Science.gov

Sample records for vero cells grown

  1. Human Respiratory Syncytial Virus Memphis 37 Grown in HEp-2 Cells Causes more Severe Disease in Lambs than Virus Grown in Vero Cells

    PubMed Central

    Derscheid, Rachel J.; van Geelen, Albert; McGill, Jodi L.; Gallup, Jack M.; Cihlar, Tomas; Sacco, Randy E.; Ackermann, Mark R.

    2013-01-01

    Respiratory syncytial virus (RSV) is the most common cause of bronchiolitis in infants and young children. A small percentage of these individuals develop severe and even fatal disease. To better understand the pathogenesis of severe disease and develop therapies unique to the less-developed infant immune system, a model of infant disease is needed. The neonatal lamb pulmonary development and physiology is similar to that of infants, and sheep are susceptible to ovine, bovine, or human strains of RSV. RSV grown in Vero (African green monkey) cells has a truncated attachment G glycoprotein as compared to that grown in HEp-2 cells. We hypothesized that the virus grown in HEp-2 cells would cause more severe clinical symptoms and cause more severe pathology. To confirm the hypothesis, lambs were inoculated simultaneously by two different delivery methods (intranasal and nebulized inoculation) with either Vero-grown or HEp-2-grown RSV Memphis 37 (M37) strain of virus to compare viral infection and disease symptoms. Lambs infected with HEp-2 cell-derived virus by either intranasal or nebulization inoculation had significantly higher levels of viral RNA in lungs as well as greater clinical disease including both gross and histopathologic lesions compared to lambs similarly inoculated with Vero-grown virus. Thus, our results provide convincing in vivo evidence for differences in viral infectivity that corroborate previous in vitro mechanistic studies demonstrating differences in the G glycoprotein expression by RSV grown in Vero cells. PMID:24284879

  2. Analysis of Vero cell growth behavior on microcarrier by means of environmental scanning electron microscopy.

    PubMed

    Shao, Manjun; Jiang, Lei; Cong, Wei; Ouyang, Fan

    2002-04-01

    By using environmental scanning electron microscopy, the morphological changes of Vero cells attached to and grown on the microcarrier Cytodex-3 were observed, and their behavior of adhesion, spreading and proliferation was analyzed. The effect of exogenous fibronectin/ laminin on adhesion and spreading of MCC/Vero cell was studied. The images of ESEM showed that expansion of cell growth was directed toward vacancy space. The growth curve and cell concentration change during the whole culture process were obtained from the statistical counting method based on ESEM images and the crystal violet method. The growth rate of Vero cells increases with increasing the concentration of cell inoculation, that is, the specific growth rate increases quickly with increasing the concentration of cell inoculation. When serum concentration in medium #199 ranged from 5% to 10%, experimental results indicated that serum concentration is one of the important factors influencing cell growth, particularly in the cell adhesion and spreading stage. PMID:18763074

  3. Increasing Vero viable cell densities for yellow fever virus production in stirred-tank bioreactors using serum-free medium.

    PubMed

    Mattos, Diogo A; Silva, Marlon V; Gaspar, Luciane P; Castilho, Leda R

    2015-08-20

    In this work, changes in Vero cell cultivation methods have been employed in order to improve cell growth conditions to obtain higher viable cell densities and to increase viral titers. The propagation of the 17DD yellow fever virus (YFV) in Vero cells grown on Cytodex I microcarriers was evaluated in 3-L bioreactor vessels. Prior to the current changes, Vero cells were repeatedly displaying insufficient microcarrier colonization. A modified cultivation process with four changes has resulted in higher cell densities and higher virus titers than previously observed for 17DD YFV. PMID:25930117

  4. High Genetic Stability of Dengue Virus Propagated in MRC-5 Cells as Compared to the Virus Propagated in Vero Cells

    PubMed Central

    Butler, Michael; Wu, Suh-Chin

    2008-01-01

    This work investigated the replication kinetics of the four dengue virus serotypes (DEN-1 to DEN-4), including dengue virus type 4 (DEN-4) recovered from an infectious cDNA clone, in Vero cells and in MRC-5 cells grown on Cytodex 1 microcarriers. DEN-1 strain Hawaii, DEN-2 strain NGC, DEN-3 strain H-87, and DEN-4 strain H-241 , and DEN-4 strain 814669 derived from cloned DNA, were used to infect Vero cells and MRC-5 cells grown in serum-free or serum-containing microcarrier cultures. Serum-free and serum-containing cultures were found to yield comparable titers of these viruses. The cloned DNA-derived DEN-4 started genetically more homogeneous was used to investigate the genetic stability of the virus propagated in Vero cells and MRC-5 cells. Sequence analysis revealed that the DEN-4 propagated in MRC-5 cells maintained a high genetic stability, compared to the virus propagated in Vero cells. Amino acid substitutions of Gly104Cys and Phe108Ile were detected at 70%, 60%, respectively, in the envelope (E) protein of DEN-4 propagated in Vero cells, whereas a single mutation of Glu345Lys was detected at 50% in E of the virus propagated in MRC-5 cells. Sequencing of multiple clones of three separate DNA fragments spanning 40% of the genome also indicated that DEN-4 propagated in Vero cells contained a higher number of mutations than the virus growing in MRC-5 cells. Although Vero cells yielded a peak virus titer approximately 1 to 17 folds higher than MRC-5 cells, cloned DEN-4 from MRC-5 cells maintained a greater stability than the virus from Vero cells. Serum-free microcarrier cultures of MRC-5 cells offer a potentially valuable system for the large-scale production of live-attenuated DEN vaccines. PMID:18350148

  5. Statistical optimization of influenza H1N1 production from batch cultures of suspension Vero cells (sVero).

    PubMed

    Paillet, Cristian; Forno, Guillermina; Soldano, Nicolas; Kratje, Ricardo; Etcheverrigaray, Marina

    2011-09-22

    Efficient vaccine production requires the growth of large quantities of virus produced with high yield from a safe host system. Human influenza vaccines are produced in embryonated chicken eggs. However, over the last decade many efforts have allowed the establishment of cell culture-derived vaccines. We generated a Vero cell line adapted to grow in suspension (sVero) in a serum-free medium and evaluated it for its potential as host cell for influenza vaccine production. Initially we studied the capacity of sVero cells to grow in the presence of incremental concentrations of trypsin. In comparison with adherent Vero cells (aVero), we found that sVero cells maintain their growth kinetics even with a three-fold increase in trypsin concentration. The influence of the conditions of infection on the yield of H1N1 produced in serum-free suspension cultures of sVero cells was investigated by a 2(2) full factorial experiment with center point. Each experiment tested the influence of the multiplicity of infection (m.o.i.) and trypsin concentration, on production yields at two levels, in four possible combinations of levels and conditions, plus a further combination in which each condition was set in the middle of its extreme levels. On the basis of software analysis, a combination of m.o.i. of 0.0066TCID(50%)/cell and trypsin concentration of 5μg/1.0×10(6) cells with a desirability of 0.737 was selected as the optimized condition for H1N1 production in sVero cells. Our results show the importance of proper selection of infection conditions for H1N1 production on sVero cells in serum-free medium. PMID:21756959

  6. Propagation and Titration of West Nile Virus on Vero Cells.

    PubMed

    McAuley, Alexander J; Beasley, David W C

    2016-01-01

    The propagation and titration of viruses are key virological techniques. Unlike other flaviviruses, such as the dengue viruses, West Nile virus (WNV) grows and plaques very efficiently on Vero cells, usually inducing strong cytopathic effect (CPE) and forming clear plaques. Here, we outline the steps for propagating WNV from culture supernatant stocks and homogenized organ/mosquito samples, as well as for determining virus titers in samples by serial-dilution plaque assay using neutral red or crystal violet stains. PMID:27188547

  7. Completion of the Entire Hepatitis C Virus Life Cycle in Vero Cells Derived from Monkey Kidney

    PubMed Central

    Murayama, Asako; Sugiyama, Nao; Wakita, Takaji

    2016-01-01

    ABSTRACT A hepatitis C virus (HCV) cell culture system incorporating the JFH-1 strain and the human hepatoma cell line HuH-7 enabled the production of infectious HCV particles. Several host factors were identified as essential for HCV replication. Supplementation of these factors in nonhepatic human cell lines enabled HCV replication and particle production. Vero cells established from monkey kidney are commonly used for the production of vaccines against a variety of viruses. In this study, we aimed to establish a novel Vero cell line to reconstruct the HCV life cycle. Unmodified Vero cells did not allow HCV infection or replication. The expression of microRNA 122 (miR-122), an essential factor for HCV replication, is notably low in Vero cells. Therefore, we supplemented Vero cells with miR-122 and found that HCV replication was enhanced. However, Vero cells that expressed miR-122 still did not allow HCV infection. We supplemented HCV receptor molecules and found that scavenger receptor class B type I (SRBI) was essential for HCV infection in Vero cells. The supplementation of apolipoprotein E (ApoE), a host factor important for virus production, enabled the production of infectious virus in Vero cells. Finally, we created a Vero cell line that expressed the essential factors miR-122, SRBI, and ApoE; the entire HCV life cycle, including infection, replication, and infectious virus production, was completed in these cells. In conclusion, we demonstrated that miR-122, SRBI, and ApoE were necessary and sufficient for the completion of the entire HCV life cycle in nonhuman, nonhepatic Vero cells. PMID:27302754

  8. Susceptibility of the VERO line of African green monkey kidney cells to human enteroviruses

    PubMed Central

    Davis, Patricia M.; Phillpotts, R. J.

    1974-01-01

    The relative susceptibility of VERO cells and primary rhesus monkey kidney cells to 47 prototype strains of human enteroviruses is described. Of these strains, types 4, 14, 16, 17, 18, 21, 31 and 34 and Coxsackie virus A 9 failed to cause CPE in the VERO cells whilst only one, echovirus type 34, failed to cause CPE in the monkey kidney cells. A comparison is given of the efficiency of the two cell cultures for enterovirus isolation from clinical material. Results show that VERO cells are as useful as primary monkey kidney for the isolation of Coxsackie B viruses but less satisfactory for isolating echoviruses. They are satisfactory for the isolation of single types of poliovirus and appear to be more satisfactory than primary monkey kidney cells for the isolation of mixtures of polioviruses. The identification of enteroviruses by neutralization tests in VERO cells is successful. PMID:4361500

  9. Preventing Cleavage of the Respiratory Syncytial Virus Attachment Protein in Vero Cells Rescues the Infectivity of Progeny Virus for Primary Human Airway Cultures

    PubMed Central

    Corry, Jacqueline; Johnson, Sara M.; Cornwell, Jessica

    2015-01-01

    ABSTRACT All live attenuated respiratory syncytial virus (RSV) vaccines that have advanced to clinical trials have been produced in Vero cells. The attachment (G) glycoprotein in virions produced in these cells is smaller than that produced in other immortalized cells due to cleavage. These virions are 5-fold less infectious for primary well-differentiated human airway epithelial (HAE) cell cultures. Because HAE cells are isolated directly from human airways, Vero cell-grown vaccine virus would very likely be similarly inefficient at initiating infection of the nasal epithelium following vaccination, and therefore, a larger inoculum would be required for effective vaccination. We hypothesized that Vero cell-derived virus containing an intact G protein would be more infectious for HAE cell cultures. Using protease inhibitors with increasing specificity, we identified cathepsin L to be the protease responsible for cleavage. Our evidence suggests that cleavage occurs in the late endosome or lysosome during endocytic recycling. Cathepsin L activity was 100-fold greater in Vero cells than in HeLa cells. In addition, cathepsin L was able to cleave the G protein in Vero cell-grown virions but not in HeLa cell-grown virions, suggesting a difference in G-protein posttranslational modification in the two cell lines. We identified by mutagenesis amino acids important for cleavage, and these amino acids included a likely cathepsin L cleavage site. Virus containing a modified, noncleavable G protein produced in Vero cells was 5-fold more infectious for HAE cells in culture, confirming our hypothesis and indicating the value of including such a mutation in future live attenuated RSV vaccines. IMPORTANCE Worldwide, RSV is the second leading infectious cause of infant death, but no vaccine is available. Experimental live attenuated RSV vaccines are grown in Vero cells, but during production the virion attachment (G) glycoprotein is cleaved. Virions containing a cleaved G protein

  10. Proteomic Analysis of Membrane Proteins of Vero Cells: Exploration of Potential Proteins Responsible for Virus Entry

    PubMed Central

    Guo, Donghua; Zhu, Qinghe; Zhang, Hong

    2014-01-01

    Vero cells are highly susceptible to many viruses in humans and animals, and its membrane proteins (MPs) are responsible for virus entry. In our study, the MP proteome of the Vero cells was investigated using a shotgun LC-MS/MS approach. Six hundred twenty-seven proteins, including a total of 1839 peptides, were identified in MP samples of the Vero cells. In 627 proteins, 307 proteins (48.96%) were annotated in terms of biological process of gene ontology (GO) categories; 356 proteins (56.78%) were annotated in terms of molecular function of GO categories; 414 proteins (66.03%) were annotated in terms of cellular components of GO categories. Of 627 identified proteins, seventeen proteins had been revealed to be virus receptor proteins. The resulting protein lists and highlighted proteins may provide valuable information to increase understanding of virus infection of Vero cells. PMID:24286161

  11. The Genome Landscape of the African Green Monkey Kidney-Derived Vero Cell Line

    PubMed Central

    Osada, Naoki; Kohara, Arihiro; Yamaji, Toshiyuki; Hirayama, Noriko; Kasai, Fumio; Sekizuka, Tsuyoshi; Kuroda, Makoto; Hanada, Kentaro

    2014-01-01

    Continuous cell lines that originate from mammalian tissues serve as not only invaluable tools for life sciences, but also important animal cell substrates for the production of various types of biological pharmaceuticals. Vero cells are susceptible to various types of microbes and toxins and have widely contributed to not only microbiology, but also the production of vaccines for human use. We here showed the genome landscape of a Vero cell line, in which 25,877 putative protein-coding genes were identified in the 2.97-Gb genome sequence. A homozygous ∼9-Mb deletion on chromosome 12 caused the loss of the type I interferon gene cluster and cyclin-dependent kinase inhibitor genes in Vero cells. In addition, an ∼59-Mb loss of heterozygosity around this deleted region suggested that the homozygosity of the deletion was established by a large-scale conversion. Moreover, a genomic analysis of Vero cells revealed a female Chlorocebus sabaeus origin and proviral variations of the endogenous simian type D retrovirus. These results revealed the genomic basis for the non-tumourigenic permanent Vero cell lineage susceptible to various pathogens and will be useful for generating new sub-lines and developing new tools in the quality control of Vero cells. PMID:25267831

  12. The spike protein of severe acute respiratory syndrome (SARS) is cleaved in virus infected Vero-E6 cells.

    PubMed

    Wu, Xiao Dong; Shang, Bo; Yang, Rui Fu; Yu, Hao; Ma, Zhi Hai; Shen, Xu; Ji, Yong Yong; Lin, Ying; Wu, Ya Di; Lin, Guo Mei; Tian, Lin; Gan, Xiao Qing; Yang, Sheng; Jiang, Wei Hong; Dai, Er Hei; Wang, Xiao Yi; Jiang, Hua Liang; Xie, You Hua; Zhu, Xue Liang; Pei, Gang; Li, Lin; Wu, Jia Rui; Sun, Bing

    2004-10-01

    Spike protein is one of the major structural proteins of severe acute respiratory syndrome-coronavirus. It is essential for the interaction of the virons with host cell receptors and subsequent fusion of the viral envelop with host cell membrane to allow infection. Some spike proteins of coronavirus, such as MHV, HCoV-OC43, AIBV and BcoV, are proteolytically cleaved into two subunits, S1 and S2. In contrast, TGV, FIPV and HCoV-229E are not. Many studies have shown that the cleavage of spike protein seriously affects its function. In order to investigate the maturation and proteolytic processing of the S protein of SARS CoV, we generated S1 and S2 subunit specific antibodies (Abs) as well as N, E and 3CL protein-specific Abs. Our results showed that the antibodies could efficiently and specifically bind to their corresponding proteins from E.coli expressed or lysate of SARS-CoV infected Vero-E6 cells by Western blot analysis. Furthermore, the anti-S1 and S2 Abs were proved to be capable of binding to SARS CoV under electron microscope observation. When S2 Ab was used to perform immune precipitation with lysate of SARS-CoV infected cells, a cleaved S2 fragment was detected with S2-specific mAb by Western blot analysis. The data demonstrated that the cleavage of S protein was observed in the lysate, indicating that proteolytic processing of S protein is present in host cells. PMID:15450134

  13. Pre-clinical development of cell culture (Vero)-derived H5N1 pandemic vaccines.

    PubMed

    Howard, M Keith; Kistner, Otfried; Barrett, P Noel

    2008-05-01

    The rapid spread of avian influenza (H5N1) and its transmission to humans has raised the possibility of an imminent pandemic and concerns over the ability of standard influenza vaccine production methods to supply sufficient amounts of an effective vaccine. We report here on a robust and flexible strategy which uses wild-type virus grown in a continuous cell culture (Vero) system to produce an inactivated whole virus vaccine. Candidate vaccines based on clade 1 and clade 2 influenza H5N1 strains, produced at a variety of manufacturing scales, were demonstrated to be highly immunogenic in animal models without the need for adjuvant. The vaccines induce cross-neutralising antibodies and are protective in a mouse challenge model not only against the homologous virus but against other H5N1 strains, including those from other clades. These data indicate that cell culture-grown, whole virus vaccines, based on the wild-type virus, allow the rapid high-yield production of a candidate pandemic vaccine. PMID:18953724

  14. Antiproliferative efficacy of Tabernaemontana divaricata against HEP2 cell line and Vero cell line

    PubMed Central

    Kumar, Arvind; Selvakumar, S.

    2015-01-01

    Background: Laryngeal cancer may also be called cancer of the larynx or laryngeal carcinoma. Conventional plants are a precious source of novel anticancer agents and are still in performance better role in health concern. The study was intended to estimation of the anticancer activity of the chloroformic extract of Tabernaemontana divaricata on the human epidermoid larynx carcinoma cell line (Hep 2). Materials and Method: The aerial parts (leaves, stem, and flowers) of T. divaricata were tested for its inhibitory effect in 96 microplate formats against Hep 2 cell line. The anticancer activity of samples on Hep 2 and Vero was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and various enzymatic parameters like catalase, reduced glutathione (GSH), GSH peroxidase, and superoxide anion scavenging activity. Viable cells were determined by the absorbance at 540 nm. Measurements were performed, and the concentration required for a 50% inhibition of viability (IC50) was determined graphically. The effect of the samples on the proliferation of Hep 2 and Vero cells was expressed as the % cell viability. Results: The extract on Hep 2 cell line up to 7.8 μg/ml and that IC50 value on Hep 2 cell line was 112 μg whereas 94 μg for Vero cell line. Hence, T. divaricata has lesser significant action on Vero cell line. Conclusion: Medicinal plant drug discovery continues to provide new and important leads against various pharmacological targets including cancer. Our results clearly indicate the anticancer property of the medicinal plant T. divaricata against the human laryngeal carcinoma cell lines (Hep 2 cell line). PMID:26109773

  15. Receptor-mediated entry of diphtheria toxin into monkey kidney (Vero) cells: electron microscopic evaluation.

    PubMed Central

    Morris, R E; Gerstein, A S; Bonventre, P F; Saelinger, C B

    1985-01-01

    To express toxicity in living cells, diphtheria toxin (DT) must cross a membrane barrier and reach its target in the cytosol. Here we examine the entry of DT into the toxin-sensitive monkey kidney (Vero) cells. Using electron microscopy we directly demonstrated for the first time that DT is internalized by receptor-mediated endocytosis, i.e., via clathrin-coated pits, and enters the endosomal system. Methylamine, which is known to protect cells from DT, stopped the movement of toxin to coated areas of the cell membrane. In the presence of amine, prebound biotinyl-DT was internalized, but toxicity was inhibited. Biochemical evidence revealed that methylamine maintained toxin molecules at a site accessible to neutralization by antitoxin. The data suggest that DT entering Vero cells in the presence of methylamine is sequestered within the cell and does not express toxicity. Images PMID:4066029

  16. Binding Component of Clostridium perfringens Iota-Toxin Induces Endocytosis in Vero Cells

    PubMed Central

    Nagahama, Masahiro; Nagayasu, Koichi; Kobayashi, Keiko; Sakurai, Jun

    2002-01-01

    Clostridium perfringens iota-toxin is a binary toxin consisting of two individual proteins, the binding component (Ib) and the enzyme component (Ia). Wild-type Ib bound to Vero cells at 4 and 37°C and formed oligomers at 37°C but not at 4°C. The Ib-induced K+ release from the cells was dependent on the oligomer formation of Ib in the cells, but the oligomer formation did not induce rounding activity or cytotoxicity. After incubation of the cells with recombinant Ib (rIb) at 37°C, the Ib oligomer in the cell became resistant to pronase treatment with time, but the Ib monomer was sensitive to the treatment. Furthermore, treatment of Vero cells with rIb in the presence of bafilomycin, methylamine, or ethylamine resulted in accumulation of the oligomer in the cells but had no effect on K+ release. Moreover, incubation with Ib plus Ia in the presence of these agents caused no rounding in the cells. These observations suggest that Ib binds to Vero cells, itself oligomerizing to form ion-permeable channels and that the formation of oligomer then induces endocytosis. PMID:11895954

  17. Characterization of homologous defective interfering RNA during persistent infection of Vero cells with Japanese encephalitis virus.

    PubMed

    Yoon, Sung Wook; Lee, Sang-Yong; Won, Sung-Yong; Park, Sun-Hee; Park, Soo-Young; Jeong, Yong Seok

    2006-02-28

    It has been suggested that defective interfering (DI) RNA contributes to the persistence of Japanese en-cephalitis virus (JEV). In this study, we characterized molecular and biological aspects of the DI RNA and its relation to viral persistence. We identified a homolo-gous DI virus intimately associated with JEV persis-tence in Vero cells. The production of DI RNA during undiluted serial passages of JEV coincided with the appearance of cells refractory to acute infection with JEV. We also established a Vero cell clone with a per-sistent JEV infection in which the DI RNA co-replicated efficiently at the expense of helper virus. The infectious virus yield of the clone fluctuated dur-ing its growth depending upon the amount of DI RNA accumulated in the previous replication cycle. Identifi-cation of the corresponding negative-sense RNA of the DI RNA indicated that the DI RNA functioned as a replication unit. Most of the DI RNA molecules re-tained their open reading frames despite a large dele-tion, encompassing most of the prM, the entire E, and the 5' half of the NS1 gene. Taken together, these ob-servations suggest that the generation of homologous DI RNA during successive JEV acute infections in Vero cells probably participates actively in persistent JEV infection. PMID:16511353

  18. Replication-competent human adenovirus 11p vectors can propagate in Vero cells.

    PubMed

    Gokumakulapalle, Madhuri; Mei, Ya-Fang

    2016-08-01

    The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were as capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. PMID:27176913

  19. [A study of the antiherpetic activity of the chaga mushroom (Inonotus obliquus) extracts in the Vero cells infected with the herpes simplex virus].

    PubMed

    Polkovnikova, M V; Nosik, N N; Garaev, T M; Kondrashina, N G; Finogenova, M P; Shibnev, V A

    2014-01-01

    The chaga mushroom (Inonotus obliquus) contains a wide range of excellent bioactive compounds. However, limited information exists on the antiviral activity of the compounds extracted from chaga. A number of subfractions of chaga were obtained using different solvents and different procedures. The subfractions of chaga extracted with water, alcohol, alkali were tested for their toxicity for the Vero cell culture and antiviral effect in the Vero cells infected with the Herpes simplex virus (HSV), Type 1. It was shown that most of the subfractions were not toxic for the Vero cells and had protective effect on the Vero cells infected with HSV. The subfraction IV in the concentration 5 microg/ml protected the Vero cells from cytodestructive action of HSV and no viral DNA was detected in infected cells treated with chaga extracts. Best protective effect was observed when compound was added before or within one hour after the Vero cells were infected with HSV. PMID:25069286

  20. Prevention of lipid peroxidation induced by ochratoxin A in Vero cells in culture by several agents.

    PubMed

    Baudrimont, I; Ahouandjivo, R; Creppy, E E

    1997-04-18

    Ochratoxin A (OTA) is a mycotoxin produced by Aspergillus ochraceus as well as other moulds. This mycotoxin contaminates animal feed and food and is nephrotoxic for all animal species studied so far. OTA is immunosuppressive, genotoxic, teratogenic and carcinogenic. It is a structural analogue of phenylalanine and contains a chlorinated dihydroisocoumarinic moiety. Ochratoxin A inhibits protein synthesis by competition with phenylalanine in the phenylalanine-tRNA aminoacylation reaction. Recently lipid peroxidation induced by OTA has been reported, indicating that the lesions induced by this toxin could also be related to oxidative damage. An attempt to prevent its toxic effect, mainly the lipid peroxidation, has been made using aspartame (L-aspartyl-L-phenylalanine methyl ester) a structural analogue of both OTA and phenylalanine, piroxicam, a non steroidal anti-inflammatory drug and superoxide dismutase+catalase (endogenous oxygen radical scavengers). Lipid peroxidation was assayed in monkey kidney cells (Vero cells) treated by increasing concentrations of OTA (5-50 microM). After 24 h incubation OTA induced lipid peroxidation in Vero cells in a concentration dependent manner, as measured by malonaldehyde (MDA) production. The MDA production, in Vero cells, was significantly increased by 50.5% from 694.1 +/- 21.0 to 1041.5 +/- 23.5 pmol/mg of protein. In the presence of superoxide dismutase (SOD)+catalase (25 micrograms/ml each) the MDA production induced by OTA was significantly decreased. At 50 microM of OTA concentration (optimal production of MDA) the MDA production decreased from 1041.5 +/- 23.5 to 827.5 +/- 21.3 pmol/mg of protein. SOD and catalase, when applied prior to the toxin, seemed to prevent lipid peroxidation more efficiently than piroxicam (at a ten-fold higher concentration than OTA) and aspartame (at equimolar concentration). These molecules also partially prevented the OTA-induced leakage of MDA in the culture medium. PMID:9158693

  1. Comparative growth of spotted fever group Rickettsia spp. strains in Vero cells.

    PubMed

    Silva, Arannadia Barbosa; Duarte, Myrian Morato; Vizzoni, Vinicius Figueiredo; Duré, Ana Íris de Lima; Lopéz, Diego Montenegro; Nogueira, Rita de Maria Seabra; Soares, Carlos Augusto Gomes; Machado-Ferreira, Erik; Gazêta, Gilberto Salles

    2016-08-01

    In Brazil, the spotted fever group (SFG) Rickettsia rickettsii and Rickettsia parkeri related species are the etiological agents of spotted fever rickettsiosis. However, the SFG, Rickettsia rhipicephali, that infects humans, has never been reported. The study of growth dynamics can be useful for understanding the infective and invasive capacity of these pathogens. Here, the growth rates of the Brazilian isolates R. rickettsii str. Taiaçu, R. parkeri str. At#24, and R. rhipicephali HJ#5, were evaluated in Vero cells by quantitative polymerase chain reaction. R. rhipicephali showed different kinetic growth compared to R. rickettsii and R. parkeri. PMID:27508322

  2. Comparative growth of spotted fever group Rickettsia spp. strains in Vero cells

    PubMed Central

    Silva, Arannadia Barbosa; Duarte, Myrian Morato; Vizzoni, Vinicius Figueiredo; Duré, Ana Íris de Lima; Lopéz, Diego Montenegro; Nogueira, Rita de Maria Seabra; Soares, Carlos Augusto Gomes; Machado-Ferreira, Erik; Gazêta, Gilberto Salles

    2016-01-01

    In Brazil, the spotted fever group (SFG) Rickettsia rickettsii and Rickettsia parkeri related species are the etiological agents of spotted fever rickettsiosis. However, the SFG, Rickettsia rhipicephali, that infects humans, has never been reported. The study of growth dynamics can be useful for understanding the infective and invasive capacity of these pathogens. Here, the growth rates of the Brazilian isolates R. rickettsii str. Taiaçu, R. parkeri str. At#24, and R. rhipicephali HJ#5, were evaluated in Vero cells by quantitative polymerase chain reaction. R. rhipicephali showed different kinetic growth compared to R. rickettsii and R. parkeri. PMID:27508322

  3. Application of a serum-free medium for the growth of Vero cells and the production of reovirus.

    PubMed

    Butler, M; Burgener, A; Patrick, M; Berry, M; Moffatt, D; Huzel, N; Barnabé, N; Coombs, K

    2000-01-01

    Two strains of reovirus (serotype 1 Lang/TIL and serotype 3 Dearing/T3D) were propagated in Vero cells grown in stationary or agitated cultures in a serum-free medium, M-VSFM. Solid microcarriers (Cytodex-1) were used to support cell growth in agitated cultures with a normal doubling time of 25 h. Cell yields of 1 x 10(6) cells/mL were obtained from an inoculum of 2 x 10(5) cells/mL in 4 days in microcarrier cultures. The growth profile and cell yield was not significantly different from serum-supplemented cultures. The virus titer increased by 3-4 orders of magnitude over a culture period of 150 h. The maximum virus titer in stationary cultures reached >1 x 10(9) pfu/mL for both strains of reovirus in M-VSFM. M-VSFM also supported high viral yields in microcarrier cultures. Both the specific productivity and final viral yield was higher in M-VSFM than serum-supplemented cultures. The high viral productivity suggests that this is a suitable system for the production of reovirus as an oncolytic agent for human therapeutic use. PMID:11027181

  4. Avian reovirus triggers autophagy in primary chicken fibroblast cells and Vero cells to promote virus production.

    PubMed

    Meng, Songshu; Jiang, Ke; Zhang, Xiaorong; Zhang, Miao; Zhou, Zhizhi; Hu, Maozhi; Yang, Rui; Sun, Chenli; Wu, Yantao

    2012-04-01

    Avian reovirus (ARV) is an important cause of disease in poultry. Although ARV is known to induce apoptosis in infected cells, the interaction between ARV and its target cells requires further elucidation. In this report, we show that the ARV isolate strain GX/2010/1 induces autophagy in both Vero and primary chicken embryonic fibroblast (CEF) cells based on the appearance of an increased number of double-membrane vesicles, the presence of GFP-microtubule-associated protein 1 light chain 3 (GFP-LC3) dot formation, and the elevated production of LC3II. We further demonstrate that the class I phosphoinositide 3-kinase (PI3K)/Akt/mTOR pathway contributes to autophagic induction by ARV infection. Moreover, treatment of ARV-infected cells with the autophagy inducer rapamycin increased viral yields, while inhibition of the autophagosomal pathway using chloroquine led to a decrease in virus production. Altogether, our studies strongly suggest that autophagy may play a critical role in determining viral yield during ARV infection. PMID:22241622

  5. Real-time Imaging of Rabies Virus Entry into Living Vero cells

    PubMed Central

    Xu, Haijiao; Hao, Xian; Wang, Shaowen; Wang, Zhiyong; Cai, Mingjun; Jiang, Junguang; Qin, Qiwei; Zhang, Maolin; Wang, Hongda

    2015-01-01

    Understanding the mechanism of rabies virus (RABV) infection is vital for prevention and therapy of virulent rabies. However, the infection mechanism remains largely uncharacterized due to the limited methods and viral models. Herein, we utilized a powerful single-virus tracking technique to dynamically and globally visualize the infection process of the live attenuated rabies vaccine strain-SRV9 in living Vero cells. Firstly, it was found that the actin-enriched filopodia is in favor of virus reaching to the cell body. Furthermore, by carrying out drug perturbation experiments, we confirmed that RABV internalization into Vero cells proceeds via classical dynamin-dependent clathrin-mediated endocytosis with requirement for intact actin, but caveolae-dependent endocytosis is not involved. Then, our real-time imaging results unambiguously uncover the characteristics of viral internalization and cellular transport dynamics. In addition, our results directly and quantitatively reveal that the intracellular motility of internalized RABV particles is largely microtubule-dependent. Collectively, our work is crucial for understanding the initial steps of RABV infection, and elucidating the mechanisms of post-infection. Significantly, the results provide profound insight into development of novel and effective antiviral targets. PMID:26148807

  6. Real-time Imaging of Rabies Virus Entry into Living Vero cells.

    PubMed

    Xu, Haijiao; Hao, Xian; Wang, Shaowen; Wang, Zhiyong; Cai, Mingjun; Jiang, Junguang; Qin, Qiwei; Zhang, Maolin; Wang, Hongda

    2015-01-01

    Understanding the mechanism of rabies virus (RABV) infection is vital for prevention and therapy of virulent rabies. However, the infection mechanism remains largely uncharacterized due to the limited methods and viral models. Herein, we utilized a powerful single-virus tracking technique to dynamically and globally visualize the infection process of the live attenuated rabies vaccine strain-SRV9 in living Vero cells. Firstly, it was found that the actin-enriched filopodia is in favor of virus reaching to the cell body. Furthermore, by carrying out drug perturbation experiments, we confirmed that RABV internalization into Vero cells proceeds via classical dynamin-dependent clathrin-mediated endocytosis with requirement for intact actin, but caveolae-dependent endocytosis is not involved. Then, our real-time imaging results unambiguously uncover the characteristics of viral internalization and cellular transport dynamics. In addition, our results directly and quantitatively reveal that the intracellular motility of internalized RABV particles is largely microtubule-dependent. Collectively, our work is crucial for understanding the initial steps of RABV infection, and elucidating the mechanisms of post-infection. Significantly, the results provide profound insight into development of novel and effective antiviral targets. PMID:26148807

  7. Estimation of the Cultured Cells’ Volume and Surface Area: Application of Stereological Methods on Vero Cells Infected by Rubella Virus

    PubMed Central

    Noorafshan, Ali; Motamedifar, Mohammad; Karbalay-Doust, Saied

    2016-01-01

    Background: Morphological changes of the cells infected with rubella virus cannot be observed easily. Estimation of the size of the cultured cells can be a valuable parameter in this condition. This study was conducted to find answers to the following questions: How much time after infection with rubella virus, the volume and surface area of the Vero cells and their nuclei get started to change?How is it possible to apply stereological methods to estimate the volume and surface area of the cultured cells using the invariator, nucleator, and surfactor techniques? Methods: The cultured Vero cells were infected with rubella virus. The cells of the control and experimental groups were harvested at 2, 4, 8, 24, and 48 hours following the incubation period. The cells were processed and embedded in paraffin. Invariator, nucleator, and surfactor were applied to estimate the size of the Vero cells and their nuclei. Results: The cell volume was decreased by 15-24%, 48 hours after the infection in comparison to the non-infected cells. Besides, the cell surface area was decreased by 13%, 48 hours after the infection. However, no changes were detected in the nuclei. The values of the standard deviation and coefficient of variation of the cells, estimated by invariator, were lower compared to those measured by the nucleator or surfactor. Conclusion: In this study, the volume and surface area of the Vero cells were reduced by rubella virus 48 hours after infection. Invariator is a more precise method compared to nucleator or surfactor. PMID:26722143

  8. Colistin inhibits E. coli O157:H7 Shiga-like toxin release, binds endotoxins and protects Vero cells.

    PubMed

    Percivalle, Elena; Monzillo, Vincenzina; Pauletto, Alessandro; Marone, Piero; Imberti, Roberto

    2016-04-01

    The role of antibiotics in the treatment of Shiga-like toxin (Stx)-producing E. coli infection is still controversial. This study investigated the effects of colistin on Vero cell cytotoxicity caused by the enterohemorrhagic EC O157:H7, and the effects of colistin on Stx and endotoxin release by EC O157:H7. Vero cells were incubated with supernatant collected from EC O157:H7 cultured for 18 h without (control) or with various concentrations of colistin. In the absence of colistin, Vero cell viability after 48 h was 29.1±6.5%. Under the same conditions, the overnight presence of colistin reduced cytotoxicity to Vero cells (viability: 97±3.5 to 56.5±14.4% for colistin concentrations ≥MIC). Sub-MIC concentrations of colistin also provided partial protection (viability: 38.8±12.5 to 36.6±14% for 0.125 and 0.06 mcg/ml colistin, respectively). Endotoxins contributed to the cytotoxic effects on Vero cells since lower but still significant protection was observed when colistin was added directly to the supernatant collected from cultures of untreated EC O157:H7. Colistin reduced Stx release in a concentration-dependent manner, also at sub-MIC concentrations. Coincubation of the supernatant from EC O157:H7 cultures with colistin markedly reduced the endotoxin concentration at all doses investigated. In conclusion, colistin protects Vero cells from EC O157:H7 at supra- and sub-MIC concentrations by inhibiting Stx release and binding endotoxins. Colistin might be a valuable treatment for clinically severe forms of EC O157:H7 infection. PMID:27196550

  9. Adaptation of high-growth influenza H5N1 vaccine virus in Vero cells: implications for pandemic preparedness.

    PubMed

    Tseng, Yu-Fen; Hu, Alan Yung-Chih; Huang, Mei-Liang; Yeh, Wei-Zhou; Weng, Tsai-Chuan; Chen, Yu-Shuan; Chong, Pele; Lee, Min-Shi

    2011-01-01

    Current egg-based influenza vaccine production technology can't promptly meet the global demand during an influenza pandemic as shown in the 2009 H1N1 pandemic. Moreover, its manufacturing capacity would be vulnerable during pandemics caused by highly pathogenic avian influenza viruses. Therefore, vaccine production using mammalian cell technology is becoming attractive. Current influenza H5N1 vaccine strain (NIBRG-14), a reassortant virus between A/Vietnam/1194/2004 (H5N1) virus and egg-adapted high-growth A/PR/8/1934 virus, could grow efficiently in eggs and MDCK cells but not Vero cells which is the most popular cell line for manufacturing human vaccines. After serial passages and plaque purifications of the NIBRG-14 vaccine virus in Vero cells, one high-growth virus strain (Vero-15) was generated and can grow over 10(8) TCID(50)/ml. In conclusion, one high-growth H5N1 vaccine virus was generated in Vero cells, which can be used to manufacture influenza H5N1 vaccines and prepare reassortant vaccine viruses for other influenza A subtypes. PMID:22022351

  10. Chemical induction of endogenous retrovirus particles from the vero cell line of African green monkeys.

    PubMed

    Ma, Hailun; Ma, Yunkun; Ma, Wenbin; Williams, Dhanya K; Galvin, Teresa A; Khan, Arifa S

    2011-07-01

    Endogenous retroviral sequences are present in high copy numbers in the genomes of all species and may be expressed as RNAs; however, the majority are defective for virus production. Although virus has been isolated from various Old World monkey and New World monkey species, there has been no report of endogenous retroviruses produced from African green monkey (AGM) tissues or cell lines. We have recently developed a stepwise approach for evaluating the presence of latent viruses by chemical induction (Khan et al., Biologicals 37:196-201, 2009). Based upon this strategy, optimum conditions were determined for investigating the presence of inducible, endogenous retroviruses in the AGM-derived Vero cell line. Low-level reverse transcriptase activity was produced with 5-azacytidine (AzaC) and with 5'-iodo-2'-deoxyuridine (IUdR); none was detected with sodium butyrate. Nucleotide sequence analysis of PCR-amplified fragments from the gag, pol, and env regions of RNAs, prepared from ultracentrifuged pellets of filtered supernatants, indicated that endogenous retrovirus particles related to simian endogenous type D betaretrovirus (SERV) sequences and baboon endogenous virus type C gammaretrovirus (BaEV) sequences were induced by AzaC, whereas SERV sequences were also induced by IUdR. Additionally, sequence heterogeneity was seen in the RNAs of SERV- and BaEV-related particles. Infectivity analysis of drug-treated AGM Vero cells showed no virus replication in cell lines known to be susceptible to type D simian retroviruses (SRVs) and to BaEV. The results indicated that multiple, inducible endogenous retrovirus loci are present in the AGM genome that can encode noninfectious, viruslike particles. PMID:21543506

  11. Chemical Induction of Endogenous Retrovirus Particles from the Vero Cell Line of African Green Monkeys▿

    PubMed Central

    Ma, Hailun; Ma, Yunkun; Ma, Wenbin; Williams, Dhanya K.; Galvin, Teresa A.; Khan, Arifa S.

    2011-01-01

    Endogenous retroviral sequences are present in high copy numbers in the genomes of all species and may be expressed as RNAs; however, the majority are defective for virus production. Although virus has been isolated from various Old World monkey and New World monkey species, there has been no report of endogenous retroviruses produced from African green monkey (AGM) tissues or cell lines. We have recently developed a stepwise approach for evaluating the presence of latent viruses by chemical induction (Khan et al., Biologicals 37:196–201, 2009). Based upon this strategy, optimum conditions were determined for investigating the presence of inducible, endogenous retroviruses in the AGM-derived Vero cell line. Low-level reverse transcriptase activity was produced with 5-azacytidine (AzaC) and with 5′-iodo-2′-deoxyuridine (IUdR); none was detected with sodium butyrate. Nucleotide sequence analysis of PCR-amplified fragments from the gag, pol, and env regions of RNAs, prepared from ultracentrifuged pellets of filtered supernatants, indicated that endogenous retrovirus particles related to simian endogenous type D betaretrovirus (SERV) sequences and baboon endogenous virus type C gammaretrovirus (BaEV) sequences were induced by AzaC, whereas SERV sequences were also induced by IUdR. Additionally, sequence heterogeneity was seen in the RNAs of SERV- and BaEV-related particles. Infectivity analysis of drug-treated AGM Vero cells showed no virus replication in cell lines known to be susceptible to type D simian retroviruses (SRVs) and to BaEV. The results indicated that multiple, inducible endogenous retrovirus loci are present in the AGM genome that can encode noninfectious, viruslike particles. PMID:21543506

  12. A novel Vero cell line for use as a mammalian host-vector system in serum-free medium.

    PubMed

    Ohno, T; Wang, X; Kurashima, J; Saijo-Kurita, K; Hirono, M

    1991-11-01

    We have established a novel cell line from a Vero cell derivative that is useful for expression of exogenous genes and protein production. Parental Vero-317 cells can grow in biotin-containing Eagle's MEM without supplements. By transforming this cell line with replication origin-defective SV40 DNA, which contains a temperature-sensitive tsA58 large T antigen gene, we established the Verots S3 cell line that amplified a SV40-origin containing plasmid. The cell line expressed a human growth hormone (hGH) gene insert with higher efficiency than COS-7 cells in 5% serum-containing MEM and could grow and continue hGH expression in protein-free MEM. However, temperature-sensitive shut down of hGH production was observed not immediately but 3 days after the temperature shift from 33 degrees C to 39.5 degrees C. PMID:1368119

  13. Photoirradiation study of gold nanospheres and rods in Vero and Hela cell lines

    NASA Astrophysics Data System (ADS)

    Gananathan, Poorani; Aruna, Prakasarao; Ganesan, Singaravelu; Elanchezhiyan, Manickan

    2014-03-01

    Photoirradiation effect of gold nanospheres in conjucation with green light and rods in conjugation with red light corresponds to their absorption wavelength range found to be appreciable. In this present work concentration of nanomaterial and light dose were optimized. Gold nanospheres were synthesized by reduction technique using Sodium Borohydrate as reducing agent and Trisodium Citrate as capping agent. Au nanorods having 680-900nm absorption were synthesized using reduction techniques with CTAB and BDAC polymers. From UV-Vis absorption and Transmission Electron Microscopy the size of nanoparticles were confirmed. 30nm Gold nanospheres and green light source of 530nm wavelength with power 30mW were applied to Vero and Hela cell lines shows higher toxicity for Hela cells. Nanorods were applied and irradiated with 680nm wavelength light source with light intensity 45mW. Post irradiation effect for 24hrs, 48hrs confirms cell proliferation in normal rate in viable cells. The morphological changes in irradiated spot leads to apoptotoic cell death was confirmed with microscopic imaging. The LD50 value was also calculated.

  14. Development of an animal-component free medium for vero cells culture.

    PubMed

    Rourou, Samia; van der Ark, Arno; van der Velden, Tiny; Kallel, Héla

    2009-01-01

    This work describes the development of an animal-component free medium (IPT-AFM) that allows an optimal growth of Vero cells, an adherent cell line used for the production of viral vaccines. Statistical experimental design was applied to identify crucial nutrients that affect cell growth. Using Medium 199 or MEM as a basal medium, a serum-free medium (SFM) referred as IPT-SFM that only enclosed transferrin as a component of animal origin was developed at first. Then, the composition of IPT-SFM was further improved to obtain an animal-component free medium named IPT-AFM. IPT-AFM contains M199 as a basal medium, plant hydrolysates, epidermal growth factor, ethanolamine, ferric citrate, and vitamin C. Among various plant hydrolysates, specific combinations of soy (Hypep 1510) and wheat gluten (Hypeps 4601 and 4605) hydrolysates, were identified to promote cell growth; whereas individual Hypeps had a minor positive effect on cell growth. Nevertheless, the removal of serum did influence cell attachment. Coating tissue-culture flasks with teleostean, a product extracted from cold water fish skin, had not only enhanced cell attachment but also improved cell growth performance in static cultures. Different non-animal proteases were also assessed as an alternative to trypsin. TrypLE Select, a recombinant trypsin, gave the best cell growth performances. Kinetics of cell growth in IPT-AFM were investigated in T-flasks, cell growth was comparable with that obtained in MEM+10% fetal calf serum (FCS). A mean cell division number equal to 2.26 +/- 0.18 and a specific growth rate micro 0.019 +/- 0.003 h(-1) were achieved in IPT-AFM. PMID:19768803

  15. VERO cells harbor a poly-ADP-ribose belt partnering their epithelial adhesion belt

    PubMed Central

    Vilchez Larrea, Salomé C.; Kun, Alejandra

    2014-01-01

    Poly-ADP-ribose (PAR) is a polymer of up to 400 ADP-ribose units synthesized by poly-ADP-ribose-polymerases (PARPs) and degraded by poly-ADP-ribose-glycohydrolase (PARG). Nuclear PAR modulates chromatin compaction, affecting nuclear functions (gene expression, DNA repair). Diverse defined PARP cytoplasmic allocation patterns contrast with the yet still imprecise PAR distribution and still unclear functions. Based on previous evidence from other models, we hypothesized that PAR could be present in epithelial cells where cadherin-based adherens junctions are linked with the actin cytoskeleton (constituting the adhesion belt). In the present work, we have examined through immunofluorescence and confocal microscopy, the subcellular localization of PAR in an epithelial monkey kidney cell line (VERO). PAR was distinguished colocalizing with actin and vinculin in the epithelial belt, a location that has not been previously reported. Actin filaments disruption with cytochalasin D was paralleled by PAR belt disruption. Conversely, PARP inhibitors 3-aminobenzamide, PJ34 or XAV 939, affected PAR belt synthesis, actin distribution, cell shape and adhesion. Extracellular calcium chelation displayed similar effects. Our results demonstrate the existence of PAR in a novel subcellular localization. An initial interpretation of all the available evidence points towards TNKS-1 as the most probable PAR belt architect, although TNKS-2 involvement cannot be discarded. Forthcoming research will test this hypothesis as well as explore the existence of the PAR belt in other epithelial cells and deepen into its functional implications. PMID:25332845

  16. Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

    PubMed Central

    de la Torre, Juan Carlos; Martínez-Sobrido, Luis

    2013-01-01

    The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells. PMID:23928556

  17. Production in Vero cells of an inactivated rabies vaccine from strain FRV/K for animal and human use.

    PubMed

    el-Karamany, R M

    1987-08-01

    A new concentrated and purified rabies vaccine was produced in Vero cells. Two rabies virus strains, the fixed rabies virus Pasteur (FRV) and Pittman Moore (PM) were adapted to Vero cells by 20 cycles of alternating passages in the brain of weaning mice. Intracerebral (i.c.) inoculation of weaning mice was followed then by 17 and 20 serial passages in Vero cells of RFV and PM strains, respectively. The adapted strains designated as FRV/K and PM/K gave titres of 10(6) +/- 1.5 log (LD50/ml for i.c. inoculated mice) in several harvests taken from one infected cell culture. Pooled harvests were concentrated 20-fold by ultrafiltration and were tested as animal vaccine after inactivation with beta-propiolactone (BPL). Another vaccine preparation destined for human use, in addition to concentration and inactivation, was also purified by gel filtration. Control tests revealed that the antigenic content of different strain FRV/K harvests was very high in comparison with that of strain PM/K and the reference tissue culture vaccine (RIV, Netherland). In sheep the antibody response induced by the FRV/K strain was very high; serum neutralizing index (NI) higher than 4 was reached 40 days after the second vaccine dose, whereas the vaccine preparation from strain PM/K gave NI of 2.3 and the reference vaccine NI of 3.8, respectively. Safety tests in rabbits and guinea pigs showed neither pyrogenicity nor toxicity. PMID:2892381

  18. VeroNectin-4 is a highly sensitive cell line that can be used for the isolation and titration of Peste des Petits Ruminants virus.

