixation occurred primarily by the C{sub 3} pathway. Photorespiration occurred at 330 microliters per liter CO{sub 2}, 21% O{sub 2} as indicated by the synthesis of high levels of {sup 14}C-labeled glycine and serine in a pulse-chase experiment and by oxygen inhibition of CO{sub 2} fixation. Short-term CO{sub 2} fixation in the presence and absence of carbonic anhydrase showed CO{sub 2}, not HCO{sub 3}{sup {minus}}, to be the main source of inorganic carbon taken up by the low CO{sub 2}-requiring cotton cells. The cells did not have a CO{sub 2}-concentrating mechanism as indicated by silicone oil centrifugation experiments. Carbonic anhydrase was absent in the low CO{sub 2}-requiring cotton cells, present in the high CO{sub 2}-requiring soybean cell lines, and absent in other high CO{sub 2} cell lines examined. Thus, the presence of carbonic anhydrase is not an essential requirement for photoautotrophy in cell suspension cultures which grow at either high or low CO{sub 2} concentrations.

Roeske, C.A.; Widholm, J.M. (Univ. of Illinois at Urbana-Champaign (USA)); Ogren, W.L. (Department of Agriculture, Urbana, IL (USA))

1989-12-01

150

Photosynthetic Carbon Metabolism in Photoautotrophic Cell Suspension Cultures Grown at Low and High CO(2).  

PubMed

Photosynthetic carbon metabolism was characterized in four photoautotrophic cell suspension cultures. There was no apparent difference between two soybean (Glycine max) and one cotton (Gossypium hirsutum) cell line which required 5% CO(2) for growth, and a unique cotton cell line that grows at ambient CO(2) (660 microliters per liter). Photosynthetic characteristics in all four lines were more like C(3) mesophyll leaf cells than the cell suspension cultures previously studied. The pattern of (14)C-labeling reflected the high ratio of ribulosebisphosphate carboxylase to phosphoenolpyruvate carboxylase activity and showed that CO(2) fixation occurred primarily by the C(3) pathway. Photorespiration occurred at 330 microliters per liter CO(2), 21% O(2) as indicated by the synthesis of high levels of (14)C-labeled glycine and serine in a pulse-chase experiment and by oxygen inhibition of CO(2) fixation. Short-term CO(2) fixation in the presence and absence of carbonic anhydrase showed CO(2), not HCO(3) (-), to be the main source of inorganic carbon taken up by the low CO(2)-requiring cotton cells. The cells did not have a CO(2)-concentrating mechanism as indicated by silicone oil centrifugation experiments. Carbonic anhydrase was absent in the low CO(2)-requiring cotton cells, present in the high CO(2)-requiring soybean cell lines, and absent in other high CO(2) cell lines examined. Thus, the presence of carbonic anhydrase is not an essential requirement for photoautotrophy in cell suspension cultures which grow at either high or low CO(2) concentrations. PMID:16667210

Roeske, C A; Widholm, J M; Ogren, W L

1989-12-01

151

Effect of endogenous methylglyoxal on Chinese hamster ovary cells grown in culture  

Microsoft Academic Search

Methylglyoxal is a ketoaldehyde that reacts readily under physiological conditions with biologically relevant ligands, such as amine and sulfhydryl groups. It is produced in mammalian cells primarily as a by-product of glycolysis. The level of glucose, L-glutamine and fetal bovine serum in culture media was found to significantly affect levels of intracellular methylglyoxal in Chinese hamster ovary cells. Medium with

Frank W. R. Chaplen; William E. Fahl; Douglas C. Cameron

1996-01-01

152

Changes in levels of cell wall constituents in wheat seedlings grown under continuous hypergravity conditions  

NASA Astrophysics Data System (ADS)

Effects of continuous hypergravity stimuli on the amounts and composition of cell wall constituents were investigated in wheat shoots. Hypergravity (300 g) treatment for three days after germination increased the net amount of cell wall polysaccharides such as hemicellulose and cellulose, but reduced the shoot elongation. As a result, the amount of cell wall polysaccharides per unit length of shoot increased under hypergravity. The hemicellulose fraction contained polysaccharides in the middle and low molecular mass range (5 kDa-1 MDa) and increased in response to hypergravity. Also, the amounts of arabinose (Ara) and xylose (Xyl), the major sugar components of the hemicellulose fraction, increased under hypergravity conditions. In addition to wall polysaccharides, hypergravity increased the amounts of cell wall-bound phenolic acids, such as ferulic acid (FA) and diferulic acid (DFA). Furthermore, the activity of phenylalanine ammonia-lyase (PAL, EC 4.3.1.5) was enhanced under hypergravity conditions. These results suggest that continuous hypergravity stimulates the synthesis of cell wall constituents, especially hemicellulosic arabinoxylans and cell wall-bound FA and DFA in wheat shoots. The increased PAL activity may promote the formation of FA and DFA. These changes in cell wall architecture may be involved in making rigid and tough cell walls under hypergravity conditions and thereby contribute to the ability of plant to sustain their structures against gravitational stimuli.

Wakabayashi, K.; Soga, K.; Kamisaka, S.; Hoson, T.

153

Behavior of Murine Renal Carcinoma Cells Grown in Ectopic or Orthotopic Sites in Syngeneic Mice  

Microsoft Academic Search

We examined whether the organ microenvironment modulates the metastatic behavior and the response to doxorubicin (DXR) in murine renal carcinoma (RENCA) cells. Tumor cells were injected into kidney (orthotopic) and subcutis (ectopic) of syngeneic mice. Lung metastases developed in up to 57% (17\\/30) of animals having kidney tumors but not in those with skin tumors. Tumors growing in the kidney

Kwang-Sung Ahn; Yoo-Sun Jung; Jhingook Kim; Hyunah Lee; Sung-Soo Yoon

2001-01-01

154

Glycosphingolipids of Plasma Membranes of Cultured Cells and an Enveloped Virus (SV5) Grown in these Cells  

Microsoft Academic Search

Glycosphingolipids of rhesus monkey kidney (MK), bovine kidney (MDBK), and two lines of hamster kidney (BHK21-F and Hak) cells have been compared with those of parainfluenza (SV5) virions grow in these cells. There are qualitative and quantitative differences in the neutral glycolipids and gangliosides found in the various cells. Cells with a high neutral glycolipid content (MK and MDBK) contain

Hans-Dieter Klenk; Purnell W. Choppin

1970-01-01

155

Discrepancy between the short and long term effects of ouabain on the sodium pumps of human cells grown in culture.  

PubMed Central

1. Human cells (HeLa) were cultured for periods up to 48 h in growth medium in the absence or presence of a range of concentrations of cardiac glycosides. In some experiments the potassium concentration of the medium was varied between 0.3 mM and the usual 5 mM. 2. For periods up to 2 h in ouabain the association and dissociation rate constants were measured and the equilibrium binding constant (KD) calculated; the apparent equilibrium binding constant (K'D) was measured after 1-2 days growth in ouabain. 3. Ouabain had a K'D after 2 days of 2-6 nM in 5 mM K+ growth medium, a 4 fold greater blocking effect on sodium pumps after 2 days than expected from the association and dissociation rate constants measured in untreated or previously ouabain-treated cells. 4. This effect was: (a) approximately the same over a range of external potassium concentrations from 0.3 to 5 mM, although the absolute effect of ouabain over this range of potassium was much different; (b) probably not due to different isoforms of pumps in cells grown in ouabain compared to untreated cells; (c) apparently not a consequence of internalisation of pump-glycoside complexes. 5. We conclude that ouabain has only a limited access to sodium pumps in whole cells; this could be because sodium pumps cycle continuously through an inaccessible region of the plasma membrane. This effect needs to be considered both in the assessment of the magnitude of the long term effects of cardiac glycosides on cells, and in the measurement of the glycoside affinities of various isoforms of the pump. PMID:1665734

Griffiths, N. M.; Ogden, P. H.; Cormack, R.; Lamb, J. F.

1991-01-01

156

Heteroepitaxial film silicon solar cell grown on Ni-W foils  

SciTech Connect

Today, silicon-wafer-based technology dominates the photovoltaic (PV) industry because it enables high efficiency, is produced from abundant, non-toxic materials and is proven in the PV marketplace.[1] However, costs associated with the wafer itself limit ultimate cost reductions.[1,2] PV based on absorber layers of crystalline Si with only 2 to 10 m thickness are a promising route to reduce these costs, while maintaining efficiencies above 15%.[3-5] With the goal of fabricating low-cost film crystalline Si (c-Si), recent research has explored wafer peeling,[6,7] crystallization of amorphous silicon films on glass,[4,8-10] and seed and epitaxy approaches.[3,5,11] In this third approach, one initially forms a seed layer that establishes the grain size and crystalline order. The Si layer is then grown heteroepitaxially on the seed layer, so that it replicates the seed crystal structure. In all of these film c-Si approaches, the critical challenge is to grow c-Si with adequate material quality: specifically, the diffusion length (LD) must be at least three times the film thickness.[12] In polycrystalline Si films, grain boundaries (GBs) are recombination-active and significantly reduce LD. This adverse effects of GBs motivates research into growth of large grained c-Si [13,14] (for a low density of GBs) and biaxially-textured c-Si [11] (for low-angle GBs).

Wee, Sung Hun [ORNL; Cantoni, Claudia [ORNL; Fanning, Thomas [Ampulse Corporation; Teplin, Charles [National Renewable Energy Laboratory (NREL); Bogorin, Daniela Florentina [ORNL; Bornstein, Jon [Ampulse Corporation; Bowers, Karen [Ampulse Corporation; Schroeter, [Ampulse Corporation; Hasoon, Falah [National Renewable Energy Laboratory (NREL); Branz, Howard [National Renewable Energy Laboratory (NREL); Paranthaman, Mariappan Parans [ORNL; Goyal, Amit [ORNL

2013-01-01

157

A market analysis for high efficiency multi-junction solar cells grown on SiGe  

E-print Network

Applications, markets and a cost model are presented for III-V multi-junction solar cells built on compositionally graded SiGe buffer layers currently being developed by professors Steven Ringell of Ohio State University ...

Judkins, Zachara Steele

2007-01-01

158

Sonochemically grown ZnO nanowalls on Graphene layers as Photoanode in Dye sensitized Solar cells.  

E-print Network

whole solar spectrum Graphene can be a very promising material in Dye Sensitized Solar cells (DSSC as photoanode is presented. The effect of Graphene on dye loading and on efficiency of DSSC is quantitatively

Pala, Nezih

159

Changes in cell wall architecture of wheat coleoptiles grown under continuous hypergravity conditions  

NASA Astrophysics Data System (ADS)

Modifications of cell wall structure of wheat coleoptiles in response to continuous hypergravity (300 g) treatment were investigated. Length of coleoptiles exposed to hypergravity for 2-4 days from germination stage was 60-70% of that of 1 g control. The net amounts of cell wall polysaccharides, such as hemicellulose and cellulose, of hypergravity-treated coleoptiles increased as much as those of 1 g control coleoptiles during the incubation period. As a result, the levels of cell wall polysaccharides per unit length of coleoptile, which mean the thickness of cell walls, largely increased under hypergravity conditions. Particularly, the amounts of hemicellulosic polymers with middle molecular mass (0.2-1 MDa) largely increased from day 2 to 3 under hypergravity conditions. The major sugar components of the hemicellulose fraction are arabinose, xylose and glucose. The ratios of arabinose and xylose to glucose were higher in hypergravity-treated coleoptiles than in control coleoptiles. The fractionation of hemicellulosic polymers into the neutral and acidic polymers by the anion-exchange column showed that the levels of acidic polymers (mainly composed of arabinoxylans) in cell walls of hypergravity-treated coleoptiles were higher than those of control coleoptiles. In addition to wall polysaccharides, the amounts of cell wall-bound phenolics, such as ferulic acid and diferulic acid, substantially increased during the incubation period both in 1 g control and hypergravity-treated coleoptiles. Especially, the levels of diferulic acid which cross-links hemicellulosic polymers were higher in hypergravity-treated coleoptiles than in control coleoptiles during the incubation period. These results suggest that hypergravity stimuli from the germination stage bias the type of synthesized hemicellulosic polysaccharides, although they do not restrict the net synthesis of cell wall constituents in wheat coleoptiles. The stimulation of the synthesis of arabinoxylans and of the formation of DFA, and also the resultant cell wall thickening may contribute to plant resistance to gravity stimuli.

Wakabayashi, K.; Soga, K.; Kamisaka, S.; Hoson, T.

160

Role of Shiga/Vero toxins in pathogenesis  

PubMed Central

Shiga toxin (Stx) is the primary cause of severe host responses including renal and central nervous system (CNS) disease in Shiga toxin-producing E. coli (STEC) infections. The interaction of Stx with different eukaryotic cell types is described. Host responses to Stx and bacterial lipopolysaccharide (LPS) are compared as related to the features of the STEC-associated Hemolytic Uremic Syndrome (HUS). Data derived from animal models of HUS and CNS disease, in vivo, and eukaryotic cells, in vitro, are evaluated in relation to HUS disease of humans.

Obata, Fumiko; Obrig, Tom

2014-01-01

161

Transparent conducting ITAZO anode films grown by a composite target RF magnetron sputtering at room temperature for organic solar cells  

NASA Astrophysics Data System (ADS)

The preparation and characteristics of AZO co-sputtered ITO (ITAZO) electrodes grown on glass and flexible substrates using a specially designed composite target in organic solar cells are described. It was found that both the electrical and optical properties of the ITAZO films were critically dependent on the Ar/O2 flow ratio and sputtering power. In addition, all ITAZO electrodes show the amorphous structure due to the low substrate temperature. Even though the ITAZO electrode was prepared at room temperature, we can obtain the ITAZO electrode with the sheet resistance of 23 ?/square (on a glass substrate) and 26 ?/square (on a flexible substrate) and the average optical transmittance of 87.5% (on a glass substrate) and 86.3% (on a flexible substrate) in the region between 450 and 800 nm wavelength. In addition, the Ar ion treatment of the polyethylene terephthalate (PET) substrate could remove surface contamination and increase the adherence of the ITAZO film with the PET substrate. Furthermore, organic solar cells prepared on the ITAZO electrode under optimized conditions show the typical current density-voltage characteristics with the conversion power efficiency of 3.2%. This indicates that the composite target sputtering technique is a promising sputtering process for transparent conducting electrodes for low-cost solar cell applications.

Sun, Nanhai; Fang, Guojia; Zheng, Qiao; Wang, Mingjun; Liu, Nishuang; Liu, Wei; Zhao, Xingzhong

2009-08-01

162

Braided stream and flood plain architecture: the Rio Vero Formation, Spanish Pyrenees  

Microsoft Academic Search

Early- to middle-Miocene fluvial sandstones of the Rio Vero Formation were studied, in an area around the town of Barbastro, south central Pyrenees Spain. The outstanding quality of outcrops in this area allows a three-dimensional study of architectural elements.Six architectural elements are recognised, described in detail, and interpreted from three key localities. Seven main lithofacies were identified and sub-divided into

S. J. Jones; L. E. Frostick; T. R. Astin

2001-01-01

163

Melanoma Spheroids Grown Under Neural Crest Cell Conditions Are Highly Plastic Migratory\\/Invasive Tumor Cells Endowed with Immunomodulator Function  

Microsoft Academic Search

Background: The aggressiveness of melanoma tumors is likely to rely on their well-recognized heterogeneity and plasticity. Melanoma comprises multi-subpopulations of cancer cells some of which may possess stem cell-like properties. Although useful, the sphere-formation assay to identify stem cell-like or tumor initiating cell subpopulations in melanoma has been challenged, and it is unclear if this model can predict a functional

Kiran Ramgolam; Jessica Lauriol; Claude Lalou; Laura Lauden; Laurence Michel; Abdel-Majid Khatib; Fawzi Aoudjit; Dominique Charron; Catherine Alcaide-Loridan; Reem; Pierre de la Grange

2011-01-01

164

Genotoxic Effects of Low- and High-LET Radiation on Human Epithelial Cells Grown in 2-D Versus 3-D Culture  

NASA Technical Reports Server (NTRS)

Risk estimation for radiation-induced cancer relies heavily on human epidemiology data obtained from terrestrial irradiation incidents from sources such as medical and occupational exposures as well as from the atomic bomb survivors. No such data exists for exposures to the types and doses of high-LET radiation that will be encountered during space travel; therefore, risk assessment for space radiation requires the use of data derived from cell culture and animal models. The use of experimental models that most accurately replicate the response of human tissues is critical for precision in risk projections. This work compares the genotoxic effects of radiation on normal human epithelial cells grown in standard 2-D monolayer culture compared to 3-D organotypic co-culture conditions. These 3-D organotypic models mimic the morphological features, differentiation markers, and growth characteristics of fully-differentiated normal human tissue and are reproducible using defined components. Cultures were irradiated with 2 Gy low-LET gamma rays or varying doses of high-LET particle radiation and genotoxic damage was measured using a modified cytokinesis block micronucleus assay. Our results revealed a 2-fold increase in residual damage in 2 Gy gamma irradiated cells grown under organotypic culture conditions compared to monolayer culture. Irradiation with high-LET particle radiation gave similar results, while background levels of damage were comparable under both scenarios. These observations may be related to the phenomenon of "multicellular resistance" where cancer cells grown as 3-D spheroids or in vivo exhibit an increased resistance to killing by chemotherapeutic agents compared to the same cells grown in 2-D culture. A variety of factors are likely involved in mediating this process, including increased cell-cell communication, microenvironment influences, and changes in cell cycle kinetics that may promote survival of damaged cells in 3-D culture that would otherwise die or be rendered reproductively inactive in 2-D culture.

Patel, Z. S.; Cucinotta, F. A.; Huff, J. L.

2011-01-01

165

Hybrid solar cells based on dc magnetron sputtered films of n-ITO on APMOVPE grown p-InP  

NASA Technical Reports Server (NTRS)

Hybrid indium-tin-oxide (ITO)/InP solar cells are discussed. The cells are constructed by dc magnetron sputter deposition of ITO onto high-quality InP films grown by atmospheric pressure metal-organic vapor-phase epitaxy (APMOVPE). A record efficiency of 18.9 percent, measured under standard Solar Energy Research Institute reporting conditions, has been obtained. The p-InP surface is shown to be type converted, principally by the ITO, but with the extent of conversion being modified by the nature of the sputtering gas. The deposition process, in itself, is not responsible for the type conversion. Dark currents have been suppressed by more than three orders of magnitude by the addition of hydrogen to the sputtering gas during deposition of a thin (5 nm) interface layer. Without this layer, and using only the more usual argon/oxygen mixture, the devices had poorer efficiencies and were unstable. A discussion of associated quantum efficiencies and capacitance/voltage measurements is also presented from which it is concluded that further improvements in efficiency will result from better control over the type-conversion process.

Coutts, T. J.; Li, X.; Wanlass, M. W.; Emery, K. A.; Gessert, T. A.

1988-01-01

166

Heteroepitaxial Film Silicon Solar Cell Grown on Ni-W Foils  

SciTech Connect

Heteroepitaxial semiconductor films on low-cost, flexible metal foil templates are a potential route to inexpensive, high-efficiency solar cells. Here, we report epitaxial growth of Si films on low-cost, flexible, biaxially-textured Ni-W substrates. A robust buffer architecture comprised of multiple epitaxial oxide layers has been developed to grow high quality, heteroepitaxial Si films without any undesired reaction between the Si film and the metal substrate and with a single biaxial texture. XRD analysis including {omega}-scans, {phi}-scans, and pole figures confirms that the buffers and silicon are all epitaxial, with excellent cube-on-cube epitaxy. A photo-conversion efficiency of 1.1% is demonstrated from a proof-of-concept heteroepitaxial film Si solar cell.

Wee, S. H.; Cantoni, C.; Fanning, T. R.; Teplin, C. W.; Bogorin, D. F.; Bornstein, J.; Bowers, K.; Schroeter, P.; Hasoon, F.; Branz, H. M.; Paranthaman, M. P.; Goyal, A.

2012-03-01

167

CBD grown ZnO-based gas sensors and dye-sensitized solar cells  

Microsoft Academic Search

Chemical bath deposition (CBD) is used for depositing different metal chalcogenide and oxide thin films through an ion-by-ion or by adsorption of colloidal particles from the solution on the substrate. In this review, we focused our intension on CBD zinc oxide (ZnO) films synthesis with different proposed deposition mechanisms and their integration into gas sensor and dye-sensitized solar cells. Due

C. D. Lokhande; P. M. Gondkar; Rajaram. S. Mane; V. R. Shinde; Sung-Hwan Han

2009-01-01

168

The functional expression of human bone-derived cells grown on rapidly resorbable calcium phosphate ceramics  

Microsoft Academic Search

The use of biodegradable bone substitutes is advantageous for alveolar ridge augmentation, since it avoids second-site surgery for autograft harvesting. This study examines the effect of novel, rapidly resorbable calcium phosphates on the expression of bone-related genes and proteins by human bone-derived cells (HBDC) and compares this behavior to that of tricalciumphosphate (TCP). Test materials were ?-TCP, and four materials

C. Knabe; G. Berger; R. Gildenhaar; C. R. Howlett; B. Markovic; H. Zreiqat

2004-01-01

169

Biological characteristics of mesenchymal stem cells grown on different topographical nanofibrous poly-L-lactide meshes.  

PubMed

The nanotopographical features of artificial scaffolds have complex effects on the biological characteristics of stem cells. They influence cell adhesion, spreading, proliferation, and differentiation; however we have limited knowledge on how these processes occur under nanotopographical cues. In this study, two kinds of electrospun nanofibrous meshes with different fiber arrangements (totally non-woven and lattice-like) were fabricated and used for in vitro culture of mesenchymal stem cells (MSCs). By comparing the characteristic marks related to osteogenic differentiation, we found that with prolonged culture time, osteopontin (OPN), osteocalcin (OCN) and alkaline phosphatase (ALP), as well as related genes (Runx2 and Colla genes), were all expressed at higher levels on lattice-like nanofibrous meshes than on non-woven ones. These results indicated that the lattice-like nanofibrous mesh activated the osteogenic differentiation of MSCs owing to changes in cell morphology directed by nanofiber orientations. Compared with pure non-woven nanofibrous meshes, lattice-like ones possessed a combined structure of parallel, magnetic-line-like, and non-woven regions. MSCs adhering onto them had upregulated expression levels of integrin subunits a5 and b1, and activated downstream signaling pathways of Ras homolog gene family member A (RhoA) and extracellular signal-regulated kinase (ERK). When the specific inhibitors PD98059 and Y27632 were used to inhibit phosphorylated ERK and p160 ROCKII activity, respectively, F-actin became disordered and the expression level of Runx2 was downregulated. Thus, we concluded that the scaffold nanotopography may modulate the microenvironment of MSCs and promote their osteogenic differentiation through the RhoA and ERK signaling pathways. These findings provided valuable information on the selection of artificial matrices suitable for MSCs application in bone tissue engineering. PMID:24015505

Zhu, Jingxian; Cai, Qing; Zhang, Xin; Hu, Xiaoqing; Li, La; Wang, Weiping; Shao, Zhenxing; Dai, Linghui; Cheng, Liyuan; Yang, Xiaoping; Zhou, Chunyan; Ao, Yingfang

2013-10-01

170

Chloroform degradation by butane-grown cells of Rhodococcus aetherovorans BCP1.  

PubMed

The ability of a Rhodococcus aetherovorans strain, BCP1, to grow on butane and to degrade chloroform in the 0-633 microM range (0-75.5 mg l(-1)) via aerobic cometabolism was investigated by means of resting-cell assays. BCP1 degraded chloroform with a complete mineralization of the organic Cl. The resulting butane and chloroform maximum specific degradation rates were equal to 118 and 22 micromol mg(protein)(-1)day(-1), respectively. Butane inhibition on chloroform degradation was satisfactorily interpreted by means of a model of competitive inhibition, with an inhibition constant equal to 38 % of the estimated butane half-saturation constant, whereas chloroform (at 11 microM) did not inhibit butane utilization. Acetylene (1,720 microM) induced an almost complete inactivation of the degradation of both butane and chloroform, indicating that the studied cometabolic process is mediated by a monooxygenase enzyme. BCP1 proved capable of degrading vinyl chloride and 1,1,2-trichloroethane, but not 1,2-trans-dichloroethylene. BCP1 could grow on the intermediates of the most common butane metabolic pathways and on the aliphatic hydrocarbons from ethane to n-heptane. After growth on n-hexane, it was able to deplete chloroform (13 microM) with a degradation rate higher than that obtained, at the same chloroform concentration, after growth on butane. PMID:17058077

Frascari, Dario; Pinelli, Davide; Nocentini, Massimo; Fedi, Stefano; Pii, Youri; Zannoni, Davide

2006-11-01

171

VeroScience: applying nature's genius to help improve the human condition.  

PubMed

VeroScience is a biotechnology company in Tiverton, Rhode Island, focused on the development of therapies and products to improve human health. The company has a strong pipeline of metabolic disease products and therapies for immunological disorders. A major platform technology of the company, Circadian Neuroendocrine Resetting Therapy, is utilized as a generator of multiple therapeutic strategies to treat a variety of disease states. The circadian timed daily (morning) administration of Cycloset®, a quick release formulation of bromocriptine mesylate, a dopamine agonist, was developed for the treatment of type 2 diabetes using this platform technology. PMID:23641424

2013-02-01

172

Development of a dose verification system for Vero4DRT using Monte Carlo method.  

PubMed

Vero4DRT is an innovative image-guided radiotherapy system employing a C-band X-ray head with gimbal mechanics. The purposes of this study were to propose specific MC models of the linac head and multileaf collimator (MLC) for the Vero4DRT and to verify their accuracy. For a 6 MV photon beam delivered by the Vero4DRT, a simulation code was implemented using EGSnrc. The linac head model and the MLC model were simulated based on its specification. Next, the percent depth dose (PDD) and beam profiles at depths of 15, 100, and 200 mm were simulated under source-to-surface distance of 900 and 1000 mm. Field size was set to 150 × 150 mm2 at a depth of 100 mm. Each of the simulated dosimetric metrics was then compared with the corresponding measurements by a 0.125 cc ionization chamber. After that, intra- and interleaf leakage, tongue-and-groove, and rounded-leaf profiles were simulated for the static MLC model. Meanwhile, film measurements were performed using EDR2 films under similar conditions to simulation. The measurement for the rounded-leaf profile was performed using the water phantom and the ionization chamber. The leaf physical density and abutting leaf gap were adjusted to obtain good agreement between the simulated intra- and interleaf leakage profiles and measurements. For the MLC model in step-and-shoot cases, a pyramid and a prostate IMRT field were simulated, while film measurements were performed using EDR2. For the linac head, exclusive of MLC, the difference in PDD was < 1.0% after the buildup region. The simulated beam profiles agreed to within 1.3% at each depth. The MLC model has been shown to reproduce dose measurements within 2.5% for static tests. The MLC is made of tungsten alloy with a purity of 95%. The leaf gap of 0.015 cm and the MLC physical density of 18.0 g/ cm3, which provided the best agreement between the simulated and measured leaf leakage, were assigned to our MC model. As a result, the simulated step-and-shoot IMRT dose distributions agreed with the film measurements to within 3.3%, with exception of the penumbra region. We have developed specific MC models of the linac head and the MLC in the Vero4DRT system. The results have demonstrated that our MC models have high accuracy.  PMID:25493521

Ishihara, Yoshitomo; Sawada, Akira; Nakamura, Mitsuhiro; Miyabe, Yuki; Tanabe, Hiroaki; Kaneko, Shuji; Takayama, Kenji; Mizowaki, Takashi; Kokubo, Masaki; Hiraoka, Masahiro

2014-01-01

173

Variable temperature carrier dynamics in bulk (In)GaAsNSb materials grown by MOVPE for multi-junction solar cells  

NASA Astrophysics Data System (ADS)

III-V multi-junction solar cells are typically based on a triple-junction design that consists of an InGaP top junction, a GaAs middle junction, and a bottom junction that employs a 1 - 1.25 eV material grown on GaAs substrates. The most promising 1 - 1.25 eV material that is currently under extensive investigation is bulk dilute nitride such as (In)GaAsNSb lattice matched to GaAs substrates. The approach utilizing dilute nitrides has a great potential to achieve high performance triple-junction solar cells as recently demonstrated by Wiemer, et al., who achieved a record efficiency of 43.5% from multi-junction solar cells including MBE-grown dilute nitride materials [1]. Although MOVPE is a preferred technique over MBE for III-V multi-junction solar cell manufacturing, MOVPEgrown dilute nitride research is at its infancy compared to MBE-grown dilute nitride. In particular, carrier dynamics studies are indispensible in the optimization of MOVPE materials growth parameters to obtain improved solar cell performance. For the present study, we employed time-resolved photoluminescence (TR-PL) techniques to study carrier dynamics in MOVPE-grown bulk dilute nitride InGaAsN materials (Eg = 1 - 1.25 eV at RT) lattice matched to GaAs substrates. In contrast to our earlier samples that showed high background C doping densities, our current samples grown using different metalorganic precursors at higher growth temperatures showed a significantly reduced background doping density of ~ 1017 /cm3. We studied carrier dynamics in (In)GaAsNSb double heterostructures (DH) with different N compositions at room temperature. Post-growth annealing yielded significant improvements in carrier lifetimes of (In)GaAsNSb double heterostructure (DH) samples. Carrier dynamics at various temperatures between 10 K and RT were also studied from (In)GaAsNSb DH samples including those samples grown on different orientation substrates.

Sin, Yongkun; Lingley, Zachary; LaLumondiere, Stephen; Wells, Nathan; Lotshaw, William; Moss, Steven C.; Kim, Tae Wan; Mawst, Luke J.; Kuech, Thomas F.

2014-03-01

174

Porous, single crystalline titanium nitride nanoplates grown on carbon fibers: excellent counter electrodes for low-cost, high performance, fiber-shaped dye-sensitized solar cells.  

PubMed

An excellent, platinum free fiber counter electrode (CE) was successfully fabricated, consisting of porous, single crystalline titanium nitride (TiN) nanoplates grown on carbon fibers (CF). The fiber-shaped dye-sensitized solar cells (FDSSCs) based on the TiN-CF CE show a high conversion efficiency of 7.20%, comparable or even superior to that of the Pt wire (6.23%). PMID:25068835

Chen, Liang; Dai, Hui; Zhou, Yong; Hu, Yingjie; Yu, Tao; Liu, Jianguo; Zou, Zhigang

2014-11-28

175

A multiple p-n junction structure obtained from as-grown Czochralski silicon crystals by heat treatment - Application to solar cells  

NASA Technical Reports Server (NTRS)

Multiple p-n junctions have been prepared in as-grown Czochralski p-type silicon through overcompensation near the oxygen periodic concentration maxima by oxygen thermal donors generated during heat treatment at 450 C. Application of the multiple p-n-junction configuration to photovoltaic energy conversion has been investigated. A new solar-cell structure based on multiple p-n-junctions was developed. Theoretical analysis showed that a significant increase in collection efficiency over the conventional solar cells can be achieved.

Chi, J. Y.; Gatos, H. C.; Mao, B. Y.

1980-01-01

176

Magnesium doping of efficient GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition  

NASA Technical Reports Server (NTRS)

Magnesium has been substituted for zinc in GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition (MOCVD). Bis(cyclopentadienyl)magnesium (Cp2Mg) is used as the MOCVD transport agent for Mg. Full retention of excellent material quality and efficient cell performance results. The substitution of Mg for Zn would enhance the abruptness and reproducibility of doping profiles, and facilitate high temperature processing and operation, due to the much lower diffusion coefficient of Mg, relative to Zn, in these materials.

Lewis, C. R.; Ford, C. W.; Werthen, J. G.

1984-01-01

177

Interactions between the Promoter Regions of Nitrogenase Structural Genes (nifHDK2) and DNA-Binding Proteins from N2- and Ammonium-Grown Cells of the Archaeon Methanosarcina barkeri 227  

PubMed Central

Transcription initiation in Archaea (archaebacteria) resembles the eucaryotic process, having been shown to involve TATA box-like promoter regions as well as TATA-binding protein and TFIIB homologs. However, little is known about transcription regulation in archaea. We have previously demonstrated that transcripts of nifHDK2 genes, encoding Methanosarcina barkeri nitrogenase, are present in N2-grown cells but not in ammonium-grown cells, indicating that nif transcription is regulated by the nitrogen source. In this study, we detected proteins in M. barkeri cell extracts that bind specifically to DNA containing the putative promoter region of nifHDK2. No binding was found when the promoter region was deleted from the DNA. A competition assay showed that the methyl coenzyme M reductase (mcr) promoter region DNA and the nifH2 promoter region DNA competed for a common factor(s). There was no binding to the nifH2 promoter region by extracts of ammonium-grown cells, but there was binding by these extracts to promoter regions for mcr genes, which are presumably constitutively expressed. Interestingly, extracts of ammonium-grown cells inhibited binding to the nif promoter region by extracts of N2-grown cells. Fractionation of extracts of ammonium-grown cells with a heparin-Sepharose column resolved them into a fraction eluting at 0 M NaCl, which inhibited binding by extracts of N2-grown cells, and a fraction eluting at 0.5 to 0.75 M NaCl, which showed binding to the promoter region. These results are congruent with a model for regulation of nif gene expression in M. barkeri in which a substance present in ammonium-grown cells inhibits DNA binding by a transcription-associated protein or proteins. PMID:9573159

Chien, Yueh-tyng; Helmann, John D.; Zinder, Stephen H.

1998-01-01

178

InGaAs/GaAsP superlattice solar cells with reduced carbon impurity grown by low-temperature metal-organic vapor phase epitaxy using triethylgallium  

NASA Astrophysics Data System (ADS)

In this paper, we investigated the effects of carbon incorporation on photovoltaic performance of InGaAs/GaAsP superlattice (SL) solar cells grown by low-temperature MOVPE (LT-MOVPE), which is required for stable SL growth on vicinal substrates. Using trimethylgallium (TMGa) as the gallium precursor, methyl radicals formed by its pyrolysis tend to be absorbed on the surface at low temperature, causing severe carbon incorporation and p-type background doping. High background carrier concentration flattens the band-lineup of the intrinsic region and blocks the carrier transport across the SLs, and resulted in serious degradation of photocurrent. Intentional sulfur doping to cancel out the background doping and hence to recover the built-in field greatly improved the cell performance, but was found to require very precise control of doping level to achieve an exact compensation doping condition. Use of triethylgallium (TEGa) instead of TMGa much reduced the carbon incorporation at low temperature and significantly enhanced the photocurrent extraction without sulfur doping treatment. By thinning GaAsP barriers to 3 nm to facilitate efficient tunneling transport, a 50-period SL cell with bandgap of 1.22 eV grown on 6°-miscut substrates achieved 1.13 times higher efficiency with 31% current enhancement as middle cell performance than a GaAs reference cell.

Fujii, Hiromasa; Toprasertpong, Kasidit; Sodabanlu, Hassanet; Watanabe, Kentaroh; Sugiyama, Masakazu; Nakano, Yoshiaki

2014-11-01

179

InGaP/GaAs Dual-Junction Solar Cell with AlGaAs/GaAs Tunnel Diode Grown on 10° off Misoriented GaAs Substrate  

NASA Astrophysics Data System (ADS)

InGaP/GaAs dual-junction solar cells with different tunnel diodes (TDs) grown on misoriented GaAs substrates are investigated. It is demonstrated that the solar cells with P++-AlGaAs/N++-GaAs TDs grown on 10° off GaAs substrates not only show a higher external quantum efficiency (EQE) but also generate a higher peak current density (Jpeak) at higher concentration ratios (185×) than the solar cells with P++-GaAs/N++-InGaP TDs grown on 6° off GaAs substrates. Furthermore, the cell design with P++-AlGaAs/N++-GaAs TDs grown on 10° off GaAs substrates does not generate a disordered InGaP epitaxial layer during material growth, and thus shows superior current-voltage characteristics.

Yu, Hung Wei; Chung, Chen Chen; Te Wang, Chin; Nguyen, Hong Quan; Tinh Tran, Binh; Lin, Kung Liang; Dee, Chang Fu; Yeop Majlis, Burhanuddin; Chang, Edward Yi

2012-08-01

180

Earliest art in the Americas: incised image of a proboscidean on a mineralized extinct animal bone from Vero Beach, Florida  

Microsoft Academic Search

A fragmented fossil bone incised with the figure of a proboscidean was recently found at Vero Beach, Florida near the location where Late Pleistocene fauna and human bones were recovered from 1913 to 1916. This engraving may represent the oldest and only existing example of Terminal Pleistocene art depicting a proboscidean in the Americas. Because of the uniqueness, rarity, and

Barbara A. Purdy; Kevin S. Jones; John J. Mecholsky; Gerald Bourne; Richard C. Hulbert; Bruce J. MacFadden; Krista L. Church; Michael W. Warren; Thomas F. Jorstad; Dennis J. Stanford; Melvin J. Wachowiak; Robert J. Speakman

2011-01-01

181

Comparison of GaInNAs and GaInNAsSb solar cells grown by plasma-assisted molecular beam epitaxy  

NASA Astrophysics Data System (ADS)

We compare dilute nitride GaInNAs and GaInNAsSb solar cells grown by molecular beam epitaxy. Single junction p-i-n diode solar cells were fabricated to test the dilute nitride and antimonide material fabrication process. Triple-junction solar cells were fabricated to test the behavior of single GaInNAs(Sb) junctions in multi-junction configuration. When nitrogen was added to the growth of GaInNAs, good crystal quality was maintained up to 4% of nitrogen at the used growth conditions. Short circuit current densities of the devices could be increased by adding Sb to the growth but at the same time the open circuit voltages decreased due to bandgap shrinkage induced by Sb. In multijunction configuration, the samples with Sb showed inferior properties to ones without it. Lower currents and voltages of Sb-containing cells may be linked to segregation of Sb and transfer to the upper junctions.

Aho, Arto; Tukiainen, Antti; Korpijärvi, Ville-Markus; Polojärvi, Ville; Salmi, Joel; Guina, Mircea

2012-10-01

182

Borate cross-linked/total rhamnogalacturonan II ratio in cell walls for the biochemical diagnosis of boron deficiency in hydroponically grown pumpkin.  

PubMed

Boron (B) is an essential micronutrient for vascular plants. The function of B has been demonstrated to cross-link monomeric rhamnogalacturonan II (mRG-II) to form dimeric RG-II-borate (dRG-II-B), and thus to stabilize plant cell walls. The dRG-II-B to total RG-II ratio in the cell walls of pumpkin hydroponically grown under various low-B conditions was analyzed to evaluate its applicability to the diagnosis of plant B deficiency. The dRG-II-B ratio in cell walls ranged between approximately 0.9 in B-sufficient tissues and approximately 0.15 in severe B-deficient tissues, reflecting the B nutritional status of tissues. This result indicates that the degree of B shortage in plant tissues is very likely to be diagnosed by the dRG-II-B ratio in cell walls. PMID:16896255

Matsunaga, Toshiro; Ishii, Tadashi

2006-08-01

183

PROCUSTE1 Encodes a Cellulose Synthase Required for Normal Cell Elongation Specifically in Roots and Dark-Grown Hypocotyls of Arabidopsis  

PubMed Central

Mutants at the PROCUSTE1 (PRC1) locus show decreased cell elongation, specifically in roots and dark-grown hypocotyls. Cell elongation defects are correlated with a cellulose deficiency and the presence of gapped walls. Map-based cloning of PRC1 reveals that it encodes a member (CesA6) of the cellulose synthase catalytic subunit family, of which at least nine other members exist in Arabidopsis. Mutations in another family member, RSW1 (CesA1), cause similar cell wall defects in all cell types, including those in hypocotyls and roots, suggesting that cellulose synthesis in these organs requires the coordinated expression of at least two distinct cellulose synthase isoforms. PMID:11148287

Fagard, Mathilde; Desnos, Thierry; Desprez, Thierry; Goubet, Florence; Refregier, Guislaine; Mouille, Gregory; McCann, Maureen; Rayon, Catherine; Vernhettes, Samantha; Höfte, Herman

2000-01-01

184

Cellular response to the deposition of diesel exhaust particle aerosols onto human lung cells grown at the air-liquid interface by inertial impaction.  

PubMed

The pathogenesis of disease resulting from exposure to diesel exhaust particles (DEP) is often studied using cultured lung cells. Frequently, researchers expose cells to DEP by spiking a suspension of particles in liquid onto the apical surface. This is not representative of in vivo exposure, where aerosols are deposited onto cell surfaces at the air-liquid interface (ALI). Inertial impaction provides an opportunity to deliver high doses of particles with aerodynamic diameters>?1 ?m to the surface of cells in seconds in a reproducible and predictable manner. A custom device was constructed to deposit DEP aerosols onto the surface of Calu-3 and A549 cells grown at the ALI. The pro-inflammatory and toxic cellular response to exposure to the deposited DEP aerosols was measured and compared to the response of cells exposed to DEP as suspensions. Calu-3 cells showed evidence of an oxidative stress response for both exposure types, while there was strong evidence to suggest that the method of aerosol delivery was harmful to the A549 cells. PMID:21756993

Cooney, Daniel J; Hickey, Anthony J

2011-12-01

185

Synthesis and application of TiO2 single-crystal nanorod arrays grown by multicycle hydrothermal for dye-sensitized solar cells  

NASA Astrophysics Data System (ADS)

TiO2 is a wide band gap semiconductor with important applications in photovoltaic cells. Vertically aligned TiO2 nanorod arrays (NRs) are grown on the fluorine-doped tin oxide (FTO) substrates by a multicycle hydrothermal synthesis process. The samples are characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), high-resolution transmission electron microscopy (HRTEM), and selected-area electron diffraction (SAED). It is found that dye-sensitized solar cells (DSSCs) assembled by the as-prepared TiO2 single-crystal NRs exhibit different trends under the condition of different nucleation and growth concentrations. Optimum cell performance is obtained with high nucleation concentration and low growth cycle concentration. The efficiency enhancement is mainly attributed to the improved specific surface area of the nanorod.

Zhu, Jian-Jing; Zhao, Yu-Long; Zhu, Lei; Gu, Xiu-Quan; Qiang, Ying-Huai

2014-04-01

186

Pt-CeO2 coating of carbon nanotubes grown on anode gas diffusion layer of the polymer electrolyte membrane fuel cell.  

PubMed

The growing of carbon nanotubes on a gas diffusion layer (GDL) was investigated using electron microscopy and photoelectron spectroscopy. The 30 nm thick Pt doped CeO2 layers were deposited by (rf) magnetron sputtering using a CeO2-Pt target on a carbon diffusion layer overgrown by carbon nanotubes. The anode prepared in such a way was tested in the proton exchange membrane fuel cell. Hydrogen/air fuel cell activity measurements normalized to the amount of used Pt revealed high specific power (W mg(-1) Pt). The high activity of this anode with CNT-grown is explained by high specific area of the catalyst, high conductivity of CNT-GDL junction and high activity of platinum present in cationic state Pt2,4+. Very high specific power and low cost together with physical vapor deposition of catalyst makes this anode preparation promising for micro fabrication of fuel cells to power mobile systems. PMID:21770144

Fiala, R; Khalakhan, I; Matolínová, I; Václav?, M; Vorokhta, M; Sofer, Z; Huber, S; Potin, V; Matolín, V

2011-06-01

187

Fabrication of hydrogenated amorphous Si/crystalline Si1?xGex (x ? 0.84) heterojunction solar cells grown by solid source molecular beam epitaxy  

NASA Astrophysics Data System (ADS)

We characterized hydrogenated amorphous Si/single-crystalline Si1?xGex heterojunction solar cells grown on Si substrates with Ge content (x) between 0.49 and 0.84 in an effort to develop materials with a bandgap range of 0.9–1.0 eV for solar applications. We showed that 3-µm-thick Si0.16Ge0.84 films grown by molecular-beam epitaxy on a virtual substrate composed of buffer layers with stepwise gradation of their composition have an almost fully strain-relaxed condition and a low dislocation density, less than 105 cm?2. An absorption edge extending up to 1300 nm and an increased quantum efficiency were observed in Si1?xGex cells with x = 0.49, 0.70, and 0.84. Consequently, the short-circuit current density increased non-linearly with Ge content, being 14.0 and 24.0 mA/cm2 for 3-µm-thick Si and Si0.16Ge0.84 cells, respectively.

Oshima, Ryuji; Yamanaka, Mitsuyuki; Kawanami, Hitoshi; Sakata, Isao; Matsubara, Koji; Sugaya, Takeyoshi

2015-01-01

188

Grown-in defects and defects produced by 1-Me electron irradiated in Al0.3Ga0.7As P-N junction solar cells  

NASA Technical Reports Server (NTRS)

Studies of grown-in defects and defects produced by the one-MeV electron irradiation in Al sub 0.3 Ga sub 0.7As p-n junction solar cells fabricated by liquid phase epitaxial (LPE) technique were made for the unirradiated and one-MeV electron irradiated samples, using DLTS and C-V methods. Defect and recombination parameters such as energy level, defect density, carrier capture cross sections and lifetimes were determined for various growth, annealing, and irradiation conditions.

Li, S. S.; Teng, K. W.; Schoenfeld, D. W.; Rahilly, W. P.

1982-01-01

189

Suramin-treated HT29-D4 cells grown in the presence of glucose in permeable culture chambers form electrically active epithelial monolayers. A comparative study with HT29-D4 cells grown in the absence of glucose.  

PubMed

The clonal cell line HT29-D4 is able to differentiate by two different ways: i) by replacing glucose by galactose in the culture medium; ii) by addition of suramin (a drug known to interfere with the growth promoting activity of growth factors) in the medium. In both cases the transition in the organization of the cell monolayer occurred without cell loss. The two ways (i.e., glucose starvation or suramin addition) lead to polarized cells which generate electrically active cell monolayers (Fantini et al., Biol. Cell 65, 163-169 (1989) and this paper). Yet several important differences can be observed at the morphological or at the electrophysiological levels. 1) The suramin-treated cells (HT29-D4-S cells) organized into monolayers of high (40-50 microns) columnar cells while glucose-starved cells (HT29-D4-Gal cells) were rather cuboidal (20-25 microns). 2) HT29-D4-S cells were highly polarized; the nucleus was rejected at the basal side of the cell and lysosomes in the upper part of the cytoplasm. Numerous lipid-like droplets surrounded with glycogen were observed underneath the nucleus. HT29-D4-Gal cells never presented such a degree of organization. 3) The transepithelial resistance and the potential difference of HT29-D4-S monolayers reached values significantly higher than those for HT29-D4-Gal monolayers, reflecting a higher degree of organization. Specific proteins such as sucrase-isomaltase, alkaline phosphatase and carcinoembryonic antigen were localized exclusively on the apical membrane while human lymphocyte antigen (HLA) class I molecules were restricted to the basolateral membrane for both HT29-D4-S and HT29-D4-Gal cells. The present data demonstrate that the same cells can generate a different degree of cellular organization according to the experimental conditions of cell growth, the most elaborate state of differentiation being obtained in the presence of suramin. PMID:2328732

Fantini, J; Rognoni, J B; Verrier, B; Lehmann, M; Roccabianca, M; Mauchamp, J; Marvaldi, J

1990-02-01

190

Alternative cell line for virus isolation.  

PubMed Central

A human lung carcinoma cell line (A549) was compared with various other cell lines to determine susceptibility to viral growth. In the first phase of the study, A549 cells were compared with human embryonic kidney (HEK) and cynomolgus monkey kidney (CMK) cells for isolation of upper-respiratory disease viruses by using 1,248 throat swab specimens from basic-combat trainees. Of the 552 virus isolates, 507 were adenoviruses, 41 were polioviruses, and 4 were herpes simplex viruses (HSV). Of the isolates, 518 (93.8%) were isolated in A549 cells, 480 (87.0%) were isolated in HEK cells, and 262 (47.5%) were isolated in CMK cells (P less than 0.001). In the second phase of the study, A549 cells were compared with a human diploid fibroblast cell strain (MRC-5) and Vero monkey kidney (VMK) cells for the isolation of HSV from 1,157 specimens submitted for culture. Of the 227 HSV isolates, 210 (92.5%) were isolated in A549 cells, 202 (89.0%) were isolated in VMK cells (P greater than 0.1 for A549 versus VMK cells), and 167 (73.6%) were isolated in MRC-5 cells (P less than 0.001 for A549 versus MRC-5 cells). These results suggest that A549 cells are more susceptible to adenovirus infection and at least as susceptible to HSV infection compared with the other cell cultures evaluated. Detracting factors for the use of A549 cells were a slight loss of sensitivity to adenovirus at passage 120 and a concurrent change in the morphology of the cells. The A549 cell line proved to be an efficient, practical, and economical alternative cell system for the isolation of adenovirus and HSV in particular. Initial indications are that other clinically significant viruses may be grown in A549 cells; however, additional studies need to be performed. PMID:3018038

Smith, C D; Craft, D W; Shiromoto, R S; Yan, P O

1986-01-01

191

Differential Effect of Auxin on Molecular Weight Distributions of Xyloglucans in Cell Walls of Outer and Inner Tissues from Segments of Dark Grown Squash (Cucurbita maxima Duch.) Hypocotyls.  

PubMed

Effects of indole-3-acetic acid (IAA) on the mechanical properties of cell walls and structures of cell wall polysaccharides in outer and inner tissues of segments of dark grown squash (Cucurbita maxima Duch.) hypocotyls were investigated. IAA induced the elongation of unpeeled, intact segments, but had no effect on the elongation of peeled segments. IAA induced the cell wall loosening in outer tissues as studied by the stress-relaxation analysis but not in inner tissues. IAA-induced changes in the net sugar content of cell wall fractions in outer and inner tissues were very small. Extracted hemicellulosic xyloglucans derived from outer tissues had a molecular weight about two times as large as in inner tissues, and the molecular weight of xyloglucans in both outer and inner tissues decreased during incubation. IAA substantially accelerated the depolymerization of xyloglucans in outer tissues, while it prevented that in inner tissues. These results suggest that IAA-induced growth in intact segments is due to the cell wall loosening in outer tissues, and that IAA-accelerated depolymerization of hemicellulosic xyloglucans in outer tissues is involved in the cell wall loosening processes. PMID:16668092

Wakabayashi, K; Sakurai, N; Kuraishi, S

1991-04-01

192

Phosphate release and heavy metal accumulation by biofilm-immobilized and chemically-coupled cells of a Citrobacter sp. pre-grown in continuous culture.  

PubMed

A heavy metal-accumulating Citrobacter sp. was grown in carbon-limiting continuous culture in an air-lift fermentor containing raschig rings as support for biofilm development. Planktonic cells from the culture outflow were immobilized in parallel on raschig rings by chemical coupling (silanization), for quantitative comparison of phosphatase activity and uranyl uptake by both types of immobilized cell. The flow rate giving 50% conversion of substrate to product (phosphate) in flow-through reactors was higher, by 35-40%, for the biofilm-immobilized cells, possibly exploiting a pH-buffering effect of inorganic phosphate species within the extracellular polymeric material. Upon incorporation of uranyl ions (0.2 mM UO22+), both types of cell removed more than 90% of the input UO22+ at slow flow rates, but the chemically-coupled cells performed better at higher flow rates. The deposited material (HUO2PO4) subsequently removed Ni2+ from a second flow via intercalative ion exchange of Ni2+ into the crystalline HUO2PO4.4H2O lattice. This occurred irrespective of the method of coupling of the biomass to the support and suggested that uranyl phosphate accumulated by both types of cell has potential as a bio-inorganic ion exchanger-a potential use for the uranium recoved from primary waste treatment processes. PMID:10099584

Finlay, J A; Allan, V J; Conner, A; Callow, M E; Basnakova, G; Macaskie, L E

1999-04-01

193

GROWTH CHARACTERISTICS, MORPHOLOGY, AND PHOSPHOLIPID COMPOSITION OF HUMAN TYPE 2 PULMONARY ALVEOLAR CELLS GROWN IN A COLLAGEN-FREE MICROENVIRONMENT  

EPA Science Inventory

Human lung epithelial cells have been cultured and characterized for phospholipid content. Any residual fibroblasts were removed by selective trypsinization within the first 48 hours in culture. Epithelial cells were serially subpassaged when cultures reached ca. 80% confluency. ...

194

Vero cytotoxin-producing Escherichia coli O157 infections in Austria.  

PubMed

To determine the prevalence of Vero cytotoxin-producing Escherichia coli (VTEC) serotype O157 associated diarrhea in the Austrian patient population, we surveyed all stool specimens of liquid consistency submitted to the Federal Public Health Laboratory (FPHL) in Innsbruck for 2 years for this organism. This laboratory serves a population of approximately 1 Million people. Of 5,265 stool specimens, 7 yielded O157 VTEC. Five isolates of E. coli O157 phage type 32, VT2 were cultured from specimens received during a three day period from residents in the county of Schwaz. During the investigation of this "outbreak" E. coli O157 strains were also isolated from two household contacts. Only 1 out of 8 persons with E. coli O157 diarrhea had bloody stools, although 5 of 7 tested specimens (= 71%) also yielded Campylobacter jejuni. None of our patients received antimicrobial therapy directed against E. coli O157 (one child had josamycin). There were no fatalities and no cases of hemolytic uremic syndrome (follow up period: 6 months). Consumption of hamburger, roast beef, and unpasteurized milk was not confirmed in this study. In Austria, no O157 VTEC strain was isolated till June 1992, although at the FPHL in Innsbruck stool specimens of liquid consistency were cultured for this organism since January 1991. PMID:8212755

Sölder, B; Allerberger, F; Eigentler, A; Köfler, D; Larcher, C; Dierich, M P; Rowe, B

1993-06-01

195

Identification of chikungunya virus interacting proteins in mammalian cells.  

PubMed

Identification and characterization of virus host interactions is an essential step for the development of novel antiviral strategies. Very few studies have been targeted towards identification of chikungunya virus (CHIKV) interacting host proteins. In current study, virus overlay protein binding assay (VOPBA) and matrix-assisted laser desorption/ ionization time of flight analysis (MALDI TOF/TOF) were employed for the identification of CHIKV binding proteins in mammalian cells. HSP70 and actin were identified as virus binding proteins in HEK-293T and Vero-E6 cells, whereas STAT-2 was identified as an additional protein in Vero-E6 cells. Pre-incubation with anti-HSP70 antibody and miRNA silencing of HSP70 significantly reduced the CHIKV production in HEK-293T and Vero-E6 cells at early time points. These results suggest that CHIKV exploits the housekeeping molecules such as actin, HSP70 and STAT-2 to establish infection in the mammalian cells. PMID:24845503

Paingankar, Mandar S; Arankalle, Vidya A

2014-06-01

196

Lactoferrin inhibits herpes simplex virus type 1 adsorption to Vero cells  

Microsoft Academic Search

This paper describes the ability of human and bovine lactoferrins (HLf; BLf), iron-binding proteins belonging to the non-immune defense system, to interfere with herpes simplex virus type 1 (HSV-1) infection. Since lactoferrins are known to bind to heparan sulphate proteoglycans and to low density lipoprotein receptor, which in turn act as binding sites for the initial interaction of HSV-1 with

Magda Marchetti; Catia Longhi; Maria Pia Conte; Silvia Pisani; Piera Valenti; Lucilla Seganti

1996-01-01

197

The attraction of Trypanosoma cruzi to vertebrate cells in vitro.  

PubMed

A video technic is described that permits a quantification of the degree of attraction of Trypanosoma cruzi trypomastigotes to vertebrate cells in vitro. Bovine embryo skeletal muscle cells (BESM), HeLa cells and Vero cells all attract a myotropic strain of T. cruzi trypomastigotes. BESM cells, however, are 2-fold more attractive to trypomastigotes than HeLa cells and 10-fold more attractive than Vero cells. Heat-inactivation of BESM cells abolishes their ability to respire and also to attract T. cruzi trypomastigotes. As there is no difference in the endogenous oxygen consumption between BESM, HeLa, and Vero cells, it is unlikely that differences in the attraction of trypomastigotes to the 3 cell types are due to variations in the magnitude of pO2 or pCO2 gradients in the milieu around the cells. PMID:826623

Dvorak, J A; Howe, C L

1976-11-01

198

Global gene expression profiles of canine macrophages and canine mammary cancer cells grown as a co-culture in vitro  

PubMed Central

Background Solid tumours comprise various cells, including cancer cells, resident stromal cells, migratory haemopoietic cells and other. These cells regulate tumour growth and metastasis. Macrophages constitute probably the most important element of all interactions within the tumour microenvironment. However, the molecular mechanism, that guides tumour environment, still remains unknown. Exploring the underlying molecular mechanisms that orchestrate these phenomena has been the aim of our study. A co-culture of canine mammary cancer cells and macrophages was established and maintained for 72 hrs. Having sorted the cells, gene expression in cancer cells and macrophages, using DNA microarrays, was examined. The results were confirmed using real-time qPCR and confocal microscopy. Moreover, their ability for migration and invasion has been assessed. Results Microarray analysis showed that the up-regulated genes in the cancer cell lines are involved in 15 highly over-manifested pathways. The pathways that drew our diligent attention included: the inflammation pathway mediated by chemokine and cytokine, the Toll receptor signalling pathway and the B cell activation. The up-regulated genes in the macrophages were involved in only 18 significantly over-manifested pathways: the angiogenesis, the p53 pathway feedback loops2 and the Wnt signalling pathway. The microarray analysis revealed that co-culturing of cancer cells with macrophages initiated the myeloid-specific antigen expression in cancer cells, as well as cytokine/chemokine genes expression. This finding was confirmed at mRNA and protein level. Moreover, we showed that macrophages increase cancer migration and invasion. Conclusions The presence of macrophages in the cancer environment induces acquisition of the macrophage phenotype (specific antigens and chemokines/cytokines expression) in cancer cells. We presumed that cancer cells also acquire other myeloid features, such as: capabilities of cell rolling, spreading, migration and matrix invasion (what has also been confirmed by our results). It may, perhaps, be the result of myeloid-cancer cell hybrid formation, or cancer cells mimicking macrophages phenotype, owing to various proteins secreted by macrophages. PMID:22353646

2012-01-01

199

1.6/1.1 eV metamorphic GaInP/GaInAs solar cells grown by MOVPE on Ge  

NASA Astrophysics Data System (ADS)

This paper focuses on the metal-organic vapor-phase epitaxy (MOVPE) growth of 2-junction (2J) solar cells where epitaxial Ga 0.29In 0.71P top and Ga 0.77In 0.23As bottom subcells are grown lattice-mismatched on a Ge substrate. Single-junction metamorphic devices with 23%-In GaInAs are grown on 100-mm dia. (0 0 1) Ge substrates. Layers are observed to be fully relaxed by high-resolution X-ray diffraction. Threading dislocation densities of 3.1×10 6 cm -2 are measured. Single-junction devices in the 1.1-eV materials demonstrate near 100% internal quantum efficiency above the band gap and an open-circuit voltage comparable to world-record silicon photovoltaic devices. The presence and strength of CuPt B ordering is explored in controlling the band gap of the Ga 0.29In 0.71P top subcell devices between 1.647 and 1.593 eV. An order parameter of 0.28 is measured by X-ray measurement of the forbidden {1}/{2}(1 1 5) reflection for the low-band gap material. The presence of low-resistance shunt pathways is observed as the present obstacle to reaching the potential efficiency of 30% for these metamorphic dual-junction devices.

Fetzer, C. M.; Yoon, H.; King, R. R.; Law, D. C.; Isshiki, T. D.; Karam, N. H.

2005-03-01

200

Human RPE Stem Cells Grown into Polarized RPE Monolayers on a Polyester Matrix Are Maintained after Grafting into Rabbit Subretinal Space  

PubMed Central

Summary Transplantation of the retinal pigment epithelium (RPE) is being developed as a cell-replacement therapy for age-related macular degeneration. Human embryonic stem cell (hESC) and induced pluripotent stem cell (iPSC)-derived RPE are currently translating toward clinic. We introduce the adult human RPE stem cell (hRPESC) as an alternative RPE source. Polarized monolayers of adult hRPESC-derived RPE grown on polyester (PET) membranes had near-native characteristics. Trephined pieces of RPE monolayers on PET were transplanted subretinally in the rabbit, a large-eyed animal model. After 4 days, retinal edema was observed above the implant, detected by spectral domain optical coherence tomography (SD-OCT) and fundoscopy. At 1 week, retinal atrophy overlying the fetal or adult transplant was observed, remaining stable thereafter. Histology obtained 4 weeks after implantation confirmed a continuous polarized human RPE monolayer on PET. Taken together, the xeno-RPE survived with retained characteristics in the subretinal space. These experiments support that adult hRPESC-derived RPE are a potential source for transplantation therapies. PMID:24511471

Stanzel, Boris V.; Liu, Zengping; Somboonthanakij, Sudawadee; Wongsawad, Warapat; Brinken, Ralf; Eter, Nicole; Corneo, Barbara; Holz, Frank G.; Temple, Sally; Stern, Jeffrey H.; Blenkinsop, Timothy A.

2014-01-01

201

Improved conversion efficiency of as-grown InGaN/GaN quantum-well solar cells for hybrid integration  

NASA Astrophysics Data System (ADS)

We report on the photovoltaic characteristics of solar cells based on 15 and 30 InxGa1-xN/GaN (x = 0.10 and 0.19) multiquantum wells (MQWs) grown on sapphire. Doubling the number of MQWs increases the peak external quantum efficiency by a factor of 2 for both In contents. Devices with 19% In, with a spectral cutoff at 465 nm, exhibit an open-circuit voltage of 1.7 V and a short-circuit current density of 3.00 mA/cm2 under 1 sun AM1.5G illumination, leading to a conversion efficiency of 2.00%, making them promising for hybrid integration with non-III-nitride photovoltaic devices.

Valdueza-Felip, Sirona; Mukhtarova, Anna; Grenet, Louis; Bougerol, Catherine; Durand, Christophe; Eymery, Joel; Monroy, Eva

2014-03-01

202

Stability of single and tandem junction a-Si:H solar cells grown using the ECR process  

SciTech Connect

The authors report on the fabrication and stability tests of single junction a-Si:H, and tandem junction a-Si:H/A-Si:H solar cells using the ECR process under high hydrogen dilution (H-ECR process). They show that devices with high fill factors can be made using the H-ECR process. They also report on the stability studies of the solar cells under 1 and 2-sun illumination conditions. The solar cells show very little degradation even after 500 hours of illumination under 2 x sunlight illumination.

Dalal, V.L.; Maxson, T.; Girvan, R.; Haroon, S.

1997-07-01

203

Lipid content and fatty acid composition of green algae Scenedesmus obliquus grown in a constant cell density apparatus  

NASA Technical Reports Server (NTRS)

The lipids of alga Scenedesmus obliquus grown under controlled conditions were separated and fractionated by column and thin-layer chromatography, and fatty acid composition of each lipid component was studied by gas-liquid chromatography (GLC). Total lipids were 11.17%, and neutral lipid, glycolipid and phospholipid fractions were 7.24%, 2.45% and 1.48% on a dry weight basis, respectively. The major neutral lipids were diglycerides, triglycerides, free sterols, hydrocarbons and sterol esters. The glycolipids were: monogalactosyl diglyceride, digalactosyl diglyceride, esterified sterol glycoside, and sterol glycoside. The phospholipids included: phosphatidyl choline, phosphatidyl glycerol and phosphatidyl ethanolamine. Fourteen fatty acids were identified in the four lipid fractions by GLC. The main fatty acids were C18:2, C16:0, C18:3(alpha), C18:1, C16:3, C16:1, and C16:4. Total unsaturated fatty acid and essential fatty acid compositions of the total algal lipids were 80% and 38%, respectively.

Choi, K. J.; Nakhost, Z.; Barzana, E.; Karel, M.

1987-01-01

204

Lipid content and fatty acid composition of green algae Scenedesmus obliquus grown in a constant cell density apparatus.  

PubMed

The lipids of alga Scenedesmus obliquus grown under controlled conditions were separated and fractionated by column and thin-layer chromatography, and fatty acid composition of each lipid component was studied by gas-liquid chromatography (GLC). Total lipids were 11.17%, and neutral lipid, glycolipid and phospholipid fractions were 7.24%, 2.45% and 1.48% on a dry weight basis, respectively. The major neutral lipids were diglycerides, triglycerides, free sterols, hydrocarbons and sterol esters. The glycolipids were: monogalactosyl diglyceride, digalactosyl diglyceride, esterified sterol glycoside, and sterol glycoside. The phospholipids included: phosphatidyl choline, phosphatidyl glycerol and phosphatidyl ethanolamine. Fourteen fatty acids were identified in the four lipid fractions by GLC. The main fatty acids were C18:2, C16:0, C18:3(alpha), C18:1, C16:3, C16:1, and C16:4. Total unsaturated fatty acid and essential fatty acid compositions of the total algal lipids were 80% and 38%, respectively. PMID:11539709

Choi, K J; Nakhost, Z; Barzana, E; Karel, M

1987-01-01

205

Cell surface characterization of amastigotes of Trypanosoma cruzi obtained from different sources  

Microsoft Academic Search

The present study analyses the morphology and the exposition of surface carbohydrates and the Ssp4 antigen of amastigote\\u000a forms of Trypanosoma cruzi (Y strain) obtained from three different sources: (a) intracellular, isolated from infected Vero cells 3 days after infection,\\u000a (b) extracellular, isolated from the supernatant of Vero cells 15 days after infection, and (c) axenic, obtained by incubation\\u000a of

E. O. Silva; E. M. B. Saraiva; W. De Souza; T. Souto-Padrón

1998-01-01

206

Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture  

NASA Technical Reports Server (NTRS)

Cocultured Xenopus neurons and myocytes were subjected to non-vectorial gravity by clinostat rotation to determine if microgravity, during space flights, may affect cell development and communications. Clinorotated cells showed changes consistent with the hypothesis that cell differentiation, in microgravity, is altered by interference with cytoskeleton-related mechanisms. We found: increases in the myocyte and its nuclear area, "fragmentation" of nucleoli, appearance of neuritic "aneurysms", decreased growth in the presence of "trophic" factors, and decreased yolk utilization. The effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. Some parameters returned to near control values within 48 hrs after cessation of rotation. Cells from cultures rotated at higher speeds (>50 rpm) appeared comparable to controls. Compensation by centrifugal forces may account for this finding. Our data are consistent, in principle, with effects on other, flighted cells and suggest that "vector-free" gravity may simulate certain aspects of microgravity. The distribution of acetylcholine receptor aggregates, on myocytes, was also altered. This indicates that brain development, in microgravity, may also be affected.

Gruener, R.; Hoeger, G.

1988-01-01

207

Effect of osteoclast co-culture on the differentiation of human mesenchymal stem cells grown on bone graft granules.  

PubMed

Traditional approaches to bone repair are currently being integrated with innovative tissue-engineering techniques, as researchers and clinicians shift their treatment focus toward regenerating functional tissue rather than just filling a defect to provide structural support. Cells are expanded and incorporated into implantable systems in hopes of enhancing the bone-forming capabilities of traditional bone graft substitutes. The present study examined how osteoclasts might be used to stimulate the differentiation of human mesenchymal stem cells (hMSCs) into bone forming cells. The two cell types were co-cultured on a resorbable, three-dimensional bone graft substitute. Osteoclasts were seeded prior to the addition of hMSCs, as well as simultaneously, to determine if resorption of the scaffold would have any bearing on observed response by hMSCs. When seeded directly with hMSCs on the 3-D substrates, the osteoclasts had an increase in TRAP expression over time if seeded simultaneously. The co-culture setup had a positive influence on the proliferation of hMSCs. Late stage osteoblast differentiation markers (bone sialoprotein) were positively affected by direct co-culture with osteoclasts. The addition of RANKL to the culture medium for osteoclastogenesis appears to be a factor in the observed responses by hMSCS, but is not the only factor influencing the MSCs. Osteoclasts were shown to have an influence on the development of mesenchymal stem cells into osteoblasts when cultured in vitro. Findings from this study, coupled with the knowledge obtained from our previous work, will aid in the development of a clinically viable mesenchymal stem cell based bone graft system. PMID:20566059

Sinclair, Sarina S Kay; Burg, Karen J L

2011-01-01

208

Comparison of initial feasibility of host cell lines for viral vaccine production.  

PubMed

In order to reduce the time required for the development and production of viral vaccines, host cell lines should be available as expression systems for production of viral vaccines against groups of viral pathogens. A selection of cell lines was compared for their initial feasibility as expression system for the replication of polioviruses, influenza A viruses and respiratory syncytial virus (wild type strain A2). Six adherent cell lines (Vero, HEK-293, MRC-5, CHO-K1, BHK-21 c13, MDCK) and six single cell suspension cell lines (CAP, AGE1.CR.HS, sCHO-K1, BHK-21 c13 2p, MDCK SFS) were studied for their ability to propagate viruses. First, maximum cell densities were determined. Second, virus receptor expression and polarization of the cell lines regarding receptor distribution of eight different viruses were monitored using flow cytometry and immunocytochemistry. Organization of the actin cytoskeleton was studied by transfection of the cells with Lifeact™, a construct coding for actin-EGFP. Finally, the ability to produce virus progeny of the viruses studied was assayed for each cell line. The results suggest that single cell suspension cell lines grown on serum free medium are the best candidates to serve as host cell lines for virus replication. PMID:23684847

Vlecken, Danielle H W; Pelgrim, Ralf P M; Ruminski, Slawomir; Bakker, Wilfried A M; van der Pol, Leo A

2013-10-01

209

Biofilm-Grown Burkholderia cepacia Complex Cells Survive Antibiotic Treatment by Avoiding Production of Reactive Oxygen Species  

PubMed Central

The presence of persister cells has been proposed as a factor in biofilm resilience. In the present study we investigated whether persister cells are present in Burkholderia cepacia complex (Bcc) biofilms, what the molecular basis of antimicrobial tolerance in Bcc persisters is, and how persisters can be eradicated from Bcc biofilms. After treatment of Bcc biofilms with high concentrations of various antibiotics often a small subpopulation survived. To investigate the molecular mechanism of tolerance in this subpopulation, Burkholderia cenocepacia biofilms were treated with 1024 µg/ml of tobramycin. Using ROS-specific staining and flow cytometry, we showed that tobramycin increased ROS production in treated sessile cells. However, approximately 0.1% of all sessile cells survived the treatment. A transcriptome analysis showed that several genes from the tricarboxylic acid cycle and genes involved in the electron transport chain were downregulated. In contrast, genes from the glyoxylate shunt were upregulated. These data indicate that protection against ROS is important for the survival of persisters. To confirm this, we determined the number of persisters in biofilms formed by catalase mutants. The persister fraction in ?katA and ?katB biofilms was significantly reduced, confirming the role of ROS detoxification in persister survival. Pretreatment of B. cenocepacia biofilms with itaconate, an inhibitor of isocitrate lyase (ICL), the first enzyme in the glyoxylate shunt, reduced the persister fraction approx. 10-fold when the biofilms were subsequently treated with tobramycin. In conclusion, most Bcc biofilms contain a significant fraction of persisters that survive treatment with high doses of tobramycin. The surviving persister cells downregulate the TCA cycle to avoid production of ROS and at the same time activate an alternative pathway, the glyoxylate shunt. This pathway may present a novel target for combination therapy. PMID:23516582

Van Acker, Heleen; Sass, Andrea; Bazzini, Silvia; De Roy, Karen; Udine, Claudia; Messiaen, Thomas; Riccardi, Giovanna; Boon, Nico; Nelis, Hans J.; Mahenthiralingam, Eshwar; Coenye, Tom

2013-01-01

210

Activity of mitochondrially synthesized reporter proteins is lower than that of imported proteins and is increased by lowering cAMP in glucose-grown Saccharomyces cerevisiae cells.  

PubMed Central

We selected for increased phenotypic expression of a synthetic cox2::arg8m-G66S reporter gene inserted into Saccharomyces cerevisiae mtDNA in place of COX2. Recessive mutations in ras2 and cyr1, as well as elevated dosage of PDE2, allowed cox2::arg8m-G66S to support Arg prototrophy. Each of these genetic alterations should decrease cellular cAMP levels. The resulting signal was transduced through redundant action of the three cAMP-dependent protein kinases, TPK1, TPK2, and TPK3. ras2 had little or no effect on the level of wild-type Arg8p encoded by cox2::ARG8m, but did increase Arg8p activity, as judged by growth phenotype. ras2 also caused increased fluorescence in cells carrying the synthetic cox3::GFPm reporter in mtDNA, but had little effect on the steady-state level of GFP polypeptide detected immunologically. Thus, decreased cAMP levels did not affect the synthesis of mitochondrially coded protein reporters in glucose-grown cells, but rather elevated activities in the matrix that promote efficient folding. Furthermore, we show that when Arg8p is synthesized in the cytoplasm and imported into mitochondria, it has greater activity than when it is synthesized in the matrix. Thus, mitochondrially synthesized proteins may not have the same access to matrix chaperones as cytoplasmically synthesized proteins emerging from the import apparatus. PMID:14668357

Demlow, Christina M; Fox, Thomas D

2003-01-01

211

Activity of mitochondrially synthesized reporter proteins is lower than that of imported proteins and is increased by lowering cAMP in glucose-grown Saccharomyces cerevisiae cells.  

PubMed

We selected for increased phenotypic expression of a synthetic cox2::arg8m-G66S reporter gene inserted into Saccharomyces cerevisiae mtDNA in place of COX2. Recessive mutations in ras2 and cyr1, as well as elevated dosage of PDE2, allowed cox2::arg8m-G66S to support Arg prototrophy. Each of these genetic alterations should decrease cellular cAMP levels. The resulting signal was transduced through redundant action of the three cAMP-dependent protein kinases, TPK1, TPK2, and TPK3. ras2 had little or no effect on the level of wild-type Arg8p encoded by cox2::ARG8m, but did increase Arg8p activity, as judged by growth phenotype. ras2 also caused increased fluorescence in cells carrying the synthetic cox3::GFPm reporter in mtDNA, but had little effect on the steady-state level of GFP polypeptide detected immunologically. Thus, decreased cAMP levels did not affect the synthesis of mitochondrially coded protein reporters in glucose-grown cells, but rather elevated activities in the matrix that promote efficient folding. Furthermore, we show that when Arg8p is synthesized in the cytoplasm and imported into mitochondria, it has greater activity than when it is synthesized in the matrix. Thus, mitochondrially synthesized proteins may not have the same access to matrix chaperones as cytoplasmically synthesized proteins emerging from the import apparatus. PMID:14668357

Demlow, Christina M; Fox, Thomas D

2003-11-01

212

Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture  

NASA Technical Reports Server (NTRS)

Cocultured Xenopus neurons and myocytes were subjected to nonvectorial gravity by clinostat rotation to determine the effects of microgravity on cell development and communications. Observed effects included increases in the myocyte and its nuclear area, fragmentation of nucleoli, the appearance of neuritic aneurysms, decreased growth in the presence of trophic factors, and decreased yolk utilization. These effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. It is found that, in microgravity, cell differentiation is altered by interference with cytoskeleton-related mechanisms. It is suggested that the alteration of the distribution of acetylcholine receptor aggregates on myocytes which occurs might indicate that microgravity affects brain development.

Gruener, Raphael; Hoeger, Glenn

1988-01-01

213

Reflectivity and topography of cells grown on glass-coverslips measured with phase-shifted laser feedback interference microscopy  

PubMed Central

In spite of the advantages associated with the molecular specificity of fluorescence imaging, there is still a significant need to augment these approaches with label-free imaging. Therefore, we have implemented a form of interference microscopy based upon phase-shifted, laser-feedback interferometry and developed an algorithm that can be used to separate the contribution of the elastically scattered light by sub-cellular structures from the reflection at the coverslip-buffer interface. The method offers an opportunity to probe protein aggregation, index of refraction variations and structure. We measure the topography and reflection from calibration spheres and from stress fibers and adhesions in both fixed and motile cells. Unlike the data acquired with reflection interference contrast microscopy, where the reflection from adhesions can appear dark, our approach demonstrates that these regions have high reflectivity. The data acquired from fixed and live cells show the presence of a dense actin layer located ? 100 nm above the coverslip interface. Finally, the measured dynamics of filopodia and the lamella in a live cell supports retrograde flow as the dominate mechanism responsible for filopodia retraction. PMID:21833378

At?lgan, Erdinç; Ovryn, Ben

2011-01-01

214

Inhibition of vimentin or B1 integrin reverts morphology of prostate tumor cells grown in laminin-rich extracellular matrix gels and reduces tumor growth in vivo  

SciTech Connect

Prostate epithelial cells grown embedded in laminin-rich extracellular matrix (lrECM) undergo morphologic changes that closely resemble their architecture in vivo. In this study, growth characteristics of three human prostate epithelial sublines derived from the same cellular lineage, but displaying different tumorigenic and metastatic properties in vivo, were assessed in three-dimensional lrECM gels. M12, a highly tumorigenic and metastatic subline, was derived from the immortalized, prostate epithelial P69 cell line by selection in athymic, nude mice and found to contain a deletion of 19p-q13.1. The stable reintroduction of an intact human chromosome 19 into M12 resulted in a poorly tumorigenic subline, designated F6. When embedded in lrECM gels, the parental, nontumorigenic P69 line produced acini with clearly defined lumena. Immunostaining with antibodies to {beta}-catenin, E-cadherin, or {alpha}6 and {beta}1 integrins showed polarization typical of glandular epithelium. In contrast, the metastatic M12 subline produced highly disorganized cells with no evidence of polarization. The F6 subline reverted to acini-like structures exhibiting basal polarity marked with integrins. Reducing either vimentin levels via small interfering RNA interference or the expression of {alpha}6 and {beta}1 integrins by the addition of blocking antibodies, reorganized the M12 subline into forming polarized acini. The loss of vimentin significantly reduced M12-Vim tumor growth when assessed by s.c. injection in athymic mice. Thus, tumorigenicity in vivo correlated with disorganized growth in three-dimensional lrECM gels. These studies suggest that the levels of vimentin and {beta}1 integrin play a key role in the homeostasis of the normal acinus in prostate and that their dysregulation may lead to tumorigenesis. [Mol Cancer Ther 2009;8(3):499-508].

Zhang, Xueping; Fournier, Marcia V; Ware, Joy L; Bissell, Mina J; Yacoub, Adly; Zehner, Zendra E

2008-06-12

215

Regulation of Cell Division, Biofilm Formation, and Virulence by FlhC in Escherichia coli O157:H7 Grown on Meat?†  

PubMed Central

To understand the continuous problems that Escherichia coli O157:H7 causes as food pathogen, this study assessed global gene regulation in bacteria growing on meat. Since FlhD/FlhC of E. coli K-12 laboratory strains was previously established as a major control point in transducing signals from the environment to several cellular processes, this study compared the expression pattern of an E. coli O157:H7 parent strain to that of its isogenic flhC mutant. This was done with bacteria that had been grown on meat. Microarray experiments revealed 287 putative targets of FlhC. Real-time PCR was performed as an alternative estimate of transcription and confirmed microarray data for 13 out of 15 genes tested (87%). The confirmed genes are representative of cellular functions, such as central metabolism, cell division, biofilm formation, and pathogenicity. An additional 13 genes from the same cellular functions that had not been hypothesized as being regulated by FlhC by the microarray experiment were tested with real-time PCR and also exhibited higher expression levels in the flhC mutant than in the parent strain. Physiological experiments were performed and confirmed that FlhC reduced the cell division rate, the amount of biofilm biomass, and pathogenicity in a chicken embryo lethality model. Altogether, this study provides valuable insight into the complex regulatory network of the pathogen that enables its survival under various environmental conditions. This information may be used to develop strategies that could be used to reduce the number of cells or pathogenicity of E. coli O157:H7 on meat by interfering with the signal transduction pathways. PMID:21498760

Sule, Preeti; Horne, Shelley M.; Logue, Catherine M.; Prüß, Birgit M.

2011-01-01

216

Chilling-induced ultrastructural changes to mesophyll cells of Arabidopsis grown under short days are almost completely reversible by plant re-warming.  

PubMed

Exposure of plants to chilling (low temperatures above freezing) limits growth and development in all environments outside the lowest latitudes. Cell ultrastructure and morphometric studies may allow associations to be made between chilling-induced changes at the ultrastructural level, molecular events and their physiological consequences. We examined changes in the shape, size and membrane organization of the organelles of mesophyll cells in Arabidopsis thaliana (Col 0), a cold-resistant species, after subjecting 6-week-old plants grown at normal growth temperatures to chilling (2.5-4°C; 14-h dark/10-h light cycle) for 6, 24 and 72 h and after a re-warming period of 50 h. No ultrastructural differences were seen in the first 6 h of chilling but after 24 h we observed swollen and rounded chloroplasts with larger starch grains and dilated thylakoids compared to control plants. By 72 h, chilling had resulted in a large accumulation of starch in chloroplasts, an apparent crowding of the cytosol and a lower abundance of peripheral reticulum than in the controls. The average area per chloroplast in cell sections increased after 72-h chilling while the number of chloroplasts remained the same. Ring-shaped and other morphologically aberrant mitochondria were present in significantly higher abundance in plants given 72 h chilling than in the controls. Plant re-warming for 50 h reduced chloroplast size to those of the controls and returned mitochondria to standard morphology, but peripheral reticulum remained less abundant than in plants never given a cold treatment. The near full return to normal ultrastructure upon plant re-warming indicates that the morphological changes may be part of acclimation to cold. PMID:22198491

Vella, Nicole G F; Joss, Tom V; Roberts, Thomas H

2012-10-01

217

The polyGeVero® software for fast and easy computation of 3D radiotherapy dosimetry data  

NASA Astrophysics Data System (ADS)

The polyGeVero® software package was elaborated for calculations of 3D dosimetry data such as the polymer gel dosimetry. It comprises four workspaces designed for: i) calculating calibrations, ii) storing calibrations in a database, iii) calculating dose distribution 3D cubes, iv) comparing two datasets e.g. a measured one with a 3D dosimetry with a calculated one with the aid of a treatment planning system. To accomplish calculations the software was equipped with a number of tools such as the brachytherapy isotopes database, brachytherapy dose versus distance calculation based on the line approximation approach, automatic spatial alignment of two 3D dose cubes for comparison purposes, 3D gamma index, 3D gamma angle, 3D dose difference, Pearson's coefficient, histograms calculations, isodoses superimposition for two datasets, and profiles calculations in any desired direction. This communication is to briefly present the main functions of the software and report on the speed of calculations performed by polyGeVero®.

Kozicki, Marek; Maras, Piotr

2015-01-01

218

Cordyceps militaris Grown on Germinated Soybean Induces G2/M Cell Cycle Arrest through Downregulation of Cyclin B1 and Cdc25c in Human Colon Cancer HT-29 Cells  

PubMed Central

Cordyceps militaris (CM) is an insect-borne fungus that has been used in traditional Chinese medicine because of its wide range of pharmacological activities. In this paper, we studied CM grown on germinated soybean (GSC) and investigated the possible mechanisms underlying antiproliferative effect of GSC on HT-29 human colon cancer cells. In comparison with CM extracts and germinated soybean (GS) BuOH extracts, BuOH extracts of GSC showed remarkable inhibitory and antiproliferative effects on HT-29 colon cancer cells. After GSC treatment, HT-29 cells became smaller and irregular in shape. High G2/M phase cell populations were observed in the GSC-treated group. The levels of cyclin B1 and Cdc25 in the GSC-treated group were lower than those in the control group. These findings suggest that GSC BuOH extracts might act as an effective anti-proliferative agent by inducing G2/M cell cycle arrest in colon cancer cells. PMID:22474493

Mollah, Mohammad Lalmoddin; Park, Dong Ki; Park, Hye-Jin

2012-01-01

219

The role of connexins in the differentiation of NT2 cells in Sertoli-NT2 cell tissue constructs grown in the rotating wall bioreactor.  

PubMed

Neural transplantation is developing as a successful treatment for neurodegenerative diseases such as Parkinson's disease. The human Ntera-2/D1 (NT2) cell line is an attractive alternative to the use of human fetal neurons as a cell source for transplantation. We have explored combining NT2 cells, as a neuronal source, and Sertoli cells, which may act as a graft facilitator to enhance neuronal survival and differentiation, and ameliorate the host immune response, into a tissue construct for use in cell replacement therapy for neurodegenerative disease. This Sertoli-NT2-aggregated cell (SNAC) tissue construct is formed in the high aspect ratio vessel (HARV) bioreactor. NT2 cells differentiate to dopaminergic NT2N neurons within the SNAC tissue construct without retinoic acid. We report here that the gap junction protein connexin 43 is decreased among differentiated NT2N neurons. Inhibition of connexin 43 with 18beta glycyrrhetinic acid and carbenoxolone, a glycyrrhetinic acid derivative, during formation of the SNAC tissue constructs disrupts the differentiation of NT2 cells. Therefore, connexin 43 is important in the differentiation of NT2 cells in the SNAC tissue construct. PMID:16328273

Shamekh, R; Cameron, D F; Willing, A E; Saporta, S

2006-04-01

220

Investigation of anodic and chemical oxides grown on p-type InP with applications to surface passivation for n(+)-p solar cell fabrication  

NASA Technical Reports Server (NTRS)

Most of the previously reported InP anodic oxides were grown on a n-type InP with applications to fabrication of MISFET structures and were described as a mixture of In2O3 and P2O5 stoichiometric compounds or nonstoichiometric phases which have properties similar to crystalline compounds In(OH)3, InPO4, and In(PO3)3. Details of the compositional change of the anodic oxides grown under different anodization conditions were previously reported. The use of P-rich oxides grown either by anodic or chemical oxidation are investigated for surface passivation of p-type InP and as a protective cap during junction formation by closed-ampoule sulfur diffusion. The investigation is based on but not limited to correlations between PL intensity and X-ray photoelectron spectroscopy (XPS) chemical composition data.

Faur, Maria; Faur, Mircea; Goradia, Manju; Goradia, Chandra; Jenkins, Phillip; Jayne, Douglas; Weinberg, Irving

1991-01-01

221

Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin  

SciTech Connect

An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of /sup 125/I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of /sup 125/I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry an internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies.

Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.; MacDonald, A.B.; Eidels, L.

1989-03-01

222

High-efficiency solar cells fabricated from direct-current magnetron sputtered n-indium tin oxide onto p-InP grown by atmospheric pressure metalorganic vapor phase epitaxy  

SciTech Connect

Solar cells based on dc magnetron sputtered indium tin oxide onto epitaxially grown films of p-InP have been fabricated and analyzed. The best cells had a global efficiency of 18.4% and an air mass zero (AMO) efficiency of 16.0%. The principal fabrication variable considered was the constituency of the sputtering gas and both argon/hydrogen and argon/oxygen mixtures have been used. The former cells have the higher efficiencies, are apparently stable, and exhibit almost ideal junction characteristics. The latter cells are relatively unstable and exhibit much higher ideality factors and reverse saturation current densities. The temperature dependence of the reverse saturation current indicates totally different charge transfer mechanisms in the two cases.

Li, X.; Wanlass, M.W.; Gessert, T.A.; Emery, K.A.; Coutts, T.J.

1989-05-01

223

Protein, free amino acid, phenloic, ß-carotene, and lycopene content, and antioxidative and cancer cell inhibitory effects of 12 greenhouse-grown commercial cherry tomato varieties  

Technology Transfer Automated Retrieval System (TEKTRAN)

The content of water, free amino acids, amino acid metabolites, crude protein, the carotene pigments ß-carotene and lycopene, and 9 characterized and 2 incompletely characterized individual phenolic (flavonoid) compounds of 12 greenhouse-grown cherry tomato varieties of various colors (green, yellow...

224

Isolation and identification of a novel chlorophenol from a cell suspension culture of Helichrysum aureonitens.  

PubMed

A novel chlorophenol, 4-chloro-2-(hepta-1,3,5-triyn-1-yl)-phenol (1), was isolated as the major phenolic compound from the cells of Helichrysum aureonitens suspension cultures. Compound 1 has been proposed to be an intermediate in the acetylene biosynthetic pathway of other acetylenic compounds in Helichrysum spp. The ethanol extract of cell suspension cultures and compound 1 were evaluated for their cytotoxicity against monkey kidney Vero (Vero cells) and human prostate epithelial carcinoma (DU145) cell lines, also, the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) against Mycobacterium tuberculosis H37Rv were determined as well. PMID:19881282

Ziaratnia, Seyed Mahdi; Ohyama, Kiyoshi; Hussein, Ahmed Abdel-Fattah; Muranaka, Toshiya; Lall, Namrita; Kunert, Karl Josef; Meyer, Jacobus Johannes Marion

2009-11-01

225

Bovine ephemeral fever virus in cell culture and mice  

Microsoft Academic Search

Summary Light, immunofluorescent and electron microscopic observations were carried out sequentially on mice and VERO cell cultures infected with bovine ephemeral fever (BEF) virus. In early harvests from cell culture, 185×73 nm cone-shaped particles with nearly parallel sides predominated; these particles had all other features typical of the Rhabdoviruses (surface projections, envelope, axial channel, precisely coiled helical nucleocapsid with 35

Frederick A. Murphy; William P. Taylor; Cedric A. Mims; Sylvia G. Whitfield

1972-01-01

226

Infection of tissue culture cells with bloodstream trypomastigotes of Trypanosoma cruzi.  

PubMed

Infection of tissue culture ("Vero" and bovine embryo skeletal muscle cells) with bloodstream from of T. cruzi depends on an adequate serum concentration and a suitable parasite population. The percentages of infections of "Vero" cells obtained with inocula presenting about 90% (Y strain) and 2% (CL strain) of slender trypomastigotes wree 11.8 +/- 4.9% and 0.1%, respectively, strongly indicating that the presence of slender forms was essential for cell infection to occur. Nevertheless, other biological characteristics seem to influence the infectivity of bloodstream stages, because evidence was provided that slender forms of the CL strain were less infective to "Vero" and muscle cells that slender forms of the Y strain. PMID:7012296

Bertelli, M S; Brener, Z

1980-12-01

227

Effect of black tea extract on herpes simplex virus-1 infection of cultured cells  

PubMed Central

Background The purpose of this investigation was to determine if black tea extract (BTE), consisting primarily of flavanol compounds called theaflavins, could inhibit herpes simplex virus type-1 (HSV-1) infection in cultured A549 (human epithelial) and Vero cells. Methods The effect of BTE both on A549 and Vero cultured cells and on HSV-1 was assessed by using phase contrast and fluorescent microscopy, and cell viability and proliferation assays. After establishing the maximum non-cytotoxic concentration of BTE, A549 and Vero cells and HSV-1 virions were treated with varying concentrations of BTE, respectively. A549 and Vero cells were infected with HSV-1 with green fluorescent protein (GFP) insert at the UL46 gene. The effect of infectivity was determined by viral DNA extraction followed by PCR, plaque assays, adsorption assays, and electrophoresis of PCR products. Results BTE was not cytotoxic to A549 and Vero cells, as confirmed by cell viability and proliferation assays, in which BTE treated groups paralleled the positive control group. For both cell lines, plaque assays and fluorescent microscopy indicated an inverse relationship between BTE concentration (from 0.14 ?M – 1.4 mM) and HSV-1 infectivity. Specifically, PCR and electrophoresis showed a reduction in the viral genome following treatment with BTE. In addition, there was a noticeable decrease in the amount of viral plaques for BTE treated samples in the adsorption assays. Conclusions BTE consisting primarily of theaflavins is not cytotoxic and can reduce or block the production of infectious HSV-1 virions in cultured A549 and Vero cells, thus inhibiting the infectivity of the virus by interfering in the attachment, penetration and viral DNA replication of HSV-1 particles. These findings indicate that BTE enriched with theaflavins has the potential to be developed as a safe, therapeutic antiviral agent to prevent the spread of HSV-1. PMID:23777309

2013-01-01

228

Induction of Caspase-Dependent Apoptosis in Cultured Cells by the Avian Coronavirus Infectious Bronchitis Virus  

Microsoft Academic Search

Avian coronavirus infectious bronchitis virus (IBV) is the causative agent of chicken infectious bronchitis, an acute, highly contagious viral respiratory disease. Replication of IBV in Vero cells causes extensive cytopathic effects (CPE), leading to destruction of the entire monolayer and the death of infected cells. In this study, we investigated the cell death processes during acute IBV infection and the

C. Liu; H. Y. Xu; D. X. Liu

2001-01-01

229

Impact of growth temperature and substrate orientation on dilute-nitride-antimonide materials grown by MOVPE for multi-junction solar cell application  

NASA Astrophysics Data System (ADS)

Nitrogen incorporation in bulk films of GaAsN, InGaAsN, and GaAsSbN films grown by metalorganic vapor phase epitaxy (MOVPE) on (100) and (311)B GaAs substrates was investigated. These films, nominally lattice-matched to a GaAs substrate, were deposited at relatively higher growth temperature (600 °C) than typically used for MOVPE-grown dilute-nitride materials (~500-530 °C), in order to reduce the background carbon impurity concentration. Even at these higher growth temperatures, sufficient N incorporation is achieved for targeting Eg~1 eV InGaAsN and GaAsN with low background carrier concentration (1-2×1017 cm-3). The presence of Sb is found to significantly inhibit N incorporation, making it challenging to achieve films of GaAsSbN grown at 600 °C with a sufficient N concentration to achieve a 1 eV band gap energy. For GaAsN and InGaAsN on (311)B GaAs substrates, increased N incorporation with lower background carbon concentration is observed, relative to films on (100) GaAs. By contrast, GaAsSbN on (311)B GaAs substrate exhibit lower-N incorporation relative to films on (100) GaAs, presumably due to surface site competition between Sb and N. The background hole carrier concentrations of thermally annealed InGaAsN and GaAsSbN on (311)B are about a factor of two lower than those on (100) GaAs substrate.

Kim, T. W.; Kuech, T. F.; Mawst, L. J.

2014-11-01

230

Bi2S3microspheres grown on graphene sheets as low-cost counter-electrode materials for dye-sensitized solar cells  

NASA Astrophysics Data System (ADS)

In this work, we synthesized 3D Bi2S3 microspheres comprised of nanorods grown along the (211) facet on graphene sheets by a solvothermal route, and investigated its catalytic activities through I-V curves and conversion efficiency tests as the CE in DSSCs. Although the (211) facet has a large band gap for a Bi2S3 semiconductor, owing to the introduction of graphene into the system, its short-circuit current density, open-circuit voltage, fill factor, and efficiency were Jsc = 12.2 mA cm-2, Voc = 0.75 V, FF = 0.60, and ? = 5.5%, respectively. By integrating it with graphene sheets, our material achieved the conversion efficiency of 5.5%, which is almost triple the best conversion efficiency value of the DSSCs with (211)-faceted 3D Bi2S3 without graphene (1.9%) reported in the latest literature. Since this conversion-efficient 3D material grown on the graphene sheets significantly improves its catalytic properties, it paves the way for designing and applying low-cost Pt-free CE materials in DSSC from inorganic nanostructures.In this work, we synthesized 3D Bi2S3 microspheres comprised of nanorods grown along the (211) facet on graphene sheets by a solvothermal route, and investigated its catalytic activities through I-V curves and conversion efficiency tests as the CE in DSSCs. Although the (211) facet has a large band gap for a Bi2S3 semiconductor, owing to the introduction of graphene into the system, its short-circuit current density, open-circuit voltage, fill factor, and efficiency were Jsc = 12.2 mA cm-2, Voc = 0.75 V, FF = 0.60, and ? = 5.5%, respectively. By integrating it with graphene sheets, our material achieved the conversion efficiency of 5.5%, which is almost triple the best conversion efficiency value of the DSSCs with (211)-faceted 3D Bi2S3 without graphene (1.9%) reported in the latest literature. Since this conversion-efficient 3D material grown on the graphene sheets significantly improves its catalytic properties, it paves the way for designing and applying low-cost Pt-free CE materials in DSSC from inorganic nanostructures. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr06093d

Li, Guang; Chen, Xiaoshuang; Gao, Guandao

2014-02-01

231

Variation in distribution of the three flavivirus-specified glycoproteins detected by immunofluorescence in infected Vero cells  

Microsoft Academic Search

Summary Indirect immunofluorescence with rabbit antisera was used to probe the intracellular locations of the antigens of envelope, prM (precursor to structural protein M) and the nonstructural glycoproteins NS 1 (formerly described as NV 3 or SCF) specified by the flaviviruses dengue-2 and Kunjin. Perinuclear staining in various types of foci was prominent for all antigens, and the distribution was

E. G. Westaway; M. R. Goodman

1987-01-01

232

A polysaccharide fraction from medicinal herb Prunella vulgaris downregulates the expression of herpes simplex virus antigen in Vero cells  

Microsoft Academic Search

Herpes simplex viruses (HSV) are pathogenic. With the emergence of drug-resistant strains of HSV, new antiviral agents, especially those with different modes of action, are urgently needed. Prunella vulgaris L. (Labiatae), a perennial plant commonly found in China and Europe, has long been used as a folk medicine to cure ailments. In this study, a polysaccharide fraction was prepared from

Lawrence Chi-Ming Chiu; Wen Zhu; Vincent Eng-Choon Ooi

2004-01-01

233

Studies on the Production of Digitalis Cardenolides by Plant Tissue Culture: II. EFFECT OF LIGHT AND PLANT GROWTH SUBSTANCES ON DIGITOXIN FORMATION BY UNDIFFERENTIATED CELLS AND SHOOT-FORMING CULTURES OF DIGITALIS PURPUREA L. GROWN IN LIQUID MEDIA.  

PubMed

Undifferentiated, highly chlorophyllous cell cultures; undifferentiated white cell cultures; green, shoot-forming cultures; and white, shoot-forming cultures of Digitalis purpurea L. were established and subcultured every 3 weeks in liquid media in the light or in the dark. The digitoxin content, the chlorophyll content, and the ribulose bisphosphate carboxylase activity of these cultures were assayed. The light-grown, green, shoot-forming cultures accumulated considerable amounts of digitoxin (about 20 to 40 micrograms per gram dry weight), and the white, shoot-forming cultures without chloroplasts accumulated about one-third that amount of digitoxin. The chlorophyll content and the ribulose bisphosphate carboxylase activity of the undifferentiated green cells were about the same as they were in the green, shoot-forming cultures, but the digitoxin content of the former was extremely low (about 0.05 to 0.2 microgram per gram dry weight), which is about the same as that in undifferentiated white cells without chloroplasts. Thus, it was concluded that the chloroplasts are not essential for the synthesis of digitoxin in Digitalis cells. The optimum concentrations of the tested compounds for accumulation of digitoxin were: benzyladenine, 0.01 to 1 milligram per liter; indoleacetic acid, 0.1 to 1 milligram per liter; alpha-naphthaleneacetic acid; 0.1 milligram per liter; and 2,4-dichlorophenoxyacetic acid, 0.01 milligram per liter. PMID:16662267

Hagimori, M; Matsumoto, T; Obi, Y

1982-03-01

234

Protein cell receptors mediate the saturable interaction of African swine fever virus attachment protein p12 with the surface of permissive cells  

Microsoft Academic Search

Previous studies have demonstrated that the entry of African swine fever virus (ASFV) into Vero cells and swine macrophages is mediated by saturable binding sites located on the plasma membrane. The ASFV protein p12 has been implicated in virus attachment to the host cell, but the cellular component responsible for the interaction with the virus is largely unknown. We have

Inmaculada Galindo; Eladio Viñuela; Angel L Carrascosa

1997-01-01

235

Effects of electron and proton irradiations on n/p and p/n GaAs cells grown by MOCVD  

NASA Technical Reports Server (NTRS)

State-of-the-art n/p and p/n heteroface GaAs cells, processed by metal organic chemical vapor deposition, were irradiated by 1 MeV electrons and 37 MeV protons and their performance determined as a function of fluence. It was found that the p/n cells were more radiation resistant than the n/p cells. The increased loss in the n/p cells was attributed to increases in series resistance and losses in the p-region resulting from the irradiation. The greater loss in fill factor observed for the n/p cells introduces the possibility that the presently observed superiority of the p/n cells may not be an intrinsic property of this configuration in GaAs.

Weinberg, Irving; Swartz, Clifford K.; Hart, Russell E., Jr.

1987-01-01

236

Differential reactivities of the Arachis hypogaea (peanut) and Vicia villosa B4 lectins with human ovarian carcinoma cells, grown either in vitro or in vivo xenograft model  

Microsoft Academic Search

PNA and VVA B4 recognize the tumor-associated T antigen and its immediate precursor Tn, respectively. We found that both lectins are highly reactive in vitro, with human ovarian carcinoma cell lines, but only VVA B4 bound significantly to breast and oral cancer cells. This binding is inhibited by specific monosaccharides. The lectin binding receptors were purified, revealing a glycoprotein of

Dody Avichezer; Ruth Arnon

1996-01-01

237

Proteolytic enzymes in embryonated chicken eggs sustain the replication of egg-grown low-pathogenicity avian influenza viruses in cells in the absence of exogenous proteases.  

PubMed

Low pathogenic influenza viruses grow readily in embryonated chicken eggs but require the addition of exogenous proteases to grow in MDCK cell culture. In this study, we found that the influenza viruses propagated previously in eggs, can grow for up to two passages in cell culture without the addition of exogenous proteolytic enzymes. These results indicate that the reason for virus propagation in cells during the first two passages may be due to proteases from egg allantoic fluid carried over from egg culture. The ability of influenza viruses to grow in cells in the absence of trypsin is currently considered as a hallmark of highly pathogenic influenza viruses. Our data indicate that differentiating between high and low pathogenicity using cell culture only is not appropriate and other indicators such as sequence analysis and in vitro pathogenicity index should be performed. PMID:24626064

Kandeil, Ahmed; Bagato, Ola; Zaraket, Hassan; Debeauchamp, Jennifer; Krauss, Scott; El-Shesheny, Rabeh; Webby, Richard J; Ali, Mohamed A; Kayali, Ghazi

2014-06-01

238

Interface Ferroelectric Transition near the Gap-Opening Temperature in a Single-Unit-Cell FeSe Film Grown on Nb-Doped SrTiO_{3} Substrate.  

PubMed

We report findings of strong anomalies in both mutual inductance and inelastic Raman spectroscopy measurements of single-unit-cell FeSe film grown on Nb-doped SrTiO_{3}, which occur near the temperature where the superconductinglike energy gap opens. Analysis suggests that the anomaly is associated with a broadened ferroelectric transition in a thin layer near the FeSe/SrTiO_{3} interface. The coincidence of the ferroelectric transition and gap-opening temperatures adds credence to the central role played by the film-substrate interaction on the strong Cooper pairing in this system. We discuss scenarios that could explain such a coincidence. PMID:25659015

Cui, Y-T; Moore, R G; Zhang, A-M; Tian, Y; Lee, J J; Schmitt, F T; Zhang, W-H; Li, W; Yi, M; Liu, Z-K; Hashimoto, M; Zhang, Y; Lu, D-H; Devereaux, T P; Wang, L-L; Ma, X-C; Zhang, Q-M; Xue, Q-K; Lee, D-H; Shen, Z-X

2015-01-23

239

A comparison of avian and mammalian cell cultures for the propagation of avian reovirus WVU 2937.  

PubMed

Two avian and seven mammalian cell lines were evaluated for their application in propagating avian reovirus WVU 2937. Cultures were compared for monolayer-formation time, support of viral replication, passages and postinfection time required for expression of cytopathic effect (CPE), type of CPE, and virus yield. CPE was observed on the first passage with infected egg yolk in primary chicken embryo kidney cells, primary through tertiary chicken embryo liver (CEL) cells, and African green monkey kidney (VERO) cells; on the third blind passage of infected supernatant in Georgia bovine kidney cells, Crandall feline kidney cells, and baby hamster cells; on the fifth blind passage in rabbit kidney cells; and on the tenth blind passage in porcine kidney cells. CPE was not observed after 10 viral passages in rabbit bone-marrow cells. Monolayer formation time and postinfection time for CPE expression occurred sooner, and virus yield was greater, with CEL and VERO cells than with other cell lines. PMID:6721794

Barta, V; Springer, W T; Millar, D L

1984-01-01

240

Comparative lipid composition of heterotrophically and autotrophically grown Sulfolobus acidocaldarius.  

PubMed Central

Complex lipids from the thermoacidophilic facultative autotroph Sulfolobus acidocaldarius, as well as a strictly autotrophic isolate, were compared between cells grown on yeast extract and elemental sulfur. Lipids from both organisms grown autotrophically were nearly identical. Each contained about 15% neutral lipids, 35% glycolipids, and 50% acidic lipids. Glycolipids and acidic lipids contained C40H82-76-derived glycerol ether residues. Major glycolipids included the glycerol ether analogues of glucosyl galactosyl diglyceride (5%) and glucosyl polyol diglyceride (75%). Acidic lipids were comprised mainly of the glycerol ether analogues of phosphatidyl inositol (7%), inositolphosphoryl glucosyl polyol diglyceride (72%), and a partially characterized sulfate- and phosphate-containing derivative of glucosyl polyol diglyceride (13%). The lipids from cells grown heterotrophically were similar to those from autotrophically grown cells, except that the partially characterized acidic lipid was absent. In addition, the two glycolipids as well as the respective inositolphosphoryl derivatives were each present in nearly equal proportions. Images PMID:863856

Langworthy, T A

1977-01-01

241

High Efficiency GaAs/Si Monolithic Three-Terminal Cascade Solar Cells Grown by Metal-Organic Chemical Vapor Deposition  

NASA Astrophysics Data System (ADS)

A high-efficiency GaAs/Si monolithic three-terminal cascade solar cell is proposed and fabricated by the metal-organic chemical vapor deposition (MOCVD) method and thermal diffusion method. The quantum efficiency in the long wavelength region was improved by using p-Si substrates with the resistivity of 10 ? ·cm as the Si bottom cells. Adopting a graded band-gap layer (GBL) of Al xGa1- xAs, the collection efficiency of the GaAs top cell was increased considerably. A total conversion efficiency of 19.1% was achieved at the AM0 condition for the GaAs/Si three-terminal cascade solar cell.

Yang, Mingju; Soga, Tetsuo; Egawa, Takashi; Jimbo, Takashi; Umeno, Masayoshi

1994-05-01

242

RICKETTSIAL PHOSPHOLIPASE A 2 AS A PATHOGENIC MECHANISM IN A MODEL OF CELL INJURY BY TYPHUS AND SPOTTED FEVER GROUP RICKETTSIAE  

Microsoft Academic Search

Phospholipase A2 activity by typhus group rickettsiae causes hemolysis in vitro. Rickettsial phospholi- pase A2 has been proposed to mediate entry into the host cell, escape from the phagosome, and cause injury to host cells by both typhus and spotted fever group rickettsiae. In a rickettsial contact-associated cytotoxicity model, the interaction of Rickettsia prowazekii or R. conorii with Vero cells

DAVID H. WALKER; HUI-MIN FENG; VSEVOLOD L. POPOV

2001-01-01

243

Virus-specific cell receptors are necessary, but not sufficient, to confer cell susceptibility to African swine fever virus  

Microsoft Academic Search

Summary.  ?The entry of African swine fever (ASF) virus into Vero cells and swine macrophages is mediated by saturable binding sites\\u000a located in the plasma membrane, which have been related, as in other virus-cell systems, to the sensitivity of the cell to\\u000a the virus. In order to define this correlation, we have analyzed up to 16 cell lines derived from different

A. L. Carrascosa; M. J. Bustos; I. Galindo; E. Viñuela

1999-01-01

244

Flexible solar cells with a Cu(In,Ga)Se2 absorber grown by using a Se thermal cracker on a polyimide substrate  

NASA Astrophysics Data System (ADS)

A polyimide substrate was used for the fabrication of flexible Cu(In,Ga)Se2 (CIGS) thin-film solar cells. To deposit a stable Mo layer on a flexible substrate, we measured the residual stress in the polyimide film after the deposition of a Mo layer by varying the process pressure. A CIGS absorber was deposited on a Mo layer at a growth temperature below 500° by using a Se thermal cracker and various cracking zone temperatures ( T C ) to improve the reactivity of Se due to the low process temperature. To investigate the effect of Na on the efficiency of a flexible CIGS solar cell, we deposited a Mo:Na layer as a source of Na between the Mo layer and the polyimide substrate. In case of the flexible CIGS solar cell fabricated under the condition of a T C of 800° with a Mo:Na layer, the highest cell efficiency was achieved at 10.76% without an anti-reflection coating, which is significantly increased by 4% compared to the efficiency of a solar cell without the Mo:Na layer.

Park, Soo-Jeong; Chung, Yong-Duck; Lee, Woo-Jung; Cho, Dae-Hyung; Wi, Jae-Hyung; Han, Won-Seok; Cho, Yousuk; Yoon, Jong-man

2015-01-01

245

Protein content and enzyme activities in methanol- and acetate-grown Methanosarcina thermophila  

SciTech Connect

The cell extract protein content of acetate-and methanol-grown Methanosarcina thermophila TM-1 was examined by two-dimensional polyacrylamide gel electrophoresis. More than 100 mutually exclusive spots were present in acetate- and methanol-grown cells. Spots corresponding to acetate kinase, phosphotransacetylase, and the five subunits of the carbon monoxide dehydrogenase complex were identified in acetate-grown cells. Activities for formylmethanofuran dehydrogenase, formylmethanofurn:tetrahydromethanopterin formyl-transferase, 5,10-methenyltetrahydromethanopterin cyclohydrolase, methylene tetrahydromethanopterin:co-enzyme F{sub 420} oxidoreductase, formate dehydrogenase, and carbonic anhydrase were examined in acetate- and methanol-grown Methanosarcina thermophila. Levels of formyltransferase in either acetate- or methanol-grown Methanosarcina thermophila were approximately half the levels detected in H{sub 2}-CO{sub 2}-grown Methanobacterium thermoautotrophicum. All other enzyme activities were significantly lower in acetate- and methanol-grown Methanosarcina thermophila.

Jablonski, P.E.; Cabell, M.C.; Ferry, J.G. (Virginia Polytechnic Institute and State Univ., Blacksburg (USA)); DiMarco, A.A.; Bobik, T.A. (Univ. of Illinois Urbana-Champaign (USA))

1990-03-01

246

Prostate tumor grown in NASA Bioreactor  

NASA Technical Reports Server (NTRS)

This prostate cancer construct was grown during NASA-sponsored bioreactor studies on Earth. Cells are attached to a biodegradable plastic lattice that gives them a head start in growth. Prostate tumor cells are to be grown in a NASA-sponsored Bioreactor experiment aboard the STS-107 Research-1 mission in 2002. Dr. Leland Chung of the University of Virginia is the principal investigator. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Credit: NASA and the University of Virginia.

2001-01-01

247

Enzyme-linked immunosorbent assay for detection of immunoglobulin G antibodies to Escherichia coli Vero cytotoxin 1.  

PubMed Central

The frequency of Vero cytotoxin 1 (VT1)-neutralizing antibody (NAb) in serum specimens from 790 age-stratified (0 to 70 years) control individuals from Toronto was 61 of 790 (7.7%), with a peak of 19% in the 20- to 30-year-old age group and a second peak of 16.7% in the 60- to 70-year-old age group. A total of 568 serum specimens, including 538 from the 790 Toronto control subjects, 21 from patients from three outbreaks of VT-producing Escherichia coli (VTEC) infection, and 9 known VT1-NAb-positive serum specimens from patients with hemolytic-uremic syndrome (HUS), were then tested for the presence of anti-VT1 immunoglobulin G (IgG) by an enzyme-linked immunosorbent assay (ELISA). The mean ELISA values of 522 VT1-NAb-negative serum specimens and 46 VT1-NAb-positive serum specimens were 0.09 +/- 0.06 (range, 0 to 0.56) and 0.78 +/- 0.66 (range, 0.16 to 2.91), respectively (P < 0.001; Student's t test). With a breakpoint of 0.21 (mean ELISA value of the VT1-NAb-negative sera + 2 standard deviations), the sensitivity, specificity, positive predictive value, and negative predictive value of the VT1 IgG ELISA compared with those of the VT1-NAb assay were, respectively, 95.7, 98.7, 86.3, and 99.6%. There were nine discrepant serum specimens, of which seven were anti-VT1 IgG positive and VT1-NAb negative and two were anti-VT1 IgG negative and VT1-NAb positive. The ELISA was also used for testing 238 control serum specimens from The Netherlands, Japan, and India and acute- and convalescent-phase serum specimens from 42 Toronto patients with HUS. The frequencies of anti-VT1 IgG (with VT1-NAb frequencies in parantheses) in control sera from the Netherlands, Japan, and India were 6% (3%), 1.1% (0%), and 12% (10%), respectively, with no age clustering. The frequencies of anti-VT1 IgG seropositivity in HUS patients were 5 of 14 (35.7%) in patients with unknown toxin exposure, 2 of 22 (9.1%) in individuals with known exposure to VT1 plus VT2 or VT1 alone, and 0 of 6 (0%) in patients exposed to only VT2. Development of serum anti-VT1 IgG response appears to be the exception rather than the rule in sporadic HUS patients infected with VTEC expressing VT1. However, in two family outbreaks associated with VTEC strains expressing VT1 alone and VT1 plus VT2, respectively, the presence of anti-VT1 IgG in virtually all exposed individuals who remained symptom free suggests that the presence of antibody was associated with protection. PMID:8077389

Karmali, M A; Petric, M; Winkler, M; Bielaszewska, M; Brunton, J; van de Kar, N; Morooka, T; Nair, G B; Richardson, S E; Arbus, G S

1994-01-01

248

1 Rectangular Bunched Rutile TiO2 Nanorod Arrays Grown on Carbon 2 Fiber for Dye-Sensitized Solar Cells  

E-print Network

of Chemistry and Chemical Engineering, Xiamen University, 7 Xiamen 361005, China 8 *S Supporting Information 9 ABSTRACT: Because of their special application in photo- 10 voltaics, the growth of one-dimensional single rod is etched into a number of small nanowires. Tube-shaped 17 dye-sensitized solar cells

Wang, Zhong L.

249

Infrared Microscopy for the Study of Biological Cell Monolayers. I. Spectral Effects of Acetone and Formalin Fixation  

E-print Network

Infrared Microscopy for the Study of Biological Cell Monolayers. I. Spectral Effects of Acetone Monolayers. I. Spectral Effects of Acetone and Formalin Fixation Correspondence to: Gary Hastings; e infrared spectra for unfixed and acetone- or formalin-fixed Vero cell monolayers. Formalin-fixed monolayers

Hastings, Gary

250

Quantification of confocal images of biofilms grown on irregular surfaces.  

PubMed

Bacterial biofilms grow on many types of surfaces, including flat surfaces such as glass and metal and irregular surfaces such as rocks, biological tissues and polymers. While laser scanning confocal microscopy can provide high-resolution images of biofilms grown on any surface, quantification of biofilm-associated bacteria is currently limited to bacteria grown on flat surfaces. This can limit researchers studying irregular surfaces to qualitative analysis or quantification of only the total bacteria in an image. In this work, we introduce a new algorithm called modified connected volume filtration (MCVF) to quantify bacteria grown on top of an irregular surface that is fluorescently labeled or reflective. Using the MCVF algorithm, two new quantification parameters are introduced. The modified substratum coverage parameter enables quantification of the connected-biofilm bacteria on top of the surface and on the imaging substratum. The utility of MCVF and the modified substratum coverage parameter were shown with Pseudomonas aeruginosa and Staphylococcus aureus biofilms grown on human airway epithelial cells. A second parameter, the percent association, provides quantified data on the colocalization of the bacteria with a labeled component, including bacteria within a labeled tissue. The utility of quantifying the bacteria associated with the cell cytoplasm was demonstrated with Neisseria gonorrhoeae biofilms grown on cervical epithelial cells. This algorithm provides more flexibility and quantitative ability to researchers studying biofilms grown on a variety of irregular substrata. PMID:24632515

Sommerfeld Ross, Stacy; Tu, Mai Han; Falsetta, Megan L; Ketterer, Margaret R; Kiedrowski, Megan R; Horswill, Alexander R; Apicella, Michael A; Reinhardt, Joseph M; Fiegel, Jennifer

2014-05-01

251

In vitro cytotoxic activity of seed oil of fenugreek against various cancer cell lines.  

PubMed

In the present study, investigations were carried out to screen the anticancer activities of fenugreek seed oil against cancer cell lines (HEp-2, MCF-7, WISH cells), and a normal cell line (Vero cells). Cytotoxicity was assessed with MTT and NRU assays, and cellular morphological alterations were studied using phase contrast light microscopy. All cells were exposed toi 10-1000 ?g/ml of fenugreek seed oil for 24 h. The results show that fenugreek seed oil significantly reduced the cell viability, and altered the cellular morphology in a dose dependent manner. Among the cell lines, HEp-2 cells showed the highest decrease in cell viability, followed by MCF-7, WISH, and Vero cells by MTT and NRU assays. Cell viability at 1000 ?g/ml was recorded as 55% in HEp-2 cells, 67% in MCF-7 cells, 75% in WISH cells, and 86% in Vero cells. The present study provides preliminary screening data for fenugreek seed oil pointing to potent cytotoxicity against cancer cells. PMID:23679282

Al-Oqail, Mai Mohammad; Farshori, Nida Nayyar; Al-Sheddi, Ebtesam Saad; Musarrat, Javed; Al-Khedhairy, Abdulaziz Ali; Siddiqui, Maqsood Ahmed

2013-01-01

252

Detection of the quantity of kinesin and microgravity-sensitive kinesin genes in rat bone marrow stromal cells grown in a simulated microgravity environment  

NASA Astrophysics Data System (ADS)

Kinesin and kinesin-like proteins (KLPs) constitute a superfamily of microtubule motor proteins found in all eukaryotic organisms. Members of the kinesin superfamily are known to play important roles in many fundamental cellular and developmental processes. To date, few published studies have reported on the effects of microgravity on kinesin expression. In this paper, we describe the expression pattern and microgravity-sensitive genes of kinesin in rat bone marrow stromal cells cultured in a ground-based rotating bioreactor. The quantity of kinesin under the clinorotation condition was examined by immunoblot analysis with anti-kinesin. Furthermore, the distribution of kinesin at various times during clinorotation was determined by dual immunostaining, using anti-kinesin monoclonal antibody or anti-?-tubulin monoclonal antibody. In terms of kinesin quantity, we found that the ratios of the amounts of clinorotated/stationary KLPs decreased from clinorotation day 5 to day 10, although it increased on days 2 and 3. Immunofluorescence analysis revealed that kinesin in the nucleus was the first to be affected by simulated microgravity, following the kinesin at the periphery that was affected at various times during clinorotation. Real-time RT-PCR analysis of kinesin mRNA expression was performed and led to the identification of 3 microgravity-sensitive kinesin genes: KIF9, KIFC1, and KIF21A. Our results suggest that kinesin has a distinct expression pattern, and the identification of microgravity-sensitive kinesin genes offers insight into fundamental cell biology.

Ni, Chengzhi; Wang, Chunyan; Li, Yuan; Li, Yinghui; Dai, Zhongquan; Zhao, Dongming; Sun, Hongyi; Wu, Bin

2011-06-01

253

Reconstitution of iron oxidase from sulfur-grown Acidithiobacillus ferrooxidans.  

PubMed

The iron oxidation system from sulfur-grown Acidithiobacillus ferrooxidans ATCC 23270 cells was reconstituted in vitro. Purified rusticyanin, cytochrome c, and aa(3)-type cytochrome oxidase were essential for reconstitution. The iron-oxidizing activity of the reconstituted system was 3.3-fold higher than that of the cell extract from which these components were purified. PMID:18791023

Taha, Taher M; Kanao, Tadayoshi; Takeuchi, Fumiaki; Sugio, Tsuyoshi

2008-11-01

254

Migration of Mitochondria to Viral Assembly Sites in African Swine Fever Virus-Infected Cells  

Microsoft Academic Search

An examination by electron microscopy of the viral assembly sites in Vero cells infected with African swine fever virus showed the presence of large clusters of mitochondria located in their proximity. These clusters surround viral factories that contain assembling particles but not factories where only precursor membranes are seen. Immunofluorescence microscopy revealed that these accumulations of mitochondria are originated by

GEMA ROJO; MARGARITA CHAMORRO; MARIA L. SALAS; ELADIO VINUELA; Severo Ochoa; Consejo Superior de Investigaciones

1998-01-01

255

Caveolin-1 is incorporated into mature respiratory syncytial virus particles during virus assembly on the surface of virus-infected cells  

Microsoft Academic Search

We have employed immunofluorescence microscopy and transmission electron microscopy to examine the assembly and maturation of respiratory syncytial virus (RSV) in the Vero cell line C1008. RSV matures at the apical cell surface in a filamentous form that extends from the plasma membrane. We observed that inclusion bodies containing viral ribonucleoprotein (RNP) cores predominantly appeared immediately below the plasma membrane,

Gaie Brown; James Aitken; Richard J. Sugrue

256

Poly(N-vinylpyrrolidone)-Decorated Reduced Graphene Oxide with ZnO Grown In Situ as a Cathode Buffer Layer for Polymer Solar Cells.  

PubMed

A ZnO@reduced graphene oxide-poly(N-vinylpyrrolidone) (ZnO@RGO-PVP) nanocomposite, prepared by in situ growth of ZnO nanoparticles on PVP-decorated RGO (RGO-PVP) was developed as a cathode buffer layer for improving the performance of polymer solar cells (PSCs). PVP not only favors homogeneous distribution of the RGO through the strong ?-? interactions between graphene and PVP molecules, but also acts as a stabilizer and bridge to control the in situ growth of sol-gel-derived ZnO nanoparticles on the surface of the graphene. At the same time, RGO provides a conductive connection for independent dispersion of ZnO nanoparticles to form uniform nanoclusters with fewer domain boundaries and surface traps. Moreover, the LUMO level of ZnO is effectively improved by modification with RGO-PVP. Compared to bare ZnO, a ZnO@RGO-PVP cathode buffer layer substantially reduces the recombination of carriers, increases the electrical conductivity, and enhances electron extraction. Consequently, the power conversion efficiency of an inverted device based on thieno[3,4-b]thiophene/benzodithiophene (PTB7):[6,6]-phenyl C71 -butyric acid methyl ester (PC71 BM) with ZnO@RGO-PVP as cathode buffer layer was greatly improved to 7.5?% with improved long-term stability. The results reveal that ZnO@RGO-PVP is universally applicable as a cathode buffer layer for improving the performance of PSCs. PMID:25345881

Hu, Ting; Chen, Lie; Yuan, Kai; Chen, Yiwang

2014-12-15

257

Nucleolus in clinostat-grown plants  

SciTech Connect

The clinostat is an apparatus that is used to mimic zero gravity in studies of plant growth in the absence of gravitropic response. Clinostat-grown tissue cultures of carrot exhibit significant increases both in the number of nuclei containing more than one nucleolus and in nucleolar volume. Oat seedlings germinated and grown on clinostats exhibit a decreased rate of shoot elongation, increased tissue sensitivity to applied auxin, and an increased response to gravitropic stimulation. Clinostat treatment clearly affects plant metabolism. The nucleolus is the region in the nucleus where ribosome synthesis and assembly take place. The 18S, 5.8S, and 25S ribosomal genes, in tandem units, are located in the nucleolus. Ribosomes orchestrate the production of all proteins that are necessary for the maintenance of cell growth, development, and survival. A full study of the effects of nullification of gravitropism, by clinostat rotation, on nucleolar development in barley has been initiated. The authors study developmental changes of nucleolar number and diameter in clinostat-grown root tissues. Preliminary results show that barley roots exhibit changes in nucleolar number and diameter. Growth rates of barley root and shoot also appear to be reduced, in measurements of both length and weight.

Shen-Miller, J.; Dannenhoffer, J. (Univ. of California, Los Angeles (United States)); Hinchman, R. (Argonne National Lab., IL (United States))

1991-05-01

258

Characterization of Junin arenavirus cell entry  

Microsoft Academic Search

Junin virus (JUNV) entry is conducted by receptor-mediated endocytosis. To explore the cellular entry mechanism of JUNV, inhibitory effects of drugs affecting the main endocytic pathways on JUNV entry into Vero cells were analysed. Compounds that impair clathrin-mediated endocytosis were shown to reduce virus internalization without affecting virion binding. In contrast, drugs that alter lipid-raft microdomains, impairing caveola-mediated endocytosis, were

M. Guadalupe Martinez; Sandra M. Cordo; Nelida A. Candurra

2007-01-01

259

Evidence that an internal carbonic anhydrase is present in 5% CO/sub 2/-grown and air-grown Chlamydomonas. [Chlamydomonas reinhardtii  

SciTech Connect

Inorganic carbon (C/sub i/) uptake was measured in wild-type cells of Chlamydomonas reinhardtii, and in cia-3, a mutant strain of C. reinhardtii that cannot grow with air levels of CO/sub 2/. Both air-grown cells, that have a CO/sub 2/ concentrating system, and 5% CO/sub 2/-grown cells that do not have this system, were used. When the external pH was 5.1 or 7.3, air-grown, wild-type cells accumulated inorganic carbon (C/sub i/) and this accumulation was enhanced when the permeant carbonic anhydrase inhibitor, ethoxyzolamide, was added. When the external pH was 5.1, 5% CO/sub 2/-grown cells also accumulated some C/sub i/, although not as much as air-grown cells and this accumulation was stimulated by the addition of ethoxyzolamide. At the same time, ethoxyzolamide inhibited CO/sub 2/ fixation by high CO/sub 2/-grown, wild-type cells at both pH 5.1 and 7.3. These observations imply that 5% CO/sub 2/-grown, wild-type cells, have a physiologically important internal carbonic anhydrase, although the major carbonic anhydrase located in the periplasmic space is only present in air-grown cells. Inorganic carbon uptake by cia-3 cells supported this conclusion. This mutant strain, which is thought to lack an internal carbonic anhydrase, was unaffected by ethoxyzolamide at pH 5.1. Other physiological characteristics of cia-3 resemble those of wild-type cells that have been treated with ethoxyzolamide. It is concluded that an internal carbonic anhydrase is under different regulatory control than the periplasmic carbonic anhydrase.

Moroney, J.V.; Togasaki, R.K.; Husic, H.D.; Tolbert, N.E.

1987-07-01

260

Vesicular Stomatitis Virus Maturation Sites in Six Different Host Cells  

Microsoft Academic Search

SUMMARY Six different cell types, L, Vero, HeLa, BHKzI, PK(H13) and CF, were infected with vesicular stomatitis virus. A minimum of IOO individual virus-containing cells of each type was scored for the sites of viral maturation as observed by electron microscopy of thin sections. The principal site of viral maturation was the intra- cytoplasmic vacuolar membranes for PK(H13) and the

Y. C. Zee; A. J. Hackett; L. Talens

1970-01-01

261

Use of SLAM and PVRL4 and Identification of Pro-HB-EGF as Cell Entry Receptors for Wild Type Phocine Distemper Virus  

PubMed Central

Signalling lymphocyte activation molecule (SLAM) has been identified as an immune cell receptor for the morbilliviruses, measles (MV), canine distemper (CDV), rinderpest and peste des petits ruminants (PPRV) viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4), also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV) remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt) MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG) and the tetraspan proteins, integrin ? and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF),for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO) cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin ? antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation. PMID:25171206

Reaney, Katherine; Tangy, Frederic; Cosby, Sara Louise

2014-01-01

262

Extremely low-frequency electromagnetic fields cause DNA strand breaks in normal cells  

PubMed Central

Background Extremely low frequency electromagnetic fields aren’t considered as a real carcinogenic agent despite the fact that some studies have showed impairment of the DNA integrity in different cells lines. The aim of this study was evaluation of the late effects of a 100 Hz and 5.6 mT electromagnetic field, applied continuously or discontinuously, on the DNA integrity of Vero cells assessed by alkaline Comet assay and by cell cycle analysis. Normal Vero cells were exposed to extremely low frequency electromagnetic fields (100 Hz, 5.6 mT) for 45 minutes. The Comet assay and cell cycle analysis were performed 48 hours after the treatment. Results Exposed samples presented an increase of the number of cells with high damaged DNA as compared with non-exposed cells. Quantitative evaluation of the comet assay showed a significantly (<0.001) increase of the tail lengths, of the quantity of DNA in tail and of Olive tail moments, respectively. Cell cycle analysis showed an increase of the frequency of the cells in S phase, proving the occurrence of single strand breaks. The most probable mechanism of induction of the registered effects is the production of different types of reactive oxygen species. Conclusions The analysis of the registered comet indices and of cell cycle showed that extremely low frequency electromagnetic field of 100 Hz and 5.6 mT had a genotoxic impact on Vero cells. PMID:24401758

2014-01-01

263

Protein Crystals Grown in Space  

NASA Technical Reports Server (NTRS)

A collage of protein and virus crystals, many of which were grown on the U.S. Space Shuttle or Russian Space Station, Mir. The crystals include the proteins canavalin; mouse monoclonal antibody; a sweet protein, thaumatin; and a fungal protease. Viruses are represented here by crystals of turnip yellow mosaic virus and satellite tobacco mosaic virus. The crystals are photographed under polarized light (thus causing the colors) and range in size from a few hundred microns in edge length up to more than a millimeter. All the crystals are grown from aqueous solutions and are useful for X-ray diffraction analysis. Credit: Dr. Alex McPherson, University of California, Irvine.

2000-01-01

264

Bioengineered Dental Tissues Grown in the Rat Jaw  

Microsoft Academic Search

Our long-term objective is to develop methods to form, in the jaw, bioengineered replacement teeth that exhibit physical properties and functions similar to those of natural teeth. Our results show that cultured rat tooth bud cells, seeded onto biodegradable scaffolds, implanted into the jaws of adult rat hosts and grown for 12 weeks, formed small, organized, bioengineered tooth crowns, containing

S. E. Duailibi; M. T. Duailibi; W. Zhang; R. Asrican; J. P. Vacanti; P. C. Yelick

2008-01-01

265

Tissue grown in space in NASA Bioreactor  

NASA Technical Reports Server (NTRS)

For 5 days on the STS-70 mission, a bioreactor cultivated human colon cancer cells, such as the culture section shown here, which grew to 30 times the volume of control specimens grown on Earth. This significant result was reproduced on STS-85 which grew mature structures that more closely match what are found in tumors in humans. The two white circles within the tumor are part of a plastic lattice that helped the cells associate. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators.

1998-01-01

266

Tissue grown in space in NASA Bioreactor  

NASA Technical Reports Server (NTRS)

Dr. Lisa E. Freed of the Massachusetts Institute of Technology and her colleagues have reported that initially disc-like specimens tend to become spherical in space, demonstrating that tissues can grow and differentiate into distinct structures in microgravity. The Mir Increment 3 (Sept. 16, 1996 - Jan. 22, 1997) samples were smaller, more spherical, and mechanically weaker than Earth-grown control samples. These results demonstrate the feasibility of microgravity tissue engineering and may have implications for long human space voyages and for treating musculoskeletal disorders on earth. Final samples from Mir and Earth appeared histologically cartilaginous throughout their entire cross sections (5-8 mm thick), with the exception of fibrous outer capsules. Constructs grown on Earth (A) appeared to have a more organized extracellular matrix with more uniform collagen orientation as compared with constructs grown on Mir (B), but the average collagen fiber diameter was similar in the two groups (22 +- 2 nm) and comparable to that previously reported for developing articular cartilage. Randomly oriented collagen in Mir samples would be consistent with previous reports that microgravity disrupts fibrillogenesis. These are transmission electron micrographs of constructs from Mir (A) and Earth (B) groups at magnifications of x3,500 and x120,000 (Inset). The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Credit: Proceedings of the National Academy of Sciences.

2001-01-01

267

Tissue grown in space in NASA Bioreactor  

NASA Technical Reports Server (NTRS)

Dr. Lisa E. Freed of the Massachusetts Institute of Technology and her colleagues have reported that initially disc-like specimens of cartilage tend to become spherical in space, demonstrating that tissues can grow and differentiate into distinct structures in microgravity. The Mir Increment 3 (Sept. 16, 1996 - Jan. 22, 1997) samples were smaller, more spherical, and mechanically weaker than Earth-grown control samples. These results demonstrate the feasibility of microgravity tissue engineering and may have implications for long human space voyages and for treating musculoskeletal disorders on earth. Constructs grown on Mir (A) tended to become more spherical, whereas those grown on Earth (B) maintained their initial disc shape. These findings might be related to differences in cultivation conditions, i.e., videotapes showed that constructs floated freely in microgravity but settled and collided with the rotating vessel wall at 1g (Earth's gravity). In particular, on Mir the constructs were exposed to uniform shear and mass transfer at all surfaces such that the tissue grew equally in all directions, whereas on Earth the settling of discoid constructs tended to align their flat circular areas perpendicular to the direction of motion, increasing shear and mass transfer circumferentially such that the tissue grew preferentially in the radial direction. A and B are full cross sections of constructs from Mir and Earth groups shown at 10-power. C and D are representative areas at the construct surfaces enlarged to 200-power. They are stained red with safranin-O. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Photo credit: Proceedings of the National Academy of Sciences.

1998-01-01

268

Thermal Stability of Corrugated Epitaxial Graphene Grown on Re(0001)  

NASA Astrophysics Data System (ADS)

We report on a novel approach to determine the relationship between the corrugation and the thermal stability of epitaxial graphene grown on a strongly interacting substrate. According to our density functional theory calculations, the C single layer grown on Re(0001) is strongly corrugated, with a buckling of 1.6 Å, yielding a simulated C 1s core level spectrum which is in excellent agreement with the experimental one. We found that corrugation is closely knit with the thermal stability of the C network: C-C bond breaking is favored in the strongly buckled regions of the moiré cell, though it requires the presence of diffusing graphene layer vacancies.

Miniussi, E.; Pozzo, M.; Baraldi, A.; Vesselli, E.; Zhan, R. R.; Comelli, G.; Mente?, T. O.; Niño, M. A.; Locatelli, A.; Lizzit, S.; Alfè, D.

2011-05-01

269

Cytotoxic Cell Vacuolating Activity from Vibrio cholerae Hemolysin  

Microsoft Academic Search

A Vibrio cholerae cytotoxin, designated VcVac, was found to cause vacuolation in Vero cells. It was originally detected in the pathogenic O1 Amazonia variant of V. cholerae and later shown to be produced in environmental strains and some El Tor strains. Comparison of VcVac production in various strains suggested that hemolysin was responsible for the vacuolating phenotype. Genetic experiments established

ANA COELHO; JOAO R. C. ANDRADE; ANA CAROLINA P. VICENTE; VICTOR J. DIRITA

2000-01-01

270

Cytotoxic effects of mycotoxin combinations in mammalian kidney cells.  

PubMed

The cytotoxicity of three Fusarium mycotoxins (beauvericin, deoxynivalenol and T-2 toxin) has been investigated using the NR assay, after 24, 48 and 72h of incubation. The IC(50) values ranged from 6.77 to 11.08, 3.30 to 10.00 and 0.004 to 0.005 for beauvericin, deoxynivalenol and T-2 toxin, respectively. Once the potential interaction has been detected, a quantitative assessment is necessary to ensure and characterize these interactions, that is, each mycotoxin contributes to the toxic effect in accord with its own potency. Combination of mycotoxins was determined in Vero cells after 24, 48 and 72h of exposure. Isobolograms and median effect method of Chou and Talalay were used to assess the nature and quantitative aspects of interaction observed between studied mycotoxins. Median effect analysis was used to calculate the combination index (CI) with values >1 indicating synergism, 1 additive effect, and <1 antagonism. CI values of BEA+DON (1.22-2.74), BEA+T-2 toxin (1.43-5.89), DON+T-2 toxin (3.13-7.62) and BEA+DON+T-2 toxin (1.32-2.68) for 24, 48 and 72h produced antagonistic effects in Vero cells. The highest antagonistic effect in Vero cells was observed with binary DON and T-2 toxin mixture. PMID:21798303

Ruiz, María-José; Macáková, Petra; Juan-García, Ana; Font, Guillermina

2011-10-01

271

Increased ultraviolet radiation sensitivity of Escherichia coli grown at low temperature.  

PubMed

The repair of DNA damage caused by ultraviolet radiation (UVR) is well understood in both lower and higher organisms. Genetic studies carried out at optimum temperature for growth, 37 °C in Escherichia coli, have revealed the major pathways of DNA repair. We show that E. coli cells grown at 20 °C are more sensitive to UVR than cells grown at 37 °C. The analysis of knockout mutants demonstrates that cells impaired in recombinational DNA repair pathways show increased UV sensitivity at 20 °C. Cells with mutations in the nucleotide excision repair (NER) pathway genes are highly sensitive to UVR when grown at 37 °C and retain that sensitivity when grown at 20 °C, whereas wild-type cells are not sensitive when grown at 37 °C but become more sensitive to UVR when grown at low temperatures. Our results taken along with reports from the literature suggest that the UVR sensitivity of E. coli cells at low temperature could be due to impaired NER function. PMID:24802940

Mangoli, Suhas; Rath, Devashish; Goswami, Manish; Jawali, Narendra

2014-05-01

272

Enhanced capacity of DNA repair in human cytomegalovirus-infected cells  

SciTech Connect

Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

Nishiyama, Y.; Rapp, F.

1981-04-01

273

High-efficiency solar cells fabricated from direct-current magnetron sputtered n-indium tin oxide onto p-InP grown by atmospheric pressure metalorganic vapor phase epitaxy  

NASA Technical Reports Server (NTRS)

An attempt is made to improve device efficiencies by depositing indium tin oxide onto epitaxially grown p-InP on p(+)-InP substrates. This leads to a reduction in the device series resistance, high-quality reproducible surfaces, and an improvement in the transport properties of the base layer. Moreover, many of the facets associated with badly characterized bulk liquid encapsulated Czochralski substrates used in previous investigations are removed in this way.

Li, X.; Wanlass, M. W.; Gessert, T. A.; Emery, K. A.; Coutts, T. J.

1989-01-01

274

Bioengineered Dental Tissues Grown in the Rat Jaw  

PubMed Central

Our long-term objective is to develop methods to form, in the jaw, bioengineered replacement teeth that exhibit physical properties and functions similar to those of natural teeth. Our results show that cultured rat tooth bud cells, seeded onto biodegradable scaffolds, implanted into the jaws of adult rat hosts and grown for 12 weeks, formed small, organized, bioengineered tooth crowns, containing dentin, enamel, pulp, and periodontal ligament tissues, similar to identical cell-seeded scaffolds implanted and grown in the omentum. Radiographic, histological, and immunohistochemical analyses showed that bioengineered teeth consisted of organized dentin, enamel, and pulp tissues. This study advances practical applications for dental tissue engineering by demonstrating that bioengineered tooth tissues can be regenerated at the site of previously lost teeth, and supports the use of tissue engineering strategies in humans, to regenerate previously lost and/or missing teeth. The results presented in this report support the feasibility of bioengineered replacement tooth formation in the jaw. PMID:18650546

Duailibi, S.E.; Duailibi, M.T.; Zhang, W.; Asrican, R.; Vacanti, J.P.; Yelick, P.C.

2009-01-01

275

Pyrimidine metabolism of Bdellovibrio bacteriovorus grown intraperiplasmically and axenically.  

PubMed Central

Bdellovibrio bacteriovorus grown axenically or intraperiplasmically on Escherichia coli has pathways for the interconversion of pyrimidines and the synthesis of pyrimidine nucleoside 5'-triphosphates similar to those found in the enteric bacteria. Minimal differences in enzyme activities were observed for axenically and intraperiplasmically grown cells. As might be expected for an organism which takes up deoxyribonucleoside 5'-monophosphates per se, high levels of enzymes which catalyze the generation of deoxyribonucleoside triphosphates from monophosphates were found. In addition, all enzymes of the thymine salvage pathway, except for thymidine kinase, were directly demonstrated in wild-type strains. It was possible to demonstrate this activity only indirectly owing to an inhibitor in wild-type extracts. Investigations with inhibitors of pyrimidine interconversion reactions showed that essentially all B. bacteriovorus deoxyribonucleic acid not synthesized from units derived from E. coli deoxyribonucleic acid is made from components of the substrate organism's ribonucleic acid. Evidence for de novo pyrimidine synthesis from the amino acid level was not found for B. bacteriovorus grown on E. coli that had a high protein/deoxyribonucleic acid ratio or on normal E. coli. The potential for de novo pyrimidine synthesis by intraperiplasmically grown B. bacteriovorus, however, cannot be totally ruled out on the basis of these investigations. PMID:6260736

Rosson, R A; Rittenberg, S C

1981-01-01

276

Susceptibilities of 14 cell lines to bluetongue virus infection.  

PubMed Central

The effect of bluetongue virus (BTV) infection was investigated in 14 cell lines. The cell lines included the following vertebrate cells: baby hamster kidney, African green monkey kidney (Vero), rabbit kidney, bovine kidney, canine kidney, bovine turbinate, bovine endothelium (CPAE), bighorn sheep tongue, equine dermis, gekko lung, rainbow trout gonad, and mouse fibroblast (L929); they also included the following invertebrate lines: mosquito and biting midge. Comparisons between the cell lines were made on the basis of time to observed cytopathic effects, titer in 50% tissue culture infectious doses, and titer in plaque-forming units. The CPAE cell line produced the highest BTV 50% tissue culture infectious dose of all cell lines tested. The Vero and L929 cells gave the most discrete plaques in plaque assays. Of the 14 cell lines tested, the CPAE cells were the most susceptible to both cell culture-adapted and animal source BTV. Bovine endothelial cells demonstrate significant potential as a cell culture system for BTV investigations. PMID:2853175

Wechsler, S J; McHolland, L E

1988-01-01

277

ICP34.5-Dependent and –Independent Activities of Salubrinal in Herpes Simplex Virus-1 Infected Cells  

PubMed Central

The small molecule salubrinal has antiviral activity against herpes simplex virus-1 (HSV-1) and inhibits dephosphorylation of eIF2? mediated by the HSV-1 protein ICP34.5. We investigated whether salubrinal's activities in infected cells depend on ICP34.5. An ICP34.5 deletion mutant was as sensitive as wild type HSV-1 to salubrinal inhibition of plaque formation in Vero cells. However, salubrinal induced formation of syncytia in infected Vero cells, which was enhanced by ICP34.5 mutations. Expression of HSV-1 US11 with immediate early kinetics, which is known to suppress the effects of ICP34.5 mutations, resulted in slight resistance to salubrinal in murine embryonic fibroblasts, and substantial resistance in those cells when ICP34.5 was additionally mutated. ICP34.5 mutations, but not immediate early expression of US11, prevented salubrinal's ability to increase phosphorylation of eIF2? during HSV-1 infection of Vero cells. Taken together, our data indicate that salubrinal has both ICP34.5-dependent and - independent activities in HSV-1 infected cells. PMID:18684481

Bryant, Kevin F.; Macari, Elizabeth R.; Malik, Natasha; Boyce, Michael; Yuan, Junying; Coen, Donald M.

2008-01-01

278

Tissue grown in NASA Bioreactor  

NASA Technical Reports Server (NTRS)

Cells from kidneys lose some of their special features in conventional culture but form spheres replete with specialized cell microvilli (hair) and synthesize hormones that may be clinically useful. Ground-based research studies have demonstrated that both normal and neoplastic cells and tissues recreate many of the characteristics in the NASA bioreactor that they display in vivo. Proximal kidney tubule cells that normally have rich apically oriented microvilli with intercellular clefts in the kidney do not form any of these structures in conventional two-dimensional monolayer culture. However, when normal proximal renal tubule cells are cultured in three-dimensions in the bioreactor, both the microvilli and the intercellular clefts form. This is important because, when the morphology is recreated, the function is more likely also to be rejuvenated. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC).

1998-01-01

279

Characterization of Si(100) homoepitaxy grown in the STM at low temperatures  

SciTech Connect

We explore the growth of low-temperature bulk-like Si(100) homoepitaxy with regard to microscopic surface roughness and defects We characterize films grown at different temperatures up to 500K in-situ by means of an effusion cell added to our UHVSTM. The development of novel architectures for future generation computers calls for high-quality homoepitaxial (WOO) grown at low temperature. Even though Si(100) can be grown crystalline up to a limited thickness: the microstructure reveals significant small-scale surface roughness and defects specific to low-temperature growth. Both can he detrimental to fabrication and operation of small-scale electronic devices.

Grube, H. (Holger); Brown, G. W. (Geoffrey W.); Pomeroy, J. M. (Joshua M.); Hawley, M. E. (Marilyn E.)

2002-01-01

280

Coxsackievirus B3 entry into the host cell interferes with G-protein-mediated transmembrane signalling  

Microsoft Academic Search

In the present work we used various cell lines in order to study the possible effect of coxsackievirus B3 (CVB3) entry on the adenylyl cyclase transmembrane signalling system. A significant decrease (by about 10–20%) was found in forskolin-augmented as well as in AlF4-- and GTP?S-sensitive adenylyl cyclase activity in plasma membranes isolated from HeLa, HEp-2, Vero and green monkey kidney

Jiri Novotny; Petr Kvapil; Jeronimo Cello; Lennart A. Ransnäs

1994-01-01

281

Detection of some dengue-2 virus antigens in infected cells using immuno-microscopy  

Microsoft Academic Search

Summary Immunoelectron microscopy was used to detect the distribution of some dengue-2 virus proteins in infected Vero andAedes albopictus (C 6\\/36) cells. It was found that the envelope protein (GP 60) was located in clumps on the surface of plasma membrane, and accumulated very little in the infected cytoplasm. However no envelopment of dengue-2 virus nucleocapsids through the plasma membranes

Mah Lee Ng; Linda C. Corner

1989-01-01

282

Strain Variation in Glycosaminoglycan Recognition Influences Cell-Type-Specific Binding by Lyme Disease Spirochetes  

Microsoft Academic Search

Lyme disease, a chronic multisystemic disorder that can affect the skin, heart, joints, and nervous system is caused by Borrelia burgdorferi sensu lato. Lyme disease spirochetes were previously shown to bind glycosamino- glycans (GAGs). In the current study, the GAG-binding properties of eight Lyme disease strains were deter- mined. Binding by two high-passage HB19 derivatives to Vero cells could not

NIKHAT PARVEEN; DOUGLAS ROBBINS; JOHN M. LEONG

1999-01-01

283

PrM- and Cell-Binding Domains of the Dengue Virus E Protein  

Microsoft Academic Search

The E-prM proteins of flaviviruses are unusual complexes which play important roles in virus assembly and fusion modulation and in potential immunity-inducing vaccines. Despite their importance, little is known about the biogenesis and structural organization of E-prM complexes. Pulse-chase radiolabeling of dengue virus-infected Vero cells demonstrated a rapid interassociation of E and prM proteins, and sucrose gradient sedimentation analysis suggested

SONGLI WANG; RUNTAO HE; ROBERT ANDERSON

1999-01-01

284

Aerobic nitrogenase activity measured as acetylene reduction in the marine non-heterocystous cyanobacterium Trichodesmium spp. grown under artificial conditions  

Microsoft Academic Search

Aerobic nitrogenase activity in the marine non-heterocystous cyanobacterium Trichodesmium spp. NIBB 1067, isolated off the Izu Peninsula, Japan in 1983 and grown under artificial conditions, was assayed by the acetylene reduction method. This strain exhibited acetylene reduction activity under aerobic conditions when cells had been grown in the medium free of combined nitrogen. Activity was markedly enhanced by light, and

K. Ohki; Y. Fujita

1988-01-01

285

Nectin4 is an epithelial cell receptor for canine distemper virus and involved in neurovirulence.  

PubMed

Canine distemper virus (CDV) uses signaling lymphocyte activation molecule (SLAM), expressed on immune cells, as a receptor. However, epithelial and neural cells are also affected by CDV in vivo. Wild-type CDV strains showed efficient replication with syncytia in Vero cells expressing dog nectin4, and the infection was blocked by an anti-nectin4 antibody. In dogs with distemper, CDV antigen was preferentially detected in nectin4-positive neurons and epithelial cells, suggesting that nectin4 is an epithelial cell receptor for CDV and also involved in its neurovirulence. PMID:22761370

Pratakpiriya, Watanyoo; Seki, Fumio; Otsuki, Noriyuki; Sakai, Kouji; Fukuhara, Hideo; Katamoto, Hiromu; Hirai, Takuya; Maenaka, Katsumi; Techangamsuwan, Somporn; Lan, Nguyen Thi; Takeda, Makoto; Yamaguchi, Ryoji

2012-09-01

286

Ear Cells  

NSDL National Science Digital Library

Spindly cells in the inner ear, called "hair" cells, are critical for both hearing and balance. Now, in a boon for research, neuro-scientists Jeffrey Corwin and Zhenqing Hu at the University of Virginia School of Medicine have finally grown and multiplied these cells in the lab.

Science Update (AAAS; )

2008-05-06

287

MBE grown iron-based nanostructures  

NASA Astrophysics Data System (ADS)

Interest in magnetic nanostructures has increased rapidly because of their potential applications in a number of magnetic nanotechnologies such as high-density magnetic recording media, magnetic field sensors, magnetic nanoprobes for spin-polarized microscopy and cell manipulation in biomedical technology. Successful incorporation of ferromagnetic nanostructures in semiconductors may open a new area in spintronic applications. In this study, two kinds of Fe-based nanostructures were grown by the molecular beam epitaxy (MBE) technique, namely, Fe quantum dots (QDs) and Fe nanowires (NWs). For Fe QDs, a multilayer magnetic QD sample containing 5 layers of Fe QDs embedded in 6 layers of ZnS spacer was grown on a GaP(100) substrate. High resolution transmission electron microscopy (HRTEM) observations reveal that the Fe QDs are single crystalline with spherical shape of diameters around 3 to 4 nm and area density of 1.5 x 1012 cm-2 . Its zero-field cooled (ZFC) and field cooled (FC) curves measured at low field (100 Oe) show the magnetic relaxation effect with a blocking temperature around 26 K. The hysteresis loop measured at 5 K shows a coercivity of 83 Oe, confirming the slow relaxation process and coercivity enhancement attributed to the nanoparticle nature of the sample. To study the transport property of Fe QDs, a Au/ZnS/Fe-QDs/ZnS/n+-GaAs Schottky-barrier structure containing 5 layers of Fe QDs was fabricated on a n+-GaAs(100) substrate. Its current-voltage (I-V) characteristics measured from 5 to 295 K display negative differential resistance (NDR) for temperature . 50 K, which is caused by the presence of Fe QDs. The highest peak-to-valley current ratio obtained at 5 K is as high as 15:1. Staircase-like I-V characteristic was also observed at low temperature in some devices fabricated from this structure. Possible mechanisms that can account for the observed unusual I-V characteristics in this structure were discussed. Two types of self-assembled Fe NWs were grown on ZnS/GaP(100) surface under high growth/annealing temperature. The Type-A Fe NWs orient along the ZnS[110] direction with irregular shape, while the type-B Fe NWs orient along either the ZnS[180] or [810] direction with seemingly straight shape. Detailed HRTEM and selected area diffraction (SAD) studies reveal that both types were single-crystalline with their elongated axis along the Fe<100> direction family possibly due to the fact that the easy axis of Fe is along this direction. We have proposed a mean-field model to explain the slight misalignment of the type-B Fe NWs. The I-V characteristic of a single type-B Fe NW measured at room temperature displays a straight line nature corresponding to a resistivity about 2.3 x 10-7Om.

Lok, Shu Kin

288

Rift Valley Fever Virus Incorporates the 78 kDa Glycoprotein into Virions Matured in Mosquito C6/36 Cells  

PubMed Central

Rift Valley fever virus (RVFV), genus Phlebovirus, family Bunyaviridae is a zoonotic arthropod-borne virus able to transition between distant host species, causing potentially severe disease in humans and ruminants. Viral proteins are encoded by three genomic segments, with the medium M segment coding for four proteins: nonstructural NSm protein, two glycoproteins Gn and Gc and large 78 kDa glycoprotein (LGp) of unknown function. Goat anti-RVFV polyclonal antibody and mouse monoclonal antibody, generated against a polypeptide unique to the LGp within the RVFV proteome, detected this protein in gradient purified RVFV ZH501 virions harvested from mosquito C6/36 cells but not in virions harvested from the mammalian Vero E6 cells. The incorporation of LGp into the mosquito cell line - matured virions was confirmed by immune-electron microscopy. The LGp was incorporated into the virions immediately during the first passage in C6/36 cells of Vero E6 derived virus. Our data indicate that LGp is a structural protein in C6/36 mosquito cell generated virions. The protein may aid the transmission from the mosquitoes to the ruminant host, with a possible role in replication of RVFV in the mosquito host. To our knowledge, this is a first report of different protein composition between virions formed in insect C6/36 versus mammalian Vero E6 cells. PMID:24489907

Weingartl, Hana M.; Zhang, Shunzhen; Marszal, Peter; McGreevy, Alan; Burton, Lynn; Wilson, William C.

2014-01-01

289

C4 Photosynthetic Gene Expression in Light- and Dark-Grown Amaranth Cotyledons.  

PubMed Central

The patterns of expression for genes encoding several C4 photosynthetic enzymes were examined in light-grown and dark-grown (etiolated) cotyledons of amaranth (Amaranthus hypochondriacus), a dicotyledonous C4 plant. The large subunit and small subunit of ribulose-1,5-bisphosphate carboxylase (RuBPCase), phosphoenolpyruvate carboxylase (PEPCase), and pyruvate orthophosphate dikinase (PPdK) were all present in the cotyledons by d 2 after planting when the seedlings first emerged from the seed coat. Kranz anatomy was apparent in light-grown cotyledons throughout development, and the overall patterns of C4 gene expression were similar to those recently described for developing amaranth leaves (J.L. Wang, D.F. Klessig, J.O. Berry [1992] Plant Cell 4: 173-184). RuBPCase mRNA and proteins were present in both bundle sheath and mesophyll cells in a C3-like pattern during early development and became progressively more localized to bundle sheath cells in the C4-type pattern as the cotyledons expanded over 2 to 7 d. PEPCase and PPdK polypeptides were localized to mesophyll cells throughout development, even though PEPCase transcripts were detected in both bundle sheath and mesophyll cells. Kranz anatomy also developed in cotyledons grown in complete darkness. In 7-d-old dark-grown cotyledons, RuBPCase, PPdK, and PEPCase were all localized to the appropriate cell types, although at somewhat lower levels than in light-grown cotyledons. These findings demonstrate that the leaves and postembryonic cotyledons of amaranth undergo common developmental programs of C4 gene expression during maturation. Furthermore, light is not required for the cell-type-specific expression of genes encoding RuBPCase and other photosynthetic enzymes in this dicotyledonous C4 plant. PMID:12231890

Wang, J. L.; Long, J. J.; Hotchkiss, T.; Berry, J. O.

1993-01-01

290

The changes in Tps1 activity, trehalose content and expression of TPS1 gene in the psychrotolerant yeast Guehomyces pullulans 17-1 grown at different temperatures.  

PubMed

The psychrotolerant yeast Guehomyces pullulans 17-1 grows the best at 15 °C. When the yeast cells grown at 15 °C for 48 h were transferred to new medium and grown at 10, 15, and 25 °C, respectively, trehalose-6-phosphate synthase (Tps1) activity and trehalose content of the yeast cells grown at 25 °C were higher than those of the yeast cells grown at 10 and 15 °C. However, Tps1 activity and trehalose content of the yeast cells grown at 10 °C were lower than those of the yeast cells grown at 15 °C. This may suggest that trehalose synthesized by G. pullulans 17-1 only can play more important role in its adaption to high temperature than in its adaption to low temperature. After the GPTPS1 gene encoding trehalose-6-phosphate synthase was cloned from the psychrotolerant yeast, it was found that the promoter of the gene contained several stress-response elements such as C4T and AG4, indicating that the gene expression might be regulated by heat shock. It was also found that the transcriptional level of the GPTPS1 gene in the yeast cells grown at 25 °C was higher than that of the GPTPS1 gene in the yeast cells grown at 10 and 15 °C. However, the transcriptional level of the GPTPS1 gene in the yeast cells grown at 10 °C was lower than that of the yeast cells grown at 15 °C. This meant that expression of the GPTPS1 gene was constant with the changes in Tps1 activity and trehalose content of the yeast cells. PMID:23334305

Zhang, Fang; Wang, Zhi-Peng; Chi, Zhe; Raoufi, Zeinab; Abdollahi, Sajad; Chi, Zhen-Ming

2013-03-01

291

Absorption coefficient of zinc selenide grown from the melt  

SciTech Connect

The authors study the absorption coefficient in a series of non-transparent set-ups, which closely resemble the schematic diagram presented. The measurement cells were in air. Temperature was measured by thermocouple sensors, whose contacts with the zinc selenide crystals were screened from the light scattered from the volume of the sample. A continuous CO laser was used as the light source. The absorption coefficient (beta) of zinc selenide single crystals grown from the melt increases with contamination by metallic impurities, among which copper appears to have the greatest effect on beta. The magnitude of absorption coefficient is, generally, not related to the measured transmission and must be determined independently.

Kulakov, M.P.; Fadeev, A.V.; Ivanenko, S.G.; Khasanov, I.S.; Ryazanova, N.D.

1986-02-01

292

Interaction of a cholera toxin derivative containing a reduced number of receptor binding sites with intact cells in culture.  

PubMed

Hybrid CTB (hCTB), having only one or two functional binding sites, has been constructed from two chemically inactivated derivatives of CTB. One inactive derivative consisted of CTB formylated in the lone Trp-88 of each beta-chain (fCTB), whereas the other inactive derivative consisted of CTB specifically succinylated in three amino groups located in or near the receptor binding site (sssCTB). hCTB, fCTB and sssCTB were able to reassociate with CTA and form the corresponding holotoxins hCT, fCT and sssCT as measured by gel filtration chromatography. In contrast to fCT and sssCT, hCT could increase the cAMP content of intact Vero cells in a time- and dose-dependent way: concentrations as low as a few nanograms of hCT per milliliter caused a significant increase in the intracellular cAMP level. The maximal cAMP level induced by hCT (1 microgram/ml) was, however, more than 2-fold lower than that elicited by its native counterpart. At saturating ligand concentrations and at 37 degrees C, the lag periods and rates of CT and hCT induced cAMP accumulation were essentially the same. Treatment of Vero and HeLa cells with GM1 did not affect their difference in response to CT and hCT. When Vero cells treated with hCT were incubated for longer periods of time, a further slow accumulation of cAMP occurred until after about 20 h cAMP levels of cells exposed to CT or hCT were essentially the same. In contrast to Vero and HeLa cells, human skin fibroblasts exhibited an almost identical response to CT as well as to hCT. Acidotropic agents such as chloroquine and monensin affected the CT and hCT induced increase in cAMP content of Vero cells, fibroblasts and GM1 treated Hela cells in a similar way. The results are consistent with the view that CT receptor recognition domains are shared between adjacent beta-chains, that pentavalent binding appears not to be essential for cytotoxicity and that in the cell types studied intracellular processing of CT, hCT is involved. PMID:8086502

De Wolf, M J; Dams, E; Dierick, W S

1994-09-01

293

Cells  

NSDL National Science Digital Library

Students use websites to review about cells and cell processes. The Cell Look inside a cell The Virtual Cell Another inside view of a cell. Click on the worksheet. Cells of the body Look inside cells of the body Cells Flash cards Practice cell parts with functions. Cell Concentration Play concentration matching game. Cell Differentiation Movie Watch how cells change as an organism develops. Cell Organelle Table Review Cell Organelles Inside a Cell Look Inside a Cell Nobel Prize Educational Games Play games while learning about ...

Mcnees, Mrs.

2010-09-28

294

Human Colon Cancer Cells Cultivated in Space  

NASA Technical Reports Server (NTRS)

Within five days, bioreactor cultivated human colon cancer cells (shown) grown in Microgravity on the STS-70 mission in 1995, had grown 30 times the volume of the control specimens on Earth. The samples grown in space had a higher level of cellular organization and specialization. Because they more closely resemble tumors found in the body, microgravity grown cell cultures are ideal for research purposes.

1995-01-01

295

38 ENGINEERING & SCIENCE wi nte r 2012 we're a long way from transplantable organs grown to order, but  

E-print Network

want to build an artificial tissue composed of liver cells, or from the insulin-producing beta cells and and with h. teresa Ku of the City of hope, recently spiked one of his ECMs with pancreatic stem cells38 ENGINEERING & SCIENCE wi nte r 2012 we're a long way from transplantable organs grown to order

296

Development of a Novel, Ultra-rapid Biosensor for the Qualitative Detection of Hepatitis B Virus-associated Antigens and Anti-HBV, Based on “Membrane-engineered” Fibroblast Cells with Virus-Specific Antibodies and Antigens  

PubMed Central

A novel miniature cell biosensor detection system for the detection of Hepatis B virus (HBV)-associated antigens and anti-HBV is described. The biosensor is based on “membrane-engineered” Vero fibroblast cells immobilized in an alginate matrix. The membrane-engineering process involved the electroinsertion of anti-HBV specific antibodies (anti-HBs, anti-HBe) or antigens (HBsAg) in the membranes of the Vero cells. The attachment of a homologous antigen to the electroinserted antibody (or, respectively, of the antibody to the electroinserted antigen) triggered specific changes to the cell membrane potential that were measured by appropriate microelectrodes, according to the principle of the Bioelectric Recognition Assay (BERA). The sensor was used for screening 133 clinical blood serum samples according to a double-blind protocol. Considerably higher sensor responses were observed against HBV-positive samples, compared with responses against negative samples or samples positive for heterologous hepatitis viruses such as Hepatitis C (HCV) virus. Detection of anti-HBs antibodies was made possible by using a biosensor based on immobilized Vero cells bearing the respective antigen (HBsAg). The observed response was rapid (45 sec) and quite reproducible. Fluorescence microscopy observations showed that attachment of HBV particles to cells membrane-engineered with anti-HBs was associated with a decrease of [Ca2+]cyt. The perspectives for using the novel biosensor as a qualitative, rapid screening, high throughput assay for HBV antigens and anti-HBs in clinical samples is discussed. PMID:22574007

Perdikaris, Antonios; Alexandropoulos, Nikos; Kintzios, Spiridon

2009-01-01

297

Mechanoresponses of human primary osteoblasts grown on carbon nanotubes.  

PubMed

Bone mechanotransduction is strongly influenced by the biomaterial properties. A good understanding of these mechanosensory mechanisms in bone has the potential to provide new strategies in the highly evolving field of bone tissue engineering. The aim of the present investigation was to study the interactive effects of local mechanical stimuli on multiwalled carbon nanotubes (MWCNTs)/osteoblast interface, using an in vitro model that allows the study of cell growth, attachment and differentiation. Strain was applied at physiological levels [strain magnitudes 500 microstrain (??), at frequency of load application 0.5 Hz]. The effect of mechanical strain and substrate was thus studied by measuring the messenger RNA expression of alkaline phosphatase, vinculin, collagen 1A, and integrins ?1, ?3, ?4, and ?v, using real-time quantitative polymerase chain reaction. The osteoblasts grown on MWCNTs displayed quick adaptation to the new environment by modulating the expression of key adhesion integrins. Furthermore, the addition of mechanical strain interplayed with the extracellular matrix and was efficiently transduced by cells grown on MWCNTs, providing stronger adhesion and survival. MWCNTs are therefore a material perfectly compatible with osteoblast differentiation, adhesion, and growth, and should be further evaluated, to derive new-generation biomaterial scaffolds for the treatment of skeletal defects which require bone reconstruction. © 2014 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 103A: 1038-1044, 2015. PMID:24910375

Kroustalli, A; Kotsikoris, V; Karamitri, A; Topouzis, S; Deligianni, D

2015-03-01

298

Replication of herpes simplex virus: egress of progeny virus at specialized cell membrane sites.  

PubMed

In the final stages of the herpes simplex virus 1 (HSV-1) life cycle, a viral nucleocapsid buds into a vesicle of trans-Golgi network (TGN)/endosome origin, acquiring an envelope and an outer vesicular membrane. The virus-containing vesicle then traffics to the plasma membrane where it fuses, exposing a mature virion. Although the process of directed egress has been studied in polarized epithelial cell lines, less work has been done in nonpolarized cell types. In this report, we describe a study of HSV-1 egress as it occurs in nonpolarized cells. The examination of infected Vero cells by electron, confocal, and total internal reflection fluorescence (TIRF) microscopy revealed that HSV-1 was released at specific pocket-like areas of the plasma membrane that were found along the substrate-adherent surface and cell-cell-adherent contacts. Both the membrane composition and cytoskeletal structure of egress sites were found to be modified by infection. The plasma membrane at virion release sites was heavily enriched in viral glycoproteins. Small glycoprotein patches formed early in infection, and virus became associated with these areas as they expanded. Glycoprotein-rich areas formed independently from virion trafficking as confirmed by the use of a UL25 mutant with a defect in capsid nuclear egress. The depolymerization of the cytoskeleton indicated that microtubules were important for the trafficking of virions and glycoproteins to release sites. In addition, the actin cytoskeleton was found to be necessary for maintaining the integrity of egress sites. When actin was depolymerized, the glycoprotein concentrations dispersed across the membrane, as did the surface-associated virus. Lastly, viral glycoprotein E appeared to function in a different manner in nonpolarized cells compared to previous studies of egress in polarized epithelial cells; the total amount of virus released at egress sites was slightly increased in infected Vero cells when gE was absent. However, gE was important for egress site formation, as Vero cells infected with gE deletion mutants formed glycoprotein patches that were significantly reduced in size. The results of this study are interpreted to indicate that the egress of HSV-1 in Vero cells is directed to virally induced, specialized egress sites that form along specific areas of the cell membrane. PMID:22532674

Mingo, Rebecca M; Han, Jun; Newcomb, William W; Brown, Jay C

2012-07-01

299

Stability of Detached Grown Germanium Single Crystals  

NASA Technical Reports Server (NTRS)

Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years, especially under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 micrometers, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5 mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 micrometers. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be discussed in detail.

Schweizer, M.; Volz, M. P.; Cobb, S. D.; Vujisic, L.; Szofran, F. R.; Rose, M. Franklin (Technical Monitor)

2001-01-01

300

Stability of Detached Grown Germanium Single Crystals  

NASA Technical Reports Server (NTRS)

Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years especially, under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 microns, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 microns. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be discussed in detail.

Schweizer, M.; Volz, M. P.; Cobb, S. D.; Motakef, S.; Szofran, F. R.; Curreri, Peter A. (Technical Monitor)

2002-01-01

301

Ion implanted epitaxially grown ZnSe  

NASA Technical Reports Server (NTRS)

The epitaxial growth of ZnSe on (100) Ge using the close-spaced transport process is described. Substrate temperature of 575 C and source temperatures of 675 C yield 10 micron, single crystal layers in 10 hours. The Ge substrates provides a nonreplenishable chemical transport agent and the epitaxial layer thickness is limited to approximately 10 microns. Grown epitaxial layers show excellent photoluminescence structure at 77 K. Grown layers exhibit high resistivity, and annealing in Zn vapor at 575 C reduces the resistivity to 10-100 ohms-cm. Zinc vapor annealing quenches the visible photoluminescence.

1974-01-01

302

Effect of beta-lactams on peptidoglycan metabolism of Haemophilus influenzae grown in animals.  

PubMed

We have examined bacterial determinants that influence beta-lactam activity in Haemophilus influenzae cells cultivated in a system that reproduces in vivo growth conditions. Bacteria grown in diffusion chambers were recovered from the peritoneal cavities of rats, and their cell properties were compared with those of bacteria grown in broth cultures by various tests performed in vitro. The rate of peptidoglycan synthesis was measured as the incorporation of [14C]alanine into cell wall material in the presence of chloramphenicol. The total incorporation of [14C]alanine into peptidoglycan was markedly increased in cells grown in rats prior to the assay but was efficiently reduced by the beta-lactams. The extent of cross-linking was lower in the peptidoglycan of in vivo-grown bacteria, as estimated by sodium dodecyl sulfate- to trichloroacetic acid-insoluble radioactive cell wall material ratios. A whole-cell labeling assay with 125I-penicillin was used to characterize the penicillin-binding proteins (PBPs). Four PBPs showed a striking reduction in the binding of the labeled penicillin in cells grown in rats. Such changes resembled the PBP alterations seen in beta-lactamase-negative clinical strains that were resistant to the beta-lactams. Although ampicillin and moxalactam showed delayed inhibitory activities in vitro for cells collected from rats, cells recovered from beta-lactam-treated rats showed evidence of antibiotic effectiveness (binding of the beta-lactams to PBPs in vivo and altered morphology), and the killing of cells exposed to antibiotics in broth or in peritoneal fluid was equally good. Finally, the frequencies of spontaneous resistance or tolerance to ampicillin or moxalactam were estimated, and there was no significant difference for in vitro- or in vivo-grown cells. These data demonstrated that the cultivation of H. influenzae in animals created changes in PBPs and the overall peptidoglycan metabolism. Such alterations did not impair the bactericidal activities of the beta-lactams, although they resulted in delayed bacterial inhibition, a phenomenon that may have important consequences in antibiotherapy. PMID:1444294

Rousseau, N; Dargis, M; Gourde, P; Beauchamp, D; Malouin, F

1992-10-01

303

Characterization of Junin arenavirus cell entry.  

PubMed

Junín virus (JUNV) entry is conducted by receptor-mediated endocytosis. To explore the cellular entry mechanism of JUNV, inhibitory effects of drugs affecting the main endocytic pathways on JUNV entry into Vero cells were analysed. Compounds that impair clathrin-mediated endocytosis were shown to reduce virus internalization without affecting virion binding. In contrast, drugs that alter lipid-raft microdomains, impairing caveola-mediated endocytosis, were not able to block virus entry. To show direct evidence of JUNV entry, transmission electron microscopy was performed; it showed JUNV particles of about 60-100 nm in membrane depressions that had an electron-dense coating. In addition, JUNV particles were found within invaginations of the plasma membrane and vesicles that resembled those of pits and clathrin-coated vesicles. Taken together, these results demonstrate that clathrin-mediated endocytosis is the main JUNV entry pathway into Vero cells and represent an important contribution to the characterization of the arenavirus multiplication cycle. PMID:17485539

Martinez, M Guadalupe; Cordo, Sandra M; Candurra, Nélida A

2007-06-01

304

Mechanism and Significance of Cell Type-Dependent Neutralization of Flaviviruses  

PubMed Central

ABSTRACT The production of neutralizing antibodies (NAbs) is a correlate of protection for many human vaccines, including currently licensed vaccines against flaviviruses. NAbs are typically measured using a plaque reduction neutralization test (PRNT). Despite its extensive use, parameters that impact the performance of the PRNT have not been investigated from a mechanistic perspective. The results of a recent phase IIb clinical trial of a tetravalent dengue virus (DENV) vaccine suggest that NAbs, as measured using a PRNT performed with Vero cells, do not correlate with protection. This surprising finding highlights the importance of understanding how well the PRNT captures the complexity of the NAb response to DENV. In this study, we demonstrated that the structural heterogeneity of flaviviruses arising from inefficient virion maturation impacts the results of neutralization assays in a cell type-dependent manner. Neutralization titers of several monoclonal antibodies were significantly reduced when assayed on Vero cells compared to Raji cells expressing DC-SIGNR. This pattern can be explained by differences in the efficiency with which partially mature flaviviruses attach to each cell type, rather than a differential capacity of antibody to block infection. Vero cells are poorly permissive to the fraction of virions that are most sensitive to neutralization. Analysis of sera from recipients of live-attenuated monovalent DENV vaccine candidates revealed a strong correlation between the sensitivity of serum antibodies to the maturation state of DENV and cell type-dependent patterns of neutralization. Cross-reactive patterns of neutralization may be underrepresented by the “gold-standard” PRNT that employs Vero cells. IMPORTANCE Cell type-dependent patterns of neutralization describe a differential capacity of antibodies to inhibit virus infection when assayed on multiple cellular substrates. In this study, we established a link between antibodies that neutralize infection in a cell type-dependent fashion and those sensitive to the maturation state of the flavivirus virion. We demonstrated that cell type-dependent neutralization reflects a differential capacity to measure neutralization of viruses that are incompletely mature. Partially mature virions that most efficiently bind maturation state-sensitive antibodies are poorly represented by assays typically used in support of flavivirus vaccine development. The selection of cellular substrate for neutralization assays may significantly impact evaluation of the neutralization potency of the polyclonal response. These data suggest that current assays do not adequately capture the full complexity of the neutralizing antibody response and may hinder the identification of correlates of protection following flavivirus vaccination. PMID:24741083

Mukherjee, Swati; Dowd, Kimberly A.; Manhart, Carolyn J.; Ledgerwood, Julie E.; Durbin, Anna P.; Whitehead, Stephen S.

2014-01-01

305

Effect of Photon Fluence Rate on Oxygen Evolution and Uptake by Chlamydomonas reinhardtii Suspensions Grown in Ambient and CO2-Enriched Air 1  

PubMed Central

A closed system consisting of an assimilation chamber furnished with a membrane inlet from the liquid phase connected to a mass spectrometer was used to measure O2 evolution and uptake by Chlamydomonas reinhardtii cells grown in ambient (0.034% CO2) or CO2-enriched (5% CO2) air. At pH = 6.9, 28°C and concentrations of dissolved inorganic carbon (DIC) saturating for photosynthesis, O2 uptake in the light (Uo) equaled O2 production (Eo) at the light compensation point (15 micromoles photons per square meter per second). Eo and Uo increased with increasing photon fluence rate (PFR) but were not rate saturated at 600 micromoles photons per square meter per second, while net O2 exchange reached a saturation level near 500 micromoles photons per square meter per second which was nearly the same for both, CO2-grown and air-grown cells. Comparison of the Uo/Eo ratios between air-grown and CO2-grown C. reinhardtii showed higher values for air-grown cells at light intensities higher than light compensation. For both, air-grown and CO2-grown algae the rates of mitochondrial O2 uptake in the dark measured immediately before and 5 minutes after illumination were much lower than Uo at PFR saturating for net photosynthesis. We conclude that noncyclic electron flow from water to NADP+ and pseudocyclic electron flow via photosystem I to O2 both significantly contribute to O2 exchange in the light. In contrast, mitochondrial respiration and photosynthetic carbon oxidation cycle are regarded as minor O2 consuming reactions in the light in both, air-grown and CO2-grown cells. It is suggested that the “extra” O2 uptake by air-grown algae provides ATP required for the energy dependent CO2/HCO3? concentrating mechanism known to be present in these cells. PMID:16664823

Sueltemeyer, Dieter F.; Klug, Klaus; Fock, Heinrich P.

1986-01-01

306

Cytochemical localization of catalase activity in methanol-grown Hansenula polymorpha  

Microsoft Academic Search

The localization of peroxidase activity in methanol-grown cells of the yeast Hansenula polymorpha has been studied by a method based on cytochemical staining with diaminobenzidine (DAB). The oxidation product of DAB occurred in microbodies, which characteristically develop during growth on methanol, and in the intracristate space of the mitochondria.

J. P. van Dijken; M. Veenhuis; C. A. Vermeulen; W. Harder

1975-01-01

307

AFLATOXIN CONTAMINATION OF COMMERCIALLY GROWN TRANSGENIC  

E-print Network

108 AFLATOXIN CONTAMINATION OF COMMERCIALLY GROWN TRANSGENIC BT COTTONSEED P.J. Cotty and C. Bock cotton may have reduced susceptibility to aflatoxin contamination as a result of pink bollworm resistance. During 1995 and 1996, Bt cottonseed from several commercial fields in Arizona contained aflatoxin levels

Cotty, Peter J.

308

Grown-ups Ought To Know Better.  

ERIC Educational Resources Information Center

Among the articles by Sam Brightman collected in this volume from the newsletter, "Adult & Continuing Education Today (ACET)" are the following: "Grown-Ups Ought to Know Better"; "Adult Education: The Only Sure Factor Is Growth"; "Adult Education Important in This Election Year"; "Will Nursery School External Degree Programs Come Next?";…

Brightman, Samuel C.

309

Transport studies on CVD-grown graphene  

E-print Network

In this thesis, we report transport studies performed on CVD-grown graphene. We perform resistivity and hall measurements on a large-area sample at 4' K. We measure the carrier mobility of the sample and find it to be on ...

Huntley, Miriam Hanna

2009-01-01

310

Rice Plants Grown With and Without Endophytes  

USGS Multimedia Gallery

These rice plants show the difference in growth of rice plants exposed to salt when grown with and without endophytes, which are mutually beneficial microscopic fungi that live in most plants. The plant on the left was colonized with a fungi that made it salt-tolerant, but it wasn't exposed to ...

311

Vapor-grown carbon fibers (VGCFs)  

Microsoft Academic Search

Submicron vapor grown carbon fibers (VGCFs) obtained by a floating growth method were evaluated in terms of their microstructural development with heat treatment temperature (HTT), physical properties of a single fiber and of the bulk state, and additional effects, such as the filler in the electrode of a lead–acid battery and a Li-ion battery system. Its desirable properties, such as

M Endo; Y. A Kim; T Hayashi; K Nishimura; T Matusita; K Miyashita; M. S Dresselhaus

2001-01-01

312

Auxin represses stomatal development in dark-grown seedlings via Aux/IAA proteins.  

PubMed

Stomatal development is tightly regulated through internal and external factors that are integrated by a complex signalling network. Light represents an external factor that strongly promotes stomata formation. Here, we show that auxin-resistant aux/iaa mutants, e.g. axr3-1, exhibit a de-repression of stomata differentiation in dark-grown seedlings. The higher stomatal index in dark-grown axr3-1 mutants when compared with the wild type is due to increased cell division in the stomatal lineage. Excessive stomata in dark-grown seedlings were also observed in mutants defective in auxin biosynthesis or auxin perception and in seedlings treated with the polar auxin transport inhibitor NPA. Consistent with these findings, exogenous auxin repressed stomata formation in light-grown seedlings. Taken together, these results indicate that auxin is a negative regulator of stomatal development in dark-grown seedlings. Epistasis analysis revealed that axr3-1 acts genetically upstream of the bHLH transcription factors SPCH, MUTE and FAMA, as well as the YDA MAP kinase cascade, but in parallel with the repressor of photomorphogenesis COP1 and the receptor-like protein TMM. The effect of exogenous auxin required the ER family of leucine-rich repeat receptor-like kinases, suggesting that auxin acts at least in part through the ER family. Expression of axr3-1 in the stomatal lineage was insufficient to alter the stomatal index, implying that cell-cell communication is necessary to mediate the effect of auxin. In summary, our results show that auxin signalling contributes to the suppression of stomatal differentiation observed in dark-grown seedlings. PMID:25063454

Balcerowicz, Martin; Ranjan, Aashish; Rupprecht, Laura; Fiene, Gabriele; Hoecker, Ute

2014-08-01

313

Optical, crystalline perfection and mechanical studies on unidirectional grown bis(thiourea) cadmium zinc chloride single crystal  

Microsoft Academic Search

Optically transparent and bulk single crystal of bis(thiourea) cadmium zinc chloride was successfully grown by unidirectional crystal growth technique. The quality of the crystal was examined by high-resolution X-ray diffraction analysis. The cell parameters and the crystallinity of the grown crystal were estimated by the single-crystal and powder X-ray diffraction analyses, respectively. Optical transmittance of the crystal was recorded using

R. Uthrakumar; C. Vesta; G. Bhagavannarayana; R. Robert; S. Jerome Das

2011-01-01

314

Rhizosphere Signals for Plant–Microbe Interactions: Implications for Field-Grown Plants  

Microsoft Academic Search

\\u000a This review presents an analysis of rhizosphere signals important in plant–microbial interactions that have been studied in\\u000a controlled conditions and how they may function on field-grown roots. We define rhizosphere signals to be molecules on or\\u000a emitted from microorganism or root cells that are recognized by other cells and trigger a response. A well-known example are\\u000a the flavonoids from legume

Ulrike Mathesius; Michelle Watt

315

[Safety assessment of stevia rebaudiana bertoni grown in southeastern Mexico as food sweetener].  

PubMed

Stevia rebaudiana leaves and their glycosides have been recently and significantly used so important as sweeteners. However, it has been reported an antihyperglycemic effect of the extract and a glycoside. The aim of this study was to quantify S. rebaudiana glycosides, assess cytotoxicity of the extract and its acute and chronic effect on blood glucose in animal models and in human. The glycosides of the Morita II and Criolla extract were quantified by HPLC, using a C18 column (250 mm x 4.6 mm and particle size of 5 uM) with UV detection at 210 nm, mobile phase of acetonitrile/sodium phosphate buffer 10 mmol/L, pH 2.6 (32:68 v/v). Cytotoxicity study was performed in Vero cells, whereas an intraperitoneal glucose tolerance test (IPGTT) and a chronic consumption assay (4 weeks) were executed in an animal model of diabetes; finally the glycemic index (G.I.) was determined in healthy individuals. The glycoside content is higher in the Morita variety II although both had a CC50 >300 ?g/mL. The areas under the curve of the IPGTT and fasting glucose of the animals were not significantly different (p> 0.05) and the I.G. extract was 11.11 %, which classifies the extract as low I.G. The extract of S. rebaudiana Morita II has a low glycemic index and, in the doses tested, is not cytotoxic nor has acute or chronic effect on blood sugar, which makes it a safe sweetener. PMID:25238836

Aranda-González, Irma; Barbosa-Martín, Enrique; Toraya-Avilés, Rocío; Segura-Campos, Maira; Moguel-Ordoñez, Yolanda; Betancur-Ancona, David

2014-01-01

316

Characterization of cellulolytic bacterial cultures grown in different substrates.  

PubMed

Nine aerobic cellulolytic bacterial cultures were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ) and the American Type Culture Collection (ATCC). The objectives of this study were to characterize the cellulolytic bacteria and to determine the optimum moisture ratio required for solid state fermentation (SSF) of palm kernel cake (PKC). The bacteria cultures were grown on reconstituted nutrient broth, incubated at 30°C and agitated at 200?rpm. Carboxymethyl cellulase, xylanase, and mannanase activities were determined using different substrates and after SSF of PKC. The SSF was conducted for 4 and 7 days with inoculum size of 10% (v/w) on different PKC concentration-to-moisture ratios: 1?:?0.2, 1?:?0.3, 1?:?0.4, and 1?:?0.5. Results showed that Bacillus amyloliquefaciens 1067?DSMZ, Bacillus megaterium 9885?ATCC, Paenibacillus curdlanolyticus 10248?DSMZ, and Paenibacillus polymyxa 842?ATCC produced higher enzyme activities as compared to other bacterial cultures grown on different substrates. The cultures mentioned above also produced higher enzyme activities when they were incubated under SSF using PKC as a substrate in different PKC-to-moisture ratios after 4 days of incubation, indicating that these cellulolytic bacteria can be used to degrade and improve the nutrient quality of PKC. PMID:24319380

Alshelmani, Mohamed Idris; Loh, Teck Chwen; Foo, Hooi Ling; Lau, Wei Hong; Sazili, Awis Qurni

2013-01-01

317

Characterization of Cellulolytic Bacterial Cultures Grown in Different Substrates  

PubMed Central

Nine aerobic cellulolytic bacterial cultures were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ) and the American Type Culture Collection (ATCC). The objectives of this study were to characterize the cellulolytic bacteria and to determine the optimum moisture ratio required for solid state fermentation (SSF) of palm kernel cake (PKC). The bacteria cultures were grown on reconstituted nutrient broth, incubated at 30°C and agitated at 200?rpm. Carboxymethyl cellulase, xylanase, and mannanase activities were determined using different substrates and after SSF of PKC. The SSF was conducted for 4 and 7 days with inoculum size of 10% (v/w) on different PKC concentration-to-moisture ratios: 1?:?0.2, 1?:?0.3, 1?:?0.4, and 1?:?0.5. Results showed that Bacillus amyloliquefaciens 1067?DSMZ, Bacillus megaterium 9885?ATCC, Paenibacillus curdlanolyticus 10248?DSMZ, and Paenibacillus polymyxa 842?ATCC produced higher enzyme activities as compared to other bacterial cultures grown on different substrates. The cultures mentioned above also produced higher enzyme activities when they were incubated under SSF using PKC as a substrate in different PKC-to-moisture ratios after 4 days of incubation, indicating that these cellulolytic bacteria can be used to degrade and improve the nutrient quality of PKC. PMID:24319380

Alshelmani, Mohamed Idris; Loh, Teck Chwen; Foo, Hooi Ling; Sazili, Awis Qurni

2013-01-01

318

Effect of three preservatives on the growth of Bacillus cereus, Vero cytotoxigenic Escherichia coli and Staphylococcus aureus, on plates with gradients of pH and sodium chloride concentration.  

PubMed

The effect of temperature, pH, sodium chloride concentration and a preservative (sodium benzoate, sodium nitrite or potassium sorbate) on the growth of three foodborne bacterial pathogens (Bacillus cereus, Vero cytotoxigenic Escherichia coli and Staphylococcus aureus) was studied using gradient gel plates. Growth, expressed in optical density units, was recorded using image analysis techniques, and was expressed as three-dimensional grids. These gave a visual indication of the effects of any three of the environmental factors on bacterial proliferation. Sorbate was completely effective against E. coli at all temperature/pH/NaCl combinations, and was the most effective preservative tested against B. cereus. Increase in the acidity and/or the NaCl concentration improved the effect of all the preservatives, except nitrite when used against St. aureus. Nitrite was the least effective preservative, particularly against St. aureus. At < 25 degrees C, sorbate was more effective than benzoate against St. aureus when used with higher concentrations of NaCl. At 35 degrees C benzoate was the most effective preservative against St. aureus, especially when used at pH < 6. PMID:8466802

Thomas, L V; Wimpenny, J W; Davis, J G

1993-02-01

319

Counting molecular-beam grown graphene layers  

SciTech Connect

We have used the ratio of the integrated intensity of graphene's Raman G peak to that of the silicon substrate's first-order optical phonon peak, accurately to determine the number of graphene layers across our molecular-beam (MB) grown graphene films. We find that these results agree well both, with those from our own exfoliated single and few-layer graphene flakes, and with the results of Koh et al.[ACS Nano 5, 269 (2011)]. We hence distinguish regions of single-, bi-, tri-, four-layer, etc., graphene, consecutively, as we scan coarsely across our MB-grown graphene. This is the first, but crucial, step to being able to grow, by such molecular-beam-techniques, a specified number of large-area graphene layers, to order.

Plaut, Annette S. [School of Physics, University of Exeter, Exeter EX4 4QL (United Kingdom)] [School of Physics, University of Exeter, Exeter EX4 4QL (United Kingdom); Wurstbauer, Ulrich [Department of Physics, Columbia University, New York, New York 10027 (United States)] [Department of Physics, Columbia University, New York, New York 10027 (United States); Pinczuk, Aron [Department of Physics, Columbia University, New York, New York 10027 (United States) [Department of Physics, Columbia University, New York, New York 10027 (United States); Department of Applied Physics and Applied Mathematics, Columbia University, New York, New York 10027 (United States); Garcia, Jorge M. [MBE Lab, IMM-Instituto de Microelectronica de Madrid (CNM-CSIC), Madrid, E-28760 (Spain)] [MBE Lab, IMM-Instituto de Microelectronica de Madrid (CNM-CSIC), Madrid, E-28760 (Spain); Pfeiffer, Loren N. [Electrical Engineering Department, Princeton University, New Jersey 08544 (United States)] [Electrical Engineering Department, Princeton University, New Jersey 08544 (United States)

2013-06-17

320

Nanoelectronic biosensors based on CVD grown graphene  

Microsoft Academic Search

Graphene, a single-atom-thick and two-dimensional carbon material, has attracted great attention recently. Because of its unique electrical, physical, and optical properties, graphene has great potential to be a novel alternative to carbon nanotubes in biosensing. We demonstrate the use of large-sized CVD grown graphene films configured as field-effect transistors for real-time biomolecular sensing. Glucose or glutamate molecules were detected by

Yinxi Huang; Xiaochen Dong; Yumeng Shi; Chang Ming Li; Lain-Jong Li; Peng Chen

2010-01-01

321

Mineral composition of organically grown tomato  

NASA Astrophysics Data System (ADS)

In recent years, consumer concerns on environmental and health issues related to food products have increased and, as a result, the demand for organically grown production has grown. Results indicate that consumers concerned about healthy diet and environmental degradation are the most likely to buy organic food, and are willing to pay a high premium. Therefore, it is important to ensure the quality of the produce, especially for highly consumed products. The tomato (Lycopersicon esculentum) is one of the most widely consumed fresh vegetables in the world. It is also widely used by the food industries as a raw material for the production of derived products such as purees or ketchup. Consequently, many investigations have addressed the impact of plant nutrition on the quality of tomato fruit. The concentrations of minerals (P, Na, K, Ca and Mg) and trace elements (Cu, Zn and Mn) were determined in tomatoes grown organically in East Georgia, Marneuli District. The contents of minerals and Mn seem to be in the range as shown in literature. Cu and Zn were found in considerably high amounts in comparison to maximum permissible values established in Georgia. Some correlations were observed between the minerals and trace elements studied. K and Mg were strongly correlated with Cu and Zn. Statistically significant difference have shown also P, K and Mg based between period of sampling.

Ghambashidze, Giorgi

2014-05-01

322

Interactions Between American Pondweed and Monoecious Hydrilla Grown in Mixtures  

Microsoft Academic Search

To assess the potential for monoecious hydrilla ( Hydrilla verticillata (L.f.) Royle) to invade existing aquatic plant com- munities, monoecious hydrilla was grown in mixtures with American pondweed ( Potamogeton nodosus Poiret). When grown with hydrilla from axillary turions, American pond- weed was a stronger competitor. When grown with hydrilla from tubers, American pondweed was equally as strong a competitor

DAVID F. SPENCER; GREGORY G. KSANDER

323

Activation of the Nipah virus fusion protein in MDCK cells is mediated by cathepsin B within the endosome-recycling compartment.  

PubMed

Proteolytic activation of the fusion protein of the highly pathogenic Nipah virus (NiV F) is a prerequisite for the production of infectious particles and for virus spread via cell-to-cell fusion. Unlike other paramyxoviral fusion proteins, functional NiV F activation requires endocytosis and pH-dependent cleavage at a monobasic cleavage site by endosomal proteases. Using prototype Vero cells, cathepsin L was previously identified to be a cleavage enzyme. Compared to Vero cells, MDCK cells showed substantially higher F cleavage rates in both NiV-infected and NiV F-transfected cells. Surprisingly, this could not be explained either by an increased F endocytosis rate or by elevated cathepsin L activities. On the contrary, MDCK cells did not display any detectable cathepsin L activity. Though we could confirm cathepsin L to be responsible for F activation in Vero cells, inhibitor studies revealed that in MDCK cells, cathepsin B was required for F-protein cleavage and productive replication of pathogenic NiV. Supporting the idea of an efficient F cleavage in early and recycling endosomes of MDCK cells, endocytosed F proteins and cathepsin B colocalized markedly with the endosomal marker proteins early endosomal antigen 1 (EEA-1), Rab4, and Rab11, while NiV F trafficking through late endosomal compartments was not needed for F activation. In summary, this study shows for the first time that endosomal cathepsin B can play a functional role in the activation of highly pathogenic NiV. PMID:22278224

Diederich, Sandra; Sauerhering, Lucie; Weis, Michael; Altmeppen, Hermann; Schaschke, Norbert; Reinheckel, Thomas; Erbar, Stephanie; Maisner, Andrea

2012-04-01

324

Increase of translatable mRNA for major microsomal proteins in n-alkane-grown Candida maltosa.  

PubMed Central

In an n-alkane-assimilating Candida sp., transfer from glucose- to n-alkane-containing medium induced changes in the microsomal proteins, and several distinctive polypeptides were demonstrated in the solubilized microsomal fraction derived from n-alkane-grown cells. Long-term-labeling and pulse-labeling experiments in vivo demonstrated the synthesis of the specific microsomal polypeptides. The polypeptides were synthesized as in vitro translation products directed by polyadenylated RNA extracted from n-alkane-grown cells. Two major polypeptides were partially purified from the microsomal fraction from n-alkane-grown cells, and antiserum was prepared in a rabbit. Immunoprecipitation of these two polypeptides was accompanied by an increase in the amount of translatable mRNA. The molecular weights of the polypeptides derived from long-term-labeling, pulse-labeling and in vitro translation experiments appeared to be identical. Images PMID:6501225

Sunairi, M; Watabe, K; Takagi, M; Yano, K

1984-01-01

325

Cometabolism of Methyl tertiary Butyl Ether and Gaseous n-Alkanes by Pseudomonas mendocina KR-1 Grown on C5 to C8 n-Alkanes  

PubMed Central

Pseudomonas mendocina KR-1 grew well on toluene, n-alkanes (C5 to C8), and 1° alcohols (C2 to C8) but not on other aromatics, gaseous n-alkanes (C1 to C4), isoalkanes (C4 to C6), 2° alcohols (C3 to C8), methyl tertiary butyl ether (MTBE), or tertiary butyl alcohol (TBA). Cells grown under carbon-limited conditions on n-alkanes in the presence of MTBE (42 ?mol) oxidized up to 94% of the added MTBE to TBA. Less than 3% of the added MTBE was oxidized to TBA when cells were grown on either 1° alcohols, toluene, or dextrose in the presence of MTBE. Concentrated n-pentane-grown cells oxidized MTBE to TBA without a lag phase and without generating tertiary butyl formate (TBF) as an intermediate. Neither TBF nor TBA was consumed by n-pentane-grown cells, while formaldehyde, the expected C1 product of MTBE dealkylation, was rapidly consumed. Similar Ks values for MTBE were observed for cells grown on C5 to C8 n-alkanes (12.95 ± 2.04 mM), suggesting that the same enzyme oxidizes MTBE in cells grown on each n-alkane. All growth-supporting n-alkanes (C5 to C8) inhibited MTBE oxidation by resting n-pentane-grown cells. Propane (Ki = 53 ?M) and n-butane (Ki = 16 ?M) also inhibited MTBE oxidation, and both gases were also consumed by cells during growth on n-pentane. Cultures grown on C5 to C8 n-alkanes also exhibited up to twofold-higher levels of growth in the presence of propane or n-butane, whereas no growth stimulation was observed with methane, ethane, MTBE, TBA, or formaldehyde. The results are discussed in terms of their impacts on our understanding of MTBE biodegradation and cometabolism. PMID:14660389

Smith, Christy A.; O'Reilly, Kirk T.; Hyman, Michael R.

2003-01-01

326

Cometabolism of methyl tertiary butyl ether and gaseous n-alkanes by Pseudomonas mendocina KR-1 grown on C5 to C8 n-alkanes.  

PubMed

Pseudomonas mendocina KR-1 grew well on toluene, n-alkanes (C5 to C8), and 1 degrees alcohols (C2 to C8) but not on other aromatics, gaseous n-alkanes (C1 to C4), isoalkanes (C4 to C6), 2 degrees alcohols (C3 to C8), methyl tertiary butyl ether (MTBE), or tertiary butyl alcohol (TBA). Cells grown under carbon-limited conditions on n-alkanes in the presence of MTBE (42 micromoles) oxidized up to 94% of the added MTBE to TBA. Less than 3% of the added MTBE was oxidized to TBA when cells were grown on either 1 degrees alcohols, toluene, or dextrose in the presence of MTBE. Concentrated n-pentane-grown cells oxidized MTBE to TBA without a lag phase and without generating tertiary butyl formate (TBF) as an intermediate. Neither TBF nor TBA was consumed by n-pentane-grown cells, while formaldehyde, the expected C1 product of MTBE dealkylation, was rapidly consumed. Similar Ks values for MTBE were observed for cells grown on C5 to C8 n-alkanes (12.95 +/- 2.04 mM), suggesting that the same enzyme oxidizes MTBE in cells grown on each n-alkane. All growth-supporting n-alkanes (C5 to C8) inhibited MTBE oxidation by resting n-pentane-grown cells. Propane (Ki = 53 micromoles) and n-butane (Ki = 16 micromoles) also inhibited MTBE oxidation, and both gases were also consumed by cells during growth on n-pentane. Cultures grown on C5 to C8 n-alkanes also exhibited up to twofold-higher levels of growth in the presence of propane or n-butane, whereas no growth stimulation was observed with methane, ethane, MTBE, TBA, or formaldehyde. The results are discussed in terms of their impacts on our understanding of MTBE biodegradation and cometabolism. PMID:14660389

Smith, Christy A; O'Reilly, Kirk T; Hyman, Michael R

2003-12-01

327

Cytotoxicity of municipal solid waste incinerator ash wastes toward mammalian kidney cell lines.  

PubMed

In this study, three municipal solid waste incinerator (MSWI) ash wastes-bottom ash, scrubber residue, and baghouse ash-were extracted using a toxicity characteristic leaching procedure (TCLP) extractant. These so-called final TCLP extracts were applied to African green monkey kidney cells (Vero), baby hamster kidney cells (BHK-21), and pig kidney cells (PK-15), multi-well absorption reader analysis was performed to test how the cytotoxicity of the incineration ashes would affect the digestive systems of animals. Ion-coupled plasma analyses indicated that the baghouse ash extract possessed the highest pH and heavy metal concentration, its cytotoxicity was also the highest. In contrast, the bottom ash and the scrubber residue exhibited very low cytotoxicities. The cytotoxicities of mixtures of baghouse ash and scrubber residue toward the three tested cell lines increased as the relative ratio of the baghouse ash increased, especially for the Vero cells. The slight cytotoxicity of the scrubber residue arose mainly from the presence of Cr species, whereas the high cytotoxicity of the baghouse ash resulted from its high content of heavy metals and alkali ions. In addition, it appears that the dissolved total organic carbon content of these ash wastes can reduce the cytotoxicity of ash wastes that collect in animal cells. PMID:18329068

Huang, Wu-Jang; Tsai, Jia-Lin; Liao, Ming-Huei

2008-05-01

328

Gene Expression by the Sulfate-Reducing Bacterium Desulfovibrio vulgaris Hildenborough Grown on an Iron Electrode under Cathodic Protection Conditions? †  

PubMed Central

The genome sequence of the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough was reanalyzed to design unique 70-mer oligonucleotide probes against 2,824 probable protein-coding regions. These included three genes not previously annotated, including one that encodes a c-type cytochrome. Using microarrays printed with these 70-mer probes, we analyzed the gene expression profile of wild-type D. vulgaris grown on cathodic hydrogen, generated at an iron electrode surface with an imposed negative potential of ?1.1 V (cathodic protection conditions). The gene expression profile of cells grown on cathodic hydrogen was compared to that of cells grown with gaseous hydrogen bubbling through the culture. Relative to the latter, the electrode-grown cells overexpressed two hydrogenases, the hyn-1 genes for [NiFe] hydrogenase 1 and the hyd genes, encoding [Fe] hydrogenase. The hmc genes for the high-molecular-weight cytochrome complex, which allows electron flow from the hydrogenases across the cytoplasmic membrane, were also overexpressed. In contrast, cells grown on gaseous hydrogen overexpressed the hys genes for [NiFeSe] hydrogenase. Cells growing on the electrode also overexpressed genes encoding proteins which promote biofilm formation. Although the gene expression profiles for these two modes of growth were distinct, they were more closely related to each other than to that for cells grown in a lactate- and sulfate-containing medium. Electrochemically measured corrosion rates were lower for iron electrodes covered with hyn-1, hyd, and hmc mutant biofilms than for wild-type biofilms. This confirms the importance, suggested by the gene expression studies, of the corresponding gene products in D. vulgaris-mediated iron corrosion. PMID:18310429

Caffrey, Sean M.; Park, Hyung Soo; Been, Jenny; Gordon, Paul; Sensen, Christoph W.; Voordouw, Gerrit

2008-01-01

329

Gene expression by the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough grown on an iron electrode under cathodic protection conditions.  

PubMed

The genome sequence of the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough was reanalyzed to design unique 70-mer oligonucleotide probes against 2,824 probable protein-coding regions. These included three genes not previously annotated, including one that encodes a c-type cytochrome. Using microarrays printed with these 70-mer probes, we analyzed the gene expression profile of wild-type D. vulgaris grown on cathodic hydrogen, generated at an iron electrode surface with an imposed negative potential of -1.1 V (cathodic protection conditions). The gene expression profile of cells grown on cathodic hydrogen was compared to that of cells grown with gaseous hydrogen bubbling through the culture. Relative to the latter, the electrode-grown cells overexpressed two hydrogenases, the hyn-1 genes for [NiFe] hydrogenase 1 and the hyd genes, encoding [Fe] hydrogenase. The hmc genes for the high-molecular-weight cytochrome complex, which allows electron flow from the hydrogenases across the cytoplasmic membrane, were also overexpressed. In contrast, cells grown on gaseous hydrogen overexpressed the hys genes for [NiFeSe] hydrogenase. Cells growing on the electrode also overexpressed genes encoding proteins which promote biofilm formation. Although the gene expression profiles for these two modes of growth were distinct, they were more closely related to each other than to that for cells grown in a lactate- and sulfate-containing medium. Electrochemically measured corrosion rates were lower for iron electrodes covered with hyn-1, hyd, and hmc mutant biofilms than for wild-type biofilms. This confirms the importance, suggested by the gene expression studies, of the corresponding gene products in D. vulgaris-mediated iron corrosion. PMID:18310429

Caffrey, Sean M; Park, Hyung Soo; Been, Jenny; Gordon, Paul; Sensen, Christoph W; Voordouw, Gerrit

2008-04-01

330

Akabane Virus Utilizes Alternative Endocytic Pathways to Entry into Mammalian Cell Lines  

PubMed Central

ABSTRACT The entry mechanisms of Akabane virus (AKAV), Bunyaviridae family, have not yet been determined. In this study, chemical inhibitors were used to analyze endocytic mechanisms during AKAV infection of mammalian cell lines. The analyses using drug treatments followed by quantitative measurement of viral RNA and N protein revealed that AKAV enters non-bovine-derived cell lines (Vero, HmLu-1 and BHK cells) in a manner indicative of clathrin endocytosis. By contrast, AKAV infection in bovine-derived cell lines (LB9.K and MDBK cells) is independent of this pathway. Further analyses indicated that AKAV entry into bovine cell lines involves a non-clathrin, non-caveolae endocytic pathway that is dependent on dynamin. We conclude that although both cell types require a low pH for AKAV penetration, AKAV utilizes alternative entry pathways into mammalian cell lines. PMID:25056673

BANGPHOOMI, Norasuthi; TAKENAKA-UEMA, Akiko; SUGI, Tatsuki; KATO, Kentaro; AKASHI, Hiroomi; HORIMOTO, Taisuke

2014-01-01

331

Defect study in molecular beam epitaxy-grown HgCdTe films with activated and unactivated arsenic  

SciTech Connect

A defect study was performed on molecular beam epitaxy-grown HgCdTe films in situ doped with arsenic. Doping was performed from either effusion cell or cracker cell, and studied were both as-grown samples and samples subjected to arsenic activation annealing. Electrical properties of the films were investigated with the use of ion milling as a means of “stirring” defects in the material. As a result of the study, it was confirmed that the most efficient incorporation of electrically active arsenic occurs at the cracking zone temperature of 700?°C. Interaction between arsenic and tellurium during the growth was observed and is discussed in the paper.

Izhnin, I. I., E-mail: i.izhnin@carat.electron.ua [R and D Institute for Materials SRC “Carat,” Lviv 79031 (Ukraine); National Research Tomsk State University, Tomsk 634050 (Russian Federation); Dvoretsky, S. A.; Mikhailov, N. N.; Varavin, V. S. [A.V. Rzhanov Institute of Semiconductor Physics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk 630090 (Russian Federation); Mynbaev, K. D. [Ioffe Physical-Technical Institute of the Russian Academy of Sciences, St. Petersburg 194021 (Russian Federation); ITMO University, St. Petersburg 197101 (Russian Federation); Fitsych, O. I. [P. Sahaydachnyi Army Academy, Lviv 79012 (Ukraine); Pociask-Bialy, M.; Sheregii, E. [Center of Microelectronics and Nanotechnology, Rzeszów University, Rzeszów 35-310 (Poland); Voitsekhovskii, A. V. [National Research Tomsk State University, Tomsk 634050 (Russian Federation)

2014-04-28

332

Nanolasers grown on silicon-based MOSFETs.  

PubMed

We report novel indium gallium arsenide (InGaAs) nanopillar lasers that are monolithically grown on (100)-silicon-based functional metal-oxide-semiconductor field effect transistors (MOSFETs) at low temperature (410 °C). The MOSFETs maintain their performance after the nanopillar growth, providing a direct demonstration of complementary metal-oxide-semiconudctor (CMOS) compatibility. Room-temperature operation of optically pumped lasers is also achieved. To our knowledge, this is the first time that monolithically integrated lasers and transistors have been shown to work on the same silicon chip, serving as a proof-of-concept that such integration can be extended to more complicated CMOS integrated circuits. PMID:22714204

Lu, Fanglu; Tran, Thai-Truong D; Ko, Wai Son; Ng, Kar Wei; Chen, Roger; Chang-Hasnain, Connie

2012-05-21

333

Solar Cells  

NASA Technical Reports Server (NTRS)

The Heat Exchanger Method (HEM) produces high efficiency crystal ingots in an automated well-insulated furnace offering low equipment, labor and energy costs. The "grown" silicon crystals are used to make solar cells, or photovoltaic cells which convert sunlight directly into electricity. The HEM method is used by Crystal Systems, Inc. and was developed under a NASA/Jet Propulsion Laboratory contract. The square wafers which are the result of the process are sold to companies manufacturing solar panels.

1983-01-01

334

Magnetization dynamics of cobalt grown on graphene  

SciTech Connect

Ferromagnetic resonance (FMR) spin pumping is a rapidly growing field which has demonstrated promising results in a variety of material systems. This technique utilizes the resonant precession of magnetization in a ferromagnet to inject spin into an adjacent non-magnetic material. Spin pumping into graphene is attractive on account of its exceptional spin transport properties. This article reports on FMR characterization of cobalt grown on chemical vapor deposition graphene and examines the validity of linewidth broadening as an indicator of spin pumping. In comparison to cobalt samples without graphene, direct contact cobalt-on-graphene exhibits increased FMR linewidth—an often used signature of spin pumping. Similar results are obtained in Co/MgO/graphene structures, where a 1?nm MgO layer acts as a tunnel barrier. However, magnetometry, magnetic force microscopy, and Kerr microscopy measurements demonstrate increased magnetic disorder in cobalt grown on graphene, perhaps due to changes in the growth process and an increase in defects. This magnetic disorder may account for the observed linewidth enhancement due to effects such as two-magnon scattering or mosaicity. As such, it is not possible to conclude successful spin injection into graphene from FMR linewidth measurements alone.

Berger, A. J.; White, S. P.; Adur, R.; Pu, Y.; Hammel, P. C., E-mail: hammel@physics.osu.edu [Department of Physics, The Ohio State University, Columbus, Ohio 43210 (United States); Amamou, W. [Department of Physics and Astronomy, University of California, Riverside, California 92521 (United States); Kawakami, R. K. [Department of Physics, The Ohio State University, Columbus, Ohio 43210 (United States); Department of Physics and Astronomy, University of California, Riverside, California 92521 (United States)

2014-05-07

335

The effect of fetuin and other sialoglycoproteins on the in vitro penetration of Trypanosoma cruzi trypomastigotes into fibroblastic cells.  

PubMed

Heat-inactivated calf-, human-, and especially fetal calf serum stimulate infection of Vero cells by cell culture-derived trypomastigotes of Trypanosoma cruzi: the stimulatory effect is more marked with extracellular activated parasites or trypsinized trypomastigotes than with recently released parasites. The augmented invasion is not the consequence of a stimulation of attachment of trypomastigotes to host cells. Various sialoglycoproteins like fetuin, transferrin, fibrinogen, alpha-1-antitrypsin, mucin and goat-IgG are also effective in enhancing in vitro infectivity. Colominic acid also stimulates invasion, but other non-sialic polyanionic compounds are either ineffective (chondroitin sulfate, poly-aspartic acid) or inhibitory (heparin, phytic acid, myo-inositol hexasulfate). Fetuin, the best stimulatory compound tested, gives half-maximal activation with approximately 0.03 mg ml-1, and total activation with 0.5-1 mg ml-1. The enhancement of infectivity is time-dependent (2-3 h for maximal activation) at 37 degrees C and does not occur at 0 degrees C. Desialidated-fetuin or -fetal calf serum do not stimulate infectivity at all. Treatment with fetuin of parasites alone (or Vero cells alone), followed by removal of free fetuin and by interaction with untreated Vero cells (or parasites) indicates that the stimulation effect of fetuin occurs mainly on the trypomastigotes. No specific binding of [125I]fetuin to the parasites could be demonstrated, and incubation with exogenous neuraminidase of trypomastigotes previously activated by fetuin, reverses nearly completely the stimulation.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2437449

Piras, M M; Henríquez, D; Piras, R

1987-01-15

336

Antiviral susceptibility testing with a cell line which expresses beta-galactosidase after infection with herpes simplex virus.  

PubMed Central

Despite increasing concern about drug-resistant herpes simplex virus (HSV), antiviral susceptibility testing is not routinely performed by most clinical virology laboratories. This omission is in large part because the most widely accepted method, the plaque reduction assay (PRA), is cumbersome to perform and results are rarely available in time to influence treatment. We report here the development of a sensitivity test for HSV which utilizes a cell line (VeroICP6LacZ#7) that expresses beta-galactosidase activity after infection with HSV such that infected cells can be detected by histochemical staining. We designed an assay in which 10-fold dilutions of virus stocks with undetermined titers were inoculated onto VeroICP6LacZ#7 cells in a 24-well tissue culture dish. Forty-eight hours after infection, the cell monolayers were histochemically stained. Plaques appear blue against a clear background and are thus easily visualized at 48 h. As with the standard PRA, the 50% inhibitory concentration (IC50) was reported as the concentration of an antiviral drug that reduces the number of plaques by 50%. Evaluation of 10 well-characterized laboratory strains and 12 clinical HSV isolates showed that the IC50 determined by this method correlated in all instances with the IC50 determined by the PRA. This method is easy to use and eliminates the need to determine the titer of the virus, and results are available within 48 h of the detection of the virus. VeroICP6Lac#7 cells are a useful tool for performing HSV antiviral susceptibility testing and could be used in a number of different formats to facilitate the identification of drug-resistant isolates of HSV. PMID:7574517

Tebas, P; Stabell, E C; Olivo, P D

1995-01-01

337

Magnetic and structural properties of MBE-grown oxidic multilayers  

SciTech Connect

Multilayers composed of oxides including Fe{sub 3}O{sub 4}, Co{sub x}Fe{sub 3{minus}x}O{sub 4}, CoO, NiO and MgO have been grown epitaxially by MBE on MgO(100) single crystal substrates. These structures can be grown with a high crystallinity in the form of flat layers having sharp interfaces. RHEED studies which commonly yielded sharp streaks accompanied by Kikuchi lines show that, for instance, growth of CoO on Fe{sub 3}O{sub 4} changes the RHEED pattern form from that consistent with a spinel structure to that of a rocksalt structure within about one and a half unit cell of CoO. STM studies on a 400 {angstrom} Fe{sub 3}O{sub 4} layer displaying atomic resolution enabled us to identify the origin of the reconstruction that one commonly observes in the RHEED and LEED patterns for magnetite. Regarding important fundamental magnetic parameters, relevant thickness dependencies were mapped out using localized magneto-optical Kerr effect experiments performed on several samples that routinely included one or multiple wedge shaped layers. These studies revealed the existence of a region in the Fe{sub 3}O{sub 4} layer near the interfaces which exhibits no net magnetic moment, strain driven perpendicular orientated magnetization for the CoO/Fe{sub 3}O{sub 4}(100) and CoO/Co{sub x}Fe{sub 3{minus}x}O{sub 4}(100) bilayer systems, and information on the thickness dependence of the magnetic interlayer coupling across an MgO spacer layer.

Bloemen, P.J.H.; Heijden, P.A.A. van der; Kohlhepp, J.T.; Jonge, W.J.M. de [Eindhoven Univ. of Technology (Netherlands). Dept. of Physics; Wolf, R.M.; Stegge, J. aan de; Reinders, A.; Jungblut, R.M.; Zaag, P.J. van der [Philips Research Labs., Eindhoven (Netherlands)

1996-11-01

338

Full-grown oocytes from Xenopus laevis resume growth when placed in culture  

SciTech Connect

When most full-grown, follicle cell-invested oocytes from Xenopus laevis are placed in an appropriate culture medium, they resume growth and remain physiologically healthy for at least 2 to 3 weeks. Rates of growth by full-grown oocytes in vitro generally approximate and can even exceed the most rapid growth rate achieved by vitellogenic oocytes in vivo. Resumption of oocyte growth can be correlated with the loss of investing follicle cells, which under normal conditions appear to interfere with vitellogenin and nutrient access to the oocyte. The final size reached by the oocyte within the ovary is thus not an intrinsic property of the oocyte but is extrinsically imposed by the somatic environment.

Wallace, R.A.; Misulovin, Z.; Etkin, L.D.

1981-05-01

339

Ectopic mineralized cartilage formation in human undifferentiated pancreatic adenocarcinoma explants grown in nude mice  

Microsoft Academic Search

Mineralized as well as nonmineralized cartilage-like structures enclosing cells resembling chondrocytes were found in human-derived undifferentiated but not in poorly differentiated pancreatic adenocarcinoma explants grown in nude mice. The structures reacted with anti-mouse IgG but not with antibodies against human cytokeratin 19, indicating that the newly formed tissue was of mouse origin. High activity of alkaline phosphatase was found in

C. J. F. Van Noorden; G. N. Jonges; I. M. C. Vogels; K. A. Hoeben; B. Van Urk; V. Everts

1995-01-01

340

Oxidation of Methyl tert-Butyl Ether by Alkane Hydroxylase in Dicyclopropylketone-Induced and n-Octane-Grown Pseudomonas putida GPo1  

PubMed Central

The alkane hydroxylase enzyme system in Pseudomonas putida GPo1 has previously been reported to be unreactive toward the gasoline oxygenate methyl tert-butyl ether (MTBE). We have reexamined this finding by using cells of strain GPo1 grown in rich medium containing dicyclopropylketone (DCPK), a potent gratuitous inducer of alkane hydroxylase activity. Cells grown with DCPK oxidized MTBE and generated stoichiometric quantities of tert-butyl alcohol (TBA). Cells grown in the presence of DCPK also oxidized tert-amyl methyl ether but did not appear to oxidize either TBA, ethyl tert-butyl ether, or tert-amyl alcohol. Evidence linking MTBE oxidation to alkane hydroxylase activity was obtained through several approaches. First, no TBA production from MTBE was observed with cells of strain GPo1 grown on rich medium without DCPK. Second, no TBA production from MTBE was observed in DCPK-treated cells of P. putida GPo12, a strain that lacks the alkane-hydroxylase-encoding OCT plasmid. Third, all n-alkanes that support the growth of strain GPo1 inhibited MTBE oxidation by DCPK-treated cells. Fourth, two non-growth-supporting n-alkanes (propane and n-butane) inhibited MTBE oxidation in a saturable, concentration-dependent process. Fifth, 1,7-octadiyne, a putative mechanism-based inactivator of alkane hydroxylase, fully inhibited TBA production from MTBE. Sixth, MTBE-oxidizing activity was also observed in n-octane-grown cells. Kinetic studies with strain GPo1 grown on n-octane or rich medium with DCPK suggest that MTBE-oxidizing activity may have previously gone undetected in n-octane-grown cells because of the unusually high Ks value (20 to 40 mM) for MTBE. PMID:15294784

Smith, Christy A.; Hyman, Michael R.

2004-01-01

341

Oxidation of methyl tert-butyl ether by alkane hydroxylase in dicyclopropylketone-induced and n-octane-grown Pseudomonas putida GPo1.  

PubMed

The alkane hydroxylase enzyme system in Pseudomonas putida GPo1 has previously been reported to be unreactive toward the gasoline oxygenate methyl tert-butyl ether (MTBE). We have reexamined this finding by using cells of strain GPo1 grown in rich medium containing dicyclopropylketone (DCPK), a potent gratuitous inducer of alkane hydroxylase activity. Cells grown with DCPK oxidized MTBE and generated stoichiometric quantities of tert-butyl alcohol (TBA). Cells grown in the presence of DCPK also oxidized tert-amyl methyl ether but did not appear to oxidize either TBA, ethyl tert-butyl ether, or tert-amyl alcohol. Evidence linking MTBE oxidation to alkane hydroxylase activity was obtained through several approaches. First, no TBA production from MTBE was observed with cells of strain GPo1 grown on rich medium without DCPK. Second, no TBA production from MTBE was observed in DCPK-treated cells of P. putida GPo12, a strain that lacks the alkane-hydroxylase-encoding OCT plasmid. Third, all n-alkanes that support the growth of strain GPo1 inhibited MTBE oxidation by DCPK-treated cells. Fourth, two non-growth-supporting n-alkanes (propane and n-butane) inhibited MTBE oxidation in a saturable, concentration-dependent process. Fifth, 1,7-octadiyne, a putative mechanism-based inactivator of alkane hydroxylase, fully inhibited TBA production from MTBE. Sixth, MTBE-oxidizing activity was also observed in n-octane-grown cells. Kinetic studies with strain GPo1 grown on n-octane or rich medium with DCPK suggest that MTBE-oxidizing activity may have previously gone undetected in n-octane-grown cells because of the unusually high K(s) value (20 to 40 mM) for MTBE. PMID:15294784

Smith, Christy A; Hyman, Michael R

2004-08-01

342

Cells  

NSDL National Science Digital Library

In this unit, students look at the components of cells and their functions and discover the controversy behind stem cell research. The first lesson focuses on the difference between prokaryotic and eukaryotic cells. In the second lesson, students learn about the basics of cellular respiration. They also learn about the application of cellular respiration to engineering and bioremediation. The third lesson continues students' education on cells in the human body and how (and why) engineers are involved in the research of stem cell behavior.

Integrated Teaching And Learning Program

343

Perfect crystals grown from imperfect interfaces  

PubMed Central

The fabrication of advanced devices increasingly requires materials with different properties to be combined in the form of monolithic heterostructures. In practice this means growing epitaxial semiconductor layers on substrates often greatly differing in lattice parameters and thermal expansion coefficients. With increasing layer thickness the relaxation of misfit and thermal strains may cause dislocations, substrate bowing and even layer cracking. Minimizing these drawbacks is therefore essential for heterostructures based on thick layers to be of any use for device fabrication. Here we prove by scanning X-ray nanodiffraction that mismatched Ge crystals epitaxially grown on deeply patterned Si substrates evolve into perfect structures away from the heavily dislocated interface. We show that relaxing thermal and misfit strains result just in lattice bending and tiny crystal tilts. We may thus expect a new concept in which continuous layers are replaced by quasi-continuous crystal arrays to lead to dramatically improved physical properties. PMID:23880632

Falub, Claudiu V.; Medu?a, Mojmír; Chrastina, Daniel; Isa, Fabio; Marzegalli, Anna; Kreiliger, Thomas; Taboada, Alfonso G.; Isella, Giovanni; Miglio, Leo; Dommann, Alex; von Känel, Hans

2013-01-01

344

Hexagonal boron nitride grown by MOVPE  

NASA Astrophysics Data System (ADS)

Hexagonal boron nitride (h-BN) has a potential for optical device applications in the deep ultraviolet spectral region. For several decades, only amorphous and turbostratic boron nitride (BN) films had been grown by chemical vapor deposition and metalorganic vapor phase epitaxy. By introducing flow-rate modulation epitaxy (FME), which enables us to reduce parasitic reactions and lower the optimal growth temperature, we have succeeded in growing single-phase h-BN epitaxial films on nearly lattice-matched (1 1 1) Ni substrates. The h-BN epitaxial films exhibit near-band-gap ultraviolet luminescence at a wavelength of 227 nm in cathodoluminescence at room temperature. The combination of FME and the lattice-matched substrate paves the way for the epitaxial growth of high-quality h-BN.

Kobayashi, Y.; Akasaka, T.; Makimoto, T.

2008-11-01

345

Humidity sensing by fractally grown nanocomposites  

NASA Astrophysics Data System (ADS)

Fractal structure of ?-iron was grown within gel-derived silica films. These were subjected to oxidation treatments at a temperature of 400K for durations varying from 1to4h. Nanoshells of Fe3O4 up to a thickness of 2nm were formed in the process. The electrical resistivity of these nanocomposites was shown to arise due to a small polaron hopping mechanism between Fe2+ and Fe3+ sites. The nanocomposite films exhibited about three to four orders-of-magnitude resistivity change for an increase of relative humidity from 35% to 95%. The decrease was found to be exponential in nature and is believed to arise due to the injection of electrons to the oxide nanoshell.

Pal, B. N.; Basu, S.; Chakravorty, D.

2005-02-01

346

The virion N protein of infectious bronchitis virus is more phosphorylated than the N protein from infected cell lysates  

SciTech Connect

Because phosphorylation of the infectious bronchitis virus (IBV) nucleocapsid protein (N) may regulate its multiple roles in viral replication, the dynamics of N phosphorylation were examined. {sup 32}P-orthophosphate labeling and Western blot analyses confirmed that N was the only viral protein that was phosphorylated. Pulse labeling with {sup 32}P-orthophosphate indicated that the IBV N protein was phosphorylated in the virion, as well as at all times during infection in either chicken embryo kidney cells or Vero cells. Pulse-chase analyses followed by immunoprecipitation of IBV N proteins using rabbit anti-IBV N polyclonal antibody demonstrated that the phosphate on the N protein was stable for at least 1 h. Simultaneous labeling with {sup 32}P-orthophosphate and {sup 3}H-leucine identified a 3.5-fold increase in the {sup 32}P:{sup 3}H counts per minute (cpm) ratio of N in the virion as compared to the {sup 32}P:{sup 3}H cpm ratio of N in the cell lysates from chicken embryo kidney cells, whereas in Vero cells the {sup 32}P:{sup 3}H cpm ratio of N from the virion was 10.5-fold greater than the {sup 32}P:{sup 3}H cpm ratio of N from the cell lysates. These studies are consistent with the phosphorylation of the IBV N playing a role in assembly or maturation of the viral particle.

Jayaram, Jyothi [Department of Veterinary Pathobiology, Texas A and M University, College Station, TX 77843-4467 (United States); Department of Biology, Texas A and M University, College Station, TX 77843-3258 (United States); Youn, Soonjeon [Department of Veterinary Pathobiology, Texas A and M University, College Station, TX 77843-4467 (United States); Collisson, Ellen W. [Department of Veterinary Pathobiology, Texas A and M University, College Station, TX 77843-4467 (United States)]. E-mail: ecollisson@cvm.tamu.edu

2005-08-15

347

Cell death in relation to DNA damage after exposure to the jellyfish Pelagia noctiluca nematocysts.  

PubMed

Studies on the toxicity of Mediterranean jellyfish have gained attention owing to their weak toxic properties. Our research has been mainly performed on the Scyphomedusae. Pelagia noctiluca is a scyphozoan jellyfish which causes a danger to sea bathers and fishery damages in the Mediterranean Sea. To check whether the cytotoxicity of Pelagia noctiluca nematocysts was associated to DNA lesions, we have looked for DNA fragmentation by means of the Comet and chromosome aberration assays. To specify cell death pathway, we have investigated caspase-3 activation. Our results have shown that nematocysts reduced cell viability and induced DNA fragmentation in a concentration-dependent manner with a maximum effect at 150 000 nematocysts mL(-1). The high percentage of chromosome aberrations also emphasized the genotoxic character of Pelagia noctiluca nematocysts in Vero cells. This fragmentation was correlated to apoptosis induction which was confirmed by caspase-3 activation. In conclusion, the present report has suggested that Pelagia noctiluca nematocysts were able to promote apoptosis in Vero cells and therefore may be useful in cancer therapy. PMID:22331667

Ayed, Yosra; Bouaziz, Chayma; Brahmi, Dalel; Zaid, Chiraz; Abid, Salwa; Bacha, Hassen

2014-03-01

348

Effect of Ottoman Viper (Montivipera xanthina (Gray, 1849)) Venom on Various Cancer Cells and on Microorganisms.  

PubMed

Cytotoxic and antimicrobial effects of Montivipera xanthina venom against LNCaP, MCF-7, HT-29, Saos-2, Hep3B, Vero cells and antimicrobial activity against selected bacterial and fungal species: Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 25922, E. coli O157H7, Enterococcus faecalis 29212, Enterococcus faecium DSM 13590, Staphylococcus epidermidis ATCC 12228, S. typhimirium CCM 5445, Proteus vulgaris ATCC 6957 and Candida albicans ATCC 10239 were studied for evaluating the potential medical benefit of this snake venom. Cytotoxicity of venom was determined using MTT assay. Snake venom cytotoxicity was expressed as the venom dose that killed 50 % of the cells (IC50). The antimicrobial activity of venom was studied by minimal inhibitory concentration (MIC) and disc diffusion assay. MIC was determined using broth dilution method. The estimated IC50 values of venom varied from 3.8 to 12.7 or from 1.9 to 7.2 ?g/ml after treatment with crude venom for 24 or 48 h for LNCaP, MCF-7, HT-29 and Saos-2 cells. There was no observable cytotoxic effect on Hep3B and Vero cells. Venom exhibited the most potent activity against C. albicans (MIC, 7.8 ?g/ml and minimal fungicidal concentration, 62.5 ?g/ml) and S. aureus (MIC, 31.25 ?g/ml). This study is the first report showing the potential of M. xanthina venom as an alternative therapeutic approach due to its cytotoxic and antimicrobial effects. PMID:23381026

Yalc?n, Husniye Tansel; Ozen, Mehmet Ozgün; Gocmen, Bayram; Nalbantsoy, Ayse

2014-01-01

349

Variation in Western Equine Encephalomyelitis Viral Strain Growth in Mammalian, Avian, and Mosquito Cells Fails to Explain Temporal Changes in Enzootic and Epidemic Activity in California  

PubMed Central

Abstract The decrease in western equine encephalomyelitis virus (WEEV; Togaviridae, Alphavirus) activity in North America over the past 20–30 years has prompted research to determine if there have been concurrent declines in virulence. Six (WEEV) strains isolated from Culex tarsalis mosquitoes from California during each of the six preceding decades failed to show a consistent declining temporal trend in virus titer using mosquito (C6/36), avian (duck embryo fibroblast), or mammalian (Vero) cells, results similar to our recent in vivo studies using birds and mosquitoes. Titers measured by Vero cell plaque assay were consistently highest on mosquito cell culture, followed by avian and mammalian cell cultures. Similar to previous in vivo results in house sparrows and mice, titers for the IMP181 strain isolated in 2005 were significantly lower in both avian and mammalian cells. Real-time monitoring of changes in cell growth measured by electrical impedance showed consistent differences among cell types, but not WEEV strains. Collectively, these in vitro results failed to explain the decrease in WEEV enzootic and epidemic activity. Results with the IMP181 strain should be verified by additional sequencing, cell growth, and pathogenesis studies using concurrent or 2006 isolates of WEEV from California. PMID:21395409

Zhang, Miaotao; Fang, Ying; Brault, Aaron C.

2011-01-01

350

Clostridium perfringens iota toxin: characterization of the cell-associated iota b complex.  

PubMed Central

Clostridium perfringens type E iota toxin consists of two unlinked proteins designated as iota a (Ia; molecular mass approximately 47 kDa), an ADP-ribosyltransferase and iota b (Ib; molecular mass approximately 81 kDa) which binds to the cell surface and facilitates Ia entry into the cytosol. By Western-blot analysis, Ib incubated with Vero cells at 37 degrees C generated a cell-associated, SDS-insoluble oligomer of Ib (molecular mass>220 kDa) within 15 s, which was still evident 110 min after washing cells. Ib oligomerization was temperature, but not pH, dependent and was facilitated by a cell-surface protein(s). Within 5 min at 37 degrees C, cell-bound Ib generated Na(+)/K(+) permeable channels that were blocked by Ia. However, Ib-induced channels or oligomers were not formed at 4 degrees C. Two monoclonal antibodies raised against Ib that recognize unique, neutralizing epitopes within residues 632-655 either inhibited Ib binding to cells and/or oligomerization, unlike a non-neutralizing monoclonal antibody that binds within Ib residues 28-66. The Ib protoxin (molecular mass approximately 98 kDa), which does not facilitate iota cytotoxicity but binds to Vero cells, did not oligomerize or form ion-permeable channels on cells, and neither trypsin nor chymotrypsin treatment of cell-bound Ib protoxin induced large complex formation. The link between Ib oligomers and iota toxicity was also apparent with a resistant cell line (MRC-5), which bound to Ib with no evidence of oligomerization. Overall, these studies revealed that the biological activity of iota toxin is dependent on a long-lived, cell-associated Ib complex that rapidly forms ion-permeable channels in cell membranes. These results further reveal the similarities of C. perfringens iota toxin with other bacterial binary toxins produced by Bacillus anthracis and C. botulinum. PMID:12175336

Stiles, Bradley G; Hale, Martha L; Marvaud, Jean Christophe; Popoff, Michel R

2002-01-01

351

Parallel determination of enzyme activities and in vivo fluxes in Brassica napus embryos grown on organic or inorganic nitrogen source  

Microsoft Academic Search

After the completion of the genomic sequencing of model organisms, numerous post-genomic studies, integrating transcriptome and metabolome data, are aimed at developing a more complete understanding of cell physiology. Here, we measure in vivo metabolic fluxes by steady state labeling, and in parallel, the activity of enzymes in central metabolism in cultured developing embryos of Brassica napus. Embryos were grown

Björn H. Junker; Joachim Lonien; Lindsey E. Heady; Alistair Rogers; Jörg Schwender

2007-01-01

352

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction-positive wild bird surveillance samples.  

PubMed

Virus isolation rates for influenza A virus (FLUAV) and Avian paramyxovirus serotype 1 (APMV-1) from wild bird surveillance samples are lower than molecular detection rates for the specific viral genomes. The current study was conducted to examine the possibility of increased virus isolation rates from real-time reverse transcription polymerase chain reaction (real-time RT-PCR) using alternative virus isolation substrates such as embryonating duck eggs (EDEs), embryonating turkey eggs (ETEs), Madin-Darby canine kidney (MDCK) cell cultures, and African green monkey kidney (Vero) cell cultures. Rectal swabs of birds in the orders Anseriformes and Charadriiformes were tested by real-time RT-PCR for the presence of FLUAV and APMV-1 genomes, and virus isolation (VI) was attempted on all real-time RT-PCR-positive samples. Samples with threshold cycle (Ct) ? 37 had VI rates for FLUAV of 62.5%, 50%, 43.8%, 31.5%, and 31.5% in embryonating chicken eggs (ECEs), ETEs, EDEs, MDCK cells, and Vero cells, respectively. A higher isolation rate was seen with ECEs compared to either cell culture method, but similar isolation rates were identified between the different embryonating avian eggs. Virus isolation rates for APMV-1 on samples with real-time RT-PCR Ct ? 37 were 75%, 100%, 100%, 0%, and 37.5% in ECEs, ETEs, EDEs, MDCK cells, and Vero cells, respectively. Significantly higher VI rates were seen with ECEs as compared to either cell culture method for all real-time RT-PCR-positive samples. Because of the limited availability and high cost of ETEs and EDEs, the data support the continuing usage of ECEs for primary isolation of both FLUAV and APMV-1 from real-time RT-PCR-positive wild bird surveillance samples. PMID:22529126

Moresco, Kira A; Stallknecht, David E; Swayne, David E

2012-05-01

353

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method  

PubMed Central

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 ?L and 50 ?L of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes. PMID:24516442

Khan, J.A.; Rathore, R.S.; Khan, S.; Ahmad, I.

2013-01-01

354

Phyllosphere Microbiota Composition and Microbial Community Transplantation on Lettuce Plants Grown Indoors  

PubMed Central

ABSTRACT The aerial surfaces of plants, or phyllosphere, are microbial habitats important to plant and human health. In order to accurately investigate microbial interactions in the phyllosphere under laboratory conditions, the composition of the phyllosphere microbiota should be representative of the diversity of microorganisms residing on plants in nature. We found that Romaine lettuce grown in the laboratory contained 10- to 100-fold lower numbers of bacteria than age-matched, field-grown lettuce. The bacterial diversity on laboratory-grown plants was also significantly lower and contained relatively higher proportions of Betaproteobacteria as opposed to the Gammaproteobacteria-enriched communities on field lettuce. Incubation of field-grown Romaine lettuce plants in environmental growth chambers for 2 weeks resulted in bacterial cell densities and taxa similar to those on plants in the field but with less diverse bacterial populations overall. In comparison, the inoculation of laboratory-grown Romaine lettuce plants with either freshly collected or cryopreserved microorganisms recovered from field lettuce resulted in the development of a field-like microbiota on the lettuce within 2 days of application. The survival of an inoculated strain of Escherichia coli O157:H7 was unchanged by microbial community transfer; however, the inoculation of E. coli O157:H7 onto those plants resulted in significant shifts in the abundance of certain taxa. This finding was strictly dependent on the presence of a field-associated as opposed to a laboratory-associated microbiota on the plants. Phyllosphere microbiota transplantation in the laboratory will be useful for elucidating microbial interactions on plants that are important to agriculture and microbial food safety. PMID:25118240

Williams, Thomas R.

2014-01-01

355

78 FR 45898 - Vidalia Onions Grown in Georgia; Continuance Referendum  

Federal Register 2010, 2011, 2012, 2013, 2014

...AMS-FV-13-0037; FV13-955-2 CR] Vidalia Onions Grown in Georgia; Continuance Referendum...conducted among eligible producers of Vidalia onions grown in Georgia to determine whether...that regulates the handling of Vidalia onions produced in the production area....

2013-07-30

356

78 FR 77367 - Almonds Grown in California; Continuance Referendum  

Federal Register 2010, 2011, 2012, 2013, 2014

...AMS-FV-13-0082; FV14-981-1 CR] Almonds Grown in California; Continuance Referendum...be conducted among eligible growers of almonds in California to determine whether they...marketing order that regulates the handling of almonds grown in California. DATES: The...

2013-12-23

357

76 FR 16323 - Irish Potatoes Grown in Washington; Continuance Referendum  

Federal Register 2010, 2011, 2012, 2013, 2014

...AMS-FV-11-0010; FV11-946-1 CR] Irish Potatoes Grown in Washington; Continuance Referendum...be conducted among eligible Washington potato growers to determine whether they favor...order regulating the handling of Irish potatoes grown in Washington. DATES: The...

2011-03-23

358

Quality characteristics of the radish grown under reduced atmospheric pressure  

Microsoft Academic Search

This study addresses whether reduced atmospheric pressure (hypobaria) affects the quality traits of radish grown under such environments. Radish (Raphanus sativus L. cv. Cherry Bomb Hybrid II) plants were grown hydroponically in specially designed hypobaric plant growth chambers at three atmospheric pressures; 33, 66, and 96 kPa (control). Oxygen and carbon dioxide partial pressures were maintained constant at 21 and

Lanfang H. Levine; Patricia A. Bisbee; Jeffrey T. Richards; Michele N. Birmele; Ronald L. Prior; Michele Perchonok; Mike Dixon; Neil C. Yorio; Gary W. Stutte; Raymond M. Wheeler

2008-01-01

359

Bacteriological quality of organically grown leaf lettuce in Norway  

Microsoft Academic Search

S. LONCAREVIC, G.S. JOHANNESSEN AND L.M. RØRVIK. 2005. Aim: To investigate bacteriological quality in organically grown leaf lettuce, including the presence of selected pathogenic bacteria, and to obtain information about organic lettuce production, including fertilizing regimes. Methods and Results: Altogether 179 samples of Norwegian organically grown lettuce were collected from 12 producers. Escherichia coli was isolated from 16 of the

S. Loncarevic; G. S. Johannessen; L. M. Rorvik

2005-01-01

360

14CO2 Fixation, Glutamate Labeling, and the Krebs Cycle in Ribose-grown Hydrogenomonas facilis  

PubMed Central

Exposure of ribose-grown Hydrogenomonas facilis to 14CO2 for 6 to 12 sec during ribose oxidation resulted in labeling of a number of compounds, three of which were glutamate, phosphoglycerate, and pyruvate. Phosphoglycerate and pyruvate were labeled almost exclusively in C1, suggesting operation of the reductive pentose phosphate cycle. Glutamate was labeled initially to the extent of 90% in C1 and 10% in C5, and this was followed by a concentration of radioisotope in C5. All of the enzymes of the tricarboxylic acid cycle were detectable in ribose-grown cells, and, in general, specific activities were similar to those found in yeast extract-grown cells. Reduced nicotinamide adenine dinucleotide oxidase, aconitase, and the dehydrogenases for pyruvate, ?-ketoglutarate, and succinate appeared to be of particulate origin. In addition to enzymes of the tricarboxylic acid cycle, an acetyl coenzyme A-stimulated phosphoenolpyruvate carboxylase was found, as was isocitrate lyase. Possible participation of these catalysts in glutamate synthesis is discussed. PMID:16562153

McFadden, Bruce A.; Kuehn, Glenn D.; Homann, H. Robert

1967-01-01

361

Secretomic survey of Trichoderma harzianum grown on plant biomass substrates.  

PubMed

The present work aims at characterizing T. harzianum secretome when the fungus is grown in synthetic medium supplemented with one of the four substrates: glucose, cellulose, xylan, and sugarcane bagasse (SB). The characterization was done by enzymatic assays and proteomic analysis using 2-DE/MALDI-TOF and gel-free shotgun LC-MS/MS. The results showed that SB induced the highest cellulolytic and xylanolytic activities when compared with the other substrates, while remarkable differences in terms of number and distribution of protein spots in 2-DE gels were also observed among the samples. Additionally, treatment of the secretomes with PNGase F revealed that most spot trails in 2-DE gels corresponded to N-glycosylated proteoforms. The LC-MS/MS analysis of the samples identified 626 different protein groups, including carbohydrate-active enzymes and accessory, noncatalytic, and cell-wall-associated proteins. Although the SB-induced secretome displayed the highest cellulolytic and xylanolytic activities, it did not correspond to a higher proteome complexity because CM-cellulose-induced secretome was significantly more diverse. Among the identified proteins, 73% were exclusive to one condition, while only 5% were present in all samples. Therefore, this study disclosed the variation of T. harzianum secretome in response to different substrates and revealed the diversity of the fungus enzymatic toolbox. PMID:24593137

Gómez-Mendoza, Diana Paola; Junqueira, Magno; do Vale, Luis Henrique Ferreira; Domont, Gilberto Barbosa; Ferreira Filho, Edivaldo Ximenes; Sousa, Marcelo Valle de; Ricart, Carlos André Ornelas

2014-04-01

362

Cell cultures of the wild sunflower Helianthus maximiliani schrader: growth and secondary metabolite synthesis.  

PubMed

Callus cultures derived from leaves, stem, sepals and ray flowers and cell suspension cultures of Helianthus maximiliani Schrader were established and analysed for their phytochemicals. Dark-grown cultures were found to synthesize small amounts of non-toxic, polycyclic diterpenoids when grown on modified MS-medium, while ?-sitosterol and palmitic acid were found in dark- and light-grown cultures. Red light irradiation did not enhance terpenoid production compared to dark- and light-grown cells. PMID:24241598

Roewer, I; Mabry, T J

1988-05-01

363

Schmallenberg virus challenge models in cattle: infectious serum or culture-grown virus?  

PubMed Central

Schmallenberg virus (SBV), discovered in Europe in 2011, causes mild transient disease in adult ruminants, but fetal infection can lead to severe malformation in cattle, sheep and goats. To elucidate the pathogenesis of this novel orthobunyavirus, considerable efforts are required. A reliable and standardized infection model is essential for in vivo studies. In the present study, two groups of four cattle were inoculated with either serum passaged in cattle only or cell culture-grown virus. The replication of culture-grown SBV in cattle was reduced compared to virus inoculated via infectious serum. In a second experiment, the infectious serum was titrated in calves; the tested batch contained 102.83 infectious doses per mL. Hence, serum-borne virus that was only passaged in the natural host is a suitable option for a standardized SBV infection model. PMID:23231006

2012-01-01

364

VHL Induces Renal Cell Differentiation and Growth Arrest through Integration of Cell-Cell and Cell-Extracellular Matrix Signaling  

PubMed Central

Mutations in the von Hippel-Lindau (VHL) gene are involved in the family cancer syndrome for which it is named and the development of sporadic renal cell cancer (RCC). Reintroduction of VHL into RCC cells lacking functional VHL [VHL(?)] can suppress their growth in nude mice, but not under standard tissue culture conditions. To examine the hypothesis that the tumor suppressor function of VHL requires signaling through contact with extracellular matrix (ECM), 786-O VHL(?) RCC cells and isogenic sublines stably expressing VHL gene products [VHL(+)] were grown on ECMs. Cell-cell and cell-ECM signalings were required to elicit VHL-dependent differences in growth and differentiation. VHL(+) cells differentiated into organized epithelial sheets, whereas VHL(?) cells were branched and disorganized. VHL(+) cells grown to high density on collagen I underwent growth arrest, whereas VHL(?) cells continued to proliferate. Integrin levels were up-regulated in VHL(?) cells, and cell adhesion was down-regulated in VHL(+) cells during growth at high cell density. Hepatocyte nuclear factor 1?, a transcription factor and global activator of proximal tubule-specific genes in the nephron, was markedly up-regulated in VHL(+) cells grown at high cell density. These data indicate that VHL can induce renal cell differentiation and mediate growth arrest through integration of cell-cell and cell-ECM signals. PMID:11154273

Davidowitz, Eliot J.; Schoenfeld, Alan R.; Burk, Robert D.

2001-01-01

365

A role for pectin de-methylesterification in a developmentally regulated growth acceleration in dark-grown Arabidopsis hypocotyls.  

PubMed

• We focused on a developmentally regulated growth acceleration in the dark-grown Arabidopsis hypocotyl to study the role of changes in cell wall metabolism in the control of cell elongation. • To this end, precise transcriptome analysis on dissected dark-grown hypocotyls, Fourier transform infrared (FT-IR) microspectroscopy and kinematic analysis were used. • Using a cellulose synthesis inhibitor, we showed that the growth acceleration marks a developmental transition during which growth becomes uncoupled from cellulose synthesis. We next investigated the cellular changes that take place during this transition. FT-IR microspectroscopy revealed significant changes in cell wall composition during, but not after, the growth acceleration. Transcriptome analysis suggested a role for cell wall remodeling, in particular pectin modification, in this growth acceleration. This was confirmed by the overexpression of a pectin methylesterase inhibitor, which caused a delay in the growth acceleration. • This study shows that the acceleration of cell elongation marks a developmental transition in dark-grown hypocotyl cells and supports a role for pectin de-methylesterification in the timing of this event. PMID:20819179

Pelletier, Sandra; Van Orden, Jürgen; Wolf, Sebastian; Vissenberg, Kris; Delacourt, Julien; Ndong, Yves Assoumou; Pelloux, Jérôme; Bischoff, Volker; Urbain, Aurélie; Mouille, Grégory; Lemonnier, Gaëtan; Renou, Jean-Pierre; Höfte, Herman

2010-11-01

366

POSITIONING AND ORIENTATION OF ADHERENT CELLS IN A MICROFLUIDIC CHIP USING THE MICRO PATTERNING OF  

E-print Network

-C, living cells, micro patterning, cell positioning, biodevice. Abstract: A new biochip for adherent cell of biochip surfaces. In this way, cells are grown directly on-chip. Current approaches use parylene

Paris-Sud XI, Université de

367

Variations in the first steps of photosynthesis for the diatom Cyclotella meneghiniana grown under different light conditions.  

PubMed

In this work we have applied picosecond and steady-state fluorescence measurements to study excitation energy transfer and trapping in intact Cyclotella meneghiniana diatom cells grown at different light intensities. Different excitation and detection wavelengths were used to discriminate between Photosystem I and II (PSI and PSII) kinetics and to study excitation energy transfer from the outer antenna to the core of PSI and PSII. It is found that the light-harvesting fucoxanthin chlorophyll proteins (FCPs) transfer their excitation energy predominantly to PSII. It is also observed that the PSII antenna is slightly richer in red-absorbing fucoxanthin than the FCPs associated with PSI. The average excitation trapping time in PSI is around 75 ps whereas this time is around 450 ps for PSII in cells grown in 20 ?mol of photons per m(2) per s. The latter time decreases to 425 ps for 50 ?mol of photons and 360 ps for 140 ?mol of photons. It is concluded that cells grown under higher photon flux densities have a smaller antenna size than the ones grown in low light. At the same time, the increase of growth light intensity leads to a decrease of the relative amount of PSI. This effect is accompanied by a substantial increase in the amount of chlorophyll a that is not active in excitation energy transfer and most probably attached to inactivated/disassembled PSII units. PMID:23036902

Chukhutsina, V U; Büchel, C; van Amerongen, H

2013-01-01

368

Synthesis of protein-coated gelatin microspheres and their use as microcarriers for cell culture. Part I. Derivatization with native collagen.  

PubMed

A novel technique for the synthesis of native collagen (type I)-coated gelatin microspheres was developed using the emulsion-polymerization principle, which is realized in four steps: emulsification, separation, stabilization, and protein modification. A 20% gelatin solution was emulsified in sunflower oil and the resulting beads were polymerized with glutaraldehyde. The novelty of our technique consists in the protein modification step, where we derivatized the beads by saturation of the free aldehyde groups on the cross-linked gelatin in the native collagen solution (0.3 mg/ml in 0.05 M Tris, pH 8.6) and further stabilized the beads with sodium borohydride. The resulting microspheres exhibited excellent properties as microcarriers for in vitro cell culturing using Vero cells as the model system. In comparison with pure gelatin beads, the cells attached more rapidly and grew faster on native collagen-coated beads. Approximately 90% of the Vero cells attached to the microcarrier after 1 h. After a lag period of nearly 24 h, the cells began to grow rapidly and reached confluence for 4-5 days, whereas the cells on pure gelatin beads reached the same density about 1 or 2 days later. PMID:2054334

Altankov, G; Brodvarova, I; Rashkov, I

1991-01-01

369

Comparative evaluation of three tests for the detection of Escherichia coli cytotoxic necrotizing factors (CNF1 and CNF2) using filtrates of cultures treated with mitomycin C.  

PubMed

Necrotizing Escherichia coli (NTEC) strains grown in the presence of mitomycin C released cell associated necrotizing factors CNF1 and CNF2 to culture medium. Using culture filtrates from 96 mitomycin C treated E. coli strains, we have found that a modified HeLa cell assay was a more sensitive and specific method for the detection of CNF1 and CNF2 than the Vero cell assay and the rabbit skin test. PMID:2120109

Blanco, J; Blanco, M; González, E A; Alonso, M P; Garabal, J I

1990-06-01

370

Heart tissue grown in NASA Bioreactor  

NASA Technical Reports Server (NTRS)

Lisa Freed and Gordana Vunjak-Novakovic, both of the Massachusetts Institute of Technology (MIT), have taken the first steps toward engineering heart muscle tissue that could one day be used to patch damaged human hearts. Cells isolated from very young animals are attached to a three-dimensional polymer scaffold, then placed in a NASA bioreactor. The cells do not divide, but after about a week start to cornect to form a functional piece of tissue. Functionally connected heart cells that are capable of transmitting electrical signals are the goal for Freed and Vunjak-Novakovic. Electrophysiological recordings of engineered tissue show spontaneous contractions at a rate of 70 beats per minute (a), and paced contractions at rates of 80, 150, and 200 beats per minute respectively (b, c, and d). The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Credit: NASA and MIT.

2001-01-01

371

Rickettsial phospholipase A2 as a pathogenic mechanism in a model of cell injury by typhus and spotted fever group rickettsiae.  

PubMed

Phospholipase A2 activity by typhus group rickettsiae causes hemolysis in vitro. Rickettsial phospholipase A2 has been proposed to mediate entry into the host cell, escape from the phagosome, and cause injury to host cells by both typhus and spotted fever group rickettsiae. In a rickettsial contact-associated cytotoxicity model, the interaction of Rickettsia prowazekii or R. conorii with Vero cells caused temperature-dependent release of 51Cr from the cells. Treatment of rickettsiae, but not the cells, with a phospholipase A2 inhibitor (bromophenacyl bromide) or with antibody to king cobra venom inhibited cell injury. Rickettsial treatment with bromophenacyl bromide inhibited the release of free fatty acids from the host cell. Neither the inhibitor nor antivenom impaired rickettsial active transport of L-lysine. Thus, host cell injury was mediated by a rickettsial phospholipase A2-dependent mechanism. PMID:11792002

Walker, D H; Feng, H M; Popov, V L

2001-12-01

372

Localization of cytochromes to the outer membrane of anaerobically grown Shewanella putrefaciens MR-1.  

PubMed Central

In gram-negative bacteria, numerous cell functions, including respiration-linked electron transport, have been ascribed to the cytoplasmic membrane. Gram-negative bacteria which use solid substrates (e.g., oxidized manganese or iron) as terminal electron acceptors for anaerobic respiration are presented with a unique problem: they must somehow establish an electron transport link across the outer membrane between large particulate metal oxides and the electron transport chain in the cytoplasmic membrane. When the metal-reducing bacterium Shewanella putrefaciens MR-1 is grown under anaerobic conditions and membrane fractions are purified from cells lysed by an EDTA-lysozyme-polyoxyethylene cetyl ether (Brij 58) protocol, approximately 80% of its membrane-bound cytochromes are localized in its outer membrane. These outer membrane cytochromes could not be dislodged by treatment with chaotropic agents or by increased concentrations of the nonionic detergent Brij 58, suggesting that they are integral membrane proteins. Cytochrome distribution in cells lysed by a French press protocol confirm the localization of cytochromes to the outer membrane of anaerobically grown cells. This novel cytochrome distribution could play a key role in the anaerobic respiratory capabilities of this bacterium, especially in its ability to mediate manganese and iron reduction. Images PMID:1592800

Myers, C R; Myers, J M

1992-01-01

373

Effect of dilution rate on lipopolysaccharide and serum resistance of Neisseria gonorrhoeae grown in continuous culture.  

PubMed Central

Growth of Neisseria gonorrhoeae strain FA171 in continuous culture under glucose-limiting conditions resulted in a growth-rate-dependent change in the lipopolysaccharide (LPS). The evidence for this change is an alteration in the mobility of purified alkali-treated LPS on sodium dodecyl sulfate-polyacrylamide gels and a quantitative difference in the amount of the LPS serotype antigen. The LPS from cells grown at a low dilution rate (0.12 h-1) contained ca. eightfold less serotype antigen than the LPS from cells grown at a high dilution rate (0.56 h-1). The decrease in LPS serotype antigen was associated with an increase in sensitivity to the bactericidal activity of normal human serum and an increase in cell surface hydrophobicity. An increase in the amount of serotype antigen was associated with a reduction in the accessibility of a monoclonal antibody to a core LPS determinant, an increase in resistance to normal human serum, and a decrease in cell surface hydrophobicity. The microheterogeneity of gonococcal LPS with respect to the content of serotype antigen may result from an alteration in the metabolism of glucose. Images PMID:6408006

Morse, S A; Mintz, C S; Sarafian, S K; Bartenstein, L; Bertram, M; Apicella, M A

1983-01-01

374

A Three-Dimensional Comparison of Tick-Borne Flavivirus Infection in Mammalian and Tick Cell Lines  

PubMed Central

Tick-borne flaviviruses (TBFV) are sustained in nature through cycling between mammalian and tick hosts. In this study, we used African green monkey kidney cells (Vero) and Ixodes scapularis tick cells (ISE6) to compare virus-induced changes in mammalian and arthropod cells. Using confocal microscopy, transmission electron microscopy (TEM), and electron tomography (ET), we examined viral protein distribution and the ultrastructural changes that occur during TBFV infection. Within host cells, flaviviruses cause complex rearrangement of cellular membranes for the purpose of virus replication. Virus infection was accompanied by a marked expansion in endoplasmic reticulum (ER) staining and markers for TBFV replication were localized mainly to the ER in both cell lines. TEM of Vero cells showed membrane-bound vesicles enclosed in a network of dilated, anastomosing ER cisternae. Virions were seen within the ER and were sometimes in paracrystalline arrays. Tubular structures or elongated vesicles were occasionally noted. In acutely and persistently infected ISE6 cells, membrane proliferation and vesicles were also noted; however, the extent of membrane expansion and the abundance of vesicles were lower and no viral particles were observed. Tubular profiles were far more prevalent in persistently infected ISE6 cells than in acutely infected cells. By ET, tubular profiles, in persistently infected tick cells, had a cross-sectional diameter of 60–100 nm, reached up to 800 nm in length, were closed at the ends, and were often arranged in fascicle-like bundles, shrouded with ER membrane. Our experiments provide analysis of viral protein localization within the context of both mammalian and arthropod cell lines as well as both acute and persistent arthropod cell infection. Additionally, we show for the first time 3D flavivirus infection in a vector cell line and the first ET of persistent flavivirus infection. PMID:23112871

Offerdahl, Danielle K.; Dorward, David W.; Hansen, Bryan T.; Bloom, Marshall E.

2012-01-01

375

A three-dimensional comparison of tick-borne flavivirus infection in mammalian and tick cell lines.  

PubMed

Tick-borne flaviviruses (TBFV) are sustained in nature through cycling between mammalian and tick hosts. In this study, we used African green monkey kidney cells (Vero) and Ixodes scapularis tick cells (ISE6) to compare virus-induced changes in mammalian and arthropod cells. Using confocal microscopy, transmission electron microscopy (TEM), and electron tomography (ET), we examined viral protein distribution and the ultrastructural changes that occur during TBFV infection. Within host cells, flaviviruses cause complex rearrangement of cellular membranes for the purpose of virus replication. Virus infection was accompanied by a marked expansion in endoplasmic reticulum (ER) staining and markers for TBFV replication were localized mainly to the ER in both cell lines. TEM of Vero cells showed membrane-bound vesicles enclosed in a network of dilated, anastomosing ER cisternae. Virions were seen within the ER and were sometimes in paracrystalline arrays. Tubular structures or elongated vesicles were occasionally noted. In acutely and persistently infected ISE6 cells, membrane proliferation and vesicles were also noted; however, the extent of membrane expansion and the abundance of vesicles were lower and no viral particles were observed. Tubular profiles were far more prevalent in persistently infected ISE6 cells than in acutely infected cells. By ET, tubular profiles, in persistently infected tick cells, had a cross-sectional diameter of 60-100 nm, reached up to 800 nm in length, were closed at the ends, and were often arranged in fascicle-like bundles, shrouded with ER membrane. Our experiments provide analysis of viral protein localization within the context of both mammalian and arthropod cell lines as well as both acute and persistent arthropod cell infection. Additionally, we show for the first time 3D flavivirus infection in a vector cell line and the first ET of persistent flavivirus infection. PMID:23112871

Offerdahl, Danielle K; Dorward, David W; Hansen, Bryan T; Bloom, Marshall E

2012-01-01

376

Heart tissue grown in NASA Bioreactor  

NASA Technical Reports Server (NTRS)

Lisa Freed and Gordana Vunjak-Novakovic, both of the Massachusetts Institute of Technology (MIT), have taken the first steps toward engineering heart muscle tissue that could one day be used to patch damaged human hearts. Cells isolated from very young animals are attached to a three-dimensional polymer scaffold, then placed in a NASA bioreactor. The cells do not divide, but after about a week start to cornect to form a functional piece of tissue. Here, a transmission electron micrograph of engineered tissue shows a number of important landmarks present in functional heart tissue: (A) well-organized myofilaments (Mfl), z-lines (Z), and abundant glycogen granules (Gly); and (D) intercalcated disc (ID) and desmosomes (DES). The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Credit: MIT

2001-01-01

377

7 CFR 989.157 - Raisins produced from grapes grown outside of California.  

Code of Federal Regulations, 2014 CFR

...produced from grapes grown outside of California. 989.157 Section 989.157 ...RAISINS PRODUCED FROM GRAPES GROWN IN CALIFORNIA Administrative Rules and Regulations...produced from grapes grown outside of California. (a) Any raisins produced...

2014-01-01

378

7 CFR 989.157 - Raisins produced from grapes grown outside of California.  

Code of Federal Regulations, 2012 CFR

...produced from grapes grown outside of California. 989.157 Section 989.157 ...RAISINS PRODUCED FROM GRAPES GROWN IN CALIFORNIA Administrative Rules and Regulations...produced from grapes grown outside of California. (a) Any raisins produced...

2012-01-01

379

7 CFR 989.157 - Raisins produced from grapes grown outside of California.  

Code of Federal Regulations, 2010 CFR

...produced from grapes grown outside of California. 989.157 Section 989.157 ...RAISINS PRODUCED FROM GRAPES GROWN IN CALIFORNIA Administrative Rules and Regulations...produced from grapes grown outside of California. (a) Any raisins produced...

2010-01-01

380

7 CFR 989.157 - Raisins produced from grapes grown outside of California.  

Code of Federal Regulations, 2013 CFR

...produced from grapes grown outside of California. 989.157 Section 989.157 ...RAISINS PRODUCED FROM GRAPES GROWN IN CALIFORNIA Administrative Rules and Regulations...produced from grapes grown outside of California. (a) Any raisins produced...

2013-01-01

381

7 CFR 989.157 - Raisins produced from grapes grown outside of California.  

Code of Federal Regulations, 2011 CFR

...produced from grapes grown outside of California. 989.157 Section 989.157 ...RAISINS PRODUCED FROM GRAPES GROWN IN CALIFORNIA Administrative Rules and Regulations...produced from grapes grown outside of California. (a) Any raisins produced...

2011-01-01

382

Development of an aciclovir implant for the effective long-term control of herpes simplex virus type-1 infection in Vero cells and in experimentally infected SKH-1 mice  

Microsoft Academic Search

Human herpes simplex virus type-1 (HSV-1) is treatable with oral doses of an antiviral agent such as aciclovir (ACV), a drug that has poor bioavailability. An alternative for delivering ACV would employ a long-lived subcutaneous implant that would allow for near zero-order drug delivery kinetics. This study aimed to develop an implant composed of a matrix of silicone and ACV

Tory P. Johnson; Robin Frey; Melissa Modugno; Timothy P. Brennan; Barry J. Margulies

2007-01-01

383

Phase I/II Randomized Double-Blind Study of the Safety and Immunogenicity of a Nonadjuvanted Vero Cell Culture-Derived Whole-Virus H9N2 Influenza Vaccine in Healthy Adults.  

PubMed

Studies on candidate pandemic vaccines against avian influenza viruses have focused on H5N1, but viruses of other subtypes, such as A/H9N2, are also considered to have pandemic potential. We investigated the safety and immunogenicity of two immunizations with one of five different antigen doses (ranging from 3.75 to 45 ?g of hemagglutinin antigen) of a nonadjuvanted whole-virus G9 lineage H9N2 influenza virus vaccine in healthy adults aged 18 to 49 years. The antibody responses were measured by hemagglutination inhibition (HI), microneutralization (MN), and single radial hemolysis (SRH) assays. To investigate a hypothesis that previous exposure to H2N2 viruses in subjects born in or before 1968 might prime for more robust antibody responses to H9N2 vaccination than that in subjects born after 1968, a post hoc age-stratified analysis of antibody responses was done. Both vaccinations in all dose groups were safe and well tolerated. No vaccine-related serious adverse events were reported, and the majority of the adverse reactions were rated as mild. The rates of injection site reactions were lower in the 3.75-?g- and 7.5-?g-dose groups than those in the higher-dose groups; the rates of systemic reactions were similar across all dose groups. The seroprotection rates among the different dose groups 21 days after the second immunization ranged from 52.8% to 88.9% as measured by HI assay, from 88.7% to 98.1% or 82.7% to 96.2% as measured by MN assay (MN titer cutoffs, 1:40 and 1:80, respectively), and from 94.2% to 100% as measured by SRH assay. Higher antibody responses were not induced in subjects born in or before 1968. These data indicate that a nonadjuvanted whole-virus H9N2 vaccine is well tolerated and immunogenic in healthy adults. (This study has been registered at ClinicalTrials.gov under registration no. NCT01320696.). PMID:25355797

Aichinger, Gerald; Grohmann-Izay, Barbara; van der Velden, Maikel V W; Fritsch, Sandor; Koska, Manuela; Portsmouth, Daniel; Hart, Mary Kate; El-Amin, Wael; Kistner, Otfried; Barrett, P Noel

2015-01-01

384

Auxin Transport Is Required for Hypocotyl Elongation in Light-Grown but Not Dark-Grown Arabidopsis1  

PubMed Central

Many auxin responses are dependent on redistribution and/or polar transport of indoleacetic acid. Polar transport of auxin can be inhibited through the application of phytotropins such as 1-naphthylphthalamic acid (NPA). When Arabidopsis thaliana seedlings were grown in the light on medium containing 1.0 ?m NPA, hypocotyl and root elongation and gravitropism were strongly inhibited. When grown in darkness, however, NPA disrupted the gravity response but did not affect elongation. The extent of inhibition of hypocotyl elongation by NPA increased in a fluence-rate-dependent manner to a maximum of about 75% inhibition at 50 ?mol m?2 s?1 of white light. Plants grown under continuous blue or far-red light showed NPA-induced hypocotyl inhibition similar to that of white-light-grown plants. Plants grown under continuous red light showed less NPA-induced inhibition. Analysis of photoreceptor mutants indicates the involvement of phytochrome and cryptochrome in mediating this NPA response. Hypocotyls of some auxin-resistant mutants had decreased sensitivity to NPA in the light, but etiolated seedlings of these mutants were similar in length to the wild type. These results indicate that light has a significant effect on NPA-induced inhibition in Arabidopsis, and suggest that auxin has a more important role in elongation responses in light-grown than in dark-grown seedlings. PMID:9489005

Jensen, Philip J.; Hangarter, Roger P.; Estelle, Mark

1998-01-01

385

Stable expression of nephrin and localization to cell-cell contacts in novel murine podocyte cell lines  

Microsoft Academic Search

Stable expression of nephrin and localization to cell-cell contacts in novel murine podocyte cell lines.Background. Cell culture of podocytes has become an indispensable tool in the study of podocyte biology. To date, however, podocyte cell lines with stable expression of the crucial slit diaphragm protein nephrin and localization of nephrin to cell-cell contacts are not available.MethodsConditionally immortalized cells were grown

DANIEL SCHIWEK; NICOLE ENDLICH; LAWRENCE HOLZMAN; HARRY HOLTHöFER; WILHELM KRIZ; KARLHANS ENDLICH

2004-01-01

386

Cryopreservation of in vitro grown shoot tips  

Technology Transfer Automated Retrieval System (TEKTRAN)

This chapter in Plant Cell Culture, Development and Biotechnology describes student laboratory exercises for cryopreservation of the growing shoot tips of plants in liquid nitrogen. It includes two exercises involving step by step protocols for use with shoot tips. Vitrification (fast freezing) an...

387

Culture of organized cell communities  

Microsoft Academic Search

Cells cultured in vitro will tend to retain their differentiated phenotype under conditions that resemble their natural in vivo environment, for example, when cultured on polymer scaffolds in tissue culture bioreactors. In this chapter, we define organized cell communities as three-dimensional in vitro grown cell–polymer constructs that display important structural and functional features of the natural tissue. We review representative

Lisa E. Freed; Gordana Vunjak-Novakovic

1998-01-01

388

7 CFR 51.1356 - Pears grown from late blooms.  

Code of Federal Regulations, 2014 CFR

... Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat tails”), or may be misshapen or slightly rough. Such pears do not ripen properly for ordinary canning...

2014-01-01

389

7 CFR 51.1356 - Pears grown from late blooms.  

Code of Federal Regulations, 2012 CFR

... Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat tails”), or may be misshapen or slightly rough. Such pears do not ripen properly for ordinary canning...

2012-01-01

390

7 CFR 51.1356 - Pears grown from late blooms.  

Code of Federal Regulations, 2011 CFR

... Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat tails”), or may be misshapen or slightly rough. Such pears do not ripen properly for ordinary canning...

2011-01-01

391

7 CFR 51.1356 - Pears grown from late blooms.  

Code of Federal Regulations, 2013 CFR

... Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat tails”), or may be misshapen or slightly rough. Such pears do not ripen properly for ordinary canning...

2013-01-01

392

GUIDELINES AND ACCEPTABLE POSTHARVEST PRACTICES FOR ORGANICALLY GROWN PRODUCE  

Technology Transfer Automated Retrieval System (TEKTRAN)

Organic foods are produced using agricultural practices that emphasize renewable resources and conservation of soil and water. Horticultural crops are grown and processed without synthetic fertilizers, pesticides, ingredients and processing aids. Crops or ingredients derived from genetic engineeri...

393

Nanotransfer and nanoreplication using deterministically grown sacrificial nanotemplates  

DOEpatents

Methods, manufactures, machines and compositions are described for nanotransfer and nanoreplication using deterministically grown sacrificial nanotemplates. An apparatus, includes a substrate and a nanoreplicant structure coupled to a surface of the substrate.

Melechko, Anatoli V. (Oak Ridge, TN); McKnight, Timothy E. (Greenback, TN); Guillorn, Michael A. (Ithaca, NY); Ilic, Bojan (Ithaca, NY); Merkulov, Vladimir I. (Knoxville, TN); Doktycz, Mitchel J. (Knoxville, TN); Lowndes, Douglas H. (Knoxville, TN); Simpson, Michael L. (Knoxville, TN)

2011-08-23

394

Survival of Potentially Pathogenic Human-Associated Bacteria in the Rhizosphere of Hydroponically Grown Wheat  

NASA Technical Reports Server (NTRS)

Plants may serve as reservoirs for human-associated bacteria (H-AB) in long-term space missions containing bioregenerative life support systems. The current study examined the abilities of five human-associated potential pathogens, Pseudomonas aeruginosa, Pseudomonas cepacia, Staphylococcus aureus, Streptococcus pyogenes, and Escherichia coli, to colonize and grow in the rhizosphere of hydroponically grown wheat, a candidate crop for life support. All of these bacteria have been recovered from past NASA missions and present potential problems for future missions. The abilities of these organisms to adhere to the roots of axenic five-day-old wheat (Triticum aestivum L. cv. Yecora rojo) were evaluated by enumeration of the attached organisms after a one hour incubation of roots in a suspension (approximately 10(exp 8 cu/ml)) of the H-AB. Results showed that a greater percentage of P. aeruginosa cells adhered to the wheat roots than the other four H-AB. Similarly incubated seedlings were also grown under attempted axenic conditions for seven days to examine the potential of each organism to proliferate in the rhizosphere (root colonization capacity). P. cepacia and P. aeruginosa showed considerable growth. E. coli and S. aureus showed no significant growth, and S. pyogenes died off in the wheat rhizosphere. Studies examining the effects of competition on the survival of these microorganisms indicated that P. aeruginosa was the only organism that survived in the rhizosphere of hydroponically grown wheat in the presence of different levels of microbial competition.

Morales, Anabelle; Garland, Jay L.; Lim, Daniel V.

1996-01-01

395

Tailoring the optical characteristics of microsized InP nanoneedles directly grown on silicon.  

PubMed

Nanoscale self-assembly offers a pathway to realize heterogeneous integration of III-V materials on silicon. However, for III-V nanowires directly grown on silicon, dislocation-free single-crystal quality could only be attained below certain critical dimensions. We recently reported a new approach that overcomes this size constraint, demonstrating the growth of single-crystal InGaAs/GaAs and InP nanoneedles with the base diameters exceeding 1 ?m. Here, we report distinct optical characteristics of InP nanoneedles which are varied from mostly zincblende, zincblende/wurtzite-mixed, to pure wurtzite crystalline phase. We achieved, for the first time, pure single-crystal wurtzite-phase InP nanoneedles grown on silicon with bandgaps of 80 meV larger than that of zincblende-phase InP. Being able to attain excellent material quality while scaling up in size promises outstanding device performance of these nanoneedles. At room temperature, a high internal quantum efficiency of 25% and optically pumped lasing are demonstrated for single nanoneedle as-grown on silicon substrate. Recombination dynamics proves the excellent surface quality of the InP nanoneedles, which paves the way toward achieving multijunction photovoltaic cells, long-wavelength heterostructure lasers, and advanced photonic integrated circuits. PMID:24299042

Li, Kun; Sun, Hao; Ren, Fan; Ng, Kar Wei; Tran, Thai-Truong D; Chen, Roger; Chang-Hasnain, Connie J

2014-01-01

396

Photoemission electronic states of epitaxially grown magnetite films  

Microsoft Academic Search

The valence band photoemission spectra of epitaxially grown 300? single crystalline magnetite films were measured by the angle-resolved ultraviolet photoemission spectroscopy (ARUPS) at 300K. The samples were grown either on MgO(001) (B termination) or on (001) Fe (iron-rich A termination), thus intentionally presenting different surface stoichiometry, i.e. also different surface electronic states. Four main features of the electron photoemission at

R. Zalecki; A. Ko?odziejczyk; J. Korecki; N. Spiridis; M. Zaj?c; A. Koz?owski; Z. K?kol; D. Antolak

2007-01-01

397

Quality characteristics of the radish grown under reduced atmospheric pressure  

Microsoft Academic Search

This study addresses whether reduced atmospheric pressure (hypobaria) affects the quality traits of radish grown under such environments. Radish (Raphanus sativus L. cv. Cherry Bomb Hybrid II) plants were grown hydroponically in specially designed hypobaric plant growth chambers at three atmospheric pressures; 33, 66, and 96kPa (control). Oxygen and carbon dioxide partial pressures were maintained constant at 21 and 0.12kPa,

Lanfang H. Levine; Patricia A. Bisbee; Jeffrey T. Richards; Michele N. Birmele; Ronald L. Prior; Michele Perchonok; Mike Dixon; Neil C. Yorio; Gary W. Stutte; Raymond M. Wheeler

2008-01-01

398

Sizing Up the Cell  

NSDL National Science Digital Library

This perspective discusses new information and experimental methods used in the study of the kinetics of cell growth and its influence on cell division. The coordination of cell growth and division is responsible for fundamental characteristics of cells such as their size: Fast growth with slow division makes big cells, whereas slow growth with fast division makes small cells. Yet despite decades of effort, the kinetics of cell growth and its influence on cell division have remained elusive topics, at least for animal cells. Is cell growth linear (constant) or exponential (proportional to cell size)? Does cell division occur after cells have grown beyond a minimum size, or is there rather some âÂÂage of consentâ for division, or both? A report by Tzur et al. combines a new experimental method with careful mathematical analysis to answer these questions for cultured mammalian lymphoblasts.

Bruce Edgar (Fred Hutchinson Cancer Research Center;); Kerry Kim (University of Washington;Center for Cell Dynamics, Friday Harbor Labs)

2009-07-10

399

Defect Density Characterization of Detached-Grown Germanium Crystals  

NASA Technical Reports Server (NTRS)

Several (111)-oriented, Ga-doped germanium crystals were grown in pyrolytic boron nitride (pBN) containers by the Bridgman and the detached Bridgman growth techniques. Growth experiments in closed-bottom pBN containers resulted in nearly completely detached-grown crystals, because the gas pressure below the melt can build up to a higher pressure than above the melt. With open-bottom tubes the gas pressure above and below the melt is balanced during the experiment, and thus no additional force supports the detachment. In this case the crystals grew attached to the wall. Etch pit density (EPD) measurements along the axial growth direction indicated a strong improvement of the crystal quality of the detached-grown samples compared to the attached samples. Starting in the seed with an EPD of 6-8 x 10(exp 3)/square cm it decreased in the detached-grown crystals continuously to about 200-500/square cm . No significant radial difference between the EPD on the edge and the middle of the crystal exists. In the attached grown samples the EPD increases up to a value of about 2-4 x 10(exp 4)/square cm (near the edge) and up to 1 x 10(exp 4)/square cm in the middle of the sample. Thus the difference between the detached- and the attached-grown crystals with respect to the EPD is approximately two orders of magnitude.

Schweizer, M.; Cobb, S. D.; Volz, M. P.; Szoke, J.; Szofran, F. R.; Whitaker, Ann F. (Technical Monitor)

2001-01-01

400

IN VITRO CYTOTOXICITY STUDY OF AGAVE AMERICANA, STRYCHNOS NUXVOMICA AND ARECA CATECHU EXTRACTS USING MCF-7 CELL LINE  

PubMed Central

Research is focusing on the search for new types of natural chemotherapeutic agent that is plant based medicines which are proving to be excellent sources of new compounds. In present research study, an attempt was made to prove cytotoxicity activity of various parts of medicinal plants such as Agave americana, Strychnos nuxvomica and Areca catechu using MCF-7 and Vero cell line. Various parts of the medicinal plants were extracted by soxhlet apparatus using solvents likes methanol and water. By trypan blue dye exclusion method, Viability of MCF-7 and Vero cell lines were 85.50 and 81.13%, respectively. IC50 value of methanol extract of Agave americana leaves and aqueous extract of Areca catechu fruits were found to be 545.9 & 826.1 ?g/ml by SRB assay and 775.1 & 1461pg/ml by MTT assay, respectively, against MCF-7 cell line. From cytotoxicity study data by SRB and MTT assay, it revealed that methanol extract of Agave americana and aqueous extract of Areca catechu are potent cytotoxic. PMID:22247852

Anajwala, Chetan C.; Patel, Rajesh M.; Dakhara, Sanjay L.; Jariwala, Jitesh K.

2010-01-01

401

Glycolate Metabolism in Low and High CO2-Grown Chlorella pyrenoidosa and Pavlova lutheri as Determined by 18O-Labeling 1  

PubMed Central

Photorespiration in Chlorella pyrenoidosa Chick. was assayed by measuring 18O-labeled intermediates of the glycolate pathway. Glycolate, glycine, serine, and excreted glycolate were isolated and analyzed on a gas chromatograph/mass spectrometer to determine isotopic enrichment. Rates of glycolate synthesis were determined from 18O-labeling kinetics of the intermediates, pool sizes, derived rate equations, and nonlinear regression techniques. Glycolate synthesis was higher in high CO2-grown cells than in air-grown cells when both were assayed under the same O2 and CO2 concentrations. Synthesis of glycolate, for both types of cells, was stimulated by high O2 levels and inhibited by high CO2 levels. Glycolate synthesis in 1.5% CO2-grown Chlorella, when exposed to a 0.035% CO2 atmosphere, increased from about 41 to 86 nanomoles per milligram chlorophyll per minute when the O2 concentration was increased from 21% to 40%. Glycolate synthesis in air-grown cells increased from 2 to 6 nanomoles per milligram chlorophyll per minute under the same gas levels. Synthesis was undetectable when either the O2 concentration was lowered to 2% or the CO2 concentration was raised to 1.5%. Glycolate excretion was also sensitive to O2 and CO2 concentrations in 1.5% CO2-grown cells and the glycolate that was excreted was 18O-labeled. Air-grown cells did not excrete glycolate under any experimental condition. Indirect evidence indicated that glycolate may be excreted as a lactone in Chlorella. Photorespiratory 18O-labeling kinetics were determined for Pavlova lutheri, which unlike Chlorella and higher plants did not directly synthesize glycine and serine from glycolate. This alga did excrete a significant proportion of newly synthesized glycolate into the media. PMID:16667116

de Veau, Edward J.; Burris, John E.

1989-01-01

402

Fusion as the result of sperm-somatic cell interaction.  

PubMed

The research has been designed to investigate whether acrosome-reacted spermatozoa can fuse with somatic cells and to check whether this event may involve the molecular machinery implicated in the sperm-egg fusion. Boar spermatozoa were capacitated in vitro and then treated with A23187 to induce acrosome reaction and activate their fusogenic potential. Reacted spermatozoa, loaded with the membrane-permeant fluorescent dye calcein AM, were incubated with plated granulosa cells or cells derived from stable cell lines: CRFK, VERO, and ESK4. The fusion between spermatozoa and somatic cells was revealed by the diffusion of the fluorescent dye from the sperm to the cell as membrane fusion and cytoplasmic continuity between the two cells were established. The involvement of integrin alpha6 and tetraspanin CD9 in the process of fusion was assessed by carrying out the experiment in the presence of antibodies against these molecules. Moreover, the incidence of fusion displayed by the different cell types used was analyzed in relation to their content in the above molecules assessed by western blot and immunostaining. The role of CD9 was additionally investigated by using CD9-negative cells. The data presented demonstrate that boar spermatozoa can fuse with different somatic cell types derived from different species and the process requires the combined presence of both integrin and tetraspanin molecules on the cell plasma membrane. PMID:19584174

Mattioli, M; Gloria, A; Mauro, A; Gioia, L; Barboni, B

2009-10-01

403

Stability of the Parainfluenza Virus 5 Genome Revealed by Deep Sequencing of Strains Isolated from Different Hosts and following Passage in Cell Culture  

PubMed Central

ABSTRACT The strain diversity of a rubulavirus, parainfluenza virus 5 (PIV5), was investigated by comparing 11 newly determined and 6 previously published genome sequences. These sequences represent 15 PIV5 strains, of which 6 were isolated from humans, 1 was from monkeys, 2 were from pigs, and 6 were from dogs. Strain diversity is remarkably low, regardless of host, year of isolation, or geographical origin; a total of 7.8% of nucleotides are variable, and the average pairwise difference between strains is 2.1%. Variation is distributed unevenly across the PIV5 genome, but no convincing evidence of selection for antibody-mediated evasion in hemagglutinin-neuraminidase was found. The finding that some canine and porcine, but not primate, strains are mutated in the SH gene, and do not produce SH, raised the possibility that dogs (or pigs) may not be the natural host of PIV5. The genetic stability of PIV5 was also demonstrated during serial passage of one strain (W3) in Vero cells at a high multiplicity of infection, under conditions of competition with large proportions of defective interfering genomes. A similar observation was made for a strain W3 mutant (PIV5V?C) lacking V gene function, in which the dominant changes were related to pseudoreversion in this gene. The mutations detected in PIV5V?C during pseudoreversion, and also those characterizing the SH gene in canine and porcine strains, predominantly involved U-to-C transitions. This suggests an important role for biased hypermutation via an adenosine deaminase, RNA-specific (ADAR)-like activity. IMPORTANCE Here we report the sequence variation of 16 different isolates of parainfluenza virus 5 (PIV5) that were isolated from a number of species, including humans, monkeys, dogs, and pigs, over 4 decades. Surprisingly, strain diversity was remarkably low, regardless of host, year of isolation, or geographical origin. Variation was distributed unevenly across the PIV5 genome, but no convincing evidence of immune or host selection was found. This overall genome stability of PIV5 was also observed when the virus was grown in the laboratory, and the genome stayed remarkably constant even during the selection of virus mutants. Some of the canine isolates had lost their ability to encode one of the viral proteins, termed SH, suggesting that although PIV5 commonly infects dogs, dogs may not be the natural host for PIV5. PMID:24453358

Rima, Bert K.; Gatherer, Derek; Young, Daniel F.; Norsted, Hanna; Davison, Andrew J.

2014-01-01

404

The preclinical testing of a formaldehyde inactivated Ross River virus vaccine designed for use in humans  

Microsoft Academic Search

Ross River virus was grown in industrial facilities in vaccine-certified Vero cells in the absence of serum, inactivated using standard formalin-inactivation protocols, treated with Benzonase to digest host cell DNA and purified on a sucrose gradient. Mice given two subcutaneous injections of 0.625?g of this vaccine or two doses of 0.156?g vaccine with aluminium hydroxide adjuvant failed to develop a

Otfried Kistner; Noel Barrett; Axel Brühmann; Manfred Reiter; Wolfgang Mundt; Helga Savidis-Dacho; Susanne Schober-Bendixen; Friedrich Dorner; John Aaskov

2007-01-01

405

Nitrogen isotope composition of organically and conventionally grown crops.  

PubMed

Authentic samples of commercially produced organic and conventionally grown tomatoes, lettuces, and carrots were collected and analyzed for their delta15N composition in order to assemble datasets to establish if there are any systematic differences in nitrogen isotope composition due to the method of production. The tomato and lettuce datasets suggest that the different types of fertilizer commonly used in organic and conventional systems result in differences in the nitrogen isotope composition of these crops. A mean delta15N value of 8.1 per thousand was found for the organically grown tomatoes compared with a mean value of -0.1 per thousand for those grown conventionally. The organically grown lettuces had a mean value of 7.6 per thousand compared with a mean value of 2.9 per thousand for the conventionally grown lettuces. The mean value for organic carrots was not significantly different from the mean value for those grown conventionally. Overlap between the delta15N values of the organic and conventional datasets (for both tomatoes and lettuces) means that it is necessary to employ a statistical methodology to try and classify a randomly analyzed "off the shelf" sample as organic/conventional, and such an approach is demonstrated. Overall, the study suggests that nitrogen isotope analysis could be used to provide useful "intelligence" to help detect the substitution of certain organic crop types with their conventional counterparts. However, delta15N analysis of a "test sample" will not provide unequivocal evidence as to whether synthetic fertilizers have been used on the crop but could, for example, in a situation when there is suspicion that mislabeling of conventionally grown crops as "organic" is occurring, be used to provide supporting evidence. PMID: