Sample records for vero cells grown

  1. An inactivated Vero cell-grown Japanese encephalitis vaccine formulated with Advax, a novel inulin-based adjuvant, induces protective neutralizing antibody against homologous and heterologous flaviviruses

    PubMed Central

    Lobigs, Mario; Pavy, Megan; Hall, Roy A.; Lobigs, Päivi; Cooper, Peter; Komiya, Tomoyoshi; Toriniwa, Hiroko; Petrovsky, Nikolai


    Advax is a polysaccharide-based adjuvant that potently stimulates vaccine immunogenicity without the increased reactogenicity seen with other adjuvants. This study investigated the immunogenicity of a novel Advax-adjuvanted Vero cell culture candidate vaccine against Japanese encephalitis virus (JEV) in mice and horses. The results showed that, in mice, a two-immunization, low-dose (50 ng JEV antigen) regimen with adjuvanted vaccine produced solid neutralizing immunity comparable to that elicited with live ChimeriVax-JE immunization and superior to that elicited with tenfold higher doses of a traditional non-adjuvanted JEV vaccine (JE-VAX; Biken Institute) or a newly approved alum-adjuvanted vaccine (Jespect; Novartis). Mice vaccinated with the Advax-adjuvanted, but not the unadjuvanted vaccine, were protected against live JEV challenge. Equine immunizations against JEV with Advax-formulated vaccine similarly showed enhanced vaccine immunogenicity, confirming that the adjuvant effects of Advax are not restricted to rodent models. Advax-adjuvanted JEV vaccine elicited a balanced T-helper 1 (Th1)/Th2 immune response against JEV with protective levels of cross-neutralizing antibody against other viruses belonging to the JEV serocomplex, including Murray Valley encephalitis virus (MVEV). The adjuvanted JEV vaccine was well tolerated with minimal reactogenicity and no systemic toxicity in immunized animals. The cessation of manufacture of traditional mouse brain-derived unadjuvanted JEV vaccine in Japan has resulted in a JEV vaccine shortage internationally. There is also an ongoing lack of human vaccines against other JEV serocomplex flaviviruses, such as MVEV, making this adjuvanted, cell culture-grown JEV vaccine a promising candidate to address both needs with one vaccine. PMID:20130134

  2. Arenoviruses in Vero Cells: Ultrastructural Studies

    PubMed Central

    Murphy, Frederick A.; Webb, Patricia A.; Johnson, Karl M.; Whitfield, Sylvia G.; Chappell, W. Adrian


    Thin-section electron microscopy was carried out on Vero green monkey kidney cell cultures infected with some viruses of the newly constituted arenovirus group. Junin, Machupo, Amapari, Pichinde, Parana, Tamiami, and Latino viruses were morphologically identical and indistinguishable from lymphocytic choriomeningitis virus, the prototype virus of the group. Virus particles were round, oval, or pleomorphic, 60 to 280 nm in diameter, and matured via budding from plasma membranes. Most characteristically, particles contained various amounts of homogeneous, 20- to 25-nm, dense granules; these granules in large masses also formed distinctive intracytoplasmic inclusions. In negative-contrast preparations from infected Vero cell culture supernatant fluids, several of the viruses appeared as pleomorphic membrane-bound forms with rather pronounced surface projections. Most particles were between 90 and 220 nm in diameter, although some reached 350 nm in their longest dimension. Internal structure was not resolved by negative-contrast electron microscopy. All observations supported the current delineation of a distinct arenovirus group. Images PMID:5497898

  3. Increasing Vero viable cell densities for yellow fever virus production in stirred-tank bioreactors using serum-free medium.


    Mattos, Diogo A; Silva, Marlon V; Gaspar, Luciane P; Castilho, Leda R


    In this work, changes in Vero cell cultivation methods have been employed in order to improve cell growth conditions to obtain higher viable cell densities and to increase viral titers. The propagation of the 17DD yellow fever virus (YFV) in Vero cells grown on Cytodex I microcarriers was evaluated in 3-L bioreactor vessels. Prior to the current changes, Vero cells were repeatedly displaying insufficient microcarrier colonization. A modified cultivation process with four changes has resulted in higher cell densities and higher virus titers than previously observed for 17DD YFV. PMID:25930117

  4. Morphological and growth alterations in Vero cells transformed by cisplatin.


    Gonalves, Estela Maria; Ventura, Cludio Angelo; Yano, Tomomasa; Rodrigues Macedo, Maria Lgia; Genari, Selma Candelria


    Cisplatin is an antineoplastic agent used to treat solid tumours, such as ovarian, testicular and bladder tumours. However, studies in vitro and in vivo have shown that cisplatin is mutagenic, genotoxic and tumorigenic in other tissues and organs. In this work, we examined the effect of cisplatin on Vero cells, a fibroblast-like cell line. The morphological characteristics were investigated using phase contrast microscopy, scanning electron microscopy and the actin cytoskeleton was labelled with fluorescein isothiocyanate-phalloidin. Cell proliferation was assessed based on the growth curve. Cultured Vero cells treated with cisplatin showed behavioural and morphological alterations associated with cellular transformation. The transformed cells grew in multilayers and formed cellular aggregates. The proliferation and morphological characteristics of the transformed cells were very different from those of control ones. Since transformed Vero cells showed several characteristics related to neoplastic growth, these cells could be a useful model for studying tumour cells in vitro. PMID:16716608

  5. Statistical optimization of influenza H1N1 production from batch cultures of suspension Vero cells (sVero).


    Paillet, Cristian; Forno, Guillermina; Soldano, Nicolas; Kratje, Ricardo; Etcheverrigaray, Marina


    Efficient vaccine production requires the growth of large quantities of virus produced with high yield from a safe host system. Human influenza vaccines are produced in embryonated chicken eggs. However, over the last decade many efforts have allowed the establishment of cell culture-derived vaccines. We generated a Vero cell line adapted to grow in suspension (sVero) in a serum-free medium and evaluated it for its potential as host cell for influenza vaccine production. Initially we studied the capacity of sVero cells to grow in the presence of incremental concentrations of trypsin. In comparison with adherent Vero cells (aVero), we found that sVero cells maintain their growth kinetics even with a three-fold increase in trypsin concentration. The influence of the conditions of infection on the yield of H1N1 produced in serum-free suspension cultures of sVero cells was investigated by a 2(2) full factorial experiment with center point. Each experiment tested the influence of the multiplicity of infection (m.o.i.) and trypsin concentration, on production yields at two levels, in four possible combinations of levels and conditions, plus a further combination in which each condition was set in the middle of its extreme levels. On the basis of software analysis, a combination of m.o.i. of 0.0066TCID(50%)/cell and trypsin concentration of 5?g/1.010(6) cells with a desirability of 0.737 was selected as the optimized condition for H1N1 production in sVero cells. Our results show the importance of proper selection of infection conditions for H1N1 production on sVero cells in serum-free medium. PMID:21756959

  6. Arbovirus neutralization tests with Peruvian sera in Vero cell cultures.


    Buckley, S M; Davis, J L; Madalengoitia, J; Flores, W; Casals, J


    Selected human sera from Peru, previously examined by the haemagglutination-inhibition (HI) test with a number of arboviruses, were reexamined by neutralization tests carried out in Vero cell cultures. Results confirmed and extended the HI findings, indicating that the antibodies detected were evoked by Eastern equine encephalitis, Mayaro, Venezuelan equine encephalitis, Ilheus, St Louis encephalitis, yellow fever, Caraparu, and Guaroa viruses. PMID:4538189

  7. Vero cells infected with the Lederle strain of canine distemper virus have increased Fas receptor signaling expression at 15 h post-infection.


    Del Puerto, H L; Martins, A S; Braz, G F; Alves, F; Heinemann, M B; Rajão, D S; Araújo, F C; Martins, S F; Nascimento, D R; Leite, R C; Vasconcelos, A C


    We evaluated the expression of the Fas receptor gene in Vero cells infected with the Lederle vaccine strain of canine distemper virus using RT-PCR. Vero cells were plated, and after being grown for 24 h in MEM with 5% FBS, 80-90% confluent monolayer cultures were infected with the virus. The cells were harvested at 3, 6, 9, and 15 h post-infection. Uninfected Vero cells were used as a control. Total RNA was isolated from Vero cells using 1 mL Trizol(®) LS, and RT was performed using 2 μg total RNA. Primer pairs for RT-PCR amplification for the canine distemper virus nucleocapsid gene, the S26 reference gene, and the Vero rFas gene were used to analyze expression in Vero cells. RT-PCR results revealed virus activity at 3, 6, 9, and 15 h in the virus-infected Vero cells. The S26 housekeeping gene was amplified in virus infected and control samples. However, expression of the cell death receptor Fas was detected in Vero cells only at 15 h post-infection. We suggest that the Lederle vaccine induces apoptosis by Fas receptor signaling, possibly through caspase-8 signaling rather than through mitochondrial signaling in the infected cells. PMID:22009866

  8. Adaptation of Marek's disease virus to the Vero continuous cell line.


    Jaikumar, D; Read, K M; Tannock, G A


    Marek's disease virus (MDV) is a highly infectious, cell-associated oncogenic herpesvirus. Production of MD vaccines has been limited to primary chicken and duck embryo fibroblast (CEF and DEF) cultures. These have a limited life span and cannot be readily stored in liquid nitrogen. Moreover, the need to prepare CEF and DEF cells on a regular basis from 10 to 11 day-old embryos derived from a flock that must be tested continuously for the presence of avian pathogens adds to the cost of vaccine production. A continuous cell line that would support MDV replication could have significant advantages for the rapid large-scale preparation of MD vaccines. In this report, we describe the adaptation to growth of CEF-grown preparations of serotype 1 and serotype 3 (herpesvirus of turkeys; HVT) strains of MDV in cells of the Vero continuous cell line. Although both viruses produced typical CPE, higher levels of infectious progeny and more extensive virus-specific immunofluorescence were obtained for HVT than for the serotype 1 virus. PCR and pulsed field electrophoresis (PFE) analysis of the DNA from Vero cells infected with either virus confirmed the presence of virus-specific DNA. PMID:11230930

  9. Improved poliovirus D-antigen yields by application of different Vero cell cultivation methods.


    Thomassen, Yvonne E; Rubingh, Olaf; Wijffels, René H; van der Pol, Leo A; Bakker, Wilfried A M


    Vero cells were grown adherent to microcarriers (Cytodex 1; 3 g L(-1)) using animal component free media in stirred-tank type bioreactors. Different strategies for media refreshment, daily media replacement (semi-batch), continuous media replacement (perfusion) and recirculation of media, were compared with batch cultivation. Cell densities increased using a feed strategy from 1×10(6) cells mL(-1) during batch cultivation to 1.8, 2.7 and 5.0×10(6) cells mL(-1) during semi-batch, perfusion and recirculation, respectively. The effects of these different cell culture strategies on subsequent poliovirus production were investigated. Increased cell densities allowed up to 3 times higher D-antigen levels when compared with that obtained from batch-wise Vero cell culture. However, the cell specific D-antigen production was lower when cells were infected at higher cell densities. This cell density effect is in good agreement with observations for different cell lines and virus types. From the evaluated alternative culture methods, application of a semi-batch mode of operations allowed the highest cell specific D-antigen production. The increased product yields that can easily be reached using these higher cell density cultivation methods, showed the possibility for better use of bioreactor capacity for the manufacturing of polio vaccines to ultimately reduce vaccine cost per dose. Further, the use of animal-component-free cell- and virus culture media shows opportunities for modernization of human viral vaccine manufacturing. PMID:24583004

  10. Susceptibility of the VERO line of African green monkey kidney cells to human enteroviruses

    PubMed Central

    Davis, Patricia M.; Phillpotts, R. J.


    The relative susceptibility of VERO cells and primary rhesus monkey kidney cells to 47 prototype strains of human enteroviruses is described. Of these strains, types 4, 14, 16, 17, 18, 21, 31 and 34 and Coxsackie virus A 9 failed to cause CPE in the VERO cells whilst only one, echovirus type 34, failed to cause CPE in the monkey kidney cells. A comparison is given of the efficiency of the two cell cultures for enterovirus isolation from clinical material. Results show that VERO cells are as useful as primary monkey kidney for the isolation of Coxsackie B viruses but less satisfactory for isolating echoviruses. They are satisfactory for the isolation of single types of poliovirus and appear to be more satisfactory than primary monkey kidney cells for the isolation of mixtures of polioviruses. The identification of enteroviruses by neutralization tests in VERO cells is successful. PMID:4361500

  11. The Genome Landscape of the African Green Monkey Kidney-Derived Vero Cell Line

    PubMed Central

    Osada, Naoki; Kohara, Arihiro; Yamaji, Toshiyuki; Hirayama, Noriko; Kasai, Fumio; Sekizuka, Tsuyoshi; Kuroda, Makoto; Hanada, Kentaro


    Continuous cell lines that originate from mammalian tissues serve as not only invaluable tools for life sciences, but also important animal cell substrates for the production of various types of biological pharmaceuticals. Vero cells are susceptible to various types of microbes and toxins and have widely contributed to not only microbiology, but also the production of vaccines for human use. We here showed the genome landscape of a Vero cell line, in which 25,877 putative protein-coding genes were identified in the 2.97-Gb genome sequence. A homozygous ∼9-Mb deletion on chromosome 12 caused the loss of the type I interferon gene cluster and cyclin-dependent kinase inhibitor genes in Vero cells. In addition, an ∼59-Mb loss of heterozygosity around this deleted region suggested that the homozygosity of the deletion was established by a large-scale conversion. Moreover, a genomic analysis of Vero cells revealed a female Chlorocebus sabaeus origin and proviral variations of the endogenous simian type D retrovirus. These results revealed the genomic basis for the non-tumourigenic permanent Vero cell lineage susceptible to various pathogens and will be useful for generating new sub-lines and developing new tools in the quality control of Vero cells. PMID:25267831

  12. Development of a Vero cell DNA reference standard for residual DNA measurement in China.


    Cao, Shouchun; Dong, Guanmu; Tang, Jianrong; Li, Jia; Liu, Jinghua; Shi, Leitai; Li, Changgui; Wang, Junzhi


    This collaborative study developed a Vero cell DNA reference for standardizing dot blot hybridization, an assay widely employed to measure residual DNA contents of viral vaccines prepared with Vero cells. High purity of Vero cell DNA was extracted and characterized by Hind III enzyme digestion and DNA sequencing. Then, with a cooperative calibration, the concentration of Vero cell DNA reference bulk solution was determined (64.0 1.9 ?g/mL, OD 260/OD 280 = 1.87) and diluted (40 ng/mL) with Tris-EDTA buffer containing bovine serum albumin as freeze-dried excipients. With industrial filling apparatus, the diluted bulk was loaded into ampoules (0.5 mL each) which were heat sealed after nitrogen filling. Finally, a collaborative study showed that the Vero cell DNA reference could reach a sensitivity of 1 to 5 pg/dot and maintained good stability after accelerated destruction test. The successful establishment of the Vero cell DNA quantitative reference will facilitate the standardization of dot blot hybridization for testing residual host cell DNA. PMID:23291952

  13. New World Hantaviruses Activate IFN? Production in Type I IFN-Deficient Vero E6 Cells

    PubMed Central

    Prescott, Joseph; Hall, Pamela; Acuna-Retamar, Mariana; Ye, Chunyan; Wathelet, Marc G.; Ebihara, Hideki; Feldmann, Heinz; Hjelle, Brian


    Background Hantaviruses indigenous to the New World are the etiologic agents of hantavirus cardiopulmonary syndrome (HCPS). These viruses induce a strong interferon-stimulated gene (ISG) response in human endothelial cells. African green monkey-derived Vero E6 cells are used to propagate hantaviruses as well as many other viruses. The utility of the Vero E6 cell line for virus production is thought to owe to their lack of genes encoding type I interferons (IFN), rendering them unable to mount an efficient innate immune response to virus infection. Interferon ?, a more recently characterized type III IFN, is transcriptionally controlled much like the type I IFNs, and activates the innate immune system in a similar manner. Methodology/Principal Findings We show that Vero E6 cells respond to hantavirus infection by secreting abundant IFN?. Three New World hantaviruses were similarly able to induce IFN? expression in this cell line. The IFN? contained within virus preparations generated with Vero E6 cells independently activates ISGs when used to infect several non-endothelial cell lines, whereas innate immune responses by endothelial cells are specifically due to viral infection. We show further that Sin Nombre virus replicates to high titer in human hepatoma cells (Huh7) without inducing ISGs. Conclusions/Significance Herein we report that Vero E6 cells respond to viral infection with a highly active antiviral response, including secretion of abundant IFN?. This cytokine is biologically active, and when contained within viral preparations and presented to human epithelioid cell lines, results in the robust activation of innate immune responses. We also show that both Huh7 and A549 cell lines do not respond to hantavirus infection, confirming that the cytoplasmic RNA helicase pathways possessed by these cells are not involved in hantavirus recognition. We demonstrate that Vero E6 actively respond to virus infection and inhibiting IFN? production in these cells might increase their utility for virus propagation. PMID:20567522

  14. Correlation of increased nuclease activity with enhanced virus reactivation. [Monkey Vero cells, mouse L cells

    SciTech Connect

    Nishiyama, Y.; Maeno, K.; Yoshida, S.


    An increase in nuclease activity, which degraded both unirradiated and ultraviolet (UV)-irradiated DNA, was observed in the extract of monkey Vero cells after irradiation with an appropriate amount of UV. In contrast, no increase was observed with mouse L cells. Neither DNA polymerases nor uracil-DNA glycosylase was enhanced but rather suppressed by UV irradiation in both cell lines. Cytological studies showed that, in Vero cells, the reactivation of UV-irradiated herpes simplex virus was markedly enhanced by irradiating cells with UV before infection. However, no enhancement was observed with L cells. These results suggest that an increase in nuclease activity may be one of underlying mechanisms for the enhanced reactivation of DNA viruses.

  15. A Vero-cell-adapted vaccine donor strain of influenza A virus generated by serial passages.


    Hu, Weibin; Zhang, Hong; Han, Qinglin; Li, Li; Chen, Yixin; Xia, Ningshao; Chen, Ze; Shu, Yuelong; Xu, Ke; Sun, Bing


    A cell culture-based vaccine production system is preferred for the large-scale production of influenza vaccines and has advantages for generating vaccines against highly pathogenic influenza A viruses. Vero cells have been widely used in human vaccine manufacturing, and the safety of these cells has been well demonstrated. However, the most commonly used influenza-vaccine donor virus, A/Puerto Rico/8/1934 (PR8) virus, does not grow efficiently in Vero cells. Therefore, we adapted the PR8 virus to Vero cells by continuous passaging, and a high-growth strain was obtained after 20 passages. Sequence analysis and virological assays of the adapted strain revealed that mutations in four viral internal genes (NP, PB1, PA and NS1) were sufficient for adaptation. The recombinant virus harboring these mutations (PR8-4mut) displayed accelerated viral transport into the nucleus and increased RNP activity. Importantly, the PR8-4mut could serve as a backbone donor virus to support the growth of the H7N1, H9N2 and H5N1 avian viruses and the H1N1 and H3N2 human viruses in Vero cells without changing its pathogenicity in either chicken embryos or mice. Thus, our work describes the generation of a Vero-adapted, high-yield PR8-4mut virus that may serve as a promising candidate for an influenza-vaccine donor virus. PMID:25448099

  16. Adhesion and internalization differences of COM nanocrystals on Vero cells before and after cell damage.


    Gan, Qiong-Zhi; Sun, Xin-Yuan; Ouyang, Jian-Ming


    The adhesion and internalization between African green monkey kidney epithelial (Vero) cells (before and after oxidative damage by hydrogen peroxide) and calcium oxalate monohydrate (COM) nanocrystals (97±35nm) were investigated so as to discuss the molecular and cellular mechanism of kidney stone formation. Scanning electron microscope (SEM) was used to observe the Vero-COM nanocrystal adhesion; the nanocrystal-cell adhesion was evaluated by measuring the content of malonaldehyde (MDA), the activity of superoxide dismutase (SOD), the expression level of cell surface osteopontin (OPN) and the change of Zeta potential. Confocal microscopy and flow cytometry were used for the observation and quantitative analysis of crystal internalization. In the process of adhesion, the cell viability and the SOD activity declined, the MDA content, Zeta potential, and the OPN expression level increased. The adhesive capacity of injured Vero was obviously stronger than normal cells; in addition the injured cells promoted the aggregation of COM nanocrystals. The capacity of normal cells to internalize crystals was obviously stronger than that of injured cells. Cell injury increased adhesive sites on cell surface, thereby facilitating the aggregation of COM nanocrystals and their attachment, which results in enhanced risk of calcium oxalate stone formation. PMID:26652375

  17. Pre-clinical development of cell culture (Vero)-derived H5N1 pandemic vaccines.


    Howard, M Keith; Kistner, Otfried; Barrett, P Noel


    The rapid spread of avian influenza (H5N1) and its transmission to humans has raised the possibility of an imminent pandemic and concerns over the ability of standard influenza vaccine production methods to supply sufficient amounts of an effective vaccine. We report here on a robust and flexible strategy which uses wild-type virus grown in a continuous cell culture (Vero) system to produce an inactivated whole virus vaccine. Candidate vaccines based on clade 1 and clade 2 influenza H5N1 strains, produced at a variety of manufacturing scales, were demonstrated to be highly immunogenic in animal models without the need for adjuvant. The vaccines induce cross-neutralising antibodies and are protective in a mouse challenge model not only against the homologous virus but against other H5N1 strains, including those from other clades. These data indicate that cell culture-grown, whole virus vaccines, based on the wild-type virus, allow the rapid high-yield production of a candidate pandemic vaccine. PMID:18953724

  18. Antiproliferative efficacy of Tabernaemontana divaricata against HEP2 cell line and Vero cell line

    PubMed Central

    Kumar, Arvind; Selvakumar, S.


    Background: Laryngeal cancer may also be called cancer of the larynx or laryngeal carcinoma. Conventional plants are a precious source of novel anticancer agents and are still in performance better role in health concern. The study was intended to estimation of the anticancer activity of the chloroformic extract of Tabernaemontana divaricata on the human epidermoid larynx carcinoma cell line (Hep 2). Materials and Method: The aerial parts (leaves, stem, and flowers) of T. divaricata were tested for its inhibitory effect in 96 microplate formats against Hep 2 cell line. The anticancer activity of samples on Hep 2 and Vero was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and various enzymatic parameters like catalase, reduced glutathione (GSH), GSH peroxidase, and superoxide anion scavenging activity. Viable cells were determined by the absorbance at 540 nm. Measurements were performed, and the concentration required for a 50% inhibition of viability (IC50) was determined graphically. The effect of the samples on the proliferation of Hep 2 and Vero cells was expressed as the % cell viability. Results: The extract on Hep 2 cell line up to 7.8 μg/ml and that IC50 value on Hep 2 cell line was 112 μg whereas 94 μg for Vero cell line. Hence, T. divaricata has lesser significant action on Vero cell line. Conclusion: Medicinal plant drug discovery continues to provide new and important leads against various pharmacological targets including cancer. Our results clearly indicate the anticancer property of the medicinal plant T. divaricata against the human laryngeal carcinoma cell lines (Hep 2 cell line). PMID:26109773

  19. Effect of brefeldin A on Mayaro virus replication in Aedes albopictus and Vero cells.


    Da Costa, L J; Rebello, M A


    Brefeldin A (BFA), a fungal metabolite that blocks transport of newly synthesized proteins from the endoplasmic reticulum, was found to inhibit Mayaro virus replication. At the concentration of 0.05 microgram/ml, the yield of the virus was inhibited by 94% in Aedes albopictus cells and by 99.5% in Vero cells. Treatment of A. albopictus cells with BFA did not inhibit the virus protein synthesis. However, this compound drastically reduced viral protein synthesis in Vero cells. The inhibitory effect progressively declined when BFA was added at late times post infection (p.i.). The effect of BFA on protein glycosylation is discussed. PMID:10825924

  20. Isolation and purification of amastigotes of Trypanosoma cruzi from cultured vero cells.


    Gamarro, F; Osuna, A; Castanys, S; Prez-Lpez, M I; Ruiz-Prez, L M


    A method is described for the isolation and purification of the intracellular amastigotes of Trypanosoma cruzi from cultured Vero cells. Host cells were infected with metacyclic forms obtained in Grace's medium. Six days after infection, the cells wer subjected to treatment with trypsin to obtain the intracellular forms. The parasites were collected and purified by Percoll discontinuous gradient centrifugation. PMID:3885604

  1. Cytotoxic effects of etephon and maleic hydrazide in Vero, Hep2, HepG2 cells.


    Yurdakok, Begum; Baydan, Emine; Okur, Hamza; Gurcan, Ismayil Safa


    The toxicity of etephon and maleic hydrazide, used as plant growth regulators in agriculture, were reported as low in mammals in previous studies. However, in vitro cytotoxicity studies in mammalian cells are currently missing to understand their toxicity at molecular level. In the current study, the cytotoxicity of these compounds, were studied in Vero (African green monkey kidney epithelium), HepG2 (human hepatocellular carcinoma), Hep2 (human epidermoid cancer) cells by MTT ((3-(4,5-dimetiltiazol-2-il)-2,5-difeniltetrazolium bromure) and LDH (lactate dehydrogenase) assays. Maleic hydrazide had lower IC50 values for all cell lines compared to ethephon. Least cytotoxic effect treated by ethephon were observed in Vero, followed by HepG2 and Hep2. Similarly maleic hydrazide also showed least cytotoxicity on Vero cells, followed by Hep2 and HepG2 cells (p?Vero cells, followed by HepG2 and Hep2 cells (p?0.868 (p?cells to be supplemented by further studies. PMID:24495230

  2. Identification of a Putative Coreceptor on Vero Cells That Participates in Dengue 4 Virus Infection

    PubMed Central

    Martnez-Barragn, Jos de Jess; del Angel, Rosa M.


    Dengue virus infects target cells by attaching to a cell surface receptor through the envelope (E) glycoprotein, located on the surface of the viral membrane. On Vero and BHK cells, heparan sulfate (HS) moieties of proteoglycans are the receptors for dengue virus; however, additional proteins have also been described as putative dengue virus receptors on C6/36, HL60, and BM cells. HS can also act as a receptor for other types of viruses or as an attachment molecule for viruses that require additional host cell molecules to allow viral penetration. In this study we searched for molecules other than HS that could participate in dengue virus infection of Vero cells. Labeled dengue 4 virus bound with high affinity to two molecules of 74 and 44 kDa. Binding of dengue virus to the 74-kDa molecule was susceptible to protease and sodium periodate treatment and resistant to heparinase treatments. Lectins such as concanavalin A and wheat germ agglutinin prevented dengue virus binding to both the 74- and the 44-kDa protein in overlay assays, while phytohemagglutinin P did not affect binding, suggesting that carbohydrate residues (?-mannose or N-acetylglucosamine) are important in virus binding to host cells. Protease susceptibility, biotin labeling, and immunofluorescence with a polyclonal antibody raised against the 74-kDa protein consistently identified the protein on the surfaces of Vero cells. Moreover, the antibody against the 74-kDa protein was able to inhibit dengue virus infection. These data suggest that HS might serve as a primary receptor, probably concentrating virus particles on the surfaces of Vero cells, and then other molecules, such as the 74-kDa protein, might participate as coreceptors in viral penetration. The 74-kDa protein possibly constitutes part of a putative receptor complex for dengue virus infection of Vero cells. PMID:11483725

  3. Co-culture with Vero cell monolayer maintains the motility of asthenozoospermic semen samples.


    Chen, H F; Ho, H N; Chen, S U; Lien, Y R; Chao, K H; Lin, H R; Huang, S C; Lee, T Y; Yang, Y S


    The clinical effectiveness of co-culture with Vero (Green monkey kidney) cell monolayer in maintaining the motility and viability of fresh asthenozoospermic semen (18 samples) and frozen-thawed semen with poor motility (motility fraction < 50%) (15 samples) in a 24-h period was evaluated. Co-culture with Vero cell monolayer in human tubal fluid (HTF) medium for 24 h resulted in a statistically better maintenance of motility percentage (P < 0.005), mean amplitude of lateral head displacement (ALH) (P < 0.005), and mean track speed (VCL) (P < 0.05) than culture in HTF medium alone. However, these motility parameters (motility percentage, ALH, VCL) declined soon after removal of spermatozoa from the monolayer. Co-culture with Vero cell monolayer also maintained the viability percentage of these sperm samples (52% of the original value) after the 24-h period compared with culture in HTF medium alone (22% of the original) (52% versus 22%, P < 0.05). It is concluded that Vero cell monolayer is effective in the maintenance of motility and viability of asthenozoospermic semen or frozen-thawed semen with poor motility. This co-culture system may be beneficial in enhancing the in-vitro performance of asthenozoospermic semen samples in the practice of assisted reproductive technology. However, its safety needs further evaluation. PMID:7962433

  4. Life cycle, growth characteristics and host cell response of Rickettsia helvetica in a Vero cell line.


    Elfving, Karin; Lukinius, Agneta; Nilsson, Kenneth


    Rickettsia helvetica, a spotted fever rickettsia and emerging pathogen with Ixodes ricinus ticks as the main vector, is an agent of human disease and may cause febrile illness as well as meningitis. In three parallel series the isolated standard type of R. helvetica, obtained from a PCR-positive I. ricinus tick, was high-passaged and propagated in a Vero cell line. By using quantitative real-time PCR, the generation time from inoculation to stationary phase of growth was calculated to 20-22 h. In the static cultivation system the stationary phase was observed from the seventh day after inoculation, and there was no observed degradation of R. helvetica DNA during the 14 days studied. Microscopy showed that the organisms invaded the host cells rapidly and were primarily found free in the cytoplasm and only occasionally located in the nucleus. Four days after inoculation some of the host cells were broken and many indifferent stages of cytoplasmic organic decomposition were seen. However the R. helvetica organism did not show any morphologic alterations and the number of organisms was stable after the replication peak which may indicate that R. helvetica is adapted to growth in a Vero cell line and/or that the phase of degradation occurs later than the 14 days studied. The findings differ from what has been reported for other rickettsiae of the spotted fever group and may be of importance for invasiveness and virulence of R. helvetica. PMID:22116301

  5. SV40 DNA extracted from persistently infected Vero cells using miniprep columns for plasmids.


    Hamelin, C; Yelle, J; D'Amours, B; Chung, Y S


    A recombinant pAT153 plasmid carrying the whole simian virus 40 (SV40) genome in the form of two consecutive Pst I restriction fragments was rapidly isolated using a commercially available minipreps DNA purification system. This rapid and simple method was used to extract SV40 DNA from infected Vero monkey cells. Viral DNA replication in persistently infected SVP-1 monkey cells was also conveniently followed over a period of 8 d by agarose gel electrophoresis and molecular hybridization using minipreps and the recombinant plasmid (pLCB104) as a probe. Unsatisfactory results were obtained, however, when herpes simplex virus DNA was tentatively extracted from infected Vero cells with the above method. Only covalently closed circular DNA molecules, with two strands unable to separate fully under denaturing conditions, were apparently retained after rapid neutralization by the silicone-based minipreps DNA purification resin. PMID:8293042

  6. Uropathogenic Escherichia coli isolates with different virulence genes content exhibit similar pathologic influence on Vero cells.


    Obaid, Jamil M A S; Mansour, Samira R; Elshahedy, Mohammed S; Rabie, Tarik E; Azab, Adel M H


    Uropathogenic Escherichia coli are the major causative agent of urinary tract infection--they may simultaneously express a number of virulence factors to cause disease. The aim of this study was to investigate the relation between virulence factors content of fifteen UPEC isolates and their pathogenic potential. The isolates belonged to the five serotypes O78:K80, O114:K90, O142:K86, O164 and O157. Nine of the virulence factors have been explored, ibeA, pap, sfa/foc, cnfl, hly, fyuA, pil, ompT and traT. Virulence factors profiling of the isolates revealed a different content ranging from 22% to 100% of the virulence genes explored. The pathogenic capacity of all fifteen isolates when tested on Vero cells showed that the cytotoxicity for all tested strains on Vero cells was approximately equal and enhanced after growth in syncase broth, leading mainly to cell lysis. The toxic effects reduced slightly after heat treatment of the toxin, and greatly after formalin detoxification, but not all the deleterious effect was abolished. Endotoxin also has cytotoxic effects on Vero cells, but longer time is needed for cytolysis which is greatly diminished with formalin treatment. In conclusion, our study revealed that pathogenic strains of UPEC can exert their pathogenic effect on live cells or system with limited virulence factors gene content. PMID:25033661

  7. [A study of the antiherpetic activity of the chaga mushroom (Inonotus obliquus) extracts in the Vero cells infected with the herpes simplex virus].


    Polkovnikova, M V; Nosik, N N; Garaev, T M; Kondrashina, N G; Finogenova, M P; Shibnev, V A


    The chaga mushroom (Inonotus obliquus) contains a wide range of excellent bioactive compounds. However, limited information exists on the antiviral activity of the compounds extracted from chaga. A number of subfractions of chaga were obtained using different solvents and different procedures. The subfractions of chaga extracted with water, alcohol, alkali were tested for their toxicity for the Vero cell culture and antiviral effect in the Vero cells infected with the Herpes simplex virus (HSV), Type 1. It was shown that most of the subfractions were not toxic for the Vero cells and had protective effect on the Vero cells infected with HSV. The subfraction IV in the concentration 5 microg/ml protected the Vero cells from cytodestructive action of HSV and no viral DNA was detected in infected cells treated with chaga extracts. Best protective effect was observed when compound was added before or within one hour after the Vero cells were infected with HSV. PMID:25069286

  8. Inhibition of Mayaro virus replication by prostaglandin A1 and B2 in Vero cells.


    Ishimaru, D; Marcicano, F G; Rebello, M A


    The effect of prostaglandins (PGA1 and PGB2) on the replication of Mayaro virus was studied in Vero cells. PGA1 and PGB2 antiviral activity was found to be dose-dependent. However, while 10 micrograms/ml PGB2 inhibited virus yield by 60%, at the same dose PGA1 suppressed virus replication by more than 90%. SDS-PAGE analysis of [35S]-methionine-labelled proteins showed that PGA1 did not alter cellular protein synthesis. In infected cells, PGA1 slightly inhibited the synthesis of protein C, while drastically inhibiting the synthesis of glycoproteins E1 and E2. PMID:9876277

  9. Prevention of lipid peroxidation induced by ochratoxin A in Vero cells in culture by several agents.


    Baudrimont, I; Ahouandjivo, R; Creppy, E E


    Ochratoxin A (OTA) is a mycotoxin produced by Aspergillus ochraceus as well as other moulds. This mycotoxin contaminates animal feed and food and is nephrotoxic for all animal species studied so far. OTA is immunosuppressive, genotoxic, teratogenic and carcinogenic. It is a structural analogue of phenylalanine and contains a chlorinated dihydroisocoumarinic moiety. Ochratoxin A inhibits protein synthesis by competition with phenylalanine in the phenylalanine-tRNA aminoacylation reaction. Recently lipid peroxidation induced by OTA has been reported, indicating that the lesions induced by this toxin could also be related to oxidative damage. An attempt to prevent its toxic effect, mainly the lipid peroxidation, has been made using aspartame (L-aspartyl-L-phenylalanine methyl ester) a structural analogue of both OTA and phenylalanine, piroxicam, a non steroidal anti-inflammatory drug and superoxide dismutase+catalase (endogenous oxygen radical scavengers). Lipid peroxidation was assayed in monkey kidney cells (Vero cells) treated by increasing concentrations of OTA (5-50 microM). After 24 h incubation OTA induced lipid peroxidation in Vero cells in a concentration dependent manner, as measured by malonaldehyde (MDA) production. The MDA production, in Vero cells, was significantly increased by 50.5% from 694.1 +/- 21.0 to 1041.5 +/- 23.5 pmol/mg of protein. In the presence of superoxide dismutase (SOD)+catalase (25 micrograms/ml each) the MDA production induced by OTA was significantly decreased. At 50 microM of OTA concentration (optimal production of MDA) the MDA production decreased from 1041.5 +/- 23.5 to 827.5 +/- 21.3 pmol/mg of protein. SOD and catalase, when applied prior to the toxin, seemed to prevent lipid peroxidation more efficiently than piroxicam (at a ten-fold higher concentration than OTA) and aspartame (at equimolar concentration). These molecules also partially prevented the OTA-induced leakage of MDA in the culture medium. PMID:9158693

  10. Superinfection exclusion is absent during acute Junin virus infection of Vero and A549 cells

    PubMed Central

    Gaudin, Raphaël; Kirchhausen, Tomas


    Many viruses have evolved strategies of so-called “superinfection exclusion” to prevent re-infection of a cell that the same virus has already infected. Although Old World arenavirus infection results in down-regulation of its viral receptor and thus superinfection exclusion, whether New World arenaviruses have evolved such a mechanism remains unclear. Here we show that acute infection by the New World Junin virus (JUNV) failed to down-regulate the transferrin receptor and did not induce superinfection exclusion. We observed that Vero cells infected by a first round of JUNV (Candid1 strain) preserve an ability to internalize new incoming JUNV particles that is comparable to that of non-infected cells. Moreover, we developed a dual infection assay with the wild-type Candid1 JUNV and a recombinant JUNV-GFP virus to discriminate between first and second infections at the transcriptional and translational levels. We found that Vero and A549 cells already infected by JUNV were fully competent to transcribe viral RNA from a second round of infection. Furthermore, flow cytometry analysis of viral protein expression indicated that viral translation was normal, regardless of whether cells were previously infected or not. We conclude that in acutely infected cells, Junin virus lacks a superinfection exclusion mechanism. PMID:26549784

  11. Mathematical model of adherent Vero cell growth and poliovirus production in animal component free medium.


    Ursache, Ramona V; Thomassen, Yvonne E; van Eikenhorst, Gerco; Verheijen, Peter J T; Bakker, Wilfried A M


    Sabin-IPV (or sIPV, inactivated polio vaccine based on attenuated Sabin strains) is anticipated to replace the oral polio vaccine for the endgame in polio eradication. Optimization of sIPV production will lead to a better economically feasible vaccine. To assist process optimization, we studied Sabin type 1 poliovirus (PV) infection kinetics on Vero cells in controlled bioreactor vessels. The aim of our study was to develop a descriptive mathematical model able to capture the dynamics of adherent Vero cell growth and PV infection kinetics in animal component free medium. The model predicts the cell density, metabolites profiles, and viral yields in time. We found that the multiplicity of infection (MOI) and the time of infection (TOI) within the investigated range did not affect maximal PV yields, but they did affect the process time. The latter may be reduced by selecting a low TOI and a high MOI. Additionally, we present a correlation between viral titers and D-antigen, a measure for immunogenicity, of Sabin type 1 PV. The developed model is adequate for further studies of the cell metabolism and infection kinetics and may be used to identify control strategies to increase viral productivity. Increased viral yields reduce costs of polio vaccines with large implications on public health. PMID:25294335

  12. Removing residual DNA from Vero-cell culture-derived human rabies vaccine by using nuclease.


    Li, Si-Ming; Bai, Fu-Liang; Xu, Wen-Juan; Yang, Yong-Bi; An, Ying; Li, Tian-He; Yu, Yin-Hang; Li, De-Shan; Wang, Wen-Fei


    The clearance of host cell DNA is a critical indicator for Vero-cell culture-derived rabies vaccine. In this study, we evaluated the clearance of DNA in Vero-cell culture-derived rabies vaccine by purification process utilizing ultrafiltration, nuclease digestion, and gel filtration chromatography. The results showed that the bioprocess of using nuclease decreased residual DNA. Dot-blot hybridization analysis showed that the residual host cell DNA was <100pg/ml in the final product. The residual nuclease in rabies vaccine was less than 0.1ng/ml protein. The residual nuclease could not paly the biologically active role of digestion of DNA. Experiments of stability showed that the freeze-drying rabies virus vaccine was stable and titers were >5.0IU/ml. Immunogenicity test and protection experiments indicated mice were greatly induced generation of neutralizing antibodies and invoked protective effects immunized with intraperitoneal injections of the rabies vaccine. These results demonstrated that the residual DNA was removed from virus particles and nuclease was removed by gel filtration chromatography. The date indicated that technology was an efficient method to produce rabies vaccine for human use by using nuclease. PMID:25108516

  13. Vero cells expressing porcine circovirus type 2-capsid protein and their diagnostic application.


    Kim, Yeon-Hee; Kweon, Chang-Hee; Kang, Seung-Won; Oh, Yoon I; Song, Jae Young; Lee, Kyoung Ki; Park, Se Chang


    Porcine circovirus type 2 (PCV2) is the causative agent of postweaning multisystemic wasting syndrome (PMWS) in swine. Although the incidences of PCV2-related diseases are ubiquitous throughout the world, the serological tools are rather limited, mainly because the virus does not induce any cytopathic effects in cells. The purpose of this study was to develop a rapid, sensitive and easy quantitative immunofluorescence assay (QIFA) using the recombinant PCV2 nucleocapsid protein (NCP) for the detection of PCV2-specific antibodies in pig sera. The recombinant PCV2 NCP was expressed in Vero cells by a lentivirus system. The performance of QIFA using these Vero cells as a diagnostic antigen was compared with currently available C-ELISA and I-ELISA; the relative sensitivity turned out to range from 92.5% up to 99.3%. The relative specificity was 93.3% when compared to C-ELISA as the gold standard. The serological experiment also indicated the inverse relationship between QIFA and the viral load in serum, semen, feces samples from 7 PCV2-positive boars. In addition, the PCV2 sequence detected from bone marrow cells shows 99% of sequence identity with PCV2 genome, confirming the infectivity of PCV2. PMID:23954842

  14. Avian reovirus triggers autophagy in primary chicken fibroblast cells and Vero cells to promote virus production.


    Meng, Songshu; Jiang, Ke; Zhang, Xiaorong; Zhang, Miao; Zhou, Zhizhi; Hu, Maozhi; Yang, Rui; Sun, Chenli; Wu, Yantao


    Avian reovirus (ARV) is an important cause of disease in poultry. Although ARV is known to induce apoptosis in infected cells, the interaction between ARV and its target cells requires further elucidation. In this report, we show that the ARV isolate strain GX/2010/1 induces autophagy in both Vero and primary chicken embryonic fibroblast (CEF) cells based on the appearance of an increased number of double-membrane vesicles, the presence of GFP-microtubule-associated protein 1 light chain 3 (GFP-LC3) dot formation, and the elevated production of LC3II. We further demonstrate that the class I phosphoinositide 3-kinase (PI3K)/Akt/mTOR pathway contributes to autophagic induction by ARV infection. Moreover, treatment of ARV-infected cells with the autophagy inducer rapamycin increased viral yields, while inhibition of the autophagosomal pathway using chloroquine led to a decrease in virus production. Altogether, our studies strongly suggest that autophagy may play a critical role in determining viral yield during ARV infection. PMID:22241622

  15. Real-time Imaging of Rabies Virus Entry into Living Vero cells

    PubMed Central

    Xu, Haijiao; Hao, Xian; Wang, Shaowen; Wang, Zhiyong; Cai, Mingjun; Jiang, Junguang; Qin, Qiwei; Zhang, Maolin; Wang, Hongda


    Understanding the mechanism of rabies virus (RABV) infection is vital for prevention and therapy of virulent rabies. However, the infection mechanism remains largely uncharacterized due to the limited methods and viral models. Herein, we utilized a powerful single-virus tracking technique to dynamically and globally visualize the infection process of the live attenuated rabies vaccine strain-SRV9 in living Vero cells. Firstly, it was found that the actin-enriched filopodia is in favor of virus reaching to the cell body. Furthermore, by carrying out drug perturbation experiments, we confirmed that RABV internalization into Vero cells proceeds via classical dynamin-dependent clathrin-mediated endocytosis with requirement for intact actin, but caveolae-dependent endocytosis is not involved. Then, our real-time imaging results unambiguously uncover the characteristics of viral internalization and cellular transport dynamics. In addition, our results directly and quantitatively reveal that the intracellular motility of internalized RABV particles is largely microtubule-dependent. Collectively, our work is crucial for understanding the initial steps of RABV infection, and elucidating the mechanisms of post-infection. Significantly, the results provide profound insight into development of novel and effective antiviral targets. PMID:26148807

  16. Estimation of the Cultured Cells’ Volume and Surface Area: Application of Stereological Methods on Vero Cells Infected by Rubella Virus

    PubMed Central

    Noorafshan, Ali; Motamedifar, Mohammad; Karbalay-Doust, Saied


    Background: Morphological changes of the cells infected with rubella virus cannot be observed easily. Estimation of the size of the cultured cells can be a valuable parameter in this condition. This study was conducted to find answers to the following questions: How much time after infection with rubella virus, the volume and surface area of the Vero cells and their nuclei get started to change?How is it possible to apply stereological methods to estimate the volume and surface area of the cultured cells using the invariator, nucleator, and surfactor techniques? Methods: The cultured Vero cells were infected with rubella virus. The cells of the control and experimental groups were harvested at 2, 4, 8, 24, and 48 hours following the incubation period. The cells were processed and embedded in paraffin. Invariator, nucleator, and surfactor were applied to estimate the size of the Vero cells and their nuclei. Results: The cell volume was decreased by 15-24%, 48 hours after the infection in comparison to the non-infected cells. Besides, the cell surface area was decreased by 13%, 48 hours after the infection. However, no changes were detected in the nuclei. The values of the standard deviation and coefficient of variation of the cells, estimated by invariator, were lower compared to those measured by the nucleator or surfactor. Conclusion: In this study, the volume and surface area of the Vero cells were reduced by rubella virus 48 hours after infection. Invariator is a more precise method compared to nucleator or surfactor. PMID:26722143

  17. Diphtheria toxin-induced channels in Vero cells selective for monovalent cations

    SciTech Connect

    Sandvig, K.; Olsnes, S.


    Ion fluxes associated with translocation of diphtheria toxin across the surface membrane of Vero cells were studied. When cells with surface-bound toxin were exposed to low pH to induce toxin entry, the cells became permeable to Na+, K+, H+, choline+, and glucosamine+. There was no increased permeability to Cl-, SO4(-2), glucose, or sucrose, whereas the uptake of /sup 45/Ca2+ was slightly increased. The influx of Ca2+, which appears to be different from that of monovalent cations, was reduced by several inhibitors of anion transport and by verapamil, Mn2+, Co2+, and Ca2+, but not by Mg2+. The toxin-induced fluxes of N+, K+, and protons were inhibited by Cd2+. Cd2+ also protected the cells against intoxication by diphtheria toxin, suggesting that the open cation-selective channel is required for toxin translocation. The involvement of the toxin receptor is discussed.

  18. Cytotoxicity of methanol extracts of Elaeis guineensis on MCF-7 and Vero cell lines

    PubMed Central

    Vijayarathna, Soundararajan; Sasidharan, Sreenivasan


    Objective To investigate the cytotoxic effect of Elaeis guineensis methanol extract on MCF-7 and Vero cell. Methods In vitro cytotoxicity was evaluated in by MTT assay. Cell morphological changes were observed by using light microscope. Results The MTT assay indicated that methanol extract of the plant exhibited significant cytotoxic effects on MCF-7. Morphological alteration of the cell lines after exposure with Elaeis guineensis extract were observed under phase contrast microscope in the dose dependent manner. Conclusions The results suggest the probable use of the Elaeis guineensis methanol extract in preparing recipes for cancer-related ailments. Further studies on isolation of metabolites and their in vivo cytotoxicity are under investigation. PMID:23569855

  19. Inhibition of Mayaro virus replication by prostaglandin A(1) in Vero cells.


    Burlandy, F M; Rebello, M A


    Prostaglandins exhibit antiviral activity against a wide variety of RNA and DNA viruses. In the present report, we describe the effect of cyclopentenone prostaglandin A(1) (PGA(1)) on Mayaro virus replication in Vero cells. Virus yield was significantly reduced at nontoxic concentrations which did not suppress DNA, RNA or protein synthesis in uninfected or infected cells. Antiviral action decreased if PGA(1) was added at later times after infection. In Mayaro virus-infected cells, PGA(1) inhibited the synthesis of virus proteins. This effect is accompanied by the induction of heat shock proteins (HSPs). Actinomycin D treatment not only inhibited the induction of HSPs but also partially prevented PGA(1) antiviral activity. PMID:11805440

  20. RNA interference targeting virion core protein ORF095 inhibits Goatpox virus replication in Vero cells

    PubMed Central


    Background Goatpox is an economically important disease in goat and sheep-producing areas of the world. Many vaccine strategies developed to control the disease are not yet completely successful. Hairpin expression vectors have been used to induce gene silencing in a large number of studies on viruses. However, none of these studies has been attempted to study GTPV. In the interest of exploiting improved methods to control goat pox, it is participated that RNAi may provide effective protection against GTPV. In this study we show the suppression of Goatpox virus (GTPV) replication via knockdown of virion core protein using RNA interference. Results Four short interfering RNA (siRNA) sequences (siRNA-61, siRNA-70, siRNA-165 and siRNA-296) against a region of GTPV ORF095 were selected. Sense and antisense siRNA-encoding sequences separated by a hairpin loop sequence were designed as short hairpin RNA (shRNA) expression cassettes under the control of a human U6 promoter. ORF095 amplicon was generated using PCR, and then cloned into pEGFP-N1 vector, named as p095/EGFP. p095/EGFP and each of the siRNA expression cassettes (p61, p70, p165 and p296) were co-transfected into BHK-21 cells. Fluorescence detection, flow cytometric analysis, retro transcription PCR (RT-PCR) and real time PCR were used to check the efficiency of RNAi. The results showed that the ORF095-specific siRNA-70 effectively down-regulated the expression of ORF095. When Vero cells were transfected with shRNA expression vectors (p61/GFP, p70/GFP, p165/GFP and p296/GFP) and then infected with GTPV, GTPV-ORF095-70 was found to be the most effective inhibition site in decreasing cytopathic effect (CPE) induced by GTPV. The results presented here indicated that DNA-based siRNA could effectively inhibit the replication of GTPV (approximately 463. 5-fold reduction of viral titers) on Vero cells. Conclusions This study demonstrates that vector-based shRNA methodology can effectively inhibit GTPV replication on Vero cells. Simultaneously, this work represents a strategy for controlling goatpox, potentially facilitating new experimental approaches in the analysis of both viral and cellular gene functions during of GTPV infection. PMID:22340205

  1. [Comparison of the indirect immunofluorescence assay performance of Bartonella henselae antigens obtained by co-cultivation in Vero and HeLa cells].


    Ergin, Ca?r?; Akkaya, Yksel; Kiri? Sat?lm??, Ozgn; Y?lmaz, Cansev


    The laboratory diagnosis of Bartonella henselae infection is mainly based on serological testing by indirect immunofluorescence assay (IFA). Cell line co-cultivation with B.henselae and agar derivated antigens are the two major procedures used for evaluation of anti-Bartonella antibodies. Vero and Hep-2 cell lines are the most commonly used media for co-cultivation both in-house and commercial diagnostic kits production. However, HeLa cells which are easily supplied and grown, also can easily be infected by B.henselae. The aim of this study was to compare the performances of antigens obtained by co-cultivation of B.henselae ATCC 49882 (Houston-1) in Vero and HeLa Cells in IFA serology. Out of 381 sera samples, 127 (33.3%) were found positive and 195 (51.2%) were found negative by IFA performed by both cell line co-cultivations. The total agreement between the methods were found as 84.5% (322/381), and Cohen kappa value was calculated as 0.68 (strong, coherent). As a result, He-La cells were found to be useful for the preparation of B.henselae antigens to be used in IFA for the serologic diagnosis of B.henselae infections. However different genotype strains and cross reactions with other infectious agents should be investigated by further studies before routine applications of HeLa cell co-cultivations procedure is established. PMID:21935779

  2. Chemical Induction of Endogenous Retrovirus Particles from the Vero Cell Line of African Green Monkeys?

    PubMed Central

    Ma, Hailun; Ma, Yunkun; Ma, Wenbin; Williams, Dhanya K.; Galvin, Teresa A.; Khan, Arifa S.


    Endogenous retroviral sequences are present in high copy numbers in the genomes of all species and may be expressed as RNAs; however, the majority are defective for virus production. Although virus has been isolated from various Old World monkey and New World monkey species, there has been no report of endogenous retroviruses produced from African green monkey (AGM) tissues or cell lines. We have recently developed a stepwise approach for evaluating the presence of latent viruses by chemical induction (Khan et al., Biologicals 37:196201, 2009). Based upon this strategy, optimum conditions were determined for investigating the presence of inducible, endogenous retroviruses in the AGM-derived Vero cell line. Low-level reverse transcriptase activity was produced with 5-azacytidine (AzaC) and with 5?-iodo-2?-deoxyuridine (IUdR); none was detected with sodium butyrate. Nucleotide sequence analysis of PCR-amplified fragments from the gag, pol, and env regions of RNAs, prepared from ultracentrifuged pellets of filtered supernatants, indicated that endogenous retrovirus particles related to simian endogenous type D betaretrovirus (SERV) sequences and baboon endogenous virus type C gammaretrovirus (BaEV) sequences were induced by AzaC, whereas SERV sequences were also induced by IUdR. Additionally, sequence heterogeneity was seen in the RNAs of SERV- and BaEV-related particles. Infectivity analysis of drug-treated AGM Vero cells showed no virus replication in cell lines known to be susceptible to type D simian retroviruses (SRVs) and to BaEV. The results indicated that multiple, inducible endogenous retrovirus loci are present in the AGM genome that can encode noninfectious, viruslike particles. PMID:21543506

  3. Chemical induction of endogenous retrovirus particles from the vero cell line of African green monkeys.


    Ma, Hailun; Ma, Yunkun; Ma, Wenbin; Williams, Dhanya K; Galvin, Teresa A; Khan, Arifa S


    Endogenous retroviral sequences are present in high copy numbers in the genomes of all species and may be expressed as RNAs; however, the majority are defective for virus production. Although virus has been isolated from various Old World monkey and New World monkey species, there has been no report of endogenous retroviruses produced from African green monkey (AGM) tissues or cell lines. We have recently developed a stepwise approach for evaluating the presence of latent viruses by chemical induction (Khan et al., Biologicals 37:196-201, 2009). Based upon this strategy, optimum conditions were determined for investigating the presence of inducible, endogenous retroviruses in the AGM-derived Vero cell line. Low-level reverse transcriptase activity was produced with 5-azacytidine (AzaC) and with 5'-iodo-2'-deoxyuridine (IUdR); none was detected with sodium butyrate. Nucleotide sequence analysis of PCR-amplified fragments from the gag, pol, and env regions of RNAs, prepared from ultracentrifuged pellets of filtered supernatants, indicated that endogenous retrovirus particles related to simian endogenous type D betaretrovirus (SERV) sequences and baboon endogenous virus type C gammaretrovirus (BaEV) sequences were induced by AzaC, whereas SERV sequences were also induced by IUdR. Additionally, sequence heterogeneity was seen in the RNAs of SERV- and BaEV-related particles. Infectivity analysis of drug-treated AGM Vero cells showed no virus replication in cell lines known to be susceptible to type D simian retroviruses (SRVs) and to BaEV. The results indicated that multiple, inducible endogenous retrovirus loci are present in the AGM genome that can encode noninfectious, viruslike particles. PMID:21543506

  4. Directional actin polymerization associated with spotted fever group Rickettsia infection of Vero cells.

    PubMed Central

    Heinzen, R A; Hayes, S F; Peacock, M G; Hackstadt, T


    Members of the spotted fever group (SFG) of rickettsiae spread rapidly from cell to cell by an unknown mechanism(s). Staining of Rickettsia rickettsii-infected Vero cells with rhodamine phalloidin demonstrated unique actin filaments associated with one pole of intracellular rickettsiae. F-actin tails greater than 70 microns in length were seen extending from rickettsiae. Treatment of infected cells with chloramphenicol eliminated rickettsia-associated F-actin tails, suggesting that de novo protein synthesis of one or more rickettsial proteins is required for tail formation. Rickettsiae were coated with F-actin as early as 15 min postinfection, and tail formation was detected by 30 min. A survey of virulent and avirulent species within the SFG rickettsiae demonstrated that all formed actin tails. Typhus group rickettsiae, which do not spread directly from cell to cell, lacked F-actin tails entirely or exhibited only very short tails. Transmission electron microscopy demonstrated fibrillar material in close association with R. rickettsii but not Rickettsia prowazekii. Biochemical evidence that actin polymerization plays a role in movement was provided by showing that transit of R. rickettsii from infected cells into the cell culture medium was inhibited by treatment of host cells with cytochalasin D. These data suggest that the cell-to-cell transmission of SFG rickettsiae may be aided by induction of actin polymerization in a fashion similar to that described for Shigella flexneri and Listeria monocytogenes. Images PMID:8478082

  5. Genetic stability of oral polio vaccine prepared on primary monkey kidney cells or Vero cells--effects of passage in cell culture and the human gastrointestinal tract.


    Chezzi, C; Dommann, C J; Blackburn, N K; Maselesele, E; McAnerney, J; Schoub, B D


    The genetic stability of the three Sabin oral poliovaccine (OPV) strains produced on either primary monkey kidney (VK) or Vero cell substrates was compared in vivo and in vitro by measuring the rate at which the bases most strongly associated with attenuation and reversion to neurovirulence (positions 480, 481, and 472 in the 5' non-coding region of Sabin 1, 2 and 3 respectively, and 2034 in VP3 of Sabin 3) reverted during passage of the vaccine strains in the gastrointestinal tract of primary vaccinees and in cell culture. For the in vivo study, the poliovirus excretion patterns of 21 infants receiving OPV produced on either VK or Vero cells were followed for 21 days. No significant differences in either the frequency of excretion or the rate of reversion were observed between the two vaccine groups. The rate of accumulation of revertants during passage in vitro was compared for the three Sabin strains passaged 10 times in either VK or Vero cells. For types 1 and 3, revertants accumulated faster upon passage through VK cells compared with passage through Vero cells. Type 2 appeared to be stable as no revertants were detected in either cell type. Results of this study suggest that the use of Vero as opposed to VK cells as substrate for the manufacture of OPV does not negatively influence the genetic stability of the three Sabin OPV strains in vivo or in vitro. PMID:9796061

  6. Photoirradiation study of gold nanospheres and rods in Vero and Hela cell lines

    NASA Astrophysics Data System (ADS)

    Gananathan, Poorani; Aruna, Prakasarao; Ganesan, Singaravelu; Elanchezhiyan, Manickan


    Photoirradiation effect of gold nanospheres in conjucation with green light and rods in conjugation with red light corresponds to their absorption wavelength range found to be appreciable. In this present work concentration of nanomaterial and light dose were optimized. Gold nanospheres were synthesized by reduction technique using Sodium Borohydrate as reducing agent and Trisodium Citrate as capping agent. Au nanorods having 680-900nm absorption were synthesized using reduction techniques with CTAB and BDAC polymers. From UV-Vis absorption and Transmission Electron Microscopy the size of nanoparticles were confirmed. 30nm Gold nanospheres and green light source of 530nm wavelength with power 30mW were applied to Vero and Hela cell lines shows higher toxicity for Hela cells. Nanorods were applied and irradiated with 680nm wavelength light source with light intensity 45mW. Post irradiation effect for 24hrs, 48hrs confirms cell proliferation in normal rate in viable cells. The morphological changes in irradiated spot leads to apoptotoic cell death was confirmed with microscopic imaging. The LD50 value was also calculated.

  7. Label free detection of pseudorabies virus infection in Vero cells using laser force analysis.


    Hebert, Colin G; Hart, Sean J; Terray, Alex


    The rapid and robust identification of viral infections has broad implications for a number of fields, including medicine, biotechnology and biodefense. Most detection systems rely on specific molecules, such as nucleic acids or proteins, to identify the target(s) of interest. These molecules afford great specificity, but are often expensive, labor-intensive, labile and limited in scope. Label free detection methods seek to overcome these limitations by instead using detection methods that rely on intrinsic properties as a basis for identifying and separating species of interest and thus do not rely on specific prior knowledge of the target. Optical chromatography, one such technique, uses the balance between optical and fluidic drag forces within a microfluidic channel to determine the optical force on cells or particles. Here we present the application of individual optical force measurements as a means of investigating pseudorabies virus infection in Vero cells. Optical force differences are seen between cells from uninfected and infected populations at a multiplicity of infection as low as 0.001 and as soon as 2 hours post infection, demonstrating the potential of this technique as a means of detecting viral infection. Through the application of a pattern recognition neural network, individual cell size data are combined with optical force as a means of classifying cell populations. Potential applications include the early detection of bloodborne pathogens for the prevention of sepsis and other diseases as well as the detection of biological threat agents. PMID:24492491

  8. Reduction of the ochratoxin A-induced cytotoxicity in Vero cells by aspartame.


    Baudrimont, I; Betbeder, A M; Creppy, E E


    Ochratoxin A (OTA) is a mycotoxin produced by Aspergillus ochraceus as well as other moulds. This mycotoxin contaminates animal feed and human food and is nephrotoxic for all animal species studied so far. OTA is immunosuppressive, genotoxic, teratogenic and carcinogenic. Recently lipid peroxidation induced by OTA has been reported. OTA, a structural analogue of phenylalanine, inhibits protein synthesis by competition with phenylalanine in the phenylalanine-tRNA aminoacylation reaction, constituting the main mechanism of OTA-induced cytotoxicity. Since it seems impossible to avoid contamination of foodstuffs by toxigenic fungi, investigation is required for preventing the toxicity of OTA. An attempt to prevent its toxic effect, mainly the inhibition of protein synthesis, has been made using aspartame (L-aspartyl-L-phenylalanine methyl ester) a structural analogue of both OTA and phenylalanine. Protein synthesis was assayed in monkey kidney cells (Vero cells) treated by increasing concentrations of OTA (10-100 microM). After 24 h incubation, protein synthesis was inhibited by OTA in a concentration dependent manner (the 50% inhibitory concentration, IC50, was c. 14.5 microM). Aspartame (A19), at tenfold higher concentrations than OTA (100-1000 microM), was found to partially protect against the OTA-induced inhibition of protein synthesis in Vero cells, and more efficiently when added 24 h prior to the toxin (IC50 34 microM) than together (IC50 22 microM). As expected A19(250 microM) prevented the OTA-induced leakage of certain enzymes, including lactate dehydrogenase, gamma-glutamyl transferase, alkaline phosphatase, into the culture medium, and the concomitant decrease of their intracellular activity in OTA (25 microM)-treated cells. In order to investigate the effect of aspartame (A19) on OTA-protein binding as explanation of the above results, the mycotoxin time- and concentration-dependent binding to human samples was studied in static diffusion cells with two compartments separated by a dialysis membrane. When A19 (34 microM) was added to the upper compartment containing plasma before installing OTA (50, 250, 1240 microM) in the lower one. OTA binding was largely prevented (95-98%). When A19 (34 microM) was added to the lower compartment simultaneously with the toxin (50, 250, 1240 microM), for the lowest concentration of OTA, the same efficiency was shown in preventing OTA binding, but at the two high concentrations A19 seemed less efficient. PMID:9137807

  9. VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt

    PubMed Central

    Vilchez Larrea, Salom C.; Kun, Alejandra


    Poly-ADP-ribose (PAR) is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs) and degraded by poly-ADP-ribose-glycohydrolase (PARG). Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair). Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt). In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO). PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications. PMID:25332845

  10. VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt.


    Lafon-Hughes, Laura; Vilchez Larrea, Salom C; Kun, Alejandra; Fernndez Villamil, Silvia H


    Poly-ADP-ribose (PAR) is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs) and degraded by poly-ADP-ribose-glycohydrolase (PARG). Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair). Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt). In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO). PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications. PMID:25332845

  11. Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

    PubMed Central

    de la Torre, Juan Carlos; Martnez-Sobrido, Luis


    The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells. PMID:23928556

  12. A single NS2 mutation of K86R promotes PR8 vaccine donor virus growth in Vero cells.


    Zhang, Hong; Han, Qinglin; Ping, Xianqiang; Li, Li; Chang, Chong; Chen, Ze; Shu, Yuelong; Xu, Ke; Sun, Bing


    Vaccination is the most effective way to prevent and control infection by influenza viruses, and a cell-culture-based vaccine production system is preferred as the future choice for the large-scale production of influenza vaccines. As one of the WHO-recommended cell lines for producing influenza vaccines, Vero cells do not efficiently support the growth of the current influenza A virus vaccine donor strain, the A/Puerto Rico/8/1934 (PR8) virus. In this study, a single mutation of K86R in the NS2 protein can sufficiently render the high-yielding property to the PR8 virus in Vero cells. Further analysis showed that the later steps in the virus replication cycle were accelerated by NS2(K86R) mutation, which may relate to an enhanced interaction between NS2(K86R) and the components of host factor F1Fo-ATPase, FoB and F1?. Because the NS2(K86R) mutation does not increase PR8 virulence in either mice or embryonated eggs, the PR8-NS2(K86R) virus could serve as a promising vaccine donor strain in Vero cells. PMID:25817403

  13. The Effect of Vero Cell Coculture on the Development of Mouse Embryos Exposed to Monoclonal Antibodies Specific for Mammalian Heat Shock Protein 60

    PubMed Central

    Noh, Ji Hyun; Chung, Kyung Nam


    Heat shock proteins (HSP) have been identified as an important factor of a very complex and highly conserved cellular defense mechanism to preserve cell survival under adverse environmental conditions. HSP 60 are immunodominant antigens of microbe such as Chlamydia trachomatis and have a potentiality to become a target antigen due to antigenic similarity between chlamydial and human HSP. This study was conducted to investigate the effects of Vero cell coculture to anti-HSP 60 on the early mouse embryo development in vitro. The 2-cell mouse embryos (ICR) were cultured and mouse embryo development was observed every 24 hr for 3 days. 45% and 22.1% of the embryos cultured in Ham's F-10 plus anti HSP 60 with Vero cells developed to the 4- to 8-cell stage (day 1) and morular stage (day 2) as compared with 29.2% and 2.7% of those cultured without Vero cells respectively. But at day 3, the beneficial effect of Vero cells was not noted. These findings suggest that Vero cells have some roles to overcome the detrimental effect of anti-HSP 60 to some degree. These results suggest that Vero cells coculture will promote reproductive outcome in patient previously sensitized to microbial (e.g. Chlamydia trachomatis) HSP 60. PMID:16614519

  14. VeroNectin-4 is a highly sensitive cell line that can be used for the isolation and titration of Peste des Petits Ruminants virus.


    Fakri, F; Elarkam, A; Daouam, S; Tadlaoui, K; Fassi-Fihri, O; Richardson, C D; Elharrak, M


    Peste des Petits Ruminants virus (PPRV) is a member of the Morbillivirus subgroup of the family Paramyxoviridae, and is one of the most contagious diseases of small ruminants throughout Africa and the rest of the world. Different cell lines have previously been used to isolate PPRV but with limited success. Thus, to improve the isolation of Morbilliviruses, human, canine, and goat homologues of the lymphocyte receptor signaling lymphocyte activation molecule (SLAM) have been introduced into cells that can support virus replication. However, the amino acid sequence of SLAM varies between species, and often requires adaptation of a particular virus to different versions of the receptor. The protein sequence of Nectin-4 is highly conserved between different mammals, which eliminate the need for receptor adaptation by the virus. Cell lines expressing Nectin-4 have previously been used to propagate measles and canine distemper viruses. In this study, we compared infections in Vero cells expressing canine SLAM (VeroDogSLAM) to those in Vero cells expressing Nectin-4 (VeroNectin-4), following inoculations with wild-type strains of PPRV. Virus isolation using VeroNectin-4 cells was successful with 23% of swabbed samples obtained from live infected animals, and was 89% effective using post-mortem tissues of infected sheep. By contrast, only 4.5% efficiency was observed from swab samples and 67% efficiency was obtained in virus isolation from post-mortem tissues using VeroDogSLAM cells. The average incubation period for virus recovery from post-mortem tissues was 3.4 days using VeroNectin-4 cells, compared with 5.5 days when using VeroDogSLAM cells. The virus titers of PPRV obtained from VeroNectin-4 cells were also higher than those derived from VeroDogSLAM cells. A comparison of the growth kinetics for PPRV in the two cell lines confirmed the superiority of VeroNectin-4 cells for PPR diagnostic purposes and vaccine virus titration. PMID:26615804

  15. An inactivated yellow fever 17DD vaccine cultivated in Vero cell cultures.


    Pereira, Renata C; Silva, Andrea N M R; Souza, Marta Cristina O; Silva, Marlon V; Neves, Patrícia P C C; Silva, Andrea A M V; Matos, Denise D C S; Herrera, Miguel A O; Yamamura, Anna M Y; Freire, Marcos S; Gaspar, Luciane P; Caride, Elena


    Yellow fever is an acute infectious disease caused by prototype virus of the genus Flavivirus. It is endemic in Africa and South America where it represents a serious public health problem causing epidemics of hemorrhagic fever with mortality rates ranging from 20% to 50%. There is no available antiviral therapy and vaccination is the primary method of disease control. Although the attenuated vaccines for yellow fever show safety and efficacy it became necessary to develop a new yellow fever vaccine due to the occurrence of rare serious adverse events, which include visceral and neurotropic diseases. The new inactivated vaccine should be safer and effective as the existing attenuated one. In the present study, the immunogenicity of an inactivated 17DD vaccine in C57BL/6 mice was evaluated. The yellow fever virus was produced by cultivation of Vero cells in bioreactors, inactivated with β-propiolactone, and adsorbed to aluminum hydroxide (alum). Mice were inoculated with inactivated 17DD vaccine containing alum adjuvant and followed by intracerebral challenge with 17DD virus. The results showed that animals receiving 3 doses of the inactivated vaccine (2 μg/dose) with alum adjuvant had neutralizing antibody titers above the cut-off of PRNT50 (Plaque Reduction Neutralization Test). In addition, animals immunized with inactivated vaccine showed survival rate of 100% after the challenge as well as animals immunized with commercial attenuated 17DD vaccine. PMID:25862300

  16. Amino acids substitutions in ?1 and ?1 outer capsid proteins of a Vero cell-adapted mammalian orthoreovirus are required for optimal virus binding and disassembly.


    Sandekian, Vronique; Lemay, Guy


    In a recent study, the serotype 3 Dearing strain of mammalian orthoreovirus was adapted to Vero cells; cells that exhibit a limited ability to support the early steps of reovirus uncoating and are unable to produce interferon as an antiviral response upon infection. The Vero cell-adapted virus (VeroAV) exhibits amino acids substitutions in both the ?1 and ?1 outer capsid proteins but no changes in the ?3 protein. Accordingly, the virus was shown not to behave as a classical uncoating mutant. In the present study, an increased ability of the virus to bind at the Vero cell surface was observed and is likely associated with an increased ability to bind onto cell-surface sialic acid residues. In addition, the kinetics of ?1 disassembly from the virions appears to be altered. The plasmid-based reverse genetics approach confirmed the importance of ?1 amino acids substitutions in VeroAV's ability to efficiently infect Vero cells, although ?1 co-adaptation appears necessary to optimize viral infection. This approach of combining in vitro selection of reoviruses with reverse genetics to identify pertinent amino acids substitutions appears promising in the context of eventual reovirus modification to increase its potential as an oncolytic virus. PMID:25445342

  17. Comparison of herpes simplex (HSV) proteins synthesized in Vero, HEP-2 and human megakaryocyte-like cell lines

    SciTech Connect

    Soslau, G.; Pastorino, M.B.; Morgan, D.A.; Brodsky, I.; Howett, M.K.


    The natural human host blood cell capable of supporting herpes virus replication has yet to be defined. They found that a recently cultured human megakaryocyte-like (Meg) cell line can support HSV 1 and 2 replication as demonstrated by growth inhibition, CPE, virus production and HSV DNA synthesis. The HSV proteins synthesized and post-translationally modified in Vero and HEp-2 infected cells were compared to the protein species produced in the infected Meg cell since differences may influence antigenic properties and host range. Host cell protein synthesis was greatly reduced in all three cell lines within hours post infection (pi). However, maximum viral protein synthesis occurs between 4 and 24 hrs pi with the Meg cells as compared to 24-48 hrs pi with the other cell lines. The immunoprecipitated /sup 35/S-methionine labeled HSV protein gel patterns for each infected cell line are qualitatively and quantitatively very different from each other. Dramatic differences were also observed when infected cells were labeled with /sup 32/P-ATP (in vitro method) or /sup 32/Pi (in vivo method). Finally, analysis of /sup 3/H-mannose labeled HSV glycoproteins demonstrates that the post-translational modifications of these proteins are significantly altered in the Meg cell as compared to the Vero and HEp-2 cells.

  18. Vero microcultures for adenovirus neutralization tests.

    PubMed Central

    Hierholzer, J C; Bingham, P G


    A microculture neutralization test is described for measuring specific antibody levels to the 35 human adenovirus serotypes in Vero cells. The test is read at 5 days by macroscopic observation after staining the uninfected cells with crystal violet. The test is performed with a minimum of manipulations and gives serum titers comparable with those obtained in tube macrocultures of monkey kidney, human embryonic kidney, and Vero cells. The Vero microculture neutralization test measures inhibition of adenovirus toxicity, although selected human adenoviruses serially subpassaged in Vero cells were shown to successfully adapt and replicate in the absence of detectable helper viruses. Images PMID:670375

  19. Phorbol Esters Isolated from Jatropha Meal Induced Apoptosis-Mediated Inhibition in Proliferation of Chang and Vero Cell Lines

    PubMed Central

    Oskoueian, Ehsan; Abdullah, Norhani; Ahmad, Syahida


    The direct feeding of Jatropha meal containing phorbol esters (PEs) indicated mild to severe toxicity symptoms in various organs of different animals. However, limited information is available on cellular and molecular mechanism of toxicity caused by PEs present in Jatropha meal. Thus, the present study was conducted to determine the cytotoxic and mode of action of PEs isolated from Jatropha meal using human hepatocyte (Chang) and African green monkey kidney (Vero) cell lines. The results showed that isolated PEs inhibited cell proliferation in a dose-dependent manner in both cell lines with the CC50 of 125.9 and 110.3 ?g/mL, respectively. These values were compatible to that of phorbol 12-myristate 13-acetate (PMA) values as positive control i.e., 124.5 and 106.3 ?g/mL respectively. Microscopic examination, flow cytometry and DNA fragmentation results confirmed cell death due to apoptosis upon treatment with PEs and PMA at CC50 concentration for 24 h in both cell lines. The Western blot analysis revealed the overexpression of PKC-? and activation of caspase-3 proteins which could be involved in the mechanism of action of PEs and PMA. Consequently, the PEs isolated form Jatropha meal caused toxicity and induced apoptosis-mediated proliferation inhibition toward Chang and Vero cell lines involving over-expression of PKC-? and caspase-3 as their mode of actions. PMID:23203036

  20. Dengue-3 Virus Entry into Vero Cells: Role of Clathrin-Mediated Endocytosis in the Outcome of Infection

    PubMed Central

    Piccini, Luana E.; Castilla, Viviana; Damonte, Elsa B.