    PubMed

    Fakri, F; Elarkam, A; Daouam, S; Tadlaoui, K; Fassi-Fihri, O; Richardson, C D; Elharrak, M

    2016-02-01

    Peste des Petits Ruminants virus (PPRV) is a member of the Morbillivirus subgroup of the family Paramyxoviridae, and is one of the most contagious diseases of small ruminants throughout Africa and the rest of the world. Different cell lines have previously been used to isolate PPRV but with limited success. Thus, to improve the isolation of Morbilliviruses, human, canine, and goat homologues of the lymphocyte receptor signaling lymphocyte activation molecule (SLAM) have been introduced into cells that can support virus replication. However, the amino acid sequence of SLAM varies between species, and often requires adaptation of a particular virus to different versions of the receptor. The protein sequence of Nectin-4 is highly conserved between different mammals, which eliminate the need for receptor adaptation by the virus. Cell lines expressing Nectin-4 have previously been used to propagate measles and canine distemper viruses. In this study, we compared infections in Vero cells expressing canine SLAM (VeroDogSLAM) to those in Vero cells expressing Nectin-4 (VeroNectin-4), following inoculations with wild-type strains of PPRV. Virus isolation using VeroNectin-4 cells was successful with 23% of swabbed samples obtained from live infected animals, and was 89% effective using post-mortem tissues of infected sheep. By contrast, only 4.5% efficiency was observed from swab samples and 67% efficiency was obtained in virus isolation from post-mortem tissues using VeroDogSLAM cells. The average incubation period for virus recovery from post-mortem tissues was 3.4 days using VeroNectin-4 cells, compared with 5.5 days when using VeroDogSLAM cells. The virus titers of PPRV obtained from VeroNectin-4 cells were also higher than those derived from VeroDogSLAM cells. A comparison of the growth kinetics for PPRV in the two cell lines confirmed the superiority of VeroNectin-4 cells for PPR diagnostic purposes and vaccine virus titration. PMID:26615804

  19. An inactivated yellow fever 17DD vaccine cultivated in Vero cell cultures.

    PubMed

    Pereira, Renata C; Silva, Andrea N M R; Souza, Marta Cristina O; Silva, Marlon V; Neves, Patrícia P C C; Silva, Andrea A M V; Matos, Denise D C S; Herrera, Miguel A O; Yamamura, Anna M Y; Freire, Marcos S; Gaspar, Luciane P; Caride, Elena

    2015-08-20

    Yellow fever is an acute infectious disease caused by prototype virus of the genus Flavivirus. It is endemic in Africa and South America where it represents a serious public health problem causing epidemics of hemorrhagic fever with mortality rates ranging from 20% to 50%. There is no available antiviral therapy and vaccination is the primary method of disease control. Although the attenuated vaccines for yellow fever show safety and efficacy it became necessary to develop a new yellow fever vaccine due to the occurrence of rare serious adverse events, which include visceral and neurotropic diseases. The new inactivated vaccine should be safer and effective as the existing attenuated one. In the present study, the immunogenicity of an inactivated 17DD vaccine in C57BL/6 mice was evaluated. The yellow fever virus was produced by cultivation of Vero cells in bioreactors, inactivated with β-propiolactone, and adsorbed to aluminum hydroxide (alum). Mice were inoculated with inactivated 17DD vaccine containing alum adjuvant and followed by intracerebral challenge with 17DD virus. The results showed that animals receiving 3 doses of the inactivated vaccine (2 μg/dose) with alum adjuvant had neutralizing antibody titers above the cut-off of PRNT50 (Plaque Reduction Neutralization Test). In addition, animals immunized with inactivated vaccine showed survival rate of 100% after the challenge as well as animals immunized with commercial attenuated 17DD vaccine. PMID:25862300

  20. Apoptotic activity and anti-Toxoplasma effects of artemether on the tachyzoites and experimental infected Vero and J774 cell lines by Toxoplasma gondii

    PubMed Central

    Mikaeiloo, Hajar; Ghaffarifar, Fatemeh; Dalimi, Abdolhossein; Sharifi, Zohreh; Hassan, Zuhair Mohammad

    2016-01-01

    Objectives: Drugs used for toxoplasmosis have limited efficacy and also severe side effects. A new drug with good efficacy and limited side effects is need of the hour. We studied the effects of artemether on Toxoplasma gondii in vitro conditions. Materials and Methods: Artemether (methyl-ether-qinghaosu) was tested for tachyzoites, J774, and Vero cell lines infected by T. gondii. For evaluating the effect of drugs on Vero cells infected with T. gondii, we designed two separate experiments; in the first experiment, the Vero cells were infected with tachyzoites and then treated with artemether; while in the second one, the tachyzoites were exposed to artemether and then Vero cells were infected with treated tachyzoites. For evaluating the apoptotic effect of artemether on tachyzoites and infected J774 macrophages cell line with T. gondii, we used flow cytometry method. Inhibitory concentration (IC50) was evaluated by intracellular replication of tachyzoites in Vero cells. Results: IC50 for infected Vero cells with tachyzoites was determined as 49.13 μg/ml. In pretreated tachyzoites with artemether before entering into Vero cells, IC50 was calculated as 13.15 μg/ml. In both experiments, artemether showed a higher inhibitory effect than sulfadiazine (positive control). Artemether even at the highest concentrations only showed low cytotoxicity on Vero and J774 cell lines. Apoptosis in tachyzoites rise with an increasing concentration of artemether. Conclusions: Our findings indicate that artemether is effective to control the tachyzoites of T. gondii in vitro and maybe a good alternative drug for toxoplasmosis. PMID:27127321

  1. Comparison of herpes simplex (HSV) proteins synthesized in Vero, HEP-2 and human megakaryocyte-like cell lines

    SciTech Connect

    Soslau, G.; Pastorino, M.B.; Morgan, D.A.; Brodsky, I.; Howett, M.K.

    1986-05-01

    The natural human host blood cell capable of supporting herpes virus replication has yet to be defined. They found that a recently cultured human megakaryocyte-like (Meg) cell line can support HSV 1 and 2 replication as demonstrated by growth inhibition, CPE, virus production and HSV DNA synthesis. The HSV proteins synthesized and post-translationally modified in Vero and HEp-2 infected cells were compared to the protein species produced in the infected Meg cell since differences may influence antigenic properties and host range. Host cell protein synthesis was greatly reduced in all three cell lines within hours post infection (pi). However, maximum viral protein synthesis occurs between 4 and 24 hrs pi with the Meg cells as compared to 24-48 hrs pi with the other cell lines. The immunoprecipitated /sup 35/S-methionine labeled HSV protein gel patterns for each infected cell line are qualitatively and quantitatively very different from each other. Dramatic differences were also observed when infected cells were labeled with /sup 32/P-ATP (in vitro method) or /sup 32/Pi (in vivo method). Finally, analysis of /sup 3/H-mannose labeled HSV glycoproteins demonstrates that the post-translational modifications of these proteins are significantly altered in the Meg cell as compared to the Vero and HEp-2 cells.

  2. Cell culture (Vero) derived whole virus (H5N1) vaccine based on wild-type virus strain induces cross-protective immune responses

    PubMed Central

    Kistner, Otfried; Howard, Keith; Spruth, Martin; Wodal, Walter; Brühl, Peter; Gerencer, Marijan; Crowe, Brian A.; Savidis-Dacho, Helga; Livey, Ian; Reiter, Manfred; Mayerhofer, Ines; Tauer, Christa; Grillberger, Leopold; Mundt, Wolfgang; Falkner, Falko G.; Barrett, P. Noel

    2007-01-01

    The rapid spread and the transmission to humans of avian influenza virus (H5N1) has induced world-wide fears of a new pandemic and raised concerns over the ability of standard influenza vaccine production methods to rapidly supply sufficient amounts of an effective vaccine. We report here on a robust and flexible strategy which uses wild-type virus grown in a continuous cell culture (Vero) system to produce an inactivated whole virus vaccine. Candidate vaccines based on clade 1 and clade 2 influenza H5N1 strains were developed and demonstrated to be highly immunogenic in animal models. The vaccines induce cross-neutralising antibodies, highly cross-reactive T-cell responses and are protective in a mouse challenge model not only against the homologous virus but against other H5N1 strains, including those from another clade. These data indicate that cell culture-grown, whole virus vaccines, based on the wild-type virus, allow the rapid high yield production of a candidate pandemic vaccine. PMID:17614165

  3. Dengue-3 Virus Entry into Vero Cells: Role of Clathrin-Mediated Endocytosis in the Outcome of Infection

    PubMed Central

    Piccini, Luana E.; Castilla, Viviana; Damonte, Elsa B.

    2015-01-01

    The endocytic uptake and intracellular trafficking for penetration of DENV-3 strain H-87 into Vero cells was analyzed by using several biochemical inhibitors and dominant negative mutants of cellular proteins. The results presented show that the infective entry of DENV-3 into Vero cells occurs through a non-classical endocytosis pathway dependent on low pH and dynamin, but non-mediated by clathrin. After uptake, DENV-3 transits through early endosomes to reach Rab 7-regulated late endosomes, and according with the half-time for ammonium chloride resistance viral nucleocapsid is released into the cytosol approximately at 12 min post-infection. Furthermore, the influence of the clathrin pathway in DENV-3 infective entry in other mammalian cell lines of human origin, such as A549, HepG2 and U937 cells, was evaluated demonstrating that variable entry pathways are employed depending on the host cell. Results show for the first time the simultaneous coexistence of infective and non -infective routes for DENV entry into the host cell, depending on the usage of clathrin-mediated endocytosis. PMID:26469784

  4. Safety and immunogenicity of two freeze-dried Vero cell rabies vaccines for human use in post-exposure prophylaxis.

    PubMed

    Wang, Ling-yun; Sun, Mei-ping; Zhang, Xue-chun; Suo, Luo-dan; Xu, Ruo-hui; Zou, Yan-jie; Zuo, Li-bo; Qi, Hua

    2011-03-24

    To provide basis for human rabies vaccination in China, the safety and immunogenicity of two freeze-dried Vero cell rabies vaccines for human use were assessed. A total of 250 volunteers were enrolled and divided into two groups: volunteers in Group A (n=200) were vaccinated five doses of Speeda Vero cell rabies vaccine manufactured by Liaoning Chengda Biotechnology Co. Ltd. on day 0, 3, 7, 14, 28 after exposure. Volunteers in Group B (n=50) were treated with Verorab Vero cell rabies vaccine manufactured by Sanofi Pasteur on the same schedule. The local and systematic adverse reactions were observed. Serum neutralizing antibody levels of 80 individuals in Group A and 50 individuals in Group B were tested with RFFIT on day 7, 14, 45, 180, 360 after the first dose. The seroconversion rates in Groups A and B were 40.3% and 37.0% on day 7 after the first dose, 95.5% and 97.7% on day 14, 100% and 100% on day 45, 100% and 100% on day 180, 89.1% and 89.5% on day 360 respectively, indicating no significant differences between the two groups. And no significant differences were found between the neutralizing antibody geometric mean titers (GMTs) of the two groups on day 7, 14, 45, 180 and 360 after the first dose, with the GMTs of day 14, 45, 180 and 360 all higher than 0.5IU/ml. Antibody levels of the two groups peaked around 2 weeks after the full vaccination program, followed by a 55% decrease up to day 180 and another 76% decrease up to day 360. Both groups experienced occasions of transient fever, rash, edema, and scleroma after vaccination. Neither group had any severe adverse reactions. It was concluded that both vaccines showed satisfactory safety and immunogenicity. Booster vaccination is recommended following another exposure after six months since the full vaccination program. PMID:21296694

  5. Absolute quantification of dengue virus serotype 4 chimera vaccine candidate in Vero cell culture by targeted mass spectrometry.

    PubMed

    Rougemont, Blandine; Simon, Romain; Carrière, Romain; Biarc, Jordane; Fonbonne, Catherine; Salvador, Arnaud; Huillet, Céline; Berard, Yves; Adam, Olivier; Manin, Catherine; Lemoine, Jérôme

    2015-10-01

    Infection by dengue flavivirus is transmitted by mosquitoes and affects tens to hundreds of millions people around the world each year. Four serotypes have been described, all of which cause similar disease. Currently, there no approved vaccines or specific therapeutics for dengue, although several vaccine prototypes are in different stages of clinical development. Among them, a chimeric vaccine, built from the replication machinery of the yellow fever 17D virus, has shown promising results in phase III trials. Accurate quantitation of expressed viral particles in alive attenuated viral antigen vaccine is essential and determination of infectious titer is usually the method of choice. The current paper describes an alternative or orthogonal strategy, namely, a multiplexed and absolute assay of four proteins of the chimera yellow fever/dengue serotype 4 virus using targeted MS in SRM mode. Over 1 month, variability of the assay using a partially purified Vero cell extract was between 8 and 17%, and accuracy was between 80 and 120%. In addition, the assay was linear between 6.25 and 200 nmol/L and could therefore be used in the near future to quantify dengue virus type 4 during production and purification from Vero cells. PMID:26205729

  6. Chemical synthesis, characterisation, and biocompatibility of nanometre scale porous anodic aluminium oxide membranes for use as a cell culture substrate for the vero cell line: a preliminary study.

    PubMed

    Poinern, Gérrard Eddy Jai; Le, Xuan Thi; O'Dea, Mark; Becker, Thomas; Fawcett, Derek

    2014-01-01

    In this preliminary study we investigate for the first time the biomedical potential of using porous anodic aluminium oxide (AAO) membranes as a cell substrate for culturing the Cercopithecus aethiops (African green monkey) Kidney (Vero) epithelial cell line. One advantage of using the inorganic AAO membrane is the presence of nanometre scale pore channels that allow the exchange of molecules and nutrients across the membrane. The size of the pore channels can be preselected by adjusting the controlling parameters of a temperature controlled two-step anodization process. The cellular interaction and response of the Vero cell line with an in-house synthesised AAO membrane, a commercially available membrane, and a glass control were assessed by investigating cell adhesion, morphology, and proliferation over a 72 h period. The number of viable cells proliferating over the respective membrane surfaces revealed that the locally produced in-house AAO membrane had cells numbers similar to the glass control. The study revealed evidence of focal adhesion sites over the surface of the nanoporous membranes and the penetration of cellular extensions into the pore structure as well. The outcome of the study has revealed that nanometre scale porous AAO membranes have the potential to become practical cell culture scaffold substrates with the capability to enhance adhesion and proliferation of Vero cells. PMID:24579077

  7. Chemical Synthesis, Characterisation, and Biocompatibility of Nanometre Scale Porous Anodic Aluminium Oxide Membranes for Use as a Cell Culture Substrate for the Vero Cell Line: A Preliminary Study

    PubMed Central

    Poinern, Gérrard Eddy Jai; Le, Xuan Thi; Becker, Thomas; Fawcett, Derek

    2014-01-01

    In this preliminary study we investigate for the first time the biomedical potential of using porous anodic aluminium oxide (AAO) membranes as a cell substrate for culturing the Cercopithecus aethiops (African green monkey) Kidney (Vero) epithelial cell line. One advantage of using the inorganic AAO membrane is the presence of nanometre scale pore channels that allow the exchange of molecules and nutrients across the membrane. The size of the pore channels can be preselected by adjusting the controlling parameters of a temperature controlled two-step anodization process. The cellular interaction and response of the Vero cell line with an in-house synthesised AAO membrane, a commercially available membrane, and a glass control were assessed by investigating cell adhesion, morphology, and proliferation over a 72 h period. The number of viable cells proliferating over the respective membrane surfaces revealed that the locally produced in-house AAO membrane had cells numbers similar to the glass control. The study revealed evidence of focal adhesion sites over the surface of the nanoporous membranes and the penetration of cellular extensions into the pore structure as well. The outcome of the study has revealed that nanometre scale porous AAO membranes have the potential to become practical cell culture scaffold substrates with the capability to enhance adhesion and proliferation of Vero cells. PMID:24579077

  8. Dengue Type 4 Live-Attenuated Vaccine Viruses Passaged in Vero Cells Affect Genetic Stability and Dengue-Induced Hemorrhaging in Mice

    PubMed Central

    Lee, Hsiang-Chi; Yen, Yu-Ting; Chen, Wen-Yu; Wu-Hsieh, Betty A.; Wu, Suh-Chin

    2011-01-01

    Most live-attenuated tetravalent dengue virus vaccines in current clinical trials are produced from Vero cells. In a previous study we demonstrated that an infectious cDNA clone-derived dengue type 4 (DEN-4) virus retains higher genetic stability in MRC-5 cells than in Vero cells. For this study we investigated two DEN-4 viruses: the infectious cDNA clone-derived DEN-4 2A and its derived 3′ NCR 30-nucleotide deletion mutant DEN-4 2AΔ30, a vaccine candidate. Mutations in the C-prM-E, NS2B-NS3, and NS4B-NS5 regions of the DEN genome were sequenced and compared following cell passages in Vero and MRC-5 cells. Our results indicate stronger genetic stability in both viruses following MRC-5 cell passages, leading to significantly lower RNA polymerase error rates when the DEN-4 virus is used for genome replication. Although no significant increases in virus titers were observed following cell passages, DEN-4 2A and DEN-4 2AΔ30 virus titers following Vero cell passages were 17-fold to 25-fold higher than titers following MRC-5 cell passages. Neurovirulence for DEN-4 2A and DEN-4 2AΔ30 viruses increased significantly following passages in Vero cells compared to passages in MRC-5 cells. In addition, more severe DEN-induced hemorrhaging in mice was noted following DEN-4 2A and DEN-4 2AΔ30 passages in Vero cells compared to passages in MRC-5 cells. Target mutagenesis performed on the DEN-4 2A infectious clone indicated that single point mutation of E-Q438H, E-V463L, NS2B-Q78H, and NS2B-A113T imperatively increased mouse hemorrhaging severity. The relationship between amino acid mutations acquired during Vero cell passage and enhanced DEN-induced hemorrhages in mice may be important for understanding DHF pathogenesis, as well as for the development of live-attenuated dengue vaccines. Taken together, the genetic stability, virus yield, and DEN-induced hemorrhaging all require further investigation in the context of live-attenuated DEN vaccine development. PMID:22053180

  9. Mutation of the dengue virus type 2 envelope protein heparan sulfate binding sites or the domain III lateral ridge blocks replication in Vero cells prior to membrane fusion

    SciTech Connect

    Roehrig, John T.; Butrapet, Siritorn; Liss, Nathan M.; Bennett, Susan L.; Luy, Betty E.; Childers, Thomas; Boroughs, Karen L.; Stovall, Janae L.; Calvert, Amanda E.; Blair, Carol D.; Huang, Claire Y.-H.

    2013-07-05

    Using an infectious cDNA clone we engineered seven mutations in the putative heparan sulfate- and receptor-binding motifs of the envelope protein of dengue virus serotype 2, strain 16681. Four mutant viruses, KK122/123EE, E202K, G304K, and KKK305/307/310EEE, were recovered following transfection of C6/36 cells. A fifth mutant, KK291/295EE, was recovered from C6/36 cells with a compensatory E295V mutation. All mutants grew in and mediated fusion of virus-infected C6/36 cells, but three of the mutants, KK122/123EE, E202K, G304K, did not grow in Vero cells without further modification. Two Vero cell lethal mutants, KK291/295EV and KKK307/307/310EEE, failed to replicate in DC-SIGN-transformed Raji cells and did not react with monoclonal antibodies known to block DENV attachment to Vero cells. Additionally, both mutants were unable to initiate negative-strand vRNA synthesis in Vero cells by 72 h post-infection, suggesting that the replication block occurred prior to virus-mediated membrane fusion. - Highlights: • Heparan sulfate- and receptor-binding motifs of DENV2 envelope protein were mutated. • Four mutant viruses were isolated—all could fuse C6/36 cells. • Two of these mutants were lethal in Vero cells without further modification. • Lethal mutations were KK291/295EV and KKK305/307/310EEE. • Cell attachment was implicated as the replication block for both mutants.

  10. Isolation of measles virus from clinical specimens using B95a and Vero/hSLAM cell-lines.

    PubMed

    Keniscope, C; Juliana, R; Subri, H; Shangari, S R; Wan Nor Azlina, W A; Hamizah, A; Emmi, E E; Nor Azlina, M D; Norizah, I; Chua, K B

    2009-03-01

    The clinical presentation of acute measles is normally quite typical, especially in the presence of Koplik's spots, that laboratory test is seldom required to confirm the diagnosis. However, with wide measles vaccination coverage and the extensive use of immunosuppressive chemotherapy, the diagnosis of atypical manifestations of acute measles may require laboratory confirmation. When compared with B95a cell-line, this study shows that the Vero/hSLAM cell-line is sensitive and is recommended for use in the primary isolation of wild-type measles virus from clinical specimens. Throat swab and urine specimens are the clinical specimens of choice and both are recommended for optimal isolation of measles virus from patients suspected of acute measles virus infection. PMID:19852319

  11. Toxicity and Antiviral Activity of the Extracts of Submerged Mycelium of Nematophagous Duddingtonia flagrans Fungus in Vero Cell Culture.

    PubMed

    Ibragimova, Zh B; Anan'ko, G G; Kostina, N E; Teplyakova, T V; Mazurkova, N A

    2015-12-01

    We studied toxicity and antiviral activity of aqueous and ethanol extracts of bioactive substances from the biomass of nematophagous fungus Duddingtonia flagrans prepared by submerged culturing of the mycelium. It is found that both extracts were characterized by low toxicity for cultured Vero cells and inhibited reproduction of DNA-viruses in this cell line. Ethanol extract of the fungus exhibited higher in vitro antiviral activity against Herpes simplex virus type 2, ectromelia virus, and vaccinia virus than water extract, which can be due to higher content of proteins, polysaccharides, flavonols, catechins, or carotenes or more effective their combination. The extracts of cultured mycelium of Duddingtonia flagrans fungus containing a complex of bioactive substances can be used for creation of broad-spectrum antiviral drugs against DNA-viruses. PMID:26621278

  12. Non-linear relationships between aflatoxin B₁ levels and the biological response of monkey kidney vero cells.

    PubMed

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel

    2013-08-01

    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B₁ (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  13. Non-Linear Relationships between Aflatoxin B1 Levels and the Biological Response of Monkey Kidney Vero Cells

    PubMed Central

    Rasooly, Reuven; Hernlem, Bradley; He, Xiaohua; Friedman, Mendel

    2013-01-01

    Aflatoxin-producing fungi contaminate food and feed during pre-harvest, storage and processing periods. Once consumed, aflatoxins (AFs) accumulate in tissues, causing illnesses in animals and humans. Most human exposure to AF seems to be a result of consumption of contaminated plant and animal products. The policy of blending and dilution of grain containing higher levels of aflatoxins with uncontaminated grains for use in animal feed implicitly assumes that the deleterious effects of low levels of the toxins are linearly correlated to concentration. This assumption may not be justified, since it involves extrapolation of these nontoxic levels in feed, which are not of further concern. To develop a better understanding of the significance of low dose effects, in the present study, we developed quantitative methods for the detection of biologically active aflatoxin B1 (AFB1) in Vero cells by two independent assays: the green fluorescent protein (GFP) assay, as a measure of protein synthesis by the cells, and the microculture tetrazolium (MTT) assay, as a measure of cell viability. The results demonstrate a non-linear dose-response relationship at the cellular level. AFB1 at low concentrations has an opposite biological effect to higher doses that inhibit protein synthesis. Additional studies showed that heat does not affect the stability of AFB1 in milk and that the Vero cell model can be used to determine the presence of bioactive AFB1 in spiked beef, lamb and turkey meat. The implication of the results for the cumulative effects of low amounts of AFB1 in numerous foods is discussed. PMID:23949006

  14. High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1

    SciTech Connect

    Zhou, Fangye; Zhou, Jian; Ma, Lei; Song, Shaohui; Zhang, Xinwen; Li, Weidong; Jiang, Shude; Wang, Yue; Liao, Guoyang

    2012-05-18

    Highlights: Black-Right-Pointing-Pointer Vero cell-based HPAI H5N1 vaccine with stable high yield. Black-Right-Pointing-Pointer Stable high yield derived from the YNVa H3N2 backbone. Black-Right-Pointing-Pointer H5N1/YNVa has a similar safety and immunogenicity to H5N1delta. -- Abstract: Highly pathogenic avian influenza (HPAI) viruses pose a global pandemic threat, for which rapid large-scale vaccine production technology is critical for prevention and control. Because chickens are highly susceptible to HPAI viruses, the supply of chicken embryos for vaccine production might be depleted during a virus outbreak. Therefore, developing HPAI virus vaccines using other technologies is critical. Meeting vaccine demand using the Vero cell-based fermentation process has been hindered by low stability and yield. In this study, a Vero cell-based HPAI H5N1 vaccine candidate (H5N1/YNVa) with stable high yield was achieved by reassortment of the Vero-adapted (Va) high growth A/Yunnan/1/2005(H3N2) (YNVa) virus with the A/Anhui/1/2005(H5N1) attenuated influenza vaccine strain (H5N1delta) using the 6/2 method. The reassorted H5N1/YNVa vaccine maintained a high hemagglutination (HA) titer of 1024. Furthermore, H5N1/YNVa displayed low pathogenicity and uniform immunogenicity compared to that of the parent virus.

  15. Characterization of Vero cell growth and death in bioreactor with serum-containing and serum-free media.

    PubMed

    Quesney, S; Marvel, J; Marc, A; Gerdil, C; Meignier, B

    2001-03-01

    The density of viable cells in a culture results from a balance between cell proliferation and cell death. The aim of this study was to characterize and compare these two phenomena in Vero cell cultures in one serum containing medium (ScA) and one serum free medium (SfB) in bioreactors. Cell growth was evaluated by cell counting(after crystal violet staining) and cell cycle analysis. Necrosis and apoptosis were characterized and quantified by measuring the release of LDH, trypan blue exclusion,annex in V-FITC/PI staining and TUNEL assay. ScA supported a higher maximal viable-cell density(2.3 x 10(6) vs. 1.8 x 10(6) cells ml(-1)). However, cell cycle analysis showed that cell division was more active in SfB than in ScA. LDH release in the supernatant increased much earlier in SfB than in ScA (one vs. five days), but trypan blue counts showed no apparent difference in the viability of the cultures. Apoptosis, evidenced by annexin V-FITC/PI staining, could be detected in the population of suspension cells detached from microcarriers, but not among adherent cells; positivity of the TUNEL assay occurred later than that of the annexin V-FITC/PI staining. Our data indicate that the lower cell yield in SfB,compared with that in ScA, results from a higher cell death rate. Apparently, cells die from apoptosis followed by secondary necrosis. PMID:19003288

  16. Photodynamic efficiency of hypericin compared with chlorin and hematoporphyrin derivatives in HEp-2 and Vero epithelial cell lines.

    PubMed

    Bernal, Claudia; Ribeiro, Anderson O; Andrade, Gislaine P; Perussi, Janice R

    2015-06-01

    Hypericin (HY) is a photoactive aromatic dianthraquinone that is considered a potent photodynamic agent. In this study, hypericin and two other photosensitizers, a hematoporphyrin derivative (Photogem(®); PG) and a chlorin derivative (Photodithazine(®); PZ), were compared in terms of their phototoxicity toward two cell lines, HEp-2 and Vero. The median inhibitory concentration (IC(50)) of each of the photosensitizers was obtained after a 16.2J cm(-2) dose of irradiation at 630 ± 10 nm. The IC(50) values were 0.07 ± 0.01 (HY), 1.0 ± 0.2 (PZ), and 9 ± 1 μgmL(-1) (PG) in HEp-2 cells and 0.3 ± 0.1 (HY), 1.6 ± 0.2 (PZ) and 11 ± 1 μgmL(-1) (PG) in Vero cells, showing that HY is more phototoxic than the others when irradiated at 630 nm. If these results are analyzed, simultaneously, with the first-order constant for BSA tryptophan photooxidation, obtained by fluorescence decay (λ(excitation)=280 nm), which are 11×10(-3) min(-1)±1. 10(-3) min(-1) (HY), 10 × 10(-3) min(-1)±1 × 10(-3) min(-1) (PZ), and 6 × 10(-3)min(-1) ± 1×10(-3)min(-1) (PG), it is possible to infer that the photodynamic efficiency alone is not sufficient to explain the higher HY phototoxicity. The lipophilicity is also an important factor for an efficient target cell accumulation and was assessed for all sensitizers through the octanol-water partition coefficient (log P): 1.20 ± 0.02 (HY), -0.62 ± 0.03 (PZ), and -0.9 ± 0.2 (PG). The higher value for HY correlates well with its observed superior efficiency to promote damage at low concentrations and doses. As HY is used for the long-term treatment of mild depression, it is considered safe for humans. This fact and the present results reinforce the great potential of this photosensitizer to replace porphyrin derivatives, with the advantages that mean it could be used as photosensitizer in clinical photodynamic therapy. PMID:25910552

  17. A polysaccharide fraction from medicinal herb Prunella vulgaris downregulates the expression of herpes simplex virus antigen in Vero cells.

    PubMed

    Chiu, Lawrence Chi-Ming; Zhu, Wen; Ooi, Vincent Eng-Choon

    2004-07-01

    Herpes simplex viruses (HSV) are pathogenic. With the emergence of drug-resistant strains of HSV, new antiviral agents, especially those with different modes of action, are urgently needed. Prunella vulgaris L. (Labiatae), a perennial plant commonly found in China and Europe, has long been used as a folk medicine to cure ailments. In this study, a polysaccharide fraction was prepared from Prunella vulgaris (PPV), and its effects on the expressions of HSV-1 and HSV-2 antigens in their host Vero cells were investigated with flow cytometry. The HSV antigen increased time-dependently in the infected cells, and PPV reduced its expression. The effective concentrations of PPV with 50% reductions of the HSV-1 and HSV-2 antigens were 20.6 and 20.1 microg/ml, respectively. The novelty of PPV is that it also reduces the antigen expression of acyclovir-resistant strain of HSV-1. After incubations with 25-100 microg/ml of PPV the HSV antigen-positive cells were reduced by 24.8-92.6%, respectively, showing that this polysaccharide fraction has a different mode of anti-HSV action from acyclovir. Results from this study show that PPV is effective against both the HSV-1 and HSV-2 infections, and flow cytometry offers a quantitative and highly reproducible anti-HSV drug-susceptibility assay. PMID:15182906

  18. A basic study on the biological monitoring for vanadium-effects of vanadium on Vero cells and the evaluation of intracellular vanadium contents.

    PubMed

    Mochizuki, Mariko; Kudo, Eiko; Kikuchi, Mitsuho; Takano, Takashi; Taniuchi, Yojiro; Kitamura, Tomoya; Hondo, Ryo; Ueda, Fukiko

    2011-07-01

    A high concentration of vanadium (V) has toxic effects on human and animals and is one of environmental pollutants. In the present study, we have conducted a fundamental study using cultured Vero cells from monkey kidney for the future environmental monitoring. Orthovanadate (VAN), one of V compounds, of 10(-10) and 10(-8) M did not affect the cell growth although the higher concentration of above 10(-6) M VAN inhibited the cell growth accompanied with the decrease in cell numbers and morphological changes. Given that the washing method with ice-cold Li is also effective for determination of the cellular Na content, we used this method for the determination of the V content of the Vero cells. The V distributions in Vero cell; in the 10(-3) M VAN solution, extracellular and intracellular were obtained as 1:0.564:0.036 and 1:0.662:0.098 at 60 and 120 min after the treatment of VAN. The intracellular V content was 10% of the applied concentration of VAN. Consequently, it was suggested that V concentration of 10(-7) and 10(-6) M in the tissue and environment, respectively, might become the threshold concentration; a criterion of the environmental contamination when we carry out environmental monitoring. PMID:20556539

  19. Detection of Vero Cells Infected with Herpes Simplex Types 1 and 2 and Varicella Zoster Viruses Using Raman Spectroscopy and Advanced Statistical Methods

    PubMed Central

    Huleihel, Mahmoud; Shufan, Elad; Zeiri, Leila; Salman, Ahmad

    2016-01-01

    Of the eight members of the herpes family of viruses, HSV1, HSV2, and varicella zoster are the most common and are mainly involved in cutaneous disorders. These viruses usually are not life-threatening, but in some cases they might cause serious infections to the eyes and the brain that can lead to blindness and possibly death. An effective drug (acyclovir and its derivatives) is available against these viruses. Therefore, early detection and identification of these viral infections is highly important for an effective treatment. Raman spectroscopy, which has been widely used in the past years in medicine and biology, was used as a powerful spectroscopic tool for the detection and identification of these viral infections in cell culture, due to its sensitivity, rapidity and reliability. Our results showed that it was possible to differentiate, with a 97% identification success rate, the uninfected Vero cells that served as a control, from the Vero cells that were infected with HSV-1, HSV-2, and VZV. For that, linear discriminant analysis (LDA) was performed on the Raman spectra after principal component analysis (PCA) with a leave one out (LOO) approach. Raman spectroscopy in tandem with PCA and LDA enable to differentiate among the different herpes viral infections of Vero cells in time span of few minutes with high accuracy rate. Understanding cell molecular changes due to herpes viral infections using Raman spectroscopy may help in early detection and effective treatment. PMID:27078266

  20. Nonreplicating Vaccinia Virus Vectors Expressing the H5 Influenza Virus Hemagglutinin Produced in Modified Vero Cells Induce Robust Protection▿

    PubMed Central

    Mayrhofer, Josef; Coulibaly, Sogue; Hessel, Annett; Holzer, Georg W.; Schwendinger, Michael; Brühl, Peter; Gerencer, Marijan; Crowe, Brian A.; Shuo, Shen; Hong, Wanjing; Tan, Yee Joo; Dietrich, Barbara; Sabarth, Nicolas; Savidis-Dacho, Helga; Kistner, Otfried; Barrett, P. Noel; Falkner, Falko G.

    2009-01-01

    The timely development of safe and effective vaccines against avian influenza virus of the H5N1 subtype will be of the utmost importance in the event of a pandemic. Our aim was first to develop a safe live vaccine which induces both humoral and cell-mediated immune responses against human H5N1 influenza viruses and second, since the supply of embryonated eggs for traditional influenza vaccine production may be endangered in a pandemic, an egg-independent production procedure based on a permanent cell line. In the present article, the generation of a complementing Vero cell line suitable for the production of safe poxviral vaccines is described. This cell line was used to produce a replication-deficient vaccinia virus vector H5N1 live vaccine, dVV-HA5, expressing the hemagglutinin of a virulent clade 1 H5N1 strain. This experimental vaccine was compared with a formalin-inactivated whole-virus vaccine based on the same clade and with different replicating poxvirus-vectored vaccines. Mice were immunized to assess protective immunity after high-dose challenge with the highly virulent A/Vietnam/1203/2004(H5N1) strain. A single dose of the defective live vaccine induced complete protection from lethal homologous virus challenge and also full cross-protection against clade 0 and 2 challenge viruses. Neutralizing antibody levels were comparable to those induced by the inactivated vaccine. Unlike the whole-virus vaccine, the dVV-HA5 vaccine induced substantial amounts of gamma interferon-secreting CD8 T cells. Thus, the nonreplicating recombinant vaccinia virus vectors are promising vaccine candidates that induce a broad immune response and can be produced in an egg-independent and adjuvant-independent manner in a proven vector system. PMID:19279103

  1. Evaluation of physicochemical and biological properties of chitosan/poly (vinyl alcohol) polymer blend membranes and their correlation for Vero cell growth.

    PubMed

    Sharma, Parul; Mathur, Garima; Dhakate, Sanjay R; Chand, Subhash; Goswami, Navendu; Sharma, Sanjeev K; Mathur, Ashwani

    2016-02-10

    The blend membranes with varying weight ratios of chitosan/poly (vinyl alcohol) (CS/PVA) (1:0, 1:1, 1:2.5, 1.5:1, 1.5: 2.5) were prepared using solvent casting method and were evaluated for their potential application in single-use membrane bioreactors (MBRs). The physicochemical properties of the prepared membranes were investigated for chemical interactions (FTIR), surface morphology (SEM), water uptake, protein sorption (qe), ammonia sorption and growth kinetics of Vero cells. CS/PVA blend membrane having weight ratio of 1.5:1 had shown enhanced membrane flexibility, reduced water uptake, less protein sorption and no ammonium sorption compared to CS membrane. This blend membrane also showed comparatively enhanced higher specific growth rate (0.82/day) of Vero cells. Improved physicochemical properties and growth kinetics obtrude CS/PVA (1.5:1) as a potential surface for adhesion and proliferation with possible application in single use membrane bioreactors. Additionally, new insight explaining correlation between water holding (%) of CS/PVA (1.5:1) blend membrane and doubling time (td) of Vero cells is proposed. PMID:26686166

  2. In vitro anthelmintic activity of the Zizyphus joazeiro bark against gastrointestinal nematodes of goats and its cytotoxicity on Vero cells.

    PubMed

    Gomes, Danilo Cavalcanti; de Lima, Hélimar Gonçalves; Vaz, Ariádne Vieira; Santos, Nathália Silva; Santos, Francianne Oliveira; Dias, Êuder Reis; Botura, Mariana Borges; Branco, Alexsandro; Batatinha, Maria José Moreira

    2016-08-15

    This study examined the in vitro effect of the Zizyphus joazeiro bark against gastrointestinal nematodes of goats and its cytotoxicity on Vero cells. The ovicidal activity of the crude hydroethanolic extract (CE), its partitioned hexane (HE) and aqueous extract (AE) and saponins fraction (SF), including betulinic acid (BA), a biogenetic compound from this plant found in HE, were investigated using the inhibition of egg hatch assay (EHA). Thereafter, the extracts and the SF were evaluated through the larval motility assay (LMA) and larval migration inhibition assay (LMIA). The AE and SF promoted a complete inhibition of the egg hatch, and the effective concentration to inhibit 50% (EC50) values was 1.9 and 1.3mg/mL, respectively. The highest percentages of inhibition in EHA observed after treatments with CE, HE and BA corresponded to 79, 48 and 17%, respectively. The extracts and SF did not show larvicidal activity in LMA and LMIA. The AE and SF demonstrated cytotoxic effects in 3-4,5-dimethylthiazol-2-yl, 2,5diphenyltetrazolium bromide (MTT) and trypan blue tests; however, SF was more toxic (50% inhibitory concentration, IC50=0.20mg/mL). The chemical characterization of the SF was made through Proton Nuclear Magnetic Resonance ((1)H NMR) and Electrospray Ionization Mass Spectrometry (ESI-MS) analyses, which led to the identification of two saponins known as Joazeiroside B and Lotoside A. The results obtained from the research of this saponin content provide important information about the biological activity, especially the anthelmintic effect present in the plant investigated. That also suggests the types of bioactive compounds that may be responsible for this antiparasitic activity exhibited by the plant extracts. PMID:27514875

  3. Immunogenicity and safety of purified Vero-cell rabies vaccine in severely rabies-exposed patients in China.

    PubMed

    Wang, X J; Lang, J; Tao, X R; Shu, J D; Le Mener, V; Wood, S C; Huang, J T; Zhao, S L

    2000-06-01

    The immunogenicity and safety of a purified Vero-cell rabies vaccine (PVRV, VERORAB; Aventis Pasteur, France) were evaluated in 171 patients treated for severe exposure to rabies (WHO category III contacts) at the Shandong Provincial Antiepidemic Station in Jinan and an EPI center in Ping Yin, China. Post-exposure treatment consisted of a single dose of equine rabies immunoglobulin (ERIG, 40 IU/kg body weight) on Day (D) 0, and intra-muscular administration of PVRV on D 0, 3, 7, 14 and 28. Antirabies antibody levels were evaluated on D 0, 7, 14, 28, 90 and 180 using the rapid fluorescent focus inhibition test. By D 14 all subjects had seroconverted (> or = 0.5 IU/ml), with a geometric mean titer of 50.3 IU/ml. Antibody titers remained above the seroprotection threshold in all patients for 3 months, and in 98.2% of subjects for 6 months. All patients were still alive 6 months after the start of treatment. PVRV and ERIG were shown to be well tolerated and no serious adverse events were observed. Following PVRV administration, 12 patients (7.0%) had at least one local reaction (mostly pruritus, erythematous rash and pain). Fourteen patients (8.2%) developed local reactions at the site of ERIG administration. Twelve patients (7.0%) developed systemic reactions following post-exposure treatment, the most frequent of which were pruritus, rash and vertigo. This study demonstrates that PVRV is immunogenic and safe in Chinese patients treated according to WHO recommendations for severe rabies exposure. PMID:11127328

  4. Neutralizing Antibody Response after Intramuscular Purified Vero Cell Rabies Vaccination (PVRV) in Iranian Patients with Specific Medical Conditions

    PubMed Central

    Rahimi, Pooneh; Vahabpour, RouhAllah; Aghasadeghi, Mohammad Reza; Sadat, Syed Mehdi; Howaizi, Nader; Mostafavi, Ehsan; Eslamifar, Ali; Fallahian, Vida

    2015-01-01

    Objective Post exposure prophylaxis using one of the WHO-approved vaccines is the method of choice for preventing rabies. Abnormal immune function in patients with some specific medical conditions, such as pregnancy, chronic hepatitis B virus infection, different types of cancers like lymphoma, diabetes I and II, corticosteroid consumption by patients with rheumatoid arthritis and lupus erythematosus, could impair the immunologic response to various vaccines. The immune response to rabies vaccination has never been examined in patients with any of these described medical conditions. This study purposed to evaluate the neutralyzing antibody response after vaccination with purified Vero cell rabies vaccine (PVRV) according to the WHO-recommended Post–Exposure Prophylaxis (PEP) "ESSEN" regimen. Methods Thirty healthy volunteers and 50 volunteers with different medical conditions who were exposed to a suspected rabid animal in the 2nd or 3rd category of exposure received 5 doses of PVRV under the ESSEN protocol. Three blood samples were collected on days 0 (before the first dose), 14, and 35. The anti-rabies antibody titer was measured using the Rapid Fluorescent Foci Inhibition Test (RFFIT) and an ELISA Bio-Rad, Platelia, Rabies II kit. Results All subjects reached NAb titers above 0.5 IU/ml by day 14 after vaccination. On day 35 (1 week after receiving the last rabies vaccine), anti-rabies antibodies were in the protective level (>0.5 IU/ml) in both groups. There was no statistically significant difference in anti-rabies antibody response due to the type of exposure (category 2 or 3), and successful seroconversion was confirmed in both groups. Conclusion In conclusion, the ESSEN protocol using the PVRV vaccine is sufficient for rabies prophylaxis in patients with specific medical conditions. PMID:26440665

  5. Reduction of spiked porcine circovirus during the manufacture of a Vero cell-derived vaccine.

    PubMed

    Lackner, Cornelia; Leydold, Sandra M; Modrof, Jens; Farcet, Maria R; Grillberger, Leopold; Schäfer, Birgit; Anderle, Heinz; Kreil, Thomas R

    2014-04-11

    Porcine circovirus-1 (PCV1) was recently identified as a contaminant in live Rotavirus vaccines, which was likely caused by contaminated porcine trypsin. The event triggered the development of new regulatory guidance on the use of porcine trypsin which shall ensure that cell lines and porcine trypsin in use are free from PCV1. In addition, manufacturing processes of biologicals other than live vaccines include virus clearance steps that may prevent and mitigate any potential virus contamination of product. In this work, artificial spiking of down-scaled models for the manufacturing process of an inactivated pandemic influenza virus vaccine were used to investigate inactivation of PCV1 and the physico-chemically related porcine parvovirus (PPV) by formalin and ultraviolet-C (UV-C) treatment as well as removal by the purification step sucrose gradient ultracentrifugation. A PCV1 infectivity assay, using a real-time PCR infectivity readout was established. The formalin treatment (0.05% for 48h) showed substantial inactivation for both PCV1 and PPV with reduction factors of 3.0log10 and 6.8log10, respectively, whereas UV-C treatment resulted in complete PPV (≥5.9log10) inactivation already at a dose of 13mJ/cm but merely 1.7log10 at 24mJ/cm(2) for PCV1. The UV-C inactivation results with PPV were confirmed using minute virus of mice (MVM), indicating that parvoviruses are far more sensitive to UV-C than PCV1. The sucrose density gradient ultracentrifugation also contributed to PCV1 clearance with a reduction factor of 2log10. The low pH treatment during the production of procine trypsin was investigated and showed effective inactivation for both PCV1 (4.5log10) and PPV (6.4log10). In conclusion, PCV1 in general appears to be more resistant to virus inactivation than PPV. Still, the inactivated pandemic influenza vaccine manufacturing process provides for robust virus reduction, in addition to the already implemented testing for PCV1 to avoid any contaminations. PMID

  6. Transcriptional profiling of Vero E6 cells over-expressing SARS-CoV S2 subunit: Insights on viral regulation of apoptosis and proliferation

    SciTech Connect

    Yeung, Y.-S. Yip, C.-W. Hon, C.-C. Chow, Ken Y.C. Ma, Iris C.M. Zeng Fanya Leung, Frederick C.C.

    2008-02-05

    We have previously demonstrated that over-expression of spike protein (S) of severe acute respiratory syndrome coronavirus (SARS-CoV) or its C-terminal subunit (S2) is sufficient to induce apoptosis in vitro. To further investigate the possible roles of S2 in SARS-CoV-induced apoptosis and pathogenesis of SARS, we characterized the host expression profiles induced upon S2 over-expression in Vero E6 cells by oligonucleotide microarray analysis. Possible activation of mitochondrial apoptotic pathway in S2 expressing cells was suggested, as evidenced by the up-regulation of cytochrome c and down-regulation of the Bcl-2 family anti-apoptotic members. Inhibition of Bcl-2-related anti-apoptotic pathway was further supported by the diminution of S2-induced apoptosis in Vero E6 cells over-expressing Bcl-xL. In addition, modulation of CCN E2 and CDKN 1A implied the possible control of cell cycle arrest at G1/S phase. This study is expected to extend our understanding on the pathogenesis of SARS at a molecular level.

  7. Immunogenicity and Protective Efficacy of a Vero Cell Culture-Derived Whole-Virus H7N9 Vaccine in Mice and Guinea Pigs

    PubMed Central

    Wodal, Walter; Schwendinger, Michael G.; Savidis-Dacho, Helga; Crowe, Brian A.; Hohenadl, Christine; Fritz, Richard; Brühl, Peter; Portsmouth, Daniel; Karner-Pichl, Anita; Balta, Dalida; Grillberger, Leopold; Kistner, Otfried; Barrett, P. Noel; Howard, M. Keith

    2015-01-01

    Background A novel avian H7N9 virus with a high case fatality rate in humans emerged in China in 2013. We evaluated the immunogenicity and protective efficacy of a candidate Vero cell culture-derived whole-virus H7N9 vaccine in small animal models. Methods Antibody responses induced in immunized DBA/2J mice and guinea pigs were evaluated by hemagglutination inhibition (HI), microneutralization (MN), and neuraminidase inhibition (NAi) assays. T-helper cell responses and IgG subclass responses in mice were analyzed by ELISPOT and ELISA, respectively. Vaccine efficacy against lethal challenge with wild-type H7N9 virus was evaluated in immunized mice. H7N9-specific antibody responses induced in mice and guinea pigs were compared to those induced by a licensed whole-virus pandemic H1N1 (H1N1pdm09) vaccine. Results The whole-virus H7N9 vaccine induced dose-dependent H7N9-specific HI, MN and NAi antibodies in mice and guinea pigs. Evaluation of T-helper cell responses and IgG subclasses indicated the induction of a balanced Th1/Th2 response. Immunized mice were protected against lethal H7N9 challenge in a dose-dependent manner. H7N9 and H1N1pdm09 vaccines were similarly immunogenic. Conclusions The induction of H7N9-specific antibody and T cell responses and protection against lethal challenge suggest that the Vero cell culture-derived whole-virus vaccine would provide an effective intervention against the H7N9 virus. PMID:25719901

  8. Comparison of human immune responses to purified Vero cell and human diploid cell rabies vaccines by using two different antibody titration methods.

    PubMed Central

    Kitala, P M; Lindqvist, K J; Koimett, E; Johnson, B K; Chunge, C N; Perrin, P; Olsvik, O

    1990-01-01

    Antibody responses to a conventional rabies preexposure regimen of a new purified Vero cell rabies vaccine (PVRV) and a human diploid cell vaccine (HDCV) were compared in 80 healthy Kenyan veterinary students. Forty-three of the students received the PVRV and 37 received the HDCV on days 0, 7, and 28. Antibody responses were monitored by using the rapid fluorescent-focus inhibition test (RFFIT) and an inhibition enzyme immunoassay (INH EIA) on days 0, 7, 28, and 49. Both vaccines elicited a rapid antibody response. A good correlation between the RFFIT titers and the INH EIA titers was obtained (r = 0.90). Our results also showed that the INH EIA was more reproducible and might therefore be a suitable substitute for the more expensive and less reproducible RFFIT. The geometric mean titers determined by both tests in the two groups of students were statistically similar during the test period. The RFFIT and the INH EIA gave comparable geometric mean titers, which differed significantly only on day 28 in the PVRV group. The effect of the new PVRV is comparable to that of the more expensive HDCV, as determined by the present test systems. The PVRV could therefore be the vaccine of choice, especially in tropical rabies-endemic areas, where the high cost of the HDCV has confined its use to a privileged few. PMID:2203814

  9. Preparation and characterization of an anti-inflammatory agent based on a zinc-layered hydroxide-salicylate nanohybrid and its effect on viability of Vero-3 cells

    PubMed Central

    Ramli, Munirah; Hussein, Mohd Zobir; Yusoff, Khatijah

    2013-01-01

    A new organic-inorganic nanohybrid based on zinc-layered hydroxide intercalated with an anti-inflammatory agent was synthesized through direct reaction of salicylic acid at various concentrations with commercially available zinc oxide. The basal spacing of the pure phase nanohybrid was 15.73 Å, with the salicylate anions arranged in a monolayer form and an angle of 57 degrees between the zinc-layered hydroxide interlayers. Fourier transform infrared study further confirmed intercalation of salicylate into the interlayers of zinc-layered hydroxide. The loading of salicylate in the nanohybrid was estimated to be around 29.66%, and the nanohybrid exhibited the properties of a mesoporous-type material, with greatly enhanced thermal stability of the salicylate compared with its free counterpart. In vitro cytotoxicity assay revealed that free salicylic acid, pure zinc oxide, and the nanohybrid have a mild effect on viability of African green monkey kidney (Vero-3) cells. PMID:23345976

  10. Preparation and characterization of an anti-inflammatory agent based on a zinc-layered hydroxide-salicylate nanohybrid and its effect on viability of Vero-3 cells.

    PubMed

    Ramli, Munirah; Hussein, Mohd Zobir; Yusoff, Khatijah

    2013-01-01

    A new organic-inorganic nanohybrid based on zinc-layered hydroxide intercalated with an anti-inflammatory agent was synthesized through direct reaction of salicylic acid at various concentrations with commercially available zinc oxide. The basal spacing of the pure phase nanohybrid was 15.73 Å, with the salicylate anions arranged in a monolayer form and an angle of 57 degrees between the zinc-layered hydroxide interlayers. Fourier transform infrared study further confirmed intercalation of salicylate into the interlayers of zinc-layered hydroxide. The loading of salicylate in the nanohybrid was estimated to be around 29.66%, and the nanohybrid exhibited the properties of a mesoporous-type material, with greatly enhanced thermal stability of the salicylate compared with its free counterpart. In vitro cytotoxicity assay revealed that free salicylic acid, pure zinc oxide, and the nanohybrid have a mild effect on viability of African green monkey kidney (Vero-3) cells. PMID:23345976

  11. Antibody response of patients after postexposure rabies vaccination with small intradermal doses of purified chick embryo cell vaccine or purified Vero cell rabies vaccine.

    PubMed Central

    Briggs, D. J.; Banzhoff, A.; Nicolay, U.; Sirikwin, S.; Dumavibhat, B.; Tongswas, S.; Wasi, C.

    2000-01-01

    Although the introduction of tissue culture vaccines for rabies has dramatically improved the immunogenicity and safety of rabies vaccines, they are often prohibitively expensive for developing countries. To examine whether smaller doses of these vaccines could be used, we tested the safety and immunogenicity of purified chick embryo cell vaccine (PCECV) on 211 patients in Thailand with World Health Organization (WHO) category II and III exposures to rabies. The patients presented at two Thai hospitals and were randomized into three groups. Patients in Group 1 received 0.1 ml PCECV intradermally at two sites on days 0, 3, 7, and at one site on days 30 and 90. Group 2 was treated similarly, except that purified Vero cell rabies vaccine (PVRV) was used instead of PCECV. Group 3 received 1.0 ml PCECV intramuscularly on days 0, 3, 7, 14, 30 and 90. After 0, 3, 7, 14, 30 and 90 days serum was collected from the subjects and the geometric mean titres (GMTs) of rabies virus neutralizing antibody determined. After 14 days the GMT of 59 patients vaccinated intradermally with PCECV was equivalent to that of patients who received PVRV. Adverse reactions were more frequent in patients who received vaccines intradermally, indicating the reactions were associated with the route of injection, rather than the vaccine per se. We conclude that PCECV is a safe and highly immunogenic vaccine for postexposure rabies vaccination when administered intradermally in 0.1-ml doses using the two-site method ("2,2,2,0,1,1") recommended by WHO. PMID:10859864

  12. ACAM2000 clonal Vero cell culture vaccinia virus (New York City Board of Health strain)--a second-generation smallpox vaccine for biological defense.

    PubMed

    Monath, Thomas P; Caldwell, Joseph R; Mundt, Wolfgang; Fusco, Joan; Johnson, Casey S; Buller, Mark; Liu, Jian; Gardner, Bridget; Downing, Greg; Blum, Paul S; Kemp, Tracy; Nichols, Richard; Weltzin, Richard

    2004-10-01

    The threat of smallpox as a biological weapon has spurred efforts to create stockpiles of vaccine for emergency preparedness. In lieu of preparing vaccine in animal skin (the original method), we cloned vaccinia virus (New York City Board of Health strain, Dryvax by plaque purification and amplified the clone in cell culture. The overarching goal was to produce a modern vaccine that was equivalent to the currently licensed Dryvax in its preclinical and clinical properties, and could thus reliably protect humans against smallpox. A variety of clones were evaluated, and many were unacceptably virulent in animal models. One clonal virus (ACAM1000) was selected and produced at clinical grade in MRC-5 human diploid cells. ACAM1000 was comparable to Dryvax in immunogenicity and protective activity but was less neurovirulent for mice and nonhuman primates. To meet requirements for large quantities of vaccine after the events of September 11th 2001, the ACAM1000 master virus seed was used to prepare vaccine (designated ACAM2000) at large scale in Vero cells under serum-free conditions. The genomes of ACAM1000 and ACAM2000 had identical nucleotide sequences, and the vaccines had comparable biological phenotypes. ACAM1000 and ACAM2000 were evaluated in three Phase 1 clinical trials. The vaccines produced major cutaneous reactions and evoked neutralizing antibody and cell-mediated immune responses in the vast majority of subjects and had a reactogenicity profile similar to that of Dryvax. PMID:15491873

  13. Colon tumor cells grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    2001-01-01

    These photos compare the results of colon carcinoma cells grown in a NASA Bioreactor flown on the STS-70 Space Shuttle in 1995 flight and ground control experiments. The cells grown in microgravity (left) have aggregated to form masses that are larger and more similar to tissue found in the body than the cells cultured on the ground (right). The principal investigator is Milburn Jessup of the University of Texas M. D. Anderson Cancer Center. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Cell constructs grown in a rotating bioreactor on Earth (left) eventually become too large to stay suspended in the nutrient media. In the microgravity of orbit, the cells stay suspended. Rotation then is needed for gentle stirring to replenish the media around the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Credit: NASA and University of Texas M. D. Anderson Cancer Center.

  14. Evaluation and Comparison of the In Vitro Cytotoxic Activity of Withania somnifera Methanolic and Ethanolic Extracts against MDA-MB-231 and Vero Cell Lines

    PubMed Central

    Srivastava, A. N.; Ahmad, Rumana; Khan, Mohsin Ali

    2016-01-01

    Withania somnifera Dunal (WS), commonly known as Ashwagandha in India, belongs to the family Solanaceae. It is extensively used in most of the Indian herbal pharmaceuticals and nutraceuticals. In the current study, the in vitro cytotoxic activity of methanolic, ethanolic, and aqueous extracts of WS stems was evaluated using cytometry and the MTT assay against the MDA-MB-231 human breast cancer cell line. Methanolic and ethanolic extracts of WS showed potent anticancer activity on the MDA-MB-231 human breast cancer cell line, whereas the aqueous extract did not exhibit any significant activity at 100 µg/ml. The percentage viability of the cell lines was determined by using the Trypan blue dye exclusion method. Cell viability was reduced to 21% and 0% at 50 and 100 µg/ml of the methanolic extract, respectively, as compared to 19% and 0% at 50 and 100 µg/ml for the ethanolic extract and 37% at 100 µg/ml in sterile Milli-Q water after 48 hours of treatment. Methanolic and ethanolic extracts of WS were shown to possess IC50 values of 30 and 37 µg/ml, respectively, by the MTT assay and cytometer-based analysis, with the methanolic extract being more active than the other two. On the other hand, methanolic and ethanolic extracts of WS did not exhibit any significant in vitro activity against the normal epithelial cell line Vero at 50 µg/ml. HPLC was carried out for the analysis of its phytochemical profile and demonstrated the presence of the active component Withaferin A in both extracts. The methanolic and ethanolic extracts of Withania should be studied further for the isolation and characterization of the active components to lead optimization studies. PMID:27110497

  15. Evaluation and Comparison of the In Vitro Cytotoxic Activity of Withania somnifera Methanolic and Ethanolic Extracts against MDA-MB-231 and Vero Cell Lines.

    PubMed

    Srivastava, A N; Ahmad, Rumana; Khan, Mohsin Ali

    2016-01-01

    Withania somnifera Dunal (WS), commonly known as Ashwagandha in India, belongs to the family Solanaceae. It is extensively used in most of the Indian herbal pharmaceuticals and nutraceuticals. In the current study, the in vitro cytotoxic activity of methanolic, ethanolic, and aqueous extracts of WS stems was evaluated using cytometry and the MTT assay against the MDA-MB-231 human breast cancer cell line. Methanolic and ethanolic extracts of WS showed potent anticancer activity on the MDA-MB-231 human breast cancer cell line, whereas the aqueous extract did not exhibit any significant activity at 100 µg/ml. The percentage viability of the cell lines was determined by using the Trypan blue dye exclusion method. Cell viability was reduced to 21% and 0% at 50 and 100 µg/ml of the methanolic extract, respectively, as compared to 19% and 0% at 50 and 100 µg/ml for the ethanolic extract and 37% at 100 µg/ml in sterile Milli-Q water after 48 hours of treatment. Methanolic and ethanolic extracts of WS were shown to possess IC50 values of 30 and 37 µg/ml, respectively, by the MTT assay and cytometer-based analysis, with the methanolic extract being more active than the other two. On the other hand, methanolic and ethanolic extracts of WS did not exhibit any significant in vitro activity against the normal epithelial cell line Vero at 50 µg/ml. HPLC was carried out for the analysis of its phytochemical profile and demonstrated the presence of the active component Withaferin A in both extracts. The methanolic and ethanolic extracts of Withania should be studied further for the isolation and characterization of the active components to lead optimization studies. PMID:27110497

  16. Sensitivity of light-grown and dark-grown Euglena cells to gamma-irradiation.

    PubMed

    Nair, K A; Netrawali, M S

    1979-09-01

    Light-grown cells which contain fully developed chloroplasts were found to be more resistant to gamma-irradiation than dark-grown cells which are devoid of chloroplasts. The radio-resistance of dark-grown cells progressively increased during light-induced development of chloroplasts and, conversely, radio-resistance of light-grown cells decreased progressively with chloroplast de-development during growth in the dark. The presence of chloroplasts seemed to play a major role in the capacity of cells to recover from radiation damage, the efficiency of cellular recovery being correlatable with the degree of chloroplast development. PMID:315395

  17. Human respiratory syncytial virus Memphis 37 grown in HEp-2 cells causes more severe disease in lambs than virus grown in vero cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Respiratory syncytial virus (RSV) is the most common cause of bronchiolitis in infants and young children. A small percentage of these individuals develop severe and even fatal disease. To better understand the pathogenesis of severe disease and develop therapies unique to the less-developed infan...

  18. Comparative study on the cytotoxicity of different Myrtaceae essential oils on cultured vero and RC-37 cells.

    PubMed

    Schnitzler, P; Wiesenhofer, K; Reichling, J

    2008-11-01

    Medicinally and commercially important essential oils from the family Myrtaceae, i.e. cajuput, clove, kanuka and manuka were phytochemically analysed by GC-MS. Cytotoxicity of these essential oils was evaluated in a standard neutral red assay. Maximum noncytotoxic concentrations for cajuput oil and clove oil were determined at 0.006%, kanuka oil and manuka oil were more cytotoxic with a maximum noncytotoxic concentration of 0.001%. The compounds alpha-pinene, eugenol and leptospermone demonstrated maximum noncytotoxic concentrations at dilutions of 0.001%, 0.003% and 0.001%, respectively. However, the terpene 1,8-cineole was about 100 times less toxic to cultured cells with a maximum noncytotoxic concentration of 0.1% and a TC50 value of 0.44%. Manuka essential oil exhibited high levels of virucidal activity against HSV-1 as well against drug-resistant HSV-1 isolates in viral suspension tests. Determination of cytotoxicity of natural products is an important prerequisite for application in cosmetic and health care products and in antiviral tests. PMID:19069246

  19. Subtilase cytotoxin, produced by Shiga-toxigenic Escherichia coli, transiently inhibits protein synthesis of Vero cells via degradation of BiP and induces cell cycle arrest at G1 by downregulation of cyclin D1.

    PubMed

    Morinaga, Naoko; Yahiro, Kinnosuke; Matsuura, Gen; Moss, Joel; Noda, Masatoshi

    2008-04-01

    Subtilase cytotoxin (SubAB) is a AB(5) type toxin produced by Shiga-toxigenic Escherichia coli, which exhibits cytotoxicity to Vero cells. SubAB B subunit binds to toxin receptors on the cell surface, whereas the A subunit is a subtilase-like serine protease that specifically cleaves chaperone BiP/Grp78. As noted previously, SubAB caused inhibition of protein synthesis. We now show that the inhibition of protein synthesis was transient and occurred as a result of ER stress induced by cleavage of BiP; it was closely associated with phosphorylation of double-stranded RNA-activated protein kinase-like ER kinase (PERK) and eukaryotic initiation factor-2alpha (eIF2alpha). The phosphorylation of PERK and eIF2alpha was maximal at 30-60 min and then returned to the control level. Protein synthesis after treatment of cells with SubAB was suppressed for 2 h and recovered, followed by induction of stress-inducible C/EBP-homologous protein (CHOP). BiP degradation continued, however, even after protein synthesis recovered. SubAB-treated cells showed cell cycle arrest in G1 phase, which may result from cyclin D1 downregulation caused by both SubAB-induced translational inhibition and continuous prolonged proteasomal degradation. PMID:18005237

  20. Preparation of genetically engineered A/H5N1 and A/H7N1 pandemic vaccine viruses by reverse genetics in a mixture of Vero and chicken embryo cells

    PubMed Central

    Legastelois, Isabelle; Garcia‐Sastre, Adolfo; Palese, Peter; Tumpey, Terrence M.; Maines, Taronna R.; Katz, Jacqueline M.; Vogel, Frederick R.; Moste, Catherine

    2007-01-01

    Background  In case of influenza pandemic, a robust, easy and clean technique to prepare reassortants would be necessary. Objectives  Using reverse genetics, we prepared two vaccine reassortants (A/H5N1 × PR8 and A/H7N1 × PR8) exhibiting the envelope glycoproteins from non‐pathogenic avian viruses, A/Turkey/Wisconsin/68 (A/H5N9) and A/Rhea/New Caledonia/39482/93 (A/H7N1) and the internal proteins of the attenuated human virus A/Puerto Rico/8/34 (H1N1). Methods  The transfection was accomplished using a mixture of Vero and chicken embryo cells both of which are currently being used for vaccine manufacturing. Results  This process was reproducible, resulting in consistent recovery of influenza viruses in 6 days. Because it is mainly the A/H5N1 strain that has recently crossed the human barrier, it is the A/PR8 × A/H5N1 reassortant (RG5) that was further amplified, either in embryonated hen eggs or Vero cells, to produce vaccine pre‐master seed stocks that met quality control specifications. Safety testing in chickens and ferrets was performed to assess the non‐virulence of the reassortant, and finally analysis using chicken and ferret sera immunized with the RG5 virus showed that the vaccine candidate elicited an antibody response cross‐reactive with the Hong Kong 1997 and 2003 H5N1 strains but not the Vietnam/2004 viruses. Conclusions  The seeds obtained could be used as part of a pandemic vaccine strain ‘library’ available in case of propagation in humans of a new highly pathogenic avian strain. PMID:19453414

  1. OM-VPE grown materials for high efficiency solar cells

    NASA Technical Reports Server (NTRS)

    Saxena, R.; Cooper, B., III; Ludowise, M.; Borden, P.; Gregory, P.

    1980-01-01

    Organometallic sources are available for all the III-V elements and a variety of dopants; thus it is possible to use the technique to grow a wide variety of semiconductor compounds. AlGaAsSb and AlGaInAs alloys for multijunction monolithic solar cells were grown by OM-VPE. While the effort concentrated on terrestrial applications, the success of OM-VPE grown GaAs/AlGaAs concentrator solar cells (23% at 400 suns) demonstrates that OM-VPE is suitable for growing high efficiency solar cells in large quantities for space applications. In addition, OM-VPE offers the potential for substantial cost reduction of photovoltaic devices with scale up and automation and due to high process yield from reproducible, uniform epitaxial growths with excellent surface morphology.

  2. Comparison of vero cell plaque assay, TaqMan reverse transcriptase polymerase chain reaction RNA assay, and VecTest antigen assay for detection of West Nile virus in field-collected mosquitoes.

    PubMed

    Nasci, Roger S; Gottfried, Kristy L; Burkhalter, Kristen L; Kulasekera, Varuni L; Lambert, Amy J; Lanciotti, Robert S; Hunt, Ann R; Ryan, Jeffrey R

    2002-12-01

    Mosquitoes collected during the epidemic of West Nile virus (WN) in Staten Island, NY, during 2000 were identified to species, grouped into pools of up to 50 individuals, and tested for the presence of WN by using TaqMan reverse transcriptase polymerase chain reaction (RT-PCR) to detect West Nile viral RNA, Vero cell plaque assay to detect infectious virus, and VecTest WNV/SLE Antigen Panel Assay. A total of 10,866 specimens was tested in 801 pools. Analysis of results indicated that TaqMan RT-PCR detected 34 WN-positive pools, more than either of the other techniques. The plaque assay detected 74% of the pools positive by TaqMan, and VecTest detected 60% of the pools positive by TaqMan. The VecTest assay detected evidence of West Nile viral antigen in 67% of the pools that contained live virus detected by plaque assay. A WN enzyme immunoassay performed similarly to the VecTest WN assay. Differences in performance were related to relative sensitivity of the tests. Infection rates of WN in Culex pipiens and Cx. salinarius calculated by the 3 techniques varied, but each estimate indicated a high infection rate in the population. Positive and negative attributes of each procedure, which may influence how and where they are used in surveillance programs, are discussed. PMID:12542186

  3. Lactobacillus plantarum LB95 impairs the virulence potential of Gram-positive and Gram-negative food-borne pathogens in HT-29 and Vero cell cultures.

    PubMed

    Dutra, Virna; Silva, Ana Carla; Cabrita, Paula; Peres, Cidália; Malcata, Xavier; Brito, Luisa

    2016-01-01

    Listeria monocytogenes, Salmonella enterica and verocytotoxigenic Escherichia coli (VTEC) are amongst the most important agents responsible for food outbreaks occurring worldwide. In this work, two Lactobacillus spp. strains (LABs), Lactobacillus plantarum (LB95) and Lactobacillus paraplantarum (LB13), previously isolated from spontaneously fermenting olive brines, and two reference probiotic strains, Lactobacillus casei Shirota and Lactobacillus rhamnosus GG, were investigated for their ability to attenuate the virulence of the aforementioned pathogens using animal cell culture assays. In competitive exclusion assays, the relative percentages of adhesion and invasion of S. enterica subsp. enterica serovar Enteritidis were significantly reduced when the human HT-29 cell line was previously exposed to LB95. The relative percentage of invasion by Listeria monocytogenes was significantly reduced when HT-29 cells were previously exposed to LB95. In the cytotoxicity assays, the cell-free supernatant of the co-culture (CFSC)of VTEC with LB95 accounted for the lowest value obtained amongst the co-cultures of VTEC with LABs, and was significantly lower than the value obtained with the co-culture of VTEC with the two probiotic reference strains. The cytotoxicity of CFSC of VTEC with both LB95 and LB13 exhibited values not significantly different from the cell-free supernatant of the nonpathogenic E. coli B strain. Our results suggested that LB95 may be able to attenuate the virulence of Gram-positive and Gram-negative food-borne pathogens; together with other reported features of these strains, our data reveal their possible use in probiotic foods due to their interesting potential in preventing enteric infections in humans. PMID:26506821

  4. Role of Proteus mirabilis MR/P fimbriae and flagella in adhesion, cytotoxicity and genotoxicity induction in T24 and Vero cells.

    PubMed

    Scavone, Paola; Villar, Silvia; Umpiérrez, Ana; Zunino, Pablo

    2015-06-01

    Proteus mirabilis is frequently associated with complicated urinary tract infections (UTI). It is proposed that several virulence factors are associated with P. mirabilis uropathogenicity. The aim of this work was to elucidate genotoxic and cytotoxic effects mediated by MR/P fimbriae and flagella in eukaryotic cells in vitro. Two cell lines (kidney- and bladder-derived) were infected with a clinical wild-type P. mirabilis strain and an MR/P and a flagellar mutant. We evaluated adhesion, genotoxicity and cytotoxicity by microscopy, comet assay and triple staining technique, respectively. Mutant strains displayed lower adhesion rates than the P. mirabilis wild-type strain and were significantly less effective to induce genotoxic and cytotoxic effects compared to the wild type. We report for the first time that P. mirabilis MR/P fimbriae and flagella mediate genotoxic and cytotoxic effects on eukaryotic cells, at least in in vitro conditions. These results could contribute to design new strategies for the control of UTI. PMID:25724892

  5. Evaluation of the safety, immunogenicity, and pharmacokinetic profile of a new, highly purified, heat-treated equine rabies immunoglobulin, administered either alone or in association with a purified, Vero-cell rabies vaccine.

    PubMed

    Lang, J; Attanath, P; Quiambao, B; Singhasivanon, V; Chanthavanich, P; Montalban, C; Lutsch, C; Pepin-Covatta, S; Le Mener, V; Miranda, M; Sabchareon, A

    1998-07-30

    A clinical evaluation of a new, purified, heat-treated equine rabies immunoglobulin (PHT-Erig), F(ab')2 preparation, was carried out in Thailand and in the Philippines-two countries where rabies is endemic. An initial prospective, randomised, controlled trial (Study 1), compared the safety and pharmacokinetics (serum concentrations of rabies antibodies) after administration either of PHT-Erig or of a commercially-available, equine rabies immune globulin (Erig PMC). A second trial (Study 2) simulated post-exposure rabies prophylaxis by using a reference cell culture vaccine, the purified Vero-cell rabies vaccine (PVRV), administered in association with either Erig PMC or PHT-Erig. In Study 1, 27 healthy, Thai adults received a 40 IU kg(-1) dose of either Erig PMC (n = 12) or PHT-Erig (n = 15) via the intramuscular (i.m.) route; half of the dose was injected into the deltoid area and the other half into the buttocks. Serum for rabies antibody determination and F(ab')2 concentration was collected at hours (H) 0, 6 and 12, and on day (D) 2, 3, 4, 6, 8, 10, 12 and 15. Both products were safe, with no serious adverse events, and in particular, no anaphylactic reactions or serum sickness was reported. A statistical comparison of the pharmacokinetic parameters did not demonstrate bioequivalence of the two products. Nonetheless, the relative bioavailability of 93% and the similar absorption rates suggest the pharmacokinetic profiles of Erig and PHT-Erig are similar. The antibody level in either group were low throughout the 15-day study period. The geometric mean titer (GMT) values ranged from group 0.027-0.117 IU ml(-1) in the Erig group and from 0.029 to 0.072 IU ml(-1) in the PHT-Erig. There was no significant difference between the evolution of GMT values for the two groups. In Study 2, 71 healthy volunteers received 40 IU kg(-1) via the intramuscular route of either Erig PMC (n = 36) or PHT-Erig (n = 35) on D0, in association with five doses of PVRV on D0, D3, D7, D14

  6. Multiband spectral emitters matched to MBE grown photovoltaic cells

    SciTech Connect

    Wong, E.M.; Hickey, J.P.; Holmquist, G.A.; Uppal, P.N.; Waldman, C.H.

    1996-02-01

    Clearly TPV devices are of considerable interest for power generation. For practical devices it is desirable to have high efficiencies combined with low temperature operation. Photovoltaic cells which can convert the energy at the longer wavelengths of interest are needed to complete such a system. The spectral emission peak of Yb{sub 2}O{sub 3} is well matched to the band gap of Si; however, the longer wavelength, spectral emissions of other rare earth oxides can also be exploited through the use of III{endash}V semiconductor compounds such as GaSb or alloys of GaInAsSb. By doping GaSb with InAs, the band gap of the resulting material can be effectively varied depending upon the concentration of InAs in the quaternary alloy. The ability to tailor the emitter materials and, in conjunction, the photovoltaic materials leads to greater efficiencies through spectral matching. Two binary rare earth oxide combinations, Er{sub 2}O{sub 3}/Ho{sub 2}O{sub 3} and Er{sub 2}O{sub 3}/Yb{sub 2}O{sub 3}, were studied. The mixtures were found to give multiple peak spectral emission in the wavelengths of interest. The intensity of the peaks were compositionally dependent though it did not vary in a linear fashion. Photon efficiencies of the molecular beam epitaxially (MBE) grown GaSb cell and GaInAsSb quaternary cell were measured when used in conjunction with the Er{sub 2}O{sub 3}/Ho{sub 2}O{sub 3} emitters in which the concentration of Er{sub 2}O{sub 3} and Ho{sub 2}O{sub 3} were varied. The results demonstrated promise for further work. {copyright} {ital 1996 American Institute of Physics.}

  7. Thin film solar cells grown by organic vapor phase deposition

    NASA Astrophysics Data System (ADS)

    Yang, Fan

    Organic solar cells have the potential to provide low-cost photovoltaic devices as a clean and renewable energy resource. In this thesis, we focus on understanding the energy conversion process in organic solar cells, and improving the power conversion efficiencies via controlled growth of organic nanostructures. First, we explain the unique optical and electrical properties of organic materials used for photovoltaics, and the excitonic energy conversion process in donor-acceptor heterojunction solar cells that place several limiting factors of their power conversion efficiency. Then, strategies for improving exciton diffusion and carrier collection are analyzed using dynamical Monte Carlo models for several nanostructure morphologies. Organic vapor phase deposition is used for controlling materials crystallization and film morphology. We improve the exciton diffusion efficiency while maintaining good carrier conduction in a bulk heterojunction solar cell. Further efficiency improvement is obtained in a novel nanocrystalline network structure with a thick absorbing layer, leading to the demonstration of an organic solar cell with 4.6% efficiency. In addition, solar cells using simultaneously active heterojunctions with broad spectral response are presented. We also analyze the efficiency limits of single and multiple junction organic solar cells, and discuss the challenges facing their practical implementations.

  8. Prodigiosin Induces Autolysins in Actively Grown Bacillus subtilis Cells.

    PubMed

    Danevčič, Tjaša; Borić Vezjak, Maja; Tabor, Maja; Zorec, Maša; Stopar, David

    2016-01-01

    Prodigiosin produced by marine bacterium Vibrio ruber DSM 14379 exhibits a potent antimicrobial activity against a broad range of Gram positive and Gram negative bacteria. The mechanism of prodigiosin antimicrobial action, however, is not known. In this work, the effect of prodigiosin on Bacillus subtilis growth, cell membrane leakage, and induction of autolysins was studied. Treating B. subtilis with prodigiosin resulted in rapid decline of optical density and increased cell membrane leakage measured by β-galactosidase activity. Cell lysis was initiated immediately after treatment with prodigiosin in the middle exponential phase and was completed within 2 h. Lytic activity of prodigiosin in mutant strains with impaired autolysin genes lytABCD decreased for 80% compared to the wild type strain, while in lytABCDEF mutant strain prodigiosin had no bacteriolytic but only bacteriostatic effect. Fast prodigiosin lytic activity on individual B. subtilis cells was confirmed by a modified comet assay. The results indicate that prodigiosin autolysin induction in B. subtilis is growth phase dependent. PMID:26858704

  9. Prodigiosin Induces Autolysins in Actively Grown Bacillus subtilis Cells

    PubMed Central

    Danevčič, Tjaša; Borić Vezjak, Maja; Tabor, Maja; Zorec, Maša; Stopar, David

    2016-01-01

    Prodigiosin produced by marine bacterium Vibrio ruber DSM 14379 exhibits a potent antimicrobial activity against a broad range of Gram positive and Gram negative bacteria. The mechanism of prodigiosin antimicrobial action, however, is not known. In this work, the effect of prodigiosin on Bacillus subtilis growth, cell membrane leakage, and induction of autolysins was studied. Treating B. subtilis with prodigiosin resulted in rapid decline of optical density and increased cell membrane leakage measured by β-galactosidase activity. Cell lysis was initiated immediately after treatment with prodigiosin in the middle exponential phase and was completed within 2 h. Lytic activity of prodigiosin in mutant strains with impaired autolysin genes lytABCD decreased for 80% compared to the wild type strain, while in lytABCDEF mutant strain prodigiosin had no bacteriolytic but only bacteriostatic effect. Fast prodigiosin lytic activity on individual B. subtilis cells was confirmed by a modified comet assay. The results indicate that prodigiosin autolysin induction in B. subtilis is growth phase dependent. PMID:26858704

  10. Efficient flotation of yeast cells grown in batch culture.

    PubMed

    Palmieri, M C; Greenhalf, W; Laluce, C

    1996-05-01

    A fast flotation assay was used to select new floating yeast strains. The flotation ability did not seem to be directly correlated to total extracellular protein concentration of the culture. However, the hydrophobicity of the cell was definitely correlated to the flotation capacity. The Saccharomyces strains (FLT strains) were highly hydrophobic and showed an excellent flotation performance in batch cultures without additives (flotation agents) and with no need for a special flotation chamber or flotation column. A stable and well-organized structure was evident in the dried foam as shown by scanning electron microscopy which revealed its unique structure showing mummified cells (dehydrated) attached to each other. The attachment among the cells and the high protein concentration of the foams indicated that proteins might be involved in the foam formation. The floating strains (strains FLT) which were not flocculent and showed no tendency to aggregate, were capable of growing and producing ethanol in a synthetic medium containing high glucose concentration as a carbon source. The phenomenon responsible for flotation seems to be quite different from the flocculation phenomenon. PMID:18626952

  11. Plastid distribution in columella cells of a starchless Arabidopsis mutant grown in microgravity

    NASA Technical Reports Server (NTRS)

    Hilaire, E.; Paulsen, A. Q.; Brown, C. S.; Guikema, J. A.; Spooner, B. S. (Principal Investigator)

    1997-01-01

    Wild-type and starchless Arabidopsis thaliana mutant seedlings (TC7) were grown and fixed in the microgravity environment of a U.S. Space Shuttle spaceflight. Computer image analysis of longitudinal sections from columella cells suggest a different plastid positioning mechanism for mutant and wild-type in the absence of gravity.

  12. Cell alignment is induced by cyclic changes in cell length: studies of cells grown in cyclically stretched substrates.

    PubMed

    Neidlinger-Wilke, C; Grood, E S; Wang JH-C; Brand, R A; Claes, L

    2001-03-01

    Many types of cells, when grown on the surface of a cyclically stretched substrate, align away from the stretch direction. Although cell alignment has been described as an avoidance response to stretch, the specific deformation signal that causes a cell population to become aligned has not been identified. Planar surface deformation is characterized by three strains: two normal strains describe the length changes of two initially perpendicular lines and one shear strain describes the change in the angle between the two lines. The present study was designed to determine which, if any, of the three strains was the signal for cell alignment. Human fibroblasts and osteoblasts were grown in deformable, rectangular, silicone culture dishes coated with ProNectin, a biosynthetic polymer containing the RGD ligand of fibronectin. 24 h after plating the cells, the dishes were cyclically stretched at 1 Hz to peak dish stretches of 0% (control), 4%, 8%, and 12%. After 24 h of stretching, the cells were fixed, stained, and their orientations measured. The cell orientation distribution was determined by calculating the percent of cells whose orientation was within each of eighteen 5 degrees angular intervals. We found that the alignment response was primarily driven by the substrate strain which tended to lengthen the cell (axial strain). We also found that for each cell type there was an axial strain limit above which few cells were found. The axial strain limit for fibroblasts, 4.2 +/- 0.4%, (mean +/- 95% confidence), was lower than for osteoblasts, 6.4 +/- 0.6%. We suggest that the fibroblasts are more responsive to stretch because of their more highly developed actin cytoskeleton. PMID:11347703

  13. Commissioning and initial stereotactic ablative radiotherapy experience with Vero.

    PubMed

    Solberg, Timothy D; Medin, Paul M; Ramirez, Ezequiel; Ding, Chuxiong; Foster, Ryan D; Yordy, John

    2014-01-01

    The purpose of this study is to describe the comprehensive commissioning process and initial clinical performance of the Vero linear accelerator, a new radiotherapy device recently installed at UT Southwestern Medical Center specifically developed for delivery of image-guided stereotactic ablative radiotherapy (SABR). The Vero system utilizes a ring gantry to integrate a beam delivery platform with image guidance systems. The ring is capable of rotating ± 60° about the vertical axis to facilitate noncoplanar beam arrangements ideal for SABR delivery. The beam delivery platform consists of a 6 MV C-band linac with a 60 leaf MLC projecting a maximum field size of 15 × 15 cm² at isocenter. The Vero planning and delivery systems support a range of treatment techniques, including fixed beam conformal, dynamic conformal arcs, fixed gantry IMRT in either SMLC (step-and-shoot) or DMLC (dynamic) delivery, and hybrid arcs, which combines dynamic conformal arcs and fixed beam IMRT delivery. The accelerator and treatment head are mounted on a gimbal mechanism that allows the linac and MLC to pivot in two dimensions for tumor tracking. Two orthogonal kV imaging subsystems built into the ring facilitate both stereoscopic and volumetric (CBCT) image guidance. The system is also equipped with an always-active electronic portal imaging device (EPID). We present our commissioning process and initial clinical experience focusing on SABR applications with the Vero, including: (1) beam data acquisition; (2) dosimetric commissioning of the treatment planning system, including evaluation of a Monte Carlo algorithm in a specially-designed anthropomorphic thorax phantom; (3) validation using the Radiological Physics Center thorax, head and neck (IMRT), and spine credentialing phantoms; (4) end-to-end evaluation of IGRT localization accuracy; (5) ongoing system performance, including isocenter stability; and (6) clinical SABR applications. PMID:24710458

  14. [Dark metabolism of acetate in Rhodospirillum rubrum cells, grown under photoheterotropic conditions].

    PubMed

    Berg, I A; Krasil'nikova, E N; Ivanovskiĭ, R N

    2000-01-01

    The mechanism of the dark assimilation of acetate in the photoheterotrophically grown nonsulfur bacterium Rhodospirillum rubrum was studied. Both in the light and in the dark, acetate assimilation in Rsp. rubrum cells, which lack the glyoxylate pathway, was accompanied by the excretion of glyoxylate into the growth medium. The assimilation of propionate was accompanied by the excretion of pyruvate. Acetate assimilation was found to be stimulated by bicarbonate, pyruvate, the C4-dicarboxylic acids of the Krebs cycle, and glyoxylate, but not by propionate. These data implied that the citramalate (CM) cycle in Rsp. rubrum cells grown aerobically in the dark can function as an anaplerotic pathway. This supposition was confirmed by respiration measurements. The respiration of cells oxidizing acetate depended on the presence of CO2 in the medium. The fact that the intermediates of the CM cycle (citramalate and mesaconate) markedly inhibited acetate assimilation but had almost no effect on cell respiration indicative that citramalate and mesaconate are intermediates of the acetate assimilation pathway. The inhibition of acetate assimilation and cell respiration by itaconate was due to its inhibitory effect on propionyl-CoA carboxylase, an enzyme of the CM cycle. The addition of 5 mM itaconate to extracts of Rsp. rubrum cells inhibited the activity of this enzyme by 85%. The data obtained suggest that the CM cycle continues to function in Rsp. rubrum cells that have been grown anaerobically in the light and then transferred to the dark and incubated aerobically. PMID:10808482

  15. Modifications of the cell wall of yeasts grown on hexadecane and under starvation conditions.

    PubMed

    Dmitriev, Vladimir V; Crowley, David E; Zvonarev, Anton N; Rusakova, Tatiana G; Negri, Maria C; Kolesnikova, Svetlana A

    2016-02-01

    Electron-microscopic examinations have demonstrated local modifications in the cell wall of the yeast Candida maltosa grown on hexadecane. In our earlier studies, these modified sites, observed in other yeasts grown on oil hydrocarbons, were conventionally called 'canals'. The biochemical and cytochemical studies of C. maltosa have revealed a correlation between the formation of 'canals' and decrease in the amount of cell wall polysaccharides, glucan and mannan. The ultrathin sections and surface replicas have shown that the 'canals' are destroyed by pronase, thus indicating that a significant proportion of their content is represented by proteins. This finding was compatible with our earlier data on the localization of oxidative enzymes in 'canals' and possible participation of the 'canals' in the primary oxidation of hydrocarbons. A completely unexpected and intriguing phenomenon has been the appearance of 'canals' in the yeast C. maltosa under starvation conditions. Unlike the yeasts grown on hexadecane, mannan almost disappears in starving cells, while the quantity of glucan first decreases and then is restored to its initial level. The role of 'canals' in starving cells is as yet unclear; it is assumed that they acquire exoenzymes involved in the utilization of products of cell lysis in the starving population. In the future, 'canals' of starving cells will be studied in connection with their possible participation in apoptosis. PMID:26833628

  16. Impedance analysis of different cell monolayers grown on gold-film electrodes.

    PubMed

    Reiss, Bjoern; Wegener, Joachim

    2015-08-01

    Impedance analysis of mammalian cells grown on planar film electrodes provides a label-free, non-invasive and unbiased observation of cell-based assays addressing the biological response to drugs, toxins or stressors in general. Whereas the time course of the measured impedance at one particular frequency has been used a lot for quantitative monitoring, in-depth analysis of the frequency-dependent impedance spectra is rarely performed. This study summarizes and validates the existing model for spectral analysis by applying it to eight different cell types from different mammalian tissues. Model parameters correctly predict the functional and/or structural properties of the individual cells under study. PMID:26737923

  17. Homojunction GaAs solar cells grown by close space vapor transport

    SciTech Connect

    Boucher, Jason W.; Ritenour, Andrew J.; Greenaway, Ann L.; Aloni, Shaul; Boettcher, Shannon W.

    2014-06-08

    We report on the first pn junction solar cells grown by homoepitaxy of GaAs using close space vapor transport (CSVT). Cells were grown both on commercial wafer substrates and on a CSVT absorber film, and had efficiencies reaching 8.1%, open circuit voltages reaching 909 mV, and internal quantum efficiency of 90%. The performance of these cells is partly limited by the electron diffusion lengths in the wafer substrates, as evidenced by the improved peak internal quantum efficiency in devices fabricated on a CSVT absorber film. Unoptimized highly-doped n-type emitters also limit the photocurrent, indicating that thinner emitters with reduced doping, and ultimately wider band gap window or surface passivation layers, are required to increase the efficiency.

  18. Effects of method of detachment on electrophoretic mobility of mammalian cells grown in monolayer culture

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    A variety of proteolytic and micolytic enzumes, mechanical procedures, and changes in the ionic environment, especially Ca chelation, are used for dispersal of monolayer grown cells. If either chelating agents or mechanical dispersion are used alone, the cell yield is often low and suspensions of single cells are difficult to obtain. Confluent monolayers treated with EDTA tend to be released from their surfaces in sheets, and clumps of cells remain even after further incubation in EDTA. Crude trypsin is the most popular dispersal agent and is known to contain a variety of contaminating enzymes which contribute to the dispersal of cells. A variety of cell injuries resulting from the activity of proteolytic enzymes are reported. It is shown that crystalline trypsin is least harmful to cell integrity as judged by trypan blue uptake.

  19. Solution-Grown Monocrystalline Hybrid Perovskite Films for Hole-Transporter-Free Solar Cells.

    PubMed

    Peng, Wei; Wang, Lingfei; Murali, Banavoth; Ho, Kang-Ting; Bera, Ashok; Cho, Namchul; Kang, Chen-Fang; Burlakov, Victor M; Pan, Jun; Sinatra, Lutfan; Ma, Chun; Xu, Wei; Shi, Dong; Alarousu, Erkki; Goriely, Alain; He, Jr-Hau; Mohammed, Omar F; Wu, Tom; Bakr, Osman M

    2016-05-01

    High-quality perovskite monocrystalline films are successfully grown through cavitation-triggered asymmetric crystallization. These films enable a simple cell structure, ITO/CH3 NH3 PbBr3 /Au, with near 100% internal quantum efficiency, promising power conversion efficiencies (PCEs) >5%, and superior stability for prototype cells. Furthermore, the monocrystalline devices using a hole-transporter-free structure yield PCEs ≈6.5%, the highest among other similar-structured CH3 NH3 PbBr3 solar cells to date. PMID:26931100

  20. Growth and radiation response of cells grown in macroporous gelatin microcarriers (CultiSpher-G).

    PubMed Central

    Rasey, J. S.; Cornwell, M. M.; Maurer, B. J.; Boyles, D. J.; Hofstrand, P.; Chin, L.; Cerveny, C.

    1996-01-01

    Four cell lines have been cultured in macroporous gelatin microcarrier beads (CultiSpher-G) to test this as a new model of three-dimensional cell growth for use in experimental cancer therapy. A549, KB 3-1, KB 8-5 and V79 cells were successfully grown in CultiSphers, albeit with longer doubling times than observed for the respective cell type in monolayer cultures. MTT staining and histology demonstrated three-dimensional contact of cells in the microcarriers. A549 cells populated the microcarriers more densely than KB 3-1 cells, and with both cell types there is bead-to-bead variation in occupancy by cells. [3H]TdR autoradiography reveals labelled cells throughout A549 and KB 3-1 CultiSphers, with no proliferation gradient from edge to centre. Central necrosis has not been observed. A549 cells but not KB 3-1 cells demonstrated a radiation contact effect (i.e. resistance) when irradiated in CultiSphers, compared with monolayers. We conclude that CultiSphers may be a useful model for three-dimensional growth and cell contact when investigators want to investigate these phenomena without the microenvironmental gradients of spheroids. Images Figure 1 PMID:8763852

  1. Lithium Induces ER Stress and N-Glycan Modification in Galactose-Grown Jurkat Cells

    PubMed Central

    Kátai, Emese; Yahiro, Rikki K. K.; Poór, Viktor S.; Montskó, Gergely; Zrínyi, Zita; Kovács, Gábor L.; Miseta, Attila

    2013-01-01

    We previously reported that lithium had a significant impact on Ca2+ regulation and induced unfolded protein response (UPR) in yeast cells grown on galactose due to inhibition of phosphoglucomutase (PGM), however the exact mechanism has not been established yet. In this study, we analysed lithium's effect in galactose-fed cells to clarify whether these ER-related changes are the result of a relative hypoglycemic state. Furthermore, we investigated whether the alterations in galactose metabolism impact protein post-translational modifications. Thus, Jurkat cells were incubated in glucose or galactose containing media with or without lithium treatment. We found that galactose-fed and lithium treated cells showed better survivability than fasting cells. We also found higher UDP-Hexose and glycogen levels in these cells compared to fasting cells. On the other hand, the UPR (X-box binding protein 1 mRNA levels) of galactose-fed and lithium treated cells was even greater than in fasting cells. We also found increased amount of proteins that contained N-linked N-acetyl-glucosamine, similar to what was reported in fasting cells by a recent study. Our results demonstrate that lithium treatment of galactose-fed cells can induce stress responses similar to hypoglycemia, however cell survival is still secured by alternative pathways. We propose that clarifying this process might be an important addition toward the better understanding of the molecular mechanisms that regulate ER-associated stress response. PMID:23894652

  2. Epitaxial Crystal Silicon Absorber Layers and Solar Cells Grown at 1.8 Microns per Minute

    SciTech Connect

    Bobela, D. C.; Teplin, C. W.; Young, D. L.; Branz, H. M.; Stradins, P.

    2011-01-01

    We have grown device-quality epitaxial silicon thin films at growth rates up to 1.85 {micro}m/min, using hot-wire chemical vapor deposition from silane, at substrate temperatures below 750 C. At these rates, which are more than 30 times faster than those used by the amorphous and nanocrystalline Si industry, capital costs for large-scale solar cell production would be dramatically reduced, even for cell absorber layers up to 10 {micro}m thick. We achieved high growth rates by optimizing the three key parameters: silane flow, depletion, and filament geometry, based on our model developed earlier. Hydrogen coverage of the filament surface likely limits silane decomposition and growth rate at high system pressures. No considerable deterioration in PV device performance is observed when grown at high rate, provided that the epitaxial growth is initiated at low rate. A simple mesa device structure (wafer/epi Si/a-Si(i)/a-Si:H(p)/ITO) with a 2.3 {micro}m thick epitaxial silicon absorber layer was grown at 0.7 {micro}m/min. The finished device had an open-circuit voltage of 0.424 V without hydrogenation treatment.

  3. Aging impairs osteoblast differentiation of mesenchymal stem cells grown on titanium by favoring adipogenesis

    PubMed Central

    ABUNA, Rodrigo Paolo Flores; STRINGHETTA-GARCIA, Camila Tami; FIORI, Leonardo Pimentel; DORNELLES, Rita Cassia Menegati; ROSA, Adalberto Luiz; BELOTI, Marcio Mateus

    2016-01-01

    ABSTRACT Aging negatively affects bone/titanium implant interactions. Our hypothesis is that the unbalance between osteogenesis and adipogenesis induced by aging may be involved in this phenomenon. Objective We investigated the osteoblast and adipocyte differentiation of mesenchymal stem cells (MSCs) from young and aged rats cultured on Ti. Material and Methods Bone marrow MSCs derived from 1-month and 21-month rats were cultured on Ti discs under osteogenic conditions for periods of up to 21 days and osteoblast and adipocyte markers were evaluated. Results Cell proliferation, alkaline phosphatase (ALP) activity, extracellular matrix mineralization and gene expression of RUNX2, osterix, ALP, bone sialoprotein, osteopontin, and osteocalcin were reduced in cultures of 21-month rats compared with 1-month rats grown on Ti. Gene expression of PPAR-γ , adipocyte protein 2, and resistin and lipid accumulation were increased in cultures of 21-month rats compared with 1-month rats grown on the same conditions. Conclusions These results indicate that the lower osteogenic potential of MSCs derived from aged rats compared with young rats goes along with the higher adipogenic potential in cultures grown on Ti surface. This unbalance between osteoblast and adipocyte differentiation should be considered in dental implant therapy to the elderly population. PMID:27556209

  4. Cyclic-radiation response of murine fibrosarcoma cells grown as pulmonary nodules

    SciTech Connect

    Grdina, D.J.; Hunter, N.

    1982-10-01

    The radiation age response of murine fibrosarcoma (FSa) cells grown as pulmonary nodules in C/sub 3/Hf/Kam mice was determined. FSa cells were irradiated in vivo either with 10 Gy as 14 day-old lung tumors (i.e., artificial macrometastases) prior to cell separation or with 5 Gy as single cells trapped in the lungs of recipient mice (i.e., artificial micrometastases) following cell separation and synchronization by centrifugal elutriation. Flow microfluorometry (FMF) was used to determine cell-cycle parameters and the relative synchrony of the separated populations, as well as the percent contamination of normal diploid cells in each of the tumor cell populations. Tumor populations containing up to 90% G/sub 1/, 60% S-, and 75% G/sub 2/+M-phase tumor cells were obtained. Cell clonogenicity, determined using a lung colony assay, ranged from 0.7 to 6% for control FSa cells from the various elutriator fractions. The radiation sensitivity of these separated cell populations varied by a factor of 6, regardless of whether the cells were irradiated as artificial micro or macro-metastases. In each experiment, tumor populations most enriched in s-phase cells exhibited the greatest radiation sensitivity. To confirm that these populations were highly enriched in S-phase cells and to demonstrate that they were more radiosensitive than FSa cells in other parts of the cell cycle, the elutriated tumor populations were exposed to either suicide labeling by high specific activity tritiated thymidine or hydroxyurea. The resultant age response curves were qualitatively similar to those obtained following irradiation and reflected the S-phase sensitivity of FSa cells to these agents.

  5. Epitaxially grown polycrystalline silicon thin-film solar cells on solid-phase crystallised seed layers

    NASA Astrophysics Data System (ADS)

    Li, Wei; Varlamov, Sergey; Xue, Chaowei

    2014-09-01

    This paper presents the fabrication of poly-Si thin film solar cells on glass substrates using seed layer approach. The solid-phase crystallised P-doped seed layer is not only used as the crystalline template for the epitaxial growth but also as the emitter for the solar cell structure. This paper investigates two important factors, surface cleaning and intragrain defects elimination for the seed layer, which can greatly influence the epitaxial grown solar cell performance. Shorter incubation and crystallisation time is observed using a simplified RCA cleaning than the other two wet chemical cleaning methods, indicating a cleaner seed layer surface is achieved. Cross sectional transmission microscope images confirm a crystallographic transferal of information from the simplified RCA cleaned seed layer into the epi-layer. RTA for the SPC seed layer can effectively eliminate the intragrain defects in the seed layer and improve structural quality of both of the seed layer and the epi-layer. Consequently, epitaxial grown poly-Si solar cell on the RTA treated seed layer shows better solar cell efficiency, Voc and Jsc than the one on the seed layer without RTA treatment.

  6. 33 CFR 110.73b - Indian River at Vero Beach, Fla.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Indian River at Vero Beach, Fla. 110.73b Section 110.73b Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.73b Indian River at Vero Beach, Fla. (a)...

  7. Cyclic-radiation response of murine fibrosarcoma cells grown as pulmonary nodules

    SciTech Connect

    Grdina, D.J.; Hunter, N.

    1982-10-01

    The radiation age response of murine fibrosarcoma (FSa) cells grown as pulmonary nudules in C/sub 3/Hf/Kam mice was determined. FSa cells were irradiated in vivo either with 10 Gy as 14 day-old lung tumors (i.e., artifical micrometastases) following cell separation and synchronization by centrifugal elutriation. Flow microfluorometry (FMF) was used to determine cell-cycle parameters and the relative synchrony of the separated populations, as well as the percent contamination of normal diploid cells in each of the tumor cells populations. Tumor populations containing up to 90% G/sub 1/-, 60% S-, and 75% G/sub 2/+M-phase tumor cells were obtained. Cell clonogenicity, determined using a lung colony assay, ranged from 0.7 to 6% for control FSa cells from the various elutriator fractions. The radiation sensitivity of these separated cell populations varied by a factor of 6, regardless of whether the cells were irradiated as artifical micro or macro-metastases. In each experiment, tumor population most enriched in S-phase cells exhibited the greatest radiation sensitivity. To confirm that these populations were highly enriched in S-phase cells and to demonstrate that they were more radiosensitive than FSa cells in other parts of the cell cycle, the elutriated tumor population were exposed to either suicide labeling by high specific activity tritated thymidine or hydroxyurea. The resultant age response curves were qualitatively similar to those obtained following irradiation and reflected the S-phase sensitivity of FSa cells to these agents.

  8. Phase III Clinical Trials Comparing the Immunogenicity and Safety of the Vero Cell-Derived Japanese Encephalitis Vaccine Encevac with Those of Mouse Brain-Derived Vaccine by Using the Beijing-1 Strain

    PubMed Central

    Miyazaki, Chiaki; Okada, Kenji; Ozaki, Takao; Hirose, Mizuo; Iribe, Kaneshige; Ishikawa, Yuji; Togashi, Takehiro; Ueda, Kohji

    2014-01-01

    The immunogenicity and safety of an inactivated cell culture Japanese encephalitis vaccine (CC-JEV) were compared with those of an inactivated mouse brain-derived Japanese encephalitis vaccine (MB-JEV) in phase III clinical multicenter trials conducted in children. The vaccines contain the same Japanese encephalitis virus strain, the Beijing-1 strain. Two independent clinical trials (trials 1 and 2) were conducted. Trial 1 was conducted in 468 healthy children. Each subject was injected with 17 μg per dose of either CC-JEV or MB-JEV, and the immunogenicity and safety of the vaccines were investigated. Trial 1 showed that CC-JEV was more immunogenic and reactive than MB-JEV at the same dose. Therefore, to adjust the immunogenicity of CC-JEV to that of MB-JEV, a vaccine that has had a good track record regarding its efficacy for a long time, trial 2 was conducted in 484 healthy children. To improve the stability, CC-JEV was converted from a liquid type to a freeze-dried type of vaccine. Each subject was injected subcutaneously with either 4 μg per dose of CC-JEV, 8 μg per dose of CC-JEV, or 17 μg per dose of MB-JEV twice, at an interval of 2 to 4 weeks, followed by an additional booster immunization 1 to 15 months after the primary immunization. Based on the results of trial 2, 4 μg per dose of the freeze-dried CC-JEV (under the label Encevac) was selected as a substitute for the MB-JEV. Encevac was approved and launched in 2011 and has since been in use as a 2nd-generation Japanese encephalitis vaccine in Japan. (These studies have been registered at the JapicCTI under registration no. JapicCTI-132063 and JapicCTI-080586 for trials 1 and 2, respectively.) PMID:24334689

  9. MDR-related properties of K 562 cells grown in two different culture media.

    PubMed

    Ferrand, V L; Chauvet, M M; Dell'Amico, M H; Tsuruo, T; Hirn, M H; Bourdeaux, M J

    1996-01-01

    Using a synthetic substitute, Ultroser HY, for fetal bovine serum to supplement a classical RPMI 1640 culture medium produced changes in the properties of sensitive and of multidrug-resistant K 562 cells. Though no morphological changes were found, a statistically significant decrease in doubling-time was noted. Plasma membranes were more rigid, as reflected by an increase in the order parameter values. Adriamycin cytotoxicity was decreased, as shown by an increase in IC 50 values. The THP-adriamycin uptake, monitored by fluorimetry, was diminished even when the revertant agent verapamil was added. Moreover, the apparent number of Pgp 170 molecules per cell was lower for resistant cells grown with Ultroser HY. Thus Pgp 170 was not involved in the MDR increase induced by Ultroser HY. In conclusion, it must be kept in mind that environmental factors such as media chemical composition influence the MDR phenomenon and that environmental factors may also influence the MDR phenomenon in clinical situations. PMID:9042237

  10. Human norovirus infection of caco-2 cells grown as a three-dimensional tissue structure.

    PubMed

    Straub, Timothy M; Bartholomew, Rachel A; Valdez, Catherine O; Valentine, Nancy B; Dohnalkova, Alice; Ozanich, Richard M; Bruckner-Lea, Cynthia J; Call, Douglas R

    2011-06-01

    Human norovirus (hNoV) infectivity was studied using a three-dimensional model of large intestinal epithelium. Large intestine Caco-2 cells were grown in rotating wall vessel bioreactors for 18-21 days at 37 degrees C and then transferred to 24-well tissue culture plates where they were infected with GI.1 and GII.4 human noroviruses collected from human challenge trials and various outbreak settings, respectively. Compared with uninfected cells, transmission micrographs of norovirus-infected cells displayed evidence of shortening or total loss of apical microvilli, and vacuolization. Quantitative reverse transcription real-time PCR (qRT-PCR) indicated an approximate 2-3 log10 increase in viral RNA copies for the infected cells. A passage experiment examined both the ability for continued viral RNA and viral antigen detection. In the passaged samples 1.01x10(6) copies ml(-1) were detected by qRT-PCR. Immune electron microscopy using primary antibody to hNoV GI.1 capsids in conjunction with 6 nm gold-labelled secondary antibodies was performed on crude cellular lysates. Localization of antibody was observed in infected but not for uninfected cells. Our present findings, coupled with earlier work with the three-dimensional small intestinal INT407 model, demonstrate the utility of 3-D cell culture methods to develop infectivity assays for enteric viruses that do not readily infect mammalian cell cultures. PMID:21942189

  11. Single and multijunction space solar cells grown by organometallic vapor phase epitaxy (OM-VPE)

    SciTech Connect

    Borden, P.G.; Gregory, P.E.; Larue, R.A.; Ludowise, M.J.

    1982-08-01

    Organometallic Vapor Phase Epitaxy (OM-VPE) is a versatile technique for growing III-V compound semiconductor solar cells. It has good uniformity and morphology, control that allows growth of extremely thin layers, and is a technique readily automated. The vehicle for the present discussion is a metal interconnected cascade (MIC/sup 2/) solar cell that has achieved 16.6% AM0 and 22% AM3 efficiency (uncorrected for 14% grid coverage). These are the best results reported to date for a cascade solar cell. Features include a 9-layer epitaxial structure, the thinnest of which is less than 1000 thick, a high-efficiency 30% AlGaAs top cell only 1.5 microns thick, a GaAs bottom cell that has survived the 780/sup 0/C, 20-minute top cell growth, and process yields greater than 4 cm/sup 2/ per wafer. The paper describes the cell design requirements, how it was grown by OM-VPE, and performance results.

  12. Resistance of Lung Cancer Cells Grown as Multicellular Tumour Spheroids to Zinc Sulfophthalocyanine Photosensitization

    PubMed Central

    Manoto, Sello Lebohang; Houreld, Nicolette Nadene; Abrahamse, Heidi

    2015-01-01

    Photodynamic therapy (PDT) is phototherapeutic modality used in the treatment of neoplastic and non-neoplastic diseases. The photochemical interaction of light, photosensitizer (PS) and molecular oxygen produces singlet oxygen which induces cell death. Zinc sulfophthalocyanine (ZnPcSmix) has been shown to be effective in A549 monolayers, multicellular tumor spheroids (MCTSs) (250 µm) and not on MCTSs with a size of 500 µm. A549 cells used in this study were grown as MCTSs to a size of 500 µm in order to determine their susceptibility to PDT. ZnPcSmix distribution in MCTSs and nuclear morphology was determined using a fluorescent microscope. Changes in cellular responses were evaluated using cell morphology, viability, proliferation, cytotoxicity, cell death analysis and mitochondrial membrane potential. Untreated MCTSs, showed no changes in cellular morphology, proliferation, cytotoxicity and nuclear morphology. Photoactivated ZnPcSmix also showed no changes in cellular morphology and nuclear morphology. However, photoactivated ZnPcSmix resulted in a significant dose dependant decrease in viability and proliferation as well as an increase in cell membrane damage in MCTSs over time. ZnPcSmix photosensitization induces apoptotic cell death in MCTSs with a size of 500 µm and more resistantance when compared to monolayer cells and MCTSs with a size of 250 µm. PMID:25950764

  13. Mesenchymal traits are selected along with stem features in breast cancer cells grown as mammospheres

    PubMed Central

    Borgna, Silvia; Armellin, Michela; di Gennaro, Alessandra; Maestro, Roberta; Santarosa, Manuela

    2012-01-01

    Increasing evidence indicates that invasive properties of breast cancers rely on gain of mesenchymal and stem features, which has suggested that the dual targeting of these phenotypes may represent an appealing therapeutic strategy. It is known that the fraction of stem cells can be enriched by culturing breast cancer cells as mammospheres (MS), but whether these pro-stem conditions favor also the expansion of cells provided of mesenchymal features is still undefined. In the attempt to shed light on this issue, we compared the phenotypes of a panel of 10 breast cancer cell lines representative of distinct subtypes (luminal, HER2-positive, basal-like and claudin-low), grown in adherent conditions and as mammospheres. Under MS-proficient conditions, the increment in the fraction of stem-like cells was associated to upregulation of the mesenchymal marker Vimentin and downregulation of the epithelial markers expressed by luminal cells (E-cadherin, KRT18, KRT19, ESR1). Luminal cells tended also to upregulate the myoepithelial marker CD10. Taken together, our data indicate that MS-proficient conditions do favor mesenchymal/myoepithelial features, and indicate that the use of mammospheres as an in vitro tumor model may efficiently allow the exploitation of therapeutic approaches aimed at targeting aggressive tumors that have undergone epithelial-to-mesenchymal transition. PMID:23095640

  14. Proliferation and Differentiation Potential of Human Adipose-Derived Stem Cells Grown on Chitosan Hydrogel

    PubMed Central

    Debnath, Tanya; Ghosh, Sutapa; Potlapuvu, Usha Shalini; Kona, Lakshmi; Kamaraju, Suguna Ratnakar; Sarkar, Suprabhat; Gaddam, Sumanlatha; Chelluri, Lakshmi Kiran

    2015-01-01

    Applied tissue engineering in regenerative medicine warrants our enhanced understanding of the biomaterials and its function. The aim of this study was to evaluate the proliferation and differentiation potential of human adipose-derived stem cells (hADSCs) grown on chitosan hydrogel. The stability of this hydrogel is pH-dependent and its swelling property is pivotal in providing a favorable matrix for cell growth. The study utilized an economical method of cross linking the chitosan with 0.5% glutaraldehyde. Following the isolation of hADSCs from omentum tissue, these cells were cultured and characterized on chitosan hydrogel. Subsequent assays that were performed included JC-1 staining for the mitochondrial integrity as a surrogate marker for viability, cell proliferation and growth kinetics by MTT assay, lineage specific differentiation under two-dimensional culture conditions. Confocal imaging, scanning electron microscopy (SEM), and flow cytometry were used to evaluate these assays. The study revealed that chitosan hydrogel promotes cell proliferation coupled with > 90% cell viability. Cytotoxicity assays demonstrated safety profile. Furthermore, glutaraldehyde cross linked chitosan showed < 5% cytotoxicity, thus serving as a scaffold and facilitating the expansion and differentiation of hADSCs across endoderm, ectoderm and mesoderm lineages. Additional functionalities can be added to this hydrogel, particularly those that regulate stem cell fate. PMID:25746846

  15. Characterization of Epitaxial Film Silicon Solar Cells Grown on Seeded Display Glass: Preprint

    SciTech Connect

    Young, D. L.; Grover, S.; Teplin, C.; Stradins, P.; LaSalvia, V.; Chuang, T. K.; Couillard, J. G.; Branz, H. M.

    2012-06-01

    We report characterizations of epitaxial film crystal silicon (c-Si) solar cells with open-circuit voltages (Voc) above 560 mV. The 2-um absorber cells are grown by low-temperature (<750 degrees C) hot-wire CVD (HWCVD) on Corning EAGLE XG display glass coated with a layer-transferred (LT) Si seed. The high Voc is a result of low-defect epitaxial Si (epi-Si) growth and effective hydrogen passivation of defects. The quality of HWCVD epitaxial growth on seeded glass substrates depends on the crystallographic quality of the seed and the morphology of the epitaxial growth surface. Heterojunction devices consist of glass/c-Si LT seed/ epi n+ Si:P/epi n- Si:P/intrinsic a-Si:H/p+ a-Si:H/ITO. Similar devices grown on electronically 'dead' n+ wafers have given Voc {approx}630 mV and {approx}8% efficiency with no light trapping features. Here we study the effects of the seed surface polish on epi-Si quality, how hydrogenation influences the device character, and the dominant junction transport physics.

  16. Stimulation of Cell Elongation by Tetraploidy in Hypocotyls of Dark-Grown Arabidopsis Seedlings

    PubMed Central

    Narukawa, Hideki; Yokoyama, Ryusuke; Komaki, Shinichiro; Sugimoto, Keiko; Nishitani, Kazuhiko

    2015-01-01

    Plant size is largely determined by the size of individual cells. A number of studies showed a link between ploidy and cell size in land plants, but this link remains controversial. In this study, post-germination growth, which occurs entirely by cell elongation, was examined in diploid and autotetraploid hypocotyls of Arabidopsis thaliana (L.) Heynh. Final hypocotyl length was longer in tetraploid plants than in diploid plants, particularly when seedlings were grown in the dark. The longer hypocotyl in the tetraploid seedlings developed as a result of enhanced cell elongation rather than by an increase in cell number. DNA microarray analysis showed that genes involved in the transport of cuticle precursors were downregulated in a defined region of the tetraploid hypocotyl when compared to the diploid hypocotyl. Cuticle permeability, as assessed by toluidine-blue staining, and cuticular structure, as visualized by electron microscopy, were altered in tetraploid plants. Taken together, these data indicate that promotion of cell elongation is responsible for ploidy-dependent size determination in the Arabidopsis hypocotyl, and that this process is directly or indirectly related to cuticular function. PMID:26244498

  17. Electron-cytochemical study of Ca2+ in cotyledon cells of soybean seedlings grown in microgravity

    NASA Technical Reports Server (NTRS)

    Nedukha, O.; Brown, C. S.; Kordyum, E.; Piastuch, W. C.; Guikema, J. A. (Principal Investigator)

    1999-01-01

    Microgravity and horizontal clinorotation are known to cause the rearrangement of the structural-functional organization of plant cells, leading to accelerated aging. Altered gravity conditions resulted in an increase in the droplets volume in cells and the destruction of chloroplast structure in Arabidopsis thaliana plants, an enhancement of cytosolic autophagaous processes, an increase in the respiration rate and a greater number of multimolecular forms of succinate- and malate dehydrogenases in cells of the Funaria hygrometrica protonema and Chlorella vulgaris, and changes in calcium balance of cells. Because ethylene is known to be involved in cell aging and microgravity appears to speed the process, and because soybean seedlings grown in space produce higher ethylene levels we asked: 1) does an acceleration of soybean cotyledon cell development and aging occur in microgravity? 2) what roles do Ca2+ ions and the enhanced ethylene level play in these events? Therefore, the goal of our investigation was to examine of the interaction of microgravity and ethylene on the localization of Ca2+ in cotyledon mesophyll of soybean seedlings.

  18. Rapid differentiation of NT2 cells in Sertoli-NT2 cell tissue constructs grown in the rotating wall bioreactor.

    PubMed

    Saporta, Samuel; Willing, Alison E; Shamekh, Rania; Bickford, Paula; Paredes, Daniel; Cameron, Don F

    2004-12-15

    Cell replacement therapy is of great interest as a long-term treatment of neurodegenerative diseases such as Parkinson's disease (PD). We have previously shown that Sertoli cells (SC) provide neurotrophic support to transplants of dopaminergic fetal neurons and NT2N neurons, derived from the human clonal precursors cell line NTera2/D1 (NT2), which differentiate into dopaminergic NT2N neurons when exposed to retinoic acid. We have created SC-NT2 cell tissue constructs cultured in the high aspect ratio vessel (HARV) rotating wall bioreactor. Sertoli cells, NT2, and SC plus NT2 cells combined in starting ratios of 1:1, 1:2, 1:4 and 1:8 were cultured in the HARV in DMEM with 10% fetal bovine serum and 1% growth factor reduced Matrigel for 3 days, without retinoic acid. Conventional, non-HARV, cultures grown in the same culture medium were used as controls. The presence of tyrosine hydroxylase (TH) was assessed in all culture conditions. Sertoli-neuron-aggregated-cell (SNAC) tissue constructs grown at starting ratios of 1:1 to 1:4 contained a significant amount of TH after 3 days of culture in the HARV. No TH was detected in SC HARV cultures, or SC, NT2 or SC-NT2 conventional co-cultures. Quantitative stereology of immunolabled 1:4 SNAC revealed that approximately 9% of NT2 cells differentiate into TH-positive (TH+) NT2N neurons after 3 days of culture in the HARV, without retinoic acid. SNAC tissue constructs also released dopamine (DA) when stimulated with KCl, suggesting that TH-positive NT2N neurons in the SNAC adopted a functional dopaminergic phenotype. SNAC tissue constructs may be an important source of dopaminergic neurons for neuronal transplantation. PMID:15561470

  19. Highly parallel introduction of nucleic acids into mammalian cells grown in microwell arrays

    PubMed Central

    Jain, Tilak; McBride, Ryan; Head, Steven; Saez, Enrique

    2010-01-01

    High-throughput cell-based screens of genome-size collections of cDNAs and siRNAs have become a powerful tool to annotate the mammalian genome, enabling the discovery of novel genes associated with normal cellular processes and pathogenic states, and the unraveling of genetic networks and signaling pathways in a systems biology approach. However, the capital expenses and the cost of reagents necessary to perform such large screens have limited application of this technology. Efforts to miniaturize the screening process have centered on the development of cellular microarrays created on microscope slides that use chemical means to introduce exogenous genetic material into mammalian cells. While this work has demonstrated the feasibility of screening in very small formats, the use of chemical transfection reagents (effective only in a subset of cell lines and not on primary cells) and the lack of defined borders between cells grown in adjacent microspots containing different genetic material (to prevent cell migration and to aid spot location recognition during imaging and phenotype deconvolution) have hampered the spread of this screening technology. Here, we describe proof-of-principles experiments to circumvent these drawbacks. We have created microwell arrays on an electroporation-ready transparent substrate and established procedures to achieve highly efficient parallel introduction of exogenous molecules into human cell lines and primary mouse macrophages. The microwells confine cells and offer multiple advantages during imaging and phenotype analysis. We have also developed a simple method to load this 484-microwell array with libraries of nucleic acids using a standard microarrayer. These advances can be elaborated upon to form the basis of a miniaturized high-throughput functional genomics screening platform to carry out genome-size screens in a variety of mammalian cells that may eventually become a mainstream tool for life science research. PMID:20024036

  20. Suppression of Hydroxycinnamate Network Formation in Cell Walls of Rice Shoots Grown under Microgravity Conditions in Space.

    PubMed

    Wakabayashi, Kazuyuki; Soga, Kouichi; Hoson, Takayuki; Kotake, Toshihisa; Yamazaki, Takashi; Higashibata, Akira; Ishioka, Noriaki; Shimazu, Toru; Fukui, Keiji; Osada, Ikuko; Kasahara, Haruo; Kamada, Motoshi

    2015-01-01

    Network structures created by hydroxycinnamate cross-links within the cell wall architecture of gramineous plants make the cell wall resistant to the gravitational force of the earth. In this study, the effects of microgravity on the formation of cell wall-bound hydroxycinnamates were examined using etiolated rice shoots simultaneously grown under artificial 1 g and microgravity conditions in the Cell Biology Experiment Facility on the International Space Station. Measurement of the mechanical properties of cell walls showed that shoot cell walls became stiff during the growth period and that microgravity suppressed this stiffening. Amounts of cell wall polysaccharides, cell wall-bound phenolic acids, and lignin in rice shoots increased as the shoot grew. Microgravity did not influence changes in the amounts of cell wall polysaccharides or phenolic acid monomers such as ferulic acid (FA) and p-coumaric acid, but it suppressed increases in diferulic acid (DFA) isomers and lignin. Activities of the enzymes phenylalanine ammonia-lyase (PAL) and cell wall-bound peroxidase (CW-PRX) in shoots also increased as the shoot grew. PAL activity in microgravity-grown shoots was almost comparable to that in artificial 1 g-grown shoots, while CW-PRX activity increased less in microgravity-grown shoots than in artificial 1 g-grown shoots. Furthermore, the increases in expression levels of some class III peroxidase genes were reduced under microgravity conditions. These results suggest that a microgravity environment modifies the expression levels of certain class III peroxidase genes in rice shoots, that the resultant reduction of CW-PRX activity may be involved in suppressing DFA formation and lignin polymerization, and that this suppression may cause a decrease in cross-linkages within the cell wall architecture. The reduction in intra-network structures may contribute to keeping the cell wall loose under microgravity conditions. PMID:26378793

  1. Suppression of Hydroxycinnamate Network Formation in Cell Walls of Rice Shoots Grown under Microgravity Conditions in Space

    PubMed Central

    Wakabayashi, Kazuyuki; Soga, Kouichi; Hoson, Takayuki; Kotake, Toshihisa; Yamazaki, Takashi; Higashibata, Akira; Ishioka, Noriaki; Shimazu, Toru; Fukui, Keiji; Osada, Ikuko; Kasahara, Haruo; Kamada, Motoshi

    2015-01-01

    Network structures created by hydroxycinnamate cross-links within the cell wall architecture of gramineous plants make the cell wall resistant to the gravitational force of the earth. In this study, the effects of microgravity on the formation of cell wall-bound hydroxycinnamates were examined using etiolated rice shoots simultaneously grown under artificial 1 g and microgravity conditions in the Cell Biology Experiment Facility on the International Space Station. Measurement of the mechanical properties of cell walls showed that shoot cell walls became stiff during the growth period and that microgravity suppressed this stiffening. Amounts of cell wall polysaccharides, cell wall-bound phenolic acids, and lignin in rice shoots increased as the shoot grew. Microgravity did not influence changes in the amounts of cell wall polysaccharides or phenolic acid monomers such as ferulic acid (FA) and p-coumaric acid, but it suppressed increases in diferulic acid (DFA) isomers and lignin. Activities of the enzymes phenylalanine ammonia-lyase (PAL) and cell wall-bound peroxidase (CW-PRX) in shoots also increased as the shoot grew. PAL activity in microgravity-grown shoots was almost comparable to that in artificial 1 g-grown shoots, while CW-PRX activity increased less in microgravity-grown shoots than in artificial 1 g-grown shoots. Furthermore, the increases in expression levels of some class III peroxidase genes were reduced under microgravity conditions. These results suggest that a microgravity environment modifies the expression levels of certain class III peroxidase genes in rice shoots, that the resultant reduction of CW-PRX activity may be involved in suppressing DFA formation and lignin polymerization, and that this suppression may cause a decrease in cross-linkages within the cell wall architecture. The reduction in intra-network structures may contribute to keeping the cell wall loose under microgravity conditions. PMID:26378793

  2. Xylem Development and Cell Wall Changes of Soybean Seedlings Grown in Space

    PubMed Central

    de Micco, Veronica; Aronne, Giovanna; Joseleau, Jean-Paul; Ruel, Katia

    2008-01-01

    Background and Aims Plants growing in altered gravity conditions encounter changes in vascular development and cell wall deposition. The aim of this study was to investigate xylem anatomy and arrangement of cellulose microfibrils in vessel walls of different organs of soybean seedlings grown in Space. Methods Seeds germinated and seedlings grew for 5 d in Space during the Foton-M2 mission. The environmental conditions, other than gravity, of the ground control repeated those experienced in orbit. The seedlings developed in space were compared with those of the control test on the basis of numerous anatomical and ultrastructural parameters such as number of veins, size and shape of vessel lumens, thickness of cell walls and deposition of cellulose microfibrils. Key Results Observations made with light, fluorescence and transmission electron microscopy, together with the quantification of the structural features through digital image analysis, showed that the alterations due to microgravity do not occur at the same level in the various organs of soybean seedlings. The modifications induced by microgravity or by the indirect effect of space-flight conditions, became conspicuous only in developing vessels at the ultrastructural level. The results suggested that the orientation of microfibrils and their assembly in developing vessels are perturbed by microgravity at the beginning of wall deposition, while they are still able to orient and arrange in thicker and ordered structures at later stages of secondary wall deposition. Conclusions The process of proper cell-wall building, although not prevented, is perturbed in Space at the early stage of development. This would explain the almost unaltered anatomy of mature structures, accompanied by a slower growth observed in seedlings grown in Space than on Earth. PMID:18252765

  3. Spheroid formation and enhanced cardiomyogenic potential of adipose-derived stem cells grown on chitosan.

    PubMed

    Liu, Bing-Hsien; Yeh, Hsi-Yi; Lin, Yu-Chun; Wang, Min-Hsiung; Chen, David C; Lee, Bo-Hua; Hsu, Shan-Hui

    2013-02-01

    Mesenchymal stem cells may differentiate into cardiomyocytes and participate in local tissue repair after heart injury. In the current study, rat adipose-derived adult stem cells (ASCs) grown on chitosan membranes were observed to form cell spheroids after 3 days. The cell seeding density and surface modification of chitosan with Arg-Gly-Asp-containing peptide had an influence on the sizes of ASC spheroids. In the absence of induction, these spheroids showed an increased level of cardiac marker gene expression (Gata4, Nkx2-5, Myh6, and Tnnt2) more than 20-fold versus cells on the tissue culture polystyrene (TCPS) dish. Induction by 5-azacytidine or p38 MAP kinase inhibitor (SB202190) did not further increase the cardiac marker gene expression of these spheroids. Moreover, the enhanced cardiomyogenic potential of the spheroids was highly associated with the chitosan substrates. When ASC spheroids were plated onto TCPS with either basal or cardiac induction medium for 9 days, the spheroids spread into a monolayer and the positive effect on cardiomyogenic marker gene expression disappeared. The possible role of calcium ion and the up-regulation of adhesion molecule P-selectin and chemokine receptor Cxcr4 were demonstrated in ASC spheroids. Applying these spheroids to the chronic myocardial infarction animal model showed better functional recovery versus single cells after 12 weeks. Taken together, this study suggested that the ASC spheroids on chitosan may form as a result of calcium ion signaling, and the transplantation of these spheroids may offer a simple method to enhance the efficiency of stem cell-based therapy in myocardial infarction. PMID:23514754

  4. Electrochemically grown ZnO nanorods for hybrid solar cell applications

    SciTech Connect

    Hames, Yakup; Alpaslan, Zuehal; Koesemen, Arif; San, Sait Eren; Yerli, Yusuf

    2010-03-15

    A hybrid solar cell is designed and proposed as a feasible and reasonable alternative, according to acquired efficiency with the employment of zinc oxide (ZnO) nanorods and ZnO thin films at the same time. Both of these ZnO structures were grown electrochemically and poly(3-hexylthiophene):phenyl-C61-butyric acid methyl ester; (P3HT:PCBM) was used as an active polymer blend, which was found to be compatible to prepared indium-tin-oxide (ITO) substrate base. This ITO base was introduced with mentioned ZnO structure in such a way that, the most efficient configuration was optimized to be ITO/ZnO film/ZnO nanorod/P3HT: PCBM/Ag. Efficiency of this optimized device is found to be 2.44%. All ZnO works were carried out electrochemically, that is indeed for the first time and at relatively lower temperatures. (author)

  5. Systematic process development towards high performance transferred thin silicon solar cells based on epitaxially grown absorbers

    NASA Astrophysics Data System (ADS)

    Murcia Salazar, Clara Paola

    ). First principles modeling, however, predicts that efficiencies of 20+% are achievable with less than 20 mum of c-Si. In addition to a high voltage design, this work reports state of the art epitaxial c-Si solar cell performance and a path towards 20+%-efficient transferred epitaxial solar cells. The design and fabrication approach is based on high open circuit voltage first, high short circuit current second. A first design is a thin solar cell grown on a conductive silicon wafer. This structure allows developing processes to increase bulk lifetime and reduce surface recombination. Important processes that can be used for a transferred solar cell such as increased fill factor (FF) are developed at this stage. A second design is based on the use of a separation layer prior to the solar cell growth. We achieve a comparable performance with the second design. A third design includes the transfer of the solar cell to a secondary substrate. Initial processing development is reported for the transferred solar cells. Improvements in solar cell critical parameters have been characterized with a combination of predictive modeling and solar cell diagnostic tools such as quantum efficiency and voltage measurements. Fabrication processes have been developed to improve solar cell performance. The combination of process development, test structures, systematic fabrication, testing and analysis concludes with a path to high voltage, transferred thin c-Si solar cells towards 20+% efficiencies.

  6. Canine and Equine Mesenchymal Stem Cells Grown in Serum Free Media Have Altered Immunophenotype.

    PubMed

    Clark, Kaitlin C; Kol, Amir; Shahbenderian, Salpi; Granick, Jennifer L; Walker, Naomi J; Borjesson, Dori L

    2016-04-01

    Mesenchymal stem cell (MSC) therapy is being increasingly used to treat dogs and horses with naturally-occurring diseases. However these animals also serve as critical large animal models for ongoing translation of cell therapy products to the human market. MSC manufacture for clinical use mandates improvement in cell culture systems to meet demands for higher MSC numbers and removal of xeno-proteins (i.e. fetal bovine serum, FBS). While serum-free media (SFM) is commercially available, its affects on MSC phenotype and immunomodulatory functions are not fully known. The objective of this study was to determine if specific MSC culture conditions, MSC expansion in HYPERFlasks® or MSC expansion in a commercially available SFM, would alter MSC proliferation, phenotype or immunomodulatory properties in vitro. MSCs cultured in HYPERFlasks® were similar in phenotype, proliferative capacity and immunomodulatory functions to MSCs grown in standard flasks however MSC yield was markedly increased. HYPERFlasks® therefore provide a viable option to generate greater cell numbers in a streamlined manner. Canine and equine MSCs expanded in SFM displayed similar proliferation, surface phenotype and inhibitory effect on lymphocyte proliferation in vitro. However, MSCs cultured in the absence of FBS secreted significantly less PGE2, and were significantly less able to inhibit IFNγ secretion by activated T-cells. Immunomodulatory functions altered by expansion in SFM were species dependent. Unlike equine MSCs, in canine adipose-derived MSCs, the inhibition of lymphocyte proliferation was not principally modulated by PGE2. The removal of FBS from both canine and equine MSC culture systems resulted in altered immunomodulatory properties in vitro and warrants further investigation prior to moving towards FBS-free culture conditions. PMID:26638159

  7. GaSb thermophotovoltaic cells grown on GaAs by molecular beam epitaxy using interfacial misfit arrays

    NASA Astrophysics Data System (ADS)

    Juang, Bor-Chau; Laghumavarapu, Ramesh B.; Foggo, Brandon J.; Simmonds, Paul J.; Lin, Andrew; Liang, Baolai; Huffaker, Diana L.

    2015-03-01

    There exists a long-term need for foreign substrates on which to grow GaSb-based optoelectronic devices. We address this need by using interfacial misfit arrays to grow GaSb-based thermophotovoltaic cells directly on GaAs (001) substrates and demonstrate promising performance. We compare these cells to control devices grown on GaSb substrates to assess device properties and material quality. The room temperature dark current densities show similar characteristics for both cells on GaAs and on GaSb. Under solar simulation the cells on GaAs exhibit an open-circuit voltage of 0.121 V and a short-circuit current density of 15.5 mA/cm2. In addition, the cells on GaAs substrates maintain 10% difference in spectral response to those of the control cells over a large range of wavelengths. While the cells on GaSb substrates in general offer better performance than the cells on GaAs substrates, the cost-savings and scalability offered by GaAs substrates could potentially outweigh the reduction in performance. By further optimizing GaSb buffer growth on GaAs substrates, Sb-based compound semiconductors grown on GaAs substrates with similar performance to devices grown directly on GaSb substrates could be realized.

  8. GaSb thermophotovoltaic cells grown on GaAs by molecular beam epitaxy using interfacial misfit arrays

    SciTech Connect

    Juang, Bor-Chau Laghumavarapu, Ramesh B.; Foggo, Brandon J.; Lin, Andrew; Simmonds, Paul J.; Liang, Baolai; Huffaker, Diana L.

    2015-03-16

    There exists a long-term need for foreign substrates on which to grow GaSb-based optoelectronic devices. We address this need by using interfacial misfit arrays to grow GaSb-based thermophotovoltaic cells directly on GaAs (001) substrates and demonstrate promising performance. We compare these cells to control devices grown on GaSb substrates to assess device properties and material quality. The room temperature dark current densities show similar characteristics for both cells on GaAs and on GaSb. Under solar simulation the cells on GaAs exhibit an open-circuit voltage of 0.121 V and a short-circuit current density of 15.5 mA/cm{sup 2}. In addition, the cells on GaAs substrates maintain 10% difference in spectral response to those of the control cells over a large range of wavelengths. While the cells on GaSb substrates in general offer better performance than the cells on GaAs substrates, the cost-savings and scalability offered by GaAs substrates could potentially outweigh the reduction in performance. By further optimizing GaSb buffer growth on GaAs substrates, Sb-based compound semiconductors grown on GaAs substrates with similar performance to devices grown directly on GaSb substrates could be realized.

  9. Tilted bulk heterojunction organic photovoltaic cells grown by oblique angle deposition

    NASA Astrophysics Data System (ADS)

    Li, Ning; Forrest, Stephen R.

    2009-09-01

    We demonstrate small molecule bulk heterojunction organic photovoltaic cells using oblique angle vacuum deposition. Obliquely deposited donor chloroaluminum phthalocyanine (ClAlPc) films on indium tin oxide have surface feature sizes of ˜30 nm, resulting in ClAlPc/C60 donor-acceptor heterojunctions (HJs) with approximately twice the interface area of HJs grown at normal incidence. This results in nearly twice the external quantum efficiency in the ClAlPc absorption band compared with analogous, planar HJs. The efficiency increase is attributed to the increased surface area presented by the donor-acceptor junction to the incident illumination by ClAlPc protrusions lying obliquely to the substrate plane formed during deposition. The power conversion efficiency improves from (2.0±0.1)% to (2.8±0.1)% under 1 sun, AM 1.5G simulated solar illumination. Similarly, the power efficiency of copper phthalocyanine/C60 organic photovoltaic cells is increased from (1.3±0.1)% to (1.7±0.1)%.

  10. Radial junction amorphous silicon solar cells on PECVD-grown silicon nanowires

    NASA Astrophysics Data System (ADS)

    Yu, Linwei; O'Donnell, Benedict; Foldyna, Martin; Cabarrocas, Pere Roca i.

    2012-05-01

    Constructing radial junction hydrogenated amorphous silicon (a-Si:H) solar cells on top of silicon nanowires (SiNWs) represents a promising approach towards high performance and cost-effective thin film photovoltaics. We here develop an all-in situ strategy to grow SiNWs, via a vapour-liquid-solid (VLS) mechanism on top of ZnO-coated glass substrate, in a plasma-enhanced chemical vapour deposition (PECVD) reactor. Controlling the distribution of indium catalyst drops allows us to tailor the as-grown SiNW arrays into suitable size and density, which in turn results in both a sufficient light trapping effect and a suitable arrangement allowing for conformal coverage of SiNWs by subsequent a-Si:H layers. We then demonstrate the fabrication of radial junction solar cells and carry on a parametric study designed to shed light on the absorption and quantum efficiency response, as functions of the intrinsic a-Si:H layer thickness and the density of SiNWs. These results lay a solid foundation for future structural optimization and performance ramp-up of the radial junction thin film a-Si:H photovoltaics.

  11. Eight-cell parthenotes originated from in vitro grown sheep preantral follicles.

    PubMed

    Luz, V B; Araújo, V R; Duarte, A B G; Celestino, J J H; Silva, T F P; Magalhães-Padilha, D M; Chaves, R N; Brito, I R; Almeida, A P; Campello, C C; Feltrin, C; Bertolini, M; Santos, R R; Figueiredo, J R

    2012-11-01

    We investigated the effect of the leukemia inhibitory factor (LIF) alone or in association with follicle-stimulating hormone (FSH) on the in vitro growth and antrum formation of sheep preantral follicles. To evaluate oocyte quality, parthenogenetic activation of the oocytes recovered from in vitro grown preantral follicles was performed. Preantral follicles >110 μm in diameter were isolated and cultured for 18 days in basic medium either alone (control) or supplemented with LIF (10 or 50 ng/mL) in the absence or presence of FSH. Every 6 days the follicular survival, growth, and antrum formation were evaluated. When compared to control (P < .05), antrum formation was increased in follicles cultured in the presence of LIF10 and FSH. At the end of the culture, the oocytes underwent in vitro maturation (IVM); their viability and chromatin configuration were assessed. Although IVM was not affect by the treatments (P > .05), the numerically highest maturation rates (29.63%) were obtained when follicles were cultured in 50 ng/mL LIF (LIF50). Therefore, their oocytes were submitted to parthenogenetic activation; from which 58.3% of the mature oocytes resulted in 8-cell stage parthenotes. In conclusion, although LIF10 + FSH increases antrum formation when compared to a nonsupplemented medium (minimum essential medium), oocytes from sheep preantral follicles are capable of growing and maturing in vitro independent of LIF addition to the medium, which resulted in the formation of 8-cell parthenotes. PMID:22562971

  12. Berry extracts exert different antiproliferative effects against cervical and colon cancer cells grown in vitro.

    PubMed

    McDougall, Gordon J; Ross, Heather A; Ikeji, Magnus; Stewart, Derek

    2008-05-14

    Polyphenol-rich berry extracts were screened for their antiproliferative effectiveness using human cervical cancer (HeLa) cells grown in microtiter plates. Rowan berry, raspberry, lingonberry, cloudberry, arctic bramble, and strawberry extracts were effective but blueberry, sea buckthorn, and pomegranate extracts were considerably less effective. The most effective extracts (strawberry > arctic bramble > cloudberry > lingonberry) gave EC 50 values in the range of 25-40 microg/(mL of phenols). These extracts were also effective against human colon cancer (CaCo-2) cells, which were generally more sensitive at low concentrations but conversely less sensitive at higher concentrations. The strawberry, cloudberry, arctic bramble, and the raspberry extracts share common polyphenol constituents, especially the ellagitannins, which have been shown to be effective antiproliferative agents. However, the components underlying the effectiveness of the lingonberry extracts are not known. The lingonberry extracts were fractionated into anthocyanin-rich and tannin-rich fractions by chromatography on Sephadex LH-20. The anthocyanin-rich fraction was considerably less effective than the original extract, whereas the antiproliferative activity was retained in the tannin-rich fraction. The polyphenolic composition of the lingonberry extract was assessed by liquid chromatography-mass spectrometry and was similar to previous reports. The tannin-rich fraction was almost entirely composed of procyanidins of linkage type A and B. Therefore, the antiproliferative activity of lingonberry was caused predominantly by procyanidins. PMID:18412361

  13. A polarized cell model for Chikungunya virus infection: entry and egress of virus occurs at the apical domain of polarized cells.

    PubMed

    Lim, Pei Jin; Chu, Justin Jang Hann

    2014-02-01

    Chikungunya virus (CHIKV) has resulted in several outbreaks in the past six decades. The clinical symptoms of Chikungunya infection include fever, skin rash, arthralgia, and an increasing incidence of encephalitis. The re-emergence of CHIKV with more severe pathogenesis highlights its potential threat on our human health. In this study, polarized HBMEC, polarized Vero C1008 and non-polarized Vero cells grown on cell culture inserts were infected with CHIKV apically or basolaterally. Plaque assays, viral binding assays and immunofluorescence assays demonstrated apical entry and release of CHIKV in polarized HBMEC and Vero C1008. Drug treatment studies were performed to elucidate both host cell and viral factors involved in the sorting and release of CHIKV at the apical domain of polarized cells. Disruption of host cell myosin II, microtubule and microfilament networks did not disrupt the polarized release of CHIKV. However, treatment with tunicamycin resulted in a bi-directional release of CHIKV, suggesting that N-glycans of CHIKV envelope glycoproteins could serve as apical sorting signals. PMID:24587455

  14. Proteomic analysis of Staphylococcus aureus biofilm cells grown under physiologically relevant fluid shear stress conditions

    PubMed Central

    2014-01-01

    Background The biofilm forming bacterium Staphylococcus aureus is responsible for maladies ranging from severe skin infection to major diseases such as bacteremia, endocarditis and osteomyelitis. A flow displacement system was used to grow S. aureus biofilms in four physiologically relevant fluid shear rates (50, 100, 500 and 1000 s-1) to identify proteins that are associated with biofilm. Results Global protein expressions from the membrane and cytosolic fractions of S. aureus biofilm cells grown under the above shear rate conditions are reported. Sixteen proteins in the membrane-enriched fraction and eight proteins in the cytosolic fraction showed significantly altered expression (p < 0.05) under increasing fluid shear. These 24 proteins were identified using nano-LC-ESI-MS/MS. They were found to be associated with various metabolic functions such as glycolysis / TCA pathways, protein synthesis and stress tolerance. Increased fluid shear stress did not influence the expression of two important surface binding proteins: fibronectin-binding and collagen-binding proteins. Conclusions The reported data suggest that while the general metabolic function of the sessile bacteria is minimal under high fluid shear stress conditions, they seem to retain the binding capacity to initiate new infections. PMID:24855455

  15. Targeting FAK Radiosensitizes 3-Dimensional Grown Human HNSCC Cells Through Reduced Akt1 and MEK1/2 Signaling

    SciTech Connect

    Hehlgans, Stephanie; Department of Radiotherapy and Oncology, University of Frankfurt, Frankfurt am Main; Institute of Radiopharmacy, Helmholtz Center Dresden-Rossendorf, Dresden ; Eke, Iris; Cordes, Nils; Institute of Radiopharmacy, Helmholtz Center Dresden-Rossendorf, Dresden; Department of Radiation Oncology, University Hospital and Medical Faculty Carl Gustav Carus, Dresden University of Technology, Dresden

    2012-08-01

    Purpose: Focal adhesion kinase (FAK), a main regulator of integrin signaling and cell migration, is frequently overexpressed and hyperphosphorylated in human head-and-neck squamous cell carcinoma (HNSCC). We have previously shown that pharmacologic FAK inhibition leads to radiosensitization of 3-dimensionally grown HNSCC cell lines. To further evaluate the role of FAK in radioresistance and as a potential cancer target, we examined FAK and FAK downstream signaling in HNSCC cell lines grown in more physiologic extracellular matrix-based 3-dimensional cell cultures. Methods and Materials: Seven HNSCC cell lines were grown in 3-dimensional extracellular matrix and the clonogenic radiation survival, expression, and phosphorylation of FAK, paxillin, Akt1, extracellular signal-regulated kinase (ERK)1/2, and MEK1/2 were analyzed after siRNA-mediated knockdown of FAK, Akt1, MEK1, FAK+Akt1, or FAK+MEK1 compared with controls or stable overexpression of FAK. The role of MEK1/2 for clonogenic survival and signaling was investigated using the MEK inhibitor U0126 with or without irradiation. Results: FAK knockdown moderately or significantly enhanced the cellular radiosensitivity of 3-dimensionally grown HNSCC cells. The FAK downstream targets paxillin, Akt1, and ERK1/2 were substantially dephosphorylated under FAK depletion. FAK overexpression, in contrast, increased radiation survival and paxillin, Akt1, and ERK1/2 phosphorylation. The degree of radiosensitization upon Akt1, ERK1/2, or MEK1 depletion or U0126 was superimposable to FAK knockdown. Combination knockdown conditions (ie, Akt1/FAK, MEK1/FAK, or U0126/FAK) failed to provide additional radiosensitization. Conclusions: Our data provide further evidence for FAK as important determinant of radiation survival, which acts in the same signaling axis as Akt1 and ERK1/2. These data strongly support our hypothesis that FAK is a relevant molecular target for HNSCC radiotherapy.

  16. Salicylic acid induces apoptosis in colon carcinoma cells grown in-vitro: Influence of oxygen and salicylic acid concentration

    SciTech Connect

    Zitta, Karina; Meybohm, Patrick; Bein, Berthold; Huang, Ying; Heinrich, Christin; Scholz, Jens; Steinfath, Markus; Albrecht, Martin

    2012-04-15

    In solid tumors the hypoxic environment can promote tumor progression and resistance to therapy. Recently, acetylsalicylic acid a major component of analgesic drugs and its metabolite salicylic acid (SA) have been shown to reduce the risk of colon cancer, but the mechanisms of action remain still unclear. Here we elucidate the effects of physiologically relevant concentrations of SA on colon carcinoma cells (CaCo-2) grown under normoxic and hypoxic conditions. Western blotting, caspase-3/7 apoptosis assays, MTS cell-proliferation assays, LDH cytotoxicity assays and hydrogen peroxide measurements were performed to investigate the effects of 1 and 10 {mu}M SA on CaCo-2 cells grown under normoxic conditions and cells exposed to hypoxia. Under normoxic conditions, SA did not influence cell proliferation or LDH release of CaCo-2 cells. However, caspase-3/7 activity was significantly increased. Under hypoxia, cell proliferation was reduced and LDH release and caspase-3/7 activities were increased. None of these parameters was altered by the addition of SA under hypoxic conditions. Hypoxia increased hydrogen peroxide concentrations 300-fold and SA significantly augmented the release of hydrogen peroxide under normoxic, but not under hypoxic conditions. Phosphorylation of the pro-survival kinases akt and erk1/2 was not changed by SA under hypoxic conditions, whereas under normoxia SA reduced phosphorylation of erk1/2 after 2 hours. We conclude that in colon carcinoma cells effects of SA on apoptosis and cellular signaling are dependent on the availability of oxygen. -- Highlights: Black-Right-Pointing-Pointer Effects of salicylic acid on colon carcinoma cells grown under normoxic and hypoxic conditions Black-Right-Pointing-Pointer Salicylic acid increases caspase-3/7 activity and hydrogen peroxide release under normoxia Black-Right-Pointing-Pointer Salicylic acid decreases pro-survival erk-1/2 phosphorylation under normoxia Black-Right-Pointing-Pointer Salicylic acid does

  17. Possible pathways linking ploidy level to cell elongation and cuticular function in hypocotyls of dark-grown Arabidopsis seedlings

    PubMed Central

    Narukawa, Hideki; Yokoyama, Ryusuke; Nishitani, Kazuhiko

    2016-01-01

    abstract The mechanisms underlying correlations between ploidy level and cell size in eukaryotes remain unclear. Recently, we showed that cell length was higher in tetraploid than in diploid dark-grown Arabidopsis hypocotyls. Cuticular function was aberrant, and expression of genes of cuticle formation was reduced. Here, the links between cell elongation, cuticular function, and ploidy level in the etiolated hypocotyl were examined. Seedlings defective in cuticle formation exhibited shorter hypocotyls. This was due to inhibition of cell elongation rather than cell proliferation, indicating that the reduced cuticular function was a consequence of tetraploidy-induced cell elongation rather than its cause. Inhibition of hypocotyl elongation by impaired cuticles was lower in tetraploid than diploid, indicating that tetraploid hypocotyls were less sensitive to cuticular damage. PMID:26618780

  18. Accumulation of a novel glycolipid and a betaine lipid in cells of Rhodobacter sphaeroides grown under phosphate limitation.

    PubMed

    Benning, C; Huang, Z H; Gage, D A

    1995-02-20

    Cells of the photosynthetic bacterium Rhodobacter sphaeroides grown under phosphate-limiting conditions accumulated nonphosphorous glycolipids and lipids carrying head groups derived from amino acids. Concomitantly, the relative amount of phosphoglycerolipids decreased from 90 to 22 mol% of total polar lipids in the membranes. Two lipids, not detectable in cells grown under standard conditions, were synthesized during phosphate-limited growth. Fast atom bombardment mass spectroscopy, exact mass measurements, 1H NMR spectroscopy, sugar composition analysis, and methylation analysis of the predominant glycolipid led to the identification of the novel compound 1,2-di-O-acyl-3-O-[alpha-D-glucopyranosyl-(1-->4)-O-beta-D-galactopyr anosyl]glycerol. The second lipid was identified as the betaine lipid 1,2-di-O-acyl-[4'-(N,N,N-trimethyl)-homoserine]glycerol by cochromatography employing an authentic standard from Chlamydomonas reinhardtii, fast atom bombardment mass spectroscopy, exact mass measurements, and 1H NMR spectroscopy. Prior to this observation, the occurrence of this lipid was thought to be restricted to lower plants and algae. Apparently, these newly synthesized nonphosphorous lipids, in addition to the sulfo- and the ornithine lipid also found in R. sphaeroides grown under optimal conditions, take over the role of phosphoglycerolipids in phosphate-deprived cells. PMID:7872771

  19. Mountain grown ginseng induces apoptosis in HL-60 cells and its mechanism have little relation with TNF-alpha production.

    PubMed

    Koo, Hyun-Na; Jeong, Hyun-Ja; Choi, In-Young; An, Hyo-Jin; Moon, Phil-Dong; Kim, Seong-Jin; Jee, Seon-Young; Um, Jae-Young; Hong, Seung-Heon; Shin, Soon-Shik; Yang, Deok-Chun; Seo, Yong-Suk; Kim, Hyung-Min

    2007-01-01

    The root of ginseng is one of the most popular natural tonics in Oriental countries. Ginseng grown in the wild, deep in the mountains, is known as Sansam (mountain grown ginseng, MGG). MGG belongs to Araliaceae and Panax. In this study, we investigated the effects of MGG on the cytotoxicity, induction of apoptosis and the putative pathways of its actions in human promyelocytic leukemia cells, HL-60. Using apoptosis analysis, we found that MGG is a potent inducer of apoptosis, but it has less effect on human peripheral blood mononuclear cells. Caspase-3 activation and subsequent apoptotic cell death in MGG-treated cells were partially blocked by the caspase-3 inhibitor, Z-DEVD-FMK. MGG also inhibited the caspase-8 activity. To determine whether MGG-induced apoptosis is involved in tumor necrosis factor-alpha (TNF-alpha) secretion, TNF-alpha secretion was quantified by enzyme-linked immunosorbent assay (ELISA) method. Unexpectedly, MGG significantly decreased the TNF-alpha secretion compared to the control. These results suggest that MGG-induced cytotoxicity have little relation with the secretion of TNF-alpha in HL-60 cells. Furthermore, MGG with rIFN-gamma synergistically increased nitric oxide (NO) production in mouse peritoneal macrophages. Taken together, our data indicate that MGG is a potent inducer of apoptosis on HL-60 cells and these abilities could be used clinically for the treatment of cancer. PMID:17265560

  20. Growth and characterization of Czochralski-grown n and p-type GaAs for space solar cell substrates

    NASA Technical Reports Server (NTRS)

    Chen, R. T.

    1983-01-01

    Progress in LEC (liquid encapsulated Czochralski) crystal growth techniques for producing high-quality, 3-inch-diameter, n- and p-type GaAs crystals suitable for solar cell applications is described. The LEC crystals with low dislocation densities and background impurities, high electrical mobilities, good dopant uniformity, and long diffusion lengths were reproducibly grown through control of the material synthesis, growth and doping conditions. The capability for producing these large-area, high-quality substrates should positively impact the manufacturability of highly efficiency, low cost, radiation-hard GaAs solar cells.

  1. 75 FR 79293 - Amendment and Revocation of Class E Airspace; Vero Beach, FL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ... a notice of proposed rulemaking to amend and remove Class E airspace at Vero Beach, FL (75 FR 65581... 12866; (2) is not a ``significant rule'' under DOT Regulatory Policies and Procedures (44 FR 11034..., 40120; E.O. 10854, 24 FR 9565, 3 CFR, 1959-1963 Comp., p. 389. Sec. 71.1 0 2. The incorporation...

  2. Biotransformation of Hydroxylaminobenzene and Aminophenol by Pseudomonas putida 2NP8 Cells Grown in the Presence of 3-Nitrophenol

    PubMed Central

    Zhao, Jian-Shen; Singh, Ajay; Huang, Xiao-Dong; Ward, Owen P.

    2000-01-01

    Biotransformation products of hydroxylaminobenzene and aminophenol produced by 3-nitrophenol-grown cells of Pseudomonas putida 2NP8, a strain grown on 2- and 3-nitrophenol, were characterized. Ammonia, 2-aminophenol, 4-aminophenol, 4-benzoquinone, N-acetyl-4-aminophenol, N-acetyl-2-aminophenol, 2-aminophenoxazine-3-one, 4-hydroquinone, and catechol were produced from hydroxylaminobenzene. Ammonia, N-acetyl-2-aminophenol, and 2-aminophenoxazine-3-one were produced from 2-aminophenol. All of these metabolites were also found in the nitrobenzene transformation medium, and this demonstrated that they were metabolites of nitrobenzene transformation via hydroxylaminobenzene. Production of 2-aminophenoxazine-3-one indicated that oxidation of 2-aminophenol via imine occurred. Rapid release of ammonia from 2-aminophenol transformation indicated that hydrolysis of the imine intermediate was the dominant reaction. The low level of 2-aminophenoxazine-3-one indicated that formation of this compound was probably due to a spontaneous reaction accompanying oxidation of 2-aminophenol via imine. 4-Hydroquinone and catechol were reduction products of 2- and 4-benzoquinones. Based on these transformation products, we propose a new ammonia release pathway via oxidation of aminophenol to benzoquinone monoimine and subsequent hydrolysis for transformation of nitroaromatic compounds by 3-nitrophenol-grown cells of P. putida 2NP8. We propose a parallel mechanism for 3-nitrophenol degradation in P. putida 2NP8, in which all of the possible intermediates are postulated. PMID:10831408

  3. Epitaxial Crystal Silicon Absorber Layers and Solar Cells Grown at 1.8 Microns per Minute: Preprint

    SciTech Connect

    Bobela, D. C.; Teplin, C. W.; Young, D. L.; Branz, H. M.; Stradins, P.

    2011-07-01

    We have grown device-quality epitaxial silicon thin films at growth rates up to 1.8 μm/min, using hot-wire chemical vapor deposition from silane at substrate temperatures below 750 degrees C. At these rates, which are more than 30 times faster than those used by the amorphous and nanocrystalline Si industry, capital costs for large-scale solar cell production would be dramatically reduced, even for cell absorber layers up to 10 ?m thick. We achieved high growth rates by optimizing the three key parameters: silane flow, depletion, and filament geometry, based on our model developed earlier. Hydrogen coverage of the filament surface likely limits silane decomposition and growth rate at high system pressures. No considerable deterioration in PV device performance is observed when grown at high rate, provided that the epitaxial growth is initiated at low rate. A simple mesa device structure (wafer/epi Si/a-Si(i)/a-Si:H(p)/ITO) with a 2.3 um epitaxial silicon absorber layer was grown at 700 nm/min. The finished device had an open-circuit voltage of 0.424 V without hydrogenation treatment.

  4. Significant Changes in Cell and Chloroplast Development in Young Wheat Leaves (Triticum aestivum cv Hereward) Grown in Elevated CO2.

    PubMed Central

    Robertson, E. J.; Leech, R. M.

    1995-01-01

    Cell and chloroplast development were characterized in young Triticum aestivum cv Hereward leaves grown at ambient (350 [mu]L L-1) or at elevated (650 [mu]L L-1) CO2. In elevated CO2, cell and chloroplast expansion was accelerated by 10 and 25%, respectively, in the first leaf of 7-d-old wheat plants without disruption to the leaf developmental pattern. Elevated CO2 did not affect the number of chloroplasts in relation to mesophyll cell size or the linear relationship between chloroplast number or size and mesophyll cell size. No major changes in leaf anatomy or in chloroplast ultrastructure were detected as a result of growth in elevated CO2, but there was a marked reduction in starch accumulation. In leaf sections fluorescently tagged antisera were used to visualize and quantitate the amount of cytochrome f, the [alpha]- and [beta]-subunits of the coupling factor 1 in ATP synthase, D1 protein of the photosystem II reaction center, the 33-kD protein of the extrinsic oxygen-evolving complex, subunit II of photosystem I, and ribulose-1,5-bisphosphate carboxylase/oxygenase. A significant finding was that in 10 to 20% of the mesophyll cells grown in elevated CO2 the 33-kD protein of the extrinsic oxygen-evolving complex of photosystem II and cytochrome f were deficient by 75%, but the other proteins accumulated normally. PMID:12228342

  5. Single Junction InGaP/GaAs Solar Cells Grown on Si Substrates using SiGe Buffer Layers

    NASA Technical Reports Server (NTRS)

    Ringel, S. A.; Carlin, J. A.; Andre, C. L.; Hudait, M. K.; Gonzalez, M.; Wilt, D. M.; Clark, E. B.; Jenkins, P.; Scheiman, D.; Allerman, A.

    2002-01-01

    Single junction InGaP/GaAs solar cells displaying high efficiency and record high open circuit voltage values have been grown by metalorganic chemical vapor deposition on Ge/graded SiGe/Si substrates. Open circuit voltages as high as 980 mV under AM0 conditions have been verified to result from a single GaAs junction, with no evidence of Ge-related sub-cell photoresponse. Current AM0 efficiencies of close to 16% have been measured for a large number of small area cells, whose performance is limited by non-fundamental current losses due to significant surface reflection resulting from greater than 10% front surface metal coverage and wafer handling during the growth sequence for these prototype cells. It is shown that at the material quality currently achieved for GaAs grown on Ge/SiGe/Si substrates, namely a 10 nanosecond minority carrier lifetime that results from complete elimination of anti-phase domains and maintaining a threading dislocation density of approximately 8 x 10(exp 5) per square centimeter, 19-20% AM0 single junction GaAs cells are imminent. Experiments show that the high performance is not degraded for larger area cells, with identical open circuit voltages and higher short circuit current (due to reduced front metal coverage) values being demonstrated, indicating that large area scaling is possible in the near term. Comparison to a simple model indicates that the voltage output of these GaAs on Si cells follows ideal behavior expected for lattice mismatched devices, demonstrating that unaccounted for defects and issues that have plagued other methods to epitaxially integrate III-V cells with Si are resolved using SiGe buffers and proper GaAs nucleation methods. These early results already show the enormous and realistic potential of the virtual SiGe substrate approach for generating high efficiency, lightweight and strong III-V solar cells.

  6. Effects of growth temperature and device structure on GaP solar cells grown by molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Vaisman, M.; Tomasulo, S.; Masuda, T.; Lang, J. R.; Faucher, J.; Lee, M. L.

    2015-02-01

    Gallium phosphide (GaP) is an attractive candidate for wide-bandgap solar cell applications, possessing the largest bandgap of the III-arsenide/phosphides without aluminum. However, GaP cells to date have exhibited poor internal quantum efficiency (IQE), even for photons absorbed by direct transitions, motivating improvements in material quality and device structure. In this work, we investigated GaP solar cells grown by molecular beam epitaxy over a range of substrate temperatures, employing a much thinner emitter than in prior work. Higher growth temperatures yielded the best solar cell characteristics, indicative of increased diffusion lengths. Furthermore, the inclusion of an AlGaP window layer improved both open-circuit voltage and short wavelength IQE.

  7. Effects of growth temperature and device structure on GaP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Vaisman, M.; Tomasulo, S.; Masuda, T.; Lang, J. R.; Faucher, J.; Lee, M. L.

    2015-02-09

    Gallium phosphide (GaP) is an attractive candidate for wide-bandgap solar cell applications, possessing the largest bandgap of the III-arsenide/phosphides without aluminum. However, GaP cells to date have exhibited poor internal quantum efficiency (IQE), even for photons absorbed by direct transitions, motivating improvements in material quality and device structure. In this work, we investigated GaP solar cells grown by molecular beam epitaxy over a range of substrate temperatures, employing a much thinner emitter than in prior work. Higher growth temperatures yielded the best solar cell characteristics, indicative of increased diffusion lengths. Furthermore, the inclusion of an AlGaP window layer improved both open-circuit voltage and short wavelength IQE.

  8. Cu(In,Ga)Se 2 thin-film solar cells grown with cracked selenium

    NASA Astrophysics Data System (ADS)

    Kawamura, Masahiro; Fujita, Toshiyuki; Yamada, Akira; Konagai, Makoto

    2009-01-01

    Cu(In 1-xGa x)Se 2 (CIGS) films have been grown by using cracked selenium. In conventional evaporation system, the Se atoms were supplied as large clusters (Se x, x>5). However, the size of clusters can be reduced by the thermal cracking. The film qualities grown with small clusters (Se x, x<4) would be improved, since the smaller size molecules easily react with elemental metals, resulting in the reduction of selenium vacancies and the enhancement of surface migration. The CIGS films were deposited by the three-stage method with cracked selenium, and the films were evaluated by SEM, XRD, EDX, C- V measurement and admittance spectroscopy. It was found from the C- V characteristics that the carrier concentrations of the CIGS films grown with cracked selenium were increased with increasing the cracking temperature. The result clearly showed that the use of cracked selenium was effective for reduction of selenium vacancies. The conversion efficiency of 15.4% was obtained by using cracked selenium at a cracking temperature of 500 °C.

  9. Pemetrexed alters folate phenotype and inflammatory profile in EA.hy 926 cells grown under low-folate conditions

    PubMed Central

    Hammons, Andrea L.; Summers, Carolyn M.; Jochems, Jeanine; Arora, Jasbir S.; Zhang, Suhong; Blair, Ian A.; Whitehead, Alexander S.

    2014-01-01

    Elevated homocysteine is a risk marker for several major human pathologies. Emerging evidence suggests that perturbations of folate/homocysteine metabolism can directly modify production of inflammatory mediators. Pemetrexed acts by inhibiting thymidylate synthetase (TYMS), dihydrofolate reductase (DHFR), and glycinamide ribonucleotide formyltransferase (GARFT). EA.hy 926 cells grown under low (“Lo”) and high (“Hi”) folate conditions were treated with pemetrexed. The concentrations of several intracellular folate derivatives were measured using LC-MRM/MS. Lo cells had lower total folate concentrations and a different distribution of the intracellular folate derivatives than Hi cells. Treatment with pemetrexed caused a decrease in individual folate analytes. Microarray analysis showed that several genes were significantly up or down-regulated in pemetrexed treated Lo cells. Several of the significantly up-regulated transcripts were inflammatory. Changes in transcript levels of selected targets, including C3, IL-8, and DHFR, were confirmed by quantitative RT-PCR. C3 and IL-8 transcript levels were increased in pemetrexed-treated Lo cells relative to Lo controls; DHFR transcript levels were decreased. In Lo cells, IL-8 and C3 protein concentrations were increased following pemetrexed treatment. Pemetrexed drug treatment was shown in this study to have effects that lead to an increase in pro-inflammatory mediators in Lo cells. No such changes were observed in Hi cells, suggesting that pemetrexed could not modify the inflammatory profile in the context of cellular folate sufficiency. PMID:22975265

  10. Effects of Female Sex Hormones on Susceptibility to HSV-2 in Vaginal Cells Grown in Air-Liquid Interface.

    PubMed

    Lee, Yung; Dizzell, Sara E; Leung, Vivian; Nazli, Aisha; Zahoor, Muhammad A; Fichorova, Raina N; Kaushic, Charu

    2016-01-01

    The lower female reproductive tract (FRT) is comprised of the cervix and vagina, surfaces that are continuously exposed to a variety of commensal and pathogenic organisms. Sexually transmitted viruses, such as herpes simplex virus type 2 (HSV-2), have to traverse the mucosal epithelial lining of the FRT to establish infection. The majority of current culture systems that model the host-pathogen interactions in the mucosal epithelium have limitations in simulating physiological conditions as they employ a liquid-liquid interface (LLI), in which both apical and basolateral surfaces are submerged in growth medium. We designed the current study to simulate in vivo conditions by growing an immortalized vaginal epithelial cell line (Vk2/E6E7) in culture with an air-liquid interface (ALI) and examined the effects of female sex hormones on their growth, differentiation, and susceptibility to HSV-2 under these conditions, in comparison to LLI cultures. ALI conditions induced Vk2/E6E7 cells to grow into multi-layered cultures compared to the monolayers present in LLI conditions. Vk2 cells in ALI showed higher production of cytokeratin in the presence of estradiol (E2), compared to cells grown in progesterone (P4). Cells grown under ALI conditions were exposed to HSV-2-green fluorescent protein (GFP) and the highest infection and replication was observed in the presence of P4. Altogether, this study suggests that ALI cultures more closely simulate the in vivo conditions of the FRT compared to the conventional LLI cultures. Furthermore, under these conditions P4 was found to confer higher susceptibility to HSV-2 infection in vaginal cells. The vaginal ALI culture system offers a better alternative to study host-pathogen interactions. PMID:27589787

  11. "allometry" Deterministic Approaches in Cell Size, Cell Number and Crude Fiber Content Related to the Physical Quality of Kangkong (Ipomoea reptans) Grown Under Different Plant Density Pressures

    NASA Astrophysics Data System (ADS)

    Selamat, A.; Atiman, S. A.; Puteh, A.; Abdullah, N. A. P.; Mohamed, M. T. M.; Zulkeefli, A. A.; Othman, S.

    Kangkong, especially the upland type (Ipomoea reptans) is popularly consumed as a vegetable dish in the South East Asian countries for its quality related to Vitamins (A and C) and crude fiber contents. Higher fiber contents would prevent from the occurrence of colon cancer and diverticular disease. With young stem edible portion, its cell number and size contribute to the stem crude fiber content. The mathematical approach of allometry of cell size, number, and fiber content of stem could be used in determining the 'best' plant density pressure in producing the quality young stem to be consumed. Basically, allometry is the ratio of relative increment (growth or change) rates of two parameters, or the change rate associated to the log of measured variables relationship. Kangkog grown equal or lower than 55 plants m-2 produced bigger individual plant and good quality (physical) kangkong leafy vegetable, but with lower total yield per unit area as compared to those grown at higher densities.

  12. Degradation Study of MOVPE-Grown and Zinc-Diffused GaSb Cells for Thermophotovoltaic Applications

    NASA Astrophysics Data System (ADS)

    Schlegl, T.; Abbott, P.; van Riesen, S.; Bett, A. W.

    2004-11-01

    GaSb-based cells are promising candidates for use in thermophotovoltaic (TPV) systems. In order to assess long term cell performance, suitable accelerated ageing tests are required. So far there are no studies concerning the degradation behaviour of GaSb cells. GaSb-based cells produced from MOVPE-grown structures and from zinc vapour diffused structures have been examined. Due to the different device structure, these two types differ in their fabrication technology and also in the anti-reflection coatings (ARC). Two different methods for accelerated ageing have been tested on these cells for TPV applications. The first involves forward bias at an elevated current density equivalent to that which is expected to flow in the real operating TPV system. The second test, storage in a humid (100%) atmosphere at 95°C, examines degradation due to oxidation processes. The behaviour in degradation is found to depend on the specific test condition and on the structure of the cell. In general, the diffused cell structure exhibits a higher stability over the course of the degradation tests.

  13. High-efficiency GaAs and GaInP solar cells grown by all solid-state molecular-beam-epitaxy

    PubMed Central

    2011-01-01

    We report the initial results of GaAs and GaInP solar cells grown by all solid-state molecular-beam-epitaxy (MBE) technique. For GaAs single-junction solar cell, with the application of AlInP as the window layer and GaInP as the back surface field layer, the photovoltaic conversion efficiency of 26% at one sun concentration and air mass 1.5 global (AM1.5G) is realized. The efficiency of 16.4% is also reached for GaInP solar cell. Our results demonstrate that the MBE-grown phosphide-contained III-V compound semiconductor solar cell can be quite comparable to the metal-organic-chemical-vapor-deposition-grown high-efficiency solar cell. PMID:22040124

  14. Development of a 2.0 eV AlGaInP Solar Cell Grown by OMVPE

    SciTech Connect

    Perl, Emmett E.; Simon, John; Geisz, John F.; Olavarria, Waldo; Young, Michelle; Duda, Anna; Dippo, Pat; Friedman, Daniel J.; Steiner, Myles A.

    2015-06-14

    AlGaInP solar cells with a bandgap (Eg) of ~2.0 eV are developed for use in next-generation multijunction photovoltaic devices. This material system is of great interest for both space and concentrator photovoltaics due to its high bandgap, which enables the development of high-efficiency five-junction and six-junction devices and is also useful for solar cells operated at elevated temperatures. In this work, we explore the conditions for the Organometallic Vapor Phase Epitaxy (OMVPE) growth of AlGaInP and study their effects on cell performance. A ~2.0 eV AlGaInP solar cell is demonstrated with an open circuit voltage (VOC) of 1.59V, a bandgap-voltage offset (WOC) of 420mV, a fill factor (FF) of 88.0%, and an efficiency of 14.8%. These AlGaInP cells have attained a similar FF, WOC and internal quantum efficiency (IQE) to the best upright GaInP cells grown in our lab to date.

  15. Temperature coefficients and radiation induced DLTS spectra of MOCVD grown n(+)p InP solar cells

    NASA Technical Reports Server (NTRS)

    Walters, Robert J.; Statler, Richard L.; Summers, Geoffrey P.

    1991-01-01

    The effects of temperature and radiation on n(+)p InP solar cells and mesa diodes grown by metallorganic chemical vapor deposition (MOCVD) were studied. It was shown that MOCVD is capable of consistently producing good quality InP solar cells with Eff greater than 19 percent which display excellent radiation resistance due to minority carrier injection and thermal annealing. It was also shown that universal predictions of InP device performance based on measurements of a small group of test samples can be expected to be quite accurate, and that the degradation of an InP device due to any incident particle spectrum should be predictable from a measurement following a single low energy proton irradiation.

  16. Epitaxially Grown Collagen Fibrils Reveal Diversity in Contact Guidance Behavior among Cancer Cells

    PubMed Central

    2015-01-01

    Invasion of cancer cells into the surrounding tissue is an important step during cancer progression and is driven by cell migration. Cell migration can be random, but often it is directed by various cues such as aligned fibers composed of extracellular matrix (ECM), a process called contact guidance. During contact guidance, aligned fibers bias migration along the long axis of the fibers. These aligned fibers of ECM are commonly composed of type I collagen, an abundant structural protein around tumors. In this paper, we epitaxially grew several different patterns of organized type I collagen on mica and compared the morphology and contact guidance behavior of two invasive breast cancer cell lines (MDA-MB-231 and MTLn3 cells). Others have shown that these cells randomly migrate in qualitatively different ways. MDA-MB-231 cells exert large traction forces, tightly adhere to the ECM, and migrate with spindle-shaped morphology and thus adopt a mesenchymal mode of migration. MTLn3 cells exert small traction forces, loosely adhere to the ECM, and migrate with a more rounded morphology and thus adopt an amoeboid mode of migration. As the degree of alignment of type I collagen fibrils increases, cells become more elongated and engage in more directed contact guidance. MDA-MB-231 cells perceive the directional signal of highly aligned type I collagen fibrils with high fidelity, elongating to large extents and migrating directionally. Interestingly, behavior in MTLn3 cells differs. While highly aligned type I collagen fibril patterns facilitate spreading and random migration of MTLn3 cells, they do not support elongation or directed migration. Thus, different contact guidance cues bias cell migration differently and the fidelity of contact guidance is cell type dependent, suggesting that ECM alignment is a permissive cue for contact guidance, but requires a cell to have certain properties to interpret that cue. PMID:25531276

  17. Enzymatic Detachment of Therapeutic Mesenchymal Stromal Cells Grown on Glass Carriers in a Bioreactor

    PubMed Central

    Salzig, Denise; Schmiermund, Alexandra; P. Grace, Pablo; Elseberg, Christiane; Weber, Christian; Czermak, Peter

    2013-01-01

    Cell therapies require the in vitro expansion of adherent cells such as mesenchymal stromal cells (hMSCs) in bioreactor systems or other culture environments, followed by cell harvest. As hMSCs are strictly adherent cells, cell harvest requires cell detachment. The use of hMSCs for cell therapy requires GMP production in accordance with the guidelines for advanced therapeutic medical products. Therefore, several GMP-conform available proteolytic enzymes were investigated for their ability to promote hMSC detachment. An allogeneic hMSC cell line (hMSC-TERT) that is used in clinical trials in the form of alginate cell capsules was chosen as a model. This study investigated the influence of several factors on the outcome of proteolytic hMSC-TERT detachment. Therefore, hMSC-TERT detachment was analyzed in different cultivation systems (static, dynamic) and in combination with further cell processing including encapsulation. Only two of the commercially available enzymes (AccutaseTM, TrypZeanTM) that fulfill all process requirements (commercial availability, cost, GMP conditions during manufacturing and non-animal origin) are found to be generally suitable for detaching hMSC-TERT. Combining cell detachment with encapsulation demonstrated a high impact of the experimental set up on cell damage. It was preferable to reduce the temperature during detachment and limit the detachment time to a maximum of 20 minutes. Cell detachment in static systems was not comparable with detachment in dynamic systems. Detachment yields in dynamic systems were lower and cell damage was higher for the same experimental conditions. Finally, only TrypZeanTM seemed to be suitable for the detachment of hMSC-TERT from dynamic reactor systems. PMID:24478807

  18. P-doped strontium titanate grown using two target pulsed laser deposition for thin film solar cells

    NASA Astrophysics Data System (ADS)

    Man, Hamdi

    Thin-film solar cells made of Mg-doped SrTiO3 p-type absorbers are promising candidates for clean energy generation. This material shows p-type conductivity and also demonstrates reasonable absorption of light. In addition, p-type SrTiO3 can be deposited as thin films so that the cost can be lower than the competing methods. In this work, Mg-doped SrTiO3 (STO) thin-films were synthesized and analyzed in order to observe their potential to be employed as the base semiconductor in photovoltaic applications. Mg-doped STO thin-films were grown by using pulsed laser deposition (PLD) using a frequency quadrupled Yttrium Aluminum Garnet (YAG) laser and with a substrate that was heated by back surface absorption of infrared (IR) laser light. The samples were characterized using X-ray photoelectron spectroscopy (XPS) and it was observed that Mg atoms were doped successfully in the stoichiometry. Reflection high energy electron diffraction (RHEED) spectroscopy proved that the thin films were polycrystalline. Kelvin Probe work function measurements indicated that the work function of the films were 4.167 eV after annealing. UV/Vis Reflection spectroscopy showed that Mg-doped STO thin-films do not reflect significantly except in the ultraviolet region of the spectrum where the reflection percentage increased up to 80%. Self-doped STO thin-films, Indium Tin Oxide (ITO) thin films and stainless steel foil (SSF) were studied in order to observe their characteristics before employing them in Mg-doped STO based solar cells. Self-doped STO thin films were grown using PLD and the results showed that they are capable of serving as the n-type semiconductor in solar cell applications with oxygen vacancies in their structure and low reflectivity. Indium Tin Oxide thin-films grown by PLD system showed low 25-50 ?/square sheet resistance and very low reflection features. Finally, commercially available stainless steel foil substrates were excellent substrates for the inexpensive growth of

  19. Effects of reaggregated granulosa cells and oocytes derived from early antral follicles on the properties of oocytes grown in vitro.

    PubMed

    Oi, Ayano; Tasaki, Hidetaka; Munakata, Yasuhisa; Shirasuna, Koumei; Kuwayama, Takehito; Iwata, Hisataka

    2015-01-01

    In this study, we examined the effects of reconstructed oocyte-granulosa cell complexes (OGCs) on the development of porcine oocytes derived from early antral follicles (EAFs; 0.5-0.7 mm in diameter). When denuded oocytes were cocultured with granulosa cells derived from other EAFs, the oocytes and granulosa cells aggregated to form OGCs after 2 days of culture. After 14 days of culture, we compared cell number, oocyte diameter, and oocyte chromatin configuration in unmanipulated (natural) OGCs, reconstructed OGCs, and OGCs collected from antral follicles (AFs, 3.0-6.0 mm in diameter). The diameters of oocytes from reconstructed OGCs grown in vitro were not different from those of oocytes from natural OGCs, although they were significantly smaller than those of oocytes from antral follicle (AF) OGCs. Oocyte chromatin configuration did not differ among the 3 OGC groups, but the oocyte nuclear maturation rate was lower in the reconstructed OGCs and higher in the AF OGCs. However, when the in vitro culture period for the reconstructed OGCs was extended by 2 days, the nuclear maturation rate of oocytes from reconstructed OGCs was similar to that of oocytes from natural OGCs. In addition, blastocysts were successfully obtained from oocytes from reconstructed OGCs. In conclusion, we established an innovative culture method that allows oocytes and granulosa cells from EAFs to reaggregate as reconstructed OGCs, which yield oocytes with the ability to develop to the blastocyst stage. PMID:25740588

  20. Effects of reaggregated granulosa cells and oocytes derived from early antral follicles on the properties of oocytes grown in vitro

    PubMed Central

    OI, Ayano; TASAKI, Hidetaka; MUNAKATA, Yasuhisa; SHIRASUNA, Koumei; KUWAYAMA, Takehito; IWATA, Hisataka

    2015-01-01

    In this study, we examined the effects of reconstructed oocyte–granulosa cell complexes (OGCs) on the development of porcine oocytes derived from early antral follicles (EAFs; 0.5–0.7 mm in diameter). When denuded oocytes were cocultured with granulosa cells derived from other EAFs, the oocytes and granulosa cells aggregated to form OGCs after 2 days of culture. After 14 days of culture, we compared cell number, oocyte diameter, and oocyte chromatin configuration in unmanipulated (natural) OGCs, reconstructed OGCs, and OGCs collected from antral follicles (AFs, 3.0–6.0 mm in diameter). The diameters of oocytes from reconstructed OGCs grown in vitro were not different from those of oocytes from natural OGCs, although they were significantly smaller than those of oocytes from antral follicle (AF) OGCs. Oocyte chromatin configuration did not differ among the 3 OGC groups, but the oocyte nuclear maturation rate was lower in the reconstructed OGCs and higher in the AF OGCs. However, when the in vitro culture period for the reconstructed OGCs was extended by 2 days, the nuclear maturation rate of oocytes from reconstructed OGCs was similar to that of oocytes from natural OGCs. In addition, blastocysts were successfully obtained from oocytes from reconstructed OGCs. In conclusion, we established an innovative culture method that allows oocytes and granulosa cells from EAFs to reaggregate as reconstructed OGCs, which yield oocytes with the ability to develop to the blastocyst stage. PMID:25740588

  1. Antigenic Protein In Microgravity-Grown Human Mixed Mullerian Tumor (LN1) Cells Preserved In RNA Stabilizing Agent

    NASA Technical Reports Server (NTRS)

    Hammond, Dianne K.; Becker, Jeanne; Elliott, T. F.; Holubec, K.; Baker, T. L.; Love, J. E.

    2004-01-01

    Cells treated with RNAlater(TradeMark) have previously been shown to contain antigenic proteins that can be visualized using Western blot analysis. These proteins seem to be stable for several months when stored in RNA stabilizer at 4 C. Antigenic protein can be recovered from cells that have been processed using an Ambion RNAqueous(Registered TradeMark) kit to remove RNA. In this set of experiments, human mixed Mullerian tumor (LNI) cells grown on the International Space Station during Expedition 3 were examined for antigenic stability after removal of RNA. The cells were stored for three months in RNAlater(TradeMark) and RNA was extracted. The RNA filtrate containing the protein was precipitated, washed, and suspended in buffer containing sodium dodecyl sulfate (SDS). Samples containing equal concentrations of protein were loaded onto SDS-polyacrylamide gels. Proteins were separated by electrophoresis and transferred by Western blot to polyvinylidene fluoride (PVDF) membrane. The Western blots were stained with an enhanced chemiluminescent ECL(Registered Trademark) Plus detection kit (Amersham) and scanned using a Storm 840 gel image analyzer (Amersham, Molecular Dynamics). ImageQuant(Registered TradeMark) software was used to quantify the densities of the protein bands. The ground control and flight LN1 cell samples showed a similar staining pattern over time with antibodies to vimentin, glyceraldehyde-3-phosphate dehydrogenase, and epithelial membrane antigens.

  2. Antigenic Protein In Microgravity-Grown Human Mixed Mullerian Tumor (LN1) Cells Preserved In RNA Stabilizing Agent

    NASA Technical Reports Server (NTRS)

    Hammond, Dianne K.; Becker, Jeanne; Holubec, K.; Baker, T. L.; Love, J. E.

    2004-01-01

    Cells treated with RNAlater(TradeMark) have previously been shown to contain antigenic proteins that can be visualized using Western blot analysis. These proteins seem to be stable for several months when stored in RNA stabilizer at 4 C. Antigenic protein can be recovered from cells that have been processed using an Ambion RNAqueous(Registered TradeMark) kit to remove RNA. In this set of experiments, human mixed Mullerian tumor (LN1) cells grown on the International Space Station during Expedition 3 were examined for antigenic stability after removal of RNA. The cells were stored for three months in RNAlater(TradeMark) and RNA was extracted. The RNA filtrate Containing the protein was precipitated, washed, and suspended in buffer containing sodium dodecyl sulfate (SDS). Samples containing equal concentrations of protein were loaded onto SDS-polyacrylamide gels. Proteins were separated by electrophoresis and transferred by Western blot to polyvinylidene fluoride (PVDF) membrane. The Western blots were stained with an enhanced chemiluminescent ECL(Registered TradeMark)Plus detection kit (Amersham) and scanned using a Storm 840 gel image analyzer (Amersham, Molecular Dynamics). ImageQuant(Registered TradeMark)a software was used to quantify the densities of the protein bands. The ground control and flight LN1 cell samples showed a similar staining pattern over time with antibodies to vimentin, glyceraldehyde-3-phosphate dehydrogenase, and epithelial membrane antigens.

  3. Dye-sensitized solar cells with vertically aligned TiO2 nanowire arrays grown on carbon fibers.

    PubMed

    Cai, Xin; Wu, Hongwei; Hou, Shaocong; Peng, Ming; Yu, Xiao; Zou, Dechun

    2014-02-01

    One-dimensional semiconductor TiO2 nanowires (TNWs) have received widespread attention from solar cell and related optoelectronics scientists. The controllable synthesis of ordered TNW arrays on arbitrary substrates would benefit both fundamental research and practical applications. Herein, vertically aligned TNW arrays in situ grown on carbon fiber (CF) substrates through a facile, controllable, and seed-assisted thermal process is presented. Also, hierarchical TiO2 -nanoparticle/TNW arrays were prepared that favor both the dye loading and depressed charge recombination of the CF/TNW photoanode. An impressive conversion efficiency of 2.48 % (under air mass 1.5 global illumination) and an apparent efficiency of 4.18 % (with a diffuse board) due to the 3D light harvesting of the wire solar cell were achieved. Moreover, efficient and inexpensive wire solar cells made from all-CF electrodes and completely flexible CF-based wire solar cells were demonstrated, taking into account actual application requirements. This work may provide an intriguing avenue for the pursuit of lightweight, cost-effective, and high-performance flexible/wearable solar cells. PMID:24488679

  4. Gene expression patterns in granulosa cells and oocytes at various stages of follicle development as well as in in vitro grown oocyte-and-granulosa cell complexes

    PubMed Central

    MUNAKATA, Yasuhisa; KAWAHARA-MIKI, Ryoka; SHIRATSUKI, Shogo; TASAKI, Hidetaka; ITAMI, Nobuhiko; SHIRASUNA, Koumei; KUWAYAMA, Takehito; IWATA, Hisataka

    2016-01-01

    Follicle development is accompanied by proliferation of granulosa cells and increasing oocyte size. To obtain high-quality oocytes in vitro, it is important to understand the processes that occur in oocytes and granulosa cells during follicle development and the differences between in vivo and in vitro follicle development. In the present study, oocytes and granulosa cells were collected from early antral follicles (EAFs, 0.5–0.7 mm in diameter), small antral follicles (SAFs, 1–3 mm in diameter), large antral follicles (LAFs, 3–7 mm in diameter), and in vitro grown oocyte-and-granulosa cell complexes (OGCs), which were cultured for 14 days after collection from EAFs. Gene expression was analyzed comprehensively using the next-generation sequencing technology. We found top upstream regulators during the in vivo follicle development and compared them with those in in vitro developed OGCs. The comparison revealed that HIF1 is among the top regulators during both in vivo and in vitro development of OGCs. In addition, we found that HIF1-mediated upregulation of glycolysis in granulosa cells is important for the growth of OGCs, but the cellular metabolism differs between in vitro and in vivo grown OGCs. Furthermore, on the basis of comparison of upstream regulators between in vivo and in vitro development of OGCs, we believe that low expression levels of FLT1 (VEGFA receptor), SPP1, and PCSK6 can be considered causal factors of the suboptimal development under in vitro culture conditions. PMID:27108636

  5. Positioning effects on quantum dot solar cells grown by molecular beam epitaxy

    SciTech Connect

    Zhou, D.; Sharma, G.; Fimland, B. O.; Vullum, P. E.; Thomassen, S. F.; Holmestad, R.; Reenaas, T. W.

    2010-02-22

    We report current-voltage and spectral response characteristics of high density InAs/GaAs quantum dot (QD) solar cells with different positions where dots are located. The short circuit current density (J{sub sc}), open circuit voltage (V{sub oc}), and external quantum efficiency of these cells under air mass 1.5 are presented and compared with a GaAs reference cell. An extended photoresponse in contrast to the GaAs reference cell was confirmed for all these cells. The effect of inserting QD layers into emitter and base region on device performance is shown. The J{sub sc} is reduced, while the V{sub oc} is maintained. The cell with QDs located toward the base side shows better performance, confirmed by both current-voltage and spectral response measurements.

  6. Effect of Hypergravity on Localization Calcium Ions in Plant Cells Grown in Vivo and in Vitro

    NASA Astrophysics Data System (ADS)

    Nedukha, Olena

    Using plant callus tissues and Arabidopsis thaliana plants as model systems we have been investigated the effect of hypergravity on the localization and relative content of calcium ions in photosynthesizing cells. The tobacco callus cells in log stage of growth and mesophyll cells from developed A. thaliana leaves were used in the experiments. Plant samples were exposed to hypergravity at 6.5 g, 10g and 14 g for 15-60 min. After centrifugation, dye Fluo-4 was loaded in the control leaves and the centrifuged samples by the standard cytochemical method. Observation of calcium fluorescence was carried out with a laser confocal microscope LSM 5 Pascal at the excitation wave 488 nm (by the argon laser), at emission wavelength 516 nm. The data of the calcium ion distribution and quantification in cells were obtained using software "Pascal" (Carl Zeiss). The effect of hypergravity on redistribution of calcium ions in plant cells has been established. This effect is depended from exposure time and from the value of hypergravity. The cells cultivated in vitro is showed fast response to hypergravity influence. Plasmolysis cells and calcium domains formation have been observed in most of callus cells. This influence was like to that, which was wrote in Funaria hygrometrica protonema cells after 8.5 g influence (Sytnik et al., 1984). Leaf cells of A. thaliana were of less responsively to hypergravity than callus cells. Sytnik K, Kordyum E, Nedukha O. et al. 1984. Plant Cell Under Change of Geophysical Factors. Kiev: Naukova Dumka, 1-134 p.

  7. Method of measuring nitric oxide release by vascular endothelial cells grown in microfluidic channels

    NASA Astrophysics Data System (ADS)

    Hosseinpour, S.; Liu, A. C.; Barakat, A. I.; Choy, J. C.; Gray, B. L.

    2014-03-01

    In this paper, a simple and versatile method is presented which enables detection of nitric oxide (NO) released from vascular endothelial cells (ECs) cultured in microfluidic structures. The culturing system and NO measurement method allow cell shape to be controlled in a non-invasive manner using microfluidic structures while NO release is monitored for cell shape versus function studies. The culturing system consists of arrays of polydimethylsiloxane (PDMS) fluidic channels 120 micrometers in depth and ranging from 100 micrometers to 3 mm in width. The number of channels in each array is varied to yield a constant cell culture surface area (75 mm2) independent of channel width. The channel surfaces are collagen-coated and ECs are cultured to confluence within the channels. A cell scraper is then used to scrape extraneous cells cultured between channels, and NO measurements are made 18 to 24 hours later. A chemiluminescence-based sensor system (NOA 280i, Sievers NO Analyzer) is utilized to measure sample NO. Initial results indicate that NO concentrations can be measured from different microfluidic channel-containing samples using this method. It is shown that there is no significant difference in NO concentration derived from channels of different widths even though the degree of cell elongation varies due to physical constraint by microfluidic channel walls. However, cells treated with TNFα release more NO than untreated cells in fluidic channels, which is comparable to the function of ECs cultured in conventional culturing systems such as culturing dishes.

  8. The density of apical cells of dark-grown protonemata of the moss Ceratodon purpureus

    NASA Technical Reports Server (NTRS)

    Schwuchow, J. M.; Kern, V. D.; Wagner, T.; Sack, F. D.

    2000-01-01

    Determinations of plant or algal cell density (cell mass divided by volume) have rarely accounted for the extracellular matrix or shrinkage during isolation. Three techniques were used to indirectly estimate the density of intact apical cells from protonemata of the moss Ceratodon purpureus. First, the volume fraction of each cell component was determined by stereology, and published values for component density were used to extrapolate to the entire cell. Second, protonemal tips were immersed in bovine serum albumin solutions of different densities, and then the equilibrium density was corrected for the mass of the cell wall. Third, apical cell protoplasts were centrifuged in low-osmolarity gradients, and values were corrected for shrinkage during protoplast isolation. Values from centrifugation (1.004 to 1.015 g/cm3) were considerably lower than from other methods (1.046 to 1.085 g/cm3). This work appears to provide the first corrected estimates of the density of any plant cell. It also documents a method for the isolation of protoplasts specifically from apical cells of protonemal filaments.

  9. Thyrotropin dependent and independent thyroid cell lines selected from FRTL-5 derived tumors grown in nude mice

    SciTech Connect

    Ossendorp, F.A.; Bruning, P.F.; Schuuring, E.M.; Van Den Brink, J.A.; van der Heide, D.; De Vijlder, J.J.; De Bruin, T.W. )

    1990-07-01

    FRTL-5 cells were used to set up a thyroid tumor model system in C3H nu/nu mice. FRTL-5 tumors could be grown in nude mice provided serum TSH levels were elevated. Persistent TSH elevation was obtained by administration of Na131I, rendering the mice hypothyroid. After 4 weeks FRTL-5 cells were injected sc resulting in tumor growth within 2 weeks in eight out of eight mice. Although the tumors showed an apparently undifferentiated histology, lacking normal follicular structures, they were functional since the tumors were capable of concentrating (131)iodine, as demonstrated by nuclear imaging. From one of the tumors a new cell line was isolated (FRTL-5/T) that, like the parental FRTL-5 cell line, was TSH dependent for growth. In a control group of six euthyroid nude mice FRTL-5 tumor growth could not be obtained with one exception. After 3 months one animal developed a small tumor that grew rapidly thereafter. This tumor was easily transplantable in other euthyroid nude mice, showed an undifferentiated histology, and was nonfunctional, as it could not concentrate (131)iodine. From this tumor two cell lines were derived: one cultured in the presence of TSH (FRTL-5/TP) and one in the absence of TSH (FRTL-5/TA). The cell lines were analyzed for TSH responsive functions and TSH receptor expression. Responsiveness to TSH in FRTL-5/T and the parental FRTL-5 cell line were similar for most thyroid specific functions tested. However, FRTL-5/T was less sensitive than FRTL-5 for TSH induced (3H)thymidine incorporation. Both cell lines had two classes of TSH binding sites with high and low affinity respectively. FRTL-5/TP and FRTL-5/TA were both able to grow in TSH free medium and were nonresponsive to TSH in vitro, as tested for (3H)thymidine and (3H)uridine incorporation, iodine uptake, thyroglobulin iodination, and thyroglobulin secretion.

  10. In vitro transformation of BHK21 cells grown in the presence of calcium chromate.

    PubMed

    Fradkin, A; Janoff, A; Lane, B P; Kuschner, M

    1975-04-01

    Concentrations of 0.25 and 0.5 mug/ml calcium chromate (CaCrO4-2H2O)dissolved in Dulbecco's medium were found to alter the growth behavior of BHK21 cells in culture. Treated cells grew as shortened fibroblasts and in random orientation. The changes detected during the first two weeks of culture in the presence of the metal became more pronounced as the number of growth passages increased. In addition to the alterations noted above, chromate-treated cells grew into large clusters in Methocel (an alternative technique to the agar suspension system), while untreated cells underwent, at most, only one or two divisions in Methocel. These alterations in growth properties were irreversible and persisted after removal of the treated cells from chromate-containing medium, suggesting that a heritable change had occurred as opposed to a transient, chromate-dependent alteration of cell growth. This experimental observation suggests that chromate salts and perhaps salts of other metals can transform BHK21 cells in vitro or can select for spontaneously transformed cells. PMID:1167811

  11. Production of putative virulence factors by Renibacterium salmoninarum grown in cell culture.

    PubMed

    McIntosh, D; Flaño, E; Grayson, T H; Gilpin, M L; Austin, B; Villena, A J

    1997-10-01

    A cell culture system, employing the fish cell line Epithelioma papillosum cyprini (EPC), was developed to study the synthesis of intracellular antigen and the expression of putative virulence factors by Renibacterium salmoninarum. EPC cultures infected with R. salmoninarum could be maintained for 7 weeks, during which the pathogen multiplied intracellularly. Immunohistochemical examination of infected cultures revealed the production of the p57 antigen, haemolysin and cytolysin. The intracellular nature of the infection was confirmed by transmission electron microscopic examination of EPC monolayers. A comparison of the relative virulence of bacterial cells cultured in EPC cells and on agar plates revealed that the former were markedly more virulent in challenge experiments with juvenile rainbow trout (Oncorhynchus mykiss Walbaum). The EPC cell culture model provided a system for the study of R. salmoninarum under more natural conditions than those achieved with plate culture techniques. PMID:9353936

  12. Identification of morphological differences between avian influenza A viruses grown in chicken and duck cells.

    PubMed

    Al-Mubarak, Firas; Daly, Janet; Christie, Denise; Fountain, Donna; Dunham, Stephen P

    2015-03-01

    Although wild ducks are considered to be the major reservoirs for most influenza A virus subtypes, they are typically resistant to the effects of the infection. In contrast, certain influenza viruses may be highly pathogenic in other avian hosts such as chickens and turkeys, causing severe illness and death. Following in vitro infection of chicken and duck embryo fibroblasts (CEF and DEF) with low pathogenic avian influenza (LPAI) viruses, duck cells die more rapidly and produce fewer infectious virions than chicken cells. In the current study, the morphology of viruses produced from CEF and DEF cells infected with low pathogenic avian H2N3 was examined. Transmission electron microscopy showed that viruses budding from duck cells were elongated, while chicken cells produced mostly spherical virions; similar differences were observed in viral supernatants. Sequencing of the influenza genome of chicken- and duck-derived H2N3 LPAI revealed no differences, implicating host cell determinants as responsible for differences in virus morphology. Both DEF and CEF cells produced filamentous virions of equine H3N8 (where virus morphology is determined by the matrix gene). DEF cells produced filamentous or short filament virions of equine H3N8 and avian H2N3, respectively, even after actin disruption with cytochalasin D. These findings suggest that cellular factors other than actin are responsible for the formation of filamentous virions in DEF cells. The formation of elongated virions in duck cells may account for the reduced number of infectious virions produced and could have implications for virus transmission or maintenance in the reservoir host. PMID:25613009

  13. Heteroepitaxial film silicon solar cell grown on Ni-W foils

    SciTech Connect

    Wee, Sung Hun; Cantoni, Claudia; Fanning, Thomas; Teplin, Charles; Bogorin, Daniela Florentina; Bornstein, Jon; Bowers, Karen; Schroeter,; Hasoon, Falah; Branz, Howard; Paranthaman, Mariappan Parans; Goyal, Amit

    2013-01-01

    Today, silicon-wafer-based technology dominates the photovoltaic (PV) industry because it enables high efficiency, is produced from abundant, non-toxic materials and is proven in the PV marketplace.[1] However, costs associated with the wafer itself limit ultimate cost reductions.[1,2] PV based on absorber layers of crystalline Si with only 2 to 10 m thickness are a promising route to reduce these costs, while maintaining efficiencies above 15%.[3-5] With the goal of fabricating low-cost film crystalline Si (c-Si), recent research has explored wafer peeling,[6,7] crystallization of amorphous silicon films on glass,[4,8-10] and seed and epitaxy approaches.[3,5,11] In this third approach, one initially forms a seed layer that establishes the grain size and crystalline order. The Si layer is then grown heteroepitaxially on the seed layer, so that it replicates the seed crystal structure. In all of these film c-Si approaches, the critical challenge is to grow c-Si with adequate material quality: specifically, the diffusion length (LD) must be at least three times the film thickness.[12] In polycrystalline Si films, grain boundaries (GBs) are recombination-active and significantly reduce LD. This adverse effects of GBs motivates research into growth of large grained c-Si [13,14] (for a low density of GBs) and biaxially-textured c-Si [11] (for low-angle GBs).

  14. Single-junction GaAsP solar cells grown on SiGe graded buffers on Si

    NASA Astrophysics Data System (ADS)

    Faucher, J.; Gerger, A.; Tomasulo, S.; Ebert, C.; Lochtefeld, A.; Barnett, A.; Lee, M. L.

    2013-11-01

    We have investigated the microstructure and device characteristics of GaAs0.82P0.18 solar cells grown on Si0.20Ge0.80/Si graded buffers. Anti-phase domains (APDs) were largely self-annihilated within the In0.39Ga0.61P initiation layer although a low density of APDs was found to propagate to the surface. A combination of techniques was used to show that the GaAs0.82P0.18 cells have a threading dislocation density of 1.2 ± 0.2 × 107 cm-2. Despite these extended defects, the devices exhibited high open-circuit voltages of 1.10-1.12 V. These results indicate that cascading a GaAs0.82P0.18 top cell with a lower-bandgap Si0.20Ge0.80 cell is a promising approach for high-efficiency dual-junction devices on low-cost Si substrates.

  15. Transcriptome profiling in Arabidopsis inflorescence stems grown under hypergravity in terms of cell walls and plant hormones

    NASA Astrophysics Data System (ADS)

    Tamaoki, D.; Karahara, I.; Nishiuchi, T.; De Oliveira, S.; Schreiber, L.; Wakasugi, T.; Yamada, K.; Yamaguchi, K.; Kamisaka, S.

    2009-07-01

    Land plants rely on lignified secondary cell walls in supporting their body weight on the Earth. Although gravity influences the formation of the secondary cell walls, the regulatory mechanism of their formation by gravity is not yet understood. We carried out a comprehensive analysis of gene expression in inflorescence stems of Arabidopsis thaliana L. using microarray (22 K) to identify genes whose expression is modulated under hypergravity condition (300 g). Total RNA was isolated from the basal region of inflorescence stems of plants grown for 24 h at 300 g or 1 g. Microarray analysis showed that hypergravity up-regulated the expression of 403 genes to more than 2-fold. Hypergravity up-regulated the genes responsible for the biosynthesis or modification of cell wall components such as lignin, xyloglucan, pectin and structural proteins. In addition, hypergravity altered the expression of genes related to the biosynthesis of plant hormones such as auxin and ethylene and that of genes encoding hormone-responsive proteins. Our transcriptome profiling indicates that hypergravity influences the formation of secondary cell walls by modulating the pattern of gene expression, and that auxin and/or ethylene play an important role in signaling hypergravity stimulus.

  16. Effects of substrate conductivity on cell morphogenesis and proliferation using tailored, atomic layer deposition-grown ZnO thin films

    PubMed Central

    Choi, Won Jin; Jung, Jongjin; Lee, Sujin; Chung, Yoon Jang; Yang, Cheol-Soo; Lee, Young Kuk; Lee, You-Seop; Park, Joung Kyu; Ko, Hyuk Wan; Lee, Jeong-O

    2015-01-01

    We demonstrate that ZnO films grown by atomic layer deposition (ALD) can be employed as a substrate to explore the effects of electrical conductivity on cell adhesion, proliferation, and morphogenesis. ZnO substrates with precisely tunable electrical conductivity were fabricated on glass substrates using ALD deposition. The electrical conductivity of the film increased linearly with increasing duration of the ZnO deposition cycle (thickness), whereas other physical characteristics, such as surface energy and roughness, tended to saturate at a certain value. Differences in conductivity dramatically affected the behavior of SF295 glioblastoma cells grown on ZnO films, with high conductivity (thick) ZnO films causing growth arrest and producing SF295 cell morphologies distinct from those cultured on insulating substrates. Based on simple electrostatic calculations, we propose that cells grown on highly conductive substrates may strongly adhere to the substrate without focal-adhesion complex formation, owing to the enhanced electrostatic interaction between cells and the substrate. Thus, the inactivation of focal adhesions leads to cell proliferation arrest. Taken together, the work presented here confirms that substrates with high conductivity disturb the cell-substrate interaction, producing cascading effects on cellular morphogenesis and disrupting proliferation, and suggests that ALD-grown ZnO offers a single-variable method for uniquely tailoring conductivity. PMID:25897486

  17. Investigation of InGaP/(In)AlGaAs/GaAs triple-junction top cells for smart stacked multijunction solar cells grown using molecular beam epitaxy

    NASA Astrophysics Data System (ADS)

    Sugaya, Takeyoshi; Mochizuki, Toru; Makita, Kikuo; Oshima, Ryuji; Matsubara, Koji; Okano, Yoshinobu; Niki, Shigeru

    2015-08-01

    We report high-quality InGaP/(In)AlGaAs/GaAs triple-junction solar cells fabricated using solid-source molecular beam epitaxy (MBE) for the first time. The triple-junction cells can be used as top cells for smart stacked multijunction solar cells. A growth temperature of 480 °C was found to be suitable for an (In)AlGaAs second cell to obtain high-quality tunnel junctions. The properties of AlGaAs solar cells were better than those of InAlGaAs solar cells when a second cell was grown at 480 °C. The high-quality InGaP/AlGaAs/GaAs solar cell had an impressive open-circuit voltage of 3.1 V. This result indicates that high-performance InGaP/AlGaAs/GaAs triple-junction solar cells can be fabricated using solid-source MBE.

  18. Functional sequences modulated by morphological transitions in human lymphoid cells grown invitro.

    PubMed

    Drewinko, B; Trujillo, J M; Tessmer, C F

    1971-01-15

    Immunoglobulin-producing cells undergo a series of morphological transitions; each configuration displays specific functional attributes. The life cycle of immunocytes may be visualized as a series of functional compartments expressed by morphological sequences. PMID:4099131

  19. Biotransformation of d-Limonene to (+) trans-Carveol by Toluene-Grown Rhodococcus opacus PWD4 Cells

    PubMed Central

    Duetz, Wouter A.; Fjällman, Ann H. M.; Ren, Shuyu; Jourdat, Catherine; Witholt, Bernard

    2001-01-01

    The toluene-degrading strain Rhodococcus opacus PWD4 was found to hydroxylate d-limonene exclusively in the 6-position, yielding enantiomerically pure (+) trans-carveol and traces of (+) carvone. This biotransformation was studied using cells cultivated in chemostat culture with toluene as a carbon and energy source. The maximal specific activity of (+) trans-carveol formation was 14.7 U (g of cells [dry weight])−1, and the final yield was 94 to 97%. Toluene was found to be a strong competitive inhibitor of the d-limonene conversion. Glucose-grown cells did not form any trans-carveol from d-limonene. These results suggest that one of the enzymes involved in toluene degradation is responsible for this allylic monohydroxylation. Another toluene degrader (Rhodococcus globerulus PWD8) had a lower specific activity but was found to oxidize most of the formed trans-carveol to (+) carvone, allowing for the biocatalytic production of this flavor compound. PMID:11375201

  20. Transparent conducting ITAZO anode films grown by a composite target RF magnetron sputtering at room temperature for organic solar cells

    NASA Astrophysics Data System (ADS)

    Sun, Nanhai; Fang, Guojia; Zheng, Qiao; Wang, Mingjun; Liu, Nishuang; Liu, Wei; Zhao, Xingzhong

    2009-08-01

    The preparation and characteristics of AZO co-sputtered ITO (ITAZO) electrodes grown on glass and flexible substrates using a specially designed composite target in organic solar cells are described. It was found that both the electrical and optical properties of the ITAZO films were critically dependent on the Ar/O2 flow ratio and sputtering power. In addition, all ITAZO electrodes show the amorphous structure due to the low substrate temperature. Even though the ITAZO electrode was prepared at room temperature, we can obtain the ITAZO electrode with the sheet resistance of 23 Ω/square (on a glass substrate) and 26 Ω/square (on a flexible substrate) and the average optical transmittance of 87.5% (on a glass substrate) and 86.3% (on a flexible substrate) in the region between 450 and 800 nm wavelength. In addition, the Ar ion treatment of the polyethylene terephthalate (PET) substrate could remove surface contamination and increase the adherence of the ITAZO film with the PET substrate. Furthermore, organic solar cells prepared on the ITAZO electrode under optimized conditions show the typical current density-voltage characteristics with the conversion power efficiency of 3.2%. This indicates that the composite target sputtering technique is a promising sputtering process for transparent conducting electrodes for low-cost solar cell applications.

  1. Photovoltaic characteristics of n(+)pp(+) InP solar cells grown by OMVPE

    NASA Technical Reports Server (NTRS)

    Tyagi, S.; Singh, K.; Bhimnathwala, H.; Ghandhi, S. K.; Borrego, J. M.

    1990-01-01

    The photovoltaic characteristics of n(+)/p/p(+) homojunction InP solar cells fabricated by organometallic vapor-phase epitaxy (OMVPE) are described. The cells are characterized by I-V, C-V and quantum efficiency measurements, and simulations are used to obtain various device and material parameters. The I-V characteristics show a high recombination rate in the depletion region; this is shown to be independent of the impurity used. It is shown that cadmium is easier to use as an acceptor for the p base and p(+) buffer and is therefore beneficial. The high quantum efficiency of 98 percent at long wavelengths measured in these cells indicates a very good collection efficiency in the base. The short-wavelength quantum efficiency is poor, indicating a high surface recombination.

  2. Optimization towards high density quantum dots for intermediate band solar cells grown by molecular beam epitaxy

    SciTech Connect

    Zhou, D.; Sharma, G.; Fimland, B. O.; Thomassen, S. F.; Reenaas, T. W.

    2010-02-08

    We report high density quantum dots (QDs) formation with optimized growth temperature and V/III ratio. At lower growth temperature, QD density is increased, due to smaller surface migration length of In adatoms. With higher V/III, the QD density is higher but it results in large clusters formation and decreases the QD uniformity. The QD solar cell was fabricated and examined. An extended spectral response in contrast to the GaAs reference cell was presented but the external quantum efficiency at energies higher than GaAs band gap is reduced, resulting from the degradation for the emitter above the strained QD layers.

  3. High efficiency GaAs-Ge tandem solar cells grown by MOCVD

    NASA Technical Reports Server (NTRS)

    Vernon, S. M.; Tobin, S. P.; Bajgar, C.; Haven, Victor E.; Geoffroy, L. M.; Lillington, D. R.; Hart, R. E., Jr.

    1989-01-01

    High conversion efficiency and low weight are obviously desirable for solar cells intended for space applications. One promising structure is GaAs on Ge. The advantages of using Ge wafers as substrates include the following: they offer high efficiency by forming a two-junction tandem cell; low weight combined with superior strength allows usage of thin (3 mil) wafers; and they are a good substrate for GaAs, being lattice matched, thermal expansion matched, and available as large-area wafers.

  4. Low temperature grown ZnO@TiO{sub 2} core shell nanorod arrays for dye sensitized solar cell application

    SciTech Connect

    Goh, Gregory Kia Liang; Le, Hong Quang; Huang, Tang Jiao; Hui, Benjamin Tan Tiong

    2014-06-01

    High aspect ratio ZnO nanorod arrays were synthesized on fluorine-doped tin oxide glasses via a low temperature solution method. By adjusting the growth condition and adding polyethylenimine, ZnO nanorod arrays with tunable length were successfully achieved. The ZnO@TiO{sub 2} core shells structures were realized by a fast growth method of immersion into a (NH{sub 4}){sub 2}·TiF{sub 6} solution. Transmission electron microscopy, X-ray Diffraction and energy dispersive X-ray measurements all confirmed the existence of a titania shell uniformly covering the ZnO nanorod's surface. Results of solar cell testing showed that addition of a TiO{sub 2} shell to the ZnO nanorod significantly increased short circuit current (from 4.2 to 5.2 mA/cm{sup 2}), open circuit voltage (from 0.6 V to 0.8 V) and fill factor (from 42.8% to 73.02%). The overall cell efficiency jumped from 1.1% for bare ZnO nanorod to 3.03% for a ZnO@TiO{sub 2} core shell structured solar cell with a 18–22 nm shell thickness, a nearly threefold increase. - Graphical abstract: The synthesis process of coating TiO{sub 2} shell onto ZnO nanorod core is shown schematically. A thin, uniform, and conformal shell had been grown on the surface of the ZnO core after immersing in the (NH{sub 4}){sub 2}·TiF{sub 6} solution for 5–15 min. - Highlights: • ZnO@TiO{sub 2} core shell nanorod has been grown on FTO substrate using low temperature solution method. • TEM, XRD, EDX results confirmed the existing of titana shell, uniformly covered rod's surface. • TiO{sub 2} shell suppressed recombination, demonstrated significant enhancement in cell's efficiency. • Core shell DSSC's efficiency achieved as high as 3.03%, 3 times higher than that of ZnO nanorods.

  5. Heteroepitaxial Film Silicon Solar Cell Grown on Ni-W Foils

    SciTech Connect

    Wee, S. H.; Cantoni, C.; Fanning, T. R.; Teplin, C. W.; Bogorin, D. F.; Bornstein, J.; Bowers, K.; Schroeter, P.; Hasoon, F.; Branz, H. M.; Paranthaman, M. P.; Goyal, A.

    2012-03-01

    Heteroepitaxial semiconductor films on low-cost, flexible metal foil templates are a potential route to inexpensive, high-efficiency solar cells. Here, we report epitaxial growth of Si films on low-cost, flexible, biaxially-textured Ni-W substrates. A robust buffer architecture comprised of multiple epitaxial oxide layers has been developed to grow high quality, heteroepitaxial Si films without any undesired reaction between the Si film and the metal substrate and with a single biaxial texture. XRD analysis including {omega}-scans, {phi}-scans, and pole figures confirms that the buffers and silicon are all epitaxial, with excellent cube-on-cube epitaxy. A photo-conversion efficiency of 1.1% is demonstrated from a proof-of-concept heteroepitaxial film Si solar cell.

  6. Development of a dose verification system for Vero4DRT using Monte Carlo method.

    PubMed

    Ishihara, Yoshitomo; Sawada, Akira; Nakamura, Mitsuhiro; Miyabe, Yuki; Tanabe, Hiroaki; Kaneko, Shuji; Takayama, Kenji; Mizowaki, Takashi; Kokubo, Masaki; Hiraoka, Masahiro

    2014-01-01

    Vero4DRT is an innovative image-guided radiotherapy system employing a C-band X-ray head with gimbal mechanics. The purposes of this study were to propose specific MC models of the linac head and multileaf collimator (MLC) for the Vero4DRT and to verify their accuracy. For a 6 MV photon beam delivered by the Vero4DRT, a simulation code was implemented using EGSnrc. The linac head model and the MLC model were simulated based on its specification. Next, the percent depth dose (PDD) and beam profiles at depths of 15, 100, and 200 mm were simulated under source-to-surface distance of 900 and 1000 mm. Field size was set to 150 × 150 mm2 at a depth of 100 mm. Each of the simulated dosimetric metrics was then compared with the corresponding measurements by a 0.125 cc ionization chamber. After that, intra- and interleaf leakage, tongue-and-groove, and rounded-leaf profiles were simulated for the static MLC model. Meanwhile, film measurements were performed using EDR2 films under similar conditions to simulation. The measurement for the rounded-leaf profile was performed using the water phantom and the ionization chamber. The leaf physical density and abutting leaf gap were adjusted to obtain good agreement between the simulated intra- and interleaf leakage profiles and measurements. For the MLC model in step-and-shoot cases, a pyramid and a prostate IMRT field were simulated, while film measurements were performed using EDR2. For the linac head, exclusive of MLC, the difference in PDD was < 1.0% after the buildup region. The simulated beam profiles agreed to within 1.3% at each depth. The MLC model has been shown to reproduce dose measurements within 2.5% for static tests. The MLC is made of tungsten alloy with a purity of 95%. The leaf gap of 0.015 cm and the MLC physical density of 18.0 g/ cm3, which provided the best agreement between the simulated and measured leaf leakage, were assigned to our MC model. As a result, the simulated step-and-shoot IMRT dose

  7. Hybrid solar cells based on dc magnetron sputtered films of n-ITO on APMOVPE grown p-InP

    NASA Technical Reports Server (NTRS)

    Coutts, T. J.; Li, X.; Wanlass, M. W.; Emery, K. A.; Gessert, T. A.

    1988-01-01

    Hybrid indium-tin-oxide (ITO)/InP solar cells are discussed. The cells are constructed by dc magnetron sputter deposition of ITO onto high-quality InP films grown by atmospheric pressure metal-organic vapor-phase epitaxy (APMOVPE). A record efficiency of 18.9 percent, measured under standard Solar Energy Research Institute reporting conditions, has been obtained. The p-InP surface is shown to be type converted, principally by the ITO, but with the extent of conversion being modified by the nature of the sputtering gas. The deposition process, in itself, is not responsible for the type conversion. Dark currents have been suppressed by more than three orders of magnitude by the addition of hydrogen to the sputtering gas during deposition of a thin (5 nm) interface layer. Without this layer, and using only the more usual argon/oxygen mixture, the devices had poorer efficiencies and were unstable. A discussion of associated quantum efficiencies and capacitance/voltage measurements is also presented from which it is concluded that further improvements in efficiency will result from better control over the type-conversion process.

  8. Combined effects of tumor necrosis factor alpha and radiation in the treatment of renal cell carcinoma grown as radia spheroids.

    PubMed

    Van Moorselaar, R J; Schwachöfer, J H; Crooijmans, R P; Van Stratum, P; Debruyne, F M; Schalken, J A

    1990-01-01

    We have investigated the antiproliferative effects of Tumor Necrosis Factor Alpha (TNF) and radiation on a recently described rat renal cell tumor line grown as multicellular tumor spheroids (MTS). Treatment commenced when the spheroids had reached a diameter of 250 microns. TNF was diluted in the tissue culture medium in different concentrations, ranging from 250-1000 ng/ml. TNF monotherapy had a dose-dependent inhibiting effect on spheroid growth. Single-dose irradiation with 2, 4 or 6 Gy also retarded spheroids significantly in their growth. In the combination treatment the highest dose of TNF (1000 ng/ml) was added 4 hours prior to radiation. TNF could not induce a potentiation of the radiation injury at 2 Gy. The combination with 4 Gy, however, had additive and the combination with 6 Gy synergistic antiproliferative effects; in these treatment regimens respectively 2 and 5 out of 24 spheroids were controlled, i.e. cured. These experiments suggest that TNF in combination with radiotherapy may be beneficial for the treatment of renal cell carcinoma or cancer in general. PMID:2285257

  9. Moringa oleifera Lam. (Moringaceae) grown in Nigeria: In vitro antisickling activity on deoxygenated erythrocyte cells

    PubMed Central

    Adejumo, Olufunmilayo E.; Kolapo, Adelodun L.; Folarin, Akintomiwa O.

    2012-01-01

    Context: Traditional medicine, which is more available and affordable for the poor uses medicinal plants for the treatment and management of various ailments, including the sickle cell disease (SCD). About 24 million Nigerians are carriers of this sickled cell gene, while approximately 2.4 million are SCD patients. Moringa oleifera Lam. (Moringaceae) possesses high nutritional value and has been used in folklore medicine to treat various ailments related to pain and inflammation. Chemical, pharmacological and pharmacognostical applications of Moringa oleifera have been reported. Objective: This study investigated the antisickling potential of polar and non-polar extracts of the seed, flower and leaf of Moringa oleifera for the first time. Materials and Methods: Using crude methanol extract, aqueous extract, ethyl acetate and butanol, the in vitro antisickling activities of Moringa oleifera fractions, were evaluated using erythrocyte cells deoxygenated with 2% sodium metabisulphite. p-Hydroxybenzoic acid and normal saline were employed as positive and negative controls. Results: Phytochemical screening revealed the presence of saponins, free anthraquinones, and alkaloids. Extracts of the seed and flower demonstrated a higher (P<0.05) antisickling activity in comparison to the leaf extract. The leaf extract, as well as those of the seed and flower, equally demonstrated a (P<0.05) reversal of sickled erythrocytes. Discussions and Conclusions: These findings suggest that Moringa oleifera may play a role in the management of SCD, by incorporation of its fractions into recipes. More extensive biological evaluations and further studies will be necessary for the chemical characterization of the antisickling principles. PMID:22557922

  10. Performance of microbial electrolysis cells with bioanodes grown at different external resistances.

    PubMed

    Rago, Laura; Monpart, Nuria; Cortés, Pilar; Baeza, Juan A; Guisasola, Albert

    2016-01-01

    Bioelectrochemical systems need an anode with a high abundance of exoelectrogenic bacteria for an optimal performance. Among all possible operational parameters for an efficient enrichment, the role of external resistance in microbial fuel cell (MFC) has gained a lot of interest since it indirectly poises an anode potential, a key parameter for biofilm distribution and morphology. Thus, this work aims at investigating and discussing whether bioanodes selected at different external resistances under MFC operation present different responses under both MFC and microbial electrolysis cell (MEC) operation. A better MEC performance (i.e. shorter start-up time, higher current intensity and higher H2 production rate) was obtained with an anode from an MFC developed under low external resistance. Quantitative real-time polymerase chain reaction (qPCR) confirmed that a low external resistance provides an MFC anodic biofilm with the highest content of Geobacter because it allows higher current intensity, which is correlated to exoelectrogenic activity. High external resistances such as 1,000 Ω led to a slower start-up time under MEC operation. PMID:26942536

  11. Genotoxic Effects of Low- and High-LET Radiation on Human Epithelial Cells Grown in 2-D Versus 3-D Culture

    NASA Technical Reports Server (NTRS)

    Patel, Z. S.; Cucinotta, F. A.; Huff, J. L.

    2011-01-01

    Risk estimation for radiation-induced cancer relies heavily on human epidemiology data obtained from terrestrial irradiation incidents from sources such as medical and occupational exposures as well as from the atomic bomb survivors. No such data exists for exposures to the types and doses of high-LET radiation that will be encountered during space travel; therefore, risk assessment for space radiation requires the use of data derived from cell culture and animal models. The use of experimental models that most accurately replicate the response of human tissues is critical for precision in risk projections. This work compares the genotoxic effects of radiation on normal human epithelial cells grown in standard 2-D monolayer culture compared to 3-D organotypic co-culture conditions. These 3-D organotypic models mimic the morphological features, differentiation markers, and growth characteristics of fully-differentiated normal human tissue and are reproducible using defined components. Cultures were irradiated with 2 Gy low-LET gamma rays or varying doses of high-LET particle radiation and genotoxic damage was measured using a modified cytokinesis block micronucleus assay. Our results revealed a 2-fold increase in residual damage in 2 Gy gamma irradiated cells grown under organotypic culture conditions compared to monolayer culture. Irradiation with high-LET particle radiation gave similar results, while background levels of damage were comparable under both scenarios. These observations may be related to the phenomenon of "multicellular resistance" where cancer cells grown as 3-D spheroids or in vivo exhibit an increased resistance to killing by chemotherapeutic agents compared to the same cells grown in 2-D culture. A variety of factors are likely involved in mediating this process, including increased cell-cell communication, microenvironment influences, and changes in cell cycle kinetics that may promote survival of damaged cells in 3-D culture that would

  12. Dye-sensitized solar cell employing zinc oxide aggregates grown in the presence of lithium

    DOEpatents

    Zhang, Qifeng; Cao, Guozhong

    2013-10-15

    Provided are a novel ZnO dye-sensitized solar cell and method of fabricating the same. In one embodiment, deliberately added lithium ions are used to mediate the growth of ZnO aggregates. The use of lithium provides ZnO aggregates that have advantageous microstructure, morphology, crystallinity, and operational characteristics. Employing lithium during aggregate synthesis results in a polydisperse collection of ZnO aggregates favorable for porosity and light scattering. The resulting nanocrystallites forming the aggregates have improved crystallinity and more favorable facets for dye molecule absorption. The lithium synthesis improves the surface stability of ZnO in acidic dyes. The procedures developed and disclosed herein also help ensure the formation of an aggregate film that has a high homogeneity of thickness, a high packing density, a high specific surface area, and good electrical contact between the film and the fluorine-doped tin oxide electrode and among the aggregate particles.

  13. Enhanced-Depletion-Width GaInNAs Solar Cells Grown by Molecular-Beam Epitaxy

    SciTech Connect

    Ptak, A. J.; Friedman, D. J.

    2005-01-01

    The 3-junction, GaInP2/GaAs/Ge solar cell is a non-optimized structure due to excess light falling on the Ge junction. Because of this, a fourth junction inserted between the GaAs and Ge subcells could use the excess light and provide an increase in device efficiency. Unfortunately, the leading candidate material, GaInNAs, suffers from very low minority-carrier diffusion lengths compared to its parent compound, GaAs. These low diffusion lengths do not allow for the collection of adequate current to keep the overall 4-junction structure current matched. If the currents generated from the GaInNAs subcell are increased, the possibility exists for practical efficiencies of greater than 40% from this structure.

  14. Synthesis of cell constituents by methane-grown Methylococcus capsulatus and Methanomonas methanooxidans

    PubMed Central

    Lawrence, A. J.; Kemp, M. B.; Quayle, J. R.

    1970-01-01

    1. A study was made of the incorporation of carbon from [14C]methanol by cultures of Methylococcus capsulatus and Methanomonas methanooxidans growing on methane. 2. The distribution of radioactivity within the non-volatile constituents of the ethanol-soluble fractions of the cells, after incubation with labelled substrate for periods of up to 3min, was analysed by chromatography and radioautography. 3. Over 80% of the radioactivity fixed by Methylococcus capsulatus at 30°C at the earliest times of sampling appeared in phosphorylated compounds, of which glucose phosphate constituted 60%. 4. Most of the radioactivity fixed by Methanomonas methanooxidans at 30°C at the earliest times of sampling appeared in serine, malate, aspartate and an unknown compound(s) tentatively suggested to be folate derivative(s). At 16°C, [14C]methanol was fixed predominantly into serine and the unknown compound(s). 5. Extracts of Methylococcus capsulatus contain an enzyme system that catalyses the condensation of formaldehyde and ribose 5-phosphate to give a mixture consisting mainly of fructose phosphate and allulose phosphate. No similar activity was detected in extracts of Methanomonas methanooxidans. A convenient method was developed for assay of this enzyme system. 6. The enzyme system catalysing the condensation of formaldehyde with ribose 5-phosphate is particle-bound in both Methylococcus capsulatus and Pseudomonas methanica and is unstable in the absence of Mg2+. 7. Extracts of Methanomonas methanooxidans contain high activities of d-glycerate–NAD oxidoreductase, whereas extracts of Methylococcus capsulatus and Pseudomonas methanica contain negligible activities of this enzyme. 8. These results indicate that during growth of Methylococcus capsulatus on methane, as with Pseudomonas methanica, cell constituents are made by the ribose phosphate cycle of formaldehyde fixation. This contrasts with Methanomonas methanooxidans, whose assimilation pathway resembles in some features

  15. Use of cycloheximide to study independent lipid metabolism of Chlamydia trachomatis cultivated in mouse L cells grown in serum-free medium.

    PubMed Central

    Reed, S I; Anderson, L E; Jenkin, H M

    1981-01-01

    A system for measuring chlamydial lipid synthesis was developed with mouse L cells grown in serum-free modified Waymouth 752/l medium in a shaker culture. Host lipid synthesis was reduced approximately 90% when cells were incubated for 24 h in medium containing cycloheximide (2 micrograms/ml). Lipid metabolism was monitored by measuring the incorporation of [3H]isoleucine into the total lipid of normal and infected cells. The results suggested that lipid synthesis of Chlamydia trachomatis lymphogranuloma venereum (LGV-404L) was not inhibited by cycloheximide treatment when the chlamydiae were grown in L cells, whereas host lipid synthesis was inhibited. Chlamydial lipid metabolism began about 6 to 12 h after infection when the noninfectious reticulate body was found and continually increased until the beginning of the appearance of intracellular infectious elementary bodies at 24 to 30 h. PMID:7216466

  16. Dilute Nitride GaNP Wide Bandgap Solar Cells Grown by Gas-Source Molecular Beam Epitaxy

    NASA Astrophysics Data System (ADS)

    Sukrittanon, Supanee

    Integration of III-V semiconductors and Si is a very attractive means to achieve low-cost high-efficiency solar cells. A promising configuration is to utilize a dual-junction solar cell, in which Si is employed as the bottom junction and a wide-bandgap III-V semiconductor as the top junction. The use of a III-V semiconductor as a top junction offers the potential to achieve higher efficiencies than today's best Si solar cell. Dilute nitride GaNP is a promising candidate for the top cell in dual-junction solar cells because it possesses several extremely important attributes: a direct-bandgap that is also tunable as well as easily-attained lattice-match with Si. As a first step towards integration of GaNP solar cells onto Si, the goal of this dissertation is to optimize and demonstrate GaNP solar cells grown by gas-source molecular beam epitaxy (GSMBE) on GaP (001) substrate. The dissertation is divided into three major parts. In the first part, we demonstrate ˜ 2.05 eV ([N]˜ 1.8%) dilute nitride GaNP thin film solar cells, in which the GaNP is closely lattice-matched to Si, on GaP substrates. From transmission electron microscopy (TEM), the device exhibits defects only at the GaNP/GaP interface, and no threading dislocations in an active layer are observed. Our best GaNP solar cell achieved an efficiency of 7.9% with anti-reflection (AR) coating and no window layer. This GaNP solar cell's efficiency is higher than the most efficient GaP solar cell to date and higher than other solar cells with similar direct bandgap (InGaP, GaAsP). Through a systematic study of the structural, electrical, and optical properties of the device, efficient broadband optical absorption and enhanced solar cell performance using GaNP are demonstrated. In the second part, we demonstrate the successful fabrication of GaP/GaNP core/shell microwires utilizing a novel technique: top-down reactive-ion etching (RIE) to create the cores and MBE to create the shells. Systematic studies have been

  17. Superparamagnetic iron oxide nanoparticles exert different cytotoxic effects on cells grown in monolayer cell culture versus as multicellular spheroids

    NASA Astrophysics Data System (ADS)

    Theumer, Anja; Gräfe, Christine; Bähring, Franziska; Bergemann, Christian; Hochhaus, Andreas; Clement, Joachim H.

    2015-04-01

    The aim of this study was to investigate the interaction of superparamagnetic iron oxide nanoparticles (SPION) with human blood-brain barrier-forming endothelial cells (HBMEC) in two-dimensional cell monolayers as well as in three-dimensional multicellular spheroids. The precise nanoparticle localisation and the influence of the NP on the cellular viability and the intracellular Akt signalling were studied in detail. Long-term effects of different polymer-coated nanoparticles (neutral fluidMAG-D, anionic fluidMAG-CMX and cationic fluidMAG-PEI) and the corresponding free polymers on cellular viability of HBMEC were investigated by real time cell analysis studies. Nanoparticles exert distinct effects on HBMEC depending on the nanoparticles' surface charge and concentration, duration of incubation and cellular context. The most severe effects were caused by PEI-coated nanoparticles. Concentrations above 25 μg/ml led to increased amounts of dead cells in monolayer culture as well as in multicellular spheroids. On the level of intracellular signalling, context-dependent differences were observed. Monolayer cultures responded on nanoparticle incubation with an increase in Akt phosphorylation whereas spheroids on the whole show a decreased Akt activity. This might be due to the differential penetration and distribution of PEI-coated nanoparticles.

  18. Oxygen Partial Pressure Is a Rate-Limiting Parameter for Cell Proliferation in 3D Spheroids Grown in Physioxic Culture Condition

    PubMed Central

    Gomes, Aurélie; Guillaume, Ludivine; Grimes, David Robert; Fehrenbach, Jérôme; Lobjois, Valérie; Ducommun, Bernard

    2016-01-01

    The in situ oxygen partial pressure in normal and tumor tissues is in the range of a few percent. Therefore, when studying cell growth in 3D culture systems, it is essential to consider how the physiological oxygen concentration, rather than the one in the ambient air, influences the proliferation parameters. Here, we investigated the effect of reducing oxygen partial pressure from 21% to 5% on cell proliferation rate and regionalization in a 3D tumor spheroid model. We found that 5% oxygen concentration strongly inhibited spheroid growth, changed the proliferation gradient and reduced the 50% In Depth Proliferation index (IDP50), compared with culture at 21% oxygen. We then modeled the oxygen partial pressure profiles using the experimental data generated by culturing spheroids in physioxic and normoxic conditions. Although hypoxia occurred at similar depth in spheroids grown in the two conditions, oxygen partial pressure was a major rate-limiting factor with a critical effect on cell proliferation rate and regionalization only in spheroids grown in physioxic condition and not in spheroids grown at atmospheric normoxia. Our findings strengthen the need to consider conducting experiment in physioxic conditions (i.e., tissue normoxia) for proper understanding of cancer cell biology and the evaluation of anticancer drugs in 3D culture systems. PMID:27575790

  19. Oxygen Partial Pressure Is a Rate-Limiting Parameter for Cell Proliferation in 3D Spheroids Grown in Physioxic Culture Condition.

    PubMed

    Gomes, Aurélie; Guillaume, Ludivine; Grimes, David Robert; Fehrenbach, Jérôme; Lobjois, Valérie; Ducommun, Bernard

    2016-01-01

    The in situ oxygen partial pressure in normal and tumor tissues is in the range of a few percent. Therefore, when studying cell growth in 3D culture systems, it is essential to consider how the physiological oxygen concentration, rather than the one in the ambient air, influences the proliferation parameters. Here, we investigated the effect of reducing oxygen partial pressure from 21% to 5% on cell proliferation rate and regionalization in a 3D tumor spheroid model. We found that 5% oxygen concentration strongly inhibited spheroid growth, changed the proliferation gradient and reduced the 50% In Depth Proliferation index (IDP50), compared with culture at 21% oxygen. We then modeled the oxygen partial pressure profiles using the experimental data generated by culturing spheroids in physioxic and normoxic conditions. Although hypoxia occurred at similar depth in spheroids grown in the two conditions, oxygen partial pressure was a major rate-limiting factor with a critical effect on cell proliferation rate and regionalization only in spheroids grown in physioxic condition and not in spheroids grown at atmospheric normoxia. Our findings strengthen the need to consider conducting experiment in physioxic conditions (i.e., tissue normoxia) for proper understanding of cancer cell biology and the evaluation of anticancer drugs in 3D culture systems. PMID:27575790

  20. Variable temperature carrier dynamics in bulk (In)GaAsNSb materials grown by MOVPE for multi-junction solar cells

    NASA Astrophysics Data System (ADS)

    Sin, Yongkun; Lingley, Zachary; LaLumondiere, Stephen; Wells, Nathan; Lotshaw, William; Moss, Steven C.; Kim, Tae Wan; Mawst, Luke J.; Kuech, Thomas F.

    2014-03-01

    III-V multi-junction solar cells are typically based on a triple-junction design that consists of an InGaP top junction, a GaAs middle junction, and a bottom junction that employs a 1 - 1.25 eV material grown on GaAs substrates. The most promising 1 - 1.25 eV material that is currently under extensive investigation is bulk dilute nitride such as (In)GaAsNSb lattice matched to GaAs substrates. The approach utilizing dilute nitrides has a great potential to achieve high performance triple-junction solar cells as recently demonstrated by Wiemer, et al., who achieved a record efficiency of 43.5% from multi-junction solar cells including MBE-grown dilute nitride materials [1]. Although MOVPE is a preferred technique over MBE for III-V multi-junction solar cell manufacturing, MOVPEgrown dilute nitride research is at its infancy compared to MBE-grown dilute nitride. In particular, carrier dynamics studies are indispensible in the optimization of MOVPE materials growth parameters to obtain improved solar cell performance. For the present study, we employed time-resolved photoluminescence (TR-PL) techniques to study carrier dynamics in MOVPE-grown bulk dilute nitride InGaAsN materials (Eg = 1 - 1.25 eV at RT) lattice matched to GaAs substrates. In contrast to our earlier samples that showed high background C doping densities, our current samples grown using different metalorganic precursors at higher growth temperatures showed a significantly reduced background doping density of ~ 1017 /cm3. We studied carrier dynamics in (In)GaAsNSb double heterostructures (DH) with different N compositions at room temperature. Post-growth annealing yielded significant improvements in carrier lifetimes of (In)GaAsNSb double heterostructure (DH) samples. Carrier dynamics at various temperatures between 10 K and RT were also studied from (In)GaAsNSb DH samples including those samples grown on different orientation substrates.

  1. Expression Profile of Drug and Nutrient Absorption Related Genes in Madin-Darby Canine Kidney (MDCK) Cells Grown under Differentiation Conditions

    PubMed Central

    Quan, Yong; Jin, Yisheng; Faria, Teresa N.; Tilford, Charles A.; He, Aiqing; Wall, Doris A.; Smith, Ronald L.; Vig, Balvinder S.

    2012-01-01

    The expression levels of genes involved in drug and nutrient absorption were evaluated in the Madin-Darby Canine Kidney (MDCK) in vitro drug absorption model. MDCK cells were grown on plastic surfaces (for 3 days) or on Transwell® membranes (for 3, 5, 7, and 9 days). The expression profile of genes including ABC transporters, SLC transporters, and cytochrome P450 (CYP) enzymes was determined using the Affymetrix® Canine GeneChip®. Expression of genes whose probe sets passed a stringent confirmation process was examined. Expression of a few transporter (MDR1, PEPT1 and PEPT2) genes in MDCK cells was confirmed by RT-PCR. The overall gene expression profile was strongly influenced by the type of support the cells were grown on. After 3 days of growth, expression of 28% of the genes was statistically different (1.5-fold cutoff, p < 0.05) between the cells grown on plastic and Transwell® membranes. When cells were differentiated on Transwell® membranes, large changes in gene expression profile were observed during the early stages, which then stabilized after 5–7 days. Only a small number of genes encoding drug absorption related SLC, ABC, and CYP were detected in MDCK cells, and most of them exhibited low hybridization signals. Results from this study provide valuable reference information on endogenous gene expression in MDCK cells that could assist in design of drug-transporter and/or drug-enzyme interaction studies, and help interpret the contributions of various transporters and metabolic enzymes in studies with MDCK cells. PMID:24300234

  2. Porous, single crystalline titanium nitride nanoplates grown on carbon fibers: excellent counter electrodes for low-cost, high performance, fiber-shaped dye-sensitized solar cells.

    PubMed

    Chen, Liang; Dai, Hui; Zhou, Yong; Hu, Yingjie; Yu, Tao; Liu, Jianguo; Zou, Zhigang

    2014-11-28

    An excellent, platinum free fiber counter electrode (CE) was successfully fabricated, consisting of porous, single crystalline titanium nitride (TiN) nanoplates grown on carbon fibers (CF). The fiber-shaped dye-sensitized solar cells (FDSSCs) based on the TiN-CF CE show a high conversion efficiency of 7.20%, comparable or even superior to that of the Pt wire (6.23%). PMID:25068835

  3. Direct sequencing of the HA gene of influenza (H3N2) virus in original clinical samples reveals sequence identity with mammalian cell-grown virus.

    PubMed Central

    Katz, J M; Wang, M; Webster, R G

    1990-01-01

    When influenza (H3N2) viruses from infected individuals are grown in embryonated chicken eggs, viruses are isolated which differ antigenically and structurally from viruses grown in mammalian Madin-Darby canine kidney (MDCK) cell culture [G.C. Schild, J.S. Oxford, J.C. de Jong, and R.G. Webster, Nature (London) 303:706-709, 1983]. To determine which of these viruses is most representative of virus replicating in the infected individual, a region of the HA gene of virus present in original clinical samples was amplified by using the polymerase chain reaction and sequenced directly. Comparison of 170 amino acid residues of HA1 flanking and containing the receptor-binding site and antigenic sites indicated that over this region, the HA of virus replicating in the infected individual was identical to that of virus after growth in MDCK cells and was distinct from the HA of viruses grown in eggs. Therefore, cultivation of human influenza H3N2 virus in mammalian MDCK cells results in a virus similar to the predominant population of virus found in the infected individual. PMID:2319652

  4. Changes of ribulose bisphosphate carboxylase/oxygenase content, ribulose bisphosphate concentration, and photosynthetic activity during adaptation of high-CO/sub 2/ grown cells to low-CO/sub 2/ conditions in Chlorella pyrenoidosa

    SciTech Connect

    Yokota, A.; Canvin, D.T.

    1986-02-01

    Changes of some photosynthetic properties of high-CO/sub 2/ grown cells of Chlorella pyrenoidosa during adaptation to low-CO/sub 2/ conditions have been investigated. The K/sub m/ value of photosynthesis of the high-CO/sub 2/ grown cells for dissolved inorganic carbon was 3.3 millimolar and decreased to 25 to 30 micromolar within 4 hours after transferring to air. In the presence of saturating CO/sub 2/ concentrations the photosynthetic activity of the high-CO/sub 2/ grown cells was 1.5 times as high as that of the low-CO/sub 2/ grown cells. There was a significant rise of the photosynthetic activity during adaptation of the high-CO/sub 2/ grown cells to air, followed by a steady decrease. The activity of ribulose 1,5-bisphosphate carboxylase/oxygenase in both the high and low-CO/sub 2/ grown cells was close to the photosynthetic activity of the cells. The concentration of ribulose 1,5-bisphosphate (RuBP) was higher in the low-CO/sub 2/ adapting and low-CO/sub 2/ grown celsl than in the high-CO/sub 2/ grown cells regardless of the photosynthetic rate. This seems to be due to an increased RuBP regeneration activity during adaptation followed by maintenance of the new higher concentration. The RuBP level always exceeded the concentration of ribulose 1,5-bisphosphate carboxylase/oxygenase RuBP binding sites in both the high- and low-CO/sub 2/ grown cells at any dissolved inorganic carbon concentration.

  5. SU-E-J-129: A Strategy to Consolidate the Image Database of a VERO Unit Into a Radiotherapy Management System

    SciTech Connect

    Yan, Y; Medin, P; Yordy, J; Zhao, B; Jiang, S

    2014-06-01

    Purpose: To present a strategy to integrate the imaging database of a VERO unit with a treatment management system (TMS) to improve clinical workflow and consolidate image data to facilitate clinical quality control and documentation. Methods: A VERO unit is equipped with both kV and MV imaging capabilities for IGRT treatments. It has its own imaging database behind a firewall. It has been a challenge to transfer images on this unit to a TMS in a radiation therapy clinic so that registered images can be reviewed remotely with an approval or rejection record. In this study, a software system, iPump-VERO, was developed to connect VERO and a TMS in our clinic. The patient database folder on the VERO unit was mapped to a read-only folder on a file server outside VERO firewall. The application runs on a regular computer with the read access to the patient database folder. It finds the latest registered images and fuses them in one of six predefined patterns before sends them via DICOM connection to the TMS. The residual image registration errors will be overlaid on the fused image to facilitate image review. Results: The fused images of either registered kV planar images or CBCT images are fully DICOM compatible. A sentinel module is built to sense new registered images with negligible computing resources from the VERO ExacTrac imaging computer. It takes a few seconds to fuse registered images and send them to the TMS. The whole process is automated without any human intervention. Conclusion: Transferring images in DICOM connection is the easiest way to consolidate images of various sources in your TMS. Technically the attending does not have to go to the VERO treatment console to review image registration prior delivery. It is a useful tool for a busy clinic with a VERO unit.

  6. Magnesium doping of efficient GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition

    NASA Technical Reports Server (NTRS)

    Lewis, C. R.; Ford, C. W.; Werthen, J. G.

    1984-01-01

    Magnesium has been substituted for zinc in GaAs and Ga(0.75)In(0.25)As solar cells grown by metalorganic chemical vapor deposition (MOCVD). Bis(cyclopentadienyl)magnesium (Cp2Mg) is used as the MOCVD transport agent for Mg. Full retention of excellent material quality and efficient cell performance results. The substitution of Mg for Zn would enhance the abruptness and reproducibility of doping profiles, and facilitate high temperature processing and operation, due to the much lower diffusion coefficient of Mg, relative to Zn, in these materials.

  7. A multiple p-n junction structure obtained from as-grown Czochralski silicon crystals by heat treatment - Application to solar cells

    NASA Technical Reports Server (NTRS)

    Chi, J. Y.; Gatos, H. C.; Mao, B. Y.

    1980-01-01

    Multiple p-n junctions have been prepared in as-grown Czochralski p-type silicon through overcompensation near the oxygen periodic concentration maxima by oxygen thermal donors generated during heat treatment at 450 C. Application of the multiple p-n-junction configuration to photovoltaic energy conversion has been investigated. A new solar-cell structure based on multiple p-n-junctions was developed. Theoretical analysis showed that a significant increase in collection efficiency over the conventional solar cells can be achieved.

  8. ZnO nanowires array grown on Ga-doped ZnO single crystal for dye-sensitized solar cells.

    PubMed

    Hu, Qichang; Li, Yafeng; Huang, Feng; Zhang, Zhaojun; Ding, Kai; Wei, Mingdeng; Lin, Zhang

    2015-01-01

    High quality ZnO nanowires arrays were homoepitaxial grown on Ga-doped ZnO single crystal (GZOSC), which have the advantages of high conductivity, high carrier mobility and high thermal stability. When it was employed as a photoanode in the DSSCs, the cell exhibited a 1.44% power-conversion efficiency under the illumination of one sun (AM 1.5G). The performance is superior to our ZnO nanowires/FTO based DSSCs under the same condition. This enhanced performance is mainly attributed to the perfect interface between the ZnO nanowires and the GZOSC substrate that contributes to lower carrier scattering and recombination rates compared with that grown on traditional FTO substrate. PMID:26099568

  9. ZnO nanowires array grown on Ga-doped ZnO single crystal for dye-sensitized solar cells

    PubMed Central

    Hu, Qichang; Li, Yafeng; Huang, Feng; Zhang, Zhaojun; Ding, Kai; Wei, Mingdeng; Lin, Zhang

    2015-01-01

    High quality ZnO nanowires arrays were homoepitaxial grown on Ga-doped ZnO single crystal (GZOSC), which have the advantages of high conductivity, high carrier mobility and high thermal stability. When it was employed as a photoanode in the DSSCs, the cell exhibited a 1.44% power-conversion efficiency under the illumination of one sun (AM 1.5G). The performance is superior to our ZnO nanowires/FTO based DSSCs under the same condition. This enhanced performance is mainly attributed to the perfect interface between the ZnO nanowires and the GZOSC substrate that contributes to lower carrier scattering and recombination rates compared with that grown on traditional FTO substrate. PMID:26099568

  10. GaAs Solar Cells Grown by Hydride Vapor-Phase Epitaxy and the Development of GaInP Cladding Layers

    SciTech Connect

    Simon, John; Schulte, Kevin L.; Young, David L.; Haegel, Nancy M.; Ptak, Aaron J.

    2016-01-01

    The high cost of high-efficiency III-V photovoltaic devices currently limits them to niche markets. Hydride vapor-phase epitaxy (HVPE) growth of III-V materials recently reemerged as a low-cost, high-throughput alternative to conventional metal- organic vapor-phase epitaxy (MOVPE) growth of high-efficiency solar cells. Previously, we demonstrated unpassivated HVPEgrown GaAs p-n junctions with good quantum efficiency and high open-circuit voltage (Voc). In this work, we demonstrate the growth of GaInPby HVPE for use as a high-quality surface passivation layer to GaAs solar cells. Solar cells grown with GaInP window layers show significantly improved quantum efficiency compared with unpassivated cells, increasing the short-circuit current (JSC) of these low-cost devices. These results show the potential of low-cost HVPE for the growth of high-quality III-V devices.

  11. Effects of buffer layer and back-surface field on MBE-grown InGaAsP/InGaAs solar cells

    NASA Astrophysics Data System (ADS)

    Wu, Yuanyuan; Ji, Lian; Dai, Pai; Tan, Ming; Lu, Shulong; Yang, Hui

    2016-02-01

    Solid-state molecular beam epitaxy (MBE)-grown InGaAsP/InGaAs dual-junction solar cells on InP substrates are reported. An efficiency of 10.6% under 1-sun AM1.5 global light intensity is realized for the dual-junction solar cell, while the efficiencies of 16.4 and 12.3% are reached for the top InGaAsP and bottom InGaAs cells, respectively. The effects of the buffer layer and back-surface field on the performance of solar cells are discussed. High device performance is achieved in the case of a low concentration of oxygen and weak recombination when InGaAs buffers and InP back-surface field layers are used, respectively.

  12. Power recovery of radiation damaged MOCVD grown indium phosphide on silicon solar cells through argon-ion laser annealing. Master`s thesis

    SciTech Connect

    Boyer, L.L.

    1996-06-01

    This thesis reports the results of a laser annealing technique used to remove defect sites from radiation damaged indium phosphide on silicon MOCVD grown solar cells. This involves the illumination of damaged solar cells with a continuous wave laser to produce a large forward-biased current. The InP/Si cells were irradiated with 1 MeV electrons to a given fluence, and tested for degradation. Light from an argon laser was used to illuminate four cells with an irradiance of 2.5 W/sq cm, producing a current density 3 to 5 times larger than AMO conditions. Cells were annealed at 19 deg C with the laser and at 25 deg C under AMO conditions. Annealing under laser illumination of n/p-type cells resulted in recovery of 48%. P/n type cells lost 4 to 12% of the assumed degradaton. Annealing under AMO conditions resulted in power recovery of 70% in n/p type cells. P/n-type cells recovered approximately 16% of lost power. Results indicate that significant power recovery results from the annealing of defects within n/p type InP/Si solar cells.

  13. Opsonization of Toxoplasma gondii tachyzoites with nonspecific immunoglobulins promotes their phagocytosis by macrophages and inhibits their proliferation in nonphagocytic cells in tissue culture.

    PubMed

    Vercammen, M; Scorza, T; El Bouhdidi, A; Van Beeck, K; Carlier, Y; Dubremetz, J F; Verschueren, H

    1999-11-01

    We have recently shown that Toxoplasma gondii tachyzoites grown in in vitro culture can bind unspecific immunoglobulin (Ig) through their Fc moiety. We show now that Fc receptors are also present on T. gondii within the host animal, and that intraperitoneal parasites in immunocompetent mice are saturated with unspecific Ig. We have also investigated the effect of the parasite's Fc receptor on the interaction of tachyzoites with mammalian cells, using the Vero cell line as a model for nonphagocytic host cells and murine peritoneal macrophages in primary culture as a model for phagocytic cells. Coating of tachyzoites with parasite-unrelated Ig did not enhance their invasive capacity in either target cell type, but slightly decreased the parasite proliferation. Moreover, phagocytosis by macrophages was increased by approximately 50% when parasites were coated with unspecific Ig. These results indicate that the Fc receptor on T. gondii affects the balance between invasion and phagocytosis in a way that is detrimental to the parasites. PMID:10583856

  14. Synergistic effect of dual interfacial modifications with room-temperature-grown epitaxial ZnO and adsorbed indoline dye for ZnO nanorod array/P3HT hybrid solar cell.

    PubMed

    Chen, Dian-Wei; Wang, Ting-Chung; Liao, Wen-Pin; Wu, Jih-Jen

    2013-09-11

    ZnO nanorod (NR)/poly(3-hexylthiophene) (P3HT) hybrid solar cells with interfacial modifications are investigated in this work. The ZnO NR arrays are modified with room-temperature (RT)-grown epitaxial ZnO shells or/and D149 dye molecules prior to the P3HT infiltration. A synergistic effect of the dual modifications on the efficiency of the ZnO NR/P3HT solar cell is observed. The open-circuit voltage and fill factor are considerable improved through the RT-grown ZnO and D149 modifications in sequence on the ZnO NR array, which brings about a 2-fold enhancement of the efficiency of the ZnO NR/P3HT solar cell. We suggested that the more suitable surface of RT-grown ZnO for D149 adsorption, the chemical compatibility of D149 and P3HT, and the elevated conduction band edge of the RT-grown ZnO/D149-modified ZnO NR array construct the superior interfacial morphology and energetics in the RT-grown ZnO/D149-modified ZnO NR/P3HT hybrid solar cell, resulting in the synergistic effect on the cell efficiency. An efficiency of 1.16% is obtained in the RT-grown ZnO/D149-modified ZnO NR/P3HT solar cell. PMID:23937447

  15. Human umbilical cord Wharton's jelly stem cells undergo enhanced chondrogenic differentiation when grown on nanofibrous scaffolds and in a sequential two-stage culture medium environment.

    PubMed

    Fong, Chui-Yee; Subramanian, Arjunan; Gauthaman, Kalamegam; Venugopal, Jayarama; Biswas, Arijit; Ramakrishna, Seeram; Bongso, Ariff

    2012-03-01

    The current treatments used for osteoarthritis from cartilage damage have their disadvantages of donor site morbidity, complicated surgical interventions and risks of infection and graft rejection. Recent advances in tissue engineering have offered much promise in cartilage repair but the best cell source and in vitro system have not as yet been optimised. Human bone marrow mesenchymal stem cells (hBMSCs) have thus far been the cell of choice. However, we derived a unique stem cell from the human umbilical cord Wharton's jelly (hWJSC) that has properties superior to hBMSCs in terms of ready availability, prolonged stemness characteristics in vitro, high proliferation rates, wide multipotency, non-tumorigenicity and tolerance in allogeneic transplantation. We observed enhanced cell attachment, cell proliferation and chondrogenesis of hWJSCs over hBMSCs when grown on PCL/Collagen nanoscaffolds in the presence of a two-stage sequential complex/chondrogenic medium for 21 days. Improvement of these three parameters were confirmed via inverted optics, field emission scanning electron microscopy (FESEM), MTT assay, pellet diameters, Alcian blue histology and staining, glycosaminglycans (GAG) and hyaluronic acid production and expression of key chondrogenic genes (SOX9, Collagen type II, COMP, FMOD) using immunohistochemistry and real-time polymerase chain reaction (qRT-PCR). In separate experiments we demonstrated that the 16 ng/ml of basic fibroblast growth factor (bFGF) present in the complex medium may have contributed to driving chondrogenesis. We conclude that hWJSCs are an attractive stem cell source for inducing chondrogenesis in vitro when grown on nanoscaffolds and exposed sequentially first to complex medium and then followed by chondrogenic medium. PMID:21671058

  16. Grown-in defects and defects produced by 1-Me electron irradiated in Al0.3Ga0.7As P-N junction solar cells

    NASA Technical Reports Server (NTRS)

    Li, S. S.; Teng, K. W.; Schoenfeld, D. W.; Rahilly, W. P.

    1982-01-01

    Studies of grown-in defects and defects produced by the one-MeV electron irradiation in Al sub 0.3 Ga sub 0.7As p-n junction solar cells fabricated by liquid phase epitaxial (LPE) technique were made for the unirradiated and one-MeV electron irradiated samples, using DLTS and C-V methods. Defect and recombination parameters such as energy level, defect density, carrier capture cross sections and lifetimes were determined for various growth, annealing, and irradiation conditions.

  17. Narrow band gap (1 eV) InGaAsSbN solar cells grown by metalorganic vapor phase epitaxy

    NASA Astrophysics Data System (ADS)

    Kim, T. W.; Garrod, T. J.; Kim, K.; Lee, J. J.; LaLumondiere, S. D.; Sin, Y.; Lotshaw, W. T.; Moss, S. C.; Kuech, T. F.; Tatavarti, Rao; Mawst, L. J.

    2012-03-01

    Heterojunction solar cell structures employing InGaAsSbN (Eg ˜ 1 eV) base regions are grown lattice-matched to GaAs substrates using metalorganic vapor phase epitaxy. Room temperature (RT) photoluminescence (PL) measurements indicate a peak spectral emission at 1.04 eV and carrier lifetimes of 471-576 ps are measured at RT from these structures using time-resolved PL techniques. Fabricated devices without anti-reflection coating demonstrate a peak efficiency of 4.58% under AM1.5 direct illumination. Solar cells with a 250 nm-thick InGaAsSbN base layer exhibit a 17% improvement in open circuit voltage (Voc), 14% improvement in fill factor, and 12% improvement in efficiency over the cells with a thicker (500 nm-thick) base layer.

  18. Mitochondria Increase Three-Fold and Mitochondrial Proteins and Lipid Change Dramatically in Postmeristematic Cells in Young Wheat Leaves Grown in Elevated CO2.

    PubMed Central

    Robertson, E. J.; Williams, M.; Harwood, J. L.; Lindsay, J. G.; Leaver, C. J.; Leech, R. M.

    1995-01-01

    A dramatic stimulation in mitochondrial biogenesis during the very early stages of leaf development was observed in young wheat plants (Triticum aestivum cv Hereward) grown in elevated CO2 (650 [mu]L L-1). An almost 3-fold increase in the number of mitochondria was observed in the very young leaf cells at the base of the first leaf of a 7-d-old wheat plant. In the same cells large increases in the accumulation of a mitochondrial chaperonin protein and the mitochondrial 2-oxoglutarate dehydrogenase complex and pyruvate dehydrogenase complex were detected by immunolabeling. Furthermore, the basal segment also shows a large increase in the rate of radiolabeling of diphosphatidylglycerol, a lipid confined to the inner mitochondrial membrane. This dramatic response in very young leaf cells to elevated CO2 suggests that the numerous documented positive effects of elevated CO2 on wheat leaf development are initiated as early as 12 h postmitosis. PMID:12228485

  19. A vero cell derived combined vaccine against sheep pox and Peste des Petits ruminants for sheep.

    PubMed

    Chaudhary, S S; Pandey, K D; Singh, R P; Verma, P C; Gupta, P K

    2009-04-28

    The combined sheep pox and Peste des Petits ruminants (PPR) vaccine was prepared in lyophilized form containing recommended doses of both vaccine viruses. Safety and immunogenicity of this combined vaccine was evaluated in sheep. Sheep immunized subcutaneously with 1ml of live attenuated vaccine consisting of 10(3)TCID(50) each of sheep pox virus (SPV) Romanian Fanar (RF) strain and Peste des Petits ruminants virus (PPRV-Sungri/96 strain) were monitored for clinical and serological responses for a period of four weeks post immunization (pi) and two week post challenge (pc). Specific antibodies directed to sheep pox virus could be demonstrated by indirect ELISA and serum neutralization test (SNT). Competitive ELISA and SNT were used for demonstration of antibodies to PPR virus. All the immunized animals resisted challenge with virulent SPV or PPRV on day 30pi, while control animals developed characteristic signs of disease. Specific virus could be detected in the unvaccinated control animals after challenge but not from any of the immunized sheep. Combined vaccine was found to be safe and potent as evident from sero conversion as well as challenge studies in sheep. This indicates that component vaccines did not interfere each other and can be used in target population for economic vaccination strategies. PMID:19428860

  20. Comparison of single junction AlGaInP and GaInP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Masuda, T; Tomasulo, S; Lang, JR; Lee, ML

    2015-03-07

    We have investigated similar to 2.0 eV (AlxGa1-x)(0.51)In0.49P and similar to 1.9 eV Ga0.51In0.49P single junction solar cells grown on both on-axis and misoriented GaAs substrates by molecular beam epitaxy (MBE). Although lattice-matched (AlxGa1-x)(0.51)In0.49P solar cells are highly attractive for space and concentrator photovoltaics, there have been few reports on the MBE growth of such cells. In this work, we demonstrate open circuit voltages (V-oc) ranging from 1.29 to 1.30 V for Ga0.51In0.49P cells, and 1.35-1.37 V for (AlxGa1-x)(0.51)In0.49P cells. Growth on misoriented substrates enabled the bandgap-voltage offset (W-oc = E-g/q - V-oc) of Ga0.51In0.49P cells to decrease from similar to 575 mV to similar to 565 mV, while that of (AlxGa1-x)(0.51)In0.49P cells remained nearly constant at 620 mV. The constant Woc as a function of substrate offcut for (AlxGa1-x)(0.51)In0.49P implies greater losses from non-radiative recombination compared with the Ga0.51In0.49P devices. In addition to larger Woc values, the (AlxGa1-x)(0.51)In0.49P cells exhibited significantly lower internal quantum efficiency (IQE) values than Ga0.51In0.49P cells due to recombination at the emitter/window layer interface. A thin emitter design is experimentally shown to be highly effective in improving IQE, particularly at short wavelengths. Our work shows that with further optimization of both cell structure and growth conditions, MBE-grown (AlxGa1-x)(0.51)In0.49P will be a promising wide-bandgap candidate material for high-efficiency, lattice-matched multi-junction solar cells. (C) 2015 AIP Publishing LLC.

  1. Clostridium difficile Cell Attachment Is Modified by Environmental Factors

    PubMed Central

    Waligora, Anne-Judith; Barc, Marie-Claude; Bourlioux, Pierre; Collignon, Anne; Karjalainen, Tuomo

    1999-01-01

    Adherence of Clostridium difficile to Vero cells under anaerobic conditions was increased by a high sodium concentration, calcium-rich medium, an acidic pH, and iron starvation. The level of adhesion of nontoxigenic strains was comparable to that of toxigenic strains. Depending on the bacterial culture conditions, Vero cells could bind to one, two, or three bacterial surface proteins with molecular masses of 70, 50, and 40 kDa. PMID:10473442

  2. Significant changes in cell and chloroplast development in young wheat leaves (Triticum aestivum cv Hereward) grown in elevated CO{sub 2}

    SciTech Connect

    Robertson, E.J.; Leech, R.M.

    1995-01-01

    Cell and chloroplast development were characterized in young Triticum aestivum cv Hereward leaves grown at ambient (350 {mu}L L{sup {minus}1}) or at elevated (650 {mu}L L{sup {minus}1}) CO{sub 2}. In elevated CO{sub 2}, cell and chloroplast expansion was accelerated by 10 and 25%, respectively, in the first leaf of 7-d-old wheat plants without disruption to the leaf developmental pattern. Elevated CO{sub 2} did not affect the number of chloroplasts in relation to mesophyll cell size or the linear relationship between chloroplast number or size and mesophyll cell size. No major changes in leaf anatomy or in chloroplast ultrastructure were detected as a result of growth in elevated CO{sub 2}, but there was a marked reduction in starch accumulation. In leaf sections fluorescently tagged antisera were used to visualize and quantitate the amount of cytochrome f, the {alpha}- and {beta}-subunits of the coupling factor 1 in ATP synthase, D1 protein of the photosystem II reaction center, the 33-kD protein of the extrinsic oxygen-evolving complex, subunit II of photosystem I, and ribulose-1,5-biphosphate carboxylase/oxygenase. A significant finding was that in 10 to 20% of the mesophyll cells grown in elevated CO{sub 2} the 33-kD protein of the extrinsic oxygen-evolving complex of photosystem II and cytochrome f were deficient by 75%, but the other proteins accumulated normally. 29 refs., 6 figs., 2 tabs.

  3. A longitudinal study of Vero cytotoxin producing Escherichia coli in cattle calves in Sri Lanka.

    PubMed Central

    Tokhi, A. M.; Peiris, J. S.; Scotland, S. M.; Willshaw, G. A.; Smith, H. R.; Cheasty, T.

    1993-01-01

    Two cohorts of 10 and 16 calves were followed at weekly or fortnightly intervals from 4-28 and 1-9 weeks respectively to determine whether natural infection by Vero cytotoxin (VT) producing Escherichia coli (VTEC) occurred. Ninety-one of 171 (53%) faecal specimens were VTEC positive and 20-80% of animals at any given time excreted VTEC. Of 104 VTEC strains studied further, 6 different serogroups (O 22.H16; O 25.H5; O 49.H-; O 86.H26; O 88.H25; O 153.H12) and an untypable strain (O? .H21) were identified. All strains belonging to the same serotype had identical profiles of reactivity with DNA probes to toxins VT1 or 2, LTI or II and a probe (CVD419) derived from a plasmid carried by enterohaemorrhagic Escherichia coli O 157.H7. Four of these serotypes were found in the faecal flora of the calves, taken as a group, throughout the 4-month study period. Sixty percent of the strains hybridized with the probe for VT1, 4% with the probe for VT2, and 36% with both probes. Faecal VTEC were significantly associated with overt diarrhoeal illness in animals < 10 weeks of age, but no characteristic profile of markers (serotype or hybridization pattern) in E. coli isolates was associated with diarrhoea. A serological response to VT1 was detected in some animals, but faecal VT1 VTEC excretion persisted in spite of seroconversion. VT1 seroconversion was not associated with diarrhoea. A serological response to VT2 was not detected even in those animals excreting VT2 VTEC in the faeces. PMID:8472764

  4. Properties of Retinal Precursor Cells Grown on Vertically Aligned Multiwalled Carbon Nanotubes Generated for the Modification of Retinal Implant-Embedded Microelectrode Arrays.

    PubMed

    Johnen, Sandra; Meißner, Frank; Krug, Mario; Baltz, Thomas; Endler, Ingolf; Mokwa, Wilfried; Walter, Peter

    2016-01-01

    Background. To analyze the biocompatibility of vertically aligned multiwalled carbon nanotubes (MWCNT), used as nanomodification to optimize the properties of prostheses-embedded microelectrodes that induce electrical stimulation of surviving retinal cells. Methods. MWCNT were synthesized on silicon wafers. Their growth was achieved by iron particles (Fe) or mixtures of iron-platinum (Fe-Pt) and iron-titanium (Fe-Ti) acting as catalysts. Viability, growth, adhesion, and gene expression of L-929 and retinal precursor (R28) cells were analyzed after nondirect and direct contact. Results. Nondirect contact had almost no influence on cell growth, as measured in comparison to reference materials with defined levels of cytotoxicity. Both cell types exhibited good proliferation properties on each MWCNT-coated wafer. Viability ranged from 95.9 to 99.8%, in which better survival was observed for nonfunctionalized MWCNT generated with the Fe-Pt and Fe-Ti catalyst mixtures. R28 cells grown on the MWCNT-coated wafers showed a decreased gene expression associated with neural and glial properties. Expression of the cell cycle-related genes CCNC, MYC, and TP53 was slightly downregulated. Cultivation on plasma-treated MWCNT did not lead to additional changes. Conclusions. All tested MWCNT-covered slices showed good biocompatibility profiles, confirming that this nanotechnology is a promising tool to improve prostheses bearing electrodes which connect with retinal tissue. PMID:27200182

  5. Properties of Retinal Precursor Cells Grown on Vertically Aligned Multiwalled Carbon Nanotubes Generated for the Modification of Retinal Implant-Embedded Microelectrode Arrays

    PubMed Central

    Johnen, Sandra; Meißner, Frank; Krug, Mario; Baltz, Thomas; Endler, Ingolf; Mokwa, Wilfried; Walter, Peter

    2016-01-01

    Background. To analyze the biocompatibility of vertically aligned multiwalled carbon nanotubes (MWCNT), used as nanomodification to optimize the properties of prostheses-embedded microelectrodes that induce electrical stimulation of surviving retinal cells. Methods. MWCNT were synthesized on silicon wafers. Their growth was achieved by iron particles (Fe) or mixtures of iron-platinum (Fe-Pt) and iron-titanium (Fe-Ti) acting as catalysts. Viability, growth, adhesion, and gene expression of L-929 and retinal precursor (R28) cells were analyzed after nondirect and direct contact. Results. Nondirect contact had almost no influence on cell growth, as measured in comparison to reference materials with defined levels of cytotoxicity. Both cell types exhibited good proliferation properties on each MWCNT-coated wafer. Viability ranged from 95.9 to 99.8%, in which better survival was observed for nonfunctionalized MWCNT generated with the Fe-Pt and Fe-Ti catalyst mixtures. R28 cells grown on the MWCNT-coated wafers showed a decreased gene expression associated with neural and glial properties. Expression of the cell cycle-related genes CCNC, MYC, and TP53 was slightly downregulated. Cultivation on plasma-treated MWCNT did not lead to additional changes. Conclusions. All tested MWCNT-covered slices showed good biocompatibility profiles, confirming that this nanotechnology is a promising tool to improve prostheses bearing electrodes which connect with retinal tissue. PMID:27200182

  6. Development of an IR-transparent, inverted-grown, thin-film, Al[sub 0. 34]Ga[sub 0. 66]As/GaAs cascade solar cell

    SciTech Connect

    Venkatasubramanian, R.; Timmons, M.L.; Sharps, P.R.; Colpitts, T.S.; Hills, J.S.; Hancock, J.; Hutchby, J.A. )

    1992-12-01

    Inverted growth and the development of associated cell processing, are likely to offer a significant degree of freedom for improving the performance of many III-V multijunction cascades and open new avenues for advanced multijunction concepts. This is especially true for the development of high-efficiency Al[sub 0.37]Ga[sub 0.63]As/GaAs cascades where the high growth temperatures required for the AlGaAs top cell growth can cause the deterioration of the tunnel junction interconnect. In the approach of inverted-grown AlGaAs/GaAs cascade cells, the AlGaAs top cell is grown first at 780 [degree]C and the GaAs tunnel junction and bottom cell are grown at 675 [degree]C. After the inverted growth, the AlGaAs/GaAs cascade structure is selectively removed from the parent substrate. The feasibility of inverted growth is demonstrated by a fully-processed, inverted-grown, thin film GaAs cell with a 1-sun AM1.5 efficiency of 20.3%. Also, an inverted-grown, thin-film, Al[sub 0.34]Ga[sub 0.66]As/GaAs cascade with AM1.5 efficiencies of 19.9% and 21% at 1-sun and 7-suns, respectively, has been obtained.

  7. GROWTH CHARACTERISTICS, MORPHOLOGY, AND PHOSPHOLIPID COMPOSITION OF HUMAN TYPE 2 PULMONARY ALVEOLAR CELLS GROWN IN A COLLAGEN-FREE MICROENVIRONMENT

    EPA Science Inventory

    Human lung epithelial cells have been cultured and characterized for phospholipid content. Any residual fibroblasts were removed by selective trypsinization within the first 48 hours in culture. Epithelial cells were serially subpassaged when cultures reached ca. 80% confluency. ...

  8. Factors derived from Escherichia coli Nissle 1917, grown in different growth media, enhance cell death in a model of 5-fluorouracil-induced Caco-2 intestinal epithelial cell damage.

    PubMed

    Wang, Hanru; Bastian, Susan E P; Lawrence, Andrew; Howarth, Gordon S

    2015-01-01

    We evaluated supernatants (SNs) from Escherichia coli Nissle 1917 (EcN) grown in commonly used growth media for their capacity to affect the viability of Caco-2 colon cancer cells in the presence and absence of 5-Fluorouracil (5-FU) chemotherapy. EcN was grown in Luria-Bertani (LB), tryptone soya (TSB), Man Rogosa Sharpe (MRS), and M17 broth supplemented with 10% (v/v) lactose solution (M17). Human Caco-2 colon cancer cells were treated with DMEM (control), growth media alone (LB, TSB, MRS, and M17) or EcN SNs derived from these 4 media, in the presence and absence of 5-FU. Cell viability, reactive oxygen species (ROS), and cell monolayer permeability were determined. EcN SN in LB medium reduced Caco-2 cell viability significantly, to 51% at 48 h. The combination of this EcN SN and 5-FU further reduced cell viability to 37% at 48 h, compared to 5-FU control. MRS broth and EcN SN in MRS, together with 5-FU, generated significantly lower levels of ROS compared to 5-FU control. However, all 5-FU treatments significantly disrupted the Caco-2 cell barrier compared to control; with no significant differences observed among any of the 5-FU treatments. EcN SNs (LB+) was most effective at decreasing the viability of Caco-2 cells. This could indicate a potential role for this EcN SN in chemoprevention for colon cancer. PMID:25625670

  9. Aromatase in the human choriocarcinoma JEG-3: inhibition by R 76 713 in cultured cells and in tumors grown in nude mice.

    PubMed

    Krekels, M D; Wouters, W; De Coster, R; Van Ginckel, R; Leonaers, A; Janssen, P A

    1991-04-01

    The aromatase enzyme and its inhibition by R 76 713 were characterized in the JEG-3 choriocarcinoma cell line in culture and in JEG-3 tumors grown in nude mice. Optimal cell culture parameters and enzyme reaction conditions for the determination of aromatase activity were established. Under these conditions, in vitro JEG-3 aromatase was inhibited by R 76 713 with IC50-values of 7.6 +/- 0.5 nM and 2.7 +/- 1.1 nM using 500 nM of androstenedione and testosterone as substrate respectively. The Km-value of the aromatase enzyme with androstenedione as substrate was 62 +/- 19 nM; with testosterone as substrate, a value of 166 +/- 27 nM was found. In the presence of increasing concentrations of R 76 713, the Km-values increased while the Vmax remained unchanged. Using androstenedione and testosterone as substrate Lineweaver-Burk analysis of the data showed Ki-values for R 76 713 of 0.43 +/- 0.06 nM and 0.47 +/- 0.39 nM respectively. R 76 713 appeared to competitively inhibit the JEG-3 aromatase. Aromatase could easily be measured in homogenates of JEG-3 tumors grown in nude mice and showed Km-values similar to those found for JEG-3 cells in vitro. IC50-values for inhibition of tumor aromatase by R 76 713 were also similar to those found in cultured cells. Tumor aromatase measured ex vivo, 2 h after a single oral administration of R 76 713 was dose-dependently inhibited. An ED50-value of 0.05 mg/kg was calculated. The JEG-3 choriocarcinoma proved to be a useful aromatase model enabling the comparative study of aromatase inhibition in vitro and in vivo. PMID:2031856

  10. Cell wall changes in nisin-resistant variants of Listeria innocua grown in the presence of high nisin concentrations.

    PubMed

    Maisnier-Patin, S; Richard, J

    1996-06-15

    Two nisin-resistant variants of a strain of Listeria innocua were isolated after growth in the presence of 500 and 4000 IU ml-1 of nisin A showed increased cell wall hydrophobicity, resistance to phage attack and three different cell wall-acting antibiotics, as well as to the peptidoglycan hydrolytic enzymes lysozyme and mutanolysin, as compared to the parental strain. Transmission electron microscopy revealed marked thickening of the wall of nisin-resistant cells with an irregular surface. Differences in thickness were lost after cell wall purification and no significant difference in gross wall composition was observed between the parental and resistant variants. Cell wall changes in nisin-resistant listeriae are attributed to abnormal cell wall synthesis and autolysin inhibition, the latter possibly associated with subtle changes in cell wall structures and function. PMID:8666198

  11. Effect of temperature and pH on ethanol production by free and immobilized cells of Kluyveromyces marxianus grown on Jerusalem artichoke extract

    SciTech Connect

    Bajpai, P.; Margaritis, A.

    1987-01-01

    The effect of temperature and pH on the kinetics of ethanol production by free and calcium alginate immobilized cells of Kluyveromyces marxianus grown on Jerusalem artichoke extract was investigated. With the free cells, the ethanol and biomass yields were relatively constant over the temperature range 25-35 degrees C, but dropped sharply beyond 35 degrees C. Other kinetic parameters, specific growth rate, specific ethanol production rate, and specific total sugar uptake rate were maximum at 35 degrees C. However, with the immobilized cells, ethanol yield remained almost constant in the temperatue range 25-45 degrees C, and the specific ethanol production rate and specific total sugar uptake rate attained their maximum values at 40 degrees C. For the pH range between 3 and 7, the free-cell optimum for growth and product formation was found to be circa pH 5. At this pH, the specific growth rate was 0.35/h and specific ethanol production rate was 2.83 g/g/h. At values higher or lower than pH 5, a sharp decrease in specific ethanol production rate as well as specific growth rate was observed. In comparison, the immobilized cells showed a broad optimum pH profile. The best ethanol production rates were observed between pH 4 and 6. (Refs. 22).

  12. Structural Complexity of Non-acid Glycosphingolipids in Human Embryonic Stem Cells Grown under Feeder-free Conditions*

    PubMed Central

    Barone, Angela; Benktander, John; Ångström, Jonas; Aspegren, Anders; Björquist, Petter; Teneberg, Susann; Breimer, Michael. E.

    2013-01-01

    Due to their pluripotency and growth capability, there are great expectations for human embryonic stem cells, both as a resource for functional studies of early human development and as a renewable source of cells for use in regenerative medicine and transplantation. However, to bring human embryonic stem cells into clinical applications, their cell surface antigen expression and its chemical structural complexity have to be defined. In the present study, total non-acid glycosphingolipid fractions were isolated from two human embryonic stem cell lines (SA121 and SA181) originating from leftover in vitro fertilized human embryos, using large amounts of starting material (1 × 109 cells/cell line). The total non-acid glycosphingolipid fractions were characterized by antibody and lectin binding, mass spectrometry, and proton NMR. In addition to the globo-series and type 1 core chain glycosphingolipids previously described in human embryonic stem cells, a number of type 2 core chain glycosphingolipids (neo-lactotetraosylceramide, the H type 2 pentaosylceramide, the Lex pentaosylceramide, and the Ley hexaosylceramide) were identified as well as the blood group A type 1 hexaosylceramide. Finally, the mono-, di-, and triglycosylceramides were characterized as galactosylceramide, glucosylceramide, lactosylceramide, galabiaosylceramide, globotriaosylceramide, and lactotriaosylceramide. Thus, the glycan diversity of human embryonic stem cells, including cell surface immune determinants, is more complex than previously appreciated. PMID:23404501

  13. Elastic hydrogel as a sensor for detection of mechanical stress generated by single cells grown in three-dimensional environment.

    PubMed

    Huang, Jianyong; Wang, Liangli; Xiong, Chunyang; Yuan, Fan

    2016-08-01

    Cell volume growth occurs in all living tissues. The growth exerts mechanical stresses on surrounding tissues that may alter tissue microenvironment, and have significant implications in health and diseases. However, the level of growth stress generated by single cells in three-dimensional (3D) environment remains to be determined. To this end, we developed a growth force microscopy technique to determine 3D distribution of the stress. The technique was based on encapsulation of cells in elastic hydrogels, and involved 3D particle tracking and mechanical analysis of gel deformation. Data from the study demonstrated that the growth stress was dynamic, and the stress distribution at the gel-cell interface was correlated inversely to the mean surface curvature or the distance to the geometric center of the cell. The stress averaged over the cell surface increased with increasing gel stiffness, suggesting that cells could alter growth stress in response to stiffness change in microenvironment. These findings suggested that the elastic hydrogel-based microscopy technique had a potential to provide new insights into mechanisms of mechanical interactions between cell and its microenvironment. PMID:27182812

  14. Lipid content and fatty acid composition of green algae Scenedesmus obliquus grown in a constant cell density apparatus

    NASA Technical Reports Server (NTRS)

    Choi, K. J.; Nakhost, Z.; Barzana, E.; Karel, M.

    1987-01-01

    The lipids of alga Scenedesmus obliquus grown under controlled conditions were separated and fractionated by column and thin-layer chromatography, and fatty acid composition of each lipid component was studied by gas-liquid chromatography (GLC). Total lipids were 11.17%, and neutral lipid, glycolipid and phospholipid fractions were 7.24%, 2.45% and 1.48% on a dry weight basis, respectively. The major neutral lipids were diglycerides, triglycerides, free sterols, hydrocarbons and sterol esters. The glycolipids were: monogalactosyl diglyceride, digalactosyl diglyceride, esterified sterol glycoside, and sterol glycoside. The phospholipids included: phosphatidyl choline, phosphatidyl glycerol and phosphatidyl ethanolamine. Fourteen fatty acids were identified in the four lipid fractions by GLC. The main fatty acids were C18:2, C16:0, C18:3(alpha), C18:1, C16:3, C16:1, and C16:4. Total unsaturated fatty acid and essential fatty acid compositions of the total algal lipids were 80% and 38%, respectively.

  15. Improved Performance of GaInNAs Solar Cells Grown by Molecular-Beam Epitaxy Using Increased Growth Rate Instead of Surfactants

    SciTech Connect

    Ptak, A. J.; France, R.; Jiang, C. S.; Romero, M. J.

    2009-01-01

    GaInNAs is potentially useful for increasing the conversion efficiency of multijunction solar cells if low photocurrents and photovoltages can be increased. Wide-depletion width devices generate significant photocurrents using an n-i-p structure grown by molecular-beam epitaxy, but these wide depletion widths are only realized in a region of parameter space that leads to rough surface morphologies. Surfactants are effective at reducing the surface roughness, but lead to increased defect densities and changes in the net acceptor or donor concentration. Here, we show that increasing the growth rate of GaInNAs solar cells leads to smooth surfaces without the use of a surfactant, even at high In compositions and substrate temperatures. No degradation in material quality is observed when increasing the growth rate from 1.5 to 3.0 {micro}m/h, but a shunt resistance does appear for the high-growth-rate samples. This shunt is attributed to increased spitting of the Ga cell, leading to an increase in the oval defect density, at the higher effusion cell temperatures used to achieve high growth rates. As with the case of Bi in GaInNAs, increased growth rates also appear to increase the net donor concentration, but it is not clear if these effects have the same cause.

  16. Human RPE Stem Cells Grown into Polarized RPE Monolayers on a Polyester Matrix Are Maintained after Grafting into Rabbit Subretinal Space

    PubMed Central

    Stanzel, Boris V.; Liu, Zengping; Somboonthanakij, Sudawadee; Wongsawad, Warapat; Brinken, Ralf; Eter, Nicole; Corneo, Barbara; Holz, Frank G.; Temple, Sally; Stern, Jeffrey H.; Blenkinsop, Timothy A.

    2014-01-01

    Summary Transplantation of the retinal pigment epithelium (RPE) is being developed as a cell-replacement therapy for age-related macular degeneration. Human embryonic stem cell (hESC) and induced pluripotent stem cell (iPSC)-derived RPE are currently translating toward clinic. We introduce the adult human RPE stem cell (hRPESC) as an alternative RPE source. Polarized monolayers of adult hRPESC-derived RPE grown on polyester (PET) membranes had near-native characteristics. Trephined pieces of RPE monolayers on PET were transplanted subretinally in the rabbit, a large-eyed animal model. After 4 days, retinal edema was observed above the implant, detected by spectral domain optical coherence tomography (SD-OCT) and fundoscopy. At 1 week, retinal atrophy overlying the fetal or adult transplant was observed, remaining stable thereafter. Histology obtained 4 weeks after implantation confirmed a continuous polarized human RPE monolayer on PET. Taken together, the xeno-RPE survived with retained characteristics in the subretinal space. These experiments support that adult hRPESC-derived RPE are a potential source for transplantation therapies. PMID:24511471

  17. Failure of propagation of human norovirus in intestinal epithelial cells with microvilli grown in three-dimensional cultures

    PubMed Central

    Takanashi, Sayaka; Saif, Linda J.; Hughes, John H.; Meulia, Tea; Jung, Kwonil; Scheuer, Kelly A.; Wang, Qiuhong

    2013-01-01

    Human noroviruses (HuNoVs) are a leading cause of acute gastroenteritis. Establishment of a cell culture system for in vitro HuNoV growth remains challenging. Replication of HuNoVs in human intestinal cell lines (INT-407 and Caco-2) that differentiate to produce microvilli in rotation wall vessel (RWV) three-dimensional cultures has been reported (Straub et al., Emerg Infect Dis 13:396–403 2007, J Water Health 9:225–240 2011, and Water Sci Technol 67:863–868 2013). We used a similar RWV system, intestinal cell lines, and the same (Genogroup [G] I.1) plus additional (GII.4 and GII.12) HuNoV strains to test the system’s reproducibility and to expand the earlier findings. Apical microvilli were observed on the surface of both cell lines by light and electron microscopy. However, none of the cell types tested resulted in productive viral replication of any of the HuNoV strains, as confirmed by plateau or declining viral RNA titers in the supernatants and cell lysates of HuNoV-infected cells, determined by real-time reverse transcription PCR. These trends were the same when culture supplements were added that have been reported to be effective for replication of other fastidious enteric viruses in vitro. Additionally, by confocal microscopy and orthoslice analysis, viral capsid proteins were mainly observed above the actin filament signals, which suggested that the majority of viral antigens were on the cell surface. We conclude that even intestinal cells displaying microvilli were not sufficient to support HuNoV replication under the conditions tested. PMID:23974469

  18. Stability of single and tandem junction a-Si:H solar cells grown using the ECR process

    SciTech Connect

    Dalal, V.L.; Maxson, T.; Girvan, R.; Haroon, S.

    1997-07-01

    The authors report on the fabrication and stability tests of single junction a-Si:H, and tandem junction a-Si:H/A-Si:H solar cells using the ECR process under high hydrogen dilution (H-ECR process). They show that devices with high fill factors can be made using the H-ECR process. They also report on the stability studies of the solar cells under 1 and 2-sun illumination conditions. The solar cells show very little degradation even after 500 hours of illumination under 2 x sunlight illumination.

  19. The light intensity under which cells are grown controls the type of peripheral light-harvesting complexes that are assembled in a purple photosynthetic bacterium

    SciTech Connect

    Brotosudarmo, Tatas H. P.; Collins, Aaron M.; Gall, Andrew; Roszak, Aleksander W.; Gardiner, Alastair T.; Blankenship, Robert E.; Cogdell, Richard J.

    2011-11-15

    The differing composition of LH2 (peripheral light-harvesting) complexes present in Rhodopseudomonas palustris 2.1.6 have been investigated when cells are grown under progressively decreasing light intensity. Analysis of the absorption spectra reveals there must be more than two types of LH2 complexes present. Purified HL (high-light) and LL (low-light) LH2 complexes have mixed apoprotein compositions. The HL complexes contain PucABa and PucABb apoproteins. The LL complexes contain PucABa, PucABd and PucBb-only apoproteins. This mixed apoprotein composition can explain their resonance Raman spectra.

  20. Differences in excitation energy transfer of Arthrospira platensis cells grown in seawater medium and freshwater medium, probed by time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Arba, Muhammad; Aikawa, Shimpei; Niki, Kenta; Yokono, Makio; Kondo, Akihiko; Akimoto, Seiji

    2013-11-01

    Excitation energy transfer of Arthrospira platensis cells grown in f/2 medium (a high salinity medium) and SOT medium (a control) was investigated by steady-state and time-resolved spectroscopies. Growth in f/2 medium induced changes in absorption and fluorescence spectra as well as in the energy transfer pathways. Excitation energy captured by phycobilisome (PBS) was transferred directly to photosystem (PS) I, instead of being first transferred to an intermediate (PBS → PSII → PSI), as observed in SOT medium. The respiration rate increased while photosynthetic rate reduced in f/2 medium. Possible causes of the differences in light-harvesting and energy-transfer processes between the two media are discussed.

  1. Inactivated rabies vaccine produced from the Flury LEP strain of virus grown in BHK-21 suspension cells.

    PubMed

    Chapman, W G; Ramshaw, I A; Crick, J

    1973-12-01

    Suspension cultures of BHK-21 cells maintained at 32 to 33 C were infected with the Flury LEP strain of rabies virus. By using a cell concentration of 2.0 x 10(6) to 2.5 x 10(6) cells per ml infected at a multiplicity of 0.05, high titers of extracellular virus were reached in 96 to 120 h, and potent inactivated vaccines were prepared from culture fluids harvested between 96 to 168 h. The addition of 1% bovine serum to the maintenance medium resulted in an increase in virus yields and vaccine potency. Estimation of the number of infected cells by immunofluorescent procedures proved a rapid and reliable guide to the virus content of suspension cultures. PMID:4588193

  2. Differences In Early T-Cell Signaling In Cultures Grown In a Rotating Clinostat vs. Static Controls

    NASA Technical Reports Server (NTRS)

    Alexamder. M.; Nelman-Gonzales, M.; Penkala, J.; Sams, C.

    1999-01-01

    Altered gravity has previously been demonstrated to be a stress that can influence components of the immune system. Specifically, T-cell activation has been shown to be affected by changes in gravity, exhibiting a decrease in proliferative response to in vitro stimulation in microgravity. Subsequent ground based studies utilizing a rotating clinostat to model some of the effects of microgravity have been consistent with earlier flight based experiments. These ground and flight experiments have examined T-cell activation by measuring various responses including production of cytokines, DNA synthesis and the production of various cell surface activation markers. These indicators of T-cell activation were measured anywhere from 4 to 72 hours after stimulation. Prior to the work described here, the initial signaling events in T-cell activation had not been directly examined. The goal of this project was to determine how the process of early signal transduction was affected by growth in a rotating clinostat. Here we directly show a defect in signaling from TCR to MAPK in purified peripheral T-cells activated in the clinostat by OKT3/antiCD28 coated microbeads as compared to static controls.

  3. The polyGeVero® software for fast and easy computation of 3D radiotherapy dosimetry data

    NASA Astrophysics Data System (ADS)

    Kozicki, Marek; Maras, Piotr

    2015-01-01

    The polyGeVero® software package was elaborated for calculations of 3D dosimetry data such as the polymer gel dosimetry. It comprises four workspaces designed for: i) calculating calibrations, ii) storing calibrations in a database, iii) calculating dose distribution 3D cubes, iv) comparing two datasets e.g. a measured one with a 3D dosimetry with a calculated one with the aid of a treatment planning system. To accomplish calculations the software was equipped with a number of tools such as the brachytherapy isotopes database, brachytherapy dose versus distance calculation based on the line approximation approach, automatic spatial alignment of two 3D dose cubes for comparison purposes, 3D gamma index, 3D gamma angle, 3D dose difference, Pearson's coefficient, histograms calculations, isodoses superimposition for two datasets, and profiles calculations in any desired direction. This communication is to briefly present the main functions of the software and report on the speed of calculations performed by polyGeVero®.

  4. Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture

    NASA Technical Reports Server (NTRS)

    Gruener, R.; Hoeger, G.

    1988-01-01

    Cocultured Xenopus neurons and myocytes were subjected to non-vectorial gravity by clinostat rotation to determine if microgravity, during space flights, may affect cell development and communications. Clinorotated cells showed changes consistent with the hypothesis that cell differentiation, in microgravity, is altered by interference with cytoskeleton-related mechanisms. We found: increases in the myocyte and its nuclear area, "fragmentation" of nucleoli, appearance of neuritic "aneurysms", decreased growth in the presence of "trophic" factors, and decreased yolk utilization. The effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. Some parameters returned to near control values within 48 hrs after cessation of rotation. Cells from cultures rotated at higher speeds (>50 rpm) appeared comparable to controls. Compensation by centrifugal forces may account for this finding. Our data are consistent, in principle, with effects on other, flighted cells and suggest that "vector-free" gravity may simulate certain aspects of microgravity. The distribution of acetylcholine receptor aggregates, on myocytes, was also altered. This indicates that brain development, in microgravity, may also be affected.

  5. Comparison of single junction AlGaInP and GaInP solar cells grown by molecular beam epitaxy

    SciTech Connect

    Masuda, Taizo Tomasulo, Stephanie; Lang, Jordan R.; Lee, Minjoo Larry

    2015-03-07

    We have investigated ∼2.0 eV (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P and ∼1.9 eV Ga{sub 0.51}In{sub 0.49}P single junction solar cells grown on both on-axis and misoriented GaAs substrates by molecular beam epitaxy (MBE). Although lattice-matched (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P solar cells are highly attractive for space and concentrator photovoltaics, there have been few reports on the MBE growth of such cells. In this work, we demonstrate open circuit voltages (V{sub oc}) ranging from 1.29 to 1.30 V for Ga{sub 0.51}In{sub 0.49}P cells, and 1.35–1.37 V for (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells. Growth on misoriented substrates enabled the bandgap-voltage offset (W{sub oc} = E{sub g}/q − V{sub oc}) of Ga{sub 0.51}In{sub 0.49}P cells to decrease from ∼575 mV to ∼565 mV, while that of (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells remained nearly constant at 620 mV. The constant W{sub oc} as a function of substrate offcut for (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P implies greater losses from non-radiative recombination compared with the Ga{sub 0.51}In{sub 0.49}P devices. In addition to larger W{sub oc} values, the (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P cells exhibited significantly lower internal quantum efficiency (IQE) values than Ga{sub 0.51}In{sub 0.49}P cells due to recombination at the emitter/window layer interface. A thin emitter design is experimentally shown to be highly effective in improving IQE, particularly at short wavelengths. Our work shows that with further optimization of both cell structure and growth conditions, MBE-grown (Al{sub x}Ga{sub 1−x}){sub 0.51}In{sub 0.49}P will be a promising wide-bandgap candidate material for high-efficiency, lattice-matched multi-junction solar cells.

  6. Maslinic Acid, a Triterpene from Olive, Affects the Antioxidant and Mitochondrial Status of B16F10 Melanoma Cells Grown under Stressful Conditions

    PubMed Central

    Mokhtari, Khalida; Rufino-Palomares, Eva E.; Pérez-Jiménez, Amalia; Reyes-Zurita, Fernando J.; Figuera, Celeny; García-Salguero, Leticia; Medina, Pedro P.; Peragón, Juan; Lupiáñez, José A.

    2015-01-01

    Maslinic acid (MA) is a natural compound whose structure corresponds to a pentacyclic triterpene. It is abundant in the cuticular lipid layer of olives. MA has many biological and therapeutic properties related to health, including antitumor, anti-inflammatory, antimicrobial, antiparasitic, antihypertensive, and antioxidant activities. However, no studies have been performed to understand the molecular mechanism induced by this compound in melanoma cancer. The objective of this study was to examine the effect of MA in melanoma (B16F10) cells grown in the presence or absence of fetal bovine serum (FBS). We performed cell proliferation measurements, and the reactive oxygen species (ROS) measurements using dihydrorhodamine 123 (DHR 123) and activities of catalase, glucose 6-phosphate dehydrogenase, glutathione S-transferase, and superoxide dismutase. These changes were corroborated by expression assays. FBS absence reduced cell viability decreasing IC50 values of MA. The DHR 123 data showed an increase in the ROS level in the absence of FBS. Furthermore, MA had an antioxidant effect at lower assayed levels measured as DHR and antioxidant defense. However, at higher dosages MA induced cellular damage by apoptosis as seen in the results obtained. PMID:26236377

  7. Maslinic Acid, a Triterpene from Olive, Affects the Antioxidant and Mitochondrial Status of B16F10 Melanoma Cells Grown under Stressful Conditions.

    PubMed

    Mokhtari, Khalida; Rufino-Palomares, Eva E; Pérez-Jiménez, Amalia; Reyes-Zurita, Fernando J; Figuera, Celeny; García-Salguero, Leticia; Medina, Pedro P; Peragón, Juan; Lupiáñez, José A

    2015-01-01

    Maslinic acid (MA) is a natural compound whose structure corresponds to a pentacyclic triterpene. It is abundant in the cuticular lipid layer of olives. MA has many biological and therapeutic properties related to health, including antitumor, anti-inflammatory, antimicrobial, antiparasitic, antihypertensive, and antioxidant activities. However, no studies have been performed to understand the molecular mechanism induced by this compound in melanoma cancer. The objective of this study was to examine the effect of MA in melanoma (B16F10) cells grown in the presence or absence of fetal bovine serum (FBS). We performed cell proliferation measurements, and the reactive oxygen species (ROS) measurements using dihydrorhodamine 123 (DHR 123) and activities of catalase, glucose 6-phosphate dehydrogenase, glutathione S-transferase, and superoxide dismutase. These changes were corroborated by expression assays. FBS absence reduced cell viability decreasing IC50 values of MA. The DHR 123 data showed an increase in the ROS level in the absence of FBS. Furthermore, MA had an antioxidant effect at lower assayed levels measured as DHR and antioxidant defense. However, at higher dosages MA induced cellular damage by apoptosis as seen in the results obtained. PMID:26236377

  8. Comparison of IgG diffusion and extracellular matrix composition in rhabdomyosarcomas grown in mice versus in vitro as spheroids reveals the role of host stromal cells

    PubMed Central

    Davies, C de L; Berk, D A; Pluen, A; Jain, R K

    2002-01-01

    The tumour extracellular matrix acts as a barrier to the delivery of therapeutic agents. To test the hypothesis that extracellular matrix composition governs the penetration rate of macromolecules in tumour tissue, we measured the diffusion coefficient of nonspecific IgG in three rhabdomyosarcoma subclones growing as multicellular spheroids in vitro or as subcutaneous tumours in dorsal windows in vivo. In subcutaneous tumours, the diffusion coefficient decreased with increasing content of collagen and sulphated glycosaminoglycans. When grown as multicellular spheroids, no differences in either extracellular matrix composition or diffusion coefficient were found. Comparison of in vitro vs in vivo results suggests an over-riding role of host stromal cells in extracellular matrix production subjected to modulation by tumour cells. Penetration of therapeutic macromolecules through tumour extracellular matrix might thus be largely determined by the host organ. Hence, caution must be exercised in extrapolating drug penetrability from spheroids and multilayer cellular sandwiches consisting of only tumour cells to tumours in vivo. British Journal of Cancer (2002) 86, 1639–1644. DOI: 10.1038/sj/bjc/6600270 www.bjcancer.com © 2002 Cancer Research UK PMID:12085216

  9. High-Quality Perovskite Films Grown with a Fast Solvent-Assisted Molecule Inserting Strategy for Highly Efficient and Stable Solar Cells.

    PubMed

    Yuan, Shuai; Qiu, Zhiwen; Gao, Chaomin; Zhang, Hailiang; Jiang, Yanan; Li, Cuncheng; Yu, Jinghua; Cao, Bingqiang

    2016-08-31

    The performance of organolead halide perovskites based solar cells has been enhanced dramatically due to the morphology control of the perovskite films. In this paper, we present a fast solvent-assisted molecule inserting (S-AMI) strategy to grow high-quality perovskite film, in which the methylammonium iodide/2-propanol (MAI/IPA) solution is spin-coated onto a dimethylformamide (DMF) wetted mixed lead halide (PbX2) precursor film. The DMF can help the inserting of MAI molecules into the PbX2 precursor film and provide a solvent environment to help the grain growth of the perovskite film. The perovskite film grown by the S-AMI approach shows large and well-oriented grains and long carrier lifetime due to the reduced grain boundary. Solar cells constructed with these perovskite films yield an average efficiency over 17% along with a high average fill factor of 80%. Moreover, these unsealed solar cell devices exhibit good stability in an ambient atmosphere. PMID:27526617

  10. High-efficiency Al sub 0. 22 Ga sub 0. 78 As solar cells grown by molecular beam epitaxy

    SciTech Connect

    Melloch, M.R. ); Tobin, S.P.; Bajgar, C. ); Keshavarzi, A.; Stellwag, T.B.; Lush, G.B.; Lundstrom, M.S. ); Emery, K. )

    1990-07-02

    The quality of {ital pn} junction photodetectors made of Al{sub 0.2}Ga{sub 0.8}As has been investigated as a first step in the optimization of tandem solar cells. We have obtained 1 sun AM1.5 efficiencies of 16.1% for 0.25 cm{sup 2} Al{sub 0.22}Ga{sub 0.78}As solar cells fabricated from molecular beam epitaxy (MBE) material. This efficiency is 3.2 percentage points higher than the previously best reported efficiency of 12.9% for an Al{sub 0.2}Ga{sub 0.8}As solar cell fabricated from MBE material.

  11. Hap4p overexpression in glucose-grown Saccharomyces cerevisiae induces cells to enter a novel metabolic state

    PubMed Central

    Lascaris, Romeo; Bussemaker, Harmen J; Boorsma, André; Piper, Matt; van der Spek, Hans; Grivell, Les; Blom, Jolanda

    2003-01-01

    Background Metabolic and regulatory gene networks generally tend to be stable. However, we have recently shown that overexpression of the transcriptional activator Hap4p in yeast causes cells to move to a state characterized by increased respiratory activity. To understand why overexpression of HAP4 is able to override the signals that normally result in glucose repression of mitochondrial function, we analyzed in detail the changes that occur in these cells. Results Whole-genome expression profiling and fingerprinting of the regulatory activity network show that HAP4 overexpression provokes changes that also occur during the diauxic shift. Overexpression of HAP4, however, primarily acts on mitochondrial function and biogenesis. In fact, a number of nuclear genes encoding mitochondrial proteins are induced to a greater extent than in cells that have passed through a normal diauxic shift: in addition to genes required for mitochondrial energy conservation they include genes encoding mitochondrial ribosomal proteins. Conclusions We show that overproduction of a single nuclear transcription factor enables cells to move to a novel state that displays features typical of, but clearly not identical to, other derepressed states. PMID:12537548

  12. Stem Cells Grown in Osteogenic Medium on PLGA, PLGA/HA, and Titanium Scaffolds for Surgical Applications

    PubMed Central

    Asti, Annalia; Gastaldi, Giulia; Dorati, Rossella; Saino, Enrica; Conti, Bice; Visai, Livia; Benazzo, Francesco

    2010-01-01

    Pluripotent adipose tissue-derived stem cells (hASCs) can differentiate into various mesodermal cell types such as osteoblasts, chondroblasts, and myoblasts. We isolated hASCs from subcutaneous adipose tissue during orthopaedic surgery and induced the osteogenic differentiation for 28 days on three different synthetic scaffolds such as polylactide-co-glycolide (PLGA), polylactide-co-glycolide/hydroxyapatite (PLGA/HA), and trabecular titanium scaffolds (Ti6Al4V). Pore size can influence certain criteria such as cell attachment, infiltration, and vascularization. The aim of this study was to investigate the performance of PLGA and PLGA/HA scaffolds with a higher porosity, ranging between 75% and 84%, with respect to Ti scaffolds but with smaller pore size, seeded with hASCs to develop a model that could be used in the treatment of bone defects and fractures. Osteogenesis was assessed by ELISA quantitation of extracellular matrix protein expression, von Kossa staining, X-ray microanalysis, and scanning electron microscopy. The higher amount of protein matrix on the Ti scaffold with respect to PLGA and PLGA/HA leads to the conclusion that not only the type of material but the structure significantly affects cell proliferation. PMID:21234383

  13. Role of surface-electrical properties on the cell-viability of carbon thin films grown in nanodomain morphology

    NASA Astrophysics Data System (ADS)

    Javid, Amjed; Kumar, Manish; Yoon, Seokyoung; Lee, Jung Heon; Tajima, Satomi; Hori, Masaru; Geon Han, Jeon

    2016-07-01

    Carbon thin films, having a combination of unique physical and chemical properties, exhibit an interesting biocompatibility and biological response to living entities. Here, the carbon films are developed in the morphology form of nano-domains with nanoscale inter-domain separations, tuned by plasma conditions in the facing target magnetron sputtering process. The wettability and surface energy are found to have a close relation to the inter-domain separations. The chemical structure of carbon films exhibited the relative enhancement of sp3 in comparison to sp2 with the increase of domain separations. The cell-viability of these films shows promising results for L929 mouse fibroblast and Saos-2 bone cells, when inter-domain separation is increased. Electrical conductivity and surface energy are identified to play the key role in different time-scales during the cell-proliferation process. The contribution from electrical conductivity is dominant in the beginning of the cultivation, whereas with the passage of time (~3–5 d) the surface energy takes control over conductivity to enhance the cell proliferation.

  14. GaInNAs/Ge (1.10/0.67 eV) double-junction solar cell grown by metalorganic chemical vapor deposition for high efficiency four-junction solar cell application

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaobin; Chen, Bingzhen; Pan, Xu; Wang, Lei; Ma, Difei; Zhang, Yang; Yang, Cuibai; Wang, Zhiyong

    2015-12-01

    GaInNAs materials with narrow bandgaps of 1.10 eV have been grown on a Ge substrate by metalorganic chemical vapor deposition to fabricate GaInNAs/Ge (1.10/0.67 eV) double-junction solar cells. We have studied the photovoltaic characteristics and the external quantum efficiencies of the double-junction cells with various annealing conditions and different GaInNAs base layer thicknesses. The best external quantum efficiency is obtained from the double-junction cell with a 1170 nm thick GaInNAs base layer annealed at 675 °C for 30 min. Under AM1.5G illumination, the best double-junction cell has a short circuit current density (J SC) as 23.63 mA cm-2, which is dominated by the J SC of the GaInNAs subcell.

  15. Development of high-bandgap AlGaInP solar cells grown by organometallic vapor-phase epitaxy

    DOE PAGESBeta

    Perl, Emmett E.; Simon, John; Geisz, John F.; Olavarria, Waldo; Young, Michelle; Duda, Anna; Friedman, Daniel J.; Steiner, Myles A.

    2016-03-29

    AlGaInP solar cells with bandgaps between 1.9 and 2.2 eV are investigated for use in next-generation multijunction photovoltaic devices. This quaternary alloy is of great importance to the development of III-V solar cells with five or more junctions and for cells optimized for operation at elevated temperatures because of the high bandgaps required in these designs. In this work, we explore the conditions for the organometallic vapor-phase epitaxy growth of AlGaInP and study their effects on cell performance. Initial efforts focused on developing ~2.0-eV AlGaInP solar cells with a nominal aluminum composition of 12%. Under the direct spectrum at 1000more » W/m2 (AM1.5D), the best of these samples had an open-circuit voltage of 1.59 V, a bandgap-voltage offset of 440 mV, a fill factor of 88.0%, and an efficiency of 14.8%. We then varied the aluminum composition of the alloy from 0% to 24% and were able to tune the bandgap of the AlGaInP layers from ~1.9 to ~2.2 eV. Furthermore, while the samples with a higher aluminum composition exhibited a reduced quantum efficiency and increased bandgap-voltage offset, the bandgap-voltage offset remained at 500 mV or less, up to a bandgap of ~2.1 eV.« less

  16. The effects of CdCl2 on the electronic properties of molecular-beam epitaxially grown CdTe/CdS heterojunction solar cells

    NASA Astrophysics Data System (ADS)

    Ringel, S. A.; Smith, A. W.; MacDougal, M. H.; Rohatgi, A.

    1991-07-01

    Significant improvements in CdTe/CdS solar cell efficiency are commonly observed as a result of a postdeposition CdCl2 dip followed by a 400 °C heat treatment during cell processing which increases CdTe grain size. In this paper, we investigate the electronic mechanisms responsible for CdCl2-induced improvement in cell performance along with possible performance-limiting defects resulting from this process in molecular-beam epitaxy-grown polycrystalline CdTe/CdS solar cells. Current density-voltage-temperature (J-V-T) analysis revealed that the CdCl2 treatment changes the dominant current transport mechanism from interface recombination/tunneling to depletion region recombination, suggesting a decrease in the density and dominance of interface states due to the CdCl2 treatment. It is shown that the change in transport mechanism is associated with (a) an increase in heterojunction barrier height from 0.56 to 0.85 eV, (b) a decrease in dark leakage current from 4.7×10-7 A/cm2 to 2.6×10-9 A/cm2 and, (c) an increase in cell Voc from 385 to 720 mV. The CdCl2 also improved the optical response of the cell. Substantial increases in the surface photovoltage and quantum efficiency accompanied by a decrease in the bias dependence of the spectral response in the CdCl2-treated structures indicate that the CdCl2 treatment improves carrier collection from the bulk as well as across the heterointerface. However, deep level transient spectroscopy measurements detected a hole trap within the CdTe depletion region of the CdCl2-treated devices at Ev + 0.64 eV which is attributed to the formation of VCd-related defects during the annealing process after the CdCl2 dip. J-V-T analysis demonstrated that this trap is the probable source of dominant recombination in the CdCl2-treated cells. An inverse correlation was found between the density of the Ev + 0.64 eV trap and cell Voc, suggesting that the heat treatment with CdCl2 may eventually limit the CdTe/CdS cell performance unless the

  17. Cell survival of glioblastoma grown in medium containing hydrogen peroxide and/or nitrite, or in plasma-activated medium.

    PubMed

    Kurake, Naoyuki; Tanaka, Hiromasa; Ishikawa, Kenji; Kondo, Takashi; Sekine, Makoto; Nakamura, Kae; Kajiyama, Hiroaki; Kikkawa, Fumitaka; Mizuno, Masaaki; Hori, Masaru

    2016-09-01

    Non-equilibrium atmospheric pressure plasmas generate a high electron density (on the order of 10(16) electrons per cm(-3)) using Ar gas. Culture medium in air at room temperature was plasma-irradiated for several hundred seconds. Tens of micromolar hydrogen peroxide (H2O2) and millimolar levels of nitrous ion (NO2(-)) were detected in the plasma-irradiated culture medium (plasma activated medium; PAM) and selectively induced the apoptotic death of glioblastoma tumor cells, but did not kill normal mammary epithelial cells. A similar antitumor effect was induced by spiking the medium with comparable concentrations of H2O2 and NO2(-). The PAM remained still a somewhat difference that it should also be assessed for understanding other latent mechanisms. PMID:26820218

  18. Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture

    NASA Technical Reports Server (NTRS)

    Gruener, Raphael; Hoeger, Glenn

    1988-01-01

    Cocultured Xenopus neurons and myocytes were subjected to nonvectorial gravity by clinostat rotation to determine the effects of microgravity on cell development and communications. Observed effects included increases in the myocyte and its nuclear area, fragmentation of nucleoli, the appearance of neuritic aneurysms, decreased growth in the presence of trophic factors, and decreased yolk utilization. These effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. It is found that, in microgravity, cell differentiation is altered by interference with cytoskeleton-related mechanisms. It is suggested that the alteration of the distribution of acetylcholine receptor aggregates on myocytes which occurs might indicate that microgravity affects brain development.

  19. Effect of Increasing Doses of γ-Radiation on Bone Marrow Stromal Cells Grown on Smooth and Rough Titanium Surfaces

    PubMed Central

    Huang, Bo; Guang, Mengkai; Ye, Jun; Gong, Ping; Tang, Hua

    2015-01-01

    Radiation therapy for oral and maxillofacial tumors could damage bone marrow stromal cells (BMSCs) in jaw, which caused dental implant failure. However, how radiation affects BMSCs on SLA (sandblasted with large-grits, acid-etched) surfaces is still unknown. The aim of this study was to investigate effect of different dose of γ-radiation on BMSCs on SLA and PT (polished titanium) surfaces. Rat BMSCs were radiated with 2, 4, and 8 Gy γ-radiation and then seeded on both surfaces. Cell adhesion, spreading, and proliferation were tested. The osteogenesis and the adipogenesis ability were examined by Alizarin-Red and Oil-Red staining, respectively. Real-time PCR was performed to detect osteogenic (osteocalcin, OCN; runt-related transcription factor 2, Runx2) and adipogenic (peroxisome proliferator-activated receptor gamma, PPARγ) gene expression at days 7 and 14 postirradiation. Results showed that γ-radiation reduced cell proliferation, adhesion, spreading, and osteogenic differentiation. 2 Gy radiation promoted adipogenic differentiation, but it was significantly decreased when dosage reached 4 Gy. In conclusion, results suggest that γ-radiation influenced BMSCs behaviors in a dosage-dependent manner except adipogenic differentiation, low dose promoted it, and high dose inhibited it. This effect was influenced by surface characteristics, which may explain the different failure rate of various implants in patients after radiation. PMID:26257788

  20. Effects of green-synthesized silver nanoparticles on lung cancer cells in vitro and grown as xenograft tumors in vivo

    PubMed Central

    He, Yan; Du, Zhiyun; Ma, Shijing; Liu, Yue; Li, Dongli; Huang, Huarong; Jiang, Sen; Cheng, Shupeng; Wu, Wenjing; Zhang, Kun; Zheng, Xi

    2016-01-01

    Silver nanoparticles (AgNPs) have now been recognized as promising therapeutic molecules and are extending their use in cancer diagnosis and therapy. This study demonstrates for the first time the antitumor activity of green-synthesized AgNPs against lung cancer in vitro and in vivo. Cytotoxicity effect was explored on human lung cancer H1299 cells in vitro by MTT and trypan blue assays. Apoptosis was measured by morphological assessment, and nuclear factor-κB (NF-κB) transcriptional activity was determined by a luciferase reporter gene assay. The expressions of phosphorylated stat3, bcl-2, survivin, and caspase-3 were examined by Western blot analysis. AgNPs showed dose-dependent cytotoxicity and stimulation of apoptosis in H1299 cells. The effects on H1299 cells correlated well with the inhibition of NF-κB activity, a decrease in bcl-2, and an increase in caspase-3 and survivin expression. AgNPs significantly suppressed the H1299 tumor growth in a xenograft severe combined immunodeficient (SCID) mouse model. The results demonstrate the anticancer activities of AgNPs, suggesting that they may act as potential beneficial molecules in lung cancer chemoprevention and chemotherapy, especially for early-stage intervention. PMID:27217750

  1. Reflectivity and topography of cells grown on glass-coverslips measured with phase-shifted laser feedback interference microscopy

    PubMed Central

    Atılgan, Erdinç; Ovryn, Ben

    2011-01-01

    In spite of the advantages associated with the molecular specificity of fluorescence imaging, there is still a significant need to augment these approaches with label-free imaging. Therefore, we have implemented a form of interference microscopy based upon phase-shifted, laser-feedback interferometry and developed an algorithm that can be used to separate the contribution of the elastically scattered light by sub-cellular structures from the reflection at the coverslip-buffer interface. The method offers an opportunity to probe protein aggregation, index of refraction variations and structure. We measure the topography and reflection from calibration spheres and from stress fibers and adhesions in both fixed and motile cells. Unlike the data acquired with reflection interference contrast microscopy, where the reflection from adhesions can appear dark, our approach demonstrates that these regions have high reflectivity. The data acquired from fixed and live cells show the presence of a dense actin layer located ≈ 100 nm above the coverslip interface. Finally, the measured dynamics of filopodia and the lamella in a live cell supports retrograde flow as the dominate mechanism responsible for filopodia retraction. PMID:21833378

  2. Metformin Induces Apoptosis and Downregulates Pyruvate Kinase M2 in Breast Cancer Cells Only When Grown in Nutrient-Poor Conditions

    PubMed Central

    Silvestri, Alessandra; Palumbo, Francesco; Rasi, Ignazio; Posca, Daniela; Pavlidou, Theodora; Paoluzi, Serena; Castagnoli, Luisa; Cesareni, Giovanni

    2015-01-01

    Introduction Metformin is proposed as adjuvant therapy in cancer treatment because of its ability to limit cancer incidence by negatively modulating the PI3K/AKT/mTOR pathway. In vitro, in addition to inhibiting cancer cell proliferation, metformin can also induce apoptosis. The molecular mechanism underlying this second effect is still poorly characterized and published data are often contrasting. We investigated how nutrient availability can modulate metformin-induced apoptosis in three breast cancer cell lines. Material and Methods MCF7, SKBR3 and MDA-MB-231 cells were plated in MEM medium supplemented with increasing glucose concentrations or in DMEM medium and treated with 10 mM metformin. Cell viability was monitored by Trypan Blue assay and treatment effects on Akt/mTOR pathway and on apoptosis were analysed by Western Blot. Moreover, we determined the level of expression of pyruvate kinase M2 (PKM2), a well-known glycolytic enzyme expressed in cancer cells. Results Our results showed that metformin can induce apoptosis in breast cancer cells when cultured at physiological glucose concentrations and that the pro-apoptotic effect was completely abolished when cells were grown in high glucose/high amino acid medium. Induction of apoptosis was found to be dependent on AMPK activation but, at least partially, independent of TORC1 inactivation. Finally, we showed that, in nutrient-poor conditions, metformin was able to modulate the intracellular glycolytic equilibrium by downregulating PKM2 expression and that this mechanism was mediated by AMPK activation. Conclusion We demonstrated that metformin induces breast cancer cell apoptosis and PKM2 downregulation only in nutrient-poor conditions. Not only glucose levels but also amino acid concentration can influence the observed metformin inhibitory effect on the mTOR pathway as well as its pro-apoptotic effect. These data demonstrate that the reduction of nutrient supply in tumors can increase metformin efficacy and

  3. Activity of mitochondrially synthesized reporter proteins is lower than that of imported proteins and is increased by lowering cAMP in glucose-grown Saccharomyces cerevisiae cells.

    PubMed Central

    Demlow, Christina M; Fox, Thomas D

    2003-01-01

    We selected for increased phenotypic expression of a synthetic cox2::arg8m-G66S reporter gene inserted into Saccharomyces cerevisiae mtDNA in place of COX2. Recessive mutations in ras2 and cyr1, as well as elevated dosage of PDE2, allowed cox2::arg8m-G66S to support Arg prototrophy. Each of these genetic alterations should decrease cellular cAMP levels. The resulting signal was transduced through redundant action of the three cAMP-dependent protein kinases, TPK1, TPK2, and TPK3. ras2 had little or no effect on the level of wild-type Arg8p encoded by cox2::ARG8m, but did increase Arg8p activity, as judged by growth phenotype. ras2 also caused increased fluorescence in cells carrying the synthetic cox3::GFPm reporter in mtDNA, but had little effect on the steady-state level of GFP polypeptide detected immunologically. Thus, decreased cAMP levels did not affect the synthesis of mitochondrially coded protein reporters in glucose-grown cells, but rather elevated activities in the matrix that promote efficient folding. Furthermore, we show that when Arg8p is synthesized in the cytoplasm and imported into mitochondria, it has greater activity than when it is synthesized in the matrix. Thus, mitochondrially synthesized proteins may not have the same access to matrix chaperones as cytoplasmically synthesized proteins emerging from the import apparatus. PMID:14668357

  4. GaInP/GaAs tandem solar cells with highly Te- and Mg-doped GaAs tunnel junctions grown by MBE

    NASA Astrophysics Data System (ADS)

    Zheng, Xin-He; Liu, San-Jie; Xia, Yu; Gan, Xing-Yuan; Wang, Hai-Xiao; Wang, Nai-Ming; Yang, Hui

    2015-10-01

    We report a GaInP/GaAs tandem solar cell with a novel GaAs tunnel junction (TJ) with using tellurium (Te) and magnesium (Mg) as n- and p-type dopants via dual-filament low temperature effusion cells grown by molecular beam epitaxy (MBE) at low temperature. The test Te/Mg-doped GaAs TJ shows a peak current density of 21 A/cm2. The tandem solar cell by the Te/Mg TJ shows a short-circuit current density of 12 mA/cm2, but a low open-circuit voltage range of 1.4 V˜1.71 V under AM1.5 illumination. The secondary ion mass spectroscopy (SIMS) analysis reveals that the Te doping is unexpectedly high and its doping profile extends to the Mg doping region, thus possibly resulting in a less abrupt junction with no tunneling carriers effectively. Furthermore, the tunneling interface shifts from the intended GaAs n++/p++ junction to the AlGaInP/GaAs junction with a higher bandgap AlGaInP tunneling layers, thereby reducing the tunneling peak. The Te concentration of ˜ 2.5 × 1020 in GaAs could cause a lattice strain of 10-3 in magnitude and thus a surface roughening, which also negatively influences the subsequent growth of the top subcell and the GaAs contacting layers. The doping features of Te and Mg are discussed to understand the photovoltaic response of the studied tandem cell. Project supported by the SINANO-SONY Joint Program (Grant No. Y1AAQ11001), the National Natural Science Foundation of China (Grant No. 61274134), the USCB Start-up Program (Grant No. 06105033), and the International Cooperation Projects of Suzhou City, China (Grant No. SH201215).

  5. Effects of lipid composition on the membrane activity and lipid phase behaviour of Vibrio sp. DSM14379 cells grown at various NaCl concentrations.

    PubMed

    Danevcic, Tjasa; Rilfors, Leif; Strancar, Janez; Lindblom, Göran; Stopar, David

    2005-06-15

    The membrane lipid composition of living cells generally adjusts to the prevailing environmental and physiological conditions. In this study, membrane activity and lipid composition of the Gram-negative bacterium Vibrio sp. DSM14379, grown aerobically in a peptone-yeast extract medium supplemented with 0.5, 1.76, 3, 5 or 10% (w/v) NaCl, was determined. The ability of the membrane to reduce a spin label was studied by EPR spectroscopy under different salt concentrations in cell suspensions labeled with TEMPON. For lipid composition studies, cells were harvested in a late exponential phase and lipids were extracted with chloroform-methanol-water, 1:2:0.8 (v/v). The lipid polar head group and acyl chain compositions were determined by thin-layer and gas-liquid chromatographies. (31)P-NMR spectroscopy was used to study the phase behaviour of the cell lipid extracts with 20 wt.% water contents in a temperature range from -10 to 50 degrees C. The results indicate that the ability of the membrane to reduce the spin label was highest at optimal salt concentrations. The composition of both polar head groups and acyl chains changed markedly with increasing salinity. The fractions of 16:0, 16:1 and 18:0 acyl chains increased while the fraction of 18:1 acyl chains decreased with increasing salinity. The phosphatidylethanolamine fraction correlated inversely with the lysophosphatidylethanolamine fraction, with phosphatidylethanolamine exhibiting a minimum, and lysophosphatidylethanolamine a maximum, at the optimum growth rate. The fraction of lysophosphatidylethanolamine was surprisingly high in the lipid extracts. This lipid can form normal micellar and hexagonal phases and it was found that all lipid extracts form a mixture of lamellar and normal isotropic liquid crystalline phases. This is an anomalous behaviour since the nonlamellar phases formed by total lipid extracts are generally of the reversed type. PMID:15878424

  6. Multi-stacked InAs/GaAs quantum dots grown with different growth modes for quantum dot solar cells

    SciTech Connect

    Kim, Yeongho; Ban, Keun-Yong Honsberg, Christiana B.

    2015-06-01

    We have studied the material properties and device performance of InAs/GaAs quantum dot solar cells (QDSCs) made using three different QD growth modes: Stranski-Krastanov (S-K), quasi-monolayer (QML), and sub-monolayer (SML) growth modes. All QDSCs show an extended external quantum efficiency (EQE) at near infrared wavelengths of 950–1070 nm from the QD absorption. Compared to the S-K and SML QDSCs, the QML QDSC with a higher strain exhibits a poor EQE response in the wavelength region of 300–880 nm due to increased non-radiative recombination. The conversion efficiency of the S-K and SML QDSCs exceeds that of the reference cell (13.4%) without QDs due to an enhanced photocurrent (>16% increase) produced by the silicon doped QD stacks. However, as expected from the EQE of the QML QDSC, the increase of strain-induced crystalline defects greatly degrades the photocurrent and open-circuit voltage, leading to the lowest conversion efficiency (8.9%)

  7. Effects of Malignant Effusions on the Mitotic Index of L Strain Mouse Cells Grown in Tissue Culture

    PubMed Central

    Hrushovetz, S. B.; Ewaniuk, Meriam H.

    1963-01-01

    By employing a clone of L strain mouse fibroblasts (LE) which does not exhibit cell clumping and lysis (cytolytic antibody reaction), it was possible to screen for the presence of growth-regulating factors in human sera and effusions, exclusive of an antigen-antibody reaction. Under conditions of the test a mitotic index greater than 20% indicated the presence of a growth-promoting factor. A total of 11 pleural effusions was tested. Four of the eight malignant effusions possessed a growth-promoting factor, while none of the three non-malignant effusions or the one sample of human umbilical cord serum possessed such a factor. Overnight storage of the unfiltered effusions at 5° C. resulted in complete loss of the growthpromoting activity. ImagesFig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6 PMID:14052976

  8. Evaluation of defects generation in crystalline silicon ingot grown by cast technique with seed crystal for solar cells.

    PubMed

    Tachibana, Tomihisa; Sameshima, Takashi; Kojima, Takuto; Arafune, Koji; Kakimoto, Koichi; Miyamura, Yoshiji; Harada, Hirofumi; Sekiguchi, Takashi; Ohshita, Yoshio; Ogura, Atsushi

    2012-04-01

    Although crystalline silicon is widely used as substrate material for solar cell, many defects occur during crystal growth. In this study, the generation of crystalline defects in silicon substrates was evaluated. The distributions of small-angle grain boundaries were observed in substrates sliced parallel to the growth direction. Many precipitates consisting of light elemental impurities and small-angle grain boundaries were confirmed to propagate. The precipitates mainly consisted of Si, C, and N atoms. The small-angle grain boundaries were distributed after the precipitation density increased. Then, precipitates appeared at the small-angle grain boundaries. We consider that the origin of the small-angle grain boundaries was lattice mismatch and/or strain caused by the high-density precipitation. PMID:22536006

  9. Carrier dynamics in QW and bulk bismide and epitaxial lift off GaAs-In(Al)GaP double heterostructures grown by MOVPE for multi-junction solar cells

    NASA Astrophysics Data System (ADS)

    Sin, Yongkun; Peterson, Mark; Lingley, Zachary; LaLumondiere, Stephen; Moss, Steven C.; Kim, Honghyuk; Forghani, Kamran; Guan, Yingxin; Kim, Kangho; Lee, Jaejin; Mawst, Luke J.; Kuech, Thomas F.; Tatavarti, Rao

    2016-03-01

    III-V multi-junction solar cells are based on a triple-junction design that consists of an InGaP top junction, a GaAs middle junction, and a bottom junction that employs either a 1eV material grown on the GaAs substrate or InGaAs grown on the Ge substrate. The most promising 1 eV materials under extensive investigation are the bulk dilute nitride such as InGaAsN(Sb) lattice-matched to GaAs substrate and the dilute-bismide quantum well materials, such as GaAsBi, strain-compensated with GaAsP barriers. Both approaches have the potential to achieve high performance triple-junction solar cells. In addition, space satellite applications utilizing III-V triple-junction solar cells can have significantly reduced weight and high efficiency. An attractive approach to achieve these goals is to employ full-wafer epitaxial lift off (ELO) technology, which can eliminate the substrate weight and also enable multiple substrate re-usages. For the present study, we employed time-resolved photoluminescence (TR-PL) techniques to study carrier dynamics in MOVPE-grown bulk dilute bismide double heterostructures (DH). Carrier lifetime measurements are crucial to optimizing MOVPE materials growth. We have studied carrier dynamics in GaAsBi QW structures with GaAsP barriers. Carrier lifetimes were measured from GaAsBi DH samples at different stages of post-growth thermal annealing steps. Post-growth annealing yielded significant improvements in carrier lifetimes. Based on this study, single junction solar cells (SJSC) were grown and annealed under a variety of conditions and characterized. The SJSC annealed at 600 - 650 °C exhibited improved response in EQE spectra. In addition, we studied carrier dynamics in MOVPE-grown GaAs-In(Al)GaP DH samples grown on GaAs substrates. The structures were grown on top of a thin AlAs release layer, which allowed epitaxial layers grown on top of the AlAs layer to be removed from the substrate. The GaAs active layers had various doping densities and

  10. Inhibition of vimentin or B1 integrin reverts morphology of prostate tumor cells grown in laminin-rich extracellular matrix gels and reduces tumor growth in vivo

    SciTech Connect

    Zhang, Xueping; Fournier, Marcia V; Ware, Joy L; Bissell, Mina J; Yacoub, Adly; Zehner, Zendra E

    2008-06-12

    Prostate epithelial cells grown embedded in laminin-rich extracellular matrix (lrECM) undergo morphologic changes that closely resemble their architecture in vivo. In this study, growth characteristics of three human prostate epithelial sublines derived from the same cellular lineage, but displaying different tumorigenic and metastatic properties in vivo, were assessed in three-dimensional lrECM gels. M12, a highly tumorigenic and metastatic subline, was derived from the immortalized, prostate epithelial P69 cell line by selection in athymic, nude mice and found to contain a deletion of 19p-q13.1. The stable reintroduction of an intact human chromosome 19 into M12 resulted in a poorly tumorigenic subline, designated F6. When embedded in lrECM gels, the parental, nontumorigenic P69 line produced acini with clearly defined lumena. Immunostaining with antibodies to {beta}-catenin, E-cadherin, or {alpha}6 and {beta}1 integrins showed polarization typical of glandular epithelium. In contrast, the metastatic M12 subline produced highly disorganized cells with no evidence of polarization. The F6 subline reverted to acini-like structures exhibiting basal polarity marked with integrins. Reducing either vimentin levels via small interfering RNA interference or the expression of {alpha}6 and {beta}1 integrins by the addition of blocking antibodies, reorganized the M12 subline into forming polarized acini. The loss of vimentin significantly reduced M12-Vim tumor growth when assessed by s.c. injection in athymic mice. Thus, tumorigenicity in vivo correlated with disorganized growth in three-dimensional lrECM gels. These studies suggest that the levels of vimentin and {beta}1 integrin play a key role in the homeostasis of the normal acinus in prostate and that their dysregulation may lead to tumorigenesis. [Mol Cancer Ther 2009;8(3):499-508].

  11. Effects of chondrogenic and osteogenic regulatory factors on composite constructs grown using human mesenchymal stem cells, silk scaffolds and bioreactors.

    PubMed

    Augst, Alexander; Marolt, Darja; Freed, Lisa E; Vepari, Charu; Meinel, Lorenz; Farley, Michelle; Fajardo, Robert; Patel, Nipun; Gray, Martha; Kaplan, David L; Vunjak-Novakovic, Gordana

    2008-08-01

    Human mesenchymal stem cells (hMSCs) isolated from bone marrow aspirates were cultured on silk scaffolds in rotating bioreactors for three weeks with either chondrogenic or osteogenic medium supplements to engineer cartilage- or bone-like tissue constructs. Osteochondral composites formed from these cartilage and bone constructs were cultured for an additional three weeks in culture medium that was supplemented with chondrogenic factors, supplemented with osteogenic factors or unsupplemented. Progression of cartilage and bone formation and the integration between the two regions were assessed by medical imaging (magnetic resonance imaging and micro-computerized tomography imaging), and by biochemical, histological and mechanical assays. During composite culture (three to six weeks), bone-like tissue formation progressed in all three media to a markedly larger extent than cartilage-like tissue formation. The integration of the constructs was most enhanced in composites cultured in chondrogenic medium. The results suggest that tissue composites with well-mineralized regions and substantially less developed cartilage regions can be generated in vitro by culturing hMSCs on silk scaffolds in bioreactors, that hMSCs have markedly higher capacity for producing engineered bone than engineered cartilage, and that chondrogenic factors play major roles at early stages of bone formation by hMSCs and in the integration of the two tissue constructs into a tissue composite. PMID:18230586

  12. Selective labeling of a membrane peptide with 15N-amino acids using cells grown in rich medium.

    PubMed

    Englander, Jacqueline; Cohen, Leah; Arshava, Boris; Estephan, Racha; Becker, Jeffrey M; Naider, Fred

    2006-01-01

    Nuclear magnetic resonance spectra of membrane proteins containing multiple transmembrane helices have proven difficult to resolve due to the redundancy of aliphatic and Ser/Thr residues in transmembrane domains and the low chemical shift dispersity exhibited by residues in alpha-helical structures. Although (13)C- and (15)N-labeling are useful tools in the biophysical analysis of proteins, selective labeling of individual amino acids has been used to help elucidate more complete structures and to probe ligand-protein interactions. In general, selective labeling has been performed in Escherichia coli expression systems using minimal media supplemented with a single labeled amino acid and nineteen other unlabeled amino acids and/or by using auxotrophs for specific amino acids. Growth in minimal media often results in low yields of cells or expression products. We demonstrate a method in which one labeled amino acid is added to a rich medium. These conditions resulted in high expression (> or =100 mg/L) of a test fusion protein and milligram quantities of the selectively labeled membrane peptide after cyanogen bromide cleavage to release the peptide from the fusion protein. High levels of (15)N incorporation and acceptable levels of cross-labeling into other amino acid residues of the peptide were achieved. Growth in rich media is a simple and convenient alternative to growth in supplemented minimal media and is readily applicable to the expression of proteins selectively labeled with specific amino acids. PMID:16741986

  13. Dosimetric accuracy of the cone-beam CT-based treatment planning of the Vero system: a phantom study.

    PubMed

    Yohannes, Indra; Prasetio, Heru; Kallis, Karoline; Bert, Christoph

    2016-01-01

    We report an investigation on the accuracy of dose calculation based on the cone-beam computed tomography (CBCT) images of the nonbowtie filter kV imaging system of the Vero linear accelerator. Different sets of materials and tube voltages were employed to generate the Hounsfield unit lookup tables (HLUTs) for both CBCT and fan-beam CT (FBCT) systems. The HLUTs were then implemented for the dose calculation in a treatment planning system (TPS). Dosimetric evaluation was carried out on an in-house-developed cube phantom that consists of water-equivalent slabs and inhomogeneity inserts. Two independent dosimeters positioned in the cube phantom were used in this study for point-dose and two-dimensional (2D) dose distribution measurements. The differences of HLUTs from various materials and tube voltages in both CT systems resulted in differences in dose calculation accuracy. We found that the higher the tube voltage used to obtain CT images, the better the point-dose calculation and the gamma passing rate of the 2D dose distribution agree to the values determined in the TPS. Moreover, the insert materials that are not tissue-equivalent led to higher dose-calculation inaccuracy. There were negligible differences in dosimetric evaluation between the CBCT- and FBCT-based treatment planning if the HLUTs were generated using the tissue-equivalent materials. In this study, the CBCT images of the Vero system from a complex inhomogeneity phantom can be applied for the TPS dose calculation if the system is calibrated using tissue-equivalent materials scanned at high tube voltage (i.e., 120 kV). PMID:27455496

  14. P-H bonds in the surface unit cell of P-rich ordered InP(001) grown by metalorganic chemical vapor deposition

    NASA Astrophysics Data System (ADS)

    Letzig, T.; Schimper, H.-J.; Hannappel, T.; Willig, F.

    2005-01-01

    The Fourier transform infrared spectrum of the MOCVD-grown (metalorganic chemical vapor deposition) P-rich ordered InP(001) surface was measured in ultrahigh vacuum applying attenuated total reflection. The surface was measured without carrying out any post-transfer surface preparation. The low-energy electron defraction pattern showed the well-known (2×1) structure with streaks in the [-110] direction. After exposure to activated deuterium, the different infrared spectrum revealed a pronounced peak at 2308cm-1 , which was ascribed to P-H bonds. Polarization-dependent spectra showed the dipole moments of the P-H bonds oriented only in [001] and [-110] directions. A weak 0.8cm-1 splitting was measured between the symmetric and antisymmetric modes of two neighboring P-H bonds. These observations provide direct proof for two oriented P-H bonds as in the surface unit cell proposed by Hahn and Schmidt [Surf. Rev. Lett. 10, 163 (2003)]. Additional much smaller peaks with different polarization behavior varied greatly for different samples and were ascribed to defects or impurities.

  15. Uptake of cadmium by rice grown on contaminated soils and its bioavailability/toxicity in human cell lines (Caco-2/HL-7702).

    PubMed

    Aziz, Rukhsanda; Rafiq, Muhammad Tariq; Li, Tingqiang; Liu, Di; He, Zhenli; Stoffella, P J; Sun, Kewang; Xiaoe, Yang

    2015-04-01

    Cadmium (Cd) enters the food chain from polluted soils via contaminated cereals and vegetables; therefore, an understanding of Cd bioaccessibility, bioavailability, and toxicity in humans through rice grain is needed. This study assessed the Cd bioaccessibility, bioavailability, and toxicity to humans from rice grown on Cd-contaminated soils using an in vitro digestion method combined with a Caco-2/HL-7702 cell model. Cadmium bioaccessibility (18.45-30.41%) and bioavailability (4.04-8.62%) were found to be significantly higher in yellow soil (YS) rice than calcareous soil (CS) rice with the corresponding values of 6.89-11.43 and 1.77-2.25%, respectively. Toxicity assays showed an initial toxicity in YS rice at 6 mg kg(-1) Cd, whereas CS rice did not show any significant change due to low Cd concentrations. The acidic soils of Cd-contaminated areas can contribute to a higher dietary intake of Cd. Therefore, it is imperative to monitor Cd concentration in rice to minimize human health risk. PMID:25738308

  16. Graphene grown on stainless steel as a high-performance and ecofriendly anti-corrosion coating for polymer electrolyte membrane fuel cell bipolar plates

    NASA Astrophysics Data System (ADS)

    Pu, Nen-Wen; Shi, Gia-Nan; Liu, Yih-Ming; Sun, Xueliang; Chang, Jeng-Kuei; Sun, Chia-Liang; Ger, Ming-Der; Chen, Chun-Yu; Wang, Po-Chiang; Peng, You-Yu; Wu, Chia-Hung; Lawes, Stephen

    2015-05-01

    In this study, the growth of graphene by chemical vapor deposition (CVD) on SUS304 stainless steel and on a catalyzing Ni/SUS304 double-layered structure was investigated. The results indicated that a thin and multilayered graphene film can be continuously grown across the metal grain boundaries of the Ni/SUS304 stainless steel and significantly enhance its corrosion resistance. A 3.5 wt% saline polarization test demonstrated that the corrosion currents in graphene-covered SUS304 were improved fivefold relative to the corrosion currents in non-graphene-covered SUS304. In addition to enhancing the corrosion resistance of stainless steel, a graphene coating also ameliorates another shortcoming of stainless steel in a corrosive environment: the formation of a passive oxidation layer on the stainless steel surface that decreases conductivity. After a corrosion test, the graphene-covered stainless steel continued to exhibit not only an excellent low interfacial contact resistance (ICR) of 36 mΩ cm2 but also outstanding drainage characteristics. The above results suggest that an extremely thin, lightweight protective coating of graphene on stainless steel can act as the next-generation bipolar plates of fuel cells.

  17. Alteration of cell cycle progression by Sindbis virus infection

    SciTech Connect

    Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa; Shirasawa, Hiroshi

    2015-07-10

    We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Vero cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G{sub 1} phase