    The endocytic uptake and intracellular trafficking for penetration of DENV-3 strain H-87 into Vero cells was analyzed by using several biochemical inhibitors and dominant negative mutants of cellular proteins. The results presented show that the infective entry of DENV-3 into Vero cells occurs through a non-classical endocytosis pathway dependent on low pH and dynamin, but non-mediated by clathrin. After uptake, DENV-3 transits through early endosomes to reach Rab 7-regulated late endosomes, and according with the half-time for ammonium chloride resistance viral nucleocapsid is released into the cytosol approximately at 12 min post-infection. Furthermore, the influence of the clathrin pathway in DENV-3 infective entry in other mammalian cell lines of human origin, such as A549, HepG2 and U937 cells, was evaluated demonstrating that variable entry pathways are employed depending on the host cell. Results show for the first time the simultaneous coexistence of infective and non -infective routes for DENV entry into the host cell, depending on the usage of clathrin-mediated endocytosis. PMID:26469784

  1. Shiga toxin glycosphingolipid receptors of Vero-B4 kidney epithelial cells and their membrane microdomain lipid environment.


    Steil, Daniel; Schepers, Catherine-Louise; Pohlentz, Gottfried; Legros, Nadine; Runde, Jana; Humpf, Hans-Ulrich; Karch, Helge; Mthing, Johannes


    Shiga toxins (Stxs) are produced by enterohemorrhagic Escherichia coli (EHEC), which cause human infections with an often fatal outcome. Vero cell lines, derived from African green monkey kidney, represent the gold standard for determining the cytotoxic effects of Stxs. Despite their global use, knowledge about the exact structures of the Stx receptor glycosphingolipids (GSLs) and their assembly in lipid rafts is poor. Here we present a comprehensive structural analysis of Stx receptor GSLs and their distribution to detergent-resistant membranes (DRMs), which were prepared from Vero-B4 cells and used as lipid raft equivalents. We identified globotriaosylceramide (Gb3Cer) and globotetraosylceramide (Gb4Cer) as the GSL receptors for Stx1a, Stx2a, and Stx2e subtypes using TLC overlay detection combined with MS. The uncommon Stx receptor, globopentaosylceramide (Gb5Cer, Gal?3GalNAc?3Gal?4Gal?4Glc?1Cer), which was specifically recognized (in addition to Gb3Cer and Gb4Cer) by Stx2e, was fully structurally characterized. Lipoforms of Stx receptor GSLs were found to mainly harbor ceramide moieties composed of sphingosine (d18:1) and C24:0/C24:1 or C16:0 fatty acid. Moreover, co-occurrence with lipid raft markers, SM and cholesterol, in DRMs suggested GSL association with membrane microdomains. This study provides the basis for further exploring the functional impact of lipid raft-associated Stx receptors for toxin-mediated injury of Vero-B4 cells. PMID:26464281

  2. High cell density perfusion cultures of anchorage-dependent Vero cells in a depth filter perfusion system.


    Choi, S K; Chang, H N; Lee, G M; Kim, I H; Oh, D J


    A depth filter perfusion system (DFPS) with polypropylene fibers had been demonstrated to support high density cultures of anchorage-independent hybridoma cells. The DFPS provides advantages of high surface-to-volume ratio of 450-600 cm(2)/cm(3), low cost set-up, easy operation and scale-up. To test the feasibility of using DFPS for high density cultures of anchorage-dependent cells, Vero cells were cultivated in the DFPS. Gelatin coating on polypropylene fibers in the DFPS was necessary to promote cell attachment and growth. Dissolved oxygen (DO) concentrations could be controlled by sparging air into the reservoir vessel through a filter sparger. When DO concentration was controlled above 40% of air saturation in the DFPS with 40 μm pore size, the maximum cell concentration as estimated on specific lactate production rate, was 3.81×10(7) cells/ml of the total reactor volume. This viable cell concentration is approximately 18 times higher than that obtained in a T-flask batch culture. Taken together, the results obtained here showed the potential of DFPS for high-density cultures of anchorage-dependent cells. PMID:22358557

  3. Preclinical evaluation of Vaxfectin-adjuvanted Vero cell-derived seasonal split and pandemic whole virus influenza vaccines

    PubMed Central

    Smith, Larry R.; Wodal, Walter; Crowe, Brian A.; Kerschbaum, Astrid; Bruehl, Peter; Schwendinger, Michael G.; Savidis-Dacho, Helga; Sullivan, Sean M.; Shlapobersky, Mark; Hartikka, Jukka; Rolland, Alain; Barrett, P. Noel; Kistner, Otfried


    Increasing the potency and supply of seasonal and pandemic influenza vaccines remains an important unmet medical need which may be effectively accomplished with adjuvanted egg- or cell culture-derived vaccines. Vaxfectin, a cationic lipid-based adjuvant with a favorable safety profile in phase 1 plasmid DNA vaccines trials, was tested in combination with seasonal split, trivalent and pandemic whole virus, monovalent influenza vaccines produced in Vero cell cultures. Comparison of hemagglutination inhibition (HI) antibody titers in Vaxfectin-adjuvanted to nonadjuvanted vaccinated mice and guinea pigs revealed 3- to 20-fold increases in antibody titers against each of the trivalent influenza virus vaccine strains and 2- to 8-fold increases in antibody titers against the monovalent H5N1 influenza virus vaccine strain. With the vaccine doses tested, comparable antibody responses were induced with formulations that were freshly prepared or refrigerated at conventional 28C storage conditions for up to 6 mo. Comparison of T-cell frequencies measured by interferon-gamma ELISPOT assay between groups revealed increases of between 2- to 10-fold for each of the adjuvanted trivalent strains and up to 22-fold higher with monovalent H5N1 strain. Both trivalent and monovalent vaccines were easy to formulate with Vaxfectin by simple mixing. These preclinical data support further testing of Vaxfectin-adjuvanted Vero cell culture vaccines toward clinical studies designed to assess safety and immunogenicity of these vaccines in humans. PMID:23857272

  4. Isolation, purification, LC-MS/MS characterization and reactive oxygen species induced by fumonisin B1 in VERO cells.


    Meca, Giuseppe; Ruiz, Maria Jos; Fernandez-Franzn, Monica; Ritieni, Alberto; Manes, Jordi


    Fumonisins are mycotoxins produced by Fusarium verticillioides that commonly contaminate maize and maize products. The present work shows the results of a comparative study of three different fermentation's techniques (solid and liquid medium of corn and a solid agarized medium) for the production of fumonisins B(1), B(2) and B(3) with strains of F. verticillioides. The solid medium of corn was the most effective in the production of fumonisins, being Fumonisin B(1) the one produced with higher concentration, so the extract obtained by solid fermentation process was used for FB(1) purification. Fumonisins characterization and quantification were performed with reversed-phase high-performance liquid chromatography with electrospray ionization triple quadrupole tandem mass spectrometry. The role of production of reactive oxygen species (ROS) in Fumonisin B(1) mediated toxicology has not been fully addresses in studies exploring FB(1) toxicity. It is evaluated the level of ROS production in kidney cell line (VERO) exposed to 1, 5 and 10 ?M of FB(1) for 0.5-100 min. The ROS level was detected using a fluorescence probe, 2',7'-dichlorofluorescein diacetate (DCFH-DA), which could be converted to highly fluorescent dichlorofluorescein (DCF) with the presence of intracellular ROS. Significant increase of ROS products was observed in VERO cells at 10 ?M dose. These results indicate that ROS production by FB(1) on renal cells is a mechanism of fumonisin mediated toxicity. PMID:20655973

  5. Accumulation of defective interfering viral particles in only a few passages in Vero cells attenuates mumps virus neurovirulence.


    antak, Maja; Markui?, Maja; Balija, Maja Lang; Kopa?, Sandra Ke?; Jug, Renata; rvell, Claes; Tomac, Jelena; For?i?, Dubravko


    Immunization programs have implemented live attenuated mumps vaccines which reduced mumps incidence ?97%. Some of the vaccine strains were abandoned due to unwanted side effects and the genetic marker of attenuation has not been identified so far. Our hypothesis was that non-infectious viral particles, in particular defective interfering particles (DIPs), contribute to neuroattenuation. We showed that non-infectious particles of the mumps vaccine L-Zagreb attenuated neurovirulence of wild type mumps virus 9218/Zg98. Then, we attenuated recent wild type mumps virus MuVi/Zagreb.HRV/28.12 in Vero cells through 16 passages but already the fifth passage (p5) showed accumulation of DIPs and attenuated neurovirulence in a newborn rat model when compared to the second passage (p2). Sequence analysis of the p2 and p5 revealed a single mutation in the 5' untranslated region of the HN gene. Analysis of the expression level of the HN protein showed that this mutation does not affect the expression of the protein. We conclude that the passages of MuVi/Zagreb.HRV/28.12 in Vero cells for only three passages accumulated DIPs which attenuate neurovirulence. These findings reveal DIPs as a very promising and general neuroattenuating factor which should be considered in the rational design of the new mumps vaccine. PMID:25479555

  6. Absolute quantification of dengue virus serotype 4 chimera vaccine candidate in Vero cell culture by targeted mass spectrometry.


    Rougemont, Blandine; Simon, Romain; Carrière, Romain; Biarc, Jordane; Fonbonne, Catherine; Salvador, Arnaud; Huillet, Céline; Berard, Yves; Adam, Olivier; Manin, Catherine; Lemoine, Jérôme


    Infection by dengue flavivirus is transmitted by mosquitoes and affects tens to hundreds of millions people around the world each year. Four serotypes have been described, all of which cause similar disease. Currently, there no approved vaccines or specific therapeutics for dengue, although several vaccine prototypes are in different stages of clinical development. Among them, a chimeric vaccine, built from the replication machinery of the yellow fever 17D virus, has shown promising results in phase III trials. Accurate quantitation of expressed viral particles in alive attenuated viral antigen vaccine is essential and determination of infectious titer is usually the method of choice. The current paper describes an alternative or orthogonal strategy, namely, a multiplexed and absolute assay of four proteins of the chimera yellow fever/dengue serotype 4 virus using targeted MS in SRM mode. Over 1 month, variability of the assay using a partially purified Vero cell extract was between 8 and 17%, and accuracy was between 80 and 120%. In addition, the assay was linear between 6.25 and 200 nmol/L and could therefore be used in the near future to quantify dengue virus type 4 during production and purification from Vero cells. PMID:26205729

  7. Chemical synthesis, characterisation, and biocompatibility of nanometre scale porous anodic aluminium oxide membranes for use as a cell culture substrate for the vero cell line: a preliminary study.


    Poinern, Grrard Eddy Jai; Le, Xuan Thi; O'Dea, Mark; Becker, Thomas; Fawcett, Derek


    In this preliminary study we investigate for the first time the biomedical potential of using porous anodic aluminium oxide (AAO) membranes as a cell substrate for culturing the Cercopithecus aethiops (African green monkey) Kidney (Vero) epithelial cell line. One advantage of using the inorganic AAO membrane is the presence of nanometre scale pore channels that allow the exchange of molecules and nutrients across the membrane. The size of the pore channels can be preselected by adjusting the controlling parameters of a temperature controlled two-step anodization process. The cellular interaction and response of the Vero cell line with an in-house synthesised AAO membrane, a commercially available membrane, and a glass control were assessed by investigating cell adhesion, morphology, and proliferation over a 72?h period. The number of viable cells proliferating over the respective membrane surfaces revealed that the locally produced in-house AAO membrane had cells numbers similar to the glass control. The study revealed evidence of focal adhesion sites over the surface of the nanoporous membranes and the penetration of cellular extensions into the pore structure as well. The outcome of the study has revealed that nanometre scale porous AAO membranes have the potential to become practical cell culture scaffold substrates with the capability to enhance adhesion and proliferation of Vero cells. PMID:24579077

  8. Chemical Synthesis, Characterisation, and Biocompatibility of Nanometre Scale Porous Anodic Aluminium Oxide Membranes for Use as a Cell Culture Substrate for the Vero Cell Line: A Preliminary Study

    PubMed Central

    Poinern, Grrard Eddy Jai; Le, Xuan Thi; Becker, Thomas; Fawcett, Derek


    In this preliminary study we investigate for the first time the biomedical potential of using porous anodic aluminium oxide (AAO) membranes as a cell substrate for culturing the Cercopithecus aethiops (African green monkey) Kidney (Vero) epithelial cell line. One advantage of using the inorganic AAO membrane is the presence of nanometre scale pore channels that allow the exchange of molecules and nutrients across the membrane. The size of the pore channels can be preselected by adjusting the controlling parameters of a temperature controlled two-step anodization process. The cellular interaction and response of the Vero cell line with an in-house synthesised AAO membrane, a commercially available membrane, and a glass control were assessed by investigating cell adhesion, morphology, and proliferation over a 72?h period. The number of viable cells proliferating over the respective membrane surfaces revealed that the locally produced in-house AAO membrane had cells numbers similar to the glass control. The study revealed evidence of focal adhesion sites over the surface of the nanoporous membranes and the penetration of cellular extensions into the pore structure as well. The outcome of the study has revealed that nanometre scale porous AAO membranes have the potential to become practical cell culture scaffold substrates with the capability to enhance adhesion and proliferation of Vero cells. PMID:24579077

  9. Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

    SciTech Connect

    Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.


    Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. Four mutant viruses were isolatedall could fuse C6/36 cells. Two of these mutants were lethal in Vero cells without further modification. Lethal mutations were KK291/295EV and KKK305/307/310EEE. Cell attachment was implicated as the replication block for both mutants.

  10. Toxicity and Antiviral Activity of the Extracts of Submerged Mycelium of Nematophagous Duddingtonia flagrans Fungus in Vero Cell Culture.

    TOXLINE Toxicology Bibliographic Information

    Ibragimova ZhB; Anan'ko GG; Kostina NE; Teplyakova TV; Mazurkova NA


    We studied toxicity and antiviral activity of aqueous and ethanol extracts of bioactive substances from the biomass of nematophagous fungus Duddingtonia flagrans prepared by submerged culturing of the mycelium. It is found that both extracts were characterized by low toxicity for cultured Vero cells and inhibited reproduction of DNA-viruses in this cell line. Ethanol extract of the fungus exhibited higher in vitro antiviral activity against Herpes simplex virus type 2, ectromelia virus, and vaccinia virus than water extract, which can be due to higher content of proteins, polysaccharides, flavonols, catechins, or carotenes or more effective their combination. The extracts of cultured mycelium of Duddingtonia flagrans fungus containing a complex of bioactive substances can be used for creation of broad-spectrum antiviral drugs against DNA-viruses.

  11. Toxicity and Antiviral Activity of the Extracts of Submerged Mycelium of Nematophagous Duddingtonia flagrans Fungus in Vero Cell Culture.


    Ibragimova, Zh B; Anan'ko, G G; Kostina, N E; Teplyakova, T V; Mazurkova, N A


    We studied toxicity and antiviral activity of aqueous and ethanol extracts of bioactive substances from the biomass of nematophagous fungus Duddingtonia flagrans prepared by submerged culturing of the mycelium. It is found that both extracts were characterized by low toxicity for cultured Vero cells and inhibited reproduction of DNA-viruses in this cell line. Ethanol extract of the fungus exhibited higher in vitro antiviral activity against Herpes simplex virus type 2, ectromelia virus, and vaccinia virus than water extract, which can be due to higher content of proteins, polysaccharides, flavonols, catechins, or carotenes or more effective their combination. The extracts of cultured mycelium of Duddingtonia flagrans fungus containing a complex of bioactive substances can be used for creation of broad-spectrum antiviral drugs against DNA-viruses. PMID:26621278

  12. Inhibition of dengue NS2B-NS3 protease and viral replication in Vero cells by recombinant retrocyclin-1

    PubMed Central


    Background Global resurgence of dengue virus infections in many of the tropical and subtropical countries is a major concern. Therefore, there is an urgent need for the development of successful drugs that are both economical and offer a long-lasting protection. The viral NS2B-NS3 serine protease (NS2B-NS3pro) is a promising target for the development of drug-like inhibitors, which are not available at the moment. In this study, we report retrocyclin-1 (RC-1) production in E. coli as a recombinant peptide to test against dengue NS2B-NS3pro. Methods Dengue NS2B-NS3pro was produced as a recombinant single chain protein in E. coli and purified by Ni+ affinity chromatography. The RC-1 peptide was produced in E. coli and the tri-disulphide bonds were reformed in a diluted alkaline environment. Protease assay was performed using a fluorogenic peptide substrate and measured by fluorescence spectrometry. Real-time PCR was used for quantification of dengue serotype 2 (DENV-2) viral RNA produced in Vero cells. Results The RC-1 peptide inhibited the activity of recombinant NS2B-NS3pro with different values at 50% inhibitory concentration (IC50) which are temperature dependent (28C, 46.1??1.7?M; 37C, 21.4??1.6?M; 40C, 14.1??1.2?M). The presence of RC-1 significantly reduced viral replication in Vero cells infected with DENV-2 at simultaneous treatment after 48hrs (70%) and 75hrs (85%). Furthermore, moderate reduction in viral replication was observed at pre-treatment mode after 48hrs (40%) and 72hrs (38%) and post-treatment at 48hrs (30%) and 72hrs (45%). Conclusion Recombinant RC-1 inhibits DENV-2 replication in Vero cells by interfering with the activity of its serine protease. Thus, we propose that recombinant RC-1 is a potent, cost-effective dengue virus inhibitor. Therefore, it is suitable to consider RC-1 as a new candidate for drug development against dengue infection. PMID:23171075

  13. Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

    PubMed Central

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel


    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  14. High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

    SciTech Connect

    Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude; Wang, Yue; Liao, Guoyang


    Highlights: Black-Right-Pointing-Pointer Vero cell-based HPAI H5N1 vaccine with stable high yield. Black-Right-Pointing-Pointer Stable high yield derived from the YNVa H3N2 backbone. Black-Right-Pointing-Pointer H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

  15. Photodynamic efficiency of hypericin compared with chlorin and hematoporphyrin derivatives in HEp-2 and Vero epithelial cell lines.


    Bernal, Claudia; Ribeiro, Anderson O; Andrade, Gislaine P; Perussi, Janice R


    Hypericin (HY) is a photoactive aromatic dianthraquinone that is considered a potent photodynamic agent. In this study, hypericin and two other photosensitizers, a hematoporphyrin derivative (Photogem(®); PG) and a chlorin derivative (Photodithazine(®); PZ), were compared in terms of their phototoxicity toward two cell lines, HEp-2 and Vero. The median inhibitory concentration (IC(50)) of each of the photosensitizers was obtained after a 16.2J cm(-2) dose of irradiation at 630 ± 10 nm. The IC(50) values were 0.07 ± 0.01 (HY), 1.0 ± 0.2 (PZ), and 9 ± 1 μgmL(-1) (PG) in HEp-2 cells and 0.3 ± 0.1 (HY), 1.6 ± 0.2 (PZ) and 11 ± 1 μgmL(-1) (PG) in Vero cells, showing that HY is more phototoxic than the others when irradiated at 630 nm. If these results are analyzed, simultaneously, with the first-order constant for BSA tryptophan photooxidation, obtained by fluorescence decay (λ(excitation)=280 nm), which are 11×10(-3) min(-1)±1. 10(-3) min(-1) (HY), 10 × 10(-3) min(-1)±1 × 10(-3) min(-1) (PZ), and 6 × 10(-3)min(-1) ± 1×10(-3)min(-1) (PG), it is possible to infer that the photodynamic efficiency alone is not sufficient to explain the higher HY phototoxicity. The lipophilicity is also an important factor for an efficient target cell accumulation and was assessed for all sensitizers through the octanol-water partition coefficient (log P): 1.20 ± 0.02 (HY), -0.62 ± 0.03 (PZ), and -0.9 ± 0.2 (PG). The higher value for HY correlates well with its observed superior efficiency to promote damage at low concentrations and doses. As HY is used for the long-term treatment of mild depression, it is considered safe for humans. This fact and the present results reinforce the great potential of this photosensitizer to replace porphyrin derivatives, with the advantages that mean it could be used as photosensitizer in clinical photodynamic therapy. PMID:25910552

  16. Isolation of bovine coronavirus (bcoV) in vero cell line and its confirmation by direct FAT and RT-PCR.


    Hansa, A; Rai, R B; Dhama, K; Wani, M Y; Saminathan, M; Ranganath, G J


    Bovine Coronavirus (BCoV) is widespread both in dairy and beef cattle throughout the world. The virus is one of the largest RNA virus and has specific tropism for intestinal and pulmonary epithelial cells. It is responsible for huge economic losses by causing winter dysentery in adult dairy cattle and respiratory and intestinal tract infections leading to pneumo-enteritis in young calves. Isolation of BCoV has been reported to be difficult. Studies regarding epidemiology, virus isolation and molecular detection from India are very few. In the present study Vero cell line was used for isolation of the BCoV from Enzyme Linked Immunosorbent Assay (ELISA) positive samples. Direct florescent antibody technique (dFAT) and reverse transcriptase-polymerase chain reaction (RT-PCR) were used to confirm the isolated virus strains at antigenic and genomic levels, respectively. Out of the 15 positive fecal samples, virus from only seven was able to infect vero cell line. Subsequently BCoV got adapted to the vero cell line upto three passages, which was confirmed both at genomic and antigenic levels by dFAT and RT-PCR testing. It can be concluded that vero cell line can be used for isolation of BCoV, however due to the enormous stain diversity of the virus it is possible that many stains can't grow and get adapt in this cell line. Further studies are required for isolation of different viral strains, finding the susceptible cell lines and also to confirm the variations among the BCoV isolates at antigenic/genomic levels. PMID:24511744

  17. Purification of Vero cell derived live replication deficient influenza A and B virus by ion exchange monolith chromatography.


    Banjac, Marko; Roethl, Elisabeth; Gelhart, Franz; Kramberger, Petra; Jarc, Barbara Lah; Jarc, Marko; Strancar, Ale; Muster, Thomas; Peterka, Matja


    We explored the possibilities for purification of various ?NS1 live, replication deficient influenza viruses on ion exchange methacrylate monoliths. Influenza A ?NS1-H1N1, ?NS1-H3N2, ?NS1-H5N1 and ?NS1-influenza B viruses were propagated in Vero cells and concentrated by tangential flow filtration. All four virus strains adsorbed well to CIM QA and CIM DEAE anion exchangers, with CIM QA producing higher recoveries than CIM DEAE. ?NS1-influenza A viruses adsorbed well also to CIM SO3 cation exchanger at the same pH, while ?NS1-influenza B virus adsorption to CIM SO3 was not complete. Dynamic binding capacity (DBC) for CIM QA, DEAE and SO3 methacrylate monoliths for influenza A ?NS1-H1N1 virus were 1.9E+10 TCID50/ml, 1.0E+10 TCID50/ml and 8.9E+08 TCID50/ml, respectively. Purification of ?NS1 viruses on CIM QA was scaled up and reproducibility was confirmed. Yields of infectious virus on CIM QA were between 70.832.3% and 8730.8%. Total protein removal varied from 93.30.4% to 98.60.2% and host cell DNA removal efficiency was ranging from 76.4% to 99.9% and strongly depended on pretreatment with deoxyribonuclease. PMID:24631091

  18. Evaluation of physicochemical and biological properties of chitosan/poly (vinyl alcohol) polymer blend membranes and their correlation for Vero cell growth.


    Sharma, Parul; Mathur, Garima; Dhakate, Sanjay R; Chand, Subhash; Goswami, Navendu; Sharma, Sanjeev K; Mathur, Ashwani


    The blend membranes with varying weight ratios of chitosan/poly (vinyl alcohol) (CS/PVA) (1:0, 1:1, 1:2.5, 1.5:1, 1.5: 2.5) were prepared using solvent casting method and were evaluated for their potential application in single-use membrane bioreactors (MBRs). The physicochemical properties of the prepared membranes were investigated for chemical interactions (FTIR), surface morphology (SEM), water uptake, protein sorption (qe), ammonia sorption and growth kinetics of Vero cells. CS/PVA blend membrane having weight ratio of 1.5:1 had shown enhanced membrane flexibility, reduced water uptake, less protein sorption and no ammonium sorption compared to CS membrane. This blend membrane also showed comparatively enhanced higher specific growth rate (0.82/day) of Vero cells. Improved physicochemical properties and growth kinetics obtrude CS/PVA (1.5:1) as a potential surface for adhesion and proliferation with possible application in single use membrane bioreactors. Additionally, new insight explaining correlation between water holding (%) of CS/PVA (1.5:1) blend membrane and doubling time (td) of Vero cells is proposed. PMID:26686166

  19. Bicarbonate/chloride antiport in Vero cells: II. Mechanisms for bicarbonate-dependent regulation of intracellular pH

    SciTech Connect

    Olsnes, S.; Ludt, J.; Tonnessen, T.I.; Sandvig, K.


    The rates of bicarbonate-dependent uptake and efflux of /sup 22/Na/sup +/ in Vero cells were studied and compared with the uptake and efflux of /sup 36/Cl/sup -/. Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na/sup +/ was much less affected by changes in pH. The bicarbonate-linked uptake of /sup 22/Na/sup +/ was dependent on internal Cl- but not on internal Na/sup +/. At a constant external concentration of HCO/sub 3/-, the amount of /sup 22/Na/sup +/ associated with the cells increased when the internal concentration of HCO/sub 3/- decreased and vice versa, which is compatible with the possibility that the ion pair NaCO/sub 3/- is the transported species and that the transport is symmetric across the membrane. Bicarbonate inhibited the uptake of /sup 36/Cl/sup -/ both in the absence and presence of Na/sup +/. At alkaline internal pH, HCO/sub 3/- stimulated the efflux of /sup 36/Cl/sup -/ from preloaded cells, while at acidic internal pH both Na/sup +/ and HCO/sub 3/- were required to induce /sup 36/Cl/sup -/ efflux. We propose a model for how bicarbonate-dependent regulation of the internal pH may occur. This model implies the existence of two bicarbonate transport mechanisms that, under physiological conditions, transport OH(-)-equivalents in opposite directions across the plasma membrane.

  20. Spectroscopic evaluation of the effect of a red microalgal polysaccharide on herpes-infected Vero cells.


    Huleihel, Mahmoud; Talyshinsky, Marina; Souprun, Yelena; Erukhimovitch, Vitaly


    The sulfated polysaccharide obtained from a species of red microalga has proved to be a potent antiviral agent against various members of the herpes family. In the present study, we used microscopic Fourier transform infrared spectroscopy (FT-IR) to investigate differences between normal cells, those infected with herpes viruses, and infected cells treated with red microalgal polysaccharide. FT-IR enables the characterization of cell or tissue pathology based on characteristic molecular vibrational spectra of the cells. The advantage of microscopic FT-IR spectroscopy over conventional FT-IR spectroscopy is that it facilitates inspection of restricted regions of cell cultures or tissue. Our results showed significant spectral differences at early stages of infection between infected and noninfected cells, and between infected cells treated with the polysaccharide and those not treated. In infected cells, there was an impressive decrease in sugar content and a considerable increase in phosphate levels in conjunction with the infection progress. Our results also proved that sugars penetrated and accumulated inside cells treated with the red microalgal polysaccharide. These could have been sugar fragments of low molecular weight present in the polysaccharide solution, despite purification by dialysis. Such sugar accumulation might be responsible for a breakdown in the internal steps of the viral replication cycle. PMID:14658634

  1. Neutralizing Antibody Response after Intramuscular Purified Vero Cell Rabies Vaccination (PVRV) in Iranian Patients with Specific Medical Conditions

    PubMed Central

    Rahimi, Pooneh; Vahabpour, RouhAllah; Aghasadeghi, Mohammad Reza; Sadat, Syed Mehdi; Howaizi, Nader; Mostafavi, Ehsan; Eslamifar, Ali; Fallahian, Vida


    Objective Post exposure prophylaxis using one of the WHO-approved vaccines is the method of choice for preventing rabies. Abnormal immune function in patients with some specific medical conditions, such as pregnancy, chronic hepatitis B virus infection, different types of cancers like lymphoma, diabetes I and II, corticosteroid consumption by patients with rheumatoid arthritis and lupus erythematosus, could impair the immunologic response to various vaccines. The immune response to rabies vaccination has never been examined in patients with any of these described medical conditions. This study purposed to evaluate the neutralyzing antibody response after vaccination with purified Vero cell rabies vaccine (PVRV) according to the WHO-recommended PostExposure Prophylaxis (PEP) "ESSEN" regimen. Methods Thirty healthy volunteers and 50 volunteers with different medical conditions who were exposed to a suspected rabid animal in the 2nd or 3rd category of exposure received 5 doses of PVRV under the ESSEN protocol. Three blood samples were collected on days 0 (before the first dose), 14, and 35. The anti-rabies antibody titer was measured using the Rapid Fluorescent Foci Inhibition Test (RFFIT) and an ELISA Bio-Rad, Platelia, Rabies II kit. Results All subjects reached NAb titers above 0.5 IU/ml by day 14 after vaccination. On day 35 (1 week after receiving the last rabies vaccine), anti-rabies antibodies were in the protective level (>0.5 IU/ml) in both groups. There was no statistically significant difference in anti-rabies antibody response due to the type of exposure (category 2 or 3), and successful seroconversion was confirmed in both groups. Conclusion In conclusion, the ESSEN protocol using the PVRV vaccine is sufficient for rabies prophylaxis in patients with specific medical conditions. PMID:26440665

  2. Transcriptional profiling of Vero E6 cells over-expressing SARS-CoV S2 subunit: Insights on viral regulation of apoptosis and proliferation

    SciTech Connect

    Yeung, Y.-S. Yip, C.-W. Hon, C.-C. Chow, Ken Y.C. Ma, Iris C.M. Zeng Fanya Leung, Frederick C.C.


    We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by the diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level.

  3. In vitro development of bovine embryos in conditioned media from bovine granulosa cells and vero cells cultured in exogenous protein- and amino acid-free chemically defined human tubal fluid medium.


    Maeda, J; Kotsuji, F; Negami, A; Kamitani, N; Tominaga, T


    We have investigated the effect of protein- and amino acid-free simple human tubal fluid (HTF) medium conditioned with bovine granulosa cells (BGC) or Vero cells on the development of early bovine embryos to the blastocyst stage. Serum-containing medium (SCM) and serum-free medium (CM) conditioned by BGC (BGC-SCM, BGC-CM) and by Vero cells (VC-SCM, VC-CM) were prepared. Early embryos (1-cell stage and 5- to 8-cell stage) were obtained by in vitro maturation and fertilization of oocytes from slaughtered cows. Embryos were randomly divided into 7 culture groups as follows: culture with BGC-SCM, BGC-CM, VC-SCM, or VC-CM; coculture with BGC or Vero cells; or culture with fresh HTF medium without serum. The proportion of 5- to 8-cell embryos developing to the blastocyst stage in BGC-CM (16%) and VC-CM (12%) was significantly lower (p < 0.05) than in BGC-SCM (41%) and in VC-SCM (29%) and after coculture with BGC (48%) and Vero cells (30%). Similarly, the percentages of 1-cell embryos developing to blastocyst in BGC-CM and VC-CM were significantly lower than in BGC-SCM and VC-SCM and after coculture. Cell numbers per blastocyst developed from 5- to 8-cell embryos in BGC-CM (96.8 cells) and in VC-CM (94.0 cells) were somewhat lower than those in BGC-SCM (128.5 cells) and VC-SCM (117.1 cells) and after coculture with BGC (124.2 cells) and Vero cells (115.3 cells). These results suggest that BGC and Vero cells cultured in a protein- and amino acid-free simple HTF medium synthesize and secrete factor(s) promoting blastocyst formation in vitro. Physiochemical analysis indicated that the embryotrophic substances in BGC-CM were distributed in two molecular size ranges, one between 10 kDa and 30 kDa and another greater than 30 kDa. PMID:8924514

  4. DNA fragmentation, apoptosis and cell cycle arrest induced by zearalenone in cultured DOK, Vero and Caco-2 cells: prevention by Vitamin E.


    Abid-Essefi, Salwa; Baudrimont, Isabelle; Hassen, Wafa; Ouanes, Zouhour; Mobio, Thophile A; Anane, Rachid; Creppy, Edmond E; Bacha, Hassen


    Zearalenone (ZEN) is a non-steroidal oestrogenic mycotoxin produced by several Fusarium species growing on cereals. ZEN and its metabolites bind to human oestrogen receptors and hence display oestrogenic and anabolic properties. Several lines of investigation suggest that ZEN may be genotoxic in vivo. ZEN damages DNA in Bacillus subtilis recombination tests, and it induces sister chromatid exchange and chromosomal aberration in CHO cells. ZEN also induces DNA-adduct formation in mouse tissues and SOS repair process in lysogenic bacteria. In the present study, ZEN genotoxicity has been confirmed in three cell-lines, Vero, Caco-2 and DOK at concentrations of 10, 20 and 40 microM. Under these conditions, ZEN induces concentration-dependent DNA fragmentation resulting in DNA laddering patterns on agarose gel electrophoresis. This observation is consistent with apoptosis, which was confirmed by observations of formation of apoptotic bodies. Moreover, ZEN induces cell cycle arrest in the three cell-lines characterised by an increase of the number of cells in the G2/M phase of the cell cycle. Vitamin E (25 microM) added simultaneously with ZEN partially reduces DNA fragmentation and apoptotic body formation after 24h incubation. Vitamin E may act by maintaining prolonged cell cycle arrest during which time DNA repair takes place. PMID:14580790

  5. Immunogenicity and Protective Efficacy of a Vero Cell Culture-Derived Whole-Virus H7N9 Vaccine in Mice and Guinea Pigs

    PubMed Central

    Wodal, Walter; Schwendinger, Michael G.; Savidis-Dacho, Helga; Crowe, Brian A.; Hohenadl, Christine; Fritz, Richard; Brhl, Peter; Portsmouth, Daniel; Karner-Pichl, Anita; Balta, Dalida; Grillberger, Leopold; Kistner, Otfried; Barrett, P. Noel; Howard, M. Keith


    Background A novel avian H7N9 virus with a high case fatality rate in humans emerged in China in 2013. We evaluated the immunogenicity and protective efficacy of a candidate Vero cell culture-derived whole-virus H7N9 vaccine in small animal models. Methods Antibody responses induced in immunized DBA/2J mice and guinea pigs were evaluated by hemagglutination inhibition (HI), microneutralization (MN), and neuraminidase inhibition (NAi) assays. T-helper cell responses and IgG subclass responses in mice were analyzed by ELISPOT and ELISA, respectively. Vaccine efficacy against lethal challenge with wild-type H7N9 virus was evaluated in immunized mice. H7N9-specific antibody responses induced in mice and guinea pigs were compared to those induced by a licensed whole-virus pandemic H1N1 (H1N1pdm09) vaccine. Results The whole-virus H7N9 vaccine induced dose-dependent H7N9-specific HI, MN and NAi antibodies in mice and guinea pigs. Evaluation of T-helper cell responses and IgG subclasses indicated the induction of a balanced Th1/Th2 response. Immunized mice were protected against lethal H7N9 challenge in a dose-dependent manner. H7N9 and H1N1pdm09 vaccines were similarly immunogenic. Conclusions The induction of H7N9-specific antibody and T cell responses and protection against lethal challenge suggest that the Vero cell culture-derived whole-virus vaccine would provide an effective intervention against the H7N9 virus. PMID:25719901

  6. Comparison of human immune responses to purified Vero cell and human diploid cell rabies vaccines by using two different antibody titration methods.


    Kitala, P M; Lindqvist, K J; Koimett, E; Johnson, B K; Chunge, C N; Perrin, P; Olsvik, O


    Antibody responses to a conventional rabies preexposure regimen of a new purified Vero cell rabies vaccine (PVRV) and a human diploid cell vaccine (HDCV) were compared in 80 healthy Kenyan veterinary students. Forty-three of the students received the PVRV and 37 received the HDCV on days 0, 7, and 28. Antibody responses were monitored by using the rapid fluorescent-focus inhibition test (RFFIT) and an inhibition enzyme immunoassay (INH EIA) on days 0, 7, 28, and 49. Both vaccines elicited a rapid antibody response. A good correlation between the RFFIT titers and the INH EIA titers was obtained (r = 0.90). Our results also showed that the INH EIA was more reproducible and might therefore be a suitable substitute for the more expensive and less reproducible RFFIT. The geometric mean titers determined by both tests in the two groups of students were statistically similar during the test period. The RFFIT and the INH EIA gave comparable geometric mean titers, which differed significantly only on day 28 in the PVRV group. The effect of the new PVRV is comparable to that of the more expensive HDCV, as determined by the present test systems. The PVRV could therefore be the vaccine of choice, especially in tropical rabies-endemic areas, where the high cost of the HDCV has confined its use to a privileged few. PMID:2203814

  7. Antibody response of patients after postexposure rabies vaccination with small intradermal doses of purified chick embryo cell vaccine or purified Vero cell rabies vaccine.

    PubMed Central

    Briggs, D. J.; Banzhoff, A.; Nicolay, U.; Sirikwin, S.; Dumavibhat, B.; Tongswas, S.; Wasi, C.


    Although the introduction of tissue culture vaccines for rabies has dramatically improved the immunogenicity and safety of rabies vaccines, they are often prohibitively expensive for developing countries. To examine whether smaller doses of these vaccines could be used, we tested the safety and immunogenicity of purified chick embryo cell vaccine (PCECV) on 211 patients in Thailand with World Health Organization (WHO) category II and III exposures to rabies. The patients presented at two Thai hospitals and were randomized into three groups. Patients in Group 1 received 0.1 ml PCECV intradermally at two sites on days 0, 3, 7, and at one site on days 30 and 90. Group 2 was treated similarly, except that purified Vero cell rabies vaccine (PVRV) was used instead of PCECV. Group 3 received 1.0 ml PCECV intramuscularly on days 0, 3, 7, 14, 30 and 90. After 0, 3, 7, 14, 30 and 90 days serum was collected from the subjects and the geometric mean titres (GMTs) of rabies virus neutralizing antibody determined. After 14 days the GMT of 59 patients vaccinated intradermally with PCECV was equivalent to that of patients who received PVRV. Adverse reactions were more frequent in patients who received vaccines intradermally, indicating the reactions were associated with the route of injection, rather than the vaccine per se. We conclude that PCECV is a safe and highly immunogenic vaccine for postexposure rabies vaccination when administered intradermally in 0.1-ml doses using the two-site method ("2,2,2,0,1,1") recommended by WHO. PMID:10859864

  8. Protective effect of methanol extract from citrus press cakes prepared by far-infrared radiation drying on H2O2-mediated oxidative damage in Vero cells

    PubMed Central

    Wijesinghe, W.A.J.P.; Senevirathne, Mahinda; Oh, Myung-Cheol


    In the present study, a suitable drying method was developed for citrus press cakes (CPCs), which are produced as a by-product in citrus juice plants, and the protective effect of methanol extract of CPCs prepared by far-infrared radiation (FIR) drying against H2O2-induced DNA damage was evaluated versus that of freeze-dried CPCs. Methanol extract of FIR-dried CPCs exhibited comparatively good ROS scavenging activity versus the freeze-dried CPCs at the concentration of 100 g/mL. The extract strongly enhanced the cell viability against H2O2-induced oxidative damage in Vero cells. Lipid peroxidation inhibitory activity of the extract from FIR-dried CPCs was comparable to that of the extract from freeze-dried CPCs. This sample also exhibited good protective effects against H2O2-mediated cell apoptosis as demonstrated by decreased apoptotic body formation in the nuclear staining with Hoechst 33342. In the comet assay, the CPC extracts exhibited strong inhibitory effects against H2O2-mediated DNA damage in a dose-dependent manner. Thus, this study demonstrated that FIR drying effectively preserves CPC as a functionally important natural antioxidant source and the FIR drying can be adapted for drying CPCs and is more economical for massive production than freeze drying. PMID:22125675

  9. Inhibition of cytotoxicity of Shiga toxin of Escherichia coli O157:H7 on vero cells by Prosopis alba Griseb (Fabaceae) and Ziziphus mistol Griseb (Rhamnaceae) extracts.


    Pellarn, M G; Albrecht, C; Rojas, M J; Aguilar, J J; Konigheim, B S; Paraje, M G; Albesa, I; Eraso, A J


    The capacity of Prosopis alba Griseb. and Ziziphus mistol Griseb. fruit extracts to inhibit the toxic action of Shiga toxin (Stx) was investigated. Purification of Stx from Escherichia coli O157:H7 was performed by saline precipitation and affinity chromatography using a column with globotriaosylceramide, while the fruits were subjected to ethanolic or aqueous extractions. The protective action of both fruits was determined by pre-, co-, and postincubation of one 50% cytotoxic dose per ml of Stx with different concentrations of ethanolic and aqueous extracts in confluent monolayers of Vero cells for 72 h at 37C (5% CO2). The inhibition of the cytotoxic effect of Stx by fruit extracts was determined by the neutral red vital staining technique. The extraction of the polyphenols and flavonoids was effective, and more polyphenols per milligram of dissolved solids were obtained from P. alba than from Z. mistol. However, there were more flavonoids in Z. mistol than in P. alba. Components of both fruits increased the viability of cells treated with Stx when the extracts were preincubated with Stx for 1 h before being applied to the cell cultures, with the ethanolic extract of P. alba showing 95% cell viability at a concentration of 2.45 mg/ml. The extracts were less effective in protecting cells when Stx, extracts, and cells were coincubated together without a previous incubation of Stx; only the concentrations of 19.46 mg/ml for the P. alba aqueous extract and 3.75 mg/ml for the Z. mistol ethanolic extract resulted in the inhibition of cytotoxicity, with 52 and 56% cell viability occurring, respectively. Investigation into this difference in the protection of cells indicated that the protein molecule of Stx suffered degradation to advanced oxidative protein products during preincubation with extracts, principally with P. alba, which exhibited a greater amount of nonflavonoid polyphenols than Z. mistol. The prooxidant action on Stx favored the cells and enhanced the protective action of both fruits. PMID:24112573

  10. Pre-exposure purified vero cell rabies vaccine and concomitant routine childhood vaccinations: 5-year post-vaccination follow-up study of an infant cohort in Vietnam.


    Lang, Jean; Feroldi, Emmanuel; Vien, Nguyen Cong


    Children have a high risk of exposure to rabies in countries where the disease is endemic. This prospective, 5-year study followed two groups of children who had received diphtheria, tetanus, whole-cell pertussis and inactivated poliomyelitis vaccine (DTP-IPV) at 2, 3, 4 months and 1 year (Group B) or concomitant with three doses of purified Vero cell rabies vaccine (PVRV), given at 2, 4 months and 1 year (Group A). Antibody determinations were made annually for 5 years. Data were available from a total of 72 subjects; 30 in Group A and 32 in Group B. In Group A, the percentage of patients immunized against rabies (anti-rabies > or = 0.5 IU/ml) decreased from 100% after the third vaccination to 63%, 5 years later. After 5 years, 93.8% in Group A and 96.7% in Group B had seroprotective diphtheria antibody titers > or = 0.01 IU/ml, and all subjects had anti-polio (type 1, 2 and 3) seroprotective titers > or = 5 1:dil. We conclude that co-administration of PVRV with DTP-IPV elicited protective antibody concentrations to all antigens that persist for at least 5 years, with continued protection against rabies in over 60% of subjects. These results are consistent with integration of pre-exposure rabies vaccination into the Expanded Program on Immunization (EPI) in countries where rabies is endemic. PMID:18048461

  11. A new selective chromogenic and turn-on fluorogenic probe for copper(II) in solution and vero cells: recognition of sulphide by [CuL].


    Mahapatra, Ajit Kumar; Mondal, Sanchita; Manna, Saikat Kumar; Maiti, Kalipada; Maji, Rajkishor; Uddin, Md Raihan; Mandal, Sukhendu; Sarkar, Deblina; Mondal, Tapan Kumar; Maiti, Dilip Kumar


    A new coumarin-appended thioimidazole-linked imine conjugate, viz. has been synthesized and characterized. has been found to recognize Cu(2+) selectively among a wide range of biologically relevant metal ions. The chemosensing behavior of has been demonstrated through fluorescence, absorption, visual fluorescence color changes, ESI-MS and (1)H NMR titrations. The chemosensor showed selectivity toward Cu(2+) by switch on fluorescence among the 18 metal ions studied with a detection limit of 1.53 μM. The complex formed between and Cu(2+) is found to be 1 : 1 on the basis of absorption and fluorescence titrations and was confirmed by ESI-MS. DFT and TDDFT calculations were performed in order to demonstrate the structure of and [CuL] and the electronic properties of chemosensor and its copper complex. This highly fluorescent [CuL] complex has been used to recognize sulphide selectively among the other allied anions. Microstructural features of and its Cu(2+) complex have been investigated by SEM imaging (scanning electron microscopy). The biological applications of were evaluated in Vero cells and it was found to exhibit low cytotoxicity and good membrane permeability for the detection of Cu(2+). PMID:25752696

  12. Selection of Escherichia coli heat-labile toxin (LT) inhibitors using both the GM1-ELISA and the cAMP Vero cell assay.


    Verhelst, Roderick; Schroyen, Martine; Buys, Nadine; Niewold, Theo


    Weaned piglets are very susceptible to diarrhea caused by enterotoxigenic Escherichia coli. In the past, various natural components were proposed to have beneficial effects by reducing the effects of diarrheal infectious diseases in humans and animals, and thus may represent an alternative for the use of (prophylactic) antibiotics. Alternatives may inactivate enterotoxigenic Escherichia coli heat-labile toxin (LT) by interfering with toxin binding to the cellular receptor GM1. In this study, various plants and other natural substances were tested for inhibitory properties, in the GM1 binding assay, and in the LT-induced cAMP production in Vero cells. The toxic dose of each compound was determined in a cell viability assay, and the highest nontoxic concentrations were used in the GM1 and cAMP assays. Results demonstrated that only d-(+)-galactose, lactose, N-acetyl-d-galactosamine, and two tea extracts were able to inhibit the binding of LT to its GM1 receptor. In the cAMP assay, only the two tea extracts showed inhibitory activity. This shows that d-(+)-galactose, lactose, and N-acetyl-d-galactosamine can indeed inhibit LT binding to GM1 based on structural homology with GM1 in the absence of living cells. However, in the cAMP assay, d-(+)-galactose, and lactose, N-acetyl-d-galactosamine are apparently metabolized to below their effective inhibitory concentration, likely predicting limited practical applicability in vivo. Both tea extracts maintained their activity in the presence of cells. The active compounds in both are probably polyphenols, which are not easily metabolized, and most likely work by aggregating the toxin. In conclusion, the combination of methods used here is a convenient and fast method for preselecting natural substances containing potentially toxin-binding compounds. Furthermore, if antidiarrhea activity is attributed to compounds found inactive here, their activity is unlikely based on interference with toxin binding. PMID:23692076

  13. Colon tumor cells grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    These photos compare the results of colon carcinoma cells grown in a NASA Bioreactor flown on the STS-70 Space Shuttle in 1995 flight and ground control experiments. The cells grown in microgravity (left) have aggregated to form masses that are larger and more similar to tissue found in the body than the cells cultured on the ground (right). The principal investigator is Milburn Jessup of the University of Texas M. D. Anderson Cancer Center. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Cell constructs grown in a rotating bioreactor on Earth (left) eventually become too large to stay suspended in the nutrient media. In the microgravity of orbit, the cells stay suspended. Rotation then is needed for gentle stirring to replenish the media around the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Credit: NASA and University of Texas M. D. Anderson Cancer Center.

  14. Characterization of yellow fever virus proteins E and NS1 expressed in Vero and Spodoptera frugiperda cells.


    Desprs, P; Girard, M; Bouloy, M


    The cDNA encoding the E and NS1 proteins of the yellow fever virus (YFV) was expressed in Spodoptera frugiperda cells via the recombinant baculovirus Ac-E. NS1 as a gp100 precursor which was cleaved to generate the recombinant proteins E and NS1 similar in size, folding and antigenicity to the authentic ones. Recombinant protein E exhibited immunodominant epitopes as judged by its reactivity with YFV-neutralizing MAbs. Using the Triton X-114 phase separation system, authentic and recombinant E proteins as well as the gp100 precursor exhibited hydrophobic properties similar to those of integral membrane proteins. Recombinant protein E was found neither in the extracellular medium nor on the cell surface, suggesting that it did not migrate within the secretory pathway of insect cells. Analysis of protein NS1 expressed in primate and insect cells revealed that the newly synthesized 48K NS1 glycoprotein was converted to a heat-labile gp72 homo-oligomeric form. This phenomenon did not require the presence of carbohydrate groups. Using the Triton X-114 phase separation system, the oligomeric form of NS1 was shown to be associated with cellular membranes although it appeared less hydrophobic than protein E and gp100. A small fraction of YFV NS1 oligomers were transported throughout the secretory pathway to be shed into the extracellular medium of primate cells. YFV NS1 oligomers migrated from the endoplasmic reticulum to the Golgi complex, whereas their N-oligosaccharides of the high-mannose type are processed to the complex-mannose type. Protein NS1 expressed by recombinant baculovirus-infected insect cells was not found in the extracellular medium but associated with the plasma membrane of the cells. Two recombinant NS1 forms were detected in insect cells: a major one with an apparent Mr of 48K and a minor one of 47K in which N-linked glycans were probably processed to a trimannosyl core without further elongation. Thus, it appears that the transport strategy as well as the N-glycosylation of NS1 in insect cells infected with recombinant baculovirus were different from those of the NS1 in primate cells infected with YFV. PMID:1710649

  15. Human respiratory syncytial virus Memphis 37 grown in HEp-2 cells causes more severe disease in lambs than virus grown in vero cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Respiratory syncytial virus (RSV) is the most common cause of bronchiolitis in infants and young children. A small percentage of these individuals develop severe and even fatal disease. To better understand the pathogenesis of severe disease and develop therapies unique to the less-developed infan...

  16. The polysulfonated compound suramin blocks adsorption and lateral difusion of herpes simplex virus type-1 in vero cells.


    Aguilar, J S; Rice, M; Wagner, E K


    Several polysulfonate compounds have been shown to have the potential to inhibit the replication of herpesviruses by blocking binding and penetration of the host cell. We analyzed the actions of the polysulfonate compound suramin on the replication of herpes simplex virus type 1 (HSV-1) and compared them with the actions of heparin. We used the expression of a reporter gene (beta-galactosidase) recombined into the latency-associated transcript region of the 17syn+ strain of HSV-1 to quickly evaluate productive cycle activity and have shown that it can be directly correlated with virus replication under the conditions used. We find that suramin, like heparin, blocks the binding of HSV-1 to the cell membrane. Also, suramin efficiently blocks the cell-to-cell spread of the virus; this effect has not been previously reported. Our control experiments demonstrate that heparin also has some effect on intercellular spread of HSV-1 but to a significantly lesser degree than does suramin. We suggest that suramin and related polysulfonate compounds have potential for developing of antiherpes treatments. PMID:10329576

  17. The Progressive Adaptation of a Georgian Isolate of African Swine Fever Virus to Vero Cells Leads to a Gradual Attenuation of Virulence in Swine Corresponding to Major Modifications of the Viral Genome

    PubMed Central

    Krug, Peter W.; Holinka, Lauren G.; O'Donnell, Vivian; Reese, Bo; Sanford, Brenton; Fernandez-Sainz, Ignacio; Gladue, Douglas P.; Arzt, Jonathan; Rodriguez, Luis; Risatti, Guillermo R.


    ABSTRACT African swine fever virus (ASFV) causes a contagious and often lethal disease of feral and domestic swine. Experimental vaccines derived from naturally occurring, genetically modified, or cell culture-adapted ASFV have been evaluated, but no commercial vaccine is available to control African swine fever (ASF). We report here the genotypic and phenotypic analysis of viruses obtained at different passages during the process of adaptation of a virulent ASFV field isolate from the Republic of Georgia (ASFV-G) to grow in cultured cell lines. ASFV-G was successively passaged 110 times in Vero cells. Viruses obtained at passages 30, 60, 80, and 110 were evaluated in vitro for the ability to replicate in Vero cells and primary swine macrophages cultures and in vivo for assessing virulence in swine. Replication of ASFV-G in Vero cells increased with successive passages, corresponding to a decreased replication in primary swine macrophages cultures. In vivo, progressive loss of virus virulence was observed with increased passages in Vero cells, and complete attenuation of ASFV-G was observed at passage 110. Infection of swine with the fully attenuated virus did not confer protection against challenge with virulent parental ASFV-G. Full-length sequence analysis of each of these viruses revealed significant deletions that gradually accumulated in specific areas at the right and left variable ends of the genome. Mutations that result in amino acid substitutions and frameshift mutations were also observed, though in a rather limited number of genes. The potential importance of these genetic changes in virus adaptation/attenuation is discussed. IMPORTANCE The main problem in controlling ASF is the lack of vaccines. Attempts to produce vaccines by adaptation of ASFV to cultured cell lines have been made. These attempts led to the production of attenuated viruses that conferred only homologous protection. Specifics regarding adaptation of these isolates to cell cultures have been insufficiently described. Details like the numbers of passages required to obtain attenuated viruses, genetic modifications introduced into the virus genomes along passages, and the extent of attenuation and induced protective efficacy are not readily available. In this study, we assessed the changes that lead to decreased growth in swine macrophages and to attenuation in swine. Loss of virulence, probably associated with limited replication in vivo, may lead to the lack of protective immunity in swine observed after challenge. This report provides valuable information that can be used to further the understanding of ASFV gene function, virus attenuation, and protection against infection. PMID:25505073

  18. The specific activities of Shiga-like toxin type II (SLT-II) and SLT-II-related toxins of enterohemorrhagic Escherichia coli differ when measured by Vero cell cytotoxicity but not by mouse lethality.

    PubMed Central

    Lindgren, S W; Samuel, J E; Schmitt, C K; O'Brien, A D


    Characteristically, enterohemorrhagic Escherichia coli (EHEC) strains produce Shiga-like toxin type I (SLT-I), SLT-II, or both of these immunologically distinct cytotoxins. No antigenic or receptor-binding variants of SLT-I have been identified, but a number of SLT-II-related toxins have been described. Because EHEC O91:H21 strain B2F1, which produces two SLT-II-related toxins, is exquisitely virulent in an orally infected, streptomycin-treated mouse model (oral 50% lethal dose [LD50], < 10 organisms), we asked whether the pathogenicity of strain B2F1 was a consequence of SLT-II-related toxin production. For this purpose, we compared the lethality of orally administered E. coli DH5 alpha (Strr) strains that produced different cytotoxic levels of SLT-II, SLT-IIvha (cloned from B2F1), SLT-IIvhb (also cloned from B2F1), or SLT-IIc (cloned from EHEC O157:H7 strain E32511) on Vero cells. We also calculated the specific activities of purified SLT-IIvhb and SLT-II in intraperitoneally injected mice and on Vero cells. The two purified toxins were equally toxic for mice, but SLT-IIvhb was approximately 100-fold less active than SLT-II on Vero cells and bound to the glycolipid receptor Gb3 with lower affinity than did SLT-II. In addition, characterization of SLT-II-related toxin-binding (B) subunit mutants generated in this study revealed that the reduced in vitro cytotoxic levels of the SLT-II-related toxins were due to Asn-16 in the B subunit. Taken together, these findings do not support the idea that B2F1 is uniquely virulent because of the in vivo toxicity of SLT-II-related toxins but do demonstrate differences in in vitro cytotoxic activity among the SLT-II group produced by human EHEC isolates. Images PMID:8300218

  19. Quantitative proteomics using stable isotope labeling with amino acids in cell culture reveals changes in the cytoplasmic, nuclear, and nucleolar proteomes in Vero cells infected with the coronavirus infectious bronchitis virus.


    Emmott, Edward; Rodgers, Mark A; Macdonald, Andrew; McCrory, Sarah; Ajuh, Paul; Hiscox, Julian A


    Virus-host interactions involve complex interplay between viral and host factors, rendering them an ideal target for proteomic analysis. Here we detail a high throughput quantitative proteomics analysis of Vero cells infected with the coronavirus infectious bronchitis virus (IBV), a positive strand RNA virus that replicates in the cytoplasm. Stable isotope labeling with amino acids in cell culture (SILAC) was used in conjunction with LC-MS/MS to identify and quantify 1830 cellular and two viral proteins from IBV-infected cells. Fractionation of cells into cytoplasmic, nuclear, and nucleolar extracts was used to reduce sample complexity and provide information on the trafficking of proteins between the different compartments. Each fraction showed a proportion of proteins exhibiting >or=2-fold changes in abundance. Ingenuity Pathway Analysis revealed that proteins that changed in response to infection could be grouped into different functional categories. These included proteins regulated by NF-kappaB- and AP-1-dependent pathways and proteins involved in the cytoskeleton and molecular motors. A luciferase-based reporter gene assay was used to validate the up-regulation of AP-1- and NF-kappaB-dependent transcription in IBV-infected cells and confirmed using immunofluorescence. Immunofluorescence was used to validate changes in the subcellular localization of vimentin and myosin VI in IBV-infected cells. The proteomics analysis also confirmed the presence of the viral nucleocapsid protein as localizing in the cytoplasm, nucleus, and nucleolus and the viral membrane protein in the cytoplasmic fraction. This research is the first application of SILAC to study total host cell proteome changes in response to positive sense RNA virus infection and illustrates the versatility of this technique as applied to infectious disease research. PMID:20467043

  20. Comparison of the antiproliferative activity of crude ethanol extracts of nine salvia species grown in Jordan against breast cancer cell line models

    PubMed Central

    Abu-Dahab, Rana; Afifi, Fatma; Kasabri, Violet; Majdalawi, Lara; Naffa, Randa


    Background: The antiproliferative activity of Salvia species grown in Jordan has not been fully evaluated yet. The aim of this work was to study the antiproliferative activity of crude ethanol extracts from nine Salvia species grown in Jordan against a panel of breast cancer cell lines. Material and Methods: Cytotoxic activity was evaluated in human tumor models of breast cancer; MCF-7, T47D, ZR-75-1, and BT 474 by the sulforhodamine B assay. In addition, the extracts were evaluated using a non-transformed cell line (Vero) and normal fibroblast cells in order to demonstrate their selectivity and safety. Results: From the nice ethanol extracts under investigation, those of S. dominica and S. fruticosa showed an inhibitory concentration of 50% of cells (IC50) in concentrations less than 30?g/mL against the four cell lines under investigation. S. syriaca and S. hormium showed an IC50 below 30?g/ml for two out of the four cell lines. S. fruticosa, S. hormium and S. syriaca showed selectivity in their antiproliferative activity against estrogen receptor positive cell lines with minimal toxicity against normal human periodontal fibroblasts. Phytochemical screening using thin layer chromatography indicated the presence of terpenoids, flavonoids and coumarins in all examined extracts. Conclusion: Three of the plant extracts under investigation exhibited antiproliferative activity against breast cancer cells and were shown to be safe and selective. These could be considered as a potential source for novel anticancer therapy. PMID:24082637

  1. Photopigments in Rhodopseudomonas capsulata cells grown anaerobically in darkness.

    PubMed Central

    Madigan, M; Cox, J C; Gest, H


    The phototrophic bacterium Rhodopseudomonas capsulata can obtain energy for dark anaerobic growth from sugar fermentations dependent on accessory oxidants such as trimethylamine-N-oxide or dimethyl sulfoxide. Cells grown for one to two subcultures in this fashion, with fructose as the energy source, showed approximately a twofold increase in bacteriochlorophyll content (per milligram of cell protein) and developed extensive intracytoplasmic membranes in comparison with cells grown photosynthetically at saturating light intensity. Cells harvested from successive anaerobic dark subcultures, however, showed progressively lower pigment contents. After ca. 20 transfers, bacteriochlorophyll and carotenoids were barely detectable, and the amount of intracytoplasmic membrane diminished considerably. Spontaneous mutants incapable of producing normal levels of photosynthetic pigments arose during prolonged anaerobic dark growth. Certain mutants of this kind appear to have a selective advantage over wild-type cells under fermentative growth conditions. Of four pigment mutants characterized (two being completely unable to produce bacteriochlorophyll), only one retained the capacity to grow photosynthetically. Images PMID:7076623

  2. OM-VPE grown materials for high efficiency solar cells

    NASA Technical Reports Server (NTRS)

    Saxena, R.; Cooper, B., III; Ludowise, M.; Borden, P.; Gregory, P.


    Organometallic sources are available for all the III-V elements and a variety of dopants; thus it is possible to use the technique to grow a wide variety of semiconductor compounds. AlGaAsSb and AlGaInAs alloys for multijunction monolithic solar cells were grown by OM-VPE. While the effort concentrated on terrestrial applications, the success of OM-VPE grown GaAs/AlGaAs concentrator solar cells (23% at 400 suns) demonstrates that OM-VPE is suitable for growing high efficiency solar cells in large quantities for space applications. In addition, OM-VPE offers the potential for substantial cost reduction of photovoltaic devices with scale up and automation and due to high process yield from reproducible, uniform epitaxial growths with excellent surface morphology.

  3. Feasibility of using the Vero SBRT system for intracranial SRS.


    Burghelea, Manuela; Verellen, Dirk; Gevaert, Thierry; Depuydt, Tom; Poels, Kenneth; Simon, Viorica; De Ridder, Mark


    The Vero SBRT system was benchmarked in a planning study against the Novalis SRS system for quality of delivered dose distributions to intracranial lesions and assessing the Vero system's capacity for SRS. A total of 27 patients with one brain lesion treated on the Novalis system, with 3 mm leaf width MLC and C-arm gantry, were replanned for Vero, with a 5 mm leaf width MLC mounted on an O-ring gantry allowing rotations around both the horizontal and vertical axis. The Novalis dynamic conformal arc (DCA) planning included vertex arcs, using 90 couch rotation. These vertex arcs cannot be reproduced with Vero due to the mechanical limitations of the O-ring gantry. Alternative class solutions were investigated for the Vero. Additionally, to distinguish between the effect of MLC leaf width and different beam arrangements on dose distributions, the Vero class solutions were also applied for Novalis. In addition, the added value of noncoplanar IMRT was investigated in this study. Quality of the achieved dose distributions was expressed in the conformity index (CI) and gradient index (GI), and compared using a paired Student's t-test with statistical significance for p-values ? 0.05. For lesions larger than 5 cm3, no statistical significant difference in conformity was observed between Vero and Novalis, but for smaller lesions, the dose distributions showed a significantly better conformity for the Novalis (?CI = 13.74%, p = 0.0002) mainly due to the smaller MLC leaf width. Using IMRT on Vero reduces this conformity difference to nonsignificant levels. The cutoff for achieving a GI around 3, characterizing a sharp dose falloff outside the target volume was 4 cm3 for Novalis and 7 cm3 for Vero using DCA technique. Using noncoplanar IMRT, this threshold was reduced to 3 cm3 for the Vero system. The smaller MLC and the presence of the vertex fields allow the Novalis system to better conform the dose around the lesion and to obtain steeper dose falloff outside the lesion. Comparable dosimetric characteristics can be achieved with Vero for lesions larger than 3 cm3 and using IMRT. PMID:24423838

  4. Gamma radiation-induced single strand breaks in DNA and their repair in spheroplasts and nuclei of light-grown and dark-grown Euglena cells.


    Netrawali, M S; Nair, K A


    Exposure of light-grown and dark-grown Euglena cells to gamma radiation causes single strand breaks in nuclear DNA as assessed by sedimentation analysis in alkaline sucrose density gradients. The number of radiation-induced single strand breaks in nuclear DNA of light-grown cells is found to be less than that in dark-grown cells. Post-irradiation incubation of both types of cells in 0 . 1 M phosphate buffer, pH 7 . 0 at 25 degrees C for 1 hour results in restitution of the strand breaks in DNA. Light-grown cells (cells with chloroplasts) are able to rejoin all the single strand breaks in DNA produced by gamma irradiation at D50 and D5 doses. On the other hand, dark-grown cells (cells devoid of chloroplasts) are unable to rejoin all the strand breaks caused by irradiation at either of the doses. The rate of DNA repair in dark-grown cells is also much slower than that in light-grown cells. Radiation-induced single strand breaks in DNA and their repair in nuclei from both types of cells is found to be similar to that observed in the spheroplasts. It is suggested that some factor(s) elaborated by chloroplasts may contribute towards the efficiency of nuclear DNA repair in Euglena cells. PMID:6403482

  5. Organic solar cells using CVD-grown graphene electrodes

    NASA Astrophysics Data System (ADS)

    Kim, Hobeom; Bae, Sang-Hoon; Han, Tae-Hee; Lim, Kyung-Geun; Ahn, Jong-Hyun; Lee, Tae-Woo


    We report on the development of flexible organic solar cells (OSCs) incorporating graphene sheets synthesized by chemical vapor deposition (CVD) as transparent conducting electrodes on polyethylene terephthalate (PET) substrates. A key barrier that must be overcome for the successful fabrication of OSCs with graphene electrodes is the poor-film properties of water-based poly(3,4-ethylenedioxythiphene):poly(styrenesulfonate) (PEDOT:PSS) when coated onto hydrophobic graphene surfaces. To form a uniform PEDOT:PSS film on a graphene surface, we added perfluorinated ionomers (PFI) to pristine PEDOT:PSS to create GraHEL, which we then successfully spin coated onto the graphene surface. We systematically investigated the effect of number of layers in layer-by-layer stacked graphene anode of an OSC on the performance parameters including the open-circuit voltage (Voc), short-circuit current (Jsc), and fill factor (FF). As the number of graphene layers increased, the FF tended to increase owing to lower sheet resistance, while Jsc tended to decrease owing to the lower light absorption. In light of this trade-off between sheet resistance and transmittance, we determined that three-layer graphene (3LG) represents the best configuration for obtaining the optimal power conversion efficiency (PCE) in OSC anodes, even at suboptimal sheet resistances. We finally developed efficient, flexible OSCs with a PCE of 4.33%, which is the highest efficiency attained so far by an OSC with CVD-grown graphene electrodes to the best of our knowledge.

  6. Organic solar cells using CVD-grown graphene electrodes.


    Kim, Hobeom; Bae, Sang-Hoon; Han, Tae-Hee; Lim, Kyung-Geun; Ahn, Jong-Hyun; Lee, Tae-Woo


    We report on the development of flexible organic solar cells (OSCs) incorporating graphene sheets synthesized by chemical vapor deposition (CVD) as transparent conducting electrodes on polyethylene terephthalate (PET) substrates. A key barrier that must be overcome for the successful fabrication of OSCs with graphene electrodes is the poor-film properties of water-based poly(3,4-ethylenedioxythiphene):poly(styrenesulfonate) (PEDOT:PSS) when coated onto hydrophobic graphene surfaces. To form a uniform PEDOT:PSS film on a graphene surface, we added perfluorinated ionomers (PFI) to pristine PEDOT:PSS to create 'GraHEL', which we then successfully spin coated onto the graphene surface. We systematically investigated the effect of number of layers in layer-by-layer stacked graphene anode of an OSC on the performance parameters including the open-circuit voltage (Voc), short-circuit current (Jsc), and fill factor (FF). As the number of graphene layers increased, the FF tended to increase owing to lower sheet resistance, while Jsc tended to decrease owing to the lower light absorption. In light of this trade-off between sheet resistance and transmittance, we determined that three-layer graphene (3LG) represents the best configuration for obtaining the optimal power conversion efficiency (PCE) in OSC anodes, even at suboptimal sheet resistances. We finally developed efficient, flexible OSCs with a PCE of 4.33%, which is the highest efficiency attained so far by an OSC with CVD-grown graphene electrodes to the best of our knowledge. PMID:24334624

  7. 75 FR 65581 - Proposed Amendment and Revocation of Class E Airspace, Vero Beach, FL

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... surface area at Vero Beach Municipal Airport, Vero Beach, FL. The Vero Beach Non- Directional Beacon (NDB... Federal Regulations (14 CFR) part 71 to amend Class E airspace designated as surface area to remove any... to Class D surface area to eliminate controlled airspace not required for the new SIAPs developed...

  8. Separation and Ultrastructure of Proplastids from Dark-grown Euglena Cells.


    Ophir, I; Ben-Shaul, Y


    A procedure for the separation of proplastids free of mitochondria from dark-grown Euglena cells has been developed. A fraction enriched in proplastids was used for freeze-etching study of proplastid structure. The prolamellar body in freeze-etched replicas appeared sponge-like, with thylakoids, often vesicular, emerging from it. The prolamellar body and the thylakoids were covered by particles of about 100A in diameter. No larger particles, typical of light-grown chloroplasts, were observed. PMID:16658476

  9. Endocytic activity of Sertoli cells grown in bicameral culture chambers

    SciTech Connect

    Dai, R.X.; Djakiew, D.; Dym, M.


    Immature rat Sertoli cells were cultured for 7 to 14 days on Millipore filters impregnated with a reconstituted basement membrane extract in dual-environment (bicameral) culture chambers. Electron microscopy of the cultured cells revealed the presence of rod-shaped mitochondria, Golgi apparatus, rough endoplasmic reticulum, and Sertoli-Sertoli tight junctions, typical of these cells in vivo. The endocytic activity of both the apical and basal surfaces of the Sertoli cells was examined by either adding alpha 2-macroglobulin (alpha 2-M) conjugated to 20 nm gold particles to the apical chamber or by adding /sup 125/I labeled alpha 2-M to the basal chamber. During endocytosis from the apical surface of Sertoli cells, the alpha 2-M-gold particles were bound initially to coated pits and then internalized into coated vesicles within 5 minutes. After 10 minutes, the alpha 2-M-gold was found in multi-vesicular bodies (MVBs) and by 30 minutes it was present in the lysosomes. The proportion of alpha 2-M-gold found within endocytic cell organelles after 1 hour of uptake was used to estimate the approximate time that this ligand spent in each type of organelle. The alpha 2-M-gold was present in coated pits, coated vesicles, multivesicular bodies, and lysosomes for approximately 3, 11, 22, and 24 minutes, respectively. This indicates that the initial stages of endocytosis are rapid, whereas MVBs and lysosomes are relatively long-lived.

  10. Comparison of saftey and immunogenicity of purified chick embryo cell rabies vaccine (PCECV) and purified vero cell rabies vaccine (PVRV) using the Thai Red Cross intradermal regimen at a dose of 0.1 ML.


    Madhusudana, Shampur N; Sanjay, Thitamaranahalli V; Mahendra, Bangalore J; Sudarshan, Mysore K; Narayana, Doddabele H Ashwath; Giri, Anand; Muhamuda, Kader; Ravi, Vasanthapuram; Vakil, Hoshang B; Malerczyk, Cladius


    Intradermal (ID) vaccination with modern cell culture rabies vaccines is a means to significantly reduce the cost of post-exposure prophylaxis as compared to intramuscular vaccination. In this study we evaluated the efficacy, immunogenicity and tolerability of PCECV and PVRV administered ID in doses of 0.1 mL per site according to the 2-site Thai Red Cross (TRC) regimen. Patients with WHO category III exposure to suspect or laboratory proven rabid animals were administered either PCECV (n = 58) or PVRV (n = 52) ID at a dose of 0.1 mL per site at two sites on days 0, 3 and 7 and at one site on days 30 and 90. Serum samples were withdrawn on days 0, 14, 30, 90 and 180 and rabies virus neutralizing antibody (RVNA) titers were determined by rapid fluorescent focus inhibition test (RFFIT). Patients who were exposed to laboratory confirmed rabid animals were followed up for one year after exposure. All 110 patients developed RVNA titers above 0.5 IU/mL by day 14. Adequate titers >0.5 IU/mL were maintained up to day 180. Both vaccines induced equivalent RVNA titers at all time points and were well tolerated. Five subjects who were bitten by laboratory confirmed rabid dogs were alive and healthy one year after exposure. As demonstrated, PCECV and PVRV are both immunogenic, efficacious and well tolerated when administered in the TRC post-exposure prophylaxis regimen in ID doses of 0.1 mL as recommended by WHO guidelines. The use of PCECV in this regimen may prove more economical in developing countries like India. PMID:17035734

  11. Changes in Escherichia coli cells starved in seawater or grown in seawater-wastewater mixtures.

    PubMed Central

    Munro, P M; Gauthier, M J; Laumond, F M


    Some metabolic modifications of Escherichia coli cells during starvation in seawater were studied in laboratory microcosms. The apparent die-off of this bacterium under such conditions, as observed by comparing the enumeration of CFU in conventional freshwater media and direct epifluorescence counts, was partially prevented when cells were previously grown in salted organic medium or on seawater-wastewater agar. beta-Galactosidase activity of starved cells disappeared gradually with time, even though some other enzymatic activities, such as that of alkaline phosphatase, increased. Moreover, some modifications of sensitivity to antibiotics, heavy metals, and bacteriophages in seawater- and wastewater-grown cells suggested that the cells undergo structural changes under natural marine conditions. These results provide additional experimental data indicating the possible active adaptation of E. coli cells to seawater. PMID:3116927

  12. Appearance of a methylated ribonucleic acid on illumination of Euglena gracillis cells grown in the dark.


    Perl, M


    Investigation of the methylation of nucleic acids by [Me-(3)H]methionine after illumination of Euglena cells grown in the dark has shown that a high-molecular-weight nucleic acid fraction undergoes methylation after exposure to light for 60-120min. This methylated nucleic acid fraction was isolated both by sucrose-density-gradient centrifugation and exclusion chromatography on Sephadex G-200. The fraction was shown to consist of a preformed RNA that is present in cells grown in the dark and which on illumination is transmethylated by methionine. PMID:5004197

  13. Prodigiosin Induces Autolysins in Actively Grown Bacillus subtilis Cells

    PubMed Central

    Danevčič, Tjaša; Borić Vezjak, Maja; Tabor, Maja; Zorec, Maša; Stopar, David


    Prodigiosin produced by marine bacterium Vibrio ruber DSM 14379 exhibits a potent antimicrobial activity against a broad range of Gram positive and Gram negative bacteria. The mechanism of prodigiosin antimicrobial action, however, is not known. In this work, the effect of prodigiosin on Bacillus subtilis growth, cell membrane leakage, and induction of autolysins was studied. Treating B. subtilis with prodigiosin resulted in rapid decline of optical density and increased cell membrane leakage measured by β-galactosidase activity. Cell lysis was initiated immediately after treatment with prodigiosin in the middle exponential phase and was completed within 2 h. Lytic activity of prodigiosin in mutant strains with impaired autolysin genes lytABCD decreased for 80% compared to the wild type strain, while in lytABCDEF mutant strain prodigiosin had no bacteriolytic but only bacteriostatic effect. Fast prodigiosin lytic activity on individual B. subtilis cells was confirmed by a modified comet assay. The results indicate that prodigiosin autolysin induction in B. subtilis is growth phase dependent. PMID:26858704

  14. Plastid distribution in columella cells of a starchless Arabidopsis mutant grown in microgravity

    NASA Technical Reports Server (NTRS)

    Hilaire, E.; Paulsen, A. Q.; Brown, C. S.; Guikema, J. A.; Spooner, B. S. (Principal Investigator)


    Wild-type and starchless Arabidopsis thaliana mutant seedlings (TC7) were grown and fixed in the microgravity environment of a U.S. Space Shuttle spaceflight. Computer image analysis of longitudinal sections from columella cells suggest a different plastid positioning mechanism for mutant and wild-type in the absence of gravity.

  15. Comparison of electrogenic capabilities of microbial fuel cell with different light power on algae grown cathode.


    Juang, D F; Lee, C H; Hsueh, S C


    Electricity generation capabilities of microbial fuel cell with different light power on algae grown cathode were compared. Results showed that microbial fuel cell with 6 and 12W power of light always produced higher voltage and power density than with 18 and 26W. Similarly, microbial fuel cell with 6 and 12W of light power always displayed higher Coulombic efficiency and specific power than the one with 18 and 26W. The results also showed that microbial fuel cell with covered anodic chamber always displayed higher voltage, power density, Coulombic efficiency and specific power than the one without covered anodic chamber. Binary quadratic equations can be used to express the relationships between the light power and the voltage, power density, Coulombic efficiency and specific power. Although lower power of light on algae grown cathode and covering anodic chamber will increase system's electricity production, they will not significantly reduce its internal resistance. PMID:22929741

  16. Modifications of the cell wall of yeasts grown on hexadecane and under starvation conditions.


    Dmitriev, Vladimir V; Crowley, David E; Zvonarev, Anton N; Rusakova, Tatiana G; Negri, Maria C; Kolesnikova, Svetlana A


    Electron-microscopic examinations have demonstrated local modifications in the cell wall of the yeast Candida maltosa grown on hexadecane. In our earlier studies, these modified sites, observed in other yeasts grown on oil hydrocarbons, were conventionally called 'canals'. The biochemical and cytochemical studies of C. maltosa have revealed a correlation between the formation of 'canals' and decrease in the amount of cell wall polysaccharides, glucan and mannan. The ultrathin sections and surface replicas have shown that the 'canals' are destroyed by pronase, thus indicating that a significant proportion of their content is represented by proteins. This finding was compatible with our earlier data on the localization of oxidative enzymes in 'canals' and possible participation of the 'canals' in the primary oxidation of hydrocarbons. A completely unexpected and intriguing phenomenon has been the appearance of 'canals' in the yeast C. maltosa under starvation conditions. Unlike the yeasts grown on hexadecane, mannan almost disappears in starving cells, while the quantity of glucan first decreases and then is restored to its initial level. The role of 'canals' in starving cells is as yet unclear; it is assumed that they acquire exoenzymes involved in the utilization of products of cell lysis in the starving population. In the future, 'canals' of starving cells will be studied in connection with their possible participation in apoptosis. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26833628

  17. Studies on the replication of Mayaro virus grown in interferon treated cells.


    Rebello, M C; Fonseca, M E; Marinho, J O; Rebello, M A


    Mayaro virus grown in interferon treated infected cells has been characterized with regard to its ability to replicate in vertebrate (TC7) and invertebrate (Aedes albopictus) cells. Virus purified from interferon treated TC7 cells adsorbs and penetrates to the same extent as the control virus. During infection, these virus particles caused inhibition of host protein synthesis and synthesized the same spectrum of viral proteins as normal virus. This population however, was apparently more sensitive to interferon treatment. Electron microscopy of TC7 cells showed the presence of numerous aberrant virus particles budding from the plasma membrane. PMID:8524064

  18. Detailed Structural and Quantitative Analysis Reveals the Spatial Organization of the Cell Walls of in Vivo Grown Mycobacterium leprae and in Vitro Grown Mycobacterium tuberculosis*

    PubMed Central

    Bhamidi, Suresh; Scherman, Michael S.; Jones, Victoria; Crick, Dean C.; Belisle, John T.; Brennan, Patrick J.; McNeil, Michael R.


    The cell wall of mycobacteria consists of an outer membrane, analogous to that of Gram-negative bacteria, attached to the peptidoglycan (PG) via a connecting polysaccharide arabinogalactan (AG). Although the primary structure of these components is fairly well deciphered, issues such as the coverage of the PG layer by covalently attached mycolates in the outer membrane and the spatial details of the mycolic acid attachment to the arabinan have remained unknown. It is also not understood how these components work together to lead to the classical acid-fast staining of mycobacteria. Because the majority of Mycobacterium tuberculosis bacteria in established experimental animal infections are acid-fast negative, clearly cell wall changes are occurring. To address both the spatial properties of mycobacterial cell walls and to begin to study the differences between bacteria grown in animals and cultures, the cell walls of Mycobacterium leprae grown in armadillos was characterized and compared with that of M. tuberculosis grown in culture. Most fundamentally, it was determined that the cell wall of M. leprae contained significantly more mycolic acids attached to PG than that of in vitro grown M. tuberculosis (mycolate:PG ratios of 21:10 versus 16:10, respectively). In keeping with this difference, more arabinogalactan (AG) molecules, linking the mycolic acids to PG, were found. Differences in the structures of the AG were also found; the AG of M. leprae is smaller than that of M. tuberculosis, although the same basic structural motifs are retained. PMID:21555513

  19. Efficient in situ electroporation of mammalian cells grown on microporous membranes.

    PubMed Central

    Yang, T A; Heiser, W C; Sedivy, J M


    Electroporation is a common technique for the introduction of DNA molecules into living cells. The method is currently limited by the necessity of applying the electrical discharge to cells in suspension. Adherent cells must therefore be removed from their substratum, which can induce unwanted physiological effects. We report here a new procedure for in situ electroporation of cells grown on microporous membranes of polyethylene terephthalate (PET) or polyester (PE). We demonstrate that this method of in situ electroporation employs only readily available materials and standard electroporation devices without any modifications, is as efficient as conventional electroporation of cells in suspension, and is applicable to a wide range of cell types. Efficient electroporation can be achieved under conditions of minimal cell killing, and can be performed with quiescent cells as well as with confluent epithelial sheets. The method is a useful extension of electroporation technology, and will allow the application of electroporation to a wider spectrum of biological systems. Images PMID:7659501

  20. Effects of method of detachment on electrophoretic mobility of mammalian cells grown in monolayer culture

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.


    A variety of proteolytic and micolytic enzumes, mechanical procedures, and changes in the ionic environment, especially Ca chelation, are used for dispersal of monolayer grown cells. If either chelating agents or mechanical dispersion are used alone, the cell yield is often low and suspensions of single cells are difficult to obtain. Confluent monolayers treated with EDTA tend to be released from their surfaces in sheets, and clumps of cells remain even after further incubation in EDTA. Crude trypsin is the most popular dispersal agent and is known to contain a variety of contaminating enzymes which contribute to the dispersal of cells. A variety of cell injuries resulting from the activity of proteolytic enzymes are reported. It is shown that crystalline trypsin is least harmful to cell integrity as judged by trypan blue uptake.

  1. Progressive adaptation of a Georgian isolate of African swine fever virus to vero cells leads to a gradual attenuation of virulence in swine corresponding to major changes of the viral genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    African swine fever virus (ASFV) causes a contagious and often lethal disease of feral and domestic swine. Experimental vaccines derived from naturally occurring, genetically modified or cell culture-adapted ASFV have been evaluated but no commercial vaccine is available to control African Swine Fev...

  2. EFG silicon ribbon solar cells. [Edge-defined Film-fed Grown

    NASA Technical Reports Server (NTRS)

    Ravi, K. V.; Serreze, H. B.; Bates, H. E.; Morrison, A. D.; Jewett, D. N.; Ho, J. C. T.


    The growth and characteristics of edge defined, film fed grown (EFG) silicon ribbons are discussed. Factors involved in the growth of continuous lengths of 1 in. wide ribbons are examined. The structural and electrical characteristics of the ribbons have been studied and the results are presented. Solar cells have been fabricated using the ribbon crystals and typical AMO efficiencies of 6 to 10% have been realized.

  3. 75 FR 79293 - Amendment and Revocation of Class E Airspace; Vero Beach, FL

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... removes Class E airspace designated as an extension to Class D surface area at Vero Beach Municipal... a notice of proposed rulemaking to amend and remove Class E airspace at Vero Beach, FL (75 FR 65581... Class D surface area, and Class E airspace areas extending upward from 700 feet above the surface of...

  4. Performance of silicon solar cells fabricated from multiple Czochralski ingots grown by using a single crucible

    NASA Technical Reports Server (NTRS)

    Kachare, A. H.; Uno, F. M.; Miyahira, T.; Lane, R. L.


    Results on the performance of solar cells fabricated on wafers from multiple silicon ingots of large diameter, grown by using a single crucible and a sequential melt replenishment Czochralski (CZO) technique are presented. Samples were analyzed for resistivity, dislocation density and impurity content. Solar cells were fabricated from the seed, center and tang end of each ingot to evaluate the growth reproducibility and material quality. The cell efficiency within a given wafer varies by no more than plus or minus 5% of the average value. A small but consistent decrease in the cell efficiency is observed from the first to the fourth ingot grown from a single crucible. This decrease may be related to an increase in impurity content or dislocation density or a combination of both. The efficiency of the cells fabricated from the tang end of the fourth ingot is about 10% lower than that of the control cell. An impurity effects model is employed to correlate this decrease in efficiency with the impurity build-up in the residual melt.

  5. Lithium Induces ER Stress and N-Glycan Modification in Galactose-Grown Jurkat Cells

    PubMed Central

    Ktai, Emese; Yahiro, Rikki K. K.; Por, Viktor S.; Montsk, Gergely; Zrnyi, Zita; Kovcs, Gbor L.; Miseta, Attila


    We previously reported that lithium had a significant impact on Ca2+ regulation and induced unfolded protein response (UPR) in yeast cells grown on galactose due to inhibition of phosphoglucomutase (PGM), however the exact mechanism has not been established yet. In this study, we analysed lithium's effect in galactose-fed cells to clarify whether these ER-related changes are the result of a relative hypoglycemic state. Furthermore, we investigated whether the alterations in galactose metabolism impact protein post-translational modifications. Thus, Jurkat cells were incubated in glucose or galactose containing media with or without lithium treatment. We found that galactose-fed and lithium treated cells showed better survivability than fasting cells. We also found higher UDP-Hexose and glycogen levels in these cells compared to fasting cells. On the other hand, the UPR (X-box binding protein 1 mRNA levels) of galactose-fed and lithium treated cells was even greater than in fasting cells. We also found increased amount of proteins that contained N-linked N-acetyl-glucosamine, similar to what was reported in fasting cells by a recent study. Our results demonstrate that lithium treatment of galactose-fed cells can induce stress responses similar to hypoglycemia, however cell survival is still secured by alternative pathways. We propose that clarifying this process might be an important addition toward the better understanding of the molecular mechanisms that regulate ER-associated stress response. PMID:23894652

  6. Longevity of U cells of differentiated yeast colonies grown on respiratory medium depends on active glycolysis.


    ?p, Michal; Vchov, Libue; Palkov, Zdena


    Colonies of Saccharomyces cerevisiae laboratory strains pass through specific developmental phases when growing on solid respiratory medium. During entry into the so-called alkali phase, in which ammonia signaling is initiated, 2 prominent cell types are formed within the colonies: U cells in upper colony regions, which have a longevity phenotype and activate the expression of a large number of metabolic genes, and L cells in lower regions, which die more quickly and exhibit a starvation phenotype. Here, we performed a detailed analysis of the activities of enzymes of central carbon metabolism in lysates of both cell types and determined several fermentation end products, showing that previously reported expression differences are reflected in the different enzymatic capabilities of each cell type. Hence, U cells, despite being grown on respiratory medium, behave as fermenting cells, whereas L cells rely on respiratory metabolism and possess active gluconeogenesis. Using a spectrum of different inhibitors, we showed that glycolysis is essential for the formation, and particularly, the survival of U cells. We also showed that ?-1,3-glucans that are released from the cell walls of L cells are the most likely source of carbohydrates for U cells. PMID:26566867

  7. Cyclic-radiation response of murine fibrosarcoma cells grown as pulmonary nodules

    SciTech Connect

    Grdina, D.J.; Hunter, N.


    The radiation age response of murine fibrosarcoma (FSa) cells grown as pulmonary nodules in C/sub 3/Hf/Kam mice was determined. FSa cells were irradiated in vivo either with 10 Gy as 14 day-old lung tumors (i.e., artificial macrometastases) prior to cell separation or with 5 Gy as single cells trapped in the lungs of recipient mice (i.e., artificial micrometastases) following cell separation and synchronization by centrifugal elutriation. Flow microfluorometry (FMF) was used to determine cell-cycle parameters and the relative synchrony of the separated populations, as well as the percent contamination of normal diploid cells in each of the tumor cell populations. Tumor populations containing up to 90% G/sub 1/, 60% S-, and 75% G/sub 2/+M-phase tumor cells were obtained. Cell clonogenicity, determined using a lung colony assay, ranged from 0.7 to 6% for control FSa cells from the various elutriator fractions. The radiation sensitivity of these separated cell populations varied by a factor of 6, regardless of whether the cells were irradiated as artificial micro or macro-metastases. In each experiment, tumor populations most enriched in s-phase cells exhibited the greatest radiation sensitivity. To confirm that these populations were highly enriched in S-phase cells and to demonstrate that they were more radiosensitive than FSa cells in other parts of the cell cycle, the elutriated tumor populations were exposed to either suicide labeling by high specific activity tritiated thymidine or hydroxyurea. The resultant age response curves were qualitatively similar to those obtained following irradiation and reflected the S-phase sensitivity of FSa cells to these agents.

  8. Epitaxial Crystal Silicon Absorber Layers and Solar Cells Grown at 1.8 Microns per Minute

    SciTech Connect

    Bobela, D. C.; Teplin, C. W.; Young, D. L.; Branz, H. M.; Stradins, P.


    We have grown device-quality epitaxial silicon thin films at growth rates up to 1.85 {micro}m/min, using hot-wire chemical vapor deposition from silane, at substrate temperatures below 750 C. At these rates, which are more than 30 times faster than those used by the amorphous and nanocrystalline Si industry, capital costs for large-scale solar cell production would be dramatically reduced, even for cell absorber layers up to 10 {micro}m thick. We achieved high growth rates by optimizing the three key parameters: silane flow, depletion, and filament geometry, based on our model developed earlier. Hydrogen coverage of the filament surface likely limits silane decomposition and growth rate at high system pressures. No considerable deterioration in PV device performance is observed when grown at high rate, provided that the epitaxial growth is initiated at low rate. A simple mesa device structure (wafer/epi Si/a-Si(i)/a-Si:H(p)/ITO) with a 2.3 {micro}m thick epitaxial silicon absorber layer was grown at 0.7 {micro}m/min. The finished device had an open-circuit voltage of 0.424 V without hydrogenation treatment.

  9. Light-triggered organization of the stigma in dark-grown nondividing cells of Euglena gracilis.


    Osafune, T; Alhadeff, M; Schiff, J A


    Dark-grown cells of Euglena gracilis Klebs var. bacillaris Cori contain amorphous stigma material. When these cells are placed on resting medium for 3 days in darkness, the cells cease division; the organization of a normal stigma from the amorphous material requires continuous illumination for 72-96 hr. We have now found that if dark-grown cells are placed on resting medium for 8 days, a 40-min light pulse is sufficient to cause normal organization of the stigma in a subsequent 72-hr dark period. Thus stigma development is light-dependent at 3 days of resting but becomes light-triggered at 8 days. Other examples of light-triggered phenomena in Euglena are discussed and a model based on turnover of protein molecules repressing development that are ordinarily removed by exposure to light is presented; it is suggested that as the cells become more starved their ability to replace repressor molecules removed by light becomes limited and the system thereby becomes light-triggered rather than light-dependent. PMID:3938992

  10. Phase III Clinical Trials Comparing the Immunogenicity and Safety of the Vero Cell-Derived Japanese Encephalitis Vaccine Encevac with Those of Mouse Brain-Derived Vaccine by Using the Beijing-1 Strain

    PubMed Central

    Miyazaki, Chiaki; Okada, Kenji; Ozaki, Takao; Hirose, Mizuo; Iribe, Kaneshige; Ishikawa, Yuji; Togashi, Takehiro; Ueda, Kohji


    The immunogenicity and safety of an inactivated cell culture Japanese encephalitis vaccine (CC-JEV) were compared with those of an inactivated mouse brain-derived Japanese encephalitis vaccine (MB-JEV) in phase III clinical multicenter trials conducted in children. The vaccines contain the same Japanese encephalitis virus strain, the Beijing-1 strain. Two independent clinical trials (trials 1 and 2) were conducted. Trial 1 was conducted in 468 healthy children. Each subject was injected with 17 ?g per dose of either CC-JEV or MB-JEV, and the immunogenicity and safety of the vaccines were investigated. Trial 1 showed that CC-JEV was more immunogenic and reactive than MB-JEV at the same dose. Therefore, to adjust the immunogenicity of CC-JEV to that of MB-JEV, a vaccine that has had a good track record regarding its efficacy for a long time, trial 2 was conducted in 484 healthy children. To improve the stability, CC-JEV was converted from a liquid type to a freeze-dried type of vaccine. Each subject was injected subcutaneously with either 4 ?g per dose of CC-JEV, 8 ?g per dose of CC-JEV, or 17 ?g per dose of MB-JEV twice, at an interval of 2 to 4 weeks, followed by an additional booster immunization 1 to 15 months after the primary immunization. Based on the results of trial 2, 4 ?g per dose of the freeze-dried CC-JEV (under the label Encevac) was selected as a substitute for the MB-JEV. Encevac was approved and launched in 2011 and has since been in use as a 2nd-generation Japanese encephalitis vaccine in Japan. (These studies have been registered at the JapicCTI under registration no. JapicCTI-132063 and JapicCTI-080586 for trials 1 and 2, respectively.) PMID:24334689

  11. Cyclic-radiation response of murine fibrosarcoma cells grown as pulmonary nodules

    SciTech Connect

    Grdina, D.J.; Hunter, N.


    The radiation age response of murine fibrosarcoma (FSa) cells grown as pulmonary nudules in C/sub 3/Hf/Kam mice was determined. FSa cells were irradiated in vivo either with 10 Gy as 14 day-old lung tumors (i.e., artifical micrometastases) following cell separation and synchronization by centrifugal elutriation. Flow microfluorometry (FMF) was used to determine cell-cycle parameters and the relative synchrony of the separated populations, as well as the percent contamination of normal diploid cells in each of the tumor cells populations. Tumor populations containing up to 90% G/sub 1/-, 60% S-, and 75% G/sub 2/+M-phase tumor cells were obtained. Cell clonogenicity, determined using a lung colony assay, ranged from 0.7 to 6% for control FSa cells from the various elutriator fractions. The radiation sensitivity of these separated cell populations varied by a factor of 6, regardless of whether the cells were irradiated as artifical micro or macro-metastases. In each experiment, tumor population most enriched in S-phase cells exhibited the greatest radiation sensitivity. To confirm that these populations were highly enriched in S-phase cells and to demonstrate that they were more radiosensitive than FSa cells in other parts of the cell cycle, the elutriated tumor population were exposed to either suicide labeling by high specific activity tritated thymidine or hydroxyurea. The resultant age response curves were qualitatively similar to those obtained following irradiation and reflected the S-phase sensitivity of FSa cells to these agents.

  12. Molecular beam epitaxy grown GaNAsSb 1 eV photovoltaic cell

    NASA Astrophysics Data System (ADS)

    Tan, K. H.; Wicaksono, S.; Loke, W. K.; Li, D.; Yoon, S. F.; Fitzgerald, E. A.; Ringel, S. A.; Harris, J. S., Jr.


    We report the performance of a 1 eV GaNAsSb-based photovoltaic cell grown using a molecular beam epitaxy system equipped with a radio frequency (RF) plasma-assisted nitrogen source. The 1 ?m-thick photoabsorption layer contains 2% of N and 6% of Sb resulting in a GaNAsSb layer with bandgap energy of 1.0 eV. Under AM1.5G solar illumination condition with and without 850 nm long pass filter, the GaNAsSb-based photovoltaic cell demonstrates a JSC values of 15 and 32 mA/W, respectively. Deep level transient spectroscopy analysis reveals that the VOC of the photovoltaic cell could possibly be limited by the presence of arsenic antisite defects.

  13. Rabies veterinary virus vaccine produced in BHK-21 cells grown on microcarriers in a bioreactor.


    Gallegos Gallegos, R M; Espinosa Larios, E L; Ramos Ramrez, L; Kretschmer Schmid, R; Aguilar Setin, A


    BHK-21 cells were grown in microcarriers in the CELLIGEN CL 50 bioreactor to produce a stock of rabies veterinary virus vaccine PV (Pasteur virus) strain. Perfusion mode operation of this bioreactor produced between two- and fourfold larger yields (cells/ml) than traditional stationary cell culture systems (i.e., Blake, and Roller bottles or cell factory multitrays). The method employed harvested 281 of rabies virus in 200 h (infectivity titer 0.6 +/- 1.4 x 10(7) LD50 per ml) in a single operation. The risk of contamination is thus reduced when compared with traditional stationary methods which, in order to obtain the same amount of virus, would require the operation of 285 Blake bottles, or 143 Roller bottles, or 15 Cell Factory multitrays (10 trays). By perfusion mode operation of the bioreactor, 89% of the cell culture medium was recovered as vaccinal virus, which contrasts with the yield of only 50-59% using traditional cell culture systems. On the other hand, only 925 ml of fetal serum was required to obtain the 281 of rabies virus harvest as compared to the 3420 ml required by traditional methods. PMID:7711449

  14. Human norovirus infection of caco-2 cells grown as a three-dimensional tissue structure.


    Straub, Timothy M; Bartholomew, Rachel A; Valdez, Catherine O; Valentine, Nancy B; Dohnalkova, Alice; Ozanich, Richard M; Bruckner-Lea, Cynthia J; Call, Douglas R


    Human norovirus (hNoV) infectivity was studied using a three-dimensional model of large intestinal epithelium. Large intestine Caco-2 cells were grown in rotating wall vessel bioreactors for 18-21 days at 37 degrees C and then transferred to 24-well tissue culture plates where they were infected with GI.1 and GII.4 human noroviruses collected from human challenge trials and various outbreak settings, respectively. Compared with uninfected cells, transmission micrographs of norovirus-infected cells displayed evidence of shortening or total loss of apical microvilli, and vacuolization. Quantitative reverse transcription real-time PCR (qRT-PCR) indicated an approximate 2-3 log10 increase in viral RNA copies for the infected cells. A passage experiment examined both the ability for continued viral RNA and viral antigen detection. In the passaged samples 1.01x10(6) copies ml(-1) were detected by qRT-PCR. Immune electron microscopy using primary antibody to hNoV GI.1 capsids in conjunction with 6 nm gold-labelled secondary antibodies was performed on crude cellular lysates. Localization of antibody was observed in infected but not for uninfected cells. Our present findings, coupled with earlier work with the three-dimensional small intestinal INT407 model, demonstrate the utility of 3-D cell culture methods to develop infectivity assays for enteric viruses that do not readily infect mammalian cell cultures. PMID:21942189

  15. Proliferation and Differentiation Potential of Human Adipose-Derived Stem Cells Grown on Chitosan Hydrogel

    PubMed Central

    Debnath, Tanya; Ghosh, Sutapa; Potlapuvu, Usha Shalini; Kona, Lakshmi; Kamaraju, Suguna Ratnakar; Sarkar, Suprabhat; Gaddam, Sumanlatha; Chelluri, Lakshmi Kiran


    Applied tissue engineering in regenerative medicine warrants our enhanced understanding of the biomaterials and its function. The aim of this study was to evaluate the proliferation and differentiation potential of human adipose-derived stem cells (hADSCs) grown on chitosan hydrogel. The stability of this hydrogel is pH-dependent and its swelling property is pivotal in providing a favorable matrix for cell growth. The study utilized an economical method of cross linking the chitosan with 0.5% glutaraldehyde. Following the isolation of hADSCs from omentum tissue, these cells were cultured and characterized on chitosan hydrogel. Subsequent assays that were performed included JC-1 staining for the mitochondrial integrity as a surrogate marker for viability, cell proliferation and growth kinetics by MTT assay, lineage specific differentiation under two-dimensional culture conditions. Confocal imaging, scanning electron microscopy (SEM), and flow cytometry were used to evaluate these assays. The study revealed that chitosan hydrogel promotes cell proliferation coupled with > 90% cell viability. Cytotoxicity assays demonstrated safety profile. Furthermore, glutaraldehyde cross linked chitosan showed < 5% cytotoxicity, thus serving as a scaffold and facilitating the expansion and differentiation of hADSCs across endoderm, ectoderm and mesoderm lineages. Additional functionalities can be added to this hydrogel, particularly those that regulate stem cell fate. PMID:25746846

  16. Characterization of Epitaxial Film Silicon Solar Cells Grown on Seeded Display Glass: Preprint

    SciTech Connect

    Young, D. L.; Grover, S.; Teplin, C.; Stradins, P.; LaSalvia, V.; Chuang, T. K.; Couillard, J. G.; Branz, H. M.


    We report characterizations of epitaxial film crystal silicon (c-Si) solar cells with open-circuit voltages (Voc) above 560 mV. The 2-um absorber cells are grown by low-temperature (<750 degrees C) hot-wire CVD (HWCVD) on Corning EAGLE XG display glass coated with a layer-transferred (LT) Si seed. The high Voc is a result of low-defect epitaxial Si (epi-Si) growth and effective hydrogen passivation of defects. The quality of HWCVD epitaxial growth on seeded glass substrates depends on the crystallographic quality of the seed and the morphology of the epitaxial growth surface. Heterojunction devices consist of glass/c-Si LT seed/ epi n+ Si:P/epi n- Si:P/intrinsic a-Si:H/p+ a-Si:H/ITO. Similar devices grown on electronically 'dead' n+ wafers have given Voc {approx}630 mV and {approx}8% efficiency with no light trapping features. Here we study the effects of the seed surface polish on epi-Si quality, how hydrogenation influences the device character, and the dominant junction transport physics.

  17. Comparison of Chloroflexus aurantiacus strain J-10-fl proteomes of cells grown chemoheterotrophically and photoheterotrophically

    SciTech Connect

    Cao, Li; Bryant, Donald A.; Schepmoes, Athena A.; Vogl, Kajetan; Smith, Richard D.; Lipton, Mary S.; Callister, Stephen J.


    Chloroflexus aurantiacus J-10-fl is a thermophilic green bacterium, a filamentous anoxygenic phototroph, and the model organism of the phylum Chloroflexi. We applied high-throughput, liquid chromatography-mass spectrometry in a global quantitative proteomics investigation of C. aurantiacus cells grown under oxic (chemoorganoheterotrophically) and anoxic (photoorganoheterotrophically) redox states. Our global analysis identified 13,524 high-confidence peptides that matched to 1,286 annotated proteins, 242 of which were either uniquely identified or significantly increased in abundance under anoxic culture conditions. Fifty-three of the 242 proteins are previously characterized photosynthesis-related proteins, including chlorosome proteins, proteins involved in the bacteriochlorophyll biosynthesis, 3-hydroxypropionate (3-OHP) CO2 fixation pathway, and components of electron transport chains. The remaining 190 proteins have not previously been reported. Of these, five proteins were found to be encoded by genes from a novel operon and observed only in photoheterotrophically grown cells. These proteins candidates may prove useful in further deciphering the phototrophic physiology of C. aurantiacus and other filamentous anoxygenic phototrophs.

  18. Electron-cytochemical study of Ca2+ in cotyledon cells of soybean seedlings grown in microgravity

    NASA Technical Reports Server (NTRS)

    Nedukha, O.; Brown, C. S.; Kordyum, E.; Piastuch, W. C.; Guikema, J. A. (Principal Investigator)


    Microgravity and horizontal clinorotation are known to cause the rearrangement of the structural-functional organization of plant cells, leading to accelerated aging. Altered gravity conditions resulted in an increase in the droplets volume in cells and the destruction of chloroplast structure in Arabidopsis thaliana plants, an enhancement of cytosolic autophagaous processes, an increase in the respiration rate and a greater number of multimolecular forms of succinate- and malate dehydrogenases in cells of the Funaria hygrometrica protonema and Chlorella vulgaris, and changes in calcium balance of cells. Because ethylene is known to be involved in cell aging and microgravity appears to speed the process, and because soybean seedlings grown in space produce higher ethylene levels we asked: 1) does an acceleration of soybean cotyledon cell development and aging occur in microgravity? 2) what roles do Ca2+ ions and the enhanced ethylene level play in these events? Therefore, the goal of our investigation was to examine of the interaction of microgravity and ethylene on the localization of Ca2+ in cotyledon mesophyll of soybean seedlings.

  19. Stimulation of Cell Elongation by Tetraploidy in Hypocotyls of Dark-Grown Arabidopsis Seedlings

    PubMed Central

    Narukawa, Hideki; Yokoyama, Ryusuke; Komaki, Shinichiro; Sugimoto, Keiko; Nishitani, Kazuhiko


    Plant size is largely determined by the size of individual cells. A number of studies showed a link between ploidy and cell size in land plants, but this link remains controversial. In this study, post-germination growth, which occurs entirely by cell elongation, was examined in diploid and autotetraploid hypocotyls of Arabidopsis thaliana (L.) Heynh. Final hypocotyl length was longer in tetraploid plants than in diploid plants, particularly when seedlings were grown in the dark. The longer hypocotyl in the tetraploid seedlings developed as a result of enhanced cell elongation rather than by an increase in cell number. DNA microarray analysis showed that genes involved in the transport of cuticle precursors were downregulated in a defined region of the tetraploid hypocotyl when compared to the diploid hypocotyl. Cuticle permeability, as assessed by toluidine-blue staining, and cuticular structure, as visualized by electron microscopy, were altered in tetraploid plants. Taken together, these data indicate that promotion of cell elongation is responsible for ploidy-dependent size determination in the Arabidopsis hypocotyl, and that this process is directly or indirectly related to cuticular function. PMID:26244498

  20. Suppression of Hydroxycinnamate Network Formation in Cell Walls of Rice Shoots Grown under Microgravity Conditions in Space

    PubMed Central

    Wakabayashi, Kazuyuki; Soga, Kouichi; Hoson, Takayuki; Kotake, Toshihisa; Yamazaki, Takashi; Higashibata, Akira; Ishioka, Noriaki; Shimazu, Toru; Fukui, Keiji; Osada, Ikuko; Kasahara, Haruo; Kamada, Motoshi


    Network structures created by hydroxycinnamate cross-links within the cell wall architecture of gramineous plants make the cell wall resistant to the gravitational force of the earth. In this study, the effects of microgravity on the formation of cell wall-bound hydroxycinnamates were examined using etiolated rice shoots simultaneously grown under artificial 1 g and microgravity conditions in the Cell Biology Experiment Facility on the International Space Station. Measurement of the mechanical properties of cell walls showed that shoot cell walls became stiff during the growth period and that microgravity suppressed this stiffening. Amounts of cell wall polysaccharides, cell wall-bound phenolic acids, and lignin in rice shoots increased as the shoot grew. Microgravity did not influence changes in the amounts of cell wall polysaccharides or phenolic acid monomers such as ferulic acid (FA) and p-coumaric acid, but it suppressed increases in diferulic acid (DFA) isomers and lignin. Activities of the enzymes phenylalanine ammonia-lyase (PAL) and cell wall-bound peroxidase (CW-PRX) in shoots also increased as the shoot grew. PAL activity in microgravity-grown shoots was almost comparable to that in artificial 1 g-grown shoots, while CW-PRX activity increased less in microgravity-grown shoots than in artificial 1 g-grown shoots. Furthermore, the increases in expression levels of some class III peroxidase genes were reduced under microgravity conditions. These results suggest that a microgravity environment modifies the expression levels of certain class III peroxidase genes in rice shoots, that the resultant reduction of CW-PRX activity may be involved in suppressing DFA formation and lignin polymerization, and that this suppression may cause a decrease in cross-linkages within the cell wall architecture. The reduction in intra-network structures may contribute to keeping the cell wall loose under microgravity conditions. PMID:26378793

  1. Suppression of Hydroxycinnamate Network Formation in Cell Walls of Rice Shoots Grown under Microgravity Conditions in Space.


    Wakabayashi, Kazuyuki; Soga, Kouichi; Hoson, Takayuki; Kotake, Toshihisa; Yamazaki, Takashi; Higashibata, Akira; Ishioka, Noriaki; Shimazu, Toru; Fukui, Keiji; Osada, Ikuko; Kasahara, Haruo; Kamada, Motoshi


    Network structures created by hydroxycinnamate cross-links within the cell wall architecture of gramineous plants make the cell wall resistant to the gravitational force of the earth. In this study, the effects of microgravity on the formation of cell wall-bound hydroxycinnamates were examined using etiolated rice shoots simultaneously grown under artificial 1 g and microgravity conditions in the Cell Biology Experiment Facility on the International Space Station. Measurement of the mechanical properties of cell walls showed that shoot cell walls became stiff during the growth period and that microgravity suppressed this stiffening. Amounts of cell wall polysaccharides, cell wall-bound phenolic acids, and lignin in rice shoots increased as the shoot grew. Microgravity did not influence changes in the amounts of cell wall polysaccharides or phenolic acid monomers such as ferulic acid (FA) and p-coumaric acid, but it suppressed increases in diferulic acid (DFA) isomers and lignin. Activities of the enzymes phenylalanine ammonia-lyase (PAL) and cell wall-bound peroxidase (CW-PRX) in shoots also increased as the shoot grew. PAL activity in microgravity-grown shoots was almost comparable to that in artificial 1 g-grown shoots, while CW-PRX activity increased less in microgravity-grown shoots than in artificial 1 g-grown shoots. Furthermore, the increases in expression levels of some class III peroxidase genes were reduced under microgravity conditions. These results suggest that a microgravity environment modifies the expression levels of certain class III peroxidase genes in rice shoots, that the resultant reduction of CW-PRX activity may be involved in suppressing DFA formation and lignin polymerization, and that this suppression may cause a decrease in cross-linkages within the cell wall architecture. The reduction in intra-network structures may contribute to keeping the cell wall loose under microgravity conditions. PMID:26378793

  2. Label-free optical detection of cells grown in 3D silicon microstructures.


    Merlo, Sabina; Carpignano, Francesca; Silva, Gloria; Aredia, Francesca; Scovassi, A Ivana; Mazzini, Giuliano; Surdo, Salvatore; Barillaro, Giuseppe


    We demonstrate high aspect-ratio photonic crystals that could serve as three-dimensional (3D) microincubators for cell culture and also provide label-free optical detection of the cells. The investigated microstructures, fabricated by electrochemical micromachining of standard silicon wafers, consist of periodic arrays of silicon walls separated by narrow deeply etched air-gaps (50 ?m high and 5 ?m wide) and feature the typical spectral properties of photonic crystals in the wavelength range 1.0-1.7 ?m: their spectral reflectivity is characterized by wavelength regions where reflectivity is high (photonic bandgaps), separated by narrow wavelength regions where reflectivity is very low. In this work, we show that the presence of cells, grown inside the gaps, strongly affects light propagation across the photonic crystal and, therefore, its spectral reflectivity. Exploiting a label-free optical detection method, based on a fiberoptic setup, we are able to probe the extension of cells adherent to the vertical silicon walls with a non-invasive direct testing. In particular, the intensity ratio at two wavelengths is the experimental parameter that can be well correlated to the cell spreading on the silicon wall inside the gaps. PMID:23817434

  3. Electrochemically grown ZnO nanorods for hybrid solar cell applications

    SciTech Connect

    Hames, Yakup; Alpaslan, Zuehal; Koesemen, Arif; San, Sait Eren; Yerli, Yusuf


    A hybrid solar cell is designed and proposed as a feasible and reasonable alternative, according to acquired efficiency with the employment of zinc oxide (ZnO) nanorods and ZnO thin films at the same time. Both of these ZnO structures were grown electrochemically and poly(3-hexylthiophene):phenyl-C61-butyric acid methyl ester; (P3HT:PCBM) was used as an active polymer blend, which was found to be compatible to prepared indium-tin-oxide (ITO) substrate base. This ITO base was introduced with mentioned ZnO structure in such a way that, the most efficient configuration was optimized to be ITO/ZnO film/ZnO nanorod/P3HT: PCBM/Ag. Efficiency of this optimized device is found to be 2.44%. All ZnO works were carried out electrochemically, that is indeed for the first time and at relatively lower temperatures. (author)

  4. Membrane-DNA attachment sites in Streptococcus faecalis cells grown at different rates.

    PubMed Central

    Parks, L C; Rigney, D; Daneo-Moore, L; Higgins, M L


    The M-band technique was used to assess the number of attachment points of DNA to the cell membrane of Streptococcus faecalis grown at three different rates. Cells were X irradiated in liquid nitrogen and then analyzed simultaneously for the introduction of double-strand breaks into the chromosome and the degree of removal of DNA from the cell membrane (M band). Consideration of the data from these experiments and of the topology of the bacterial chromosome resulted in a reevaluation of former quantitative models. Our results are consistent with a semiquantitative model in which the bacterial chromosome is organized around a core structure. We interpret our data to mean that the core is attached to the membrane and that the complexity of the core changes more drastically with growth rate than does the number of membrane-DNA attachment points. An alternative model in which RNA hybridizes with DNA containing single- and double-strand breaks is also discussed. In any event, the complexity of these interactions precludes a reliable estimate of the number of membrane-DNA attachment sites. PMID:6811550

  5. Morphology of Tumours Induced in Hamsters by CELO Virus, Tumour Tissue, and Tumour Cells Grown in Culture*

    PubMed Central

    Mancini, L. O.; Jasty, V.; Anderson, J.; Yates, V. J.


    Tumours in hamsters, induced by the chicken-embryo-lethal-orphan (CELO) virus, by tumour tissue transplants, or by tumour cells grown in culture, were well circumscribed solid tumours and covered by a thin capsule-like structure. All were fibrosarcomata. However, tumours produced by the 3 inocula exhibited the following histological differences. Neoplasms induced by CELO virus were generally less differentiated and were composed of cells with polygonal or oval nuclei and indistinct cytoplasmic boundaries. Numerous multinucleated bizarre giant cells were found. Those produced by tumour tissue transplants were more differentiated and were composed of spindle shaped cells with abundant collagen fibre formation. Neoplasms induced by tumour cells grown in culture were generally undifferentiated with many mitotic figures and contained numerous giant cells. Cells from tumours induced by CELO virus or tumour transplants produced similar morphologies when cultured in vitro. The cell cultures consisted of large cells with oval or rounded large nuclei and prominent nucleoli. Multinucleated giant cells, cells in mitosis, and a disorganized growth pattern were also characteristic of the cell cultures. However, mitosis and a piling-up of cells occurred more frequently with cell cultures derived from the CELO virus-induced tumour. ImagesFig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6 PMID:4335495

  6. GaSb thermophotovoltaic cells grown on GaAs by molecular beam epitaxy using interfacial misfit arrays

    SciTech Connect

    Juang, Bor-Chau Laghumavarapu, Ramesh B.; Foggo, Brandon J.; Lin, Andrew; Simmonds, Paul J.; Liang, Baolai; Huffaker, Diana L.


    There exists a long-term need for foreign substrates on which to grow GaSb-based optoelectronic devices. We address this need by using interfacial misfit arrays to grow GaSb-based thermophotovoltaic cells directly on GaAs (001) substrates and demonstrate promising performance. We compare these cells to control devices grown on GaSb substrates to assess device properties and material quality. The room temperature dark current densities show similar characteristics for both cells on GaAs and on GaSb. Under solar simulation the cells on GaAs exhibit an open-circuit voltage of 0.121 V and a short-circuit current density of 15.5 mA/cm{sup 2}. In addition, the cells on GaAs substrates maintain 10% difference in spectral response to those of the control cells over a large range of wavelengths. While the cells on GaSb substrates in general offer better performance than the cells on GaAs substrates, the cost-savings and scalability offered by GaAs substrates could potentially outweigh the reduction in performance. By further optimizing GaSb buffer growth on GaAs substrates, Sb-based compound semiconductors grown on GaAs substrates with similar performance to devices grown directly on GaSb substrates could be realized.

  7. GaSb thermophotovoltaic cells grown on GaAs by molecular beam epitaxy using interfacial misfit arrays

    NASA Astrophysics Data System (ADS)

    Juang, Bor-Chau; Laghumavarapu, Ramesh B.; Foggo, Brandon J.; Simmonds, Paul J.; Lin, Andrew; Liang, Baolai; Huffaker, Diana L.


    There exists a long-term need for foreign substrates on which to grow GaSb-based optoelectronic devices. We address this need by using interfacial misfit arrays to grow GaSb-based thermophotovoltaic cells directly on GaAs (001) substrates and demonstrate promising performance. We compare these cells to control devices grown on GaSb substrates to assess device properties and material quality. The room temperature dark current densities show similar characteristics for both cells on GaAs and on GaSb. Under solar simulation the cells on GaAs exhibit an open-circuit voltage of 0.121 V and a short-circuit current density of 15.5 mA/cm2. In addition, the cells on GaAs substrates maintain 10% difference in spectral response to those of the control cells over a large range of wavelengths. While the cells on GaSb substrates in general offer better performance than the cells on GaAs substrates, the cost-savings and scalability offered by GaAs substrates could potentially outweigh the reduction in performance. By further optimizing GaSb buffer growth on GaAs substrates, Sb-based compound semiconductors grown on GaAs substrates with similar performance to devices grown directly on GaSb substrates could be realized.

  8. Berry extracts exert different antiproliferative effects against cervical and colon cancer cells grown in vitro.


    McDougall, Gordon J; Ross, Heather A; Ikeji, Magnus; Stewart, Derek


    Polyphenol-rich berry extracts were screened for their antiproliferative effectiveness using human cervical cancer (HeLa) cells grown in microtiter plates. Rowan berry, raspberry, lingonberry, cloudberry, arctic bramble, and strawberry extracts were effective but blueberry, sea buckthorn, and pomegranate extracts were considerably less effective. The most effective extracts (strawberry > arctic bramble > cloudberry > lingonberry) gave EC 50 values in the range of 25-40 microg/(mL of phenols). These extracts were also effective against human colon cancer (CaCo-2) cells, which were generally more sensitive at low concentrations but conversely less sensitive at higher concentrations. The strawberry, cloudberry, arctic bramble, and the raspberry extracts share common polyphenol constituents, especially the ellagitannins, which have been shown to be effective antiproliferative agents. However, the components underlying the effectiveness of the lingonberry extracts are not known. The lingonberry extracts were fractionated into anthocyanin-rich and tannin-rich fractions by chromatography on Sephadex LH-20. The anthocyanin-rich fraction was considerably less effective than the original extract, whereas the antiproliferative activity was retained in the tannin-rich fraction. The polyphenolic composition of the lingonberry extract was assessed by liquid chromatography-mass spectrometry and was similar to previous reports. The tannin-rich fraction was almost entirely composed of procyanidins of linkage type A and B. Therefore, the antiproliferative activity of lingonberry was caused predominantly by procyanidins. PMID:18412361

  9. A549 Lung Epithelial Cells Grown as Three-Dimensional Aggregates: Alternative Tissue Culture Model for Pseudomonas aeruginosa Pathogenesis

    PubMed Central

    Carterson, A. J.; Höner zu Bentrup, K.; Ott, C. M.; Clarke, M. S.; Pierson, D. L.; Vanderburg, C. R.; Buchanan, K. L.; Nickerson, C. A.; Schurr, M. J.


    A three-dimensional (3-D) lung aggregate model was developed from A549 human lung epithelial cells by using a rotating-wall vessel bioreactor to study the interactions between Pseudomonas aeruginosa and lung epithelial cells. The suitability of the 3-D aggregates as an infection model was examined by immunohistochemistry, adherence and invasion assays, scanning electron microscopy, and cytokine and mucoglycoprotein production. Immunohistochemical characterization of the 3-D A549 aggregates showed increased expression of epithelial cell-specific markers and decreased expression of cancer-specific markers compared to their monolayer counterparts. Immunohistochemistry of junctional markers on A549 3-D cells revealed that these cells formed tight junctions and polarity, in contrast to the cells grown as monolayers. Additionally, the 3-D aggregates stained positively for the production of mucoglycoprotein while the monolayers showed no indication of staining. Moreover, mucin-specific antibodies to MUC1 and MUC5A bound with greater affinity to 3-D aggregates than to the monolayers. P. aeruginosa attached to and penetrated A549 monolayers significantly more than the same cells grown as 3-D aggregates. Scanning electron microscopy of A549 cells grown as monolayers and 3-D aggregates infected with P. aeruginosa showed that monolayers detached from the surface of the culture plate postinfection, in contrast to the 3-D aggregates, which remained attached to the microcarrier beads. In response to infection, proinflammatory cytokine levels were elevated for the 3-D A549 aggregates compared to monolayer controls. These findings suggest that A549 lung cells grown as 3-D aggregates may represent a more physiologically relevant model to examine the interactions between P. aeruginosa and the lung epithelium during infection. PMID:15664956

  10. Antrodia camphorata Grown on Germinated Brown Rice Suppresses Melanoma Cell Proliferation by Inducing Apoptosis and Cell Differentiation and Tumor Growth

    PubMed Central

    Song, Minjung; Park, Dong Ki; Park, Hye-Jin


    Antrodia camphorata grown on germinated brown rice (CBR) was prepared to suppress melanoma development. CBR extracts were divided into hexane, EtOAc, BuOH, and water fractions. Among all the fractions, EtOAc fraction showed the best suppressive effect on B16F10 melanoma cell proliferation by CCK-8 assay. It also showed the increased cell death and the changed cellular morphology after CBR treatment. Annexin V-FITC/PI, flow cytometry, and western blotting were performed to elucidate anticancer activity of CBR. The results showed that CBR induced p53-mediated apoptotic cell death of B16F10. CBR EtOAc treatment increased melanin content and melanogenesis-related proteins of MITF and TRP-1 expressions, which supports its anticancer activity. Its potential as an anticancer agent was further investigated in tumor-xenografted mouse model. In melanoma-xenografted mouse model, melanoma tumor growth was significantly suppressed under CBR EtOAc fraction treatment. HPLC analysis of CBR extract showed peak of adenosine. In conclusion, CBR extracts notably inhibited B16F10 melanoma cell proliferation through the p53-mediated apoptosis induction and increased melanogenesis. These findings suggest that CBR EtOAc fraction can act as an effective anticancer agent to treat melanoma. PMID:23533475

  11. Antrodia camphorata Grown on Germinated Brown Rice Suppresses Melanoma Cell Proliferation by Inducing Apoptosis and Cell Differentiation and Tumor Growth.


    Song, Minjung; Park, Dong Ki; Park, Hye-Jin


    Antrodia camphorata grown on germinated brown rice (CBR) was prepared to suppress melanoma development. CBR extracts were divided into hexane, EtOAc, BuOH, and water fractions. Among all the fractions, EtOAc fraction showed the best suppressive effect on B16F10 melanoma cell proliferation by CCK-8 assay. It also showed the increased cell death and the changed cellular morphology after CBR treatment. Annexin V-FITC/PI, flow cytometry, and western blotting were performed to elucidate anticancer activity of CBR. The results showed that CBR induced p53-mediated apoptotic cell death of B16F10. CBR EtOAc treatment increased melanin content and melanogenesis-related proteins of MITF and TRP-1 expressions, which supports its anticancer activity. Its potential as an anticancer agent was further investigated in tumor-xenografted mouse model. In melanoma-xenografted mouse model, melanoma tumor growth was significantly suppressed under CBR EtOAc fraction treatment. HPLC analysis of CBR extract showed peak of adenosine. In conclusion, CBR extracts notably inhibited B16F10 melanoma cell proliferation through the p53-mediated apoptosis induction and increased melanogenesis. These findings suggest that CBR EtOAc fraction can act as an effective anticancer agent to treat melanoma. PMID:23533475

  12. A simple pneumatic device for plunge-freezing cells grown on electron microscopy grids.


    Cole, R; Matuszek, G; See, C; Rieder, C L


    A detailed design for a simple and inexpensive variable-speed (1.0-5.8 m s-1) pneumatic plunge-freezing device is presented. Cultured cells, grown on Formvar-coated 75-mesh gold finder grids, are pneumatically driven into a stirring mixture of propane/isopentane (3:1) cooled by liquid nitrogen (LN2). Premature freezing of the sample in the cryogenic vapors above the cryogen is prevented by plunging through an entry tube into an insulating box, to which a partial vacuum is applied. The cryogenic vapors are drafted into the box at the level of the liquid cryogen by the vacuum, thereby preventing a layer of cold gas from collecting above the cryogen. To prevent the sample from thawing during transfer from the cryogen to the substitution medium, the box top is removed and compressed air is forced through a corrugated tube running the length of the box. The resulting boiling LN2 creates an atmosphere below -120 degrees C in which the transfer can be accomplished. PMID:2213239

  13. Proteomic analysis of Staphylococcus aureus biofilm cells grown under physiologically relevant fluid shear stress conditions

    PubMed Central


    Background The biofilm forming bacterium Staphylococcus aureus is responsible for maladies ranging from severe skin infection to major diseases such as bacteremia, endocarditis and osteomyelitis. A flow displacement system was used to grow S. aureus biofilms in four physiologically relevant fluid shear rates (50, 100, 500 and 1000s-1) to identify proteins that are associated with biofilm. Results Global protein expressions from the membrane and cytosolic fractions of S. aureus biofilm cells grown under the above shear rate conditions are reported. Sixteen proteins in the membrane-enriched fraction and eight proteins in the cytosolic fraction showed significantly altered expression (p?

  14. Targeting FAK Radiosensitizes 3-Dimensional Grown Human HNSCC Cells Through Reduced Akt1 and MEK1/2 Signaling

    SciTech Connect

    Hehlgans, Stephanie; Department of Radiotherapy and Oncology, University of Frankfurt, Frankfurt am Main; Institute of Radiopharmacy, Helmholtz Center Dresden-Rossendorf, Dresden ; Eke, Iris; Cordes, Nils; Institute of Radiopharmacy, Helmholtz Center Dresden-Rossendorf, Dresden; Department of Radiation Oncology, University Hospital and Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden


    Purpose: Focal adhesion kinase (FAK), a main regulator of integrin signaling and cell migration, is frequently overexpressed and hyperphosphorylated in human head-and-neck squamous cell carcinoma (HNSCC). We have previously shown that pharmacologic FAK inhibition leads to radiosensitization of 3-dimensionally grown HNSCC cell lines. To further evaluate the role of FAK in radioresistance and as a potential cancer target, we examined FAK and FAK downstream signaling in HNSCC cell lines grown in more physiologic extracellular matrix-based 3-dimensional cell cultures. Methods and Materials: Seven HNSCC cell lines were grown in 3-dimensional extracellular matrix and the clonogenic radiation survival, expression, and phosphorylation of FAK, paxillin, Akt1, extracellular signal-regulated kinase (ERK)1/2, and MEK1/2 were analyzed after siRNA-mediated knockdown of FAK, Akt1, MEK1, FAK+Akt1, or FAK+MEK1 compared with controls or stable overexpression of FAK. The role of MEK1/2 for clonogenic survival and signaling was investigated using the MEK inhibitor U0126 with or without irradiation. Results: FAK knockdown moderately or significantly enhanced the cellular radiosensitivity of 3-dimensionally grown HNSCC cells. The FAK downstream targets paxillin, Akt1, and ERK1/2 were substantially dephosphorylated under FAK depletion. FAK overexpression, in contrast, increased radiation survival and paxillin, Akt1, and ERK1/2 phosphorylation. The degree of radiosensitization upon Akt1, ERK1/2, or MEK1 depletion or U0126 was superimposable to FAK knockdown. Combination knockdown conditions (ie, Akt1/FAK, MEK1/FAK, or U0126/FAK) failed to provide additional radiosensitization. Conclusions: Our data provide further evidence for FAK as important determinant of radiation survival, which acts in the same signaling axis as Akt1 and ERK1/2. These data strongly support our hypothesis that FAK is a relevant molecular target for HNSCC radiotherapy.

  15. Grain and crystal texture properties of absorber layers in MOCVD-grown CdTe/CdS solar cells

    NASA Astrophysics Data System (ADS)

    Zoppi, G.; Durose, K.; Irvine, S. J. C.; Barrioz, V.


    The microstructure of 4-13 m thick CdTe absorber layers in CdTe/CdS/ITO/glass solar cell structures grown by metal-organic chemical vapour deposition (MOCVD) at 350 C has been studied. The crystalline texture, lattice parameter and grain size were measured as a function of thickness for the as-grown layers, and as a function of annealing temperature and time for annealing in both nitrogen (N2) and cadmium chloride (CdCl2) environments. The average grain sizes developed with thickness as r (m) = 0.050x - 0.10 (4 < x < 12 m), and this behaviour is contrasted with that for close-spaced sublimation material grown at 500 C. Annealing in both ambients promoted grain growth (with Rayleigh grain size distribution functions and Burke-Turnbull exponents being n = 7 at 440 C and ~4 at 400 C), a development of the grown-in preferred orientation from [1 1 1] to [2 1 1], and relief of the grown-in compressive stress. A growth mechanism by which development of the [2 1 1] preferred orientation may accompany grain growth is described. It is concluded that MOCVD growth at temperatures higher than 350 C used here will be required to produce the larger grain sizes required for photovoltaic applications.

  16. Radiosensitivity of different human tumor cells lines grown as multicellular spheroids determined from growth curves and survival data

    SciTech Connect

    Schwachoefer, J.H.C.; Crooijmans, R.P.; van Gasteren, J.J.; Hoogenhout, J.; Jerusalem, C.R.; Kal, H.B.; Theeuwes, A.G. )


    Five human tumor cell lines were grown as multicellular tumor spheroids (MTS) to determine whether multicellular tumor spheroids derived from different types of tumors would show tumor-type dependent differences in response to single-dose irradiation, and whether these differences paralleled clinical behavior. Multicellular tumor spheroids of two neuroblastoma, one lung adenocarcinoma, one melanoma, and a squamous cell carcinoma of the oral tongue, were studied in terms of growth delay, calculated cell survival, and spheroid control dose50 (SCD50). Growth delay and cell survival analysis for the tumor cell lines showed sensitivities that correlated well with clinical behavior of the tumor types of origin. Similar to other studies on melanoma multicellular tumor spheroids our spheroid control dose50 results for the melanoma cell line deviated from the general pattern of sensitivity. This might be due to the location of surviving cells, which prohibits proliferation of surviving cells and hence growth of melanoma multicellular tumor spheroids. This study demonstrates that radiosensitivity of human tumor cell lines can be evaluated in terms of growth delay, calculated cell survival, and spheroid control dose50 when grown as multicellular tumor spheroids. The sensitivity established from these evaluations parallels clinical behavior, thus offering a unique tool for the in vitro analysis of human tumor radiosensitivity.

  17. Salicylic acid induces apoptosis in colon carcinoma cells grown in-vitro: Influence of oxygen and salicylic acid concentration

    SciTech Connect

    Zitta, Karina; Meybohm, Patrick; Bein, Berthold; Huang, Ying; Heinrich, Christin; Scholz, Jens; Steinfath, Markus; Albrecht, Martin


    In solid tumors the hypoxic environment can promote tumor progression and resistance to therapy. Recently, acetylsalicylic acid a major component of analgesic drugs and its metabolite salicylic acid (SA) have been shown to reduce the risk of colon cancer, but the mechanisms of action remain still unclear. Here we elucidate the effects of physiologically relevant concentrations of SA on colon carcinoma cells (CaCo-2) grown under normoxic and hypoxic conditions. Western blotting, caspase-3/7 apoptosis assays, MTS cell-proliferation assays, LDH cytotoxicity assays and hydrogen peroxide measurements were performed to investigate the effects of 1 and 10 {mu}M SA on CaCo-2 cells grown under normoxic conditions and cells exposed to hypoxia. Under normoxic conditions, SA did not influence cell proliferation or LDH release of CaCo-2 cells. However, caspase-3/7 activity was significantly increased. Under hypoxia, cell proliferation was reduced and LDH release and caspase-3/7 activities were increased. None of these parameters was altered by the addition of SA under hypoxic conditions. Hypoxia increased hydrogen peroxide concentrations 300-fold and SA significantly augmented the release of hydrogen peroxide under normoxic, but not under hypoxic conditions. Phosphorylation of the pro-survival kinases akt and erk1/2 was not changed by SA under hypoxic conditions, whereas under normoxia SA reduced phosphorylation of erk1/2 after 2 hours. We conclude that in colon carcinoma cells effects of SA on apoptosis and cellular signaling are dependent on the availability of oxygen. -- Highlights: Black-Right-Pointing-Pointer Effects of salicylic acid on colon carcinoma cells grown under normoxic and hypoxic conditions Black-Right-Pointing-Pointer Salicylic acid increases caspase-3/7 activity and hydrogen peroxide release under normoxia Black-Right-Pointing-Pointer Salicylic acid decreases pro-survival erk-1/2 phosphorylation under normoxia Black-Right-Pointing-Pointer Salicylic acid does not influence any of the investigated parameters under hypoxia.

  18. Accumulation of a novel glycolipid and a betaine lipid in cells of Rhodobacter sphaeroides grown under phosphate limitation.


    Benning, C; Huang, Z H; Gage, D A


    Cells of the photosynthetic bacterium Rhodobacter sphaeroides grown under phosphate-limiting conditions accumulated nonphosphorous glycolipids and lipids carrying head groups derived from amino acids. Concomitantly, the relative amount of phosphoglycerolipids decreased from 90 to 22 mol% of total polar lipids in the membranes. Two lipids, not detectable in cells grown under standard conditions, were synthesized during phosphate-limited growth. Fast atom bombardment mass spectroscopy, exact mass measurements, 1H NMR spectroscopy, sugar composition analysis, and methylation analysis of the predominant glycolipid led to the identification of the novel compound 1,2-di-O-acyl-3-O-[alpha-D-glucopyranosyl-(1-->4)-O-beta-D-galactopyr anosyl]glycerol. The second lipid was identified as the betaine lipid 1,2-di-O-acyl-[4'-(N,N,N-trimethyl)-homoserine]glycerol by cochromatography employing an authentic standard from Chlamydomonas reinhardtii, fast atom bombardment mass spectroscopy, exact mass measurements, and 1H NMR spectroscopy. Prior to this observation, the occurrence of this lipid was thought to be restricted to lower plants and algae. Apparently, these newly synthesized nonphosphorous lipids, in addition to the sulfo- and the ornithine lipid also found in R. sphaeroides grown under optimal conditions, take over the role of phosphoglycerolipids in phosphate-deprived cells. PMID:7872771

  19. Effects of cadmium on intercellular junctions in a renal epithelial cell line grown on permeable membrane supports

    SciTech Connect

    Prozialeck, W.C.; Niewenhuis, R.J. )


    Recent findings from the authors laboratories have shown that Cd{sup 2+} has relatively specific damaging effects on adhering and occluding junctions in the established porcine renal epithelial cell line, LLC-PK{sub 1}. The present studies were undertaken in order to further characterize the junction-perturbing effects of Cd{sup 2+} in polarized monolayers of LLC-PK{sub 1} cells, and to begin to identify the mechanisms underlying these effects. LLC-PK{sub 1} cells were grown to confluency on Millicell HA chambers and exposed to Cd{sup 2+} in polarized monolayers of LLC-PK{sub 1} cells, and to begin to identify the mechanisms underlying these effects. LLC-PK{sub 1} cells were grown to confluency on Millicell HA chambers an exposed to Cd{sup 2+} by adding CdCl{sub 2} to the solutions on either side of the cell monolayer. The integrity of cell-cell junctions was assessed by monitoring the transepithelial electrical resistance. The results showed that exposure to Cd{sup 2+} caused a pronounced decrease in transepithelial resistance without causing the cells to detach from the Millicell membrane. This decrease in resistance occurred more quickly and was much more pronounced when Cd{sup 2+} was added to the basolateral surface rather than the apical surface. Furthermore, the effects of Cd{sup 2+} were greatly reduced when excess Ca{sup 2+} was present in the medium. These results suggest that Cd{sup 2+} was present in the medium. These results suggest that Cd{sup 2+} may disrupt cell-cell junctions by interacting with Ca{sup 2+} binding sites or Ca{sup 2+} channels that are oriented toward the basolateral cell surface.

  20. Increased glucocorticoid responsiveness of CD4+ T-cell clonal lines grown in serum-free media.


    Chilton, D G; Johnson, B H; Danel-Moore, L; Kawa, S; Thompson, E B


    CEM-C7, a human leukemic CD4+ T-lymphocyte cell line and three of its subclones, CEM-4R4, CEM-3R43, and ICR-27, previously cultured in a medium supplemented with 5 to 10% fetal bovine serum, have been adapted to serum-free media. The best medium of those tested was RPMI 1640 supplemented with 5 micrograms/ml each transferrin and insulin + 5 ng/ml sodium selenite +/- 0.1% bovine serum albumin. While growing either with or without albumin, the several clonal lines of CEM cells displayed growth similar to serum-supplemented cultures. Cell proliferation of CEM-C7 cells cultured in both serum-free media has been sustained for 3 mo. with culture doubling times of about 25 h for both serum-supplemented and serum-free cultures (viability greater than or equal to 90%). Cell morphology remained essentially the same in serum-free or serum containing media. The expression of CD4, a marker for T-derived lymphoid cells, was not significantly different in serum-free medium. When grown in serum-free medium, CEM-C7 cells exhibited increased steroid responsiveness as evidenced by increased glucocorticoid receptor binding sites, increased induction of glutamine synthetase, and cell lysis at lower concentrations of steroid. Receptor mutant subclones of CEM-C7, which are proven to be completely unresponsive to micromolar concentrations of dexamethasone when grown in serum-supplemented medium, become partially sensitive to the hormone after growth in defined medium. The increased sensitivity of CEM-C7 cells and its subclones to dexamethasone in serum-free medium returned to previous levels when these cells were recultured in serum-containing medium. Our results suggest that substances in serum influence steroid effects on these cells and that the molecular details of glucocorticoid hormone action may be pursued more precisely in a clearly defined culture medium. PMID:1972702

  1. High targeted migration of human mesenchymal stem cells grown in hypoxia is associated with enhanced activation of RhoA

    PubMed Central


    Introduction A feature which makes stem cells promising candidates for cell therapy is their ability to migrate effectively into damaged or diseased tissues. Recent reports demonstrated the increased motility of human mesenchymal stem cells (hMSC) grown under hypoxic conditions compared to normoxic cells. However, the directional migration of hMSC cultured in hypoxia has not been investigated. In this study we examined the in vitro transmembrane migration of hMSC permanently cultured in hypoxia in response to various cytokines. We also studied the involvement of RhoA, a molecule believed to play an essential role in the migration of MSC via reorganization of the cytoskeleton. Methods We compared the directional migration of human hMSCs grown permanently under normal (21%, normoxic) and low O2 (5%, hypoxic) conditions until passage 4 using an in vitro transmembrane migration assay. A series of 17 cytokines was used to induce chemotaxis. We also compared the level of GTP-bound RhoA in the cell extracts of calpeptin-activated hypoxic and normoxic hMSC. Results We found that hMSC cultured in hypoxia demonstrate markedly higher targeted migration activity compared to normoxic cells, particularly towards wound healing cytokines, including those found in ischemic and myocardial infarction. We also demonstrated for the first time that hMSC are dramatically more sensitive to activation of RhoA. Conclusions The results of this study indicate that high directional migration of hMSCs permanently grown in hypoxia is associated with the enhanced activation of RhoA. The enhanced migratory capacity of hypoxic hMSC would further suggest their potential advantages for clinical applications. PMID:23295150

  2. Investigation of InGaP/(In)AlGaAs/GaAs triple-junction top cells for smart stacked multijunction solar cells grown using molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Sugaya, Takeyoshi; Mochizuki, Toru; Makita, Kikuo; Oshima, Ryuji; Matsubara, Koji; Okano, Yoshinobu; Niki, Shigeru


    We report high-quality InGaP/(In)AlGaAs/GaAs triple-junction solar cells fabricated using solid-source molecular beam epitaxy (MBE) for the first time. The triple-junction cells can be used as top cells for smart stacked multijunction solar cells. A growth temperature of 480 C was found to be suitable for an (In)AlGaAs second cell to obtain high-quality tunnel junctions. The properties of AlGaAs solar cells were better than those of InAlGaAs solar cells when a second cell was grown at 480 C. The high-quality InGaP/AlGaAs/GaAs solar cell had an impressive open-circuit voltage of 3.1 V. This result indicates that high-performance InGaP/AlGaAs/GaAs triple-junction solar cells can be fabricated using solid-source MBE.

  3. Growth and characterization of Czochralski-grown n and p-type GaAs for space solar cell substrates

    NASA Technical Reports Server (NTRS)

    Chen, R. T.


    Progress in LEC (liquid encapsulated Czochralski) crystal growth techniques for producing high-quality, 3-inch-diameter, n- and p-type GaAs crystals suitable for solar cell applications is described. The LEC crystals with low dislocation densities and background impurities, high electrical mobilities, good dopant uniformity, and long diffusion lengths were reproducibly grown through control of the material synthesis, growth and doping conditions. The capability for producing these large-area, high-quality substrates should positively impact the manufacturability of highly efficiency, low cost, radiation-hard GaAs solar cells.

  4. Study of a 1 eV GaNAsSb photovoltaic cell grown on a silicon substrate

    SciTech Connect

    Tan, K. H.; Loke, W. K.; Wicaksono, S.; Li, D.; Leong, Y. R.; Yoon, S. F.; Sharma, P.; Milakovich, T.; Bulsara, M. T.; Fitzgerald, E. A.


    We report the performance of a 1 eV GaNAsSb photovoltaic cell grown on a Si substrate with a SiGe graded buffer grown using molecular beam epitaxy. For comparison, the performance of a similar 1 eV GaN{sub 0.018}As{sub 0.897}Sb{sub 0.085} photovoltaic cell grown on a GaAs substrate was also reported. Both devices were in situ annealed at 700 °C for 5 min, and a significant performance improvement over our previous result was observed. The device on the GaAs substrate showed a low open circuit voltage (V{sub OC}) of 0.42 V and a short circuit current density (J{sub SC}) of 23.4 mA/cm{sup 2} while the device on the Si substrate showed a V{sub OC} of 0.39 V and a J{sub SC} of 21.3 mA/cm{sup 2}. Both devices delivered a quantum efficiency of 50%–55% without any anti-reflection coating.

  5. Epitaxial Crystal Silicon Absorber Layers and Solar Cells Grown at 1.8 Microns per Minute: Preprint

    SciTech Connect

    Bobela, D. C.; Teplin, C. W.; Young, D. L.; Branz, H. M.; Stradins, P.


    We have grown device-quality epitaxial silicon thin films at growth rates up to 1.8 ?m/min, using hot-wire chemical vapor deposition from silane at substrate temperatures below 750 degrees C. At these rates, which are more than 30 times faster than those used by the amorphous and nanocrystalline Si industry, capital costs for large-scale solar cell production would be dramatically reduced, even for cell absorber layers up to 10 ?m thick. We achieved high growth rates by optimizing the three key parameters: silane flow, depletion, and filament geometry, based on our model developed earlier. Hydrogen coverage of the filament surface likely limits silane decomposition and growth rate at high system pressures. No considerable deterioration in PV device performance is observed when grown at high rate, provided that the epitaxial growth is initiated at low rate. A simple mesa device structure (wafer/epi Si/a-Si(i)/a-Si:H(p)/ITO) with a 2.3 um epitaxial silicon absorber layer was grown at 700 nm/min. The finished device had an open-circuit voltage of 0.424 V without hydrogenation treatment.

  6. Single Junction InGaP/GaAs Solar Cells Grown on Si Substrates using SiGe Buffer Layers

    NASA Astrophysics Data System (ADS)

    Ringel, S. A.; Carlin, J. A.; Andre, C. L.; Hudait, M. K.; Gonzalez, M.; Wilt, D. M.; Clark, E. B.; Jenkins, P.; Scheiman, D.; Allerman, A.


    Single junction InGaP/GaAs solar cells displaying high efficiency and record high open circuit voltage values have been grown by metalorganic chemical vapor deposition on Ge/graded SiGe/Si substrates. Open circuit voltages as high as 980 mV under AM0 conditions have been verified to result from a single GaAs junction, with no evidence of Ge-related sub-cell photoresponse. Current AM0 efficiencies of close to 16% have been measured for a large number of small area cells, whose performance is limited by non-fundamental current losses due to significant surface reflection resulting from greater than 10% front surface metal coverage and wafer handling during the growth sequence for these prototype cells. It is shown that at the material quality currently achieved for GaAs grown on Ge/SiGe/Si substrates, namely a 10 nanosecond minority carrier lifetime that results from complete elimination of anti-phase domains and maintaining a threading dislocation density of approximately 8 x 105 per square centimeter, 19-20% AM0 single junction GaAs cells are imminent. Experiments show that the high performance is not degraded for larger area cells, with identical open circuit voltages and higher short circuit current (due to reduced front metal coverage) values being demonstrated, indicating that large area scaling is possible in the near term. Comparison to a simple model indicates that the voltage output of these GaAs on Si cells follows ideal behavior expected for lattice mismatched devices, demonstrating that unaccounted for defects and issues that have plagued other methods to epitaxially integrate III-V cells with Si are resolved using SiGe buffers and proper GaAs nucleation methods. These early results already show the enormous and realistic potential of the virtual SiGe substrate approach for generating high efficiency, lightweight and strong III-V solar cells.

  7. Single Junction InGaP/GaAs Solar Cells Grown on Si Substrates using SiGe Buffer Layers

    NASA Technical Reports Server (NTRS)

    Ringel, S. A.; Carlin, J. A.; Andre, C. L.; Hudait, M. K.; Gonzalez, M.; Wilt, D. M.; Clark, E. B.; Jenkins, P.; Scheiman, D.; Allerman, A.


    Single junction InGaP/GaAs solar cells displaying high efficiency and record high open circuit voltage values have been grown by metalorganic chemical vapor deposition on Ge/graded SiGe/Si substrates. Open circuit voltages as high as 980 mV under AM0 conditions have been verified to result from a single GaAs junction, with no evidence of Ge-related sub-cell photoresponse. Current AM0 efficiencies of close to 16% have been measured for a large number of small area cells, whose performance is limited by non-fundamental current losses due to significant surface reflection resulting from greater than 10% front surface metal coverage and wafer handling during the growth sequence for these prototype cells. It is shown that at the material quality currently achieved for GaAs grown on Ge/SiGe/Si substrates, namely a 10 nanosecond minority carrier lifetime that results from complete elimination of anti-phase domains and maintaining a threading dislocation density of approximately 8 x 10(exp 5) per square centimeter, 19-20% AM0 single junction GaAs cells are imminent. Experiments show that the high performance is not degraded for larger area cells, with identical open circuit voltages and higher short circuit current (due to reduced front metal coverage) values being demonstrated, indicating that large area scaling is possible in the near term. Comparison to a simple model indicates that the voltage output of these GaAs on Si cells follows ideal behavior expected for lattice mismatched devices, demonstrating that unaccounted for defects and issues that have plagued other methods to epitaxially integrate III-V cells with Si are resolved using SiGe buffers and proper GaAs nucleation methods. These early results already show the enormous and realistic potential of the virtual SiGe substrate approach for generating high efficiency, lightweight and strong III-V solar cells.

  8. Effects of growth temperature and device structure on GaP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Vaisman, M.; Tomasulo, S.; Masuda, T.; Lang, J. R.; Faucher, J.; Lee, M. L.


    Gallium phosphide (GaP) is an attractive candidate for wide-bandgap solar cell applications, possessing the largest bandgap of the III-arsenide/phosphides without aluminum. However, GaP cells to date have exhibited poor internal quantum efficiency (IQE), even for photons absorbed by direct transitions, motivating improvements in material quality and device structure. In this work, we investigated GaP solar cells grown by molecular beam epitaxy over a range of substrate temperatures, employing a much thinner emitter than in prior work. Higher growth temperatures yielded the best solar cell characteristics, indicative of increased diffusion lengths. Furthermore, the inclusion of an AlGaP window layer improved both open-circuit voltage and short wavelength IQE.

  9. Effects of growth temperature and device structure on GaP solar cells grown by molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Vaisman, M.; Tomasulo, S.; Masuda, T.; Lang, J. R.; Faucher, J.; Lee, M. L.


    Gallium phosphide (GaP) is an attractive candidate for wide-bandgap solar cell applications, possessing the largest bandgap of the III-arsenide/phosphides without aluminum. However, GaP cells to date have exhibited poor internal quantum efficiency (IQE), even for photons absorbed by direct transitions, motivating improvements in material quality and device structure. In this work, we investigated GaP solar cells grown by molecular beam epitaxy over a range of substrate temperatures, employing a much thinner emitter than in prior work. Higher growth temperatures yielded the best solar cell characteristics, indicative of increased diffusion lengths. Furthermore, the inclusion of an AlGaP window layer improved both open-circuit voltage and short wavelength IQE.

  10. Cell-cycle-specific fluctuation in cytoplasmic membrane composition in aerobically grown Rhodospirillum rubrum.

    PubMed Central

    Myers, C R; Collins, M L


    Aerobic growth with synchronous cell division was induced in Rhodospirillum rubrum by starvation methods. Cells were harvested at different points in the cell cycle. Analysis of the composition of the cell envelope prepared by differential centrifugation or density gradient-purified cytoplasmic membrane obtained from cells at different times indicated that the protein/phospholipid ratio fluctuated with the cell cycle. The protein/phospholipid ratio of cell envelope from selection-synchronized cells also fluctuated with the cell cycle. These studies indicate that the phenomenon of cell-cycle-dependent fluctuation in membrane composition is not restricted to the intracytoplasmic chromatophore membrane of phototrophic cells. PMID:3119564

  11. Beta 1 integrin binding plays a role in the constant traction force generation in response to varying stiffness for cells grown on mature cardiac extracellular matrix.


    Gershlak, Joshua R; Black, Lauren D


    We have previously reported a unique response of traction force generation for cells grown on mature cardiac ECM, where traction force was constant over a range of stiffnesses. In this study we sought to further investigate the role of the complex mixture of ECM on this response and assess the potential mechanism behind it. Using traction force microscopy, we measured cellular traction forces and stresses for mesenchymal stem cells (MSCs) grown on polyacrylamide gels at a range of stiffnesses (9, 25, or 48 kPa) containing either adult rat heart ECM, different singular ECM proteins including collagen I, fibronectin, and laminin, or ECM mimics comprised of varying amounts of collagen I, fibronectin, and laminin. We also measured the expression of integrins on these different substrates as well as probed for ?1 integrin binding. There was no significant change in traction force generation for cells grown on the adult ECM, as previously reported, whereas cells grown on singular ECM protein substrates had increased traction force generation with an increase in substrate stiffness. Cells grown on ECM mimics containing collagen I, fibronectin and laminin were found to be reminiscent of the traction forces generated by cells grown on native ECM. Integrin expression generally increased with increasing stiffness except for the ?1 integrin, potentially implicating it as playing a role in the response to adult cardiac ECM. We inhibited binding through the ?1 integrin on cells grown on the adult ECM and found that the inhibition of ?1 binding led to a return to the typical response of increasing traction force generation with increasing stiffness. Our data demonstrates that cells grown on the mature cardiac ECM are able to circumvent typical stiffness related cellular behaviors, likely through ?1 integrin binding to the complex composition. PMID:25220424

  12. mtDNA depletion confers specific gene expression profiles in human cells grown in culture and in xenograft

    PubMed Central

    Magda, Darren; Lecane, Philip; Prescott, Julia; Thiemann, Patricia; Ma, Xuan; Dranchak, Patricia K; Toleno, Donna M; Ramaswamy, Krishna; Siegmund, Kimberly D; Hacia, Joseph G


    Background Interactions between the gene products encoded by the mitochondrial and nuclear genomes play critical roles in eukaryotic cellular function. However, the effects mitochondrial DNA (mtDNA) levels have on the nuclear transcriptome have not been defined under physiological conditions. In order to address this issue, we characterized the gene expression profiles of A549 lung cancer cells and their mtDNA-depleted ?0 counterparts grown in culture and as tumor xenografts in immune-deficient mice. Results Cultured A549 ?0 cells were respiration-deficient and showed enhanced levels of transcripts relevant to metal homeostasis, initiation of the epithelial-mesenchymal transition, and glucuronidation pathways. Several well-established HIF-regulated transcripts showed increased or decreased abundance relative to the parental cell line. Furthermore, growth in culture versus xenograft has a significantly greater influence on expression profiles, including transcripts involved in mitochondrial structure and both aerobic and anaerobic energy metabolism. However, both in vitro and in vivo, mtDNA levels explained the majority of the variance observed in the expression of transcripts in glucuronidation, tRNA synthetase, and immune surveillance related pathways. mtDNA levels in A549 xenografts also affected the expression of genes, such as AMACR and PHYH, involved in peroxisomal lipid metabolic pathways. Conclusion We have identified mtDNA-dependent gene expression profiles that are shared in cultured cells and in xenografts. These profiles indicate that mtDNA-depleted cells could provide informative model systems for the testing the efficacy of select classes of therapeutics, such as anti-angiogenesis agents. Furthermore, mtDNA-depleted cells grown culture and in xenografts provide a powerful means to investigate possible relationships between mitochondrial activity and gene expression profiles in normal and pathological cells. PMID:18980691

  13. "allometry" Deterministic Approaches in Cell Size, Cell Number and Crude Fiber Content Related to the Physical Quality of Kangkong (Ipomoea reptans) Grown Under Different Plant Density Pressures

    NASA Astrophysics Data System (ADS)

    Selamat, A.; Atiman, S. A.; Puteh, A.; Abdullah, N. A. P.; Mohamed, M. T. M.; Zulkeefli, A. A.; Othman, S.

    Kangkong, especially the upland type (Ipomoea reptans) is popularly consumed as a vegetable dish in the South East Asian countries for its quality related to Vitamins (A and C) and crude fiber contents. Higher fiber contents would prevent from the occurrence of colon cancer and diverticular disease. With young stem edible portion, its cell number and size contribute to the stem crude fiber content. The mathematical approach of allometry of cell size, number, and fiber content of stem could be used in determining the 'best' plant density pressure in producing the quality young stem to be consumed. Basically, allometry is the ratio of relative increment (growth or change) rates of two parameters, or the change rate associated to the log of measured variables relationship. Kangkog grown equal or lower than 55 plants m-2 produced bigger individual plant and good quality (physical) kangkong leafy vegetable, but with lower total yield per unit area as compared to those grown at higher densities.

  14. Collagen scaffolds with in situ-grown calcium phosphate for osteogenic differentiation of Wharton's jelly and menstrual blood stem cells.


    Karadas, Ozge; Yucel, Deniz; Kenar, Halime; Torun Kose, Gamze; Hasirci, Vasif


    The aim of this research was to investigate the osteogenic differentiation potential of non-invasively obtained human stem cells on collagen nanocomposite scaffolds with in situ-grown calcium phosphate crystals. The foams had 70% porosity and pore sizes varying in the range 50-200 m. The elastic modulus and compressive strength of the calcium phosphate containing collagen scaffolds were determined to be 234.5 kPa and 127.1 kPa, respectively, prior to in vitro studies. Mesenchymal stem cells (MSCs) obtained from Wharton's jelly and menstrual blood were seeded on the collagen scaffolds and proliferation and osteogenic differentiation capacities of these cells from two different sources were compared. The cells on the composite scaffold showed the highest alkaline phosphatase activity compared to the controls, cells on tissue culture polystyrene and cells on collagen scaffolds without in situ-formed calcium phosphate. MSCs isolated from both Wharton's jelly and menstrual blood showed a significant level of osteogenic activity, but those from Wharton's jelly performed better. In this study it was shown that collagen nanocomposite scaffolds seeded with cells obtained non-invasively from human tissues could represent a potential construct to be used in bone tissue engineering. PMID:22744919

  15. High-efficiency GaAs and GaInP solar cells grown by all solid-state molecular-beam-epitaxy

    PubMed Central


    We report the initial results of GaAs and GaInP solar cells grown by all solid-state molecular-beam-epitaxy (MBE) technique. For GaAs single-junction solar cell, with the application of AlInP as the window layer and GaInP as the back surface field layer, the photovoltaic conversion efficiency of 26% at one sun concentration and air mass 1.5 global (AM1.5G) is realized. The efficiency of 16.4% is also reached for GaInP solar cell. Our results demonstrate that the MBE-grown phosphide-contained III-V compound semiconductor solar cell can be quite comparable to the metal-organic-chemical-vapor-deposition-grown high-efficiency solar cell. PMID:22040124

  16. Temperature coefficients and radiation induced DLTS spectra of MOCVD grown n(+)p InP solar cells

    NASA Technical Reports Server (NTRS)

    Walters, Robert J.; Statler, Richard L.; Summers, Geoffrey P.


    The effects of temperature and radiation on n(+)p InP solar cells and mesa diodes grown by metallorganic chemical vapor deposition (MOCVD) were studied. It was shown that MOCVD is capable of consistently producing good quality InP solar cells with Eff greater than 19 percent which display excellent radiation resistance due to minority carrier injection and thermal annealing. It was also shown that universal predictions of InP device performance based on measurements of a small group of test samples can be expected to be quite accurate, and that the degradation of an InP device due to any incident particle spectrum should be predictable from a measurement following a single low energy proton irradiation.

  17. The Proteome of Filter-Grown Caco-2 Cells With a Focus on Proteins Involved in Drug Disposition.


    Ölander, Magnus; Wiśniewski, Jacek R; Matsson, Pär; Lundquist, Patrik; Artursson, Per


    Caco-2 cells are widely used in studies of intestinal cell physiology and drug transport. Here, the global proteome of filter-grown Caco-2 cells was quantified using the total protein approach and compared with the human colon and jejunum proteomes. In total, 8096 proteins were identified. In-depth analysis of proteins defining enterocyte differentiation-including brush-border hydrolases, integrins, and adherens and tight junctions-gave near-complete coverage of the expected proteins. Three hundred twenty-seven absorption, distribution, metabolism and excretion proteins were identified, including 112 solute carriers and 20 ATP-binding cassette transporters. OATP2B1 levels were 16-fold higher in Caco-2 cells than in jejunum. To investigate the impact of this difference on in vitro-in vivo extrapolations, we studied the uptake kinetics of the OATP2B1 substrate pitavastatin in Caco-2 monolayers, and found that the contribution of OATP2B1 was 60%-70% at clinically relevant intestinal concentrations. Pitavastatin kinetics was combined with transporter concentrations to model the contribution of active transport and membrane permeation in the jejunum. The lower OATP2B1 expression in jejunum led to a considerably lower transporter contribution (<5%), suggesting that transmembrane diffusion dominates pitavastatin absorption in vivo. In conclusion, we present the first in-depth quantification of the filter-grown Caco-2 proteome. We also demonstrate the crucial importance of considering transporter expression levels for correct interpretation of drug transport routes across the human intestine. PMID:26869432

  18. Enzymatic Detachment of Therapeutic Mesenchymal Stromal Cells Grown on Glass Carriers in a Bioreactor

    PubMed Central

    Salzig, Denise; Schmiermund, Alexandra; P. Grace, Pablo; Elseberg, Christiane; Weber, Christian; Czermak, Peter


    Cell therapies require the in vitro expansion of adherent cells such as mesenchymal stromal cells (hMSCs) in bioreactor systems or other culture environments, followed by cell harvest. As hMSCs are strictly adherent cells, cell harvest requires cell detachment. The use of hMSCs for cell therapy requires GMP production in accordance with the guidelines for advanced therapeutic medical products. Therefore, several GMP-conform available proteolytic enzymes were investigated for their ability to promote hMSC detachment. An allogeneic hMSC cell line (hMSC-TERT) that is used in clinical trials in the form of alginate cell capsules was chosen as a model. This study investigated the influence of several factors on the outcome of proteolytic hMSC-TERT detachment. Therefore, hMSC-TERT detachment was analyzed in different cultivation systems (static, dynamic) and in combination with further cell processing including encapsulation. Only two of the commercially available enzymes (AccutaseTM, TrypZeanTM) that fulfill all process requirements (commercial availability, cost, GMP conditions during manufacturing and non-animal origin) are found to be generally suitable for detaching hMSC-TERT. Combining cell detachment with encapsulation demonstrated a high impact of the experimental set up on cell damage. It was preferable to reduce the temperature during detachment and limit the detachment time to a maximum of 20 minutes. Cell detachment in static systems was not comparable with detachment in dynamic systems. Detachment yields in dynamic systems were lower and cell damage was higher for the same experimental conditions. Finally, only TrypZeanTM seemed to be suitable for the detachment of hMSC-TERT from dynamic reactor systems. PMID:24478807

  19. Epitaxially Grown Collagen Fibrils Reveal Diversity in Contact Guidance Behavior among Cancer Cells

    PubMed Central


    Invasion of cancer cells into the surrounding tissue is an important step during cancer progression and is driven by cell migration. Cell migration can be random, but often it is directed by various cues such as aligned fibers composed of extracellular matrix (ECM), a process called contact guidance. During contact guidance, aligned fibers bias migration along the long axis of the fibers. These aligned fibers of ECM are commonly composed of type I collagen, an abundant structural protein around tumors. In this paper, we epitaxially grew several different patterns of organized type I collagen on mica and compared the morphology and contact guidance behavior of two invasive breast cancer cell lines (MDA-MB-231 and MTLn3 cells). Others have shown that these cells randomly migrate in qualitatively different ways. MDA-MB-231 cells exert large traction forces, tightly adhere to the ECM, and migrate with spindle-shaped morphology and thus adopt a mesenchymal mode of migration. MTLn3 cells exert small traction forces, loosely adhere to the ECM, and migrate with a more rounded morphology and thus adopt an amoeboid mode of migration. As the degree of alignment of type I collagen fibrils increases, cells become more elongated and engage in more directed contact guidance. MDA-MB-231 cells perceive the directional signal of highly aligned type I collagen fibrils with high fidelity, elongating to large extents and migrating directionally. Interestingly, behavior in MTLn3 cells differs. While highly aligned type I collagen fibril patterns facilitate spreading and random migration of MTLn3 cells, they do not support elongation or directed migration. Thus, different contact guidance cues bias cell migration differently and the fidelity of contact guidance is cell type dependent, suggesting that ECM alignment is a permissive cue for contact guidance, but requires a cell to have certain properties to interpret that cue. PMID:25531276

  20. Endothelial cells grown on thin polyelectrolyte mutlilayered films: an evaluation of a new versatile surface modification.


    Boura, C; Menu, P; Payan, E; Picart, C; Voegel, J C; Muller, S; Stoltz, J F


    Endothelial cell seeding constitutes an appreciated method to improve blood compatibility of small-diameter vascular grafts. In this study, we report the development of a simple innovative technique based on multilayered polyelectrolyte films as cell adhesive substrates. Polyelectrolyte multilayered films ending by poly(sodium-4-styrenesulfonate)/poly(allylamine hydrochloride) (PSS/PAH) or poly(L-glutamic acid)/poly(D-lysine) (PGA/PDL) could enhance cell adhesion by modification of the physico-chemical properties of the surface. The biological responses of human umbilical vein endothelial cells seeded on the polyelectrolyte multilayer films, on PDL or PAH monolayers, and on control surfaces, were evaluated in terms of initial attachment, growth, cellular metabolic activity, endothelial phenotype, and adhesion. The results showed that polyelectrolyte multilayers neither induce cytotoxic effects nor alter the phenotype of the endothelial cells. The polyelectrolyte multilayered films enhanced initial cell attachment as compared to the polyelectrolyte monolayer. Cell growth observed on the films was similar to that on TCPS. Among the different coating tested, the film ending by PSS/PAH exhibited an excellent cellular biocompatibility and appeared to be the most interesting surface in terms of cellular adhesion and growth. Such films could be used to cover hydrophobic (cell resistant) substrates in order to promote cell colonization, thereby constituting an excellent material for endothelial cell seeding. PMID:12809781

  1. Effects of temperature on the cell wall and osmotic properties in dark-grown rice and azuki bean seedlings.


    Nakamura, Yukiko; Wakabayashi, Kazuyuki; Kamisaka, Seiichiro; Hoson, Takayuki


    The mechanism inducing the difference in growth rate under various temperature (10-50 degrees C) conditions was analyzed using rice and azuki bean seedlings. The growth rate of rice coleoptiles and azuki bean epicotyls increased as temperature increased up to 40 and 30 degrees C, respectively, and the elongation was retarded at a higher temperature. The cell wall extensibility of rice coleoptiles and azuki bean epicotyls also showed the highest value at 40 and 30 degrees C, respectively, and became smaller as the temperature rose or dropped from the optimum. The opposite tendency was observed in the minimum stress-relaxation time of the cell wall. On the other hand, the cellular osmotic concentration of rice coleoptiles and azuki bean epicotyls was lower at the temperature optimum for growth at 40 and 30 degrees C, respectively. When rice and azuki bean seedlings grown at 10, 20, 40, or 50 degrees C were transferred to the initial temperature (30 degrees C), the growth rate of coleoptiles and epicotyls was mostly elevated, concomitant with an increase in the cell wall extensibility. The growth rate was correlated with the cell wall mechanical parameters in both materials. These results suggest that the environmental temperature modulates the growth rate of plant shoots by affecting mainly the mechanical properties of the cell wall. PMID:12579449

  2. Antigenic Protein In Microgravity-Grown Human Mixed Mullerian Tumor (LN1) Cells Preserved In RNA Stabilizing Agent

    NASA Technical Reports Server (NTRS)

    Hammond, Dianne K.; Becker, Jeanne; Elliott, T. F.; Holubec, K.; Baker, T. L.; Love, J. E.


    Cells treated with RNAlater(TradeMark) have previously been shown to contain antigenic proteins that can be visualized using Western blot analysis. These proteins seem to be stable for several months when stored in RNA stabilizer at 4 C. Antigenic protein can be recovered from cells that have been processed using an Ambion RNAqueous(Registered TradeMark) kit to remove RNA. In this set of experiments, human mixed Mullerian tumor (LNI) cells grown on the International Space Station during Expedition 3 were examined for antigenic stability after removal of RNA. The cells were stored for three months in RNAlater(TradeMark) and RNA was extracted. The RNA filtrate containing the protein was precipitated, washed, and suspended in buffer containing sodium dodecyl sulfate (SDS). Samples containing equal concentrations of protein were loaded onto SDS-polyacrylamide gels. Proteins were separated by electrophoresis and transferred by Western blot to polyvinylidene fluoride (PVDF) membrane. The Western blots were stained with an enhanced chemiluminescent ECL(Registered Trademark) Plus detection kit (Amersham) and scanned using a Storm 840 gel image analyzer (Amersham, Molecular Dynamics). ImageQuant(Registered TradeMark) software was used to quantify the densities of the protein bands. The ground control and flight LN1 cell samples showed a similar staining pattern over time with antibodies to vimentin, glyceraldehyde-3-phosphate dehydrogenase, and epithelial membrane antigens.

  3. Antigenic Protein In Microgravity-Grown Human Mixed Mullerian Tumor (LN1) Cells Preserved In RNA Stabilizing Agent

    NASA Technical Reports Server (NTRS)

    Hammond, Dianne K.; Becker, Jeanne; Holubec, K.; Baker, T. L.; Love, J. E.


    Cells treated with RNAlater(TradeMark) have previously been shown to contain antigenic proteins that can be visualized using Western blot analysis. These proteins seem to be stable for several months when stored in RNA stabilizer at 4 C. Antigenic protein can be recovered from cells that have been processed using an Ambion RNAqueous(Registered TradeMark) kit to remove RNA. In this set of experiments, human mixed Mullerian tumor (LN1) cells grown on the International Space Station during Expedition 3 were examined for antigenic stability after removal of RNA. The cells were stored for three months in RNAlater(TradeMark) and RNA was extracted. The RNA filtrate Containing the protein was precipitated, washed, and suspended in buffer containing sodium dodecyl sulfate (SDS). Samples containing equal concentrations of protein were loaded onto SDS-polyacrylamide gels. Proteins were separated by electrophoresis and transferred by Western blot to polyvinylidene fluoride (PVDF) membrane. The Western blots were stained with an enhanced chemiluminescent ECL(Registered TradeMark)Plus detection kit (Amersham) and scanned using a Storm 840 gel image analyzer (Amersham, Molecular Dynamics). ImageQuant(Registered TradeMark)a software was used to quantify the densities of the protein bands. The ground control and flight LN1 cell samples showed a similar staining pattern over time with antibodies to vimentin, glyceraldehyde-3-phosphate dehydrogenase, and epithelial membrane antigens.

  4. Positioning effects on quantum dot solar cells grown by molecular beam epitaxy

    SciTech Connect

    Zhou, D.; Sharma, G.; Fimland, B. O.; Vullum, P. E.; Thomassen, S. F.; Holmestad, R.; Reenaas, T. W.


    We report current-voltage and spectral response characteristics of high density InAs/GaAs quantum dot (QD) solar cells with different positions where dots are located. The short circuit current density (J{sub sc}), open circuit voltage (V{sub oc}), and external quantum efficiency of these cells under air mass 1.5 are presented and compared with a GaAs reference cell. An extended photoresponse in contrast to the GaAs reference cell was confirmed for all these cells. The effect of inserting QD layers into emitter and base region on device performance is shown. The J{sub sc} is reduced, while the V{sub oc} is maintained. The cell with QDs located toward the base side shows better performance, confirmed by both current-voltage and spectral response measurements.

  5. Effect of Hypergravity on Localization Calcium Ions in Plant Cells Grown in Vivo and in Vitro

    NASA Astrophysics Data System (ADS)

    Nedukha, Olena

    Using plant callus tissues and Arabidopsis thaliana plants as model systems we have been investigated the effect of hypergravity on the localization and relative content of calcium ions in photosynthesizing cells. The tobacco callus cells in log stage of growth and mesophyll cells from developed A. thaliana leaves were used in the experiments. Plant samples were exposed to hypergravity at 6.5 g, 10g and 14 g for 15-60 min. After centrifugation, dye Fluo-4 was loaded in the control leaves and the centrifuged samples by the standard cytochemical method. Observation of calcium fluorescence was carried out with a laser confocal microscope LSM 5 Pascal at the excitation wave 488 nm (by the argon laser), at emission wavelength 516 nm. The data of the calcium ion distribution and quantification in cells were obtained using software "Pascal" (Carl Zeiss). The effect of hypergravity on redistribution of calcium ions in plant cells has been established. This effect is depended from exposure time and from the value of hypergravity. The cells cultivated in vitro is showed fast response to hypergravity influence. Plasmolysis cells and calcium domains formation have been observed in most of callus cells. This influence was like to that, which was wrote in Funaria hygrometrica protonema cells after 8.5 g influence (Sytnik et al., 1984). Leaf cells of A. thaliana were of less responsively to hypergravity than callus cells. Sytnik K, Kordyum E, Nedukha O. et al. 1984. Plant Cell Under Change of Geophysical Factors. Kiev: Naukova Dumka, 1-134 p.

  6. Method of measuring nitric oxide release by vascular endothelial cells grown in microfluidic channels

    NASA Astrophysics Data System (ADS)

    Hosseinpour, S.; Liu, A. C.; Barakat, A. I.; Choy, J. C.; Gray, B. L.


    In this paper, a simple and versatile method is presented which enables detection of nitric oxide (NO) released from vascular endothelial cells (ECs) cultured in microfluidic structures. The culturing system and NO measurement method allow cell shape to be controlled in a non-invasive manner using microfluidic structures while NO release is monitored for cell shape versus function studies. The culturing system consists of arrays of polydimethylsiloxane (PDMS) fluidic channels 120 micrometers in depth and ranging from 100 micrometers to 3 mm in width. The number of channels in each array is varied to yield a constant cell culture surface area (75 mm2) independent of channel width. The channel surfaces are collagen-coated and ECs are cultured to confluence within the channels. A cell scraper is then used to scrape extraneous cells cultured between channels, and NO measurements are made 18 to 24 hours later. A chemiluminescence-based sensor system (NOA 280i, Sievers NO Analyzer) is utilized to measure sample NO. Initial results indicate that NO concentrations can be measured from different microfluidic channel-containing samples using this method. It is shown that there is no significant difference in NO concentration derived from channels of different widths even though the degree of cell elongation varies due to physical constraint by microfluidic channel walls. However, cells treated with TNF? release more NO than untreated cells in fluidic channels, which is comparable to the function of ECs cultured in conventional culturing systems such as culturing dishes.

  7. The density of apical cells of dark-grown protonemata of the moss Ceratodon purpureus

    NASA Technical Reports Server (NTRS)

    Schwuchow, J. M.; Kern, V. D.; Wagner, T.; Sack, F. D.


    Determinations of plant or algal cell density (cell mass divided by volume) have rarely accounted for the extracellular matrix or shrinkage during isolation. Three techniques were used to indirectly estimate the density of intact apical cells from protonemata of the moss Ceratodon purpureus. First, the volume fraction of each cell component was determined by stereology, and published values for component density were used to extrapolate to the entire cell. Second, protonemal tips were immersed in bovine serum albumin solutions of different densities, and then the equilibrium density was corrected for the mass of the cell wall. Third, apical cell protoplasts were centrifuged in low-osmolarity gradients, and values were corrected for shrinkage during protoplast isolation. Values from centrifugation (1.004 to 1.015 g/cm3) were considerably lower than from other methods (1.046 to 1.085 g/cm3). This work appears to provide the first corrected estimates of the density of any plant cell. It also documents a method for the isolation of protoplasts specifically from apical cells of protonemal filaments.

  8. Thyrotropin dependent and independent thyroid cell lines selected from FRTL-5 derived tumors grown in nude mice

    SciTech Connect

    Ossendorp, F.A.; Bruning, P.F.; Schuuring, E.M.; Van Den Brink, J.A.; van der Heide, D.; De Vijlder, J.J.; De Bruin, T.W. )


    FRTL-5 cells were used to set up a thyroid tumor model system in C3H nu/nu mice. FRTL-5 tumors could be grown in nude mice provided serum TSH levels were elevated. Persistent TSH elevation was obtained by administration of Na131I, rendering the mice hypothyroid. After 4 weeks FRTL-5 cells were injected sc resulting in tumor growth within 2 weeks in eight out of eight mice. Although the tumors showed an apparently undifferentiated histology, lacking normal follicular structures, they were functional since the tumors were capable of concentrating (131)iodine, as demonstrated by nuclear imaging. From one of the tumors a new cell line was isolated (FRTL-5/T) that, like the parental FRTL-5 cell line, was TSH dependent for growth. In a control group of six euthyroid nude mice FRTL-5 tumor growth could not be obtained with one exception. After 3 months one animal developed a small tumor that grew rapidly thereafter. This tumor was easily transplantable in other euthyroid nude mice, showed an undifferentiated histology, and was nonfunctional, as it could not concentrate (131)iodine. From this tumor two cell lines were derived: one cultured in the presence of TSH (FRTL-5/TP) and one in the absence of TSH (FRTL-5/TA). The cell lines were analyzed for TSH responsive functions and TSH receptor expression. Responsiveness to TSH in FRTL-5/T and the parental FRTL-5 cell line were similar for most thyroid specific functions tested. However, FRTL-5/T was less sensitive than FRTL-5 for TSH induced (3H)thymidine incorporation. Both cell lines had two classes of TSH binding sites with high and low affinity respectively. FRTL-5/TP and FRTL-5/TA were both able to grow in TSH free medium and were nonresponsive to TSH in vitro, as tested for (3H)thymidine and (3H)uridine incorporation, iodine uptake, thyroglobulin iodination, and thyroglobulin secretion.

  9. Changes in levels of cell wall constituents in wheat seedlings grown under continuous hypergravity conditions

    NASA Astrophysics Data System (ADS)

    Wakabayashi, K.; Soga, K.; Kamisaka, S.; Hoson, T.

    Effects of continuous hypergravity stimuli on the amounts and composition of cell wall constituents were investigated in wheat shoots. Hypergravity (300 g) treatment for three days after germination increased the net amount of cell wall polysaccharides such as hemicellulose and cellulose, but reduced the shoot elongation. As a result, the amount of cell wall polysaccharides per unit length of shoot increased under hypergravity. The hemicellulose fraction contained polysaccharides in the middle and low molecular mass range (5 kDa-1 MDa) and increased in response to hypergravity. Also, the amounts of arabinose (Ara) and xylose (Xyl), the major sugar components of the hemicellulose fraction, increased under hypergravity conditions. In addition to wall polysaccharides, hypergravity increased the amounts of cell wall-bound phenolic acids, such as ferulic acid (FA) and diferulic acid (DFA). Furthermore, the activity of phenylalanine ammonia-lyase (PAL, EC was enhanced under hypergravity conditions. These results suggest that continuous hypergravity stimulates the synthesis of cell wall constituents, especially hemicellulosic arabinoxylans and cell wall-bound FA and DFA in wheat shoots. The increased PAL activity may promote the formation of FA and DFA. These changes in cell wall architecture may be involved in making rigid and tough cell walls under hypergravity conditions and thereby contribute to the ability of plant to sustain their structures against gravitational stimuli.

  10. Identification of morphological differences between avian influenza A viruses grown in chicken and duck cells.


    Al-Mubarak, Firas; Daly, Janet; Christie, Denise; Fountain, Donna; Dunham, Stephen P


    Although wild ducks are considered to be the major reservoirs for most influenza A virus subtypes, they are typically resistant to the effects of the infection. In contrast, certain influenza viruses may be highly pathogenic in other avian hosts such as chickens and turkeys, causing severe illness and death. Following in vitro infection of chicken and duck embryo fibroblasts (CEF and DEF) with low pathogenic avian influenza (LPAI) viruses, duck cells die more rapidly and produce fewer infectious virions than chicken cells. In the current study, the morphology of viruses produced from CEF and DEF cells infected with low pathogenic avian H2N3 was examined. Transmission electron microscopy showed that viruses budding from duck cells were elongated, while chicken cells produced mostly spherical virions; similar differences were observed in viral supernatants. Sequencing of the influenza genome of chicken- and duck-derived H2N3 LPAI revealed no differences, implicating host cell determinants as responsible for differences in virus morphology. Both DEF and CEF cells produced filamentous virions of equine H3N8 (where virus morphology is determined by the matrix gene). DEF cells produced filamentous or short filament virions of equine H3N8 and avian H2N3, respectively, even after actin disruption with cytochalasin D. These findings suggest that cellular factors other than actin are responsible for the formation of filamentous virions in DEF cells. The formation of elongated virions in duck cells may account for the reduced number of infectious virions produced and could have implications for virus transmission or maintenance in the reservoir host. PMID:25613009

  11. Transcriptome profiling in Arabidopsis inflorescence stems grown under hypergravity in terms of cell walls and plant hormones

    NASA Astrophysics Data System (ADS)

    Tamaoki, D.; Karahara, I.; Nishiuchi, T.; De Oliveira, S.; Schreiber, L.; Wakasugi, T.; Yamada, K.; Yamaguchi, K.; Kamisaka, S.


    Land plants rely on lignified secondary cell walls in supporting their body weight on the Earth. Although gravity influences the formation of the secondary cell walls, the regulatory mechanism of their formation by gravity is not yet understood. We carried out a comprehensive analysis of gene expression in inflorescence stems of Arabidopsis thaliana L. using microarray (22 K) to identify genes whose expression is modulated under hypergravity condition (300 g). Total RNA was isolated from the basal region of inflorescence stems of plants grown for 24 h at 300 g or 1 g. Microarray analysis showed that hypergravity up-regulated the expression of 403 genes to more than 2-fold. Hypergravity up-regulated the genes responsible for the biosynthesis or modification of cell wall components such as lignin, xyloglucan, pectin and structural proteins. In addition, hypergravity altered the expression of genes related to the biosynthesis of plant hormones such as auxin and ethylene and that of genes encoding hormone-responsive proteins. Our transcriptome profiling indicates that hypergravity influences the formation of secondary cell walls by modulating the pattern of gene expression, and that auxin and/or ethylene play an important role in signaling hypergravity stimulus.

  12. MG63 Osteoblast-Like Cells Exhibit Different Behavior when Grown on Electrospun Collagen Matrix versus Electrospun Gelatin Matrix

    PubMed Central

    Tsai, Shiao-Wen; Liou, Hau-Min; Lin, Cheng-Jie; Kuo, Ko-Liang; Hung, Yi-Sheng; Weng, Ru-Chun; Hsu, Fu-Yin


    Electrospinning is a simple and efficient method of fabricating a non-woven polymeric nanofiber matrix. However, using fluorinated alcohols as a solvent for the electrospinning of proteins often results in protein denaturation. TEM and circular dichroism analysis indicated a massive loss of triple-helical collagen from an electrospun collagen (EC) matrix, and the random coils were similar to those found in gelatin. Nevertheless, from mechanical testing we found the Young's modulus and ultimate tensile stresses of EC matrices were significantly higher than electrospun gelatin (EG) matrices because matrix stiffness can affect many cell behaviors such as cell adhesion, proliferation and differentiation. We hypothesize that the difference of matrix stiffness between EC and EG will affect intracellular signaling through the mechano-transducers Rho kinase (ROCK) and focal adhesion kinase (FAK) and subsequently regulates the osteogenic phenotype of MG63 osteoblast-like cells. From the results, we found there was no significant difference between the EC and EG matrices with respect to either cell attachment or proliferation rate. However, the gene expression levels of OPN, type I collagen, ALP, and OCN were significantly higher in MG63 osteoblast-like cells grown on the EC than in those grown on the EG. In addition, the phosphorylation levels of Y397-FAK, ERK1/2, BSP, and OPN proteins, as well as ALP activity, were also higher on the EC than on the EG. We further inhibited ROCK activation with Y27632 during differentiation to investigate its effects on matrix-mediated osteogenic differentiation. Results showed the extent of mineralization was decreased with inhibition after induction. Moreover, there is no significant difference between EC and EG. From the results of the protein levels of phosphorylated Y397-FAK, ERK1/2, BSP and OPN, ALP activity and mineral deposition, we speculate that the mechanism that influences the osteogenic differentiation of MG63 osteoblast-like cells on EC and EG is matrix stiffness and via ROCK-FAK-ERK1/2. PMID:22319618

  13. Effects of substrate conductivity on cell morphogenesis and proliferation using tailored, atomic layer deposition-grown ZnO thin films

    PubMed Central

    Choi, Won Jin; Jung, Jongjin; Lee, Sujin; Chung, Yoon Jang; Yang, Cheol-Soo; Lee, Young Kuk; Lee, You-Seop; Park, Joung Kyu; Ko, Hyuk Wan; Lee, Jeong-O


    We demonstrate that ZnO films grown by atomic layer deposition (ALD) can be employed as a substrate to explore the effects of electrical conductivity on cell adhesion, proliferation, and morphogenesis. ZnO substrates with precisely tunable electrical conductivity were fabricated on glass substrates using ALD deposition. The electrical conductivity of the film increased linearly with increasing duration of the ZnO deposition cycle (thickness), whereas other physical characteristics, such as surface energy and roughness, tended to saturate at a certain value. Differences in conductivity dramatically affected the behavior of SF295 glioblastoma cells grown on ZnO films, with high conductivity (thick) ZnO films causing growth arrest and producing SF295 cell morphologies distinct from those cultured on insulating substrates. Based on simple electrostatic calculations, we propose that cells grown on highly conductive substrates may strongly adhere to the substrate without focal-adhesion complex formation, owing to the enhanced electrostatic interaction between cells and the substrate. Thus, the inactivation of focal adhesions leads to cell proliferation arrest. Taken together, the work presented here confirms that substrates with high conductivity disturb the cell-substrate interaction, producing cascading effects on cellular morphogenesis and disrupting proliferation, and suggests that ALD-grown ZnO offers a single-variable method for uniquely tailoring conductivity. PMID:25897486

  14. Effects of substrate conductivity on cell morphogenesis and proliferation using tailored, atomic layer deposition-grown ZnO thin films.


    Choi, Won Jin; Jung, Jongjin; Lee, Sujin; Chung, Yoon Jang; Yang, Cheol-Soo; Lee, Young Kuk; Lee, You-Seop; Park, Joung Kyu; Ko, Hyuk Wan; Lee, Jeong-O


    We demonstrate that ZnO films grown by atomic layer deposition (ALD) can be employed as a substrate to explore the effects of electrical conductivity on cell adhesion, proliferation, and morphogenesis. ZnO substrates with precisely tunable electrical conductivity were fabricated on glass substrates using ALD deposition. The electrical conductivity of the film increased linearly with increasing duration of the ZnO deposition cycle (thickness), whereas other physical characteristics, such as surface energy and roughness, tended to saturate at a certain value. Differences in conductivity dramatically affected the behavior of SF295 glioblastoma cells grown on ZnO films, with high conductivity (thick) ZnO films causing growth arrest and producing SF295 cell morphologies distinct from those cultured on insulating substrates. Based on simple electrostatic calculations, we propose that cells grown on highly conductive substrates may strongly adhere to the substrate without focal-adhesion complex formation, owing to the enhanced electrostatic interaction between cells and the substrate. Thus, the inactivation of focal adhesions leads to cell proliferation arrest. Taken together, the work presented here confirms that substrates with high conductivity disturb the cell-substrate interaction, producing cascading effects on cellular morphogenesis and disrupting proliferation, and suggests that ALD-grown ZnO offers a single-variable method for uniquely tailoring conductivity. PMID:25897486

  15. Heteroepitaxial film silicon solar cell grown on Ni-W foils

    SciTech Connect

    Wee, Sung Hun; Cantoni, Claudia; Fanning, Thomas; Teplin, Charles; Bogorin, Daniela Florentina; Bornstein, Jon; Bowers, Karen; Schroeter,; Hasoon, Falah; Branz, Howard; Paranthaman, Mariappan Parans; Goyal, Amit


    Today, silicon-wafer-based technology dominates the photovoltaic (PV) industry because it enables high efficiency, is produced from abundant, non-toxic materials and is proven in the PV marketplace.[1] However, costs associated with the wafer itself limit ultimate cost reductions.[1,2] PV based on absorber layers of crystalline Si with only 2 to 10 m thickness are a promising route to reduce these costs, while maintaining efficiencies above 15%.[3-5] With the goal of fabricating low-cost film crystalline Si (c-Si), recent research has explored wafer peeling,[6,7] crystallization of amorphous silicon films on glass,[4,8-10] and seed and epitaxy approaches.[3,5,11] In this third approach, one initially forms a seed layer that establishes the grain size and crystalline order. The Si layer is then grown heteroepitaxially on the seed layer, so that it replicates the seed crystal structure. In all of these film c-Si approaches, the critical challenge is to grow c-Si with adequate material quality: specifically, the diffusion length (LD) must be at least three times the film thickness.[12] In polycrystalline Si films, grain boundaries (GBs) are recombination-active and significantly reduce LD. This adverse effects of GBs motivates research into growth of large grained c-Si [13,14] (for a low density of GBs) and biaxially-textured c-Si [11] (for low-angle GBs).

  16. Membranes of Rhodospirillum rubrum: isolation and physicochemical properties of membranes from aerobically grown cells.

    PubMed Central

    Collins, M L; Niederman, R A


    Highly purified preparations of cytoplasmic and outer membrane were isolated from aerobically grown Rhodospirillum rubrum lysed by sequential treatment with lysozyme, ethylenediaminetetraacetate, and Brij 58. The membranes were resolved and separated from other cellular constitutents by a combination of velocity and isopyknic sedimentation in sucrose density gradients. On the basis of their appearance in electron micrographs and their protein profiles in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, these preparations appear to be quite similar to those obtained from other gram-negative bacteria. The cytoplasmic membrane fraction contained the majority of the total membrane-bound succinic dehydrogenase activity and was 10-fold enriched in b- and c-type cytochrome with respect to the outer membrane. The latter fraction was characterized by a much greater carbohydrate content and the presence of arachidic acid, which is typical of R. rubrum lipopolysaccharide. Their protein fatty acid, and overall chemical compositions suggested that these preparations were freer from cross-contamination than those obtained from R. rubrum with currently available methods. Images PMID:820689

  17. Cryopreservation of Dendritic Cells Grown in Vitro from Monocytes for Their Future Clinical Use.


    Cao, Hua; Verg, Vronique; Martinache, Chantal; Leon, Anne; Gorin, Norbert-Claude; Bernard, Jacky; Lopez, Manuel


    Dendritic cells are professional antigen presenting cells which are being used as adjuvants in tumor vaccination trials. Most clinical protocols currently include 4 to 10 weekly infusions of doses > 10(6) cells, each inoculum coming from a simple culture of blood monocytes. In the present study, several millions of dendritic cells from a single leukapheresis were produced; monocytes were isolated by elutriation and then cultured in Teflon bags in presence of 800 U/ml GM-CSF + 100 micro g/ml IL-13 + 10% fetal calf serum (FCS). The dendritic cells from this single batch were aliquoted in many doses for potential multiple infusions and cryopreserved in 10% DMSO + 2% human albumin in Teflon-kapton Fresenius bags either at -1 degrees C/min using a controlled rate freezer, or putting the bags directly in a -80 degrees C mechanical freezer without controlling the temperature rate. Six experiments were carried out. After one month of cryopreservation, the cells were thawed in a 40 degrees C water bath. Before and after freezing, cells were evaluated for immunophenotype (CD1a, CD14, CD40, CD80, CD83, CD86, CD54, CD58, CD16, CD32, CD64 and HLA-DR) and for their capacity to stimulate allogenic (MLR) or autologous (antigen presentation tests) lymphocytes. The results demonstrated that the mean recovery rates after freezing in liquid nitrogen or at -80 degrees C were (67 +/- 14)% and (71 +/- 13)% respectively, without any significant difference between the two techniques. The immunophenotype was not modified by the freezing-thawing procedure, as well as the lymphocyte stimulating capacities. In conclusion, our study showed that substantial numbers of functional DCs can be derived from peripheral blood monocytes using Teflon bags. DCs can be cryopreserved in a good laboratory practice setting for further clinical trials with an acceptable loss of cells and without modification of their functions. PMID:12578659

  18. DNA-gold nanoparticle reversible networks grown on cell surface marker sites: application in diagnostics.


    Lee, Kyuwan; Drachev, Vladimir P; Irudayaraj, Joseph


    Effective identification of breast cancer stem cells (CSC) benefits from a multiplexed approach to detect cell surface markers that can distinguish this subpopulation, which can invade and proliferate at sites of metastasis. We present a new approach for dual-mode sensing based on targeting using pointer and signal enhancement using enhancer particle networks for detection by surface plasmon resonance (SPR) and surface-enhanced Raman scattering (SERS). We demonstrate our concept to detect cell surface markers, CD44 and CD24, in three breast cancer cell lines to identify a CD44+/CD24- subpopulation of CSCs. The designed network structure can be well-controlled and has improved sensitivity compared to conventional approaches with ability to detect a single target on the membrane of a living cell. We have also developed a fractal approach to model the dimension of the network structure and developed an empirical relationship to estimate the number of particles in the network and its size. The empirical equation was validated with experiments and finite-difference time-domain simulations, and the cell phenotyping results were found to be in good agreement with published data from conventional sorting by flow cytometry. PMID:21314177

  19. VeroScience: applying nature's genius to help improve the human condition.



    VeroScience is a biotechnology company in Tiverton, Rhode Island, focused on the development of therapies and products to improve human health. The company has a strong pipeline of metabolic disease products and therapies for immunological disorders. A major platform technology of the company, Circadian Neuroendocrine Resetting Therapy, is utilized as a generator of multiple therapeutic strategies to treat a variety of disease states. The circadian timed daily (morning) administration of Cycloset, a quick release formulation of bromocriptine mesylate, a dopamine agonist, was developed for the treatment of type 2 diabetes using this platform technology. PMID:23641424

  20. Discrepancy between the short and long term effects of ouabain on the sodium pumps of human cells grown in culture.

    PubMed Central

    Griffiths, N. M.; Ogden, P. H.; Cormack, R.; Lamb, J. F.


    1. Human cells (HeLa) were cultured for periods up to 48 h in growth medium in the absence or presence of a range of concentrations of cardiac glycosides. In some experiments the potassium concentration of the medium was varied between 0.3 mM and the usual 5 mM. 2. For periods up to 2 h in ouabain the association and dissociation rate constants were measured and the equilibrium binding constant (KD) calculated; the apparent equilibrium binding constant (K'D) was measured after 1-2 days growth in ouabain. 3. Ouabain had a K'D after 2 days of 2-6 nM in 5 mM K+ growth medium, a 4 fold greater blocking effect on sodium pumps after 2 days than expected from the association and dissociation rate constants measured in untreated or previously ouabain-treated cells. 4. This effect was: (a) approximately the same over a range of external potassium concentrations from 0.3 to 5 mM, although the absolute effect of ouabain over this range of potassium was much different; (b) probably not due to different isoforms of pumps in cells grown in ouabain compared to untreated cells; (c) apparently not a consequence of internalisation of pump-glycoside complexes. 5. We conclude that ouabain has only a limited access to sodium pumps in whole cells; this could be because sodium pumps cycle continuously through an inaccessible region of the plasma membrane. This effect needs to be considered both in the assessment of the magnitude of the long term effects of cardiac glycosides on cells, and in the measurement of the glycoside affinities of various isoforms of the pump. PMID:1665734

  1. Scanning electron microscopic observations on cells grown in vitro. VII. HeLa cells can penetrate Wi38 fibroblasts.


    Benke, R; Paweletz, N


    When HeLa cells are seeded on a preexisting monolayer of Wi38 fibroblasts, the HeLa cells "try" to get into direct contact with the glass substrate. Once on top of a flat fibroblast the HeLa cell can either migrate from the fibroblast to settle between two fibroblasts on glass or somehow stimulate the underlying cells to retract. In a few cases the HeLa cell directly penetrates the fibroblast, "melting" its way through the underlying cell. The mechanism of this phenomenon which has never been described before in this combination is discussed. PMID:6698044

  2. Optimization towards high density quantum dots for intermediate band solar cells grown by molecular beam epitaxy

    SciTech Connect

    Zhou, D.; Sharma, G.; Fimland, B. O.; Thomassen, S. F.; Reenaas, T. W.


    We report high density quantum dots (QDs) formation with optimized growth temperature and V/III ratio. At lower growth temperature, QD density is increased, due to smaller surface migration length of In adatoms. With higher V/III, the QD density is higher but it results in large clusters formation and decreases the QD uniformity. The QD solar cell was fabricated and examined. An extended spectral response in contrast to the GaAs reference cell was presented but the external quantum efficiency at energies higher than GaAs band gap is reduced, resulting from the degradation for the emitter above the strained QD layers.

  3. High efficiency GaAs-Ge tandem solar cells grown by MOCVD

    NASA Technical Reports Server (NTRS)

    Vernon, S. M.; Tobin, S. P.; Bajgar, C.; Haven, Victor E.; Geoffroy, L. M.; Lillington, D. R.; Hart, R. E., Jr.


    High conversion efficiency and low weight are obviously desirable for solar cells intended for space applications. One promising structure is GaAs on Ge. The advantages of using Ge wafers as substrates include the following: they offer high efficiency by forming a two-junction tandem cell; low weight combined with superior strength allows usage of thin (3 mil) wafers; and they are a good substrate for GaAs, being lattice matched, thermal expansion matched, and available as large-area wafers.

  4. Low temperature grown ZnO@TiO{sub 2} core shell nanorod arrays for dye sensitized solar cell application

    SciTech Connect

    Goh, Gregory Kia Liang; Le, Hong Quang; Huang, Tang Jiao; Hui, Benjamin Tan Tiong


    High aspect ratio ZnO nanorod arrays were synthesized on fluorine-doped tin oxide glasses via a low temperature solution method. By adjusting the growth condition and adding polyethylenimine, ZnO nanorod arrays with tunable length were successfully achieved. The ZnO@TiO{sub 2} core shells structures were realized by a fast growth method of immersion into a (NH{sub 4}){sub 2}·TiF{sub 6} solution. Transmission electron microscopy, X-ray Diffraction and energy dispersive X-ray measurements all confirmed the existence of a titania shell uniformly covering the ZnO nanorod's surface. Results of solar cell testing showed that addition of a TiO{sub 2} shell to the ZnO nanorod significantly increased short circuit current (from 4.2 to 5.2 mA/cm{sup 2}), open circuit voltage (from 0.6 V to 0.8 V) and fill factor (from 42.8% to 73.02%). The overall cell efficiency jumped from 1.1% for bare ZnO nanorod to 3.03% for a ZnO@TiO{sub 2} core shell structured solar cell with a 18–22 nm shell thickness, a nearly threefold increase. - Graphical abstract: The synthesis process of coating TiO{sub 2} shell onto ZnO nanorod core is shown schematically. A thin, uniform, and conformal shell had been grown on the surface of the ZnO core after immersing in the (NH{sub 4}){sub 2}·TiF{sub 6} solution for 5–15 min. - Highlights: • ZnO@TiO{sub 2} core shell nanorod has been grown on FTO substrate using low temperature solution method. • TEM, XRD, EDX results confirmed the existing of titana shell, uniformly covered rod's surface. • TiO{sub 2} shell suppressed recombination, demonstrated significant enhancement in cell's efficiency. • Core shell DSSC's efficiency achieved as high as 3.03%, 3 times higher than that of ZnO nanorods.

  5. Assessment of immunogenic potential of Vero adapted formalin inactivated vaccine derived from novel ECSA genotype of Chikungunya virus.


    Tiwari, Mugdha; Parida, Manmohan; Santhosh, S R; Khan, Mohsin; Dash, Paban Kumar; Rao, P V Lakshmana


    The recent resurgence of Chikungunya virus (CHIKV) in India and Indian Ocean Islands with unusual clinical severity is a matter of great public health concern. Despite the fact that CHIKV resurgence is associated with epidemic of unprecedented magnitude, no approved licensed vaccine is currently available. In the present study, a Vero cell adapted purified formalin inactivated prototype vaccine candidate was prepared using a current Indian strain implicated with the explosive epidemic during 2006. The bulk preparation of the vaccine candidate was undertaken in microcarrier based spinner culture using cytodex-1 in virus production serum free medium. The inactivation of the virus was accomplished through standard formalin inactivation protocol. The mice were immunized subcutaneously with alhydrogel gel formulation of inactivated virus preparation. The assessment of both humoral and cell-mediated immune response was accomplished through ELISA, plaque reduction neutralization test (PRNT), microcytotoxicity assay and cytokine production assay. The results revealed that formalin inactivated vaccine candidate induced both high titered ELISA (1:51,200) and plaque reduction neutralizing antibodies (1:6400) with peak antibody titer being observed during 6 -- 8 weeks of post-vaccination. In the absence of suitable murine challenge model, the protective efficacy was established by both in vitro and in vivo neutralization tests. Further assessment of cellular immunity through in vitro stimulation of spleenocytes from immunized mice revealed augmentation of high levels of both pro- and anti-inflammatory cytokines, indicating a mixed balance of Th1 and Th2 response. These findings suggest that the formalin inactivated Chikungunya vaccine candidate reported in this study has very good immunogenic potential to neutralize the virus infectivity by augmenting both humoral and cell-mediated immune response. PMID:19368794

  6. Heteroepitaxial Film Silicon Solar Cell Grown on Ni-W Foils

    SciTech Connect

    Wee, S. H.; Cantoni, C.; Fanning, T. R.; Teplin, C. W.; Bogorin, D. F.; Bornstein, J.; Bowers, K.; Schroeter, P.; Hasoon, F.; Branz, H. M.; Paranthaman, M. P.; Goyal, A.


    Heteroepitaxial semiconductor films on low-cost, flexible metal foil templates are a potential route to inexpensive, high-efficiency solar cells. Here, we report epitaxial growth of Si films on low-cost, flexible, biaxially-textured Ni-W substrates. A robust buffer architecture comprised of multiple epitaxial oxide layers has been developed to grow high quality, heteroepitaxial Si films without any undesired reaction between the Si film and the metal substrate and with a single biaxial texture. XRD analysis including {omega}-scans, {phi}-scans, and pole figures confirms that the buffers and silicon are all epitaxial, with excellent cube-on-cube epitaxy. A photo-conversion efficiency of 1.1% is demonstrated from a proof-of-concept heteroepitaxial film Si solar cell.

  7. Biological characteristics of mesenchymal stem cells grown on different topographical nanofibrous poly-L-lactide meshes.


    Zhu, Jingxian; Cai, Qing; Zhang, Xin; Hu, Xiaoqing; Li, La; Wang, Weiping; Shao, Zhenxing; Dai, Linghui; Cheng, Liyuan; Yang, Xiaoping; Zhou, Chunyan; Ao, Yingfang


    The nanotopographical features of artificial scaffolds have complex effects on the biological characteristics of stem cells. They influence cell adhesion, spreading, proliferation, and differentiation; however we have limited knowledge on how these processes occur under nanotopographical cues. In this study, two kinds of electrospun nanofibrous meshes with different fiber arrangements (totally non-woven and lattice-like) were fabricated and used for in vitro culture of mesenchymal stem cells (MSCs). By comparing the characteristic marks related to osteogenic differentiation, we found that with prolonged culture time, osteopontin (OPN), osteocalcin (OCN) and alkaline phosphatase (ALP), as well as related genes (Runx2 and Colla genes), were all expressed at higher levels on lattice-like nanofibrous meshes than on non-woven ones. These results indicated that the lattice-like nanofibrous mesh activated the osteogenic differentiation of MSCs owing to changes in cell morphology directed by nanofiber orientations. Compared with pure non-woven nanofibrous meshes, lattice-like ones possessed a combined structure of parallel, magnetic-line-like, and non-woven regions. MSCs adhering onto them had upregulated expression levels of integrin subunits a5 and b1, and activated downstream signaling pathways of Ras homolog gene family member A (RhoA) and extracellular signal-regulated kinase (ERK). When the specific inhibitors PD98059 and Y27632 were used to inhibit phosphorylated ERK and p160 ROCKII activity, respectively, F-actin became disordered and the expression level of Runx2 was downregulated. Thus, we concluded that the scaffold nanotopography may modulate the microenvironment of MSCs and promote their osteogenic differentiation through the RhoA and ERK signaling pathways. These findings provided valuable information on the selection of artificial matrices suitable for MSCs application in bone tissue engineering. PMID:24015505

  8. GaAsPN-based PIN solar cells MBE-grown on GaP substrates: toward the III-V/Si tandem solar cell

    NASA Astrophysics Data System (ADS)

    Da Silva, M.; Almosni, S.; Cornet, C.; Létoublon, A.; Levallois, C.; Rale, P.; Lombez, L.; Guillemoles, J.-F.; Durand, O.


    GaAsPN semiconductors are promising material for the elaboration of high efficiencies tandem solar cells on silicon substrates. GaAsPN diluted nitride alloy is studied as the top junction material due to its perfect lattice matching with the Si substrate and its ideal bandgap energy allowing a perfect current matching with the Si bottom cell. We review our recent progress in materials development of the GaAsPN alloy and our recent studies of some of the different building blocks toward the elaboration of a PIN solar cell. A lattice matched (with a GaP(001) substrate, as a first step toward the elaboration on a Si substrate) 1μm-thick GaAsPN alloy has been grown by MBE. After a post-growth annealing step, this alloy displays a strong absorption around 1.8-1.9 eV, and efficient photoluminescence at room temperature suitable for the elaboration of the targeted solar cell top junction. Early stage GaAsPN PIN solar cells prototypes have been grown on GaP (001) substrates, with 2 different absorber thicknesses (1μm and 0.3μm). The external quantum efficiencies and the I-V curves show that carriers have been extracted from the GaAsPN alloy absorbers, with an open-circuit voltage of 1.18 V, while displaying low short circuit currents meaning that the GaAsPN structural properties needs a further optimization. A better carrier extraction has been observed with the absorber displaying the smallest thickness, which is coherent with a low carriers diffusion length in our GaAsPN compound. Considering all the pathways for improvement, the efficiency obtained under AM1.5G is however promising.

  9. Molecular and immunological characterization of three strains of Anaplasma marginale grown in cultured tick cells.


    Lis, Katarzyna; Fernndez de Mera, Isabel G; Popara, Marina; Cabezas-Cruz, Alejandro; Aylln, Nieves; Zweygarth, Erich; Passos, Lygia M F; Broniszewska, Marzena; Villar, Margarita; Kocan, Katherine M; Ribeiro, Mucio F B; Pfister, Kurt; de la Fuente, Jos


    Anaplasma marginale is an economically important tick-borne pathogen of cattle that causes bovine anaplasmosis. A wide range of geographic strains of A. marginale have been isolated from cattle, several of which have been characterized using genomics and proteomics. While many of these strains have been propagated in tick lines, comparative analyses after propagation in tick cells have not been reported. The overall purpose of this research therefore was to compare the degree of conservation of selected genes after propagation in tick cell culture among A. marginale strains from the U.S. (the Virginia strain) and Brazil (UFMG1 and UFMG2 strains). The genes studied herein included those which encode the proteins HSP70 and SODB involved in heat shock and stress responses, respectively, and two genes that encode major surface proteins MSP4 and MSP5. Strain identities were first confirmed by sequencing the tandem repeats of the msp1a gene which encodes for the adhesin, MSP1a. The results of these studies demonstrated that the genes encoding for both stress response and heat shock proteins were highly conserved among the three A. marginale strains. Antibodies specific for MSP4, MSP5, SODB and HSP70 proteins were used to further characterize the A. marginale strains, and they reacted with all of these strains propagated in tick cell culture, providing further evidence for antigenic conservation. Although antigenic differences were not found among the three A. marginale strains, multi-locus sequence analysis (MLSA) performed with nucleotide sequences of these genes demonstrated that the A. marginale Brazilian and U.S. strains fall in different clades. These results showed that phylogenetically distant strains of A. marginale are antigenically conserved, even after several in vitro passages, supporting the use of some of the above conserved proteins as candidates for universal vaccines. PMID:25943785

  10. Hybrid solar cells based on dc magnetron sputtered films of n-ITO on APMOVPE grown p-InP

    NASA Technical Reports Server (NTRS)

    Coutts, T. J.; Li, X.; Wanlass, M. W.; Emery, K. A.; Gessert, T. A.


    Hybrid indium-tin-oxide (ITO)/InP solar cells are discussed. The cells are constructed by dc magnetron sputter deposition of ITO onto high-quality InP films grown by atmospheric pressure metal-organic vapor-phase epitaxy (APMOVPE). A record efficiency of 18.9 percent, measured under standard Solar Energy Research Institute reporting conditions, has been obtained. The p-InP surface is shown to be type converted, principally by the ITO, but with the extent of conversion being modified by the nature of the sputtering gas. The deposition process, in itself, is not responsible for the type conversion. Dark currents have been suppressed by more than three orders of magnitude by the addition of hydrogen to the sputtering gas during deposition of a thin (5 nm) interface layer. Without this layer, and using only the more usual argon/oxygen mixture, the devices had poorer efficiencies and were unstable. A discussion of associated quantum efficiencies and capacitance/voltage measurements is also presented from which it is concluded that further improvements in efficiency will result from better control over the type-conversion process.

  11. Growth and stoichiometry of a Catharanthus roseus cell suspension culture grown under nitrogen-limiting conditions.


    Rho, D; André, G


    The uptake of carbohydrate and nitrate by Catharanthus roseus cell suspension cultures was studied in relation to biomass production in shake flasks. Biomass production was similar when using either 6, 12, 18, or 24 mM nitrate as the nitrogen source and 20 g L(-1) sucrose as the carbon source. In all cases, maximum biomass production was reached when carbohydrates were entirely consumer by the cells. Apparent biomass yields, Y(X/S) and Y(X/N) were 0.49 g biomass g(-1) glucose equivalent and 0.23 g biomass mmol(-1) nitrate, respectively. The determination of the cellular carbon-to-nitrogen ration (C/N ration) resulted in the identification of three district growth phases: an active growth phase, and accumulation phase, and a biomass decline phase (endogenous metabolism). The onset of the last two phases was correlated with nitrate and sugar of the last two phases was correlated with nitrate and sugar exhaustion, respectively. Balanced stoichiometric equations describing the active growth and accumulation phases were proposed based on elemental composition and ash content of the biomass. The stoichiometric equation related to the accumulation phase predicts that the available sugars are stored as starch- and lipid-like materials. PMID:18604877

  12. Performance of microbial electrolysis cells with bioanodes grown at different external resistances.


    Rago, Laura; Monpart, Nuria; Cortés, Pilar; Baeza, Juan A; Guisasola, Albert


    Bioelectrochemical systems need an anode with a high abundance of exoelectrogenic bacteria for an optimal performance. Among all possible operational parameters for an efficient enrichment, the role of external resistance in microbial fuel cell (MFC) has gained a lot of interest since it indirectly poises an anode potential, a key parameter for biofilm distribution and morphology. Thus, this work aims at investigating and discussing whether bioanodes selected at different external resistances under MFC operation present different responses under both MFC and microbial electrolysis cell (MEC) operation. A better MEC performance (i.e. shorter start-up time, higher current intensity and higher H2 production rate) was obtained with an anode from an MFC developed under low external resistance. Quantitative real-time polymerase chain reaction (qPCR) confirmed that a low external resistance provides an MFC anodic biofilm with the highest content of Geobacter because it allows higher current intensity, which is correlated to exoelectrogenic activity. High external resistances such as 1,000 Ω led to a slower start-up time under MEC operation. PMID:26942536

  13. Genotoxic Effects of Low- and High-LET Radiation on Human Epithelial Cells Grown in 2-D Versus 3-D Culture

    NASA Technical Reports Server (NTRS)

    Patel, Z. S.; Cucinotta, F. A.; Huff, J. L.


    Risk estimation for radiation-induced cancer relies heavily on human epidemiology data obtained from terrestrial irradiation incidents from sources such as medical and occupational exposures as well as from the atomic bomb survivors. No such data exists for exposures to the types and doses of high-LET radiation that will be encountered during space travel; therefore, risk assessment for space radiation requires the use of data derived from cell culture and animal models. The use of experimental models that most accurately replicate the response of human tissues is critical for precision in risk projections. This work compares the genotoxic effects of radiation on normal human epithelial cells grown in standard 2-D monolayer culture compared to 3-D organotypic co-culture conditions. These 3-D organotypic models mimic the morphological features, differentiation markers, and growth characteristics of fully-differentiated normal human tissue and are reproducible using defined components. Cultures were irradiated with 2 Gy low-LET gamma rays or varying doses of high-LET particle radiation and genotoxic damage was measured using a modified cytokinesis block micronucleus assay. Our results revealed a 2-fold increase in residual damage in 2 Gy gamma irradiated cells grown under organotypic culture conditions compared to monolayer culture. Irradiation with high-LET particle radiation gave similar results, while background levels of damage were comparable under both scenarios. These observations may be related to the phenomenon of "multicellular resistance" where cancer cells grown as 3-D spheroids or in vivo exhibit an increased resistance to killing by chemotherapeutic agents compared to the same cells grown in 2-D culture. A variety of factors are likely involved in mediating this process, including increased cell-cell communication, microenvironment influences, and changes in cell cycle kinetics that may promote survival of damaged cells in 3-D culture that would otherwise die or be rendered reproductively inactive in 2-D culture.

  14. Dye-sensitized solar cell employing zinc oxide aggregates grown in the presence of lithium


    Zhang, Qifeng; Cao, Guozhong


    Provided are a novel ZnO dye-sensitized solar cell and method of fabricating the same. In one embodiment, deliberately added lithium ions are used to mediate the growth of ZnO aggregates. The use of lithium provides ZnO aggregates that have advantageous microstructure, morphology, crystallinity, and operational characteristics. Employing lithium during aggregate synthesis results in a polydisperse collection of ZnO aggregates favorable for porosity and light scattering. The resulting nanocrystallites forming the aggregates have improved crystallinity and more favorable facets for dye molecule absorption. The lithium synthesis improves the surface stability of ZnO in acidic dyes. The procedures developed and disclosed herein also help ensure the formation of an aggregate film that has a high homogeneity of thickness, a high packing density, a high specific surface area, and good electrical contact between the film and the fluorine-doped tin oxide electrode and among the aggregate particles.

  15. MBE-grown GaAs:Si/GaAs:Be tunnel diodes for multijunction solar cells

    NASA Astrophysics Data System (ADS)

    Klimko, G. V.; Komissarova, T. A.; Sorokin, S. V.; Kontrosh, E. V.; Lebedeva, N. M.; Usikova, A. A.; Il'inskaya, N. D.; Kalinovskii, V. S.; Ivanov, S. V.


    We present the results of optimization of the design and molecular beam epitaxy (MBE) growth technology of N-AlGaAs:Si/ n +-GaAs:Si/ p +-GaAs:Be/ P-AlGaAs:Be heterostructures for tunnel diodes (TDs). The achieved maximum peak current density level ( J p = 513 A/cm2) allows these TDs to be used for cascade connections both in multijunction solar cells and in structures of tunnel-coupled laser diodes. The initial region of the J- U curve of TDs exhibits nonlinearity that is explained by a residual potential barrier left in the p +- P- p + isotype heterojunction (confining the active region of TD) as a result of non-optimum doping of Al0.4Ga0.6As alloy.

  16. Emitter thickness optimization for GaSb thermophotovoltaic cells grown by molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Abdallah, Shaimaa A.; Herrera, Daniel J.; Conlon, Benjamin P.; Rahimi, Nassim; Lester, Luke F.


    GaSb thermophotovoltaic (TPV) devices were fabricated using a Molecular Beam Epitaxy (MBE) technique. Different emitter thicknesses (de) were studied to maximize the TPV cell's short circuit current density. In this regard, the fabricated TPV device's emitter was incrementally wet-etched and characterized to find the optimal thickness value. Simulations were performed using the Crosslight APSYS platform over the full-spectrum range in order to predict device performance for different designs, while maximizing the photocurrent generation and enhancing the emitter sheet resistance. TPV devices were characterized electrically and optically. These experimental data showed that the etched emitter has minimal impact on the measured short circuit current density (Jsc) while simulated results demonstrated an optimal de of 200 nm.

  17. Enhanced-Depletion-Width GaInNAs Solar Cells Grown by Molecular-Beam Epitaxy

    SciTech Connect

    Ptak, A. J.; Friedman, D. J.


    The 3-junction, GaInP2/GaAs/Ge solar cell is a non-optimized structure due to excess light falling on the Ge junction. Because of this, a fourth junction inserted between the GaAs and Ge subcells could use the excess light and provide an increase in device efficiency. Unfortunately, the leading candidate material, GaInNAs, suffers from very low minority-carrier diffusion lengths compared to its parent compound, GaAs. These low diffusion lengths do not allow for the collection of adequate current to keep the overall 4-junction structure current matched. If the currents generated from the GaInNAs subcell are increased, the possibility exists for practical efficiencies of greater than 40% from this structure.

  18. Scanning electron microscopic observations on cells grown in vitro. VIII. Cell-cell interactions between HeLa cells and WI38 fibroblasts.


    Benke, R; Paweletz, N


    Adherent HeLa 1 and non-adherent HeLa S cells were seeded onto a preexisting monolayer of WI38 fibroblasts. Both cell types were able to attach to and to spread on top of the fibroblasts. Furthermore, both cell types were able to migrate actively from these fibroblasts if they managed to contact the underlying glass support. Both cell types were capable of penetrating the monolayer, under-lapping the fibroblast cells and finally destroying the monolayer. The cells' behavior was different when the monolayer consisted of alcohol-fixed or irradiated WI38 cells. In this case spreading on top of the treated fibroblasts resembled the concentric spreading seen on glass or plastic. This was in contrast to the spreading on untreated cells where the tumor cells became more or less spindle shaped. Moreover, the HeLa cells appeared to be less mobile and destruction of the monolayer was never observed. From all this we concluded: i: HeLa 1 and HeLa S cells have more than one attachment mechanism. ii: the spreading behavior is strongly influenced by the underlying support. iii: the upper cell surface of fibroblasts supports the spreading and movement of other cell types. iv: movement of HeLa cells and consequently the destruction of the monolayer is promoted by the intact fibroblasts. PMID:4085498

  19. Human Vero cytotoxigenic Escherichia coli (VTEC) O157 infection linked to birds.


    Ejidokun, O O; Walsh, A; Barnett, J; Hope, Y; Ellis, S; Sharp, M W; Paiba, G A; Logan, M; Willshaw, G A; Cheasty, T


    Vero cytotoxin-producing Escherichia coli O157 (VTEC O157) infections are a threat to public health. VTEC O157 has been isolated from gulls but evidence of transmission to humans from birds has not been reported. We recount an incident of VTEC O157 infection affecting two sibling children who had no direct contact with farm animals. An outbreak control team was convened to investigate the source of infection, its likely mode of transmission, and to advise on control measures. Human and veterinary samples were examined and the human isolates were found to be identical to an isolate from a sample of bird (rook) faeces. Cattle, rabbit and environmental samples were negative. This report provides evidence that birds may act as intermediaries for human infection with VTEC O157. PMID:16490148

  20. Superparamagnetic iron oxide nanoparticles exert different cytotoxic effects on cells grown in monolayer cell culture versus as multicellular spheroids

    NASA Astrophysics Data System (ADS)

    Theumer, Anja; Grfe, Christine; Bhring, Franziska; Bergemann, Christian; Hochhaus, Andreas; Clement, Joachim H.


    The aim of this study was to investigate the interaction of superparamagnetic iron oxide nanoparticles (SPION) with human blood-brain barrier-forming endothelial cells (HBMEC) in two-dimensional cell monolayers as well as in three-dimensional multicellular spheroids. The precise nanoparticle localisation and the influence of the NP on the cellular viability and the intracellular Akt signalling were studied in detail. Long-term effects of different polymer-coated nanoparticles (neutral fluidMAG-D, anionic fluidMAG-CMX and cationic fluidMAG-PEI) and the corresponding free polymers on cellular viability of HBMEC were investigated by real time cell analysis studies. Nanoparticles exert distinct effects on HBMEC depending on the nanoparticles' surface charge and concentration, duration of incubation and cellular context. The most severe effects were caused by PEI-coated nanoparticles. Concentrations above 25 ?g/ml led to increased amounts of dead cells in monolayer culture as well as in multicellular spheroids. On the level of intracellular signalling, context-dependent differences were observed. Monolayer cultures responded on nanoparticle incubation with an increase in Akt phosphorylation whereas spheroids on the whole show a decreased Akt activity. This might be due to the differential penetration and distribution of PEI-coated nanoparticles.

  1. Intragrain defects in polycrystalline silicon layers grown by aluminum-induced crystallization and epitaxy for thin-film solar cells

    NASA Astrophysics Data System (ADS)

    Van Gestel, Dries; Gordon, Ivan; Bender, Hugo; Saurel, Damien; Vanacken, Johan; Beaucarne, Guy; Poortmans, Jef


    Polycrystalline silicon (pc-Si) thin-films with a grain size in the range of 0.1-100 ?m grown on top of inexpensive substrates are economical materials for semiconductor devices such as transistors and solar cells and attract much attention nowadays. For pc-Si, grain size enlargement is thought to be an important parameter to improve material quality and therefore device performance. Aluminum-induced crystallization (AIC) of amorphous Si in combination with epitaxial growth allows achieving large-grained pc-Si layers on nonsilicon substrates. In this work, we made pc-Si layers with variable grain sizes by changing the crystallization temperature of the AIC process in order to see if larger grains indeed result in better solar cells. Solar cells based on these layers show a performance independent of the grain size. Defect etching and electron beam induced current (EBIC) measurements showed the presence of a high density of electrically active intragrain defects. We therefore consider them as the reason for the grain size independent device performance. Besides dislocations and stacking faults, also ?3 boundaries were electrically active as shown by combining electron backscattered diffraction with EBIC measurements. The electrical activity of the defects is probably triggered by impurity decoration. Plasma hydrogenation changed the electrical behavior of the defects, as seen by photoluminescence, but the defects were not completely passivated as shown by EBIC measurements. In order to reveal the origin of the defects, cross section transmission electron microscopy measurements were done showing that the intragrain defects are already present in the AIC seed layer and get copied into the epitaxial layer during epitaxial growth. The same types of intragrain defects were found in layers made on different substrates (alumina ceramic, glass ceramic, and oxidized silicon wafer) from which we conclude that intragrain defects are not related to the relatively rough alumina ceramic substrates often used in combination with high temperature epitaxy. Further improvement of the material quality, and hence device performance, is therefore not simply achieved by increasing the grain size, but the intragrain quality of the material also needs to be taken into account. For pc-Si layers based on AIC and epitaxial growth, the seed layer has a crucial impact on the intragrain defect formation.

  2. Expression and subcellular location of the tetrapyrrole synthesis enzyme porphobilinogen deaminase in light-grown Euglena gracilis and three nonchlorophyllous cell lines.


    Shashidhara, L S; Smith, A G


    The expression and subcellular location of porphobilinogen deaminase (PBGD, also known as hydroxymethylbilane synthase; EC, one of the early enzymes of porphyrin synthesis, was investigated in light-grown Euglena and in three cell lines that do not contain chlorophyll: dark-grown Euglena, a streptomycin-bleached mutant, and Astasia longa. In wild-type Euglena, immunogold electron microscopy demonstrated that all the immunodetectable enzyme protein was in the chloroplast. PBGD was shown to be photoregulated, and like many other nuclear-encoded proteins in Euglena, the regulation was at the posttranscriptional level. In the three nonchlorophyllous cell lines, as in light-grown Euglena, a single protein of 40 kDa was detected with antiserum to PBGD. This same antiserum immunoprecipitated a larger precursor protein from the total translation products of poly(A)+ RNA, and a single transcript, which was large enough to encode the precursor, was detected on Northern blots of all four cell types. Therefore, in cells that make chlorophyll and those that do not (or cannot), PBGD is located in the plastid. No evidence was obtained for another form of the enzyme, which suggests that in Euglena there is only one pathway for the synthesis of the tetrapyrrole moiety of chlorophyll and heme. PMID:11607141

  3. SU-E-J-129: A Strategy to Consolidate the Image Database of a VERO Unit Into a Radiotherapy Management System

    SciTech Connect

    Yan, Y; Medin, P; Yordy, J; Zhao, B; Jiang, S


    Purpose: To present a strategy to integrate the imaging database of a VERO unit with a treatment management system (TMS) to improve clinical workflow and consolidate image data to facilitate clinical quality control and documentation. Methods: A VERO unit is equipped with both kV and MV imaging capabilities for IGRT treatments. It has its own imaging database behind a firewall. It has been a challenge to transfer images on this unit to a TMS in a radiation therapy clinic so that registered images can be reviewed remotely with an approval or rejection record. In this study, a software system, iPump-VERO, was developed to connect VERO and a TMS in our clinic. The patient database folder on the VERO unit was mapped to a read-only folder on a file server outside VERO firewall. The application runs on a regular computer with the read access to the patient database folder. It finds the latest registered images and fuses them in one of six predefined patterns before sends them via DICOM connection to the TMS. The residual image registration errors will be overlaid on the fused image to facilitate image review. Results: The fused images of either registered kV planar images or CBCT images are fully DICOM compatible. A sentinel module is built to sense new registered images with negligible computing resources from the VERO ExacTrac imaging computer. It takes a few seconds to fuse registered images and send them to the TMS. The whole process is automated without any human intervention. Conclusion: Transferring images in DICOM connection is the easiest way to consolidate images of various sources in your TMS. Technically the attending does not have to go to the VERO treatment console to review image registration prior delivery. It is a useful tool for a busy clinic with a VERO unit.

  4. Interface enhanced superconductivity in one unit-cell FeSe films grown on SrTiO3

    NASA Astrophysics Data System (ADS)

    Ma, Xucun


    Heterostructure based interface engineering has been proved an effective method for finding new superconducting systems and raising superconducting transition temperature (Tc). Recently discovered high temperature superconductivity in one unit-cell (UC) FeSe films on SrTiO3 (STO) substrate grown by molecular beam epitaxy has attracted intensive attention. In sharp contrast to FeSe films on graphene where a 2.2 meV superconducting gap is observed on thick films and no superconducting gap on 1-UC FeSe down to 2.3 K, 1-UC FeSe films on STO substrate exhibit unexpected large superconducting gaps of 15-20 meV. Interestingly, the anomalously large superconducting gap is only found in the first UC FeSe but not on 2-UC or thicker layers, indicating that interface plays a crucial role in the enhanced superconductivity in 1-UC FeSe films on STO substrate. Another interesting point of this system is its simple band structure that consists only of electron Fermi pockets at M points, which is different from that of bulk FeSe. In this talk, a comprehensive study of 1-UC FeSe films by in situ scanning tunneling microscopy/spectroscopy (STM/STS) and angle-resolved photoemission spectroscopy (ARPES) and ex situ transport measurements will be presented to discuss the possible superconducting mechanism in this well-defined heterostructure. Collaborators: Qi-Kun Xue, Lili Wang, Yayu Wang (Tsinghua University); Xingjiang Zhou (Institute of Physics, CAS); Jian Wang (Peking University)

  5. Bioremoval and recovery of Cd(II) by Pseudoalteromonas sp. SCSE709-6: Comparative study on growing and grown cells.


    Zhou, Weizhi; Liu, Dongsheng; Zhang, Hai'ou; Kong, Wenqian; Zhang, Yuzhong


    Comparison of the bioremoval and recovery of Cd(II) by growing and grown marine bacterium Pseudoalteromonas sp. SCSE709-6 was performed in batch systems. Bioremoval with growing cells (Sorption I) showed better performance at low Cd(II) concentrations, whereas bioremoval with grown cells (Sorption II) had significant advantages in both removal efficiency and time consumption at high Cd(II) concentrations. The optimal pH was higher for Sorption I than for Sorption II for achieving the maximum Cd(II) removal efficiency. Complete desorption was achieved using either Na2EDTA or HNO3 as eluent. Cd(II) adsorbed on grown cells had higher tendency to be desorbed. Na2EDTA was a preferable eluent for the recycling biomaterials, whereas HNO3 performed better for the final security disposal of sludge. For Sorption II, both Langmuir and Freundlich isotherms well explained the biosorption behavior, and the pseudo-second-order model better expressed biosorption and desorption kinetics. PMID:24565875

  6. Changes of ribulose bisphosphate carboxylase/oxygenase content, ribulose bisphosphate concentration, and photosynthetic activity during adaptation of high-CO/sub 2/ grown cells to low-CO/sub 2/ conditions in Chlorella pyrenoidosa

    SciTech Connect

    Yokota, A.; Canvin, D.T.


    Changes of some photosynthetic properties of high-CO/sub 2/ grown cells of Chlorella pyrenoidosa during adaptation to low-CO/sub 2/ conditions have been investigated. The K/sub m/ value of photosynthesis of the high-CO/sub 2/ grown cells for dissolved inorganic carbon was 3.3 millimolar and decreased to 25 to 30 micromolar within 4 hours after transferring to air. In the presence of saturating CO/sub 2/ concentrations the photosynthetic activity of the high-CO/sub 2/ grown cells was 1.5 times as high as that of the low-CO/sub 2/ grown cells. There was a significant rise of the photosynthetic activity during adaptation of the high-CO/sub 2/ grown cells to air, followed by a steady decrease. The activity of ribulose 1,5-bisphosphate carboxylase/oxygenase in both the high and low-CO/sub 2/ grown cells was close to the photosynthetic activity of the cells. The concentration of ribulose 1,5-bisphosphate (RuBP) was higher in the low-CO/sub 2/ adapting and low-CO/sub 2/ grown celsl than in the high-CO/sub 2/ grown cells regardless of the photosynthetic rate. This seems to be due to an increased RuBP regeneration activity during adaptation followed by maintenance of the new higher concentration. The RuBP level always exceeded the concentration of ribulose 1,5-bisphosphate carboxylase/oxygenase RuBP binding sites in both the high- and low-CO/sub 2/ grown cells at any dissolved inorganic carbon concentration.

  7. Magnesium doping of efficient GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition

    NASA Technical Reports Server (NTRS)

    Lewis, C. R.; Ford, C. W.; Werthen, J. G.


    Magnesium has been substituted for zinc in GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition (MOCVD). Bis(cyclopentadienyl)magnesium (Cp2Mg) is used as the MOCVD transport agent for Mg. Full retention of excellent material quality and efficient cell performance results. The substitution of Mg for Zn would enhance the abruptness and reproducibility of doping profiles, and facilitate high temperature processing and operation, due to the much lower diffusion coefficient of Mg, relative to Zn, in these materials.

  8. A multiple p-n junction structure obtained from as-grown Czochralski silicon crystals by heat treatment - Application to solar cells

    NASA Technical Reports Server (NTRS)

    Chi, J. Y.; Gatos, H. C.; Mao, B. Y.


    Multiple p-n junctions have been prepared in as-grown Czochralski p-type silicon through overcompensation near the oxygen periodic concentration maxima by oxygen thermal donors generated during heat treatment at 450 C. Application of the multiple p-n-junction configuration to photovoltaic energy conversion has been investigated. A new solar-cell structure based on multiple p-n-junctions was developed. Theoretical analysis showed that a significant increase in collection efficiency over the conventional solar cells can be achieved.

  9. InGaAs/GaAsP superlattice solar cells with reduced carbon impurity grown by low-temperature metal-organic vapor phase epitaxy using triethylgallium

    NASA Astrophysics Data System (ADS)

    Fujii, Hiromasa; Toprasertpong, Kasidit; Sodabanlu, Hassanet; Watanabe, Kentaroh; Sugiyama, Masakazu; Nakano, Yoshiaki


    In this paper, we investigated the effects of carbon incorporation on photovoltaic performance of InGaAs/GaAsP superlattice (SL) solar cells grown by low-temperature MOVPE (LT-MOVPE), which is required for stable SL growth on vicinal substrates. Using trimethylgallium (TMGa) as the gallium precursor, methyl radicals formed by its pyrolysis tend to be absorbed on the surface at low temperature, causing severe carbon incorporation and p-type background doping. High background carrier concentration flattens the band-lineup of the intrinsic region and blocks the carrier transport across the SLs, and resulted in serious degradation of photocurrent. Intentional sulfur doping to cancel out the background doping and hence to recover the built-in field greatly improved the cell performance, but was found to require very precise control of doping level to achieve an exact compensation doping condition. Use of triethylgallium (TEGa) instead of TMGa much reduced the carbon incorporation at low temperature and significantly enhanced the photocurrent extraction without sulfur doping treatment. By thinning GaAsP barriers to 3 nm to facilitate efficient tunneling transport, a 50-period SL cell with bandgap of 1.22 eV grown on 6°-miscut substrates achieved 1.13 times higher efficiency with 31% current enhancement as middle cell performance than a GaAs reference cell.

  10. ZnO nanowires array grown on Ga-doped ZnO single crystal for dye-sensitized solar cells

    PubMed Central

    Hu, Qichang; Li, Yafeng; Huang, Feng; Zhang, Zhaojun; Ding, Kai; Wei, Mingdeng; Lin, Zhang


    High quality ZnO nanowires arrays were homoepitaxial grown on Ga-doped ZnO single crystal (GZOSC), which have the advantages of high conductivity, high carrier mobility and high thermal stability. When it was employed as a photoanode in the DSSCs, the cell exhibited a 1.44% power-conversion efficiency under the illumination of one sun (AM 1.5G). The performance is superior to our ZnO nanowires/FTO based DSSCs under the same condition. This enhanced performance is mainly attributed to the perfect interface between the ZnO nanowires and the GZOSC substrate that contributes to lower carrier scattering and recombination rates compared with that grown on traditional FTO substrate. PMID:26099568

  11. ZnO nanowires array grown on Ga-doped ZnO single crystal for dye-sensitized solar cells.


    Hu, Qichang; Li, Yafeng; Huang, Feng; Zhang, Zhaojun; Ding, Kai; Wei, Mingdeng; Lin, Zhang


    High quality ZnO nanowires arrays were homoepitaxial grown on Ga-doped ZnO single crystal (GZOSC), which have the advantages of high conductivity, high carrier mobility and high thermal stability. When it was employed as a photoanode in the DSSCs, the cell exhibited a 1.44% power-conversion efficiency under the illumination of one sun (AM 1.5G). The performance is superior to our ZnO nanowires/FTO based DSSCs under the same condition. This enhanced performance is mainly attributed to the perfect interface between the ZnO nanowires and the GZOSC substrate that contributes to lower carrier scattering and recombination rates compared with that grown on traditional FTO substrate. PMID:26099568

  12. ZnO nanowires array grown on Ga-doped ZnO single crystal for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Hu, Qichang; Li, Yafeng; Huang, Feng; Zhang, Zhaojun; Ding, Kai; Wei, Mingdeng; Lin, Zhang


    High quality ZnO nanowires arrays were homoepitaxial grown on Ga-doped ZnO single crystal (GZOSC), which have the advantages of high conductivity, high carrier mobility and high thermal stability. When it was employed as a photoanode in the DSSCs, the cell exhibited a 1.44% power-conversion efficiency under the illumination of one sun (AM 1.5G). The performance is superior to our ZnO nanowires/FTO based DSSCs under the same condition. This enhanced performance is mainly attributed to the perfect interface between the ZnO nanowires and the GZOSC substrate that contributes to lower carrier scattering and recombination rates compared with that grown on traditional FTO substrate.

  13. The gene expression profiles of canine mammary cancer cells grown with carcinoma-associated fibroblasts (CAFs) as a co-culture in vitro

    PubMed Central


    Background It is supposed that fibroblasts present in tumour microenvironment increase cancer invasiveness and its ability to metastasize but the mechanisms have not been clearly defined yet. Thus, the current study was designed to assess changes in gene expression in five various cancer cell lines grown as a co-culture with the carcinoma-associated fibroblasts (CAFs) in vitro. Results A carcinoma-associated fibroblast cell line was isolated from a canine mammary cancer. Then, a co-culture of cancer cells with the CAFs was established and maintained for 72 hrs. Having sorted the cells, a global gene expression in cancer cells using DNA microarrays was examined. The analysis revealed an up-regulation of 100 genes and a down-regulation of 106 genes in the cancer cells grown as a co-culture with the CAFs in comparison to control conditions. The PANTHER binomial statistics tool was applied to determine statistically over-manifested pathways (p < 0.05). Bulk of the up-regulated genes are involved in the adhesion, the angiogenesis, the epithelial-mesenchymal transition (EMT) and generally take part in the developmental processes. These results were further confirmed using real-time qPCR. Moreover, a wound-healing assay and growth characteristics on Matrigel matrix showed that CAFs increase cancer cell migration and matrix invasion. Conclusion The results of the current study showed that the co-culturing of cancer cells and the CAFs caused significant changes to the cancer gene expression. The presence of the CAFs in a microenvironment of cancer cells promotes adhesion, angiogenesis and EMT. PMID:22453032

  14. PROCUSTE1 Encodes a Cellulose Synthase Required for Normal Cell Elongation Specifically in Roots and Dark-Grown Hypocotyls of Arabidopsis

    PubMed Central

    Fagard, Mathilde; Desnos, Thierry; Desprez, Thierry; Goubet, Florence; Refregier, Guislaine; Mouille, Gregory; McCann, Maureen; Rayon, Catherine; Vernhettes, Samantha; Hfte, Herman


    Mutants at the PROCUSTE1 (PRC1) locus show decreased cell elongation, specifically in roots and dark-grown hypocotyls. Cell elongation defects are correlated with a cellulose deficiency and the presence of gapped walls. Map-based cloning of PRC1 reveals that it encodes a member (CesA6) of the cellulose synthase catalytic subunit family, of which at least nine other members exist in Arabidopsis. Mutations in another family member, RSW1 (CesA1), cause similar cell wall defects in all cell types, including those in hypocotyls and roots, suggesting that cellulose synthesis in these organs requires the coordinated expression of at least two distinct cellulose synthase isoforms. PMID:11148287

  15. Effects of buffer layer and back-surface field on MBE-grown InGaAsP/InGaAs solar cells

    NASA Astrophysics Data System (ADS)

    Wu, Yuanyuan; Ji, Lian; Dai, Pai; Tan, Ming; Lu, Shulong; Yang, Hui


    Solid-state molecular beam epitaxy (MBE)-grown InGaAsP/InGaAs dual-junction solar cells on InP substrates are reported. An efficiency of 10.6% under 1-sun AM1.5 global light intensity is realized for the dual-junction solar cell, while the efficiencies of 16.4 and 12.3% are reached for the top InGaAsP and bottom InGaAs cells, respectively. The effects of the buffer layer and back-surface field on the performance of solar cells are discussed. High device performance is achieved in the case of a low concentration of oxygen and weak recombination when InGaAs buffers and InP back-surface field layers are used, respectively.

  16. Power recovery of radiation damaged MOCVD grown indium phosphide on silicon solar cells through argon-ion laser annealing. Master`s thesis

    SciTech Connect

    Boyer, L.L.


    This thesis reports the results of a laser annealing technique used to remove defect sites from radiation damaged indium phosphide on silicon MOCVD grown solar cells. This involves the illumination of damaged solar cells with a continuous wave laser to produce a large forward-biased current. The InP/Si cells were irradiated with 1 MeV electrons to a given fluence, and tested for degradation. Light from an argon laser was used to illuminate four cells with an irradiance of 2.5 W/sq cm, producing a current density 3 to 5 times larger than AMO conditions. Cells were annealed at 19 deg C with the laser and at 25 deg C under AMO conditions. Annealing under laser illumination of n/p-type cells resulted in recovery of 48%. P/n type cells lost 4 to 12% of the assumed degradaton. Annealing under AMO conditions resulted in power recovery of 70% in n/p type cells. P/n-type cells recovered approximately 16% of lost power. Results indicate that significant power recovery results from the annealing of defects within n/p type InP/Si solar cells.

  17. Effects of three-dimensional culturing on osteosarcoma cells grown in a fibrous matrix: analyses of cell morphology, cell cycle, and apoptosis.


    Chen, Chunnuan; Chen, Kathryn; Yang, Shang-Tian


    Osteosarcoma cells were cultured in stirred tank bioreactors with either a fibrous matrix or nonporous microcarriers to study the environmental effects on cell growth, morphology, cell cycle, and apoptosis. Cell cycle and apoptosis were analyzed using flow cytometry and visualized using confocal laser scanning microscopy and fluorescence microscopy. The three-dimensional (3-D) fibrous culture had better cell growth and higher metabolic rates than the two-dimensional (2-D) microcarrier culture because cells in the fibrous matrix were protected from shear stress and had lower apoptosis and cell death even under suboptimal conditions (e.g., nutrient depletion). The polyester fibrous matrix used in this study also exhibited the capability of selectively retaining viable and nonapoptotic cells and disposing apoptotic and nonviable cells. Consequently, very few apoptotic cells were found in the fibrous matrix even in the long-term (1 month) T-flask culture. In the continuous culture with packed fibrous matrixes for cell support, most cells were arrested in the G1/G0 phase after 4 days. Decreasing the dissolved oxygen level from 60 to 10% air saturation did not significantly change cell cycle and apoptosis, which remained low at approximately 15%. These results could explain why the fibrous bed bioreactor had good long-term stability and was advantageous for production of non-growth-associated proteins by animal cell cultures. PMID:14524722

  18. Production of Methyl Ketones from Secondary Alcohols by Cell Suspensions of C(2) to C(4)n-Alkane-Grown Bacteria.


    Hou, C T; Patel, R; Laskin, A I; Barnabe, N; Barist, I


    Nineteen new C(2) to C(4)n-alkane-grown cultures were isolated from lake water from Warinanco Park, Linden, N.J., and from lake and soil samples from Bayway Refinery, Linden, N.J. Fifteen known liquid alkane-utilizing cultures were also found to be able to grow on C(2) to C(4)n-alkanes. Cell suspensions of these C(2) to C(4)n-alkane-grown bacteria oxidized 2-alcohols (2-propanol, 2-butanol, 2-pentanol, and 2-hexanol) to their corresponding methyl ketones. The product methyl ketones accumulated extracellularly. Cells grown on 1-propanol or 2-propanol oxidized both primary and secondary alcohols. In addition, the activity for production of methyl ketones from secondary alcohols was found in cells grown on either alkanes, alcohols, or alkylamines, indicating that the enzyme(s) responsible for this reaction is constitutive. The optimum conditions for in vivo methyl ketone formation from secondary alcohols were compared among selected strains: Brevibacterium sp. strain CRL56, Nocardia paraffinica ATCC 21198, and Pseudomonas fluorescens NRRL B-1244. The rates for the oxidation of secondary alcohols were linear for the first 3 h of incubation. Among secondary alcohols, 2-propanol and 2-butanol were oxidized at the highest rate. A pH around 8.0 to 9.0 was found to be the optimum for acetone or 2-butanone formation from 2-alcohols. The temperature optimum for the production of acetone or 2-butanone from 2-propanol or 2-butanol was rather high at 60 degrees C, indicating that the enzyme involved in the reaction is relatively thermally stable. Metal-chelating agents inhibit the production of methyl ketones, suggesting the involvement of a metal(s) in the oxidation of secondary alcohols. Secondary alcohol dehydrogenase activity was found in the cell-free soluble fraction; this activity requires a cofactor, specifically NAD. Propane monooxygenase activity was also found in the cell-free soluble fraction. It is a nonspecific enzyme catalyzing both terminal and subterminal oxidation of n-alkanes. PMID:16346339

  19. Production of Methyl Ketones from Secondary Alcohols by Cell Suspensions of C2 to C4n-Alkane-Grown Bacteria

    PubMed Central

    Hou, Ching T.; Patel, Ramesh; Laskin, Allen I.; Barnabe, Nancy; Barist, Irene


    Nineteen new C2 to C4n-alkane-grown cultures were isolated from lake water from Warinanco Park, Linden, N.J., and from lake and soil samples from Bayway Refinery, Linden, N.J. Fifteen known liquid alkane-utilizing cultures were also found to be able to grow on C2 to C4n-alkanes. Cell suspensions of these C2 to C4n-alkane-grown bacteria oxidized 2-alcohols (2-propanol, 2-butanol, 2-pentanol, and 2-hexanol) to their corresponding methyl ketones. The product methyl ketones accumulated extracellularly. Cells grown on 1-propanol or 2-propanol oxidized both primary and secondary alcohols. In addition, the activity for production of methyl ketones from secondary alcohols was found in cells grown on either alkanes, alcohols, or alkylamines, indicating that the enzyme(s) responsible for this reaction is constitutive. The optimum conditions for in vivo methyl ketone formation from secondary alcohols were compared among selected strains: Brevibacterium sp. strain CRL56, Nocardia paraffinica ATCC 21198, and Pseudomonas fluorescens NRRL B-1244. The rates for the oxidation of secondary alcohols were linear for the first 3 h of incubation. Among secondary alcohols, 2-propanol and 2-butanol were oxidized at the highest rate. A pH around 8.0 to 9.0 was found to be the optimum for acetone or 2-butanone formation from 2-alcohols. The temperature optimum for the production of acetone or 2-butanone from 2-propanol or 2-butanol was rather high at 60C, indicating that the enzyme involved in the reaction is relatively thermally stable. Metal-chelating agents inhibit the production of methyl ketones, suggesting the involvement of a metal(s) in the oxidation of secondary alcohols. Secondary alcohol dehydrogenase activity was found in the cell-free soluble fraction; this activity requires a cofactor, specifically NAD. Propane monooxygenase activity was also found in the cell-free soluble fraction. It is a nonspecific enzyme catalyzing both terminal and subterminal oxidation of n-alkanes. PMID:16346339

  20. Loss of capacity for acid-induced wall loosening as the principal cause of the cessation of cell enlargement in light-grown bean leaves.


    Van Volkenburgh, E; Schmidt, M G; Cleland, R E


    Cell enlargement in primary leaves of bean (Phaseolus vulgaris L.) can be induced, free of cell divisions, by exposure of 10-d-old, red-light-grown seedlings to white light. The absolute rate of leaf expansion increases until day 12, then decreases until the leaves reached mature size on day 18. The cause of the reduction in growth rate following day 12 has been investigated. Turgor calculated from measurements of leaf water and osmotic potential fell from 6.5 to 3.5 bar before day 12, but remained constant thereafter. The decline of growth after day 12 is not caused by a decrease in turgor. On the other hand, Instron-measured cell-wall extensibility decreased in parallel with growth rate after day 12. Two parameters influencing extensibility were examined. Light-induced acidification of cell walls, which has been shown to initiate wall extension, remained constant over the growth period (days 10-18). Furthermore, cells of any age could be stimulated to excrete H(+) by fusicoccin. However, older tissue was not able to grow in response to fusicoccin or light. Measurements of acid-induced extension on preparations of isolated cell walls showed that as cells matured, the cell walls became less able to extend when acidified. These data indicate that it is a decline in the capacity for acid-induced wall loosening that reduces wall extensibility and thus cell enlargement in maturing leaves. PMID:24249449

  1. High-efficiency microcrystalline silicon solar cells on honeycomb textured substrates grown with high-rate VHF plasma-enhanced chemical vapor deposition

    NASA Astrophysics Data System (ADS)

    Sai, Hitoshi; Maejima, Keigo; Matsui, Takuya; Koida, Takashi; Kondo, Michio; Nakao, Sachiko; Takeuchi, Yoshiaki; Katayama, Hirotaka; Yoshida, Isao


    The potential of high-rate growth of high-quality microcrystalline silicon (c-Si:H) films for solar cell applications is investigated by very high frequency plasma-enhanced chemical vapor deposition (VHF-PECVD) under a high-pressure SiH4 depletion condition. It is found that the morphology of textured substrates plays an important role in not only light trapping but also c-Si:H film growth. A high conversion efficiency of 11.1% is attained in a substrate-type c-Si:H cell on a substrate with honeycomb textures, which has rounded concaves in a honeycomb arrangement with an appropriate period. It is also clarified that ZnO:B films grown by metal organic chemical vapor deposition (MOCVD) are beneficial in terms of carrier collection compared with the standard In2O3:Sn (ITO) film grown by sputtering. On the basis of these findings, a new world-record c-Si:H cell with a certified conversion efficiency of 11.8% is developed with a relatively high deposition rate of 1 nm/s.

  2. Fabrication of hydrogenated amorphous Si/crystalline Si1-xGex (x ? 0.84) heterojunction solar cells grown by solid source molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Oshima, Ryuji; Yamanaka, Mitsuyuki; Kawanami, Hitoshi; Sakata, Isao; Matsubara, Koji; Sugaya, Takeyoshi


    We characterized hydrogenated amorphous Si/single-crystalline Si1-xGex heterojunction solar cells grown on Si substrates with Ge content (x) between 0.49 and 0.84 in an effort to develop materials with a bandgap range of 0.9-1.0 eV for solar applications. We showed that 3-m-thick Si0.16Ge0.84 films grown by molecular-beam epitaxy on a virtual substrate composed of buffer layers with stepwise gradation of their composition have an almost fully strain-relaxed condition and a low dislocation density, less than 105 cm-2. An absorption edge extending up to 1300 nm and an increased quantum efficiency were observed in Si1-xGex cells with x = 0.49, 0.70, and 0.84. Consequently, the short-circuit current density increased non-linearly with Ge content, being 14.0 and 24.0 mA/cm2 for 3-m-thick Si and Si0.16Ge0.84 cells, respectively.

  3. Differences in excitation energy transfer of Arthrospira platensis cells grown in seawater medium and freshwater medium, probed by time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Arba, Muhammad; Aikawa, Shimpei; Niki, Kenta; Yokono, Makio; Kondo, Akihiko; Akimoto, Seiji


    Excitation energy transfer of Arthrospira platensis cells grown in f/2 medium (a high salinity medium) and SOT medium (a control) was investigated by steady-state and time-resolved spectroscopies. Growth in f/2 medium induced changes in absorption and fluorescence spectra as well as in the energy transfer pathways. Excitation energy captured by phycobilisome (PBS) was transferred directly to photosystem (PS) I, instead of being first transferred to an intermediate (PBS ? PSII ? PSI), as observed in SOT medium. The respiration rate increased while photosynthetic rate reduced in f/2 medium. Possible causes of the differences in light-harvesting and energy-transfer processes between the two media are discussed.

  4. Comparison of single junction AlGaInP and GaInP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Masuda, T; Tomasulo, S; Lang, JR; Lee, ML


    We have investigated similar to 2.0 eV (AlxGa1-x)(0.51)In0.49P and similar to 1.9 eV Ga0.51In0.49P single junction solar cells grown on both on-axis and misoriented GaAs substrates by molecular beam epitaxy (MBE). Although lattice-matched (AlxGa1-x)(0.51)In0.49P solar cells are highly attractive for space and concentrator photovoltaics, there have been few reports on the MBE growth of such cells. In this work, we demonstrate open circuit voltages (V-oc) ranging from 1.29 to 1.30 V for Ga0.51In0.49P cells, and 1.35-1.37 V for (AlxGa1-x)(0.51)In0.49P cells. Growth on misoriented substrates enabled the bandgap-voltage offset (W-oc = E-g/q - V-oc) of Ga0.51In0.49P cells to decrease from similar to 575 mV to similar to 565 mV, while that of (AlxGa1-x)(0.51)In0.49P cells remained nearly constant at 620 mV. The constant Woc as a function of substrate offcut for (AlxGa1-x)(0.51)In0.49P implies greater losses from non-radiative recombination compared with the Ga0.51In0.49P devices. In addition to larger Woc values, the (AlxGa1-x)(0.51)In0.49P cells exhibited significantly lower internal quantum efficiency (IQE) values than Ga0.51In0.49P cells due to recombination at the emitter/window layer interface. A thin emitter design is experimentally shown to be highly effective in improving IQE, particularly at short wavelengths. Our work shows that with further optimization of both cell structure and growth conditions, MBE-grown (AlxGa1-x)(0.51)In0.49P will be a promising wide-bandgap candidate material for high-efficiency, lattice-matched multi-junction solar cells. (C) 2015 AIP Publishing LLC.

  5. Comparison of single junction AlGaInP and GaInP solar cells grown by molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Masuda, Taizo; Tomasulo, Stephanie; Lang, Jordan R.; Lee, Minjoo Larry


    We have investigated 2.0 eV (AlxGa1-x)0.51In0.49P and 1.9 eV Ga0.51In0.49P single junction solar cells grown on both on-axis and misoriented GaAs substrates by molecular beam epitaxy (MBE). Although lattice-matched (AlxGa1-x)0.51In0.49P solar cells are highly attractive for space and concentrator photovoltaics, there have been few reports on the MBE growth of such cells. In this work, we demonstrate open circuit voltages (Voc) ranging from 1.29 to 1.30 V for Ga0.51In0.49P cells, and 1.35-1.37 V for (AlxGa1-x)0.51In0.49P cells. Growth on misoriented substrates enabled the bandgap-voltage offset (Woc = Eg/q - Voc) of Ga0.51In0.49P cells to decrease from 575 mV to 565 mV, while that of (AlxGa1-x)0.51In0.49P cells remained nearly constant at 620 mV. The constant Woc as a function of substrate offcut for (AlxGa1-x)0.51In0.49P implies greater losses from non-radiative recombination compared with the Ga0.51In0.49P devices. In addition to larger Woc values, the (AlxGa1-x)0.51In0.49P cells exhibited significantly lower internal quantum efficiency (IQE) values than Ga0.51In0.49P cells due to recombination at the emitter/window layer interface. A thin emitter design is experimentally shown to be highly effective in improving IQE, particularly at short wavelengths. Our work shows that with further optimization of both cell structure and growth conditions, MBE-grown (AlxGa1-x)0.51In0.49P will be a promising wide-bandgap candidate material for high-efficiency, lattice-matched multi-junction solar cells.

  6. Significant changes in cell and chloroplast development in young wheat leaves (Triticum aestivum cv Hereward) grown in elevated CO{sub 2}

    SciTech Connect

    Robertson, E.J.; Leech, R.M.


    Cell and chloroplast development were characterized in young Triticum aestivum cv Hereward leaves grown at ambient (350 {mu}L L{sup {minus}1}) or at elevated (650 {mu}L L{sup {minus}1}) CO{sub 2}. In elevated CO{sub 2}, cell and chloroplast expansion was accelerated by 10 and 25%, respectively, in the first leaf of 7-d-old wheat plants without disruption to the leaf developmental pattern. Elevated CO{sub 2} did not affect the number of chloroplasts in relation to mesophyll cell size or the linear relationship between chloroplast number or size and mesophyll cell size. No major changes in leaf anatomy or in chloroplast ultrastructure were detected as a result of growth in elevated CO{sub 2}, but there was a marked reduction in starch accumulation. In leaf sections fluorescently tagged antisera were used to visualize and quantitate the amount of cytochrome f, the {alpha}- and {beta}-subunits of the coupling factor 1 in ATP synthase, D1 protein of the photosystem II reaction center, the 33-kD protein of the extrinsic oxygen-evolving complex, subunit II of photosystem I, and ribulose-1,5-biphosphate carboxylase/oxygenase. A significant finding was that in 10 to 20% of the mesophyll cells grown in elevated CO{sub 2} the 33-kD protein of the extrinsic oxygen-evolving complex of photosystem II and cytochrome f were deficient by 75%, but the other proteins accumulated normally. 29 refs., 6 figs., 2 tabs.

  7. MBE-grown InGaAsP solar cells with 1.0 eV bandgap on InP(001) substrates for application to multijunction solar cells

    NASA Astrophysics Data System (ADS)

    Oshima, Ryuji; Makita, Kikuo; Mizuno, Hidenori; Takato, Hidetaka; Matsubara, Koji; Sugaya, Takeyoshi


    In this study, we have developed the first ever solid-source molecular beam epitaxy (SS-MBE)-grown In0.81Ga0.19As0.43P0.57/In0.47Ga0.53As dual-junction solar cells grown on InP substrates with a 1.0/0.7 eV bandgap for use in mechanically stacked multijunction solar cells. We studied the adsorption efficiencies of As2 and P2 to determine the optimal parameters for the growth of lattice-matched In0.81Ga0.19As0.43P0.57 by SS-MBE. The adsorption efficiency of As2 was found to be seven times greater than that of P2, and lattice-matched In0.81Ga0.19AsyP1-y (y = 0.43) can be achieved at a PAs/(PP + PAs) ratio of 0.10. Then, we studied the effect of growth temperature on the characteristics of lattice-matched In0.81Ga0.19As0.43P0.57 single-junction solar cells. The open-circuit voltage (VOC) was found to be greatly affected by the growth temperature, and the highest VOC = 0.47 V (efficiency ? = 10.5%) was obtained for cells grown at 440 C. On the other hand, photoluminescence intensity measured for these cells at room temperature monotonically increased with an increase in the growth temperature, which implies that the reduction in VOC for the cells grown at 400 and 420 C was due to the increase in the intrinsic defects and unexpected contaminations. By contrast, the reduction in VOC for the cell grown at 450 C is presumably attributed to an increase in local compositional fluctuations. We integrated the abovementioned In0.81Ga0.19As0.43P0.57 top cell with the In0.47Ga0.53As bottom cell and an ? of 3.7% was obtained using an 880-nm-long pass filter.

  8. Factors derived from Escherichia coli Nissle 1917, grown in different growth media, enhance cell death in a model of 5-fluorouracil-induced Caco-2 intestinal epithelial cell damage.


    Wang, Hanru; Bastian, Susan E P; Lawrence, Andrew; Howarth, Gordon S


    We evaluated supernatants (SNs) from Escherichia coli Nissle 1917 (EcN) grown in commonly used growth media for their capacity to affect the viability of Caco-2 colon cancer cells in the presence and absence of 5-Fluorouracil (5-FU) chemotherapy. EcN was grown in Luria-Bertani (LB), tryptone soya (TSB), Man Rogosa Sharpe (MRS), and M17 broth supplemented with 10% (v/v) lactose solution (M17). Human Caco-2 colon cancer cells were treated with DMEM (control), growth media alone (LB, TSB, MRS, and M17) or EcN SNs derived from these 4 media, in the presence and absence of 5-FU. Cell viability, reactive oxygen species (ROS), and cell monolayer permeability were determined. EcN SN in LB medium reduced Caco-2 cell viability significantly, to 51% at 48 h. The combination of this EcN SN and 5-FU further reduced cell viability to 37% at 48 h, compared to 5-FU control. MRS broth and EcN SN in MRS, together with 5-FU, generated significantly lower levels of ROS compared to 5-FU control. However, all 5-FU treatments significantly disrupted the Caco-2 cell barrier compared to control; with no significant differences observed among any of the 5-FU treatments. EcN SNs (LB+) was most effective at decreasing the viability of Caco-2 cells. This could indicate a potential role for this EcN SN in chemoprevention for colon cancer. PMID:25625670


    EPA Science Inventory

    Human lung epithelial cells have been cultured and characterized for phospholipid content. Any residual fibroblasts were removed by selective trypsinization within the first 48 hours in culture. Epithelial cells were serially subpassaged when cultures reached ca. 80% confluency. ...

  10. Effect of temperature and pH on ethanol production by free and immobilized cells of Kluyveromyces marxianus grown on Jerusalem artichoke extract

    SciTech Connect

    Bajpai, P.; Margaritis, A.


    The effect of temperature and pH on the kinetics of ethanol production by free and calcium alginate immobilized cells of Kluyveromyces marxianus grown on Jerusalem artichoke extract was investigated. With the free cells, the ethanol and biomass yields were relatively constant over the temperature range 25-35 degrees C, but dropped sharply beyond 35 degrees C. Other kinetic parameters, specific growth rate, specific ethanol production rate, and specific total sugar uptake rate were maximum at 35 degrees C. However, with the immobilized cells, ethanol yield remained almost constant in the temperatue range 25-45 degrees C, and the specific ethanol production rate and specific total sugar uptake rate attained their maximum values at 40 degrees C. For the pH range between 3 and 7, the free-cell optimum for growth and product formation was found to be circa pH 5. At this pH, the specific growth rate was 0.35/h and specific ethanol production rate was 2.83 g/g/h. At values higher or lower than pH 5, a sharp decrease in specific ethanol production rate as well as specific growth rate was observed. In comparison, the immobilized cells showed a broad optimum pH profile. The best ethanol production rates were observed between pH 4 and 6. (Refs. 22).

  11. The polyGeVero® software for fast and easy computation of 3D radiotherapy dosimetry data

    NASA Astrophysics Data System (ADS)

    Kozicki, Marek; Maras, Piotr


    The polyGeVero® software package was elaborated for calculations of 3D dosimetry data such as the polymer gel dosimetry. It comprises four workspaces designed for: i) calculating calibrations, ii) storing calibrations in a database, iii) calculating dose distribution 3D cubes, iv) comparing two datasets e.g. a measured one with a 3D dosimetry with a calculated one with the aid of a treatment planning system. To accomplish calculations the software was equipped with a number of tools such as the brachytherapy isotopes database, brachytherapy dose versus distance calculation based on the line approximation approach, automatic spatial alignment of two 3D dose cubes for comparison purposes, 3D gamma index, 3D gamma angle, 3D dose difference, Pearson's coefficient, histograms calculations, isodoses superimposition for two datasets, and profiles calculations in any desired direction. This communication is to briefly present the main functions of the software and report on the speed of calculations performed by polyGeVero®.

  12. Human RPE stem cells grown into polarized RPE monolayers on a polyester matrix are maintained after grafting into rabbit subretinal space.


    Stanzel, Boris V; Liu, Zengping; Somboonthanakij, Sudawadee; Wongsawad, Warapat; Brinken, Ralf; Eter, Nicole; Corneo, Barbara; Holz, Frank G; Temple, Sally; Stern, Jeffrey H; Blenkinsop, Timothy A


    Transplantation of the retinal pigment epithelium (RPE) is being developed as a cell-replacement therapy for age-related macular degeneration. Human embryonic stem cell (hESC) and induced pluripotent stem cell (iPSC)-derived RPE are currently translating toward clinic. We introduce the adult human RPE stem cell (hRPESC) as an alternative RPE source. Polarized monolayers of adult hRPESC-derived RPE grown on polyester (PET) membranes had near-native characteristics. Trephined pieces of RPE monolayers on PET were transplanted subretinally in the rabbit, a large-eyed animal model. After 4days, retinal edema was observed above the implant, detected by spectral domain optical coherence tomography (SD-OCT) and fundoscopy. At 1week, retinal atrophy overlying the fetal or adult transplant was observed, remaining stable thereafter. Histology obtained 4weeks after implantation confirmed a continuous polarized human RPE monolayer on PET. Taken together, the xeno-RPE survived with retained characteristics in the subretinal space. These experiments support that adult hRPESC-derived RPE are a potential source for transplantation therapies. PMID:24511471

  13. Density and length of stomatal and epidermal cells in "living fossil" trees grown under elevated CO 2 and a polar light regime

    NASA Astrophysics Data System (ADS)

    Ogaya, R.; Llorens, L.; Peuelas, J.


    During the Cretaceous and early Tertiary, when the climate was warm and the atmospheric CO 2 concentration ([CO 2]) was at least double that of the present-day, polar forests populated high latitude landmasses. We investigated the density and length of stomata and other epidermal cells of two deciduous and three evergreen "living fossil" tree species representative of these ancient forests. These tree species were grown in a simulated Cretaceous high latitude environment at either ambient (400 ppmv) or elevated (800 ppmv) [CO 2] during four years. After 4 years growing at elevated [CO 2], the leaf stomatal density and index (percentage of leaf epidermal cells that are stomata) of these plants were similar to those of their counterparts growing at ambient [CO 2]. While the CO 2 enrichment only modified the stomatal pore length in two of the five studied species, it increased significantly the overall length of the epidermal cells of all the species, reducing their density. These results revealed that leaf epidermal cells of these "living fossil" species were more sensitive than stomata to an experimental doubling of atmospheric CO 2 concentration.

  14. Human RPE Stem Cells Grown into Polarized RPE Monolayers on a Polyester Matrix Are Maintained after Grafting into Rabbit Subretinal Space

    PubMed Central

    Stanzel, BorisV.; Liu, Zengping; Somboonthanakij, Sudawadee; Wongsawad, Warapat; Brinken, Ralf; Eter, Nicole; Corneo, Barbara; Holz, FrankG.; Temple, Sally; Stern, JeffreyH.; Blenkinsop, TimothyA.


    Summary Transplantation of the retinal pigment epithelium (RPE) is being developed as a cell-replacement therapy for age-related macular degeneration. Human embryonic stem cell (hESC) and induced pluripotent stem cell (iPSC)-derived RPE are currently translating toward clinic. We introduce the adult human RPE stem cell (hRPESC) as an alternative RPE source. Polarized monolayers of adult hRPESC-derived RPE grown on polyester (PET) membranes had near-native characteristics. Trephined pieces of RPE monolayers on PET were transplanted subretinally in the rabbit, a large-eyed animal model. After 4days, retinal edema was observed above the implant, detected by spectral domain optical coherence tomography (SD-OCT) and fundoscopy. At 1week, retinal atrophy overlying the fetal or adult transplant was observed, remaining stable thereafter. Histology obtained 4weeks after implantation confirmed a continuous polarized human RPE monolayer on PET. Taken together, the xeno-RPE survived with retained characteristics in the subretinal space. These experiments support that adult hRPESC-derived RPE are a potential source for transplantation therapies. PMID:24511471

  15. Lipid content and fatty acid composition of green algae Scenedesmus obliquus grown in a constant cell density apparatus

    NASA Technical Reports Server (NTRS)

    Choi, K. J.; Nakhost, Z.; Barzana, E.; Karel, M.


    The lipids of alga Scenedesmus obliquus grown under controlled conditions were separated and fractionated by column and thin-layer chromatography, and fatty acid composition of each lipid component was studied by gas-liquid chromatography (GLC). Total lipids were 11.17%, and neutral lipid, glycolipid and phospholipid fractions were 7.24%, 2.45% and 1.48% on a dry weight basis, respectively. The major neutral lipids were diglycerides, triglycerides, free sterols, hydrocarbons and sterol esters. The glycolipids were: monogalactosyl diglyceride, digalactosyl diglyceride, esterified sterol glycoside, and sterol glycoside. The phospholipids included: phosphatidyl choline, phosphatidyl glycerol and phosphatidyl ethanolamine. Fourteen fatty acids were identified in the four lipid fractions by GLC. The main fatty acids were C18:2, C16:0, C18:3(alpha), C18:1, C16:3, C16:1, and C16:4. Total unsaturated fatty acid and essential fatty acid compositions of the total algal lipids were 80% and 38%, respectively.

  16. Failure of propagation of human norovirus in intestinal epithelial cells with microvilli grown in three-dimensional cultures.


    Takanashi, Sayaka; Saif, Linda J; Hughes, John H; Meulia, Tea; Jung, Kwonil; Scheuer, Kelly A; Wang, Qiuhong


    Human noroviruses (HuNoVs) are a leading cause of acute gastroenteritis. Establishment of a cell culture system for in vitro HuNoV growth remains challenging. Replication of HuNoVs in human intestinal cell lines (INT-407 and Caco-2) that differentiate to produce microvilli in rotation wall vessel (RWV) three-dimensional cultures has been reported (Straub et al. in Emerg Infect Dis 13:396-403, 2007; J Water Health 9:225-240, 2011, and Water Sci Technol 67:863-868, 2013). We used a similar RWV system, intestinal cell lines, and the same (Genogroup [G] I.1) plus additional (GII.4 and GII.12) HuNoV strains to test the system's reproducibility and to expand the earlier findings. Apical microvilli were observed on the surface of both cell lines by light and electron microscopy. However, none of the cell types tested resulted in productive viral replication of any of the HuNoV strains, as confirmed by plateau or declining viral RNA titers in the supernatants and cell lysates of HuNoV-infected cells, determined by real-time reverse transcription PCR. These trends were the same when culture supplements were added that have been reported to be effective for replication of other fastidious enteric viruses in vitro. Additionally, by confocal microscopy and orthoslice analysis, viral capsid proteins were mainly observed above the actin filament signals, which suggested that the majority of viral antigens were on the cell surface. We conclude that even intestinal cells displaying microvilli were not sufficient to support HuNoV replication under the conditions tested. PMID:23974469

  17. Stability of single and tandem junction a-Si:H solar cells grown using the ECR process

    SciTech Connect

    Dalal, V.L.; Maxson, T.; Girvan, R.; Haroon, S.


    The authors report on the fabrication and stability tests of single junction a-Si:H, and tandem junction a-Si:H/A-Si:H solar cells using the ECR process under high hydrogen dilution (H-ECR process). They show that devices with high fill factors can be made using the H-ECR process. They also report on the stability studies of the solar cells under 1 and 2-sun illumination conditions. The solar cells show very little degradation even after 500 hours of illumination under 2 x sunlight illumination.

  18. The light intensity under which cells are grown controls the type of peripheral light-harvesting complexes that are assembled in a purple photosynthetic bacterium

    SciTech Connect

    Brotosudarmo, Tatas H. P.; Collins, Aaron M.; Gall, Andrew; Roszak, Aleksander W.; Gardiner, Alastair T.; Blankenship, Robert E.; Cogdell, Richard J.


    The differing composition of LH2 (peripheral light-harvesting) complexes present in Rhodopseudomonas palustris 2.1.6 have been investigated when cells are grown under progressively decreasing light intensity. Analysis of the absorption spectra reveals there must be more than two types of LH2 complexes present. Purified HL (high-light) and LL (low-light) LH2 complexes have mixed apoprotein compositions. The HL complexes contain PucABa and PucABb apoproteins. The LL complexes contain PucABa, PucABd and PucBb-only apoproteins. This mixed apoprotein composition can explain their resonance Raman spectra.

  19. Effects of the aspect ratio on the dye adsorption of ZnO nanorods grown by using a sonochemical method for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Choi, Seok Cheol; Yun, Won Suk; Sohn, Sang Ho; Oh, Sang Jin


    Well-aligned ZnO nanorods for the photoelectrode of dye-sensitized solar cells (DSSCs) were grown via a sonochemical method, and the effects of their aspect ratios on the dye adsorption in DSSCs were studied. The control of the aspect ratio of well-aligned ZnO nanorods was performed by tuning the mole concentration of zinc acetate dehydrate in the range of 0.04-0.06M. The dye amounts adsorbed in the ZnO nanorods were estimated from the UV-Visible absorbance by using the Beer-Lambert law. The efficiency of DSSCs with ZnO nanorods was measured to investigate the effects of the aspect ratio of the ZnO nanorods on the dye adsorption properties. A change in the aspect ratio of the ZnO nanorods was founded to yield a change in their dye adsorption ability, resulting in a change in the efficiency of the DSSCs.

  20. High external quantum efficiency and fill-factor InGaN/GaN heterojunction solar cells grown by NH{sub 3}-based molecular beam epitaxy

    SciTech Connect

    Lang, J. R.; Hurni, C. A.; Cruz, S. C.; Matioli, E.; Speck, J. S.; Neufeld, C. J.; Mishra, U. K.


    High external quantum efficiency (EQE) p-i-n heterojunction solar cells grown by NH{sub 3}-based molecular beam epitaxy are presented. EQE values including optical losses are greater than 50% with fill-factors over 72% when illuminated with a 1 sun AM0 spectrum. Optical absorption measurements in conjunction with EQE measurements indicate an internal quantum efficiency greater than 90% for the InGaN absorbing layer. By adjusting the thickness of the top p-type GaN window contact layer, it is shown that the short-wavelength (<365 nm) quantum efficiency is limited by the minority carrier diffusion length in highly Mg-doped p-GaN.

  1. Differences In Early T-Cell Signaling In Cultures Grown In a Rotating Clinostat vs. Static Controls

    NASA Technical Reports Server (NTRS)

    Alexamder. M.; Nelman-Gonzales, M.; Penkala, J.; Sams, C.


    Altered gravity has previously been demonstrated to be a stress that can influence components of the immune system. Specifically, T-cell activation has been shown to be affected by changes in gravity, exhibiting a decrease in proliferative response to in vitro stimulation in microgravity. Subsequent ground based studies utilizing a rotating clinostat to model some of the effects of microgravity have been consistent with earlier flight based experiments. These ground and flight experiments have examined T-cell activation by measuring various responses including production of cytokines, DNA synthesis and the production of various cell surface activation markers. These indicators of T-cell activation were measured anywhere from 4 to 72 hours after stimulation. Prior to the work described here, the initial signaling events in T-cell activation had not been directly examined. The goal of this project was to determine how the process of early signal transduction was affected by growth in a rotating clinostat. Here we directly show a defect in signaling from TCR to MAPK in purified peripheral T-cells activated in the clinostat by OKT3/antiCD28 coated microbeads as compared to static controls.

  2. Cell wall-bound peroxidase activity and lignin formation in azuki bean epicotyls grown under hypergravity conditions.


    Wakabayashi, Kazuyuki; Nakano, Saho; Soga, Kouichi; Hoson, Takayuki


    The effects of accelerated gravity stimuli on the cell wall-bound peroxidase activity and the lignin content were investigated along epicotyls of azuki bean (Vigna angularis) seedlings. The endogenous growth occurred primarily in the upper regions of the epicotyl, but no growth was detected in the middle or basal regions. Hypergravity treatment at 300g for 6h suppressed elongation growth and stimulated lateral expansion of the upper regions. The content of acetyl bromide-soluble lignin increased gradually from the apical to the basal regions of epicotyls. Hypergravity treatment stimulated the increase in the lignin content in epicotyls, particularly in the middle and basal regions. The peroxidase activity in the protein fraction extracted with a high ionic strength buffer from the cell wall preparation also increased gradually toward the basal region, and hypergravity treatment increased the activity in all epicotyl regions. There was a close correlation between the lignin content and the enzyme activity. These results suggest that hypergravity increases the activity of cell wall-bound peroxidase followed by increases of the lignin formation in epicotyl cell walls, which may contribute to increasing the rigidity of cell walls against the gravitational force. PMID:19195738

  3. Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture

    NASA Technical Reports Server (NTRS)

    Gruener, R.; Hoeger, G.


    Cocultured Xenopus neurons and myocytes were subjected to non-vectorial gravity by clinostat rotation to determine if microgravity, during space flights, may affect cell development and communications. Clinorotated cells showed changes consistent with the hypothesis that cell differentiation, in microgravity, is altered by interference with cytoskeleton-related mechanisms. We found: increases in the myocyte and its nuclear area, "fragmentation" of nucleoli, appearance of neuritic "aneurysms", decreased growth in the presence of "trophic" factors, and decreased yolk utilization. The effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. Some parameters returned to near control values within 48 hrs after cessation of rotation. Cells from cultures rotated at higher speeds (>50 rpm) appeared comparable to controls. Compensation by centrifugal forces may account for this finding. Our data are consistent, in principle, with effects on other, flighted cells and suggest that "vector-free" gravity may simulate certain aspects of microgravity. The distribution of acetylcholine receptor aggregates, on myocytes, was also altered. This indicates that brain development, in microgravity, may also be affected.

  4. Comparison of single junction AlGaInP and GaInP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Masuda, Taizo Tomasulo, Stephanie; Lang, Jordan R.; Lee, Minjoo Larry


    We have investigated ∼2.0 eV (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P and ∼1.9 eV Ga{sub 0.51}In{sub 0.49}P single junction solar cells grown on both on-axis and misoriented GaAs substrates by molecular beam epitaxy (MBE). Although lattice-matched (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P solar cells are highly attractive for space and concentrator photovoltaics, there have been few reports on the MBE growth of such cells. In this work, we demonstrate open circuit voltages (V{sub oc}) ranging from 1.29 to 1.30 V for Ga{sub 0.51}In{sub 0.49}P cells, and 1.35–1.37 V for (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells. Growth on misoriented substrates enabled the bandgap-voltage offset (W{sub oc} = E{sub g}/q − V{sub oc}) of Ga{sub 0.51}In{sub 0.49}P cells to decrease from ∼575 mV to ∼565 mV, while that of (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells remained nearly constant at 620 mV. The constant W{sub oc} as a function of substrate offcut for (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P implies greater losses from non-radiative recombination compared with the Ga{sub 0.51}In{sub 0.49}P devices. In addition to larger W{sub oc} values, the (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells exhibited significantly lower internal quantum efficiency (IQE) values than Ga{sub 0.51}In{sub 0.49}P cells due to recombination at the emitter/window layer interface. A thin emitter design is experimentally shown to be highly effective in improving IQE, particularly at short wavelengths. Our work shows that with further optimization of both cell structure and growth conditions, MBE-grown (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P will be a promising wide-bandgap candidate material for high-efficiency, lattice-matched multi-junction solar cells.

  5. Pertubation of beta1 integrin function using anti-sense or function-blocking antibodies on corneal cells grown on fibronectin and tenascin.


    Doane, Kathleen J; Bhattacharya, Raka; Marchant, Jeff


    During corneal development, neural crest derivatives from the periocular mesenchyme migrate into the cornea and differentiate into corneal fibroblasts. During this time, these cells interact with a variety of extracellular matrices for proper orientation and development. In the present studies, we have examined the interaction of beta(1) integrins on periocular mesenchyme cells (POM) and corneal fibroblasts (CF) with fibronectin and tenascin by perturbing the function of this integrin. POM and CF attached and spread to a much greater extent on fibronectin than on tenascin. An antibody against beta(1) integrin, CSAT, decreased spreading and attachment, and resulted in a lack of immuno-detectable beta(1) integrin in focal adhesions on fibronectin; few beta(1) positive focal adhesions were observed in cells grown on tenascin. An anti-sense retroviral construct decreased endogenous levels of beta(1) integrin protein, and caused decreased attachment and spreading as well as sparse, disorganized focal adhesions. These data indicate that in vitro, both POM and CF have beta(1) integrins that interact with fibronectin and allow them to attach and spread, while tenascin is anti-adhesive. Further studies using both of these experimental paradigms will clarify whether these interactions also occur in vivo. PMID:11846443

  6. Maslinic Acid, a Triterpene from Olive, Affects the Antioxidant and Mitochondrial Status of B16F10 Melanoma Cells Grown under Stressful Conditions

    PubMed Central

    Mokhtari, Khalida; Rufino-Palomares, Eva E.; Pérez-Jiménez, Amalia; Reyes-Zurita, Fernando J.; Figuera, Celeny; García-Salguero, Leticia; Medina, Pedro P.; Peragón, Juan; Lupiáñez, José A.


    Maslinic acid (MA) is a natural compound whose structure corresponds to a pentacyclic triterpene. It is abundant in the cuticular lipid layer of olives. MA has many biological and therapeutic properties related to health, including antitumor, anti-inflammatory, antimicrobial, antiparasitic, antihypertensive, and antioxidant activities. However, no studies have been performed to understand the molecular mechanism induced by this compound in melanoma cancer. The objective of this study was to examine the effect of MA in melanoma (B16F10) cells grown in the presence or absence of fetal bovine serum (FBS). We performed cell proliferation measurements, and the reactive oxygen species (ROS) measurements using dihydrorhodamine 123 (DHR 123) and activities of catalase, glucose 6-phosphate dehydrogenase, glutathione S-transferase, and superoxide dismutase. These changes were corroborated by expression assays. FBS absence reduced cell viability decreasing IC50 values of MA. The DHR 123 data showed an increase in the ROS level in the absence of FBS. Furthermore, MA had an antioxidant effect at lower assayed levels measured as DHR and antioxidant defense. However, at higher dosages MA induced cellular damage by apoptosis as seen in the results obtained. PMID:26236377

  7. Comparison of surface proteins of Anaplasma marginale grown in tick cell culture, tick salivary glands, and cattle.


    Barbet, A F; Blentlinger, R; Yi, J; Lundgren, A M; Blouin, E F; Kocan, K M


    Anaplasma marginale, a tick-borne rickettsial pathogen of cattle, infects bovine erythrocytes, resulting in mild to severe hemolytic disease that causes economic losses in domestic livestock worldwide. Recently, the Virginia isolate of A. marginale was propagated in a continuous tick cell line, IDE8, derived from embryonic Ixodes scapularis. Development of A. marginale in cell culture was morphologically similar to that described previously in ticks. In order to evaluate the potential of the cell culture-derived organisms for use in future research or as an antigen for serologic tests and vaccines, the extent of structural conservation of the major surface proteins (MSPs) between the cell culture-derived A. marginale and the bovine erythrocytic stage, currently the source of A. marginale antigen, was determined. Structural conservation on the tick salivary-gland stage was also examined. Monoclonal and monospecific antisera against MSPs 1 through 5, initially characterized against erythrocyte stages, also reacted with A. marginale from cell culture and tick salivary glands. MSP1a among geographic A. marginale isolates is variable in size because of different numbers of a tandemly repeated 28- or 29-amino-acid peptide. The cell culture-derived A. marginale maintained the same-size MSP1a as that found on the Virginia isolate of A. marginale in bovine erythrocytes and tick salivary glands. Although differences were observed in the polymorphic MSP2 antigen between culture and salivary-gland stages, MSP2 did not appear to vary, by two-dimensional gel electrophoresis, during continuous passage in culture. These data show that MSPs of erythrocyte-stage A. marginale are present on culture stages and may be structurally conserved during continuous culture. The presence of all current candidate diagnostic and vaccine antigens suggests that in vitro cultures are a valuable source of rickettsiae for basic research and for the development of improved diagnostic reagents and vaccines against anaplasmosis. PMID:9864202

  8. GaInNAs/Ge (1.10/0.67?eV) double-junction solar cell grown by metalorganic chemical vapor deposition for high efficiency four-junction solar cell application

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaobin; Chen, Bingzhen; Pan, Xu; Wang, Lei; Ma, Difei; Zhang, Yang; Yang, Cuibai; Wang, Zhiyong


    GaInNAs materials with narrow bandgaps of 1.10?eV have been grown on a Ge substrate by metalorganic chemical vapor deposition to fabricate GaInNAs/Ge (1.10/0.67?eV) double-junction solar cells. We have studied the photovoltaic characteristics and the external quantum efficiencies of the double-junction cells with various annealing conditions and different GaInNAs base layer thicknesses. The best external quantum efficiency is obtained from the double-junction cell with a 1170?nm thick GaInNAs base layer annealed at 675 C for 30?min. Under AM1.5G illumination, the best double-junction cell has a short circuit current density (J SC) as 23.63 mA cm?2, which is dominated by the J SC of the GaInNAs subcell.

  9. Hap4p overexpression in glucose-grown Saccharomyces cerevisiae induces cells to enter a novel metabolic state

    PubMed Central

    Lascaris, Romeo; Bussemaker, Harmen J; Boorsma, Andr; Piper, Matt; van der Spek, Hans; Grivell, Les; Blom, Jolanda


    Background Metabolic and regulatory gene networks generally tend to be stable. However, we have recently shown that overexpression of the transcriptional activator Hap4p in yeast causes cells to move to a state characterized by increased respiratory activity. To understand why overexpression of HAP4 is able to override the signals that normally result in glucose repression of mitochondrial function, we analyzed in detail the changes that occur in these cells. Results Whole-genome expression profiling and fingerprinting of the regulatory activity network show that HAP4 overexpression provokes changes that also occur during the diauxic shift. Overexpression of HAP4, however, primarily acts on mitochondrial function and biogenesis. In fact, a number of nuclear genes encoding mitochondrial proteins are induced to a greater extent than in cells that have passed through a normal diauxic shift: in addition to genes required for mitochondrial energy conservation they include genes encoding mitochondrial ribosomal proteins. Conclusions We show that overproduction of a single nuclear transcription factor enables cells to move to a novel state that displays features typical of, but clearly not identical to, other derepressed states. PMID:12537548

  10. Bioactive metabolite production and stress-related hormones in Devil's claw cell suspension cultures grown in bioreactors.


    Georgiev, Milen; Ludwig-Mller, Jutta; Weber, Jost; Stancheva, Nina; Bley, Thomas


    In a previous report, we showed that cell cultures of Harpagophytum procumbens, a South African plant with high medicinal value, accumulate high amounts of anti-inflammatory phenylethanoid glycosides during cultivation in shake-flasks. The aim of the present study was to transfer the phenylethanoid biosynthetic process to a 3-L stirred tank reactor and a 1-L glass-column bioreactor (operated with pulsed aeration). We found that, with stepwise increases in aeration, the stirred tank reactor yielded similar productivities of verbascoside (the major phenylethanoid glycoside in the cells) to those reported for shake-flask cultures (55.68 vs. 54.78 mg verbascoside/L/day, respectively). Transfer in the pulse-aerated column reactor resulted in 165.42 mg verbascoside/L/day, one of the highest yields reported to date. Further, to evaluate the physiological status of the suspended cells in the bioreactors cultures, we examined their hormone levels and compared them to those of cells in shake-flask cultures. While indole-3-acetic acid levels did not differ significantly between the bioreactor and shake-flask cultures, there were considerable differences in their levels of abscisic, jasmonic, and salicylic acids. These results are discussed with respect to relative stress levels in the different cultivation systems. PMID:21104241

  11. Stem Cells Grown in Osteogenic Medium on PLGA, PLGA/HA, and Titanium Scaffolds for Surgical Applications

    PubMed Central

    Asti, Annalia; Gastaldi, Giulia; Dorati, Rossella; Saino, Enrica; Conti, Bice; Visai, Livia; Benazzo, Francesco


    Pluripotent adipose tissue-derived stem cells (hASCs) can differentiate into various mesodermal cell types such as osteoblasts, chondroblasts, and myoblasts. We isolated hASCs from subcutaneous adipose tissue during orthopaedic surgery and induced the osteogenic differentiation for 28 days on three different synthetic scaffolds such as polylactide-co-glycolide (PLGA), polylactide-co-glycolide/hydroxyapatite (PLGA/HA), and trabecular titanium scaffolds (Ti6Al4V). Pore size can influence certain criteria such as cell attachment, infiltration, and vascularization. The aim of this study was to investigate the performance of PLGA and PLGA/HA scaffolds with a higher porosity, ranging between 75% and 84%, with respect to Ti scaffolds but with smaller pore size, seeded with hASCs to develop a model that could be used in the treatment of bone defects and fractures. Osteogenesis was assessed by ELISA quantitation of extracellular matrix protein expression, von Kossa staining, X-ray microanalysis, and scanning electron microscopy. The higher amount of protein matrix on the Ti scaffold with respect to PLGA and PLGA/HA leads to the conclusion that not only the type of material but the structure significantly affects cell proliferation. PMID:21234383

  12. Biofilm-Grown Burkholderia cepacia Complex Cells Survive Antibiotic Treatment by Avoiding Production of Reactive Oxygen Species

    PubMed Central

    Van Acker, Heleen; Sass, Andrea; Bazzini, Silvia; De Roy, Karen; Udine, Claudia; Messiaen, Thomas; Riccardi, Giovanna; Boon, Nico; Nelis, Hans J.; Mahenthiralingam, Eshwar; Coenye, Tom


    The presence of persister cells has been proposed as a factor in biofilm resilience. In the present study we investigated whether persister cells are present in Burkholderia cepacia complex (Bcc) biofilms, what the molecular basis of antimicrobial tolerance in Bcc persisters is, and how persisters can be eradicated from Bcc biofilms. After treatment of Bcc biofilms with high concentrations of various antibiotics often a small subpopulation survived. To investigate the molecular mechanism of tolerance in this subpopulation, Burkholderia cenocepacia biofilms were treated with 1024 µg/ml of tobramycin. Using ROS-specific staining and flow cytometry, we showed that tobramycin increased ROS production in treated sessile cells. However, approximately 0.1% of all sessile cells survived the treatment. A transcriptome analysis showed that several genes from the tricarboxylic acid cycle and genes involved in the electron transport chain were downregulated. In contrast, genes from the glyoxylate shunt were upregulated. These data indicate that protection against ROS is important for the survival of persisters. To confirm this, we determined the number of persisters in biofilms formed by catalase mutants. The persister fraction in ΔkatA and ΔkatB biofilms was significantly reduced, confirming the role of ROS detoxification in persister survival. Pretreatment of B. cenocepacia biofilms with itaconate, an inhibitor of isocitrate lyase (ICL), the first enzyme in the glyoxylate shunt, reduced the persister fraction approx. 10-fold when the biofilms were subsequently treated with tobramycin. In conclusion, most Bcc biofilms contain a significant fraction of persisters that survive treatment with high doses of tobramycin. The surviving persister cells downregulate the TCA cycle to avoid production of ROS and at the same time activate an alternative pathway, the glyoxylate shunt. This pathway may present a novel target for combination therapy. PMID:23516582

  13. Thin, high quality GaInP compositionally graded buffer layers grown at high growth rates for metamorphic III-V solar cell applications

    NASA Astrophysics Data System (ADS)

    Garcia, I.; France, R. M.; Geisz, J. F.; Simon, J.


    The metamorphic growth of lattice-mismatched materials has allowed optimizing the bandgap combination in multijunction solar cells for the solar spectrum under consideration. Buffer structures are used to accommodate the lattice-mismatch by introducing dislocations and relaxing the material in a controlled way. However, the metamorphic buffers typically involve significant growth time and material usage, which increases the cost of these solar cells. In this work, the thinning of buffer structures with continuously, linearly graded misfit is addressed with the goal of increasing the cost-effectiveness of metamorphic multijunction solar cells. The relaxation dynamics and quality of the buffer layers analyzed were assessed by in-situ stress measurements and ex-situ measurements of residual strain, threading dislocation density and surface roughness. Their ultimate quality has been tested using these buffers as templates for the growth of 1 eV Ga0.73In0.27As solar cells. The deleterious effect of thinning the grade layer of these buffer structures from 2 to 1 ?m was investigated. It is shown that prompting the relaxation of the buffer by using a stepwise misfit jump at the beginning of the grade layer improves the quality of the thinned buffer structure. The residual threading dislocation density of the optimized thin buffers, grown at a high growth rate of 7 ?m/h, is 3106 cm-2, and solar cells on these buffers exhibit near-ideal carrier collection efficiency and a Voc of 0.62 V at 1-sun direct terrestrial spectrum.

  14. Neural Progenitor Cells Grown on Hydrogel Surfaces Respond to the product of the Transgene of Encapsulated Genetically Engineered Fibroblasts

    PubMed Central

    Shanbhag, Mihir S.; Lathia, Justin D.; Mughal, Mohamed R.; Francis, Nicola L.; Pashos, Nicholas; Mattson, Mark P.; Wheatley, Margaret A.


    Engineered tissue strategies for central nervous system (CNS) repair have the potential for localizing treatment using a wide variety of cells or growth factors. However, these strategies are often limited by their ability to address only one aspect of the injury. Here we report the development of a novel alginate construct that acts as a multi-functional tissue scaffold for CNS repair, and as a localized growth factor delivery vehicle. We show that the surface of this alginate construct acts as an optimal growth environment for neural progenitor cell (NPC) attachment, survival, migration, and differentiation. Importantly, we show that tailor-made alginate constructs containing brain-derived neurotrophic factor or neurotrophin-3 differentially direct lineage fates of NPCs and may therefore be useful in treating a wide variety of injuries. It is this potential for directed differentiation of a scaffold prior to implantation at the injury site that we explore here. PMID:20942395

  15. Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture

    NASA Technical Reports Server (NTRS)

    Gruener, Raphael; Hoeger, Glenn


    Cocultured Xenopus neurons and myocytes were subjected to nonvectorial gravity by clinostat rotation to determine the effects of microgravity on cell development and communications. Observed effects included increases in the myocyte and its nuclear area, fragmentation of nucleoli, the appearance of neuritic aneurysms, decreased growth in the presence of trophic factors, and decreased yolk utilization. These effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. It is found that, in microgravity, cell differentiation is altered by interference with cytoskeleton-related mechanisms. It is suggested that the alteration of the distribution of acetylcholine receptor aggregates on myocytes which occurs might indicate that microgravity affects brain development.

  16. Effect of Increasing Doses of ?-Radiation on Bone Marrow Stromal Cells Grown on Smooth and Rough Titanium Surfaces

    PubMed Central

    Huang, Bo; Guang, Mengkai; Ye, Jun; Gong, Ping; Tang, Hua


    Radiation therapy for oral and maxillofacial tumors could damage bone marrow stromal cells (BMSCs) in jaw, which caused dental implant failure. However, how radiation affects BMSCs on SLA (sandblasted with large-grits, acid-etched) surfaces is still unknown. The aim of this study was to investigate effect of different dose of ?-radiation on BMSCs on SLA and PT (polished titanium) surfaces. Rat BMSCs were radiated with 2, 4, and 8?Gy ?-radiation and then seeded on both surfaces. Cell adhesion, spreading, and proliferation were tested. The osteogenesis and the adipogenesis ability were examined by Alizarin-Red and Oil-Red staining, respectively. Real-time PCR was performed to detect osteogenic (osteocalcin, OCN; runt-related transcription factor 2, Runx2) and adipogenic (peroxisome proliferator-activated receptor gamma, PPAR?) gene expression at days 7 and 14 postirradiation. Results showed that ?-radiation reduced cell proliferation, adhesion, spreading, and osteogenic differentiation. 2?Gy radiation promoted adipogenic differentiation, but it was significantly decreased when dosage reached 4?Gy. In conclusion, results suggest that ?-radiation influenced BMSCs behaviors in a dosage-dependent manner except adipogenic differentiation, low dose promoted it, and high dose inhibited it. This effect was influenced by surface characteristics, which may explain the different failure rate of various implants in patients after radiation. PMID:26257788

  17. Reflectivity and topography of cells grown on glass-coverslips measured with phase-shifted laser feedback interference microscopy

    PubMed Central

    At?lgan, Erdin; Ovryn, Ben


    In spite of the advantages associated with the molecular specificity of fluorescence imaging, there is still a significant need to augment these approaches with label-free imaging. Therefore, we have implemented a form of interference microscopy based upon phase-shifted, laser-feedback interferometry and developed an algorithm that can be used to separate the contribution of the elastically scattered light by sub-cellular structures from the reflection at the coverslip-buffer interface. The method offers an opportunity to probe protein aggregation, index of refraction variations and structure. We measure the topography and reflection from calibration spheres and from stress fibers and adhesions in both fixed and motile cells. Unlike the data acquired with reflection interference contrast microscopy, where the reflection from adhesions can appear dark, our approach demonstrates that these regions have high reflectivity. The data acquired from fixed and live cells show the presence of a dense actin layer located ? 100 nm above the coverslip interface. Finally, the measured dynamics of filopodia and the lamella in a live cell supports retrograde flow as the dominate mechanism responsible for filopodia retraction. PMID:21833378

  18. Comparison of initial feasibility of host cell lines for viral vaccine production.


    Vlecken, Danielle H W; Pelgrim, Ralf P M; Ruminski, Slawomir; Bakker, Wilfried A M; van der Pol, Leo A


    In order to reduce the time required for the development and production of viral vaccines, host cell lines should be available as expression systems for production of viral vaccines against groups of viral pathogens. A selection of cell lines was compared for their initial feasibility as expression system for the replication of polioviruses, influenza A viruses and respiratory syncytial virus (wild type strain A2). Six adherent cell lines (Vero, HEK-293, MRC-5, CHO-K1, BHK-21 c13, MDCK) and six single cell suspension cell lines (CAP, AGE1.CR.HS, sCHO-K1, BHK-21 c13 2p, MDCK SFS) were studied for their ability to propagate viruses. First, maximum cell densities were determined. Second, virus receptor expression and polarization of the cell lines regarding receptor distribution of eight different viruses were monitored using flow cytometry and immunocytochemistry. Organization of the actin cytoskeleton was studied by transfection of the cells with Lifeact, a construct coding for actin-EGFP. Finally, the ability to produce virus progeny of the viruses studied was assayed for each cell line. The results suggest that single cell suspension cell lines grown on serum free medium are the best candidates to serve as host cell lines for virus replication. PMID:23684847

  19. Metformin Induces Apoptosis and Downregulates Pyruvate Kinase M2 in Breast Cancer Cells Only When Grown in Nutrient-Poor Conditions

    PubMed Central

    Silvestri, Alessandra; Palumbo, Francesco; Rasi, Ignazio; Posca, Daniela; Pavlidou, Theodora; Paoluzi, Serena; Castagnoli, Luisa; Cesareni, Giovanni


    Introduction Metformin is proposed as adjuvant therapy in cancer treatment because of its ability to limit cancer incidence by negatively modulating the PI3K/AKT/mTOR pathway. In vitro, in addition to inhibiting cancer cell proliferation, metformin can also induce apoptosis. The molecular mechanism underlying this second effect is still poorly characterized and published data are often contrasting. We investigated how nutrient availability can modulate metformin-induced apoptosis in three breast cancer cell lines. Material and Methods MCF7, SKBR3 and MDA-MB-231 cells were plated in MEM medium supplemented with increasing glucose concentrations or in DMEM medium and treated with 10 mM metformin. Cell viability was monitored by Trypan Blue assay and treatment effects on Akt/mTOR pathway and on apoptosis were analysed by Western Blot. Moreover, we determined the level of expression of pyruvate kinase M2 (PKM2), a well-known glycolytic enzyme expressed in cancer cells. Results Our results showed that metformin can induce apoptosis in breast cancer cells when cultured at physiological glucose concentrations and that the pro-apoptotic effect was completely abolished when cells were grown in high glucose/high amino acid medium. Induction of apoptosis was found to be dependent on AMPK activation but, at least partially, independent of TORC1 inactivation. Finally, we showed that, in nutrient-poor conditions, metformin was able to modulate the intracellular glycolytic equilibrium by downregulating PKM2 expression and that this mechanism was mediated by AMPK activation. Conclusion We demonstrated that metformin induces breast cancer cell apoptosis and PKM2 downregulation only in nutrient-poor conditions. Not only glucose levels but also amino acid concentration can influence the observed metformin inhibitory effect on the mTOR pathway as well as its pro-apoptotic effect. These data demonstrate that the reduction of nutrient supply in tumors can increase metformin efficacy and that modulation of PKM2 expression/activity could be a promising strategy to boost metformin anti-cancer effect. PMID:26291325

  20. GaInP/GaAs tandem solar cells with highly Te- and Mg-doped GaAs tunnel junctions grown by MBE

    NASA Astrophysics Data System (ADS)

    Zheng, Xin-He; Liu, San-Jie; Xia, Yu; Gan, Xing-Yuan; Wang, Hai-Xiao; Wang, Nai-Ming; Yang, Hui


    We report a GaInP/GaAs tandem solar cell with a novel GaAs tunnel junction (TJ) with using tellurium (Te) and magnesium (Mg) as n- and p-type dopants via dual-filament low temperature effusion cells grown by molecular beam epitaxy (MBE) at low temperature. The test Te/Mg-doped GaAs TJ shows a peak current density of 21 A/cm2. The tandem solar cell by the Te/Mg TJ shows a short-circuit current density of 12 mA/cm2, but a low open-circuit voltage range of 1.4 V1.71 V under AM1.5 illumination. The secondary ion mass spectroscopy (SIMS) analysis reveals that the Te doping is unexpectedly high and its doping profile extends to the Mg doping region, thus possibly resulting in a less abrupt junction with no tunneling carriers effectively. Furthermore, the tunneling interface shifts from the intended GaAs n++/p++ junction to the AlGaInP/GaAs junction with a higher bandgap AlGaInP tunneling layers, thereby reducing the tunneling peak. The Te concentration of 2.5 1020 in GaAs could cause a lattice strain of 10-3 in magnitude and thus a surface roughening, which also negatively influences the subsequent growth of the top subcell and the GaAs contacting layers. The doping features of Te and Mg are discussed to understand the photovoltaic response of the studied tandem cell. Project supported by the SINANO-SONY Joint Program (Grant No. Y1AAQ11001), the National Natural Science Foundation of China (Grant No. 61274134), the USCB Start-up Program (Grant No. 06105033), and the International Cooperation Projects of Suzhou City, China (Grant No. SH201215).

  1. Symbiodinium transcriptome and global responses of cells to immediate changes in light intensity when grown under autotrophic or mixotrophic conditions.


    Xiang, Tingting; Nelson, William; Rodriguez, Jesse; Tolleter, Dimitri; Grossman, Arthur R


    Symbiosis between unicellular dinoflagellates (genus Symbiodinium) and their cnidarian hosts (e.g. corals, sea anemones) is the foundation of coral reef ecosystems. Dysfunction of this symbiosis under changing environmental conditions has led to global reef decline. Little information is known about Symbiodinium gene expression and mechanisms by which light impacts host-symbiont associations. To address these issues, we generated a transcriptome from axenic Symbiodinium strain SSB01. Here we report features of the transcriptome, including occurrence and length distribution of spliced leader sequences, the functional landscape of encoded proteins and the impact of light on gene expression. Expression of many Symbiodinium genes appears to be significantly impacted by light. Transcript encoding cryptochrome 2 declined in high light while some transcripts for Regulators of Chromatin Condensation (RCC1) declined in the dark. We also identified a transcript encoding a light harvesting AcpPC protein with homology to Chlamydomonas LHCSR2. The level of this transcript increased in high light autotrophic conditions, suggesting that it is involved in photo-protection and the dissipation of excess absorbed light energy. The most extensive changes in transcript abundances occurred when the algae were transferred from low light to darkness. Interestingly, transcripts encoding several cell adhesion proteins rapidly declined following movement of cultures to the dark, which correlated with a dramatic change in cell surface morphology, likely reflecting the complexity of the extracellular matrix. Thus, light-sensitive cell adhesion proteins may play a role in establishing surface architecture, which may in turn alter interactions between the endosymbiont and its host. PMID:25664570

  2. Multi-stacked InAs/GaAs quantum dots grown with different growth modes for quantum dot solar cells

    SciTech Connect

    Kim, Yeongho; Ban, Keun-Yong Honsberg, Christiana B.


    We have studied the material properties and device performance of InAs/GaAs quantum dot solar cells (QDSCs) made using three different QD growth modes: Stranski-Krastanov (S-K), quasi-monolayer (QML), and sub-monolayer (SML) growth modes. All QDSCs show an extended external quantum efficiency (EQE) at near infrared wavelengths of 950–1070 nm from the QD absorption. Compared to the S-K and SML QDSCs, the QML QDSC with a higher strain exhibits a poor EQE response in the wavelength region of 300–880 nm due to increased non-radiative recombination. The conversion efficiency of the S-K and SML QDSCs exceeds that of the reference cell (13.4%) without QDs due to an enhanced photocurrent (>16% increase) produced by the silicon doped QD stacks. However, as expected from the EQE of the QML QDSC, the increase of strain-induced crystalline defects greatly degrades the photocurrent and open-circuit voltage, leading to the lowest conversion efficiency (8.9%)

  3. Multi-stacked InAs/GaAs quantum dots grown with different growth modes for quantum dot solar cells

    NASA Astrophysics Data System (ADS)

    Kim, Yeongho; Ban, Keun-Yong; Honsberg, Christiana B.


    We have studied the material properties and device performance of InAs/GaAs quantum dot solar cells (QDSCs) made using three different QD growth modes: Stranski-Krastanov (S-K), quasi-monolayer (QML), and sub-monolayer (SML) growth modes. All QDSCs show an extended external quantum efficiency (EQE) at near infrared wavelengths of 950-1070 nm from the QD absorption. Compared to the S-K and SML QDSCs, the QML QDSC with a higher strain exhibits a poor EQE response in the wavelength region of 300-880 nm due to increased non-radiative recombination. The conversion efficiency of the S-K and SML QDSCs exceeds that of the reference cell (13.4%) without QDs due to an enhanced photocurrent (>16% increase) produced by the silicon doped QD stacks. However, as expected from the EQE of the QML QDSC, the increase of strain-induced crystalline defects greatly degrades the photocurrent and open-circuit voltage, leading to the lowest conversion efficiency (8.9%).

  4. Adenosine accelerates the healing of diabetic ischemic ulcers by improving autophagy of endothelial progenitor cells grown on a biomaterial

    PubMed Central

    Chen, Wen; Wu, Yangxiao; Li, Li; Yang, Mingcan; Shen, Lei; Liu, Ge; Tan, Ju; Zeng, Wen; Zhu, Chuhong


    Endothelial progenitor cells (EPCs) seeded on biomaterials can effectively promote diabetic ischemic wound healing. However, the function of transplanted EPCs is negatively affected by a high-glucose and ischemic microenvironment. Our experiments showed that EPC autophagy was inhibited and mitochondrial membrane potential (MMP) was increased in diabetic patients, while adenosine treatment decreased the energy requirements and increased the autophagy levels of EPCs. In animal experiments, we transplanted a biomaterial seeded with EPCs onto the surface of diabetic wounds and found that adenosine-stimulated EPCs effectively promoted wound healing. Increased microvascular genesis and survival of the transplanted cells were also observed in the adenosine-stimulated groups. Interestingly, our study showed that adenosine increased the autophagy of the transplanted EPCs seeded onto the biomaterial and maintained EPC survival at 48 and 96?hours. Moreover, we observed that adenosine induced EPC differentiation through increasing the level of autophagy. In conclusion, our study indicated that adenosine-stimulated EPCs seeded onto a biomaterial significantly improved wound healing in diabetic mice; mechanistically, adenosine might maintain EPC survival and differentiation by increasing high glucose-inhibited EPC autophagy and maintaining cellular energy metabolism. PMID:26108983

  5. ALD grown bilayer junction of ZnO:Al and tunnel oxide barrier for SIS solar cell?

    PubMed Central

    Bethge, O.; Nobile, M.; Abermann, S.; Glaser, M.; Bertagnolli, E.


    Various metal oxides are probed as extrinsic thin tunnel barriers in Semiconductor Insulator Semiconductor solar cells. Namely Al2O3, ZrO2, Y2O3, and La2O3 thin films are in between n-type ZnO:Al (AZO) and p-type Si substrates by means of Atomic Layer Deposition. Low reverse dark currentdensity as low as 310?7A/cm2, a fill factor up to 71.3%, and open-circuit voltage as high as 527mV are obtained, achieving conversion efficiency of 8% for the rare earth oxide La2O3. ZrO2 and notably Al2O3 show drawbacks in performance suggesting an adverse reactivity with AZO as also indicated by X-ray Photoelectron Spectroscopy.

  6. Scanning electron microscopic observation on cells grown in vitro. VI. aggregate formation in confrontation cultures of human diploid and tumor cells.


    Gerstberger, R; Paweletz, N


    Two human cell lines, HeLa carcinoma cells and Wi38 lung fibroblasts have been used in confrontation experiments to study different adhesion processes including cellular motility, sorting out and invasion by SEM and statistics. Aggregates of one cell type were co-cultured with resuspended cells of the other type for up to 96 hours and vice versa. Homotypic aggregation kinetics as a control showed a saturation of the time-dependent increase in aggregate diameter and a mirror-like decrease in single cell number for both cell lines. In the heterotypic aggregation process, dissociated HeLa cells covered the surface of Wi38 aggregates without showing any particular distribution pattern. They partially penetrated the outer fibroblast layers and invasive actions were detected. Suspended Wi38 lung cells also adhered to the tumor cell aggregates. After a period of non-coordinated, random settlement (8 to 18 h or co-cultivation), the fibroblasts sorted out to form a network around the tumor aggregates in the form of sheets of cells arranged in parallel. The underlying HeLa cells then broke through the Wi38 layers, thus performing an inside-out invasion. Finally, all the aggregates were again covered by HeLa cells. PMID:7327174

  7. InGaAs/GaAsP strain balanced multi-quantum wires grown on misoriented GaAs substrates for high efficiency solar cells

    NASA Astrophysics Data System (ADS)

    Alonso-lvarez, D.; Thomas, T.; Fhrer, M.; Hylton, N. P.; Ekins-Daukes, N. J.; Lackner, D.; Philipps, S. P.; Bett, A. W.; Sodabanlu, H.; Fujii, H.; Watanabe, K.; Sugiyama, M.; Nasi, L.; Campanini, M.


    Quantum wires (QWRs) form naturally when growing strain balanced InGaAs/GaAsP multi-quantum wells (MQW) on GaAs [100] 6 misoriented substrates under the usual growth conditions. The presence of wires instead of wells could have several unexpected consequences for the performance of the MQW solar cells, both positive and negative, that need to be assessed to achieve high conversion efficiencies. In this letter, we study QWR properties from the point of view of their performance as solar cells by means of transmission electron microscopy, time resolved photoluminescence and external quantum efficiency (EQE) using polarised light. We find that these QWRs have longer lifetimes than nominally identical QWs grown on exact [100] GaAs substrates, of up to 1 ?s, at any level of illumination. We attribute this effect to an asymmetric carrier escape from the nanostructures leading to a strong 1D-photo-charging, keeping electrons confined along the wire and holes in the barriers. In principle, these extended lifetimes could be exploited to enhance carrier collection and reduce dark current losses. Light absorption by these QWRs is 1.6 times weaker than QWs, as revealed by EQE measurements, which emphasises the need for more layers of nanostructures or the use light trapping techniques. Contrary to what we expected, QWR show very low absorption anisotropy, only 3.5%, which was the main drawback a priori of this nanostructure. We attribute this to a reduced lateral confinement inside the wires. These results encourage further study and optimization of QWRs for high efficiency solar cells.

  8. InGaAs/GaAsP strain balanced multi-quantum wires grown on misoriented GaAs substrates for high efficiency solar cells

    SciTech Connect

    Alonso-lvarez, D.; Thomas, T.; Fhrer, M.; Hylton, N. P.; Ekins-Daukes, N. J.; Lackner, D.; Philipps, S. P.; Bett, A. W.; Sodabanlu, H.; Fujii, H.; Watanabe, K.; Sugiyama, M.; Nasi, L.; Campanini, M.


    Quantum wires (QWRs) form naturally when growing strain balanced InGaAs/GaAsP multi-quantum wells (MQW) on GaAs [100] 6 misoriented substrates under the usual growth conditions. The presence of wires instead of wells could have several unexpected consequences for the performance of the MQW solar cells, both positive and negative, that need to be assessed to achieve high conversion efficiencies. In this letter, we study QWR properties from the point of view of their performance as solar cells by means of transmission electron microscopy, time resolved photoluminescence and external quantum efficiency (EQE) using polarised light. We find that these QWRs have longer lifetimes than nominally identical QWs grown on exact [100] GaAs substrates, of up to 1??s, at any level of illumination. We attribute this effect to an asymmetric carrier escape from the nanostructures leading to a strong 1D-photo-charging, keeping electrons confined along the wire and holes in the barriers. In principle, these extended lifetimes could be exploited to enhance carrier collection and reduce dark current losses. Light absorption by these QWRs is 1.6 times weaker than QWs, as revealed by EQE measurements, which emphasises the need for more layers of nanostructures or the use light trapping techniques. Contrary to what we expected, QWR show very low absorption anisotropy, only 3.5%, which was the main drawback a priori of this nanostructure. We attribute this to a reduced lateral confinement inside the wires. These results encourage further study and optimization of QWRs for high efficiency solar cells.

  9. Regulation of Cell Division, Biofilm Formation, and Virulence by FlhC in Escherichia coli O157:H7 Grown on Meat▿†

    PubMed Central

    Sule, Preeti; Horne, Shelley M.; Logue, Catherine M.; Prüß, Birgit M.


    To understand the continuous problems that Escherichia coli O157:H7 causes as food pathogen, this study assessed global gene regulation in bacteria growing on meat. Since FlhD/FlhC of E. coli K-12 laboratory strains was previously established as a major control point in transducing signals from the environment to several cellular processes, this study compared the expression pattern of an E. coli O157:H7 parent strain to that of its isogenic flhC mutant. This was done with bacteria that had been grown on meat. Microarray experiments revealed 287 putative targets of FlhC. Real-time PCR was performed as an alternative estimate of transcription and confirmed microarray data for 13 out of 15 genes tested (87%). The confirmed genes are representative of cellular functions, such as central metabolism, cell division, biofilm formation, and pathogenicity. An additional 13 genes from the same cellular functions that had not been hypothesized as being regulated by FlhC by the microarray experiment were tested with real-time PCR and also exhibited higher expression levels in the flhC mutant than in the parent strain. Physiological experiments were performed and confirmed that FlhC reduced the cell division rate, the amount of biofilm biomass, and pathogenicity in a chicken embryo lethality model. Altogether, this study provides valuable insight into the complex regulatory network of the pathogen that enables its survival under various environmental conditions. This information may be used to develop strategies that could be used to reduce the number of cells or pathogenicity of E. coli O157:H7 on meat by interfering with the signal transduction pathways. PMID:21498760

  10. Inhibition of vimentin or B1 integrin reverts morphology of prostate tumor cells grown in laminin-rich extracellular matrix gels and reduces tumor growth in vivo

    SciTech Connect

    Zhang, Xueping; Fournier, Marcia V; Ware, Joy L; Bissell, Mina J; Yacoub, Adly; Zehner, Zendra E


    Prostate epithelial cells grown embedded in laminin-rich extracellular matrix (lrECM) undergo morphologic changes that closely resemble their architecture in vivo. In this study, growth characteristics of three human prostate epithelial sublines derived from the same cellular lineage, but displaying different tumorigenic and metastatic properties in vivo, were assessed in three-dimensional lrECM gels. M12, a highly tumorigenic and metastatic subline, was derived from the immortalized, prostate epithelial P69 cell line by selection in athymic, nude mice and found to contain a deletion of 19p-q13.1. The stable reintroduction of an intact human chromosome 19 into M12 resulted in a poorly tumorigenic subline, designated F6. When embedded in lrECM gels, the parental, nontumorigenic P69 line produced acini with clearly defined lumena. Immunostaining with antibodies to {beta}-catenin, E-cadherin, or {alpha}6 and {beta}1 integrins showed polarization typical of glandular epithelium. In contrast, the metastatic M12 subline produced highly disorganized cells with no evidence of polarization. The F6 subline reverted to acini-like structures exhibiting basal polarity marked with integrins. Reducing either vimentin levels via small interfering RNA interference or the expression of {alpha}6 and {beta}1 integrins by the addition of blocking antibodies, reorganized the M12 subline into forming polarized acini. The loss of vimentin significantly reduced M12-Vim tumor growth when assessed by s.c. injection in athymic mice. Thus, tumorigenicity in vivo correlated with disorganized growth in three-dimensional lrECM gels. These studies suggest that the levels of vimentin and {beta}1 integrin play a key role in the homeostasis of the normal acinus in prostate and that their dysregulation may lead to tumorigenesis. [Mol Cancer Ther 2009;8(3):499-508].

  11. Uptake of cadmium by rice grown on contaminated soils and its bioavailability/toxicity in human cell lines (Caco-2/HL-7702).


    Aziz, Rukhsanda; Rafiq, Muhammad Tariq; Li, Tingqiang; Liu, Di; He, Zhenli; Stoffella, P J; Sun, Kewang; Xiaoe, Yang


    Cadmium (Cd) enters the food chain from polluted soils via contaminated cereals and vegetables; therefore, an understanding of Cd bioaccessibility, bioavailability, and toxicity in humans through rice grain is needed. This study assessed the Cd bioaccessibility, bioavailability, and toxicity to humans from rice grown on Cd-contaminated soils using an in vitro digestion method combined with a Caco-2/HL-7702 cell model. Cadmium bioaccessibility (18.45-30.41%) and bioavailability (4.04-8.62%) were found to be significantly higher in yellow soil (YS) rice than calcareous soil (CS) rice with the corresponding values of 6.89-11.43 and 1.77-2.25%, respectively. Toxicity assays showed an initial toxicity in YS rice at 6 mg kg(-1) Cd, whereas CS rice did not show any significant change due to low Cd concentrations. The acidic soils of Cd-contaminated areas can contribute to a higher dietary intake of Cd. Therefore, it is imperative to monitor Cd concentration in rice to minimize human health risk. PMID:25738308

  12. Graphene grown on stainless steel as a high-performance and ecofriendly anti-corrosion coating for polymer electrolyte membrane fuel cell bipolar plates

    NASA Astrophysics Data System (ADS)

    Pu, Nen-Wen; Shi, Gia-Nan; Liu, Yih-Ming; Sun, Xueliang; Chang, Jeng-Kuei; Sun, Chia-Liang; Ger, Ming-Der; Chen, Chun-Yu; Wang, Po-Chiang; Peng, You-Yu; Wu, Chia-Hung; Lawes, Stephen


    In this study, the growth of graphene by chemical vapor deposition (CVD) on SUS304 stainless steel and on a catalyzing Ni/SUS304 double-layered structure was investigated. The results indicated that a thin and multilayered graphene film can be continuously grown across the metal grain boundaries of the Ni/SUS304 stainless steel and significantly enhance its corrosion resistance. A 3.5 wt% saline polarization test demonstrated that the corrosion currents in graphene-covered SUS304 were improved fivefold relative to the corrosion currents in non-graphene-covered SUS304. In addition to enhancing the corrosion resistance of stainless steel, a graphene coating also ameliorates another shortcoming of stainless steel in a corrosive environment: the formation of a passive oxidation layer on the stainless steel surface that decreases conductivity. After a corrosion test, the graphene-covered stainless steel continued to exhibit not only an excellent low interfacial contact resistance (ICR) of 36 m? cm2 but also outstanding drainage characteristics. The above results suggest that an extremely thin, lightweight protective coating of graphene on stainless steel can act as the next-generation bipolar plates of fuel cells.

  13. Effect of passivation layer grown by atomic layer deposition and sputtering processes on Si quantum dot superlattice to generate high photocurrent for high-efficiency solar cells

    NASA Astrophysics Data System (ADS)

    Maksudur Rahman, Mohammad; Higo, Akio; Sekhar, Halubai; Erman Syazwan, Mohd; Hoshi, Yusuke; Usami, Noritaka; Samukawa, Seiji


    The effect of passivation films on a Si quantum dot superlattice (QDSL) was investigated to generate high photocurrent in solar-cell applications. Three types of passivation films, sputter-grown amorphous silicon carbide (a-SiC), hydrogenated a-SiC (a-SiC:H), and atomic-layer-deposited aluminum oxide (ALD-Al2O3), were used to passivate the Si QDSLs containing a stack of four 4 nm Si nanodisks (NDs) and 2 nm silicon carbide (SiC) films fabricated by neutral beam etching (NBE). Because of the high surface-to-volume ratio typically present in quantum Si-NDs formed in the top-down NBE process, there is a tendency to form larger surface dangling bonds on untreated Si-ND surfaces as well as to have short distance (<10 nm) between high-aspect-ratio nanopillars of stacked 4 nm Si-NDs/2 nm SiC films, which conventionally sputter SiC films cannot uniformly cover. Therefore, we optimized the passivation techniques with an ALD-Al2O3 film. Scanning electron microscopy (SEM) analysis helped to explain the surface morphology before and after the passivation of the QDSLs. After the completion of the passivation process, the quality of the top surface films of the QDSLs was analyzed from the surface roughness by atomic force microscopy (AFM) analysis, which revealed that ALD-Al2O3 passivated films had the smallest roughness (RMS) of 1.09 nm with respect to sputter-grown a-SiC (RMS: 1.75 nm) and a-SiC:H (RMS: 1.54 nm) films. Conductive atomic force microscopy (CAFM) revealed that ALD-Al2O3 passivation decreased the surface-leakage current as a result of proper passivation of side-wall surface defects in the QDSLs. The carrier transport characteristics were extracted from the QDSLs using the photovoltaic (PV) properties of p++/i/n+ solar cells, where the QDSLs consisted of different passivation layers acting as intermediate layers (i-layers) between the high-doping-density p++ Si (1 × 1020 cm‑3) and n+ Si (1 × 1019 cm‑3) substrates. High-doping-density p++ Si acted as a hole conductor instead of a photocarrier generator, hence, we could observe the PV properties of the i-layers. The highest short-circuit current density of 4.75 mA cm‑2 was generated from the QDSL with the ALD-Al2O3-passivated surface, which is suitable for high-efficiency QD solar cells compared with a-SiC-passivated (0.04 mA cm‑2) and a-SiC:H-passivated (0.37 mA cm‑2) QDSL surfaces.

  14. SU-E-J-156: Preclinical Inverstigation of Dynamic Tumor Tracking Using Vero SBRT Linear Accelerator: Motion Phantom Dosimetry Study

    SciTech Connect

    Mamalui-Hunter, M; Wu, J; Li, Z; Su, Z


    Purpose: Following the ‘end-to-end testing’ paradigm of Dynamic Target Tracking option in our Image-Guided dedicated SBRT VeroTM linac, we verify the capability of the system to deliver planned dose to moving targets in the heterogeneous thorax phantom (CIRSTM). The system includes gimbaled C-band linac head, robotic 6 degree of freedom couch and a tumor tracking method based on predictive modeling of target position using fluoroscopically tracked implanted markers and optically tracked infrared reflecting external markers. Methods: 4DCT scan of the motion phantom with the VisicoilTM implanted marker in the close vicinity of the target was acquired, the ‘exhale’=most prevalent phase was used for planning (iPlan by BrainLabTM). Typical 3D conformal SBRT treatment plans aimed to deliver 6-8Gy/fx to two types of targets: a)solid water-equivalent target 3cm in diameter; b)single VisicoilTM marker inserted within lung equivalent material. The planning GTV/CTV-to-PTV margins were 2mm, the block margins were 3 mm. The dose calculated by MonteCarlo algorithm with 1% variance using option Dose-to-water was compared to the ion chamber (CC01 by IBA Dosimetry) measurements in case (a) and GafchromicTM EBT3 film measurements in case (b). During delivery, the target 6 motion patterns available as a standard on CIRSTM motion phantom were investigated: in case (a), the target was moving along the designated sine or cosine4 3D trajectory; in case (b), the inserted marker was moving sinusoidally in 1D. Results: The ion chamber measurements have shown the agreement with the planned dose within 1% under all the studied motion conditions. The film measurements show 98.1% agreement with the planar calculated dose (gamma criteria: 3%/3mm). Conclusion: We successfully verified the capability of the SBRT VeroTM linac to perform real-time tumor tracking and accurate dose delivery to the target, based on predictive modeling of the correlation between implanted marker motion and external surrogate of breathing motion.

  15. Video of Tissue Grown in Space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    Principal investigator Leland Chung grew prostate cancer and bone stromal cells aboard the Space Shuttle Columbia during the STS-107 mission. Although the experiment samples were lost along with the ill-fated spacecraft and crew, he did obtain downlinked video of the experiment that indicates the enormous potential of growing tissues in microgravity. Cells grown aboard Columbia had grown far larger tissue aggregates at day 5 than did the cells grown in a NASA bioreactor on the ground.

  16. A foodborne outbreak of Vero cytotoxin-producing Escherichia coli O157:H-phage type 8 in hospital.


    O'Brien, S J; Murdoch, P S; Riley, A H; King, I; Barr, M; Murdoch, S; Greig, A; Main, R; Reilly, W J; Thomson-Carter, F M


    This paper describes the epidemiological and microbiological aspects of the largest outbreak of Vero cytotoxin-producing Escherichia coli O157 (VTEC O157) infection in a hospital setting in which the route of transmission was foodborne. The outbreak, which was caused by a relatively uncommon phage type of VTEC O157, occurred in four geriatric continuing care wards in May 1997. The total number of people found to be excreting the organism was 37, of whom 16 were inpatients and 11 were staff. Twelve people displayed enteric symptoms. In addition, all but two of 10 cases identified in the local community were thought to be associated with the outbreak. An epidemiological investigation amongst the hospital patients revealed a statistically significant association between VTEC O157 infection and attendance at a concert party on the continuing care wards on 17 May 1997 (relative risk = 3.22;P= 0.006). There was an even stronger relationship between consumption of home-baked cream-filled cakes brought to that party and evidence of infection (relative risk = 19.35;P= 0.00002). Further investigations in the local community, coupled with microbiological evidence, supported the epidemiological finding that homemade cream cakes brought into the hospital were the vehicle of infection for the outbreak. There was no secondary spread within the hospital. The outbreak serves as a reminder of the hazard posed by foodstuffs brought into a hospital from outside. PMID:11716633

  17. Optical and electrical characterization of CdS-Glycine thin films with ammonia free buffer grown at different temperatures for solar cells applications

    NASA Astrophysics Data System (ADS)

    Berman-Mendoza, D.; Quiñones-Urías, D.; Ferra-González, S.; Vera-Marquina, A.; Rojas-Hernández, A.; Gómez Fuentes, R.; García-Juárez, A.; Leal-Cruz, A. L.; Ramos-Carrasco, A.


    In this work we report the fabrication and electro-optical characterization of CdS thin films using glycine as complexing agent with ammonia and ammonia free buffer by the Chemical Bath Deposition (CBD) method. The CdS thin films were grown at different temperatures of 50, 60, 70 and 80 °C in a thermal water bath. The morphology of these films was determined using atomic force microscopy; the resultant films were homogeneous, well adhered to the substrate, and specularly reflecting with a varying color depending on the deposition temperature. Transmittance and reflectance measurements of thermally treated CdS films were carried to study the effect of the ammonia buffer on its optical properties and bandgap. The crystallinity of the CdS thin films was determined by means of X Ray diffraction measurements. Therefore, for this study, an ammonia-free complexing agent has been taken for the deposition of CdS. Among different methods, which are being used for the preparation of CdS films, Chemical Bath Deposition (CBD) is the most attractive due to its low cost, easy to handle and large possibilities regarding doping and deposition on various substrates. In particular it can be used to easily obtain field effect devices by depositing CdS thin films over a SiO2/Si substrate. Heterostructures with interesting physical properties can be imagined, realized and tested in this way.. Structures CdS/PbS also were realized and have shown good solar cell characteristics.

  18. Room-temperature wafer bonded InGaP/GaAs//InGaAsP/InGaAs four-junction solar cell grown by all-solid state molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Dai, Pan; Lu, Shulong; Uchida, Shiro; Ji, Lian; Wu, Yuanyuan; Tan, Ming; Bian, Lifeng; Yang, Hui


    An InGaP/GaAs tandem cell on a GaAs substrate and an InGaAsP/InGaAs tandem cell on an InP substrate were grown separately by all-solid-state molecular beam epitaxy. A room-temperature direct wafer-bonding technique was used to integrate these subcells into an InGaP/GaAs//InGaAsP/InGaAs wafer-bonded solar cell, which resulted in an abrupt interface with low resistance and high optical transmission. The current-matching design for the base layer thickness of each cell was investigated. The resulting efficiency of the four-junction solar cell was 42.0% at 230 suns, which demonstrates the great potential of the room-temperature wafer-bonding technique to achieve high conversion efficiency for cells with four or more junctions.

  19. Catalase Activity of Psychrophilic Bacteria Grown at 2 and 30 C1

    PubMed Central

    Frank, Hilmer A.; Ishibashi, Sandra T.; Reid, Ann; Ito, June S.


    Catalase activity was measured in resting-cell suspensions of psychrophilic bacteria grown at 2 and at 30 C. Enzyme activity decreased in both cell-suspension types as harvest age increased. At comparable physiological age, cells grown at 2 C had more catalase than cells grown at 30 C. PMID:13959237

  20. Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based ?-evaluation and dose-area-histograms.


    Sothmann, T; Blanck, O; Poels, K; Werner, R; Gauer, T


    The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), ?-passing rates inside the CTV (?-criteria of 1% / 1?mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. ?-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between??+1.5 Gy to??+6.0 Gy (CyberKnife:??+0.5 Gy to??+3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were??-1.0?mm to??+0.7?mm (lateral) /-0.6?mm to??+0.1?mm (superior-inferior) for CyberKnife and??-0.8?mm to??+0.2?mm /-0.8?mm to??+0.4?mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA ?-criteria of 3% / 3?mm. PMID:26836488

  1. Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based γ-evaluation and dose-area-histograms

    NASA Astrophysics Data System (ADS)

    Sothmann, T.; Blanck, O.; Poels, K.; Werner, R.; Gauer, T.


    The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between  +1.5 Gy to  +6.0 Gy (CyberKnife:  +0.5 Gy to  +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were  ‑1.0 mm to  +0.7 mm (lateral) /‑0.6 mm to  +0.1 mm (superior–inferior) for CyberKnife and  ‑0.8 mm to  +0.2 mm /‑0.8 mm to  +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm.

  2. Evaluation of Cytotoxicity and Cell Death Induced In Vitro by Saxitoxin in Mammalian Cells.


    Melegari, Silvia P; de Carvalho Pinto, Ctia R S; Moukha, Serge; Creppy, Edmond E; Matias, William G


    Since the cyanotoxin saxitoxin (STX) is a neurotoxin and induces ecological changes in aquatic environments, a potential risk to public and environmental health exists. However, data on STX-mediated cytotoxic and genotoxic effects are still scare. In order to gain a better understanding of the effects of this toxin, the cytotoxic and genotoxic potential of STX was examined in two mammalian cell lines. Neuro 2A (N2A), a neuroblastoma mouse cell line, and Vero cell line, derived from Vero green monkey kidney cells, were exposed to several concentrations of STX ranging from 0.5 to 64 nM to determine cell viability, induction of apoptosis (DNA fragmentation assay), and formation of micronuclei (MN) (cytokinesis-block micronucleus assay; CBMN) following 24 h of incubation. The half maximal effective concentration (EC50) values for STX calculated in cell viability tests were 1.01 nM for N2A and 0.82 nM for Vero cells. With increasing STX concentration there was evidence of DNA fragmentation indicating apoptosis induction in Vero cells with a 50% increase in DNA fragmentation compared to control at the highest STX concentration tested (3 nM). The results demonstrated no significant changes in the frequency of micronucleated binucleated cells in N2A and Vero cells exposed to STX, indicating the absence of genotoxicity under these test conditions. There was no apparent cellular necrosis as evidenced by a lack of formation of multinucleated cells. In conclusion, data reported herein demonstrate that STX produced death of both cell types tested through an apoptotic process. PMID:26436995

  3. Investigation of anodic and chemical oxides grown on p-type InP with applications to surface passivation for n(+)-p solar cell fabrication

    NASA Technical Reports Server (NTRS)

    Faur, Maria; Faur, Mircea; Goradia, Manju; Goradia, Chandra; Jenkins, Phillip; Jayne, Douglas; Weinberg, Irving


    Most of the previously reported InP anodic oxides were grown on a n-type InP with applications to fabrication of MISFET structures and were described as a mixture of In2O3 and P2O5 stoichiometric compounds or nonstoichiometric phases which have properties similar to crystalline compounds In(OH)3, InPO4, and In(PO3)3. Details of the compositional change of the anodic oxides grown under different anodization conditions were previously reported. The use of P-rich oxides grown either by anodic or chemical oxidation are investigated for surface passivation of p-type InP and as a protective cap during junction formation by closed-ampoule sulfur diffusion. The investigation is based on but not limited to correlations between PL intensity and X-ray photoelectron spectroscopy (XPS) chemical composition data.

  4. The role of cell culture vaccines in the control of the next influenza pandemic.


    Audsley, J M; Tannock, G A


    Pandemic influenza A viruses of avian origin are of particular concern and have crossed the species barrier several times in recent years, giving rise to illness and occasionally death in humans. This situation could become dramatically worse if the infectivity of avian viruses for humans were increased by reassortment between the genes of human and avian viruses. Co-infection of humans or an intermediate host with an avian strain and an existing human strain could produce new viruses of unknown pathogenicity to which the entire population would be susceptible. Inactivated vaccines against influenza have been prepared for many years using viruses grown in embryonated chicken eggs. However, the use of eggs presents difficulties when vaccine supplies need to be expanded at short notice. It seems likely that future vaccines will be prepared in high-yielding cell cultures from continuous lines that are preferably anchorage-independent. At present, only certain preparations of the Vero and Madin-Darby canine kidney cell lines, grown and maintained in serum-free medium, are acceptable to all regulatory authorities. However, this situation is likely to change with increasing need for non-pandemic and pandemic vaccines. PMID:15155162

  5. Investigation of H2/CH4 mixed gas plasma post-etching process for ZnO:B front contacts grown by LP-MOCVD method in silicon-based thin-film solar cells

    NASA Astrophysics Data System (ADS)

    Wang, Li; Zhang, Xiaodan; Zhao, Ying; Yamada, Takuto; Naito, Yusuke


    A new plasma post-etching method, H2/CH4 mixed gas plasma, is introduced to modify ZnO:B films grown by LP-MOCVD technique, successfully relaxing the double trade-offs, i.e., transparency/conductivity trade-off and surface texture/Voc and FF trade-off. To deeply evaluate the post-etching process, optical emission spectroscopy technique is applied to diagnose the plasma condition. Upon different etching power, three distinct possible etching mechanisms are identified by analyzing the evolution of H?*, H?*, CH* emission species in the plasma space. It is demonstrated that H?* and CH* species are responsible for the physical etching process and chemical etching process, respectively, from which a new soft surface morphology is formed with a combination of micro- and nano-sized texture. Additionally, H?* species can bond with ZnO and also passivate the grains boundaries, thereby making both the carrier concentration and hall mobility increase. This process is defined as chemical bonding process. Finally, pin-type a-Si:H single-junction solar cells with an optimized device structure is grown on the etched ZnO:B substrate. The corresponding electrical parameters, such as Jsc, Voc and FF, are simultaneously improved compared with the solar cell deposited on as-grown ZnO:B substrate with the same fabrication process. As a consequence, a noteworthy 8.85% conversion-efficiency is achieved with an absorber layer thickness only 160 nm.

  6. Protein, free amino acid, phenloic, ß-carotene, and lycopene content, and antioxidative and cancer cell inhibitory effects of 12 greenhouse-grown commercial cherry tomato varieties

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The content of water, free amino acids, amino acid metabolites, crude protein, the carotene pigments ß-carotene and lycopene, and 9 characterized and 2 incompletely characterized individual phenolic (flavonoid) compounds of 12 greenhouse-grown cherry tomato varieties of various colors (green, yellow...

  7. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin (AF)-producing fungi contaminate food and feed during preharvest, storage and processing periods. Once consumed, AF accumulates in tissues, causing illnesses in animals and humans. At least 20 different types of AFs have been identified, and of these, aflatoxin B1 (AFB1) is the most ubiqui...

  8. A Vero Cell Based Fluorescence Assay to Assess Relative Toxicities of Shiga Toxin 2 Subtypes from Escherichia coli

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Shiga toxin-producing Escherichia coli is a leading cause worldwide of human gastroenteritis from food and waterborne sources. Shiga toxins 1 and 2 are important virulence factors linked to severe human illness. In particular, Shiga toxin 2 is composed of a diverse and heterogeneous group of subty...

  9. Virological and Serological Findings in Rousettus aegyptiacus Experimentally Inoculated with Vero Cells-Adapted Hogan Strain of Marburg Virus

    PubMed Central

    Paweska, Janusz T.; Jansen van Vuren, Petrus; Masumu, Justin; Leman, Patricia A.; Grobbelaar, Antoinette A.; Birkhead, Monica; Clift, Sarah; Swanepoel, Robert; Kemp, Alan


    The Egyptian fruit bat, Rousettus aegyptiacus, is currently regarded as a potential reservoir host for Marburg virus (MARV). However, the modes of transmission, the level of viral replication, tissue tropism and viral shedding pattern remains to be described. Captive-bred R. aegyptiacus, including adult males, females and pups were exposed to MARV by different inoculation routes. Blood, tissues, feces and urine from 9 bats inoculated by combination of nasal and oral routes were all negative for the virus and ELISA IgG antibody could not be demonstrated for up to 21 days post inoculation (p.i.). In 21 bats inoculated by a combination of intraperitoneal/subcutaneous route, viremia and the presence of MARV in different tissues was detected on days 2–9 p.i., and IgG antibody on days 9–21 p.i. In 3 bats inoculated subcutaneously, viremia was detected on days 5 and 8 (termination of experiment), with virus isolation from different organs. MARV could not be detected in urine, feces or oral swabs in any of the 3 experimental groups. However, it was detected in tissues which might contribute to horizontal or vertical transmission, e.g. lung, intestines, kidney, bladder, salivary glands, and female reproductive tract. Viremia lasting at least 5 days could also facilitate MARV mechanical transmission by blood sucking arthropods and infections of susceptible vertebrate hosts by direct contact with infected blood. All bats were clinically normal and no gross pathology was identified on post mortem examination. This work confirms the susceptibility of R. aegyptiacus to infection with MARV irrespective of sex and age and contributes to establishing a bat-filovirus experimental model. Further studies are required to uncover the mode of MARV transmission, and to investigate the putative role of R. aegyptiacus as a reservoir host. PMID:23029039

  10. Virological and serological findings in Rousettus aegyptiacus experimentally inoculated with vero cells-adapted hogan strain of Marburg virus.


    Paweska, Janusz T; Jansen van Vuren, Petrus; Masumu, Justin; Leman, Patricia A; Grobbelaar, Antoinette A; Birkhead, Monica; Clift, Sarah; Swanepoel, Robert; Kemp, Alan


    The Egyptian fruit bat, Rousettus aegyptiacus, is currently regarded as a potential reservoir host for Marburg virus (MARV). However, the modes of transmission, the level of viral replication, tissue tropism and viral shedding pattern remains to be described. Captive-bred R. aegyptiacus, including adult males, females and pups were exposed to MARV by different inoculation routes. Blood, tissues, feces and urine from 9 bats inoculated by combination of nasal and oral routes were all negative for the virus and ELISA IgG antibody could not be demonstrated for up to 21 days post inoculation (p.i.). In 21 bats inoculated by a combination of intraperitoneal/subcutaneous route, viremia and the presence of MARV in different tissues was detected on days 2-9 p.i., and IgG antibody on days 9-21 p.i. In 3 bats inoculated subcutaneously, viremia was detected on days 5 and 8 (termination of experiment), with virus isolation from different organs. MARV could not be detected in urine, feces or oral swabs in any of the 3 experimental groups. However, it was detected in tissues which might contribute to horizontal or vertical transmission, e.g. lung, intestines, kidney, bladder, salivary glands, and female reproductive tract. Viremia lasting at least 5 days could also facilitate MARV mechanical transmission by blood sucking arthropods and infections of susceptible vertebrate hosts by direct contact with infected blood. All bats were clinically normal and no gross pathology was identified on post mortem examination. This work confirms the susceptibility of R. aegyptiacus to infection with MARV irrespective of sex and age and contributes to establishing a bat-filovirus experimental model. Further studies are required to uncover the mode of MARV transmission, and to investigate the putative role of R. aegyptiacus as a reservoir host. PMID:23029039

  11. Interface Ferroelectric Transition near the Gap-Opening Temperature in a Single-Unit-Cell FeSe Film Grown on Nb-Doped SrTiO3 Substrate

    NASA Astrophysics Data System (ADS)

    Cui, Y.-T.; Moore, R. G.; Zhang, A.-M.; Tian, Y.; Lee, J. J.; Schmitt, F. T.; Zhang, W.-H.; Li, W.; Yi, M.; Liu, Z.-K.; Hashimoto, M.; Zhang, Y.; Lu, D.-H.; Devereaux, T. P.; Wang, L.-L.; Ma, X.-C.; Zhang, Q.-M.; Xue, Q.-K.; Lee, D.-H.; Shen, Z.-X.


    We report findings of strong anomalies in both mutual inductance and inelastic Raman spectroscopy measurements of single-unit-cell FeSe film grown on Nb-doped SrTiO3 , which occur near the temperature where the superconductinglike energy gap opens. Analysis suggests that the anomaly is associated with a broadened ferroelectric transition in a thin layer near the FeSe /SrTiO3 interface. The coincidence of the ferroelectric transition and gap-opening temperatures adds credence to the central role played by the film-substrate interaction on the strong Cooper pairing in this system. We discuss scenarios that could explain such a coincidence.

  12. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.


    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki


    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-?, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-? antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. PMID:25680810

  13. Scanning electron microscopic study of human neuroblastoma cells affected with Naegleria fowleri Thai strains.


    Tiewcharoen, Supathra; Rabablert, Jundee; Chetanachan, Pruksawan; Junnu, Virach; Worawirounwong, Dusit; Malainual, Nat


    In order to understand the pathogenesis of Naegleria fowleri in primary amoebic meningoencephalitis, the human neuroblastoma (SK-N-MC) and African green monkey kidney (Vero) cells were studied in vitro. Amoeba suspension in cell-culture medium was added to the confluent monolayer of SK-N-MC and Vero cells. The cytopathic activity of N. fowleri trophozoites in co-culture system was elucidated by scanning electron microscope at 3, 6, 9, 12, and 24 h. Two strains of N. fowleri displayed well-organized vigorous pseudopods in Nelson's medium at 37 degrees C. In co-culture, the target monolayer cells were damaged by two mechanisms, phagocytosis by vigorous pseudopods and engulfment by sucker-like apparatus. N. fowleri trophozoites produced amoebostomes only in co-culture with SK-N-MC cells. In contrast, we could not find such apparatus in the co-culture with Vero cells. The complete destruction time (100%) at 1:1 amoeba/cells ratio of SK-N-MC cells (1 day) was shorter than the Vero cells (12 days). In conclusion, SK-N-MC cells were confirmed to be a target model for studying neuropathogenesis of primary amoebic meningoencephalitis. PMID:18685867

  14. Graphic Grown Up

    ERIC Educational Resources Information Center

    Kim, Ann


    It's no secret that children and YAs are clued in to graphic novels (GNs) and that comics-loving adults are positively giddy that this format is getting the recognition it deserves. Still, there is a whole swath of library card-carrying grown-up readers out there with no idea where to start. Splashy movies such as "300" and "Spider-Man" and their

  15. Free amino acid and phenolic contents and antioxidative and cancer cell-inhibiting activities of extracts of 11 greenhouse-grown tomato varieties and 13 tomato-based foods.


    Choi, Suk-Hyun; Kim, Hyen-Ryung; Kim, Hyun-Jeong; Lee, In-Seon; Kozukue, Nobuyuki; Levin, Carol E; Friedman, Mendel


    Tomato (Solanum lycopersicum) plants synthesize nutrients, pigments, and bioactive compounds that benefit nutrition and human health. The nature and concentrations of these compounds are strongly influenced by varietal factors such as size and color as well as by processing. To better understand how these factors affect the concentration of nutrients and bioactive compounds, we analyzed 11 Korean tomato varieties grown under the same greenhouse conditions and 13 processed commercial tomato products for free amino acids and amino acid metabolites by HPLC, for individual phenolics by HPLC-MS, for total phenolics by the Folin-Ciocalteu method, for antioxidative activity by the FRAP and DPPH methods, and for cancer cell-inhibiting effects by the MTT assay. We also determined the protein content of the tomatoes by an automated Kjeldahl method. The results show that there is a broad range of bioactive compounds across tomato varieties and products. Small tomatoes had higher contents of bioactive compounds than the large ones. The content of phenolic compounds of processed products was lower than that of fresh tomatoes. Tomato extracts promoted growth in normal liver (Chang) cells, had little effect in normal lung (Hel299) cells, mildly inhibited growth of lung cancer (A549) cells, and first promoted and then, at higher concentrations, inhibited growth in lymphoma (U937) cells. The relationship of cell growth to measured constituents was not apparent. Dietary and health aspects of the results are discussed. PMID:22070764

  16. Cyclic AMP stimulation of transferrin secretion by breast cancer cell grown on extracellular matrix or in two-compartment culture chambers

    SciTech Connect

    Vandewalle, B.; Hornez, L.; Revillion, F.; Lefebvre, J. )


    Extrahepatic synthesis and secretion of transferrin (Tf), the major iron-carrying protein, have been described in normal and tumoral tissues suggesting a potential role for paracrine or autocrine function. In breast tumor cell MCF-7, we have previously shown a Tf secretion stimulated by estradiol which might confer selective growth advantages of these rapidly proliferating cells. The present work refers to possible additional Tf functions related to differentiation of breast tumor cells. We induced MCF-7 cell differentiation by the cyclic AMP derivative, dibutyryl cAMP (dB cAMP) and studied Tf secretion in different culture conditions after labeling with (35S) methionine. Our results demonstrate that dB cAMP stimulates Tf secretion only in culture environment that permits access to the basolateral surface and caters to the polarity requirements of the cell. These results suggest that Tf may also act as a modulator of cellular differentiation in breast cancer cells.

  17. Presence of lactate dehydrogenase and lactate racemase in Megasphaera elsdenii grown on glucose or lactate.

    PubMed Central

    Hino, T; Kuroda, S


    Activity of D-lactate dehydrogenase (D-LDH) was shown not only in cell extracts from Megasphaera elsdenii grown on DL-lactate, but also in cell extracts from glucose-grown cells, although glucose-grown cells contained approximately half as much D-LDH as DL-lactate-grown cells. This indicates that the D-LDH of M. elsdenii is a constitutive enzyme. However, lactate racemase (LR) activity was present in DL-lactate-grown cells, but was not detected in glucose-grown cells, suggesting that LR is induced by lactate. Acetate, propionate, and butyrate were produced similarly from both D- and L-lactate, indicating that LR can be induced by both D- and L-lactate. These results suggest that the primary reason for the inability of M. elsdenii to produce propionate from glucose is that cells fermenting glucose do not synthesize LR, which is induced by lactate. PMID:8439152

  18. The participation of growth factors in simulating the quiescent, proliferative, and differentiative stages of rat granulosa cells grown in a serum-free medium.


    Anderson, E; Lee, G Y


    Ovarian granulosa cells from small antral follicles from immature rats were cultured in a serum-free medium on an extracellular matrix for 10 days with growth factors in an effort to simulate the metabolic states they experience during their differentiation. During in vivo differentiation granulosa cells are initially quiescent, later proliferate and subsequently commence differentiation. With the production of androstenedione by the vascularized theca interna they produce estrogen and when the follicle reaches the preovulatory stage, granulosa cells produce both estrogen and progesterone. Culturing granulosa cells in serum-free medium plus FSH, PDGF, or FSH plus PDGF, the cells remain quiescent. The cells proliferate most consistently (as assessed by DNA quantitation) when cultured in FSH, PDGF, TGF alpha, TGF beta and GH, and undergo the first level of differentiation by producing estrogen (assessed by RIA) when cultured in FSH, PDGF, TGF beta, IGF-I and delta 4-A. Further differentiation is achieved in the presence of FSH, PDGF, TGF alpha, bFGF and delta 4-A when the cells produce both estrogen and progesterone similar to their production in preovulatory follicles. Phase contrast photomicrographs were made to monitor cellular shape changes. Electron microscopic analysis of the quiescent and proliferative cells reveal them to contain the normally occurring organelles. After 8 days in culture, cells producing estrogen, and estrogen and progesterone, contain endoplasmic reticulum of the smooth variety, an organelle which, in cooperation with mitochondria, is known to be involved in the production of steroids such as estrogen and progesterone. Therefore, with the addition of one or more growth factors and androstenedione to FSH-containing serum free medium, the simulated conditions are partially reminiscent of the follicular microenvironment, in which granulosa cells cultured on extracellular matrix can exhibit characteristics of growth and differentiation similar to folliculogenesis. PMID:8470094

  19. Feasibility evaluation of a new irradiation technique: three-dimensional unicursal irradiation with the Vero4DRT (MHI-TM2000).


    Mizowaki, Takashi; Takayama, Kenji; Nagano, Kazuo; Miyabe, Yuki; Matsuo, Yukinori; Kaneko, Shuji; Kokubo, Masaki; Hiraoka, Masahiro


    The Vero4DRT (MHI-TM2000) is a newly designed unique image-guided radiotherapy system consisting of an O-ring gantry. This system can realize a new irradiation technique in which both the gantry head and O-ring continuously and simultaneously rotate around the inner circumference of the O-ring and the vertical axis of the O-ring, respectively, during irradiation. This technique creates three-dimensional (3D) rotational dynamic conformal arc irradiation, which we term '3D unicursal irradiation'. The aim of this study was to present the concept and to estimate feasibility and potential advantages of the new irradiation technique. Collision maps were developed for the technique and a 3D unicursal plan was experimentally created in reference to the collision map for a pancreatic cancer case. Thereafter, dosimetric comparisons among the 3D unicursal, a two-dimensionally rotational dynamic conformal arc irradiation (2D-DCART), and an intensity-modulated radiation therapy (IMRT) plan were conducted. Dose volume data of the 3D unicursal plan were comparable or improved compared to those of the 2D-DCART and IMRT plans with respect to both the target and the organs at risk. The expected monitor unit (MU) number for the 3D unicursal plan was only 7% higher and 22.1% lower than the MUs for the 2D-DCART plan and IMRT plan, respectively. It is expected that the 3D unicursal irradiation technique has potential advantages in both treatment time and dose distribution, which should be validated under various conditions with a future version of the Vero4DRT fully implemented the function. PMID:22923744

  20. Investigation of crystallinity and planar defects in the Si nanowires grown by vapor–liquid–solid mode using indium catalyst for solar cell applications

    NASA Astrophysics Data System (ADS)

    Ajmal Khan, Muhammad; Ishikawa, Yasuaki; Kita, Ippei; Tani, Ayumi; Yano, Hiroshi; Fuyuki, Takashi; Konagai, Makoto


    Stacking-fault-free and planar defect (twinning plane)-free In-catalyzed Si nanowires (NWs) are essential for carrier transport and nanoscale device applications. In this article, In-catalyzed, vertically aligned, and cone-shaped Si NWs on Si(111) were grown successfully, in the vapor–liquid–solid (VLS) mode. In particular, the influences of substrate temperature (TS) and cooling rate (ΔTS/Δt) on the formation of planar defects, twinning planes along the [112] direction, and stacking faults in Si NWs were investigated. When TS was decreased from 600 °C to room temperature at a rate of 100 °C/240 s after Si NW growth, twinning plane defects perpendicular to the substrate and along different segments of (111)-oriented Si NWs were observed. Finally, one simple model was proposed to explain the stacking fault formation as well as Si NW length limitation due to the In-nanoparticle (In-NP) migration, and root causes of the twinning plane defects in the Si-NWs.

  1. Loss of Glycosaminoglycan Receptor Binding after Mosquito Cell Passage Reduces Chikungunya Virus Infectivity.


    Acharya, Dhiraj; Paul, Amber M; Anderson, John F; Huang, Faqing; Bai, Fengwei


    Chikungunya virus (CHIKV) is a mosquito-transmitted alphavirus that can cause fever and chronic arthritis in humans. CHIKV that is generated in mosquito or mammalian cells differs in glycosylation patterns of viral proteins, which may affect its replication and virulence. Herein, we compare replication, pathogenicity, and receptor binding of CHIKV generated in Vero cells (mammal) or C6/36 cells (mosquito) through a single passage. We demonstrate that mosquito cell-derived CHIKV (CHIKV mos) has slower replication than mammalian cell-derived CHIKV (CHIKV vero), when tested in both human and murine cell lines. Consistent with this, CHIKV mos infection in both cell lines produce less cytopathic effects and reduced antiviral responses. In addition, infection in mice show that CHIKV mos produces a lower level of viremia and less severe footpad swelling when compared with CHIKV vero. Interestingly, CHIKV mos has impaired ability to bind to glycosaminoglycan (GAG) receptors on mammalian cells. However, sequencing analysis shows that this impairment is not due to a mutation in the CHIKV E2 gene, which encodes for the viral receptor binding protein. Moreover, CHIKV mos progenies can regain GAG receptor binding capability and can replicate similarly to CHIKV vero after a single passage in mammalian cells. Furthermore, CHIKV vero and CHIKV mos no longer differ in replication when N-glycosylation of viral proteins was inhibited by growing these viruses in the presence of tunicamycin. Collectively, these results suggest that N-glycosylation of viral proteins within mosquito cells can result in loss of GAG receptor binding capability of CHIKV and reduction of its infectivity in mammalian cells. PMID:26484530

  2. Interface ferroelectric transition near the gap-opening temperature in a single-unit-cell FeSe film grown on Nb-Doped SrTiO3 substrate.


    Cui, Y-T; Moore, R G; Zhang, A-M; Tian, Y; Lee, J J; Schmitt, F T; Zhang, W-H; Li, W; Yi, M; Liu, Z-K; Hashimoto, M; Zhang, Y; Lu, D-H; Devereaux, T P; Wang, L-L; Ma, X-C; Zhang, Q-M; Xue, Q-K; Lee, D-H; Shen, Z-X


    We report findings of strong anomalies in both mutual inductance and inelastic Raman spectroscopy measurements of single-unit-cell FeSe film grown on Nb-doped SrTiO3, which occur near the temperature where the superconductinglike energy gap opens. Analysis suggests that the anomaly is associated with a broadened ferroelectric transition in a thin layer near the FeSe/SrTiO3 interface. The coincidence of the ferroelectric transition and gap-opening temperatures adds credence to the central role played by the film-substrate interaction on the strong Cooper pairing in this system. We discuss scenarios that could explain such a coincidence. PMID:25659015

  3. Novel Cell-Based Method To Detect Shiga Toxin 2 from Escherichia coli O157:H7 and Inhibitors of Toxin Activity?

    PubMed Central

    Quiones, Beatriz; Massey, Shane; Friedman, Mendel; Swimley, Michelle S.; Teter, Ken


    Escherichia coli O157:H7 is a leading cause of food-borne illness. This human pathogen produces Shiga toxins (Stx1 and Stx2) which inhibit protein synthesis by inactivating ribosome function. The present study describes a novel cell-based assay to detect Stx2 and inhibitors of toxin activity. A Vero cell line harboring a destabilized variant (half-life, 2 h) of the enhanced green fluorescent protein (d2EGFP) was used to monitor the toxin-induced inhibition of protein synthesis. This Vero-d2EGFP cell line produced a fluorescent signal which could be detected by microscopy or with a plate reader. However, a greatly attenuated fluorescent signal was detected in Vero-d2EGFP cells that had been incubated overnight with either purified Stx2 or a cell-free culture supernatant from Stx1- and Stx2-producing E. coli O157:H7. Dose-response curves demonstrated that the Stx2-induced inhibition of enhanced green fluorescent protein fluorescence mirrored the Stx2-induced inhibition of overall protein synthesis and identified a picogram-per-milliliter threshold for toxin detection. To establish our Vero-d2EGFP assay as a useful tool for the identification of toxin inhibitors, we screened a panel of plant compounds for antitoxin activities. Fluorescent signals were maintained when Vero-d2EGFP cells were exposed to Stx1- and Stx2-containing medium in the presence of either grape seed or grape pomace extract. The antitoxin properties of the grape extracts were confirmed with an independent toxicity assay that monitored the overall level of protein synthesis in cells treated with purified Stx2. These results indicate that the Vero-d2EGFP fluorescence assay is an accurate and sensitive method to detect Stx2 activity and can be utilized to identify toxin inhibitors. PMID:19139230

  4. N/P InP homojunction solar cells with an In0.53Ga0.47As contacting layer grown by liquid phase epitaxy

    NASA Technical Reports Server (NTRS)

    Shen, C. C.; Choi, K. Y.


    N/P InP homojunction solar cells with an In sub 0.53 Ga sub 0.47 As contacting layer were fabricated by liquid phase epitaxy (LPE). Electron-Beam-Induced-Current (EBIC) measurements were performed on several selected samples. It was found that the background doping level in the base region sometimes results in a deep junction, which greatly affects the cell performance.

  5. Developmental transitions of Coxiella burnetii grown in axenic media

    PubMed Central

    Sandoz, Kelsi M.; Sturdevant, Daniel E.; Hansen, Bryan; Heinzen, Robert A.


    Coxiella burnetii undergoes a biphasic developmental cycle within its host cell that generates morphologically and physiologically distinct large cell variants (LCV) and small cell variants (SCV). During the lag phase of the C. burnetii growth cycle, non-replicating SCV differentiate into replicating LCV that in turn differentiate back into SCV during stationary phase. Nearly homogeneous SCV are observed in infected Vero cells after extended incubation (21 to 28 days). In the current study, we sought to establish whether C. burnetii developmental transitions in host cells are recapitulated during host cell-free (axenic) growth in first and second generation acidified citrate cysteine media (ACCM-1 and ACCM-2, respectively). We show that ACCM-2 supported developmental transitions and viability. Although ACCM-1 also supported SCV to LCV transition, LCV to SCV transition did not occur after extended incubation (21 days). Instead, C. burnetii exhibited a ghost-like appearance with bacteria containing condensed chromatin but otherwise devoid of cytoplasmic content. This phenotype correlated with a near total loss in viability between 14 and 21 days of cultivation. Transcriptional profiling of C. burnetii following 14 days of incubation revealed elevated expression of oxidative stress genes in ACCM-1 cultivated bacteria. ACCM-2 differs from ACCM-1 by the substitution of methyl-?-cyclodextrin (M?-CD) for fetal bovine serum. Addition of M?-CD to ACCM-1 at 7 days post-inoculation rescued C. burnetii viability and lowered expression of oxidative stress genes. Thus, M?-CD appears to alleviate oxidative stress in ACCM-2 to result in C. burnetii developmental transitions and viability that mimic host cell-cultivated organisms. Axenic cultivation of C. burnetii in ACCM-2 and new methods of genetic manipulation now allow investigation of the molecular basis of C. burnetii biphasic development. PMID:24286928

  6. What is the influence of ordinary epidermal cells and stomata on the leaf plasticity of coffee plants grown under full-sun and shady conditions?


    Pompelli, M F; Martins, S C V; Celin, E F; Ventrella, M C; Damatta, F M


    Stomata are crucial in land plant productivity and survival. In general, with lower irradiance, stomatal and epidermal cell frequency per unit leaf area decreases, whereas guard-cell length or width increases. Nevertheless, the stomatal index is accepted as remaining constant. The aim of this paper to study the influence of ordinary epidermal cells and stomata on leaf plasticity and the influence of these characteristics on stomata density, index, and sizes, in the total number of stomata, as well as the detailed distribution of stomata on a leaf blade. As a result, a highly significant positive correlation (R(a) = 0.767 p ? 0.001) between stomatal index and stomatal density, and with ordinary epidermal cell density (R(a) = 0.500 p ? 0.05), and a highly negative correlation between stomatal index and ordinary epidermal cell area (R(a) = -0.571 p ? 0.001), were obtained. However in no instance was the correlation between stomatal index or stomatal density and stomatal dimensions taken into consideration. The study also indicated that in coffee, the stomatal index was 19.09% in shaded leaves and 20.08% in full-sun leaves. In this sense, variations in the stomatal index by irradiance, its causes and the consequences on plant physiology were discussed. PMID:21180918

  7. Flexible solar cells with a Cu(In,Ga)Se2 absorber grown by using a Se thermal cracker on a polyimide substrate

    NASA Astrophysics Data System (ADS)

    Park, Soo-Jeong; Chung, Yong-Duck; Lee, Woo-Jung; Cho, Dae-Hyung; Wi, Jae-Hyung; Han, Won-Seok; Cho, Yousuk; Yoon, Jong-man


    A polyimide substrate was used for the fabrication of flexible Cu(In,Ga)Se2 (CIGS) thin-film solar cells. To deposit a stable Mo layer on a flexible substrate, we measured the residual stress in the polyimide film after the deposition of a Mo layer by varying the process pressure. A CIGS absorber was deposited on a Mo layer at a growth temperature below 500? by using a Se thermal cracker and various cracking zone temperatures ( T C ) to improve the reactivity of Se due to the low process temperature. To investigate the effect of Na on the efficiency of a flexible CIGS solar cell, we deposited a Mo:Na layer as a source of Na between the Mo layer and the polyimide substrate. In case of the flexible CIGS solar cell fabricated under the condition of a T C of 800? with a Mo:Na layer, the highest cell efficiency was achieved at 10.76% without an anti-reflection coating, which is significantly increased by 4% compared to the efficiency of a solar cell without the Mo:Na layer.

  8. Transwell-grown HepG2 cell monolayers as in vitro permeability model to study drug-drug or drug-food interactions.


    Berginc, Katja; Kristl, Albin


    HepG2 cell monolayers, formed during cell growth on collagen-coated Transwell (Corning Inc., Corning, NY, USA) inserts, can be used for the evaluation of interactions between food supplements and drugs that are substrates for P-glycoprotein (Pgp) and/or multidrug resistance-associated protein 2 (MRP-2). Samples obtained during such permeability studies were relatively free of intracellular proteins or cell debris compared to usually performed uptake experiments with HepG2 cells; therefore no special preparation protocol prior to the analysis was needed. In the presence of aged garlic extract the activities of hepatic efflux transporters (Pgp, MRP-2) changed, which was observed as significant permeability changes of tested human immunodeficiency virus (HIV) protease inhibitors. Darunavir efflux significantly increased, whereas that of saquinavir significantly decreased. Because of the observed in vitro interactions between aged garlic extract and HIV protease inhibitors (darunavir, saquinavir), any alterations of in vivo liver transport in the presence of garlic phytochemicals could also significantly influence darunavir/saquinavir hepatocyte intracellular concentrations and hence their bioavailabilities. Therefore this aspect needs further in vivo animal evaluation. PMID:21138349

  9. Transwell-grown HepG2 cell monolayers as in vitro permeability model to study drug-drug or drug-food interactions.

    TOXLINE Toxicology Bibliographic Information

    Berginc K; Kristl A


    HepG2 cell monolayers, formed during cell growth on collagen-coated Transwell (Corning Inc., Corning, NY, USA) inserts, can be used for the evaluation of interactions between food supplements and drugs that are substrates for P-glycoprotein (Pgp) and/or multidrug resistance-associated protein 2 (MRP-2). Samples obtained during such permeability studies were relatively free of intracellular proteins or cell debris compared to usually performed uptake experiments with HepG2 cells; therefore no special preparation protocol prior to the analysis was needed. In the presence of aged garlic extract the activities of hepatic efflux transporters (Pgp, MRP-2) changed, which was observed as significant permeability changes of tested human immunodeficiency virus (HIV) protease inhibitors. Darunavir efflux significantly increased, whereas that of saquinavir significantly decreased. Because of the observed in vitro interactions between aged garlic extract and HIV protease inhibitors (darunavir, saquinavir), any alterations of in vivo liver transport in the presence of garlic phytochemicals could also significantly influence darunavir/saquinavir hepatocyte intracellular concentrations and hence their bioavailabilities. Therefore this aspect needs further in vivo animal evaluation.

  10. Freestanding aligned carbon nanotube array grown on a large-area single-layered graphene sheet for efficient dye-sensitized solar cell.


    Qiu, Longbin; Wu, Qiong; Yang, Zhibin; Sun, Xuemei; Zhang, Yuanbo; Peng, Huisheng


    A novel carbon nanomaterial with aligned carbon nanotubes (CNTs) chemically bonded to a single-layered, large area graphene sheet is designed and fabricated, showing remarkable electronic and electrocatalytic properties. When the carbon nanomaterial is used as a counter electrode, the resulting dye-sensitized solar cell exhibits ≈11% enhancement of energy conversion efficiency than aligned CNT array. PMID:24889384

  11. Microhardness studies of vapour grown tin (II) sulfide single crystals

    NASA Astrophysics Data System (ADS)

    Hegde, S. S.; Kunjomana, A. G.; Ramesh, K.


    Earth abundant tin sulfide (SnS) has attracted considerable attention as a possible absorber material for low-cost solar cells due to its favourable optoelectronic properties. Single crystals of SnS were grown by physical vapour deposition (PVD) technique. Microindentation studies were carried out on the cleaved surfaces of the crystals to understand their mechanical behaviour. Microhardness increased initially with the load, giving sharp maximum at 15 g. Quenching effect has increased the microhardness, while annealing reduced the microhardness of grown crystals. The hardness values of as-grown, annealed and quenched samples at 15 g load are computed to be 99.69, 44.52 and 106.29 kg/mm2 respectively. The microhardness of PVD grown crystals are high compared to CdTe, a leading low-cost PV material. The as-grown faces are found to be fracture resistant.

  12. Prostate tumor grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    This prostate cancer construct was grown during NASA-sponsored bioreactor studies on Earth. Cells are attached to a biodegradable plastic lattice that gives them a head start in growth. Prostate tumor cells are to be grown in a NASA-sponsored Bioreactor experiment aboard the STS-107 Research-1 mission in 2002. Dr. Leland Chung of the University of Virginia is the principal investigator. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Credit: NASA and the University of Virginia.

  13. Use of a feline respiratory epithelial cell culture system grown at the air-liquid interface to characterize the innate immune response following feline herpesvirus 1 infection.


    Nelli, Rahul K; Maes, Roger; Kiupel, Matti; Hussey, Gisela Soboll


    Infection with feline herpesvirus-1 (FHV-1) accounts for 50% of viral upper respiratory diseases in domestic cats and is a significant cause of ocular diseases. Despite the clinical significance and high prevalence of FHV-1 infection, currently available vaccines cannot completely protect cats from infection and lifelong latency. FHV-1 infects via the mucous membranes and replicates in respiratory epithelial cells, but very little is known about the early innate immunity at this site. To address questions about immunity to FHV-1, feline respiratory epithelial cells cultured at air-liquid interface (ALI-FRECs) were established by collecting respiratory tracts from 6 healthy cats after euthanasia. Cells were isolated, cultured and characterized histologically and immunologically before infection with FHV-1. The expression of Toll-like receptors (TLRs), cytokine and chemokine responses were measured by real time PCR. ALI-FRECs morphologically resembled the natural airways of cats with multilayered columnar epithelial cells and cilia. Immunological properties of the natural airways were maintained in ALI-FRECs, as evidenced by the expression of TLRs, cytokines, chemokines, interferons, beta-defensins, and other regulatory genes. Furthermore, ALI-FRECs were able to support infection and replication of FHV-1, as well as modulate transcriptional regulation of various immune genes in response to infection. IL-1β and TNFα were increased in ALI-FRECs by 24hpi, whereas expression levels of IFN-α and TLR9 were not increased until 36hpi. In contrast, TLR3, GM-CSF and TGF-1β expression was down-regulated at 36hpi. The data presented show the development of a system ideal for investigating the molecular pathogenesis and immunity of FHV-1 or other respiratory pathogens. PMID:26795546

  14. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation

    NASA Astrophysics Data System (ADS)

    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu


    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation.

  15. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation.


    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu


    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation. PMID:26727026

  16. Angiogenic tube formation of bovine aortic endothelial cells grown on patterns formed by H2/He plasma treatment of the plasma polymerized hexamethyldisiloxane film.


    Park, Jisoo; Ha, Myunghoon; Lee, Hye-Rim; Park, Heonyong; Yu, Jung-Hoon; Boo, Jin-Hyo; Jung, Donggeun


    Angiogenesis, the process to generate new vessels, is necessary for normal development in children as well as the wound healing and the tumor growth in adults. Therefore, it is physiologically and/or pathophysiologically significant to monitor angiogenesis. However, classical in vitro methods to evaluate angiogenesis take a long time and are expensive. Here, the authors developed a novel method to analyze the angiogenesis in a simple and economical way, using patterned films. In this study, the authors fabricated a plasma polymerized hexamethyldisiloxane (PPHMDSO) thin film deposited by capacitively coupled plasma chemical vapor deposition system with various plasma powers. The patterned PPHMDSO film was plasma treated by 10:90 H2/He mixture gas through a metal shadow mask. The films were characterized by water contact angle, atomic force microscopy, x-ray photoelectron spectroscopy, and Fourier-transform infrared spectroscopy analyses. Our results show that the PPHMDSO film suppresses the cell adhesion, whereas surface modified PPHMDSO film enhances the cell adhesion and proliferation. From cell culture experiments, the authors found that the patterned film with 300 μm line interval was most efficient to evaluate the tube formation, a sapient angiogenic indicator. This patterned film will provide an effective and promising method for evaluating angiogenesis. PMID:25724221

  17. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation

    PubMed Central

    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu


    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation. PMID:26727026

  18. Enhanced cell-free protein synthesis using a S30 extract from Escherichia coli grown rapidly at 42 degrees C in an amino acid enriched medium.


    Yamane, Tsuneo; Ikeda, Yusuke; Nagasaka, Takehiro; Nakano, Hideo


    Growths of Escherichia coli strain A19 were investigated in a 5-L fermentor at 37 and 42 degrees C either in Pratt's medium (a standard medium for cell-free protein synthesis using its S30 extract) or in a casamino acids supplemented Pratt's medium (aa-enriched medium). Specific growth rates in Pratt's medium at 37 and 42 degrees C were 0.77 and 0.46 h(-1), respectively, whereas those in the aa-enriched medium at 37 and 42 degrees C were 0.87 and 1.49 h(-1), respectively. The extent of cell-free chloramphenicol acetyltransferase (CAT) synthesis was compared at 37 degrees C incubation (from a plasmid pK7-CAT) for S30 extracts prepared from the cells cultured in the aa-enriched medium at 37 or 42 degrees C. A 40% increase in CAT synthesis occurred when the 42 degrees C/S30 extract was used as compared with 37 degrees C/S30 extract. CAT and both the light and heavy chains (Lc and Hc) of the Fab fragment of an antibody 6D9 were synthesized at 37 degrees C in the cell-free synthesis in the presence of [(14)C]Leu. Their reaction mixtures were subjected to SDS-PAGE autoradiographic analysis. It was found that most of the synthesized proteins were in the soluble fraction when 42 degrees C/S30 extract was used, suggesting that the 42 degrees C/S30 extract contained greater amounts of various protein folding factors. A dialysis membrane minibioreactor with a reaction volume ca. 0.5 mL was handmade by the authors. The advantages of the minibioreactor are a simple configuration, a low manufacturing cost, and the capability of the dialysis membrane replacement. Increased CAT synthesis was also observed for continuous exchange cell-free (CECF) protein synthesis at 37 degrees C when the 42 degrees C/S30 extract was used in the minibioreactor. Some plausible reasons to give higher protein synthesis activity of the 42 degrees C/S30 extract are discussed. PMID:15801806

  19. Characteristics of Escherichia coli grown in bay water as compared with rich medium.

    PubMed Central

    Chai, T J


    Membrane-filtered bay water can support a certain degree of growth of Escherichia coli organisms isolated from the bay water or from sewage. The effect of the growth medium (bay water versus rich medium) on sensitivities to antimicrobial agents and cell envelope proteins was studied in many of these strains. Bay water-grown cells were less sensitive to bacteriophages and colicins, but were more sensitive to heavy metals and detergents as compared with rich-medium-grown cells. These results indicated that the cell envelope composition of the bay water-grown cells could be modified, resulting in altered susceptibility to various antimicrobial agents. An analysis of cell envelope proteins by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed that cells from rich-medium-grown cultures contained two or three major outer membrane proteins, whereas in bay water-grown cells, the OmpF protein was greatly reduced. Images PMID:6344791

  20. Alterations of leaf cell ultrastructures and AFLP DNA profiles in Earth-grown tomato plants propagated from long-term six years Mir-flown seeds

    NASA Astrophysics Data System (ADS)

    Liu, Min; Xue, Huai; Pan, Yi; Zhang, Chunhua; Lu, Jinying

    Leaf cell ultrastructures and DNA variations in the firstand the second-generation of Earthgrown tomato (Lycopersicon esculentun Mill) plants that had been endured a long-term six years spaceflight in the Mir were compared to their ground-based control plants, under observations with a Transmission Electron Microscope and the Amplification Fragment Length Polymorphism (AFLP) analysis. For alterations in the morphological ultrastructures, one plant among the 11 first-generation plants generated from 30 Mir-flown seeds had a three-layered palisade cell structure, while other 10 first-generation plants and all ground-based controls had one-layered palisade cell structure in leaves. Starch grains were larger and in clusters, numbers of starch grains increased in the chloroplasts in the Mir-flown plants. Leaf cells became contracted and deformed, and cell shape patterns were different in the Mir-flown plants. For the leaf genomic DNA alterations, 34 DNA bands were polymorphic with a 1.32% polymorphism among 2582 DNA bands in the first-generation Mir-flown plants. Band types in the spaceflight treated plants were also different from those in the ground-based control. Of 11 survived first-generation plants, 7 spaceflight treated plants (Plant Nos. 1-6 and No. 9) had a same 7 polymorphic bands and a same 0.27%DNA mutation. The DNA mutation rate was greatest in Plants No.10 and No.7 (0.90% and 0.94%), less in Plant No.11 (0.31%) and least in Plant No.8 (0.20%). For the 38 send-generation plants propagated from the No. 5 Mir-flown seed, 6 DNA bands were polymorphic with a 0.23% polymorphism among 2564 amplified DNA bands. Among those 38 second-generation plants amplified by primer pair (E4: ACC, M8: CTT), one DNA band disappeared in 29 second-generation plants and in the original Mir-flown No. 5 plant, compared to the ground-base controls. Among the 38 second-generation plants generated from the Mir-flown No. 5 seed, the DNA band types of 29 second-generation plants were different from that of the ground-base controls and had a same 6 polymorphic bands and a same 0.23% DNA mutation. For the 49 second-generation plants derived from the Mir-flown No. 6 seed, 7 DNA bands were polymorphic with 0.27% polymorphism among 2564 amplified DNA bands. With only one exception among those 49 second-generation plants amplified by primer pair (E3: ACA, M3: CAG), one DNA band disappeared in 48 second-generation plants and in the original Mir-flown No. 6 plant, compared to the ground-based controls. Among the 49 second-generation plants generated from the Mir-flown No. 6 seed, the DNA band types of 48 second-generation plants were different from that of the ground-base controls and had a same 7 polymorphic bands and a same 0.27% DNA mutation. Our results indicated that leaf cell ultrastructures had been altered and heredity variations had been induced by seeds being exposed to a long-term outer-space environment. Further research is needed to elucidate the dynamics and mechanisms resulting in such variations. Plant biology studies in the space environment may open potential approaches to induce mutations and to screen new plant varieties by ground-based selections among spaceflight treated seeds or seedlings.

  1. Anti-West Nile virus activity of in vitro expanded human primary natural killer cells

    PubMed Central


    Background Natural Killer (NK) cells are a crucial component of the host innate immune system with anti-viral and anti-cancer properties. However, the role of NK cells in West Nile virus (WNV) infection is controversial, with reported effects ranging from active suppression of virus to no effect at all. It was previously shown that K562-mb15-41BBL (K562D2) cells, which express IL-15 and 4-1BBL on the K562 cell surface, were able to expand and activate human primary NK cells of normal peripheral blood mononuclear cells (PBMC). The expanded NK cells were tested for their ability to inhibit WNV infection in vitro. Results Co-culture of PBMC with irradiated K562D2 cells expanded the NK cell number by 2-3 logs in 2-3 weeks, with more than 90% purity; upregulated NK cell surface activation receptors; downregulated inhibitory receptors; and boosted interferon gamma (IFN-?) production by ~33 fold. The expanded NK (D2NK) cell has strong natural killing activity against both K562 and Vero cells, and killed the WNV infected Vero cells through antibody-dependent cellular cytotoxicity (ADCC). The D2NK cell culture supernatants inhibited both WNV replication and WNV induced cytopathic effect (CPE) in Vero cells when added before or after infection. Anti-IFN-? neutralizing antibody blocked the NK supernatant-mediated anti-WNV effect, demonstrating a noncytolytic activity mediated through IFN-?. Conclusions Co-culture of PBMC with K562D2 stimulatory cells is an efficient technique to prepare large quantities of pure and active NK cells, and these expanded NK cells inhibited WNV infection of Vero cells through both cytolytic and noncytolytic activities, which may imply a potential role of NK cells in combating WNV infection. PMID:20089143

  2. Effect of high energy shock waves on tumor cells.


    Kohri, K; Uemura, T; Iguchi, M; Kurita, T


    Exposure of bladder tumor cell strain HT-1197, chronic bonemarrow leukemic cell strain K-562, and African green-turtle normal kidney cell strain Vero to high energy shock waves resulted in ultrastructural changes and a reduction in cell viability as determined by 3H-thymidine incorporation assay and flowcytometer. K-562 was the most sensitive while Vero was the most resistant to the high energy shock wave. By flowcytometry using anti BrdU antibody, described K-562 in the S phase was found to be inhibited by the exposure. Electron microscopy revealed destruction of microvilli over the cell surface and swollen mitochondria in K-562 and HT-1197. These effects were related to the number of high energy shock wave exposures. Our study demonstrates that a high energy shock wave has an anti-tumor effect in vitro. PMID:2339478

  3. Wide-spectrum Mg and Ga co-doped ZnO TCO thin films for solar cells grown via magnetron sputtering with H2 introduction

    NASA Astrophysics Data System (ADS)

    Chen, Xin-liang; Liu, Jie-ming; Ni, Jian; Zhao, Ying; Zhang, Xiao-dan


    Wide-spectrum Mg and Ga co-doped ZnO transparent conductive oxide (TCO) thin films are deposited via magnetron sputtering at various H2 flow rates on glass substrates. The structural, electrical, and optical properties of MGZO thin films are investigated with different H2 flow rates. The experiment results show that the MGZO thin films are polycrystalline with a hexagonal wurtzite structure exhibiting a preferred (0 0 2) crystal plane orientation. The carrier concentration remarkably increases from 5.15 × 1019 cm-3 to 2.12 × 1020 cm-3 with increasing the H2 flow rate from 0 sccm to 4.0 sccm and then decreases when further increasing the H2 flow rate. The glass/MGZO thin film deposited at the H2 flow rate of 4.0 sccm exhibits the lowest resistivity of 1.96 × 10-3 Ω cm (film thickness d ∼ 548 nm) and an average transmittance (Ta) of 80.5% in the wavelength range from 340 nm to 1100 nm. Optical measurements indicate that the optical band gap (Eg) of MGZO thin films varies from 3.45 eV to 3.78 eV with adjusting H2 flow rate from 0 sccm to 12.0 sccm. The obtained MGZO thin films with an appropriate thickness are preliminarily applied in p-i-n type hydrogenated amorphous silicon (a-Si:H) thin film solar cells. The a-Si:H solar cell with MGZO layer presents higher quantum efficiency in the short wavelength region than that with GZO layer, resulting from widened optical band gap.

  4. Correlation between Phylogroups and Intracellular Proteomes of Propionibacterium acnes and Differences in the Protein Expression Profiles between Anaerobically and Aerobically Grown Cells

    PubMed Central

    Dekio, Itaru; Culak, Renata; Ball, Graham; Gharbia, Saheer; Shah, Haroun N.


    Propionibacterium acnes is one of the dominant commensals on the human skin and also an opportunistic pathogen in relation to acne, sarcoidosis, prostate cancer, and various infections. Recent investigations using housekeeping and virulence genes have revealed that the species consists of three major evolutionary clades (types I, II, and III). In order to investigate protein expression differences between these phylogroups, proteomic profiles of 21 strains of P. acnes were investigated. The proteins extracted from cells cultured under anaerobic and aerobic conditions were analysed using a SELDI-TOF mass spectrometer, high-resolution capillary gel electrophoresis, and LC-MS/ MS. The SELDI spectral profiles were visualised as a heat map and a dendrogram, which resulted in four proteomic groups. Strains belonging to type I were represented in the proteome Group A, while Group B contained type III strains. Groups C and D contained mixtures of types I and II. Each of these groups was not influenced by differences in culture conditions. Under anoxic growth conditions, a type IB strain yielded high expressions of some proteins, such as methylmalonyl-CoA epimerase and the Christie-Atkins-Munch-Petersen (CAMP) factor. The present study revealed good congruence between genomic and proteomic data suggesting that the microenvironment of each subtype may influence protein expression. PMID:23878795

  5. An international outbreak of Vero cytotoxin-producing Escherichia coli O157 infection amongst tourists; a challenge for the European infectious disease surveillance network.

    PubMed Central

    Pebody, R. G.; Furtado, C.; Rojas, A.; McCarthy, N.; Nylen, G.; Ruutu, P.; Leino, T.; Chalmers, R.; de Jong, B.; Donnelly, M.; Fisher, I.; Gilham, C.; Graverson, L.; Cheasty, T.; Willshaw, G.; Navarro, M.; Salmon, R.; Leinikki, P.; Wall, P.; Bartlett, C.


    In March 1997, an outbreak of Vero cytotoxin-producing Escherichia coli O157 (VTEC) infection occurred amongst holidaymakers returning from Fuerteventura, Canary Islands. For the investigation, a confirmed case was an individual staying in Fuerteventura during March 1997, with either E. coli O157 VTEC isolated in stool, HUS or serological evidence of recent infection; a probable case was an individual with bloody diarrhoea without laboratory confirmation. Local and Europe-wide active case finding was undertaken through national centres, Salm-Net and the European Programme of Intervention Epidemiology, followed by a case-control study. Fourteen confirmed and one probable case were identified from England (7), Finland (5), Wales (1), Sweden (1) and Denmark (1) staying in four hotels. Three of the four hotels were supplied with water from a private well which appeared to be the probable vehicle of transmission. The case-control study showed illness was associated with consumption of raw vegetables (OR 8.4, 95% CI 1-5-48.2) which may have been washed in well water. This investigation shows the importance of international collaboration in the detection and investigation of clusters of enteric infection. PMID:10579440

  6. The impact of meteorology on the occurrence of waterborne outbreaks of vero cytotoxin-producing Escherichia coli (VTEC): a logistic regression approach.


    O'Dwyer, Jean; Morris Downes, Margaret; Adley, Catherine C


    This study analyses the relationship between meteorological phenomena and outbreaks of waterborne-transmitted vero cytotoxin-producing Escherichia coli (VTEC) in the Republic of Ireland over an 8-year period (2005-2012). Data pertaining to the notification of waterborne VTEC outbreaks were extracted from the Computerised Infectious Disease Reporting system, which is administered through the national Health Protection Surveillance Centre as part of the Health Service Executive. Rainfall and temperature data were obtained from the national meteorological office and categorised as cumulative rainfall, heavy rainfall events in the previous 7 days, and mean temperature. Regression analysis was performed using logistic regression (LR) analysis. The LR model was significant (p < 0.001), with all independent variables: cumulative rainfall, heavy rainfall and mean temperature making a statistically significant contribution to the model. The study has found that rainfall, particularly heavy rainfall in the preceding 7 days of an outbreak, is a strong statistical indicator of a waterborne outbreak and that temperature also impacts waterborne VTEC outbreak occurrence. PMID:26837828

  7. Effect of spacer layer thickness on multi-stacked InGaAs quantum dots grown on GaAs (311)B substrate for application to intermediate band solar cells

    SciTech Connect

    Shoji, Yasushi; Narahara, Kohei; Okada, Yoshitaka; Tanaka, Hideharu; Kita, Takashi; Akimoto, Katsuhiro


    We have investigated the properties of multi-stacked layers of self-organized In{sub 0.4}Ga{sub 0.6}As quantum dots (QDs) on GaAs (311)B grown by molecular beam epitaxy. We found that a high degree of in-plane ordering of QDs structure with a six-fold symmetry was maintained though the growth has been performed at a higher growth rate than the conventional conditions. The dependence of photoluminescence characteristics on spacer layer thickness showed an increasing degree of electronic coupling between the stacked QDs for thinner spacer layers. The external quantum efficiency for an InGaAs/GaAs quantum dot solar cell (QDSC) with a thin spacer layer thickness increased in the longer wavelength range due to additive contribution from QD layers inserted in the intrinsic region. Furthermore, a photocurrent production by 2-step photon absorption has been observed at room temperature for the InGaAs/GaAs QDSC with a spacer layer thickness of 15 nm.

  8. Nucleolus in clinostat-grown plants

    SciTech Connect

    Shen-Miller, J.; Dannenhoffer, J. ); Hinchman, R. )


    The clinostat is an apparatus that is used to mimic zero gravity in studies of plant growth in the absence of gravitropic response. Clinostat-grown tissue cultures of carrot exhibit significant increases both in the number of nuclei containing more than one nucleolus and in nucleolar volume. Oat seedlings germinated and grown on clinostats exhibit a decreased rate of shoot elongation, increased tissue sensitivity to applied auxin, and an increased response to gravitropic stimulation. Clinostat treatment clearly affects plant metabolism. The nucleolus is the region in the nucleus where ribosome synthesis and assembly take place. The 18S, 5.8S, and 25S ribosomal genes, in tandem units, are located in the nucleolus. Ribosomes orchestrate the production of all proteins that are necessary for the maintenance of cell growth, development, and survival. A full study of the effects of nullification of gravitropism, by clinostat rotation, on nucleolar development in barley has been initiated. The authors study developmental changes of nucleolar number and diameter in clinostat-grown root tissues. Preliminary results show that barley roots exhibit changes in nucleolar number and diameter. Growth rates of barley root and shoot also appear to be reduced, in measurements of both length and weight.

  9. Characteristics of Murayama virus in various cell cultures and laboratory animals.


    Nishikawa, F; Yamamoto, K; Sugiyama, T


    Some biological properties of Murayama virus, a new paramyxovirus, were studied. The virus grew well in primary monkey kidney cells as well as embryonated eggs, while the virus yields in primary chick embryo and BHK-21 cells were much lower. The infected BHK-21 cells formed large syncytia and showed typical hemadsorption, but did not produce any detectable amount of hemagglutinin in the culture fluid. The virus yields were very low in Vero. LLC-MK2 and MDCK cells at first passages. The addition of trypsin to the medium enhanced virus growth in Vero and LLC-MK2 but not in MDCK cells. Cell fusion activity of the virus was observed in Molt-4 cells. Hemolytic activity was enhanced by freeze-thawing. Several species of mammals and birds were susceptible to experimental infections with the virus as evidenced by seroconversion and positive virus isolation without showing any clinical signs. PMID:6790746

  10. Cytopathogenesis of Naegleria fowleri Thai strains for cultured human neuroblastoma cells.


    Tiewcharoen, Supathra; Malainual, Nat; Junnu, Virach; Chetanachan, Pruksawan; Rabablert, Jundee


    The aim of this study is to evaluate cellular interaction between free-living amoebae Naegleria fowleri strains and mammalian target cells in vitro. Two Thai strains of N. fowleri; Khon Kaen strain from the environment and Siriraj strain from the patient's cerebrospinal fluid and the Center of Disease Control VO 3081 strain from Atlanta (US) were studied. Human neuroblastoma (SK-N-MC) and African Green monkey Kidney (Vero) cells were used as target cells. Each cell line was inoculated with each strain of N. fowleri at a ratio of 1:1 and observed for 7 days. The uninoculated target cells and each strain of N. fowleri were used as control. The numbers of the challenged and unchallenged cells as well as the free-living amoebae were counted three times by trypan blue exclusion method. The inoculation began when the amoebae attached to the cell membrane and ingested the target cells. In this study, extensive cytopathogenesis with many floating inoculated cells and abundant number of amoebae were observed. The destruction pattern of both inoculated SK-N-MC and Vero target cells were similar. Interestingly, SK-N-MC was more susceptible to N. fowleri strains than the Vero cell. In addition, N. fowleri Siriraj strain showed the highest destruction pattern for each target cell. Our findings suggest that the SK-N-MC should be used as a base model for studying the neuropathogenesis in primary amoebic meningoencephalitis patients. PMID:18214541

  11. Extremely low-frequency electromagnetic fields cause DNA strand breaks in normal cells

    PubMed Central


    Background Extremely low frequency electromagnetic fields aren’t considered as a real carcinogenic agent despite the fact that some studies have showed impairment of the DNA integrity in different cells lines. The aim of this study was evaluation of the late effects of a 100 Hz and 5.6 mT electromagnetic field, applied continuously or discontinuously, on the DNA integrity of Vero cells assessed by alkaline Comet assay and by cell cycle analysis. Normal Vero cells were exposed to extremely low frequency electromagnetic fields (100 Hz, 5.6 mT) for 45 minutes. The Comet assay and cell cycle analysis were performed 48 hours after the treatment. Results Exposed samples presented an increase of the number of cells with high damaged DNA as compared with non-exposed cells. Quantitative evaluation of the comet assay showed a significantly (<0.001) increase of the tail lengths, of the quantity of DNA in tail and of Olive tail moments, respectively. Cell cycle analysis showed an increase of the frequency of the cells in S phase, proving the occurrence of single strand breaks. The most probable mechanism of induction of the registered effects is the production of different types of reactive oxygen species. Conclusions The analysis of the registered comet indices and of cell cycle showed that extremely low frequency electromagnetic field of 100 Hz and 5.6 mT had a genotoxic impact on Vero cells. PMID:24401758

  12. Characterization of silicon crystals grown by the heat exchanger method

    SciTech Connect

    Hyland, S.; Dumas, K.A.; Engelbrecht, J.A.A.; Leung, D.; Schwuttke, G.M.


    Silicon ingots grown by the Heat Exchanger Method (HEM) as large as 45 kg in mass (34 cm x 34 cm x 17 cm) are characterized electrically and structurally. The defect state in the crystal is related to the solar cell efficiency. Such characterization indicates that the solar cell efficiency of HEM crystals is limited by the crystal perfection, but that HEM silicon has the potential to yield silicon with quality comparable to Cz grown silicon. A new approach to grow HEM material of better quality is discussed.

  13. Protein Crystals Grown in Space

    NASA Technical Reports Server (NTRS)


    A collage of protein and virus crystals, many of which were grown on the U.S. Space Shuttle or Russian Space Station, Mir. The crystals include the proteins canavalin; mouse monoclonal antibody; a sweet protein, thaumatin; and a fungal protease. Viruses are represented here by crystals of turnip yellow mosaic virus and satellite tobacco mosaic virus. The crystals are photographed under polarized light (thus causing the colors) and range in size from a few hundred microns in edge length up to more than a millimeter. All the crystals are grown from aqueous solutions and are useful for X-ray diffraction analysis. Credit: Dr. Alex McPherson, University of California, Irvine.

  14. Evidence that an internal carbonic anhydrase is present in 5% CO/sub 2/-grown and air-grown Chlamydomonas. [Chlamydomonas reinhardtii

    SciTech Connect

    Moroney, J.V.; Togasaki, R.K.; Husic, H.D.; Tolbert, N.E.


    Inorganic carbon (C/sub i/) uptake was measured in wild-type cells of Chlamydomonas reinhardtii, and in cia-3, a mutant strain of C. reinhardtii that cannot grow with air levels of CO/sub 2/. Both air-grown cells, that have a CO/sub 2/ concentrating system, and 5% CO/sub 2/-grown cells that do not have this system, were used. When the external pH was 5.1 or 7.3, air-grown, wild-type cells accumulated inorganic carbon (C/sub i/) and this accumulation was enhanced when the permeant carbonic anhydrase inhibitor, ethoxyzolamide, was added. When the external pH was 5.1, 5% CO/sub 2/-grown cells also accumulated some C/sub i/, although not as much as air-grown cells and this accumulation was stimulated by the addition of ethoxyzolamide. At the same time, ethoxyzolamide inhibited CO/sub 2/ fixation by high CO/sub 2/-grown, wild-type cells at both pH 5.1 and 7.3. These observations imply that 5% CO/sub 2/-grown, wild-type cells, have a physiologically important internal carbonic anhydrase, although the major carbonic anhydrase located in the periplasmic space is only present in air-grown cells. Inorganic carbon uptake by cia-3 cells supported this conclusion. This mutant strain, which is thought to lack an internal carbonic anhydrase, was unaffected by ethoxyzolamide at pH 5.1. Other physiological characteristics of cia-3 resemble those of wild-type cells that have been treated with ethoxyzolamide. It is concluded that an internal carbonic anhydrase is under different regulatory control than the periplasmic carbonic anhydrase.

  15. A Novel Cell-Based Method to Detect Shiga Toxin 2 from Escherichia coli O157:H7 and Inhibitors of Toxin Activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Escherichia coli O157:H7 is a leading cause of foodborne illness. This human pathogen produces Shiga toxins (Stx1 and Stx2) which inhibit protein synthesis by inactivating ribosome function. The present study describes a novel cell-based assay to detect Stxs and inhibitors of Stx activity. A Vero...

  16. Selective cytotoxic effects on human breast carcinoma of new methoxylated flavonoids from Euryops arabicus grown in Saudi Arabia.


    Alarif, Walied M; Abdel-Lateff, Ahmed; Al-Abd, Ahmed M; Basaif, Salim A; Badria, Farid A; Shams, Maher; Ayyad, Seif-Eldin N


    The chloroform-methanol extract of Euryops arabicus, collected from Saudi provenance, yielded a new kaurane diterpene (1) and seven methoxylated flavones (2-8), two of which are new (2 and 3). Structures of the compounds were elucidated through interpretation of spectral data of NMR, MS and comparison with literature values. All compounds were evaluated for their anti-tumor activities, employing four different cancer cell lines (WI-38, VERO, HepG2 and MCF-7), ABTS free radical scavenging and immunemodulatory effects. All metabolites had considerable antioxidant and immunestimulatory effects. All compounds showed anticancer activity with IC?? in range 10-125 ?M, whilst 2 and 6 showed significant anti-proliferative activity against HepG2 (IC?? = 20 and 15 ?M) and MCF-7 (IC?? = 15 and 10 ?M), respectively. This effect was attributed to significant S-phase cell cycle arrest. PMID:23800391

  17. Reduced virulence of Pseudomonas aeruginosa grown in the presence of benzalkonium chloride.


    Adair, F W; Liauw, H L; Geftic, S G; Gelzer, J


    Resistant cells of Pseudomonas aeruginosa ATCC 9027 which were grown in the presence of 1 mg of benzalkonium chloride (BC) per ml caused only a mild conjunctivitis when they were dropped onto the scratched corneas of rabbits. In contrast, cells of the BC-sensitive parent strain induced a severe keratoconjunctivitis. In addition, the BC-grown cells also had a reduced capacity to produce kidney infections in mice as compared to the parent strain. BC-grown cells acted as weak complex antigens which conferred slight protection against lethal doses of BC-grown cells. No cross-protection to cells of the parent strain occurred. The data indicate that growth in the presence of BC results in cells with reduced virulence. PMID:809470

  18. Dendritic cells in antitumor immune responses. II. Dendritic cells grown from bone marrow precursors, but not mature DC from tumor-bearing mice, are effective antigen carriers in the therapy of established tumors.


    Gabrilovich, D I; Nadaf, S; Corak, J; Berzofsky, J A; Carbone, D P


    Antitumor CTL responses were studied in a model tumor hearing a mutant human p53 gene. We found ineffective induction of antitumor CTL in mice bearing these tumors associated with measurable defects in the function of dendritic cells (DC) from these animals. In this study we investigate the mechanism of this defect in mature DC and find that functional DC can be generated by growth from the bone marrow of tumor-hearing animals. Tumor cell supernatants did not affect the function of mature DC obtained from the spleen of tumor-bearing animals, but significantly suppressed the ability to generate functional DC from the bone marrow of control mice in vitro. This suggests that tumor cells may release factors which block early stages of DC maturation from precursors. DC generated from the bone marrow of tumor-bearing mice showed normal potential to stimulate allogeneic T cells, to stimulate anti-mutant p53 peptide-specific cytotoxic T cells, and to induce anti-p53 CTL responses in vivo in control mice. Repeated immunization with peptide-pulsed DC generated from the bone marrow of control mice (every 4-5 days) blocked progression of established tumors. Immunization of mice with peptide-pulsed DC obtained from the spleen of tumor-bearing mice (4 weeks after tumor injection) did not affect the tumor growth, whereas immunization with peptide-pulsed DC generated from bone marrow of tumor-bearing mice resulted in significantly prolonged survival and delayed tumor growth. Tumor progression was associated with change of the balance Th1/Th2 cells in favor of the Th2-like cytokine profile, while effective immunization was associated with a shift to the Th1 phenotype. Thus, frequent immunization of mice with mutant p53 peptide-pulsed DC generated from stem cells of tumor-bearing hosts can induce effective antitumor CTL responses associated with production of Th1 cells and lead to significant antitumor effects. PMID:8665591

  19. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    Dr. Lisa E. Freed of the Massachusetts Institute of Technology and her colleagues have reported that initially disc-like specimens tend to become spherical in space, demonstrating that tissues can grow and differentiate into distinct structures in microgravity. The Mir Increment 3 (Sept. 16, 1996 - Jan. 22, 1997) samples were smaller, more spherical, and mechanically weaker than Earth-grown control samples. These results demonstrate the feasibility of microgravity tissue engineering and may have implications for long human space voyages and for treating musculoskeletal disorders on earth. Final samples from Mir and Earth appeared histologically cartilaginous throughout their entire cross sections (5-8 mm thick), with the exception of fibrous outer capsules. Constructs grown on Earth (A) appeared to have a more organized extracellular matrix with more uniform collagen orientation as compared with constructs grown on Mir (B), but the average collagen fiber diameter was similar in the two groups (22 +- 2 nm) and comparable to that previously reported for developing articular cartilage. Randomly oriented collagen in Mir samples would be consistent with previous reports that microgravity disrupts fibrillogenesis. These are transmission electron micrographs of constructs from Mir (A) and Earth (B) groups at magnifications of x3,500 and x120,000 (Inset). The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Credit: Proceedings of the National Academy of Sciences.

  20. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    Dr. Lisa E. Freed of the Massachusetts Institute of Technology and her colleagues have reported that initially disc-like specimens of cartilage tend to become spherical in space, demonstrating that tissues can grow and differentiate into distinct structures in microgravity. The Mir Increment 3 (Sept. 16, 1996 - Jan. 22, 1997) samples were smaller, more spherical, and mechanically weaker than Earth-grown control samples. These results demonstrate the feasibility of microgravity tissue engineering and may have implications for long human space voyages and for treating musculoskeletal disorders on earth. Constructs grown on Mir (A) tended to become more spherical, whereas those grown on Earth (B) maintained their initial disc shape. These findings might be related to differences in cultivation conditions, i.e., videotapes showed that constructs floated freely in microgravity but settled and collided with the rotating vessel wall at 1g (Earth's gravity). In particular, on Mir the constructs were exposed to uniform shear and mass transfer at all surfaces such that the tissue grew equally in all directions, whereas on Earth the settling of discoid constructs tended to align their flat circular areas perpendicular to the direction of motion, increasing shear and mass transfer circumferentially such that the tissue grew preferentially in the radial direction. A and B are full cross sections of constructs from Mir and Earth groups shown at 10-power. C and D are representative areas at the construct surfaces enlarged to 200-power. They are stained red with safranin-O. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Photo credit: Proceedings of the National Academy of Sciences.

  1. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    For 5 days on the STS-70 mission, a bioreactor cultivated human colon cancer cells, such as the culture section shown here, which grew to 30 times the volume of control specimens grown on Earth. This significant result was reproduced on STS-85 which grew mature structures that more closely match what are found in tumors in humans. The two white circles within the tumor are part of a plastic lattice that helped the cells associate. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators.

  2. Comparative sensitivity of four different cell lines for the isolation of Coxiella burnetii.


    Lockhart, Michelle G; Islam, Aminul; Fenwick, Stan G; Graves, Stephen R; Stenos, John


    Coxiella burnetii is an obligate intracellular bacterium that causes the disease Q-fever. This is usually diagnosed by serology (immunofluorescence assay) and/or PCR detection of C.burnetii DNA. However, neither of these methods can determine the viability of the bacterium. Four different cell lines were compared for their ability to amplify very low numbers of viable C.burnetii. Two different isolates of C.burnetii were used. For the Henzerling isolate, DH82 (dog macrophage) cells were the most sensitive with an ID (50) (dose required to infect 50% of cell cultures) of 14.6 bacterial copies. For the Arandale isolate, Vero (monkey epithelial) cells were the most sensitive with an ID (50) of less than one bacterium in a 100-?L inoculum. The Vero cell line appeared highly useful as vacuoles could be seen microscopically in unstained infected cells. The findings of this study favour the use of Vero and DH82 tissue culture cell lines for isolation and growth of C.burnetii in vitro. The other cell lines, XTC-2 and L929, were less suitable. PMID:22681323

  3. Penetration and intracellular growth of Brucella abortus in nonphagocytic cells in vitro.

    PubMed Central

    Detilleux, P G; Deyoe, B L; Cheville, N F


    In pregnant ruminants, Brucella abortus localizes and replicates within the rough endoplasmic reticulum of trophoblastic epithelial cells. In this study, Vero cells were exposed to B. abortus to investigate its internalization and intracellular growth in nonphagocytic cells. A new double-fluorescence staining procedure to discriminate between extracellular and intracellular bacteria was developed. Studies with the double-fluorescence staining procedure and quantitative bacteriologic culture of disrupted host cells showed that various B. abortus strains replicated within Vero cells, including smooth virulent (strains 2308S and 544), smooth attenuated (strain 19), and rough (strains 45/20 and 2308R) strains. Rough brucellae were more adherent and entered a greater number of Vero cells. Intracellular replication occurred in a larger percentage of cells with smooth virulent (2308S and 544) strains than with smooth attenuated (19) or rough (45/20 and 2308R) strains. Differences in adhesiveness and invasiveness were correlated to hydrophobicity of the organism, as measured by hydrocarbon adherence. Ultrastructurally, intracellular smooth (2308S) and rough (45/20) brucellae were consistently found within cisternae of the rough endoplasmic reticulum and nuclear envelope. The results suggest that transfer to the rough endoplasmic reticulum is the limiting step in the infection of nonphagocytic cells by B. abortus. Images PMID:2114362

  4. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.


    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  5. Influence of FcγRIIa-Expressing Cells on the Assessment of Neutralizing and Enhancing Serum Antibodies Elicited by a Live-Attenuated Tetravalent Dengue Vaccine

    PubMed Central

    Byers, Anthony M.; Broder, Ryan; Haupfear, Kelly; Timiryasova, Tatyana M.; Hu, Branda T.; Boaz, Mark; Warren, William L.; Jackson, Nicholas; Moser, Janice M.; Guy, Bruno


    Background. Recent trials of recombinant, live-attenuated chimeric yellow fever-dengue tetravalent dengue vaccine (CYD-TDV) demonstrated efficacy against symptomatic, virologically confirmed dengue disease with higher point estimates of efficacy toward dengue virus (DENV)3 and DENV4 and moderate levels toward DENV1 and DENV2. It is interesting to note that serotype-specific efficacy did not correlate with absolute neutralizing antibody (nAb) geometric mean titer (GMT) values measured in a Vero-based plaque reduction neutralization test assay. The absence of Fcγ receptors on Vero cells may explain this observation. Methods. We performed parallel seroneutralization assays in Vero cells and CV-1 cells that express FcγRIIa (CV-1-Fc) to determine the neutralizing and enhancing capacity of serotype-specific DENV Abs present in CYD-TDV clinical trial sera. Results. Enhancement of DENV infection was observed in CV-1-Fc cells in naturally exposed nonvaccine sera, mostly for DENV3 and DENV4, at high dilutions. The CYD-TDV-vaccinated sera showed similar enhancement patterns. The CV-1-Fc nAb GMT values were 2- to 9-fold lower than Vero for all serotypes in both naturally infected individuals and CYD-TDV-vaccinated subjects with and without previous dengue immunity. The relative (CV-1-Fc/Vero) GMT decrease for anti-DENV1 and anti-DENV2 responses was not greater than for the other serotypes. Conclusions. In vitro neutralization assays utilizing FcγRIIa-expressing cells provide evidence that serotype-specific Ab enhancement may not be a primary factor in the serotype-specific efficacy differences exhibited in the CYD-TDV trials. PMID:26719844

  6. Influence of FcγRIIa-Expressing Cells on the Assessment of Neutralizing and Enhancing Serum Antibodies Elicited by a Live-Attenuated Tetravalent Dengue Vaccine.


    Byers, Anthony M; Broder, Ryan; Haupfear, Kelly; Timiryasova, Tatyana M; Hu, Branda T; Boaz, Mark; Warren, William L; Jackson, Nicholas; Moser, Janice M; Guy, Bruno


    Background.  Recent trials of recombinant, live-attenuated chimeric yellow fever-dengue tetravalent dengue vaccine (CYD-TDV) demonstrated efficacy against symptomatic, virologically confirmed dengue disease with higher point estimates of efficacy toward dengue virus (DENV)3 and DENV4 and moderate levels toward DENV1 and DENV2. It is interesting to note that serotype-specific efficacy did not correlate with absolute neutralizing antibody (nAb) geometric mean titer (GMT) values measured in a Vero-based plaque reduction neutralization test assay. The absence of Fcγ receptors on Vero cells may explain this observation. Methods.  We performed parallel seroneutralization assays in Vero cells and CV-1 cells that express FcγRIIa (CV-1-Fc) to determine the neutralizing and enhancing capacity of serotype-specific DENV Abs present in CYD-TDV clinical trial sera. Results.  Enhancement of DENV infection was observed in CV-1-Fc cells in naturally exposed nonvaccine sera, mostly for DENV3 and DENV4, at high dilutions. The CYD-TDV-vaccinated sera showed similar enhancement patterns. The CV-1-Fc nAb GMT values were 2- to 9-fold lower than Vero for all serotypes in both naturally infected individuals and CYD-TDV-vaccinated subjects with and without previous dengue immunity. The relative (CV-1-Fc/Vero) GMT decrease for anti-DENV1 and anti-DENV2 responses was not greater than for the other serotypes. Conclusions.  In vitro neutralization assays utilizing FcγRIIa-expressing cells provide evidence that serotype-specific Ab enhancement may not be a primary factor in the serotype-specific efficacy differences exhibited in the CYD-TDV trials. PMID:26719844

  7. Thermal Stability of Corrugated Epitaxial Graphene Grown on Re(0001)

    NASA Astrophysics Data System (ADS)

    Miniussi, E.; Pozzo, M.; Baraldi, A.; Vesselli, E.; Zhan, R. R.; Comelli, G.; Mente?, T. O.; Nio, M. A.; Locatelli, A.; Lizzit, S.; Alf, D.


    We report on a novel approach to determine the relationship between the corrugation and the thermal stability of epitaxial graphene grown on a strongly interacting substrate. According to our density functional theory calculations, the C single layer grown on Re(0001) is strongly corrugated, with a buckling of 1.6 , yielding a simulated C 1s core level spectrum which is in excellent agreement with the experimental one. We found that corrugation is closely knit with the thermal stability of the C network: C-C bond breaking is favored in the strongly buckled regions of the moir cell, though it requires the presence of diffusing graphene layer vacancies.

  8. Fourier Transform Infrared spectroscopy discloses different types of cell death in flow cytometrically sorted cells.


    Le Roux, K; Prinsloo, L C; Meyer, D


    Fourier Transform Infrared (FTIR) spectroscopy is a label free methodology showing promise in characterizing different types of cell death. Cervical adenocarcinoma (HeLa) and African monkey kidney (Vero) cells were treated with a necrosis inducer (methanol), novel apoptotic inducers (diphenylphosphino gold (I) complexes) and positive control, auranofin. Following treatment, cells stained with annexin-V and propidium iodide were sorted using a Fluorescence Activated Cell Sorter (FACS Aria) to obtain populations consisting of either viable, necrotic or apoptotic cells. Transmission Electron Microscopy confirmed successful sorting of all three populations. Four bands were identified which could discriminate between viable and necrotic cells namely 989 cm(-1), 2852 cm(-1), 2875 cm(-1) and 2923 cm(-1). In HeLa cells viable and induced apoptosis could be distinguished by 1294 cm(-1), while four bands were different in Vero cells namely; 1626 cm(-1), 1741 cm(-1), 2852 cm(-1) 2923 cm(-1). Principal Component Analysis showed separation between the different types of cell death and the loadings plots indicated an increase in an additional band at 1623 cm(-1) in dead cells. FTIR spectroscopy can be developed into an invaluable tool for the assessment of specific types of chemically induced cell death with notably different molecular signatures depending on whether the cells are cancerous and mechanism of cell death. PMID:26254093

  9. Measurement of exhaled nitric oxide concentration in asthma: a systematic review and economic evaluation of NIOX MINO, NIOX VERO and NObreath.

    PubMed Central

    Harnan, Sue E; Tappenden, Paul; Essat, Munira; Gomersall, Tim; Minton, Jon; Wong, Ruth; Pavord, Ian; Everard, Mark; Lawson, Rod


    BACKGROUND High fractions of exhaled nitric oxide (FeNO) in the breath of patients with symptoms of asthma are correlated with high levels of eosinophils and indicate that a patient is likely to respond to inhaled corticosteroids. This may have a role in the diagnosis and management of asthma. OBJECTIVE To assess the diagnostic accuracy, clinical effectiveness and cost-effectiveness of the hand-held electrochemical devices NIOX MINO(®) (Aerocrine, Solna, Sweden), NIOX VERO(®) (Aerocrine) and NObreath(®) (Bedfont Scientific, Maidstone, UK) for the diagnosis and management of asthma. DATA SOURCES Systematic searches were carried out between March 2013 and April 2013 from database inception. Databases searched included MEDLINE, EMBASE, the Cochrane Database of Systematic Reviews, the Database of Abstracts of Reviews of Effects, Science Citation Index Expanded and Conference Proceedings Citation Index - Science. Trial registers such as and the metaRegister of Controlled Trials were also searched in March 2013. All searches were updated in September 2013. REVIEW METHODS A rapid review was conducted to assess the equivalence of hand-held and chemiluminescent FeNO monitors. Systematic reviews of diagnostic accuracy and management efficacy were conducted. A systematic review of economic analyses was also conducted and two de novo health economic models were developed. All three reviews were undertaken according to robust high-quality methodology. RESULTS The rapid review (27 studies) found varying levels of agreement between monitors (Bland-Altman 95% limits of agreement up to ±10 parts per billion), with better agreement at lower FeNO values. Correlation was good (generally r > 0.9). The diagnostic accuracy review identified 22 studies in adults (all ages) and four in children. No studies used NObreath or NIOX VERO and seven used NIOX MINO. Estimates of diagnostic accuracy varied widely. FeNO used in combination with another test altered diagnostic accuracy only slightly. High levels of heterogeneity precluded meta-analysis. Limited observations included that FeNO may be more reliable and useful as a rule-in than as a rule-out test; lower cut-off values in children and in smokers may be appropriate; and FeNO may be less reliable in the elderly. The management review identified five randomised controlled trials in adults, one in pregnant asthmatics and seven in children. Despite clinical heterogeneity, exacerbation rates were lower in all studies but not generally statistically significantly so. Effects on inhaled corticosteroid (ICS) use were inconsistent, possibly because of differences in management protocols, differential effectiveness in adults and children and differences in population severity. One UK diagnostic model and one management model were identified. Aerocrine also submitted diagnostic and management models. All had significant limitations including short time horizons and the selective use of efficacy evidence. The de novo diagnostic model suggested that the expected difference in quality-adjusted life-year (QALY) gains between diagnostic options is likely to be very small. Airway hyper-responsiveness by methacholine challenge test is expected to produce the greatest QALY gain but with an expected incremental cost-effectiveness ratio (ICER) compared with FeNO (NObreath) in combination with bronchodilator reversibility of £1.125M per QALY gained. All remaining options are expected to be dominated. The de novo management model indicates that the ICER of guidelines plus FeNO monitoring using NObreath compared with guidelines alone in children is expected to be approximately £45,200 per QALY gained. Within the adult subgroup, FeNO monitoring using NObreath compared with guidelines alone is expected to have an ICER of approximately £2100 per QALY gained. The results are particularly sensitive to assumptions regarding changes in ICS use over time, the number of nurse visits for FeNO monitoring and duration of effect. CONCLUSIONS Limitations of the evidence base impose considerable uncertainty on all analyses. Equivalence of devices was assumed but not assured. Evidence for diagnosis is difficult to interpret in the context of inserting FeNO monitoring into a diagnostic pathway. Evidence for management is also inconclusive, but largely consistent with FeNO monitoring resulting in fewer exacerbations, with a small or zero reduction in ICS use in adults and a possible increased ICS use in children or patients with more severe asthma. It is unclear which specific management protocol is likely to be most effective. The economic analysis indicates that FeNO monitoring could have value in diagnostic and management settings. The diagnostic model indicates that FeNO monitoring plus bronchodilator reversibility dominates many other diagnostic tests. FeNO-guided management has the potential to be cost-effective, although this is largely dependent on the duration of effect. The conclusions drawn from both models require strong technical value judgements with respect to several aspects of the decision problem in which little or no empirical evidence exists. There are many potential directions for further work, including investigations into which management protocol is best and long-term follow-up in both diagnosis and management studies. STUDY REGISTRATION This study is registered as PROSPERO CRD42013004149. FUNDING The National Institute for Health Research Health Technology Assessment programme. PMID:26484874

  10. Cytotoxic effects of mycotoxin combinations in mammalian kidney cells.


    Ruiz, María-José; Macáková, Petra; Juan-García, Ana; Font, Guillermina


    The cytotoxicity of three Fusarium mycotoxins (beauvericin, deoxynivalenol and T-2 toxin) has been investigated using the NR assay, after 24, 48 and 72h of incubation. The IC(50) values ranged from 6.77 to 11.08, 3.30 to 10.00 and 0.004 to 0.005 for beauvericin, deoxynivalenol and T-2 toxin, respectively. Once the potential interaction has been detected, a quantitative assessment is necessary to ensure and characterize these interactions, that is, each mycotoxin contributes to the toxic effect in accord with its own potency. Combination of mycotoxins was determined in Vero cells after 24, 48 and 72h of exposure. Isobolograms and median effect method of Chou and Talalay were used to assess the nature and quantitative aspects of interaction observed between studied mycotoxins. Median effect analysis was used to calculate the combination index (CI) with values >1 indicating synergism, 1 additive effect, and <1 antagonism. CI values of BEA+DON (1.22-2.74), BEA+T-2 toxin (1.43-5.89), DON+T-2 toxin (3.13-7.62) and BEA+DON+T-2 toxin (1.32-2.68) for 24, 48 and 72h produced antagonistic effects in Vero cells. The highest antagonistic effect in Vero cells was observed with binary DON and T-2 toxin mixture. PMID:21798303

  11. Response to copper of Acidithiobacillus ferrooxidans ATCC 23270 grown in elemental sulfur.


    Almrcegui, Rodrigo J; Navarro, Claudio A; Paradela, Alberto; Albar, Juan Pablo; von Bernath, Diego; Jerez, Carlos A


    The response of Acidithiobacillus ferrooxidans ATCC 23270 to copper was analyzed in sulfur-grown cells by using quantitative proteomics. Forty-seven proteins showed altered levels in cells grown in the presence of 50 mM copper sulfate. Of these proteins, 24 were up-regulated and 23 down-regulated. As seen before in ferrous iron-grown cells, there was a notorious up-regulation of RND-type Cus systems and different RND-type efflux pumps, indicating that these proteins are very important in copper resistance. Copper also triggered the down-regulation of the major outer membrane porin of A. ferrooxidans in sulfur-grown bacteria, suggesting they respond to the metal by decreasing the influx of cations into the cell. On the contrary, copper in sulfur-grown cells caused an overexpression of putative TadA and TadB proteins known to be essential for biofilm formation in bacteria. Surprisingly, sulfur-grown microorganisms showed increased levels of proteins related with energy generation (rus and petII operons) in the presence of copper. Although rus operon is overexpressed mainly in cells grown in ferrous iron, the up-regulation of rusticyanin in sulfur indicates a possible role for this protein in copper resistance as well. Finally, copper response in A. ferrooxidans appears to be influenced by the substrate being oxidized by the microorganism. PMID:25041950

  12. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.


    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  13. Infectious dengue vesicles derived from CD61+ cells in acute patient plasma exhibited a diaphanous appearance

    PubMed Central

    Hsu, Alan Yi-Hui; Wu, Shang-Rung; Tsai, Jih-Jin; Chen, Po-Lin; Chen, Ya-Ping; Chen, Tsai-Yun; Lo, Yu-Chih; Ho, Tzu-Chuan; Lee, Meed; Chen, Min-Ting; Chiu, Yen-Chi; Perng, Guey Chuen


    The levels of neutralizing antibody to a pathogen are an effective indicator to predict efficacy of a vaccine in trial. And yet not all the trial vaccines are in line with the theory. Using dengue virus (DENV) to investigate the viral morphology affecting the predictive value, we evaluated the viral morphology in acute dengue plasma compared to that of Vero cells derived DENV. The virions in plasma were infectious and heterogeneous in shape with a “sunny-side up egg” appearance, viral RNA was enclosed with CD61+ cell-derived membrane interspersed by the viral envelope protein, defined as dengue vesicles. The unique viral features were also observed from ex vivo infected human bone marrow. Dengue vesicles were less efficiently neutralized by convalescent patient serum, compared to virions produced from Vero cells. Our results exhibit a reason why potencies of protective immunity fail in vivo and significantly impact dengue vaccine and drug development. PMID:26657027

  14. Infectious dengue vesicles derived from CD61+ cells in acute patient plasma exhibited a diaphanous appearance.


    Hsu, Alan Yi-Hui; Wu, Shang-Rung; Tsai, Jih-Jin; Chen, Po-Lin; Chen, Ya-Ping; Chen, Tsai-Yun; Lo, Yu-Chih; Ho, Tzu-Chuan; Lee, Meed; Chen, Min-Ting; Chiu, Yen-Chi; Perng, Guey Chuen


    The levels of neutralizing antibody to a pathogen are an effective indicator to predict efficacy of a vaccine in trial. And yet not all the trial vaccines are in line with the theory. Using dengue virus (DENV) to investigate the viral morphology affecting the predictive value, we evaluated the viral morphology in acute dengue plasma compared to that of Vero cells derived DENV. The virions in plasma were infectious and heterogeneous in shape with a "sunny-side up egg" appearance, viral RNA was enclosed with CD61+ cell-derived membrane interspersed by the viral envelope protein, defined as dengue vesicles. The unique viral features were also observed from ex vivo infected human bone marrow. Dengue vesicles were less efficiently neutralized by convalescent patient serum, compared to virions produced from Vero cells. Our results exhibit a reason why potencies of protective immunity fail in vivo and significantly impact dengue vaccine and drug development. PMID:26657027

  15. Chromosome Conformation of Human Fibroblasts Grown in 3-Dimensional Spheroids

    PubMed Central

    Chen, Haiming; Comment, Nicholas; Chen, Jie; Ronquist, Scott; Hero, Alfred; Ried, Thomas; Rajapakse, Indika


    In the study of interphase chromosome organization, genome-wide chromosome conformation capture (Hi-C) maps are often generated using 2-dimensional (2D) monolayer cultures. These 2D cells have morphological deviations from cells that exist in 3-dimensional (3D) tissues in vivo, and may not maintain the same chromosome conformation. We used Hi-C maps to test the extent of differences in chromosome conformation between human fibroblasts grown in 2D cultures and those grown in 3D spheroids. Significant differences in chromosome conformation were found between 2D cells and those grown in spheroids. Intra-chromosomal interactions were generally increased in spheroid cells, with a few exceptions, while inter-chromosomal interactions were generally decreased. Overall, chromosomes located closer to the nuclear periphery had increased intra-chromosomal contacts in spheroid cells, while those located more centrally had decreased interactions. This study highlights the necessity to conduct studies on the topography of the interphase nucleus under conditions that mimic an in vivo environment. PMID:25738643

  16. Pathogenicity of Listeria monocytogenes grown on crabmeat.

    PubMed Central

    Brackett, R E; Beuchat, L R


    The pathogenicity of Listeria monocytogenes as influenced by growth on crabmeat at 5 and 10 degrees C was studied. Crabmeat was inoculated with L. monocytogenes V7 (ca. 10(4) CFU/g) and incubated for up to 14 days at 5 and 10 degrees C. At selected incubation times, L. monocytogenes was removed from crabmeat by washing with 0.1 M potassium phosphate buffer (pH 7.0), and populations were determined by surface plating on LiCl-phenylethanol-moxalactam agar. Buffered suspensions were then centrifuged, and the resulting pellets were suspended in phosphate buffer containing 10% glycerol and stored at -18 degrees C. Thawed, diluted suspensions of cells were tested for pathogenicity by intraperitoneal injection into immunocompromised and nonimmunocompromised mice. L. monocytogenes cells recovered from crabmeat and then recultured in tryptose phosphate broth (TPB), as well as cells which had not been passed through crabmeat but had been cultured in TPB, were likewise harvested, suspended in buffered 10% glycerol, frozen, thawed, diluted, and tested for pathogenicity by intraperitoneal injection. Growth on crabmeat at 5 and 10 degrees C did not have a significant effect on pathogenicity. The population of L. monocytogenes necessary to kill about 50% of the immunocompromised mice in each test set within 7 days was about 10(4) CFU, and this result was not significantly affected by storage temperature of the crabmeat or type of substrate, i.e., crabmeat or TPB, on which it had grown. PMID:2111120

  17. High-efficiency solar cells fabricated from direct-current magnetron sputtered n-indium tin oxide onto p-InP grown by atmospheric pressure metalorganic vapor phase epitaxy

    NASA Technical Reports Server (NTRS)

    Li, X.; Wanlass, M. W.; Gessert, T. A.; Emery, K. A.; Coutts, T. J.


    An attempt is made to improve device efficiencies by depositing indium tin oxide onto epitaxially grown p-InP on p(+)-InP substrates. This leads to a reduction in the device series resistance, high-quality reproducible surfaces, and an improvement in the transport properties of the base layer. Moreover, many of the facets associated with badly characterized bulk liquid encapsulated Czochralski substrates used in previous investigations are removed in this way.

  18. SU-E-J-70: Feasibility Study of Dynamic Arc and IMRT Treatment Plans Utilizing Vero Treatment Unit and IPlan Planning Computer for SRS/FSRT Brain Cancer Patients

    SciTech Connect

    Huh, S; Lee, S; Dagan, R; Malyapa, R; Mendenhall, N; Mendenhall, W; Ho, M; Hough, D; Yam, M; Li, Z


    Purpose: To investigate the feasibility of utilizing Dynamic Arc (DA) and IMRT with 5mm MLC leaf of VERO treatment unit for SRS/FSRT brain cancer patients with non-invasive stereotactic treatments. The DA and IMRT plans using the VERO unit (BrainLab Inc, USA) are compared with cone-based planning and proton plans to evaluate their dosimetric advantages. Methods: The Vero treatment has unique features like no rotational or translational movements of the table during treatments, Dynamic Arc/IMRT, tracking of IR markers, limitation of Ring rotation. Accuracies of the image fusions using CBCT, orthogonal x-rays, and CT are evaluated less than ∼ 0.7mm with a custom-made target phantom with 18 hidden targets. 1mm margin is given to GTV to determine PTV for planning constraints considering all the uncertainties of planning computer and mechanical uncertainties of the treatment unit. Also, double-scattering proton plans with 6F to 9F beams and typical clinical parameters, multiple isocenter plans with 6 to 21 isocenters, and DA/IMRT plans are evaluated to investigate the dosimetric advantages of the DA/IMRT for complex shape of targets. Results: 3 Groups of the patients are divided: (1) Group A (complex target shape), CI's are same for IMRT, and DGI of the proton plan are better by 9.5% than that of the IMRT, (2) Group B, CI of the DA plans (1.91+/−0.4) are better than cone-based plan, while DGI of the DA plan is 4.60+/−1.1 is better than cone-based plan (5.32+/−1.4), (3) Group C (small spherical targets), CI of the DA and cone-based plans are almost the same. Conclusion: For small spherical targets, cone-based plans are superior to other 2 plans: DS proton and DA plans. For complex or irregular plans, dynamic and IMRT plans are comparable to cone-based and proton plans for complex targets.

  19. Harvesting microalgae grown on wastewater.


    Udom, Innocent; Zaribaf, Behnaz H; Halfhide, Trina; Gillie, Benjamin; Dalrymple, Omatoyo; Zhang, Qiong; Ergas, Sarina J


    The costs and life cycle impacts of microalgae harvesting for biofuel production were investigated. Algae were grown in semi-continuous culture in pilot-scale photobioreactors under natural light with anaerobic digester centrate as the feed source. Algae suspensions were collected and the optimal coagulant dosages for metal salts (alum, ferric chloride), cationic polymer (Zetag 8819), anionic polymer (E-38) and natural coagulants (Moringa Oleifera and Opuntia ficus-indica cactus) were determined using jar tests. The relative dewaterability of the algae cake was estimated by centrifugation. Alum, ferric chloride and cationic polymer could all achieve >91% algae recovery at optimal dosages. Life cycle assessment (LCA) and cost analysis results revealed that cationic polymer had the lowest cost but the highest environmental impacts, while ferric chloride had the highest cost and lowest environmental impacts. Based on the LCA results, belt presses are the recommended algae dewatering technology prior to oil extraction. PMID:23648758

  20. Involvement of the stage-specific 82-kilodalton adhesion molecule of Trypanosoma cruzi metacyclic trypomastigotes in host cell invasion.

    PubMed Central

    Ramirez, M I; Ruiz, R de C; Araya, J E; Da Silveira, J F; Yoshida, N


    This study provides several pieces of evidence indicating that 3F6-Ag, identified by monoclonal antibody (MAb) 3F6 as a stage-specific glycoprotein of approximately 82 kDa on the surface of metacyclic trypomastigotes of different Trypanosoma cruzi strains, promotes the entry of parasites into host cells through a ligand-receptor type interaction. First, invasion of Vero cells by metacyclic trypomastigotes of both CL and Tulahuen strains was significantly inhibited by MAb 3F6 or its Fab fragments. Second, purified 3F6-Ag bound to Vero cells in a dose-dependent and saturable fashion. Third, soluble 3F6-Ag reduced the infection of Vero cells by metacyclic forms of CL and Tulahuen strains by 90 to 97 and 50%, respectively. Unrelated proteins, as well as extracellular matrix components, such as heparan sulfate and collagen, had no effect. Our studies also show that in the Tulahuen strain, 10D8-Ag, a 35/50-kDa glycoprotein identified by MAb 10D8, participates in target cell invasion, confirming previous observations, but the variant form of 10D8-Ag expressed by highly invasive CL strain metacyclic trypomastigotes appears to be irrelevant. Overall, our results indicate that the surface components of T. cruzi metacyclic trypomastigotes involved in the process of host cell penetration are developmentally regulated molecules, such as 3F6-Ag and 10D8-Ag, that have no counterpart in blood- or tissue culture-derived trypomastigotes. Images PMID:8359886

  1. Tissue grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)


    Cells from kidneys lose some of their special features in conventional culture but form spheres replete with specialized cell microvilli (hair) and synthesize hormones that may be clinically useful. Ground-based research studies have demonstrated that both normal and neoplastic cells and tissues recreate many of the characteristics in the NASA bioreactor that they display in vivo. Proximal kidney tubule cells that normally have rich apically oriented microvilli with intercellular clefts in the kidney do not form any of these structures in conventional two-dimensional monolayer culture. However, when normal proximal renal tubule cells are cultured in three-dimensions in the bioreactor, both the microvilli and the intercellular clefts form. This is important because, when the morphology is recreated, the function is more likely also to be rejuvenated. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC).

  2. [Use of continuous human and animal cell lines for the production of viral vaccines].


    Grachev, V P; Khapchaev, Iu Kh


    History of development of safety criteria for continuous human and animal cell lines approved for manufacture of immunobiologic preparations. It was noted that current WHO documents recommend mandatory use of respective WHO's reference cell cultures (Vero-10-87 for continuous cell lines, and Wi-38 or MRC-5 for diploid cell lines) during attestation of new cell cultures proposed for the manufacturing of immunobiologic preparations. Examples of practical use of continuous cell lines (CCLs) for production of viral vaccines on industrial scale are described. On the basis of modern data most important principles were formulated which should be considered to provide safety and efficacy of vaccines produced on the CCLs. PMID:18368760

  3. Listeria monocytogenes grown at 7 C shows reduced acid survival and an altered transcriptional response to acid shock compared to L. monocytogenes grown at 37 C.


    Ivy, R A; Wiedmann, M; Boor, K J


    Survival of the food-borne pathogen Listeria monocytogenes in acidic environments (e.g., in the human stomach) is vital to its transmission. Refrigerated, ready-to-eat foods have been sources of listeriosis outbreaks. The purpose of this study was to determine whether growth at a low temperature (i.e., 7C) affects L. monocytogenes survival or gene transcription after exposure to a simulated gastric environment (i.e., acid shock at 37C). L. monocytogenes cells grown at 7C were less resistant to artificial gastric fluid (AGF) or acidified brain heart infusion broth (ABHI) than bacteria grown at higher temperatures (i.e., 30C or 37C). For L. monocytogenes grown at 7C, stationary-phase cells were more resistant to ABHI than log-phase cells, indicating that both temperature and growth phase affect acid survival. Microarray transcriptomic analysis revealed that the number and functional categories of genes differentially expressed after acid shock differed according to both growth temperature and growth phase. The acid response of L. monocytogenes grown to log phase at 37C involved stress-related transcriptional regulators (i.e., ?(B), ?(H), CtsR, and HrcA), some of which have been implicated in adaptation to the intracellular environment. In contrast, for bacteria grown at 7C to stationary phase, acid exposure did not result in differential expression of the stress regulons examined. However, two large operons encoding bacteriophage-like proteins were induced, suggesting lysogenic prophage induction. The adaptive transcriptional response observed in 37C-grown cells was largely absent in 7C-grown cells, suggesting that temperatures commonly encountered during food storage and distribution affect the ability of L. monocytogenes to survive gastric passage and ultimately cause disease. PMID:22447604

  4. Vitamin C content of organically grown produce

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organically grown produce is the fastest growing sector of fresh market sales in the U.S. While accounting for only 3% of total produce sales, it is growing by 20% per year. There has been much debate over the relative health merits of organically grown fruits and vegetables. Most consumers believ...

  5. Nectin4 is an epithelial cell receptor for canine distemper virus and involved in neurovirulence.


    Pratakpiriya, Watanyoo; Seki, Fumio; Otsuki, Noriyuki; Sakai, Kouji; Fukuhara, Hideo; Katamoto, Hiromu; Hirai, Takuya; Maenaka, Katsumi; Techangamsuwan, Somporn; Lan, Nguyen Thi; Takeda, Makoto; Yamaguchi, Ryoji


    Canine distemper virus (CDV) uses signaling lymphocyte activation molecule (SLAM), expressed on immune cells, as a receptor. However, epithelial and neural cells are also affected by CDV in vivo. Wild-type CDV strains showed efficient replication with syncytia in Vero cells expressing dog nectin4, and the infection was blocked by an anti-nectin4 antibody. In dogs with distemper, CDV antigen was preferentially detected in nectin4-positive neurons and epithelial cells, suggesting that nectin4 is an epithelial cell receptor for CDV and also involved in its neurovirulence. PMID:22761370

  6. Rift Valley Fever Virus Incorporates the 78 kDa Glycoprotein into Virions Matured in Mosquito C6/36 Cells

    PubMed Central

    Weingartl, Hana M.; Zhang, Shunzhen; Marszal, Peter; McGreevy, Alan; Burton, Lynn; Wilson, William C.


    Rift Valley fever virus (RVFV), genus Phlebovirus, family Bunyaviridae is a zoonotic arthropod-borne virus able to transition between distant host species, causing potentially severe disease in humans and ruminants. Viral proteins are encoded by three genomic segments, with the medium M segment coding for four proteins: nonstructural NSm protein, two glycoproteins Gn and Gc and large 78 kDa glycoprotein (LGp) of unknown function. Goat anti-RVFV polyclonal antibody and mouse monoclonal antibody, generated against a polypeptide unique to the LGp within the RVFV proteome, detected this protein in gradient purified RVFV ZH501 virions harvested from mosquito C6/36 cells but not in virions harvested from the mammalian Vero E6 cells. The incorporation of LGp into the mosquito cell line - matured virions was confirmed by immune-electron microscopy. The LGp was incorporated into the virions immediately during the first passage in C6/36 cells of Vero E6 derived virus. Our data indicate that LGp is a structural protein in C6/36 mosquito cell generated virions. The protein may aid the transmission from the mosquitoes to the ruminant host, with a possible role in replication of RVFV in the mosquito host. To our knowledge, this is a first report of different protein composition between virions formed in insect C6/36 versus mammalian Vero E6 cells. PMID:24489907

  7. MBE grown iron-based nanostructures

    NASA Astrophysics Data System (ADS)

    Lok, Shu Kin

    Interest in magnetic nanostructures has increased rapidly because of their potential applications in a number of magnetic nanotechnologies such as high-density magnetic recording media, magnetic field sensors, magnetic nanoprobes for spin-polarized microscopy and cell manipulation in biomedical technology. Successful incorporation of ferromagnetic nanostructures in semiconductors may open a new area in spintronic applications. In this study, two kinds of Fe-based nanostructures were grown by the molecular beam epitaxy (MBE) technique, namely, Fe quantum dots (QDs) and Fe nanowires (NWs). For Fe QDs, a multilayer magnetic QD sample containing 5 layers of Fe QDs embedded in 6 layers of ZnS spacer was grown on a GaP(100) substrate. High resolution transmission electron microscopy (HRTEM) observations reveal that the Fe QDs are single crystalline with spherical shape of diameters around 3 to 4 nm and area density of 1.5 x 1012 cm-2 . Its zero-field cooled (ZFC) and field cooled (FC) curves measured at low field (100 Oe) show the magnetic relaxation effect with a blocking temperature around 26 K. The hysteresis loop measured at 5 K shows a coercivity of 83 Oe, confirming the slow relaxation process and coercivity enhancement attributed to the nanoparticle nature of the sample. To study the transport property of Fe QDs, a Au/ZnS/Fe-QDs/ZnS/n+-GaAs Schottky-barrier structure containing 5 layers of Fe QDs was fabricated on a n+-GaAs(100) substrate. Its current-voltage (I-V) characteristics measured from 5 to 295 K display negative differential resistance (NDR) for temperature . 50 K, which is caused by the presence of Fe QDs. The highest peak-to-valley current ratio obtained at 5 K is as high as 15:1. Staircase-like I-V characteristic was also observed at low temperature in some devices fabricated from this structure. Possible mechanisms that can account for the observed unusual I-V characteristics in this structure were discussed. Two types of self-assembled Fe NWs were grown on ZnS/GaP(100) surface under high growth/annealing temperature. The Type-A Fe NWs orient along the ZnS[110] direction with irregular shape, while the type-B Fe NWs orient along either the ZnS[180] or [810] direction with seemingly straight shape. Detailed HRTEM and selected area diffraction (SAD) studies reveal that both types were single-crystalline with their elongated axis along the Fe<100> direction family possibly due to the fact that the easy axis of Fe is along this direction. We have proposed a mean-field model to explain the slight misalignment of the type-B Fe NWs. The I-V characteristic of a single type-B Fe NW measured at room temperature displays a straight line nature corresponding to a resistivity about 2.3 x 10-7Om.

  8. Molecule diagram from space-grown crystals

    NASA Technical Reports Server (NTRS)


    Researchers' at Hauptman-Woodward Medical Research Institute, in Buffalo, N.Y. have analyzed the molecular structures of insulin crystals grown during Space Shuttle experiments and are unlocking the mystery of how insulin works.

  9. [Electron microscopic study of cell cultures chronically infected with fixed rabies virus].


    Ianova, N N; Bogomolova, N N


    HEp-2 and Vero cell cultures chronically infected with rabies virus were examined electron microscopically. In the cytoplasm and intercellular spaces of these cultures structures were found morphologically similar to virus particles previously described in cells acutely infected with rabies virus. The observed virus particles were elongated, oval or spherical in shape. Their inner structure appeared as homogeneous material of varying optic density surrounded with a 3-layer membrane. Changes in the ultrastructural organization of the infected cells were observed consisting in the appearance of lipid inclusions, formation of structures of concentrically packed membranes, formation of multilayer areas of the cell membrane. PMID:7269529

  10. Pyrophen Produced by Endophytic Fungi Aspergillus sp Isolated from Piper crocatum Ruiz and Pav Exhibits Cytotoxic Activity and Induces S Phase Arrest in T47D Breast Cancer Cells.


    Astuti, Puji; Erden, Willy; Wahyono; Wahyuono, Subagus; Hertiani, Triana


    Ethyl acetate extracts obtained from culture of endophytic fungi Aspergillus sp isolated from Piper crocatum Ruiz and Pav, have been shown to possess cytotoxic activity against T47D breast cancer cells. Investigations were here conducted to determine bioactive compounds responsible for the activity. Bioassay guided fractionation was employed to obtain active compounds. Structure elucidation was performed based on analysis of LC-MS, 1H-NMR, 13C-NMR, COSY, DEPT, HMQC, HMBC data. Cytotoxity assays were conducted in 96 well plates against T47D and Vero cell lines. Bioassay guided isolation and chemical investigation led to the isolation of pyrophen, a 4-methoxy-6-(1'-acetamido-2'-phenylethyl)-2H-pyran-2-one. Further analysis of its activity against T47D and Vero cells showed an ability to inhibit the growth of T47D cells with IC50 values of 9.2 ?g/mL but less cytotoxicity to Vero cells with an IC50 of 109 ?g/mL. This compound at a concentration of 400 ng/mL induced S-phase arrest in T47D cells. PMID:26925652

  11. Microwave Heating Inactivates Shiga Toxin (Stx2) in Reconstituted Fat-Free Milk and Adversely Affects the Nutritional Value of Cell Culture Medium.


    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel


    Microwave exposure is a convenient and widely used method for defrosting, heating, and cooking numerous foods. Microwave cooking is also reported to kill pathogenic microorganisms that often contaminate food. In this study, we tested whether microwaves would inactivate the toxicity of Shiga toxin 2 (Stx2) added to 5% reconstituted fat-free milk administered to monkey kidney Vero cells. Heating of milk spiked with Stx2 in a microwave oven using a 10% duty cycle (cycle period of 30 s) for a total of 165 kJ energy or thermal heating (pasteurization), widely used to kill pathogenic bacteria, did not destroy the biological effect of the toxin in the Vero cells. However, conventional heating of milk to 95 C for 5 min or at an increased microwave energy of 198 kJ reduced the Stx2 activity. Gel electrophoresis showed that exposure of the protein toxin to high-energy microwaves resulted in the degradation of its original structure. In addition, two independent assays showed that exposure of the cell culture medium to microwave energy of 198 kJ completely destroyed the nutritional value of the culture medium used to grow the Vero cells, possibly by damaging susceptible essential nutrients present in the medium. These observations suggest that microwave heating has the potential to destroy the Shiga toxin in liquid food. PMID:24669932

  12. Effect of growth conditions on heat resistance of Arizona bacteria grown in a chemostat.

    PubMed Central

    Ng, H


    The effects of various growth conditions on the heat resistance of Arizona bacteria grown in a continuous-culture device (chemostat) were studied. Using either glucose, NH4Cl, NaH2PO4, or MgCl2 as the rate-limiting nutrient, it was found that the heat resistance, in all cases depended on the dilution rate and, hence, growth rate of the culture. Cells grown at high dilution rates were less heat resistant than those grown at low dilution rates. If, however, the dilution rate was maintained at a constant rate, the higher the growth temperature, the more heat resistant were the cells. Also at any given dilution rate, the cells were most heat resistant when grown at a near neutral pH. Most survival curves were biphasic in shape, indicating the presence in the population of two fractions of cells, one fraction being more resistant than the other. The size of the more heat-resistant fraction varied from almost 100% in very slow-growing cultures to practically 0% in cultures grown at a dilution rate of 0.67 h-1. PMID:7103473

  13. Some karyological observations on plants grown in space

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.; Oconnor, S. A.


    Experiments were conducted to assess whether cell division in a plant root would be affected by prolonged exposure to microgravity. Root materials from sunflower, oat, and mung bean plants grown on STS-2 and STS-3 were utilized for the experiments. It is found that all oat, sunflower, and mung seedlings showed a reduced number of cells in division as they went through their first cell division cycle on earth when compared to their ground controls. A significant number of oat, mung, and sunflower plantlets exhibited random root orientation and the lack of strictly orthotropic growth of their shoot systems in the flight samples. In addition, it is found that the mung roots were apparently least affected in terms of their cytology despite the fact that their roots were often randomly oriented.

  14. Wood quality from fast-grown plantations

    SciTech Connect

    Zobel, B.


    As forestry becomes more intensive and as forestry operations move toward the tropical areas, an increasing proportion of the wood available to the industry will come from young, fast-grown plantations. The wood of such trees, especially from the conifers, is so different that it will have a major effect on utilization and product standards. Acceptability of wood from fast-grown plantations will change as solid wood and paper quality standards change. Some of the primary effects on wood and products from fast-grown plantations are discussed in this paper. The wood is very suitable for some products and poor for others. The paper reports on conifers and hardwoods separately, with a large section on Eucalyptus.

  15. Replication of Herpes Simplex Virus: Egress of Progeny Virus at Specialized Cell Membrane Sites

    PubMed Central

    Mingo, Rebecca M.; Han, Jun; Newcomb, William W.


    In the final stages of the herpes simplex virus 1 (HSV-1) life cycle, a viral nucleocapsid buds into a vesicle of trans-Golgi network (TGN)/endosome origin, acquiring an envelope and an outer vesicular membrane. The virus-containing vesicle then traffics to the plasma membrane where it fuses, exposing a mature virion. Although the process of directed egress has been studied in polarized epithelial cell lines, less work has been done in nonpolarized cell types. In this report, we describe a study of HSV-1 egress as it occurs in nonpolarized cells. The examination of infected Vero cells by electron, confocal, and total internal reflection fluorescence (TIRF) microscopy revealed that HSV-1 was released at specific pocket-like areas of the plasma membrane that were found along the substrate-adherent surface and cell-cell-adherent contacts. Both the membrane composition and cytoskeletal structure of egress sites were found to be modified by infection. The plasma membrane at virion release sites was heavily enriched in viral glycoproteins. Small glycoprotein patches formed early in infection, and virus became associated with these areas as they expanded. Glycoprotein-rich areas formed independently from virion trafficking as confirmed by the use of a UL25 mutant with a defect in capsid nuclear egress. The depolymerization of the cytoskeleton indicated that microtubules were important for the trafficking of virions and glycoproteins to release sites. In addition, the actin cytoskeleton was found to be necessary for maintaining the integrity of egress sites. When actin was depolymerized, the glycoprotein concentrations dispersed across the membrane, as did the surface-associated virus. Lastly, viral glycoprotein E appeared to function in a different manner in nonpolarized cells compared to previous studies of egress in polarized epithelial cells; the total amount of virus released at egress sites was slightly increased in infected Vero cells when gE was absent. However, gE was important for egress site formation, as Vero cells infected with gE deletion mutants formed glycoprotein patches that were significantly reduced in size. The results of this study are interpreted to indicate that the egress of HSV-1 in Vero cells is directed to virally induced, specialized egress sites that form along specific areas of the cell membrane. PMID:22532674

  16. Stability of Detached Grown Germanium Single Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Volz, M. P.; Cobb, S. D.; Motakef, S.; Szofran, F. R.; Curreri, Peter A. (Technical Monitor)


    Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years especially, under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 microns, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 microns. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be discussed in detail.

  17. Stability of Detached Grown Germanium Single Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Volz, M. P.; Cobb, S. D.; Vujisic, L.; Szofran, F. R.; Rose, M. Franklin (Technical Monitor)


    Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years, especially under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 micrometers, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5 mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 micrometers. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be discussed in detail.

  18. Cell Fusion by Canine Distemper Virus-Infected Cells

    PubMed Central

    Rankin, Anne M.; Fisher, Linda E.; Bussell, Robert H.


    AV3 cells (continuous human amnion) infected with the Onderstepoort strain of canine distemper virus produced cell fusion within 2 to 5 hr when added to AV3 cell monolayers. An apparent requirement for intact, infected cells was demonstrated by showing that (i) frozen-and-thawed infected cells failed to induce fusion, (ii) infected cells frozen in the presence of glycerol retained their ability to induce fusion, (iii) infected cells subjected to swelling in hypotonic buffer and homogenization lost their ability to fuse cells, and (iv) semipurified and concentrated virus preparations with infectivity titers as high as 107.5 mean tissue culture doses per ml failed to induce fusion within 5 hr. Preparations of intact, infected cells had a mean log10 ratio of infectivity to fusion activity of 3.6. Treatment with beta-propiolactone rendered the active preparations free from detectable infectivity while they retained their ability to cause cell fusion. Cycloheximide did not block the formation of syncytia in assay cells. This type of cell fusion was neutralized by canine distemper virus immune antisera, and measles virus immune sera showed a slight degree of cross-neutralization. Other cell lines, HEp-2, MA 139 (embryonic ferret lung), MA 104 (embryonic rhesus monkey kidney), and Vero (African green monkey kidney) were also susceptible. PMID:4644630

  19. Chloroplast avoidance movement is not functional in plants grown under strong sunlight.


    Higa, Takeshi; Wada, Masamitsu


    Chloroplast movement in nine climbing plant species was investigated. It is thought that chloroplasts generally escape from strong light to avoid photodamage but accumulate towards weak light to perform photosynthesis effectively. Unexpectedly, however, the leaves of climbing plants grown under strong sunlight showed very low or no chloroplast photorelocation responses to either weak or strong blue light when detected by red light transmittance through leaves. Direct observations of Cayratia japonica leaves, for example, revealed that the average number of chloroplasts in upper periclinal walls of palisade tissue cells was only 1.2 after weak blue-light irradiation and almost all of the chloroplasts remained at the anticlinal wall, the state of chloroplast avoidance response. The leaves grown under strong light have thin and columnar palisade tissue cells comparing with the leaves grown under low light. Depending on our analyses and our schematic model, the thinner cells in a unit leaf area have a wider total plasma membrane area, such that more chloroplasts can exist on the plasma membrane in the thinner cells than in the thicker cells in a unit leaf-area basis. The same strategy might be used in other plant leaves grown under direct sunlight. PMID:26586173

  20. Active protein and calcium hydroxyapatite bilayers grown by laser techniques for therapeutic applications.


    Motoc, M M; Axente, E; Popescu, C; Sima, L E; Petrescu, S M; Mihailescu, I N; Gyorgy, E


    Active protein and bioceramic calcium hydroxyapatite (HA) bilayers were grown by combining conventional pulsed laser deposition (PLD) and matrix-assisted pulsed laser evaporation (MAPLE) techniques. A pulsed UV KrF* excimer laser was used for the irradiations. The HA layers were grown by PLD. Proteins with antimicrobial action were attached to the bioceramic layers using MAPLE. The composite MAPLE targets were obtained by dissolving the proteins powder in distilled water. The crystalline status and chemical composition of the obtained structures were studied by X-ray diffractometry and Fourier transform infrared spectroscopy. The layers were grown for the design of advanced future metal implants coatings, ensuring both enhanced bone formation and localized antimicrobial therapy. Our results demonstrated that protein coatings improve bone cell proliferation in vitro. Immunofluorescence experiments show that actin filaments stretch throughout bone cells and sustain their optimal spreading. PMID:23427118

  1. Catabolic enzymes of the acetogen Butyribacterium methylotrophicum grown on single-carbon substrates.

    PubMed Central

    Kerby, R; Zeikus, J G


    When grown on formate, formate-CO, and methanol-CO, Butyribacterium methylotrophicum contained high levels of tetrahydrofolate (H4folate) and required enzymes, carbon monoxide dehydrogenase, formate dehydrogenase, and hydrogenase. The activities of methylene-H4folate reductase were comparable to other H4 folate activities (which ranged from 0.55 to 9.28 mumol/min per mg of protein) when measured by an improved procedure. The H4folate activities in formate-grown cells were twice those found in formate-CO-grown cells. This result correlated with a growth yield on formate that was one-half that on formate-CO. The stoichiometry of the formyl-H4folate synthetase reaction was 1 mol of ATP per 1 mol of formate. The methylene-H4folate dehydrogenase was NAD+ dependent. We conclude that B. methylotrophicum utilizes these enzymes in homoacetogenic catabolism. PMID:3316188


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Reports on the lycopene content of tomatoes vary widely with country and source of fruit (field, greenhouse, retail). This study was done to compare the lycopene content of organically grown tomatoes, and to compare fully red fruit to those ripened after harvest. Thirteen tomato cultivars (12 beef...

  3. Efflux Of Nitrate From Hydroponically Grown Wheat

    NASA Technical Reports Server (NTRS)

    Huffaker, R. C.; Aslam, M.; Ward, M. R.


    Report describes experiments to measure influx, and efflux of nitrate from hydroponically grown wheat seedlings. Ratio between efflux and influx greater in darkness than in light; increased with concentration of nitrate in nutrient solution. On basis of experiments, authors suggest nutrient solution optimized at lowest possible concentration of nitrate.

  4. Rice Plants Grown With and Without Endophytes

    USGS Multimedia Gallery

    These rice plants show the difference in growth of rice plants exposed to salt when grown with and without endophytes, which are mutually beneficial microscopic fungi that live in most plants. The plant on the left was colonized with a fungi that made it salt-tolerant, but it wasn't exposed to ...

  5. Grown-ups Ought To Know Better.

    ERIC Educational Resources Information Center

    Brightman, Samuel C.

    Among the articles by Sam Brightman collected in this volume from the newsletter, "Adult & Continuing Education Today (ACET)" are the following: "Grown-Ups Ought to Know Better"; "Adult Education: The Only Sure Factor Is Growth"; "Adult Education Important in This Election Year"; "Will Nursery School External Degree Programs Come Next?";…

  6. Molecule diagram from earth-grown crystals

    NASA Technical Reports Server (NTRS)


    Like many chemicals in the body, the three-dimensional structure of insulin is extremely complex. When grown on the ground, insulin crystals do not grow as large or as ordered as researchers desire--obscuring the blueprint of the insulin molecules.

  7. Increased outer membrane ornithine-containing lipid and lysozyme penetrability of Paracoccus denitrificans grown in a complex medium deficient in divalent cations.

    PubMed Central

    Wee, S; Wilkinson, B J


    Paracoccus denitrificans grown in a complex medium was highly susceptible to lysozyme, in contrast to cells grown in a complex medium supplemented with Mg2+ and Ca2+ or in a succinate-salts medium. The complex medium was deficient in divalent cations needed for optimum outer membrane stability. The major change in molecular compositions of outer membranes isolated from cells grown under the different conditions was a higher ratio of ornithine-containing lipid to phospholipid in complex-medium-grown cells (0.63) than in cells grown in complex medium with Mg2+ and Ca2+ (0.22) or in succinate-salts medium (0.14). We suggest that the dipolarionic ornithine-containing lipid is less dependent than acidic phospholipids on divalent cations for its incorporation into the outer membrane. PMID:3384812

  8. Influence of Na on Cu(In,Ga)Se2 solar cells grown on polyimide substrates at low temperature: Impact on the Cu(In,Ga)Se2/Mo interface

    NASA Astrophysics Data System (ADS)

    Caballero, R.; Kaufmann, C. A.; Eisenbarth, T.; Grimm, A.; Lauermann, I.; Unold, T.; Klenk, R.; Schock, H. W.


    There are still open questions regarding the nature of the positive effect of the presence of Na on the performance of Cu(In,Ga)Se2 based, chalcopyrite thin film solar cells, especially at low processing temperatures. Studying Cu(In,Ga)Se2 thin film devices fabricated from low-temperature coevaporated absorbers on polyimide substrates by admittance and J-V-T measurements, characteristic properties are identified for different amounts of Na present during the growth. A roll-over behavior can be directly correlated with the Na-content. X-ray photoelectron spectroscopy shows the development of a MoSe2 phase at the back contact of the device. Efficiencies of 15.1% with MgF2 antireflection coating are demonstrated.

  9. [Safety assessment of stevia rebaudiana bertoni grown in southeastern Mexico as food sweetener].


    Aranda-Gonzlez, Irma; Barbosa-Martn, Enrique; Toraya-Avils, Roco; Segura-Campos, Maira; Moguel-Ordoez, Yolanda; Betancur-Ancona, David


    Stevia rebaudiana leaves and their glycosides have been recently and significantly used so important as sweeteners. However, it has been reported an antihyperglycemic effect of the extract and a glycoside. The aim of this study was to quantify S. rebaudiana glycosides, assess cytotoxicity of the extract and its acute and chronic effect on blood glucose in animal models and in human. The glycosides of the Morita II and Criolla extract were quantified by HPLC, using a C18 column (250 mm x 4.6 mm and particle size of 5 uM) with UV detection at 210 nm, mobile phase of acetonitrile/sodium phosphate buffer 10 mmol/L, pH 2.6 (32:68 v/v). Cytotoxicity study was performed in Vero cells, whereas an intraperitoneal glucose tolerance test (IPGTT) and a chronic consumption assay (4 weeks) were executed in an animal model of diabetes; finally the glycemic index (G.I.) was determined in healthy individuals. The glycoside content is higher in the Morita variety II although both had a CC50 >300 ?g/mL. The areas under the curve of the IPGTT and fasting glucose of the animals were not significantly different (p> 0.05) and the I.G. extract was 11.11 %, which classifies the extract as low I.G. The extract of S. rebaudiana Morita II has a low glycemic index and, in the doses tested, is not cytotoxic nor has acute or chronic effect on blood sugar, which makes it a safe sweetener. PMID:25238836

  10. Human Colon Cancer Cells Cultivated in Space

    NASA Technical Reports Server (NTRS)


    Within five days, bioreactor cultivated human colon cancer cells (shown) grown in Microgravity on the STS-70 mission in 1995, had grown 30 times the volume of the control specimens on Earth. The samples grown in space had a higher level of cellular organization and specialization. Because they more closely resemble tumors found in the body, microgravity grown cell cultures are ideal for research purposes.

  11. Distinct impact of targeted actin cytoskeleton reorganization on mechanical properties of normal and malignant cells.


    Efremov, Yu M; Dokrunova, A A; Efremenko, A V; Kirpichnikov, M P; Shaitan, K V; Sokolova, O S


    The actin cytoskeleton is substantially modified in cancer cells because of changes in actin-binding protein abundance and functional activity. As a consequence, cancer cells have distinctive motility and mechanical properties, which are important for many processes, including invasion and metastasis. Here, we studied the effects of actin cytoskeleton alterations induced by specific nucleation inhibitors (SMIFH2, CK-666), cytochalasin D, Y-27632 and detachment from the surface by trypsinization on the mechanical properties of normal Vero and prostate cancer cell line DU145. The Young's modulus of Vero cells was 1300900 Pa, while the prostate cancer cell line DU145 exhibited significantly lower Young's moduli (600400 Pa). The Young's moduli exhibited a log-normal distribution for both cell lines. Unlike normal cells, cancer cells demonstrated diverse viscoelastic behavior and different responses to actin cytoskeleton reorganization. They were more resistant to specific formin-dependent nucleation inhibition, and reinforced their cortical actin after detachment from the substrate. This article is part of a Special Issue entitled: Mechanobiology. PMID:25970206

  12. miR-146a Attenuates Inflammatory Pathways Mediated by TLR4/NF-κB and TNFα to Protect Primary Human Retinal Microvascular Endothelial Cells Grown in High Glucose

    PubMed Central

    Ye, Eun-Ah; Steinle, Jena J.


    Pathological mechanisms underlying diabetic retinopathy are still not completely understood. Increased understanding of potential cellular pathways responsive to hyperglycemia is essential to develop novel therapeutic strategies for diabetic retinopathy. A growing body of evidence shows that microRNA (miRNA) play important roles in pathological mechanisms involved in diabetic retinopathy, as well as possessing potential as novel therapeutic targets. The hypothesis of this study was that miR-146a plays a key role in attenuating hyperglycemia-induced inflammatory pathways through reduced TLR4/NF-κB and TNFα signaling in primary human retinal microvascular endothelial cells (REC). We cultured human REC in normal (5 mM) glucose or transferred to high glucose medium (25 mM) for 3 days. Transfection was performed on REC with miRNA mimic (hsa-miR-146a-5p). Our results demonstrate that miR-146a expression was decreased in human REC cultured in high glucose. Overexpression of miR-146a using mimics reduced the levels of TLR4/NF-κB and TNFα in REC cultured in high glucose. Both MyD88-dependent and -independent signaling were decreased by miR-146a overexpression in REC in high glucose conditions. The results suggest that miR-146a is a potential therapeutic target for reducing inflammation in REC through inhibition of TLR4/NF-κB and TNFα. Our study will contribute to understanding of diabetic retinal pathology, as well as providing important clues to develop therapeutics for clinical applications.

  13. Transfer of a human preproinsulin gene containing plasmid into non-pancreatic mammalian cells.


    Walther, R; Leibiger, I; Kiessling, U; Sarrach, D; Zühlke, H


    A recombinant plasmid containing the human preproinsulin gene fused to the mouse metallothionein-I-promoter was transferred into Vero cells from a monkey kidney cell line by protoplast fusion. The transient formation of immunoreactive insulin was demonstrated by RIA and studied in the absence and in the presence of zinc and cadmium ions. The recombinant plasmid was encapsulated into reverse-phase evaporated vesicles and the influence of the sonication time on the encapsulated DNA has been studied. It was demonstrated that, although DNA fragmentation occurs, at least a part of the encapsulated DNA retains its biological activity. PMID:3240289

  14. Discovery of Novel Human and Animal Cells Infected by the Severe Acute Respiratory Syndrome Coronavirus by Replication-Specific Multiplex Reverse Transcription-PCR

    PubMed Central

    Gillim-Ross, Laura; Taylor, Jill; Scholl, David R.; Ridenour, Jared; Masters, Paul S.; Wentworth, David E.


    The severe acute respiratory syndrome coronavirus (SARS-CoV) is the causative agent of the recent outbreak of severe acute respiratory syndrome. VeroE6 cells, fetal rhesus monkey kidney cells, and human peripheral blood mononuclear cells were the only cells known to be susceptible to SARS-CoV. We developed a multiplex reverse transcription-PCR assay to analyze the susceptibility of cells derived from a variety of tissues and species to SARS-CoV. Additionally, productive infection was determined by titration of cellular supernatants. Cells derived from three species of monkey were susceptible to SARS-CoV. However, the levels of SARS-CoV produced differed by 4 log10. Mink lung epithelial cells (Mv1Lu) and R-Mix, a mixed monolayer of human lung-derived cells (A549) and mink lung-derived cells (Mv1Lu), are used by diagnostic laboratories to detect respiratory viruses (e.g., influenza virus); they were also infected with SARS-CoV, indicating that the practices of diagnostic laboratories should be examined to ensure appropriate biosafety precautions. Mv1Lu cells produce little SARS-CoV compared to that produced by VeroE6 cells, which indicates that they are a safer alternative for SARS-CoV diagnostics. Evaluation of cells permissive to other coronaviruses indicated that these cell types are not infected by SARS-CoV, providing additional evidence that SARS-CoV binds an alternative receptor. Analysis of human cells derived from lung, kidney, liver, and intestine led to the discovery that human cell lines were productively infected by SARS-CoV. This study identifies new cell lines that may be used for SARS-CoV diagnostics and/or basic research. Our data and other in vivo studies indicate that SARS-CoV has a wide host range, suggesting that the cellular receptor(s) utilized by SARS-CoV is highly conserved and is expressed by a variety of tissues. PMID:15243082

  15. Effect of Photon Fluence Rate on Oxygen Evolution and Uptake by Chlamydomonas reinhardtii Suspensions Grown in Ambient and CO(2)-Enriched Air.


    Sueltemeyer, D F; Klug, K; Fock, H P


    A closed system consisting of an assimilation chamber furnished with a membrane inlet from the liquid phase connected to a mass spectrometer was used to measure O(2) evolution and uptake by Chlamydomonas reinhardtii cells grown in ambient (0.034% CO(2)) or CO(2)-enriched (5% CO(2)) air. At pH = 6.9, 28 degrees C and concentrations of dissolved inorganic carbon (DIC) saturating for photosynthesis, O(2) uptake in the light (U(o)) equaled O(2) production (E(o)) at the light compensation point (15 micromoles photons per square meter per second). E(o) and U(o) increased with increasing photon fluence rate (PFR) but were not rate saturated at 600 micromoles photons per square meter per second, while net O(2) exchange reached a saturation level near 500 micromoles photons per square meter per second which was nearly the same for both, CO(2)-grown and air-grown cells. Comparison of the U(o)/E(o) ratios between air-grown and CO(2)-grown C. reinhardtii showed higher values for air-grown cells at light intensities higher than light compensation. For both, air-grown and CO(2)-grown algae the rates of mitochondrial O(2) uptake in the dark measured immediately before and 5 minutes after illumination were much lower than U(o) at PFR saturating for net photosynthesis. We conclude that noncyclic electron flow from water to NADP(+) and pseudocyclic electron flow via photosystem I to O(2) both significantly contribute to O(2) exchange in the light. In contrast, mitochondrial respiration and photosynthetic carbon oxidation cycle are regarded as minor O(2) consuming reactions in the light in both, air-grown and CO(2)-grown cells. It is suggested that the "extra" O(2) uptake by air-grown algae provides ATP required for the energy dependent CO(2)/HCO(3) (-) concentrating mechanism known to be present in these cells. PMID:16664823

  16. Lethal photosensitization of biofilm-grown bacteria

    NASA Astrophysics Data System (ADS)

    Wilson, Michael


    Antibacterial agents are increasingly being used for the prophylaxis and treatment of oral diseases. As these agents can be rendered ineffective by resistance development in the target organisms there is a need to develop alternative antimicrobial approaches. Light-activated antimicrobial agents release singlet oxygen and free radicals which can kill adjacent bacteria and a wide range of cariogenic and periodontopathogenic bacteria has been shown to be susceptible to such agents. In the oral cavity these organisms are present as biofilms (dental plaques) which are less susceptible to traditional antimicrobial agents than bacterial suspensions. The results of these studies have shown that biofilm-grown oral bacteria are also susceptible to lethal photosensitization although the light energy doses required are grater than those needed to kill the organisms when they are grown as aqueous suspensions.

  17. Counting molecular-beam grown graphene layers

    NASA Astrophysics Data System (ADS)

    Plaut, Annette S.; Wurstbauer, Ulrich; Pinczuk, Aron; Garcia, Jorge M.; Pfeiffer, Loren N.


    We have used the ratio of the integrated intensity of graphene's Raman G peak to that of the silicon substrate's first-order optical phonon peak, accurately to determine the number of graphene layers across our molecular-beam (MB) grown graphene films. We find that these results agree well both, with those from our own exfoliated single and few-layer graphene flakes, and with the results of Koh et al. [ACS Nano 5, 269 (2011)]. We hence distinguish regions of single-, bi-, tri-, four-layer, etc., graphene, consecutively, as we scan coarsely across our MB-grown graphene. This is the first, but crucial, step to being able to grow, by such molecular-beam-techniques, a specified number of large-area graphene layers, to order.

  18. Counting molecular-beam grown graphene layers

    SciTech Connect

    Plaut, Annette S.; Wurstbauer, Ulrich; Pinczuk, Aron; Department of Applied Physics and Applied Mathematics, Columbia University, New York, New York 10027 ; Garcia, Jorge M.; Pfeiffer, Loren N.


    We have used the ratio of the integrated intensity of graphene's Raman G peak to that of the silicon substrate's first-order optical phonon peak, accurately to determine the number of graphene layers across our molecular-beam (MB) grown graphene films. We find that these results agree well both, with those from our own exfoliated single and few-layer graphene flakes, and with the results of Koh et al.[ACS Nano 5, 269 (2011)]. We hence distinguish regions of single-, bi-, tri-, four-layer, etc., graphene, consecutively, as we scan coarsely across our MB-grown graphene. This is the first, but crucial, step to being able to grow, by such molecular-beam-techniques, a specified number of large-area graphene layers, to order.

  19. Characterization of cellulolytic bacterial cultures grown in different substrates.


    Alshelmani, Mohamed Idris; Loh, Teck Chwen; Foo, Hooi Ling; Lau, Wei Hong; Sazili, Awis Qurni


    Nine aerobic cellulolytic bacterial cultures were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ) and the American Type Culture Collection (ATCC). The objectives of this study were to characterize the cellulolytic bacteria and to determine the optimum moisture ratio required for solid state fermentation (SSF) of palm kernel cake (PKC). The bacteria cultures were grown on reconstituted nutrient broth, incubated at 30°C and agitated at 200 rpm. Carboxymethyl cellulase, xylanase, and mannanase activities were determined using different substrates and after SSF of PKC. The SSF was conducted for 4 and 7 days with inoculum size of 10% (v/w) on different PKC concentration-to-moisture ratios: 1 : 0.2, 1 : 0.3, 1 : 0.4, and 1 : 0.5. Results showed that Bacillus amyloliquefaciens 1067 DSMZ, Bacillus megaterium 9885 ATCC, Paenibacillus curdlanolyticus 10248 DSMZ, and Paenibacillus polymyxa 842 ATCC produced higher enzyme activities as compared to other bacterial cultures grown on different substrates. The cultures mentioned above also produced higher enzyme activities when they were incubated under SSF using PKC as a substrate in different PKC-to-moisture ratios after 4 days of incubation, indicating that these cellulolytic bacteria can be used to degrade and improve the nutrient quality of PKC. PMID:24319380

  20. Characterization of Cellulolytic Bacterial Cultures Grown in Different Substrates

    PubMed Central

    Alshelmani, Mohamed Idris; Loh, Teck Chwen; Foo, Hooi Ling; Sazili, Awis Qurni


    Nine aerobic cellulolytic bacterial cultures were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ) and the American Type Culture Collection (ATCC). The objectives of this study were to characterize the cellulolytic bacteria and to determine the optimum moisture ratio required for solid state fermentation (SSF) of palm kernel cake (PKC). The bacteria cultures were grown on reconstituted nutrient broth, incubated at 30°C and agitated at 200 rpm. Carboxymethyl cellulase, xylanase, and mannanase activities were determined using different substrates and after SSF of PKC. The SSF was conducted for 4 and 7 days with inoculum size of 10% (v/w) on different PKC concentration-to-moisture ratios: 1 : 0.2, 1 : 0.3, 1 : 0.4, and 1 : 0.5. Results showed that Bacillus amyloliquefaciens 1067 DSMZ, Bacillus megaterium 9885 ATCC, Paenibacillus curdlanolyticus 10248 DSMZ, and Paenibacillus polymyxa 842 ATCC produced higher enzyme activities as compared to other bacterial cultures grown on different substrates. The cultures mentioned above also produced higher enzyme activities when they were incubated under SSF using PKC as a substrate in different PKC-to-moisture ratios after 4 days of incubation, indicating that these cellulolytic bacteria can be used to degrade and improve the nutrient quality of PKC. PMID:24319380

  1. Chirality of electrodeposits grown in a magnetic field.


    Mhochin, T R N; Coey, J M D


    Electrodeposits grown around a point cathode in a flat, horizontal electrochemical cell have fractal form. When grown in the presence of a perpendicular applied magnetic field, the deposits develop a spiral structure with chirality which reverses on switching the field direction. These structures are modeled numerically using biased variants of the diffusion limited aggregation (DLA) model. The effects of electric and magnetic fields are modeled successfully by varying the probabilities that a random walker will move in a given direction as a result of a Coulomb force and the Lorentz force-induced flow of electrolyte past the deposit surface. By contrast, a numerical model which considers only the effect of the Lorentz force on individual ions, without reference to the surface of the growing deposit, produces spiral structures with incorrect chirality. The modified DLA model is related to the differential equations for diffusion, migration, and convection. Length scales in the problem are understood by associating the step length of the random walker with the diffusion layer thickness, the lookup radius with the hydrodynamic boundary layer thickness and a point on the numerical deposit with a nucleation center for growth of a crystallite. PMID:15244565

  2. Mineral composition of organically grown tomato

    NASA Astrophysics Data System (ADS)

    Ghambashidze, Giorgi


    In recent years, consumer concerns on environmental and health issues related to food products have increased and, as a result, the demand for organically grown production has grown. Results indicate that consumers concerned about healthy diet and environmental degradation are the most likely to buy organic food, and are willing to pay a high premium. Therefore, it is important to ensure the quality of the produce, especially for highly consumed products. The tomato (Lycopersicon esculentum) is one of the most widely consumed fresh vegetables in the world. It is also widely used by the food industries as a raw material for the production of derived products such as purees or ketchup. Consequently, many investigations have addressed the impact of plant nutrition on the quality of tomato fruit. The concentrations of minerals (P, Na, K, Ca and Mg) and trace elements (Cu, Zn and Mn) were determined in tomatoes grown organically in East Georgia, Marneuli District. The contents of minerals and Mn seem to be in the range as shown in literature. Cu and Zn were found in considerably high amounts in comparison to maximum permissible values established in Georgia. Some correlations were observed between the minerals and trace elements studied. K and Mg were strongly correlated with Cu and Zn. Statistically significant difference have shown also P, K and Mg based between period of sampling.

  3. Morphometric analyses of petioles of seedlings grown in a spaceflight experiment.


    Johnson, Christina M; Subramanian, Aswati; Edelmann, Richard E; Kiss, John Z


    Gravity is a constant unidirectional stimulus on Earth, and gravitropism in plants involves three phases: perception, transduction, and response. In shoots, perception takes place within the endodermis. To investigate the cellular machinery of perception in microgravity, we conducted a spaceflight study with Arabidopsis thaliana seedlings, which were grown in microgravity in darkness using the Biological Research in Canisters (BRIC) hardware during space shuttle mission STS-131. In the 14-day-old etiolated plants, we studied seedling development and the morphological parameters of the endodermal cells in the petiole. Seedlings from the spaceflight experiment (FL) were compared to a ground control (GC), which both were in the BRIC flight hardware. In addition, to assay any potential effects from growth in spaceflight hardware, we performed another control by growing seedlings in Petri dishes in standard laboratory conditions (termed the hardware control, HC). Seed germination was significantly lower in samples grown in flight hardware (FL, GC) compared to the HC. In terms of cellular parameters of endodermal cells, the greatest differences also were between seedlings grown in spaceflight hardware (FL, GC) compared to those grown outside of this hardware (HC). Specifically, the endodermal cells were significantly smaller in seedlings grown in the BRIC system compared to those in the HC. However, a change in the shape of the cell, suggesting alterations in the cell wall, was one parameter that appears to be a true microgravity effect. Taken together, our results suggest that caution must be taken when interpreting results from the increasingly utilized BRIC spaceflight hardware system and that it is important to perform additional ground controls to aid in the analysis of spaceflight experiments. PMID:26376793

  4. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2011 CFR


    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat...

  5. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat...

  6. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2014 CFR


    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... (INSPECTION, CERTIFICATION, AND STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long...

  7. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2012 CFR


    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat...

  8. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2013 CFR


    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... (INSPECTION, CERTIFICATION, AND STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long...

  9. Sonochemically grown 1D ZnO nanostructures and their applications

    NASA Astrophysics Data System (ADS)

    Bayam, Yavuz; Rodrigues, Debora; Atalay, Ramazan; Zafer, Ceylan; Okur, Salih; Bala, Rukayya K.; Okyay, Tugba O.; Gültekin, Burak; Caha, Ihsan; Tural, Enis E.; Duyar, Sinem; Özbek, Cebrail; Guler, Telat


    Sonochemical growth technique is based upon the chemical effect of ultrasound on chemical reactions. This process is carried out at an ambient atmosphere without the need for a complex experimental set up and additional heating. This method is of significant importance because of it's vital application in various fields. ZnO nanorods were grown on glass substrates without any additional heat or surfactance by sonochemical growth technique. The grown nanostructures were characterized by Raman spectroscopy, scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). Sonochemically grown ZnO nanorod networks were characterized for their antibacterial properties toward B.subtilis. These structures were also characterized for their CO sensing properties and photovoltaic performances for dye sensitized solar cell (DSSC) application. All material characterization and device performances suggest that sonochemsitry can be utilized as an alternative growth method for 1D ZnO nanostructures.

  10. Lipid accumulation by Rhodococcus rhodochrous grown on glucose.


    Shields-Menard, Sara A; Amirsadeghi, Marta; Sukhbaatar, Badamkhand; Revellame, Emmanuel; Hernandez, Rafael; Donaldson, Janet R; French, W Todd


    Biodiesel is an alternative fuel made from costly vegetable oil feedstocks. Some microorganisms can accumulate lipids when nutrients are limited and carbon is in excess. Rhodococcus rhodochrous is a gram-positive bacterium most often used in bioremediation or acrylamide production. The purpose of this study was to investigate and characterize the lipid accumulation capabilities of R. rhodochrous. Shake flasks and a large-scale fermentation were used to cultivate R. rhodochrous in varying concentrations of glucose. R. rhodochrous achieved almost 50 % of dry cell mass as lipid when grown in 20 g/L of glucose. Wax esters and triglycerides were identified in R. rhodochrous lipid extract. The transesterified extractables of R. rhodochrous consisted of mostly palmitic (35 %) and oleic (42 %) acid methyl esters. This study shows R. rhodochrous to be an oleaginous bacterium with potential for application in alternative fuels. PMID:25656153

  11. Listeria monocytogenes Grown at 7°C Shows Reduced Acid Survival and an Altered Transcriptional Response to Acid Shock Compared to L. monocytogenes Grown at 37°C

    PubMed Central

    Ivy, R. A.; Wiedmann, M.


    Survival of the food-borne pathogen Listeria monocytogenes in acidic environments (e.g., in the human stomach) is vital to its transmission. Refrigerated, ready-to-eat foods have been sources of listeriosis outbreaks. The purpose of this study was to determine whether growth at a low temperature (i.e., 7°C) affects L. monocytogenes survival or gene transcription after exposure to a simulated gastric environment (i.e., acid shock at 37°C). L. monocytogenes cells grown at 7°C were less resistant to artificial gastric fluid (AGF) or acidified brain heart infusion broth (ABHI) than bacteria grown at higher temperatures (i.e., 30°C or 37°C). For L. monocytogenes grown at 7°C, stationary-phase cells were more resistant to ABHI than log-phase cells, indicating that both temperature and growth phase affect acid survival. Microarray transcriptomic analysis revealed that the number and functional categories of genes differentially expressed after acid shock differed according to both growth temperature and growth phase. The acid response of L. monocytogenes grown to log phase at 37°C involved stress-related transcriptional regulators (i.e., σB, σH, CtsR, and HrcA), some of which have been implicated in adaptation to the intracellular environment. In contrast, for bacteria grown at 7°C to stationary phase, acid exposure did not result in differential expression of the stress regulons examined. However, two large operons encoding bacteriophage-like proteins were induced, suggesting lysogenic prophage induction. The adaptive transcriptional response observed in 37°C-grown cells was largely absent in 7°C-grown cells, suggesting that temperatures commonly encountered during food storage and distribution affect the ability of L. monocytogenes to survive gastric passage and ultimately cause disease. PMID:22447604

  12. Three distinct quinoprotein alcohol dehydrogenases are expressed when Pseudomonas putida is grown on different alcohols.

    PubMed Central

    Toyama, H; Fujii, A; Matsushita, K; Shinagawa, E; Ameyama, M; Adachi, O


    A bacterial strain that can utilize several kinds of alcohols as its sole carbon and energy sources was isolated from soil and tentatively identified as Pseudomonas putida HK5. Three distinct dye-linked alcohol dehydrogenases (ADHs), each of which contained the prosthetic group pyrroloquinoline quinone (PQQ), were formed in the soluble fractions of this strain grown on different alcohols. ADH I was formed most abundantly in the cells grown on ethanol and was similar to the quinoprotein ADH reported for P. putida (H. Grisch and M. Rupp, Antonie Leeuwenhoek 56:35-45, 1989) except for its isoelectric point. The other two ADHs, ADH IIB and ADH IIG, were formed separately in the cells grown on 1-butanol and 1,2-propanediol, respectively. Both of these enzymes contained heme c in addition to PQQ and functioned as quinohemoprotein dehydrogenases. Potassium ferricyanide was an available electron acceptor for ADHs IIB and IIG but not for ADH I. The molecular weights were estimated to be 69,000 for ADH IIB and 72,000 for ADH IIG, and both enzymes were shown to be monomers. Antibodies raised against each of the purified ADHs could distinguish the ADHs from one another. Immunoblot analysis showed that ADH I was detected in cells grown on each alcohol tested, but ethanol was the most effective inducer. ADH IIB was formed in the cells grown on alcohols of medium chain length and also on 1,3-butanediol. Induction of ADH IIG was restricted to 1,2-propanediol or glycerol, of which the former alcohol was more effective. These results from immunoblot analysis correlated well with the substrate specificities of the respective enzymes. Thus, three distinct quinoprotein ADHs were shown to be synthesized by a single bacterium under different growth conditions. PMID:7730276

  13. Cytotoxicity of municipal solid waste incinerator ash wastes toward mammalian kidney cell lines.


    Huang, Wu-Jang; Tsai, Jia-Lin; Liao, Ming-Huei


    In this study, three municipal solid waste incinerator (MSWI) ash wastes-bottom ash, scrubber residue, and baghouse ash-were extracted using a toxicity characteristic leaching procedure (TCLP) extractant. These so-called final TCLP extracts were applied to African green monkey kidney cells (Vero), baby hamster kidney cells (BHK-21), and pig kidney cells (PK-15), multi-well absorption reader analysis was performed to test how the cytotoxicity of the incineration ashes would affect the digestive systems of animals. Ion-coupled plasma analyses indicated that the baghouse ash extract possessed the highest pH and heavy metal concentration, its cytotoxicity was also the highest. In contrast, the bottom ash and the scrubber residue exhibited very low cytotoxicities. The cytotoxicities of mixtures of baghouse ash and scrubber residue toward the three tested cell lines increased as the relative ratio of the baghouse ash increased, especially for the Vero cells. The slight cytotoxicity of the scrubber residue arose mainly from the presence of Cr species, whereas the high cytotoxicity of the baghouse ash resulted from its high content of heavy metals and alkali ions. In addition, it appears that the dissolved total organic carbon content of these ash wastes can reduce the cytotoxicity of ash wastes that collect in animal cells. PMID:18329068

  14. Akabane Virus Utilizes Alternative Endocytic Pathways to Entry into Mammalian Cell Lines

    PubMed Central

    BANGPHOOMI, Norasuthi; TAKENAKA-UEMA, Akiko; SUGI, Tatsuki; KATO, Kentaro; AKASHI, Hiroomi; HORIMOTO, Taisuke


    ABSTRACT The entry mechanisms of Akabane virus (AKAV), Bunyaviridae family, have not yet been determined. In this study, chemical inhibitors were used to analyze endocytic mechanisms during AKAV infection of mammalian cell lines. The analyses using drug treatments followed by quantitative measurement of viral RNA and N protein revealed that AKAV enters non-bovine-derived cell lines (Vero, HmLu-1 and BHK cells) in a manner indicative of clathrin endocytosis. By contrast, AKAV infection in bovine-derived cell lines (LB9.K and MDBK cells) is independent of this pathway. Further analyses indicated that AKAV entry into bovine cell lines involves a non-clathrin, non-caveolae endocytic pathway that is dependent on dynamin. We conclude that although both cell types require a low pH for AKAV penetration, AKAV utilizes alternative entry pathways into mammalian cell lines. PMID:25056673

  15. Cell lines that support replication of a novel herpes simplex virus 1 U{sub L}31 deletion mutant can properly target U{sub L}34 protein to the nuclear rim in the absence of U{sub L}31

    SciTech Connect

    Liang Li; Tanaka, Michiko; Kawaguchi, Yasushi; Baines, Joel D. . E-mail:


    Previous results indicated that the herpes simplex virus 1 (HSV-1) U{sub L}31 gene is necessary and sufficient for localization of the U{sub L}34 protein exclusively to the nuclear membrane of infected Hep2 cells. In the current studies, a bacterial artificial chromosome containing the entire HSV-1 strain F genome was used to construct a recombinant viral genome in which a gene encoding kanamycin resistance was inserted in place of 262 codons of the 306 codon U{sub L}31 open reading frame. The deletion virus produced virus titers approximately 10- to 50-fold lower in rabbit skin cells, more than 2000-fold lower in Vero cells, and more than 1500-fold lower in CV1 cells, compared to a virus bearing a restored U{sub L}31 gene. The replication of the U{sub L}31 deletion virus was restored on U{sub L}31-complementing cell lines derived either from rabbit skin cells or CV1 cells. Confocal microscopy indicated that the majority of U{sub L}34 protein localized aberrantly in the cytoplasm and nucleoplasm of Vero cells and CV1 cells, whereas U{sub L}34 protein localized at the nuclear membrane in rabbit skin cells, and U{sub L}31 complementing CV1 cells infected with the U{sub L}31 deletion virus. We conclude that rabbit skin cells encode a function that allows proper localization of U{sub L}34 protein to the nuclear membrane. We speculate that this function partially complements that of U{sub L}31 and may explain why U{sub L}31 is less critical for replication in rabbit skin cells as opposed to Vero and CV1 cells.

  16. Phytochemical phenolics in organically grown vegetables.


    Young, Janice E; Zhao, Xin; Carey, Edward E; Welti, Ruth; Yang, Shie-Shien; Wang, Weiqun


    Fruit and vegetable intake is inversely correlated with risks for several chronic diseases in humans. Phytochemicals, and in particular, phenolic compounds, present in plant foods may be partly responsible for these health benefits through a variety of mechanisms. Since environmental factors play a role in a plant's production of secondary metabolites, it was hypothesized that an organic agricultural production system would increase phenolic levels. Cultivars of leaf lettuce, collards, and pac choi were grown either on organically certified plots or on adjacent conventional plots. Nine prominent phenolic agents were quantified by HPLC, including phenolic acids (e. g. caffeic acid and gallic acid) and aglycone or glycoside flavonoids (e. g. apigenin, kaempferol, luteolin, and quercetin). Statistically, we did not find significant higher levels of phenolic agents in lettuce and collard samples grown organically. The total phenolic content of organic pac choi samples as measured by the Folin-Ciocalteu assay, however, was significantly higher than conventional samples (p < 0.01), and seemed to be associated with a greater attack the plants in organic plots by flea beetles. These results indicated that although organic production method alone did not enhance biosynthesis of phytochemicals in lettuce and collards, the organic system provided an increased opportunity for insect attack, resulting in a higher level of total phenolic agents in pac choi. PMID:16302198

  17. Recrystallization phenomena of solution grown paraffin dendrites

    NASA Astrophysics Data System (ADS)

    Hollander, F. F. A.; Stasse, O.; van Suchtelen, J.; van Enckevort, W. J. P.


    Paraffin crystals were grown from decane solutions using a micro-Bridgman set up for in-situ observation of the morphology at the growth front. It is shown that for large imposed velocities, dendrites are obtained. After dendritic growth, aging or recrystallization processes set in rather quickly, changing the crystal shapes considerably from the well-known dendritic shapes of melt grown dendrites. It is shown that several factors may cause these post-growth shape transitions: surface minimization, uptake and subsequent sweating of solvent material, and polymorphic phase conversion. It is shown that the first two recrystallization mechanisms are the most important for tricosane (n-C 23H 48) and pentacosane (n-C 25H 52) dendrites. Surface minimization by increasing the thickness of the crystals is particularly favorable. For dotriacontane (n-C 32H 66) dendrites, the recrystallization behavior appears to be less dramatic. It is shown that the uptake and sweating out of solvent material afterwards may lead to formation of holes within the dendrites.

  18. Magnetization dynamics of cobalt grown on graphene

    SciTech Connect

    Berger, A. J.; White, S. P.; Adur, R.; Pu, Y.; Hammel, P. C.; Amamou, W.; Kawakami, R. K.


    Ferromagnetic resonance (FMR) spin pumping is a rapidly growing field which has demonstrated promising results in a variety of material systems. This technique utilizes the resonant precession of magnetization in a ferromagnet to inject spin into an adjacent non-magnetic material. Spin pumping into graphene is attractive on account of its exceptional spin transport properties. This article reports on FMR characterization of cobalt grown on chemical vapor deposition graphene and examines the validity of linewidth broadening as an indicator of spin pumping. In comparison to cobalt samples without graphene, direct contact cobalt-on-graphene exhibits increased FMR linewidthan often used signature of spin pumping. Similar results are obtained in Co/MgO/graphene structures, where a 1?nm MgO layer acts as a tunnel barrier. However, magnetometry, magnetic force microscopy, and Kerr microscopy measurements demonstrate increased magnetic disorder in cobalt grown on graphene, perhaps due to changes in the growth process and an increase in defects. This magnetic disorder may account for the observed linewidth enhancement due to effects such as two-magnon scattering or mosaicity. As such, it is not possible to conclude successful spin injection into graphene from FMR linewidth measurements alone.

  19. The antioxidant butylated hydroxyanisole potentiates the toxic effects of propylparaben in cultured mammalian cells.


    Martn, Jos Manuel Prez; Freire, Paloma Fernndez; Daimiel, Lidia; Martnez-Botas, Javier; Snchez, Covadonga Martn; Lasuncin, Miguel ngel; Peropadre, Ana; Hazen, Mara Jos


    Butylated hydroxyanisole and propylparaben are phenolic preservatives commonly used in food, pharmaceutical and personal care products. Both chemicals have been subjected to extensive toxicological studies, due to the growing concern regarding their possible impacts on environmental and human health. However, the cytotoxicity and underlying mechanisms of co-exposure to these compounds have not been explored. In this study, a set of relevant cytotoxicity endpoints including cell viability and proliferation, oxidative stress, DNA damage and gene expression changes were analyzed to assess whether the antioxidant butylated hydroxyanisole could prevent the pro-oxidant effects caused by propylparaben in Vero cells. We demonstrated that binary mixtures of both chemicals induce greater cytotoxic effects than those reported after single exposureto each compound. Simultaneous treatment with butylated hydroxyanisole and propylparaben caused G0/G1 cell cycle arrest as a result of enhanced generation of oxidative stress and DNA double strand breaks. DNA microarray analysis revealed that a cross-talk between transforming growth factor beta (TGF?) and ataxia-telangiectasia mutated kinase (ATM) pathways regulates the response of Vero cells to the tested compounds in binary mixture. Our findings indicate that butylated hydroxyanisole potentiates the pro-oxidant effects of propylparaben in cultured mammalian cells and provide useful information for their safety assessment. PMID:25086368

  20. Increase of translatable mRNA for major microsomal proteins in n-alkane-grown Candida maltosa

    SciTech Connect

    Sunairi, M.; Watabe, K.; Takagi, M.; Yano, K.


    In an n-alkane-assimilating Candida sp., transfer from glucose- to n-alkane-containing medium induced changes in the microsomal proteins, and several distinctive polypeptides were demonstrated in the solubilized microsomal fraction derived from n-alkane-grown cells. Long-term-labeling and pulse-labeling experiments in vivo demonstrated the synthesis of the specific microsomal polypeptides. The polypeptides were synthesized as in vitro translation products directed by polyadenylated RNA extracted from n-alkane-grown cells. Two major polypeptides were partially purified from the microsomal fraction from n-alkane-grown cells, and antiserum was prepared in a rabbit. Immunoprecipitation of these two polypeptides was accompanied by an increase in the amount of translatable mRNA. The molecular weights of the polypeptides derived from long-term-labeling, pulse-labeling and in vitro translation experiments appeared to be identical.

  1. Dynamic and selective HERV RNA expression in neuroblastoma cells subjected to variation in oxygen tension and demethylation.


    Hu, Lijuan; Uzhameckis, Dmitrijs; Hedborg, Fredrik; Blomberg, Jonas


    We studied HERV expression in cell lines after hypoxia, mitogenic stimulation, and demethylation, to better understand if hypoxia may play a role in ERV activation also within the nervous system, as represented by neuroblastoma cell lines. The level of RNA of four human ERV groups (HERVs) (HERVE, I/T, H, and W), and three housekeeping genes, of different cell lines including A549, COS-1, Namalwa, RD-L and Vero-E6, as well as human neuroblastoma cell lines SH-SY5Y, SK-N-DZ, and SK-N-AS were studied using reverse transcription and real-time quantitative PCR (QPCR). During the course of recovery from hypoxia a pronounced and selective activation of RNA expression of HERVW-like sequences, but not of HERVE, I/T, H, and three housekeeping genes, was found in the neuroblastoma cell lines, most pronounced in SK-N-DZ. In the SK-N-DZ cell line, we also tested the expression of HERVs after chemical treatments. HERVW-like sequences were selectively upregulated by 5-azacytidine, a demethylating agent. Some HERVW loci seem especially responsive to hypoxia and demethylation. HERV expression in neuroblastoma cells is selectively and profoundly influenced by some physiological and chemical stimuli. PMID:26818268

  2. Gene expression by the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough grown on an iron electrode under cathodic protection conditions.


    Caffrey, Sean M; Park, Hyung Soo; Been, Jenny; Gordon, Paul; Sensen, Christoph W; Voordouw, Gerrit


    The genome sequence of the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough was reanalyzed to design unique 70-mer oligonucleotide probes against 2,824 probable protein-coding regions. These included three genes not previously annotated, including one that encodes a c-type cytochrome. Using microarrays printed with these 70-mer probes, we analyzed the gene expression profile of wild-type D. vulgaris grown on cathodic hydrogen, generated at an iron electrode surface with an imposed negative potential of -1.1 V (cathodic protection conditions). The gene expression profile of cells grown on cathodic hydrogen was compared to that of cells grown with gaseous hydrogen bubbling through the culture. Relative to the latter, the electrode-grown cells overexpressed two hydrogenases, the hyn-1 genes for [NiFe] hydrogenase 1 and the hyd genes, encoding [Fe] hydrogenase. The hmc genes for the high-molecular-weight cytochrome complex, which allows electron flow from the hydrogenases across the cytoplasmic membrane, were also overexpressed. In contrast, cells grown on gaseous hydrogen overexpressed the hys genes for [NiFeSe] hydrogenase. Cells growing on the electrode also overexpressed genes encoding proteins which promote biofilm formation. Although the gene expression profiles for these two modes of growth were distinct, they were more closely related to each other than to that for cells grown in a lactate- and sulfate-containing medium. Electrochemically measured corrosion rates were lower for iron electrodes covered with hyn-1, hyd, and hmc mutant biofilms than for wild-type biofilms. This confirms the importance, suggested by the gene expression studies, of the corresponding gene products in D. vulgaris-mediated iron corrosion. PMID:18310429

  3. Cometabolism of Methyl tertiary Butyl Ether and Gaseous n-Alkanes by Pseudomonas mendocina KR-1 Grown on C5 to C8 n-Alkanes

    PubMed Central

    Smith, Christy A.; O'Reilly, Kirk T.; Hyman, Michael R.


    Pseudomonas mendocina KR-1 grew well on toluene, n-alkanes (C5 to C8), and 1 alcohols (C2 to C8) but not on other aromatics, gaseous n-alkanes (C1 to C4), isoalkanes (C4 to C6), 2 alcohols (C3 to C8), methyl tertiary butyl ether (MTBE), or tertiary butyl alcohol (TBA). Cells grown under carbon-limited conditions on n-alkanes in the presence of MTBE (42 ?mol) oxidized up to 94% of the added MTBE to TBA. Less than 3% of the added MTBE was oxidized to TBA when cells were grown on either 1 alcohols, toluene, or dextrose in the presence of MTBE. Concentrated n-pentane-grown cells oxidized MTBE to TBA without a lag phase and without generating tertiary butyl formate (TBF) as an intermediate. Neither TBF nor TBA was consumed by n-pentane-grown cells, while formaldehyde, the expected C1 product of MTBE dealkylation, was rapidly consumed. Similar Ks values for MTBE were observed for cells grown on C5 to C8 n-alkanes (12.95 2.04 mM), suggesting that the same enzyme oxidizes MTBE in cells grown on each n-alkane. All growth-supporting n-alkanes (C5 to C8) inhibited MTBE oxidation by resting n-pentane-grown cells. Propane (Ki = 53 ?M) and n-butane (Ki = 16 ?M) also inhibited MTBE oxidation, and both gases were also consumed by cells during growth on n-pentane. Cultures grown on C5 to C8 n-alkanes also exhibited up to twofold-higher levels of growth in the presence of propane or n-butane, whereas no growth stimulation was observed with methane, ethane, MTBE, TBA, or formaldehyde. The results are discussed in terms of their impacts on our understanding of MTBE biodegradation and cometabolism. PMID:14660389

  4. Effects of sulfated fucan, ascophyllan, from the brown Alga Ascophyllum nodosum on various cell lines: a comparative study on ascophyllan and fucoidan.


    Jiang, Zedong; Okimura, Takasi; Yokose, Takeshi; Yamasaki, Yasuhiro; Yamaguchi, Kenichi; Oda, Tatsuya


    The effects of fucose-containing sulfated polysaccharides, ascophyllan and fucoidan, isolated from the brown alga Ascophyllum nodosum, on the growth of various cell lines (MDCK, Vero, PtK(1), CHO, HeLa, and XC) were investigated. In a colony formation assay, ascophyllan and fucoidan showed potent cytotoxic effects on Vero and XC cells, while other cell lines were relatively resistant to these polysaccharides. Almost no significant effects of these polysaccharides were observed in the cell lines tested using the Alamar blue cytotoxicity assay over 48 h with varying initial cell densities (2500-20,000 cells/well) in growth medium. Interestingly, a significant growth promoting effect of ascophyllan on MDCK cells was observed, whereas treatment with fucoidan showed growth suppressive effects on this cell line under the same experimental conditions. These results suggest that ascophyllan is distinguishable from fucoidan in terms of their bioactivities. This is the first report of the growth promoting effects of a sulfated fucan on a mammalian cell line under normal growth conditions. PMID:20541128

  5. Magnetic and structural properties of MBE-grown oxidic multilayers

    SciTech Connect

    Bloemen, P.J.H.; Heijden, P.A.A. van der; Kohlhepp, J.T.; Jonge, W.J.M. de; Wolf, R.M.; Stegge, J. aan de; Reinders, A.; Jungblut, R.M.; Zaag, P.J. van der


    Multilayers composed of oxides including Fe{sub 3}O{sub 4}, Co{sub x}Fe{sub 3{minus}x}O{sub 4}, CoO, NiO and MgO have been grown epitaxially by MBE on MgO(100) single crystal substrates. These structures can be grown with a high crystallinity in the form of flat layers having sharp interfaces. RHEED studies which commonly yielded sharp streaks accompanied by Kikuchi lines show that, for instance, growth of CoO on Fe{sub 3}O{sub 4} changes the RHEED pattern form from that consistent with a spinel structure to that of a rocksalt structure within about one and a half unit cell of CoO. STM studies on a 400 {angstrom} Fe{sub 3}O{sub 4} layer displaying atomic resolution enabled us to identify the origin of the reconstruction that one commonly observes in the RHEED and LEED patterns for magnetite. Regarding important fundamental magnetic parameters, relevant thickness dependencies were mapped out using localized magneto-optical Kerr effect experiments performed on several samples that routinely included one or multiple wedge shaped layers. These studies revealed the existence of a region in the Fe{sub 3}O{sub 4} layer near the interfaces which exhibits no net magnetic moment, strain driven perpendicular orientated magnetization for the CoO/Fe{sub 3}O{sub 4}(100) and CoO/Co{sub x}Fe{sub 3{minus}x}O{sub 4}(100) bilayer systems, and information on the thickness dependence of the magnetic interlayer coupling across an MgO spacer layer.

  6. Regulation of nitrogen fixation in Rhodospirillum rubrum grown under dark, fermentative conditions

    SciTech Connect

    Schultz, J.E.; Gotto, J.W.; Weaver, P.F.; Yoch, D.C.


    Rhodospirillum rubrum was shown to grow fermentatively on fructose with N/sub 2/ as a nitrogen source. The nitrogenase activity of these cells was regulated by the NH/sub 4//sup +/ switch-off/switch-on mechanism in a manner identical to that for photosynthetically grown cells. In vitro, the inactive nitrogenase Fe protein from fermenting cells was reactivated by an endogenous membrane-bound, Mn/sup 2 +/-dependent activating enzyme that was interchangeable with the activating enzyme isolated from photosynthetic membranes.

  7. Learning about Cancer by Studying Stem Cells


    ... Science Home Page Learning About Cancer by Studying Stem Cells By Sharon Reynolds Posted January 8, 2014 Normally, ... of them are exploring the process by studying stem cells. Modeling Early Pancreatic Cancer Pancreatic cancer cells grown ...

  8. Vapor grown carbon fiber (VGCF) composites

    SciTech Connect

    Ciminelli, D.L.; Kearns, K.M.; Ragland, W.R.


    Vapor grown carbon fibers (VGCF) offer a unique opportunity for carbon fiber composites to expand into a multitude of new markets due to their low cost of only $3 to 5 per pound. Additionally, VGCFs are extremely graphitic and have demonstrated the highest thermal conductivity of any graphite material. Pyrograf-III{reg_sign}, a VGCF produced by Applied Sciences, Inc (ASI), is a small diameter (0.1 {mu}m) fiber with a high aspect ratio (100- 1000). The primary interest of the work is for thermal management applications. The focus of the work has been developing novel process methodologies for these unusual fibers using phenolic and epoxy resin to produce low cost composites. The development of VGCF composites is being performed through a Cooperative Research and Development Agreement (CRDA) between ASI and the Materials Directorate (WL/ML), Wright Laboratory, United States Air Force.

  9. Impurity contamination in fast grown KDP

    SciTech Connect

    Yan, Ming; DeYoreo, J.; Zaitseva, N.; Torres, R.


    Potassium dihydrogen phosphate (KDP) has traditionally been used as a nonlinear optical material for frequency conversion to produce second and third harmonic radiation. A high laser-induced damage threshold for KDP crystals is required for high power laser applications, such as laser fusion. High quality KDP crystals for such applications can be produced by a recently developed rapid crystal growth method. The authors report the results of an impurity contamination study in rapidly-grown KDP crystals. Using absorption spectroscopy, they identified the impurity contamination in the different growth sectors of the crystals. They show that the level of contamination depends on the growth rate achieved during the rapid growth. The impurities observed by absorption spectroscopy are identified as the origin of lattice distortion and optical birefringence in the KDP crystals. The study of impurity incorporation during crystal growth is important for understanding the damage mechanism of KDP.

  10. Perfect crystals grown from imperfect interfaces

    PubMed Central

    Falub, Claudiu V.; Medu?a, Mojmr; Chrastina, Daniel; Isa, Fabio; Marzegalli, Anna; Kreiliger, Thomas; Taboada, Alfonso G.; Isella, Giovanni; Miglio, Leo; Dommann, Alex; von Knel, Hans


    The fabrication of advanced devices increasingly requires materials with different properties to be combined in the form of monolithic heterostructures. In practice this means growing epitaxial semiconductor layers on substrates often greatly differing in lattice parameters and thermal expansion coefficients. With increasing layer thickness the relaxation of misfit and thermal strains may cause dislocations, substrate bowing and even layer cracking. Minimizing these drawbacks is therefore essential for heterostructures based on thick layers to be of any use for device fabrication. Here we prove by scanning X-ray nanodiffraction that mismatched Ge crystals epitaxially grown on deeply patterned Si substrates evolve into perfect structures away from the heavily dislocated interface. We show that relaxing thermal and misfit strains result just in lattice bending and tiny crystal tilts. We may thus expect a new concept in which continuous layers are replaced by quasi-continuous crystal arrays to lead to dramatically improved physical properties. PMID:23880632

  11. Nanolasers grown on silicon-based MOSFETs.


    Lu, Fanglu; Tran, Thai-Truong D; Ko, Wai Son; Ng, Kar Wei; Chen, Roger; Chang-Hasnain, Connie


    We report novel indium gallium arsenide (InGaAs) nanopillar lasers that are monolithically grown on (100)-silicon-based functional metal-oxide-semiconductor field effect transistors (MOSFETs) at low temperature (410 °C). The MOSFETs maintain their performance after the nanopillar growth, providing a direct demonstration of complementary metal-oxide-semiconudctor (CMOS) compatibility. Room-temperature operation of optically pumped lasers is also achieved. To our knowledge, this is the first time that monolithically integrated lasers and transistors have been shown to work on the same silicon chip, serving as a proof-of-concept that such integration can be extended to more complicated CMOS integrated circuits. PMID:22714204

  12. Hexagonal boron nitride grown by MOVPE

    NASA Astrophysics Data System (ADS)

    Kobayashi, Y.; Akasaka, T.; Makimoto, T.


    Hexagonal boron nitride (h-BN) has a potential for optical device applications in the deep ultraviolet spectral region. For several decades, only amorphous and turbostratic boron nitride (BN) films had been grown by chemical vapor deposition and metalorganic vapor phase epitaxy. By introducing flow-rate modulation epitaxy (FME), which enables us to reduce parasitic reactions and lower the optimal growth temperature, we have succeeded in growing single-phase h-BN epitaxial films on nearly lattice-matched (1 1 1) Ni substrates. The h-BN epitaxial films exhibit near-band-gap ultraviolet luminescence at a wavelength of 227 nm in cathodoluminescence at room temperature. The combination of FME and the lattice-matched substrate paves the way for the epitaxial growth of high-quality h-BN.

  13. Nanoelectronic biosensors based on CVD grown graphene

    NASA Astrophysics Data System (ADS)

    Huang, Yinxi; Dong, Xiaochen; Shi, Yumeng; Li, Chang Ming; Li, Lain-Jong; Chen, Peng


    Graphene, a single-atom-thick and two-dimensional carbon material, has attracted great attention recently. Because of its unique electrical, physical, and optical properties, graphene has great potential to be a novel alternative to carbon nanotubes in biosensing. We demonstrate the use of large-sized CVD grown graphene films configured as field-effect transistors for real-time biomolecular sensing. Glucose or glutamate molecules were detected by the conductance change of the graphene transistor as the molecules are oxidized by the specific redox enzyme (glucose oxidase or glutamic dehydrogenase) functionalized onto the graphene film. This study indicates that graphene is a promising candidate for the development of real-time nanoelectronic biosensors.Graphene, a single-atom-thick and two-dimensional carbon material, has attracted great attention recently. Because of its unique electrical, physical, and optical properties, graphene has great potential to be a novel alternative to carbon nanotubes in biosensing. We demonstrate the use of large-sized CVD grown graphene films configured as field-effect transistors for real-time biomolecular sensing. Glucose or glutamate molecules were detected by the conductance change of the graphene transistor as the molecules are oxidized by the specific redox enzyme (glucose oxidase or glutamic dehydrogenase) functionalized onto the graphene film. This study indicates that graphene is a promising candidate for the development of real-time nanoelectronic biosensors. Electronic supplementary information (ESI) available: AFM images of graphene film before and after functionalization, transfer curves of graphene after every step, SEM image of CNT-net, and detection results using CNT-net devices. See DOI: 10.1039/c0nr00142b

  14. The virion N protein of infectious bronchitis virus is more phosphorylated than the N protein from infected cell lysates

    SciTech Connect

    Jayaram, Jyothi; Youn, Soonjeon; Collisson, Ellen W. . E-mail:


    Because phosphorylation of the infectious bronchitis virus (IBV) nucleocapsid protein (N) may regulate its multiple roles in viral replication, the dynamics of N phosphorylation were examined. {sup 32}P-orthophosphate labeling and Western blot analyses confirmed that N was the only viral protein that was phosphorylated. Pulse labeling with {sup 32}P-orthophosphate indicated that the IBV N protein was phosphorylated in the virion, as well as at all times during infection in either chicken embryo kidney cells or Vero cells. Pulse-chase analyses followed by immunoprecipitation of IBV N proteins using rabbit anti-IBV N polyclonal antibody demonstrated that the phosphate on the N protein was stable for at least 1 h. Simultaneous labeling with {sup 32}P-orthophosphate and {sup 3}H-leucine identified a 3.5-fold increase in the {sup 32}P:{sup 3}H counts per minute (cpm) ratio of N in the virion as compared to the {sup 32}P:{sup 3}H cpm ratio of N in the cell lysates from chicken embryo kidney cells, whereas in Vero cells the {sup 32}P:{sup 3}H cpm ratio of N from the virion was 10.5-fold greater than the {sup 32}P:{sup 3}H cpm ratio of N from the cell lysates. These studies are consistent with the phosphorylation of the IBV N playing a role in assembly or maturation of the viral particle.

  15. Full-grown oocytes from Xenopus laevis resume growth when placed in culture

    SciTech Connect

    Wallace, R.A.; Misulovin, Z.; Etkin, L.D.


    When most full-grown, follicle cell-invested oocytes from Xenopus laevis are placed in an appropriate culture medium, they resume growth and remain physiologically healthy for at least 2 to 3 weeks. Rates of growth by full-grown oocytes in vitro generally approximate and can even exceed the most rapid growth rate achieved by vitellogenic oocytes in vivo. Resumption of oocyte growth can be correlated with the loss of investing follicle cells, which under normal conditions appear to interfere with vitellogenin and nutrient access to the oocyte. The final size reached by the oocyte within the ovary is thus not an intrinsic property of the oocyte but is extrinsically imposed by the somatic environment.

  16. Quantitative Schlieren analysis applied to holograms of crystals grown on Spacelab 3

    NASA Technical Reports Server (NTRS)

    Brooks, Howard L.


    In order to extract additional information about crystals grown in the microgravity environment of Spacelab, a quantitative schlieren analysis technique was developed for use in a Holography Ground System of the Fluid Experiment System. Utilizing the Unidex position controller, it was possible to measure deviation angles produced by refractive index gradients of 0.5 milliradians. Additionally, refractive index gradient maps for any recorded time during the crystal growth were drawn and used to create solute concentration maps for the environment around the crystal. The technique was applied to flight holograms of Cell 204 of the Fluid Experiment System that were recorded during the Spacelab 3 mission on STS 51B. A triglycine sulfate crystal was grown under isothermal conditions in the cell and the data gathered with the quantitative schlieren analysis technique is consistent with a diffusion limited growth process.

  17. Cratoxylum formosum (Jack) Dyer ssp. pruniflorum (Kurz) Gogel. (Hng y m) extract induces apoptosis in human hepatocellular carcinoma HepG2 cells through caspase-dependent pathways

    PubMed Central


    Background Cratoxylum formosum (Jack) Dyer ssp. pruniflorum (Kurz) Gogel. (Hng y m) (CF) has been used for treatment of fever, cough, and peptic ulcer. Previously, a 50% ethanol-water extract from twigs of CF was shown highly selective in cytotoxicity against cancer cells. This study aims to investigate the molecular mechanisms underlying the apoptosis-inducing effect of CF. Methods The cytotoxicity of CF was evaluated in the human hepatocellular carcinoma (HCC) HepG2 cell line in comparison with a non-cancerous African green monkey kidney epithelial cell line (Vero) by a neutral red assay. The apoptosis induction mechanisms were investigated through nuclear morphological changes, DNA fragmentation, mitochondrial membrane potential alterations, and caspase enzyme activities. Results CF selectively induced HepG2 cell death compared with non-cancerous Vero cells. A 1.5-fold higher apoptotic effect compared with melphalan was induced by 120?g/mL of the 50% ethanol-water extract of CF. The apoptotic cell death in HepG2 cells occurred via extrinsic and intrinsic caspase-dependent pathways in dose- and time-dependent manners by significantly increasing the activities of caspase 3/7, 8, and 9, decreasing the mitochondrial membrane potential, and causing apoptotic body formation and DNA fragmentation. Conclusions CF extract induced a caspase-dependent apoptosis in HepG2 cells. PMID:24708784

  18. Variation in Western Equine Encephalomyelitis Viral Strain Growth in Mammalian, Avian, and Mosquito Cells Fails to Explain Temporal Changes in Enzootic and Epidemic Activity in California

    PubMed Central

    Zhang, Miaotao; Fang, Ying; Brault, Aaron C.


    Abstract The decrease in western equine encephalomyelitis virus (WEEV; Togaviridae, Alphavirus) activity in North America over the past 2030 years has prompted research to determine if there have been concurrent declines in virulence. Six (WEEV) strains isolated from Culex tarsalis mosquitoes from California during each of the six preceding decades failed to show a consistent declining temporal trend in virus titer using mosquito (C6/36), avian (duck embryo fibroblast), or mammalian (Vero) cells, results similar to our recent in vivo studies using birds and mosquitoes. Titers measured by Vero cell plaque assay were consistently highest on mosquito cell culture, followed by avian and mammalian cell cultures. Similar to previous in vivo results in house sparrows and mice, titers for the IMP181 strain isolated in 2005 were significantly lower in both avian and mammalian cells. Real-time monitoring of changes in cell growth measured by electrical impedance showed consistent differences among cell types, but not WEEV strains. Collectively, these in vitro results failed to explain the decrease in WEEV enzootic and epidemic activity. Results with the IMP181 strain should be verified by additional sequencing, cell growth, and pathogenesis studies using concurrent or 2006 isolates of WEEV from California. PMID:21395409

  19. Quantitative Proteomic and Microarray Analysis of the Archaeon Methanosarcina Acetivorans Grown with Acetate Versus Methanol*

    PubMed Central

    Li, Lingyun; Li, Qingbo; Rohlin, Lars; Kim, UnMi; Salmon, Kirsty; Rejtar, Tomas; Gunsalus, Robert P.; Karger, Barry L.; Ferry, James G.


    Summary Methanosarcina acetivorans strain C2A is an acetate- and methanol-utilizing methane-producing organism for which the genome, the largest yet sequenced among the Archaea, reveals extensive physiological diversity. LC linear ion trap-FTICR mass spectrometry was employed to analyze acetate- vs. methanol-grown cells metabolically labeled with 14N vs. 15N, respectively, to obtain quantitative protein abundance ratios. DNA microarray analyses of acetate- vs. methanol-grown cells was also performed to determine gene expression ratios. The combined approaches were highly complementary, extending the physiological understanding of growth and methanogenesis. Of the 1081 proteins detected, 255 were ? 3-fold differentially abundant. DNA microarray analysis revealed 410 genes that were ? 2.5-fold differentially expressed of 1972 genes with detected expression. The ratios of differentially abundant proteins were in good agreement with expression ratios of the encoding genes. Taken together, the results suggest several novel roles for electron transport components specific to acetate-grown cells, including two flavodoxins each specific for growth on acetate or methanol. Protein abundance ratios indicated that duplicate CO dehydrogenase/acetyl-CoA complexes function in the conversion of acetate to methane. Surprisingly, the protein abundance and gene expression ratios indicated a general stress response in acetate- vs. methanol-grown cells that included enzymes specific for polyphosphate accumulation and oxidative stress. The microarray analysis identified transcripts of several genes encoding regulatory proteins with identity to the PhoU, MarR, GlnK, and TetR families commonly found in the Bacteria domain. An analysis of neighboring genes suggested roles in controlling phosphate metabolism (PhoU), ammonia assimilation (GlnK), and molybdopterin cofactor biosynthesis (TetR). Finally, the proteomic and microarray results suggested roles for two-component regulatory systems specific for each growth substrate. PMID:17269732

  20. Production of fertile offspring from oocytes grown in vitro by nuclear transfer in cattle.


    Hirao, Yuji; Naruse, Kenji; Kaneda, Masahiro; Somfai, Tamas; Iga, Kosuke; Shimizu, Manabu; Akagi, Satoshi; Cao, Feng; Kono, Tomohiro; Nagai, Takashi; Takenouchi, Naoki


    Because of recent advancements in reproductive technology, oocytes have attained an increasingly enriched value as a unique cell population in the production of offspring. The growing oocytes in the ovary are an immediate potential source that serve this need; however, complete oocyte growth before use is crucial. Our research objective was to create in vitro-grown (IVG) oocytes that would have the ability to perform specialized activities, including nuclear reprogramming, as an alternative to in vivo-grown oocytes. Bovine oocyte-granulosa cell complexes with a mean oocyte diameter of approximately 100 μm were cultured on Millicell membrane inserts, with culture medium supplemented with 4% polyvinylpyrrolidone (molecular weight, 360,000), 20 ng/ml androstenedione, 2 mM hypoxanthine, and 5 ng/ml bone morphogenetic protein 7. Oocyte viability after the 14-day culture period was 95%, and there was a 71% increase in oocyte volume. Upon induction of oocyte maturation, 61% of the IVG oocytes extruded a polar body. Eighty-four percent of the reconstructed IVG oocytes that used cumulus cells as donor cells underwent cleavage, and half of them became blastocysts. DNA methylation analyses of the satellite I and II regions of the blastocysts revealed a similar highly methylated status in the cloned embryos derived from in vivo-grown and IVG oocytes. Finally, one of the nine embryos reconstructed from the IVG oocytes developed into a living calf following embryo transfer. Fertility of the offspring was confirmed. In conclusion, the potential of a proportion of the IVG oocytes was comparable to that of in vivo-grown oocytes. PMID:23884646

  1. Recent results in characterization of melt-grown and quench-melt- grown YBCO superconductors

    SciTech Connect

    Balachandran, U.; Poeppel, R.B. ); Gangopadhyay, A.K. . Dept. of Materials Science and Engineering)


    From the standpoint of applications, melt-grown (MG) and quench-melt-grown (QMG) bulk YBCO superconductors are of considerable interest. In this paper, we studied the intragranular critical current density (J{sub c}), the apparent pinning potential (U{sub o}), and the irreversibility temperature (T{sub irr}) of MG and QMG samples and compared the results to those for conventionally sintered YBCO. A systematic increase in U{sub o} and a slower drop in J{sub c} with temperature indicate a systematic improvement in flux-pinning properties in progressing from the sintered YBCO to QMG and MG samples. Weaker pinning is observed in the QMG YBCO than in the MG samples.

  2. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method.


    Khan, J A; Rathore, R S; Khan, S; Ahmad, I


    Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 ?L and 50 ?L of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes. PMID:24516442

  3. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    PubMed Central

    Khan, J.A.; Rathore, R.S.; Khan, S.; Ahmad, I.


    Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 ?L and 50 ?L of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes. PMID:24516442

  4. Peculiar properties of chlorophyll thermoluminescence emission of autotrophically or mixotrophically grown Chlamydomonas reinhardtii.


    Ducruet, Jean-Marc; Serrano, Aurelio; Roncel, Mercedes; Ortega, Jos M


    The microalgae Chlamydomonas reinhardtii and Chlorella sp. CCAP 211/84 were grown autotrophically and mixotrophically and their thermoluminescence emissions were recorded above 0 C after excitation by 1, 2 or 3 xenon flashes or by continuous far-red light. An oscillation of the B band intensity according to the number of flashes was always observed, with a maximum after 2 flashes, accompanied by a downshift of the B band temperature maximum in mixotrophic compared to autotrophic grown cells, indicative of a dark stable pH gradient. Moreover, new flash-induced bands emerged in mixotrophic Chlamydomonas grown cells, at temperatures higher than that of the B band. In contrast to the afterglow band observed in higher plants, in Chlamydomonas these bands were not inducible by far-red light, were fully suppressed by 2 ?M antimycin A, and peaked at different temperatures depending on the flash number and growth stage, with higher temperature maxima in cells at a stationary compared to an exponential growth stage. These differences are discussed according to the particular properties of cyclic electron transfer pathways in C. reinhardtii. PMID:21402481

  5. Predicting thermal inactivation in media of different pH of Salmonella grown at different temperatures.


    Mañas, Pilar; Pagán, Rafael; Raso, Javier; Condón, Santiago


    The influence of the growth temperature and the pH of the heating medium on the heat resistance at different temperatures of Salmonella typhimurium ATCC 13311 was studied and described mathematically. The shift of the growth temperature from 10 to 37 degrees C increased heat resistance of S. typhimurium fourfold. The pH of the heating medium at which heat resistance was maximum was pH 6 for cells grown at 37 degrees C, but changed with growth temperature. The alkalinization of the heating medium from pH 6 to pH 7.7 decreased the heat resistance of cells grown at 37 degrees C by a factor of 3. Neither the growth temperature nor the pH modified the z values significantly (4.9 degrees C). The decimal reduction times at different treatment temperatures, in buffers of different pH of cells of S. typhimurium grown at different temperatures, were accurately described by a mathematical equation (correlation coefficient of 0.97). This equation was also tested for Salmonella senftenberg 775W (ATCC 43845) and Salmonella enteritidis ATCC 13076, strains in which the correlation coefficients between the observed and the theoretically calculated values were 0.91 and 0.98, respectively. PMID:12927706

  6. Cytotoxic activity of some lichen extracts on murine and human cancer cell lines.


    Bzivin, C; Tomasi, S; Lohzic-Le Dvhat, F; Boustie, J


    Eight lichens were extracted successively with n-hexane, diethyl ether and methanol using a Soxhlet process. The cytotoxic activity of the 24 lichen extracts was evaluated in vitro using two murine (the L1210: lymphocytic leukaemia, and the 3LL: Lewis lung carcinoma) and four human (the K-562: chronic myelogenous leukaemia, the U251: glioblastoma, the DU145: prostate carcinoma, and the MCF7: breast adenocarcinoma) cancer cell lines and non-cancerous cells, the Vero cell line (African green monkey kidney cell line). The MTT assay revealed significant cytotoxicity (IC50 < or = 20 microg/ml) on one of the tested cancer cell lines for at least one extract of each lichen species. Some extracts of Cladonia convoluta, Cladonia rangiformis, Parmelia caperata, Platismatia glauca and Ramalina cuspidata demonstrated interesting activities particularly on human cancer cell lines as good selectivity indices were recorded (SI > 3). PMID:13678234

  7. Solar Cells

    NASA Technical Reports Server (NTRS)


    The Heat Exchanger Method (HEM) produces high efficiency crystal ingots in an automated well-insulated furnace offering low equipment, labor and energy costs. The "grown" silicon crystals are used to make solar cells, or photovoltaic cells which convert sunlight directly into electricity. The HEM method is used by Crystal Systems, Inc. and was developed under a NASA/Jet Propulsion Laboratory contract. The square wafers which are the result of the process are sold to companies manufacturing solar panels.

  8. 76 FR 11937 - Olives Grown in California; Decreased Assessment Rate

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Service 7 CFR Part 932 Olives Grown in California; Decreased Assessment Rate AGENCY: Agricultural... assessment rate established for the California Olive Committee (Committee) for 2011 and subsequent fiscal... order which regulates the handling of olives grown in California. Assessments upon olive handlers...

  9. 78 FR 45898 - Vidalia Onions Grown in Georgia; Continuance Referendum

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...; ] DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 955 Vidalia Onions Grown in Georgia... document directs that a referendum be conducted among eligible producers of Vidalia onions grown in Georgia... Vidalia onions produced in the production area. DATES: The referendum will be conducted from September...

  10. Influence of shading on container-grown flowering dogwoods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bare root dogwoods can be successfully grown when transplanted into a container production system. Shade treatments regardless of color or density did have an effect on the plant growth of Cherokee Brave and Cherokee Princess dogwood. Plants grown under 50% black and 50% white shade had more heigh...

  11. Vapor grown silicon dioxide improves transistor base-collector junctions

    NASA Technical Reports Server (NTRS)

    Carley, D. R.; Duclos, R. A.


    Vapor grown silicon dioxide layer protects base-collector junction in silicon planar transistors during the emitter diffusion process. This oxide fills in any imperfections that exist in the thermally grown oxide layer and is of greater thickness than that layer. This process is used to deposit protective silicon dioxide coatings on optical surfaces.

  12. 76 FR 16323 - Irish Potatoes Grown in Washington; Continuance Referendum

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 946 Irish Potatoes Grown in Washington; Continuance Referendum AGENCY... of the marketing order regulating the handling of Irish potatoes grown in Washington. DATES:...

  13. Silicon samples grown under reduced melt convection

    NASA Astrophysics Data System (ADS)

    Binetti, S.; Gonik, M.; Le Donne, A.; Croel, A.


    In any crystallization process, convection rules the formation and distribution of impurities and precipitates. Silicon is actually a well studied material; however the distribution of impurities and their related precipitation processes are still not investigated from the point of view of diffusion and segregation phenomena. In principle, experimentation under microgravity can contribute to a better understanding of the processes occurring during solidification since the chemical segregation and distribution of impurities can be studied under purely diffusive transport conditions. In ground experiments, the effect of a reduced melt convection growth process and its effect on the crystal quality could be studied growing silicon by the Axial Heating Process (AHP). For this purpose, a modified Float Zone (FZ) technique using an additional AHP heater submerged into the melt was applied in this work to grow silicon single crystal. The obtained samples were inspected by resistivity measurements and spectroscopic techniques (PL, FT-IR). The spatial distribution of the dopant along the ingot obtained by local resistivity measurements was compared with a theoretical distribution of dopant. PL measurements confirm the high quality level of the grown ingots and infrared spectroscopy reveals low carbon and oxygen concentration. Such an approach seems to be very promising also for solar grade Si solidification for PV applications.

  14. ?-Glucuronidase and Other Hemicellulase Activities of Fibrobacter succinogenes S85 Grown on Crystalline Cellulose or Ball-Milled Barley Straw

    PubMed Central

    Smith, D. C.; Forsberg, C. W.


    Fibrobacter succinogenes produces an ?-glucuronidase which cleaves 4-O-methyl-?-d-glucuronic acid from birch wood 4-O-methyl-?-d-glucuronoxylan. Very low levels of ?-glucuronidase activity were detected in extracellular enzyme preparations of F. succinogenes on birch wood xylan substrate. The release of 4-O-methyl-?-d-glucuronic acid was enhanced when the birch wood xylan substrate was predigested by either a purified Schizophyllum commune xylanase or a cloned F. succinogenes S85 xylanase. These data suggest that the ?-glucuronidase is unable to cleave 4-O-methyl-?-d-glucuronic acid from intact xylan but can act on unique low-molecular-weight glucuronoxylan fragments created by the cloned F. succinogenes xylanase. The cloned xylanase presumably must account for a small proportion of the indigenous xylanase activity of F. succinogenes cultures, since this xylanase source does not support high glucuronidase activity. The ?-glucuronidase and associated hemicellulolytic enzymes exhibited higher activities in culture fluid from cells grown on ball-milled barley straw than in that of cellulose-grown cells. The profile of xylanases separated by isoelectric focusing (zymogram) of culture filtrate from cells grown on barley straw was more complex than that of culture filtrates from cells grown on cellulose. These data demonstrate that F. succinogenes produces an ?-glucuronidase with an exacting substrate specificity which enables extensive cleavage of glucuronic acid residues from xylan as a consequence of synergistic xylanase action. Images PMID:16348603

  15. Nutritional Characteristics of Forage Grown in South of Benin

    PubMed Central

    Musco, Nadia; Koura, Ivan B.; Tudisco, Raffaella; Awadjihè, Ghislain; Adjolohoun, Sebastien; Cutrignelli, Monica I.; Mollica, Maria Pina; Houinato, Marcel; Infascelli, Federico; Calabrò, Serena


    In order to provide recommendations on the most useful forage species to smallholder farmers, eleven grass and eleven legume forages grown in Abomey-Calavi in Republic of Benin were investigated for nutritive value (i.e. chemical composition and energy content) and fermentation characteristics (i.e. gas and volatile fatty acid production, organic matter degradability). The in vitro gas production technique was used, incubating the forages for 120 h under anaerobic condition with buffalo rumen fluid. Compared to legume, tropical grass forages showed lower energy (8.07 vs 10.57 MJ/kg dry matter [DM]) and crude protein level (16.10% vs 19.91% DM) and higher cell wall content (neutral detergent fiber: 63.8% vs 40.45% DM), respectively. In grass forages, the chemical composition showed a quite high crude protein content; the in vitro degradability was slightly lower than the range of tropical pasture. The woody legumes were richer in protein and energy and lower in structural carbohydrates than herbaceous plants, however, their in vitro results are influenced by the presence of complex compounds (i.e. tannins). Significant correlations were found between chemical composition and in vitro fermentation characteristics. The in vitro gas production method appears to be a suitable technique for the evaluation of the nutritive value of forages in developing countries. PMID:26732328

  16. Nutritional Characteristics of Forage Grown in South of Benin.


    Musco, Nadia; Koura, Ivan B; Tudisco, Raffaella; Awadjih, Ghislain; Adjolohoun, Sebastien; Cutrignelli, Monica I; Mollica, Maria Pina; Houinato, Marcel; Infascelli, Federico; Calabr, Serena


    In order to provide recommendations on the most useful forage species to smallholder farmers, eleven grass and eleven legume forages grown in Abomey-Calavi in Republic of Benin were investigated for nutritive value (i.e. chemical composition and energy content) and fermentation characteristics (i.e. gas and volatile fatty acid production, organic matter degradability). The in vitro gas production technique was used, incubating the forages for 120 h under anaerobic condition with buffalo rumen fluid. Compared to legume, tropical grass forages showed lower energy (8.07 vs 10.57 MJ/kg dry matter [DM]) and crude protein level (16.10% vs 19.91% DM) and higher cell wall content (neutral detergent fiber: 63.8% vs 40.45% DM), respectively. In grass forages, the chemical composition showed a quite high crude protein content; the in vitro degradability was slightly lower than the range of tropical pasture. The woody legumes were richer in protein and energy and lower in structural carbohydrates than herbaceous plants, however, their in vitro results are influenced by the presence of complex compounds (i.e. tannins). Significant correlations were found between chemical composition and in vitro fermentation characteristics. The in vitro gas production method appears to be a suitable technique for the evaluation of the nutritive value of forages in developing countries. PMID:26732328

  17. Exceptional gettering response of epitaxially grown kerfless silicon


    Powell, D. M.; Markevich, V. P.; Hofstetter, J.; Jensen, M. A.; Morishige, A. E.; Castellanos, S.; Lai, B.; Peaker, A. R.; Buonassisi, T.


    The bulk minority-carrier lifetime in p- and n-type kerfless epitaxial (epi) crystalline silicon wafers is shown to increase >500 during phosphorus gettering. We employ kinetic defect simulations and microstructural characterization techniques to elucidate the root cause of this exceptional gettering response. Simulations and deep-level transient spectroscopy (DLTS) indicate that a high concentra- tion of point defects (likely Pt) is “locked in” during fast (60 C/min) cooling during epi wafer growth. The fine dispersion of moderately fast-diffusing recombination-active point defects limits as-grown lifetime but can also be removed during gettering, confirmed by DLTS measurements. Synchrotron-based X-ray fluorescence microscopy indicates metal agglomeratesmore » at structural defects, yet the structural defect density is sufficiently low to enable high lifetimes. Consequently, after phosphorus diffusion gettering, epi silicon exhibits a higher lifetime than materials with similar bulk impurity contents but higher densities of structural defects, including multicrystalline ingot and ribbon silicon materials. As a result, device simulations suggest a solar-cell efficiency potential of this material >23%.« less

  18. Exceptional gettering response of epitaxially grown kerfless silicon

    NASA Astrophysics Data System (ADS)

    Powell, D. M.; Markevich, V. P.; Hofstetter, J.; Jensen, M. A.; Morishige, A. E.; Castellanos, S.; Lai, B.; Peaker, A. R.; Buonassisi, T.


    The bulk minority-carrier lifetime in p- and n-type kerfless epitaxial (epi) crystalline silicon wafers is shown to increase >500× during phosphorus gettering. We employ kinetic defect simulations and microstructural characterization techniques to elucidate the root cause of this exceptional gettering response. Simulations and deep-level transient spectroscopy (DLTS) indicate that a high concentration of point defects (likely Pt) is "locked in" during fast (60 °C/min) cooling during epi wafer growth. The fine dispersion of moderately fast-diffusing recombination-active point defects limits as-grown lifetime but can also be removed during gettering, confirmed by DLTS measurements. Synchrotron-based X-ray fluorescence microscopy indicates metal agglomerates at structural defects, yet the structural defect density is sufficiently low to enable high lifetimes. Consequently, after phosphorus diffusion gettering, epi silicon exhibits a higher lifetime than materials with similar bulk impurity contents but higher densities of structural defects, including multicrystalline ingot and ribbon silicon materials. Device simulations suggest a solar-cell efficiency potential of this material >23%.

  19. Highly efficient excitonic emission of CBD grown ZnO micropods (Presentation Recording)

    NASA Astrophysics Data System (ADS)

    Aad, Roy; Gokarna, Anisha; Nomenyo, Komla; Miska, Patrice; Geng, Wei; Couteau, Christophe; Lérondel, Gilles


    Due to its wide direct band gap and large exciton binding energy allowing for efficient excitonic emission at room temperature, ZnO has attracted attention as a luminescent material in various applications such as UV-light emitting diodes, chemical sensors and solar cells. While low-cost growth techniques, such as chemical bath deposition (CBD), of ZnO thin films and nanostructures have been already reported; nevertheless, ZnO thin films and nanostructures grown by costly techniques, such as metalorganic vapour phase epitaxy, still present the most interesting properties in terms of crystallinity and internal quantum efficiency. In this work, we report on highly efficient and highly crystalline ZnO micropods grown by CBD at a low temperature (< 90°C). XRD and low-temperature photoluminescence (PL) investigations on as-grown ZnO micropods revealed a highly crystalline ZnO structure and a strong UV excitonic emission with internal quantum efficiency (IQE) of 10% at room temperature. Thermal annealing at 900°C of the as-grown ZnO micropods leads to further enhancement in their structural and optical properties. Low-temperature PL measurements on annealed ZnO micropods showed the presence of phonon replicas, which was not the case for as-grown samples. The appearance of phonon replicas provides a strong proof of the improved crystal quality of annealed ZnO micropods. Most importantly, low-temperature PL reveals an improved IQE of 15% in the excitonic emission of ZnO micropods. The ZnO micropods IQE reported here are comparable to IQEs reported on ZnO structures obtained by costly and more complex growth techniques. These results are of great interest demonstrating that high quality ZnO microstructures can be obtained at low temperatures using a low-cost CBD growth technique.

  20. Phyllosphere Microbiota Composition and Microbial Community Transplantation on Lettuce Plants Grown Indoors

    PubMed Central

    Williams, Thomas R.


    ABSTRACT The aerial surfaces of plants, or phyllosphere, are microbial habitats important to plant and human health. In order to accurately investigate microbial interactions in the phyllosphere under laboratory conditions, the composition of the phyllosphere microbiota should be representative of the diversity of microorganisms residing on plants in nature. We found that Romaine lettuce grown in the laboratory contained 10- to 100-fold lower numbers of bacteria than age-matched, field-grown lettuce. The bacterial diversity on laboratory-grown plants was also significantly lower and contained relatively higher proportions of Betaproteobacteria as opposed to the Gammaproteobacteria-enriched communities on field lettuce. Incubation of field-grown Romaine lettuce plants in environmental growth chambers for 2 weeks resulted in bacterial cell densities and taxa similar to those on plants in the field but with less diverse bacterial populations overall. In comparison, the inoculation of laboratory-grown Romaine lettuce plants with either freshly collected or cryopreserved microorganisms recovered from field lettuce resulted in the development of a field-like microbiota on the lettuce within 2 days of application. The survival of an inoculated strain of Escherichia coli O157:H7 was unchanged by microbial community transfer; however, the inoculation of E. coli O157:H7 onto those plants resulted in significant shifts in the abundance of certain taxa. This finding was strictly dependent on the presence of a field-associated as opposed to a laboratory-associated microbiota on the plants. Phyllosphere microbiota transplantation in the laboratory will be useful for elucidating microbial interactions on plants that are important to agriculture and microbial food safety. PMID:25118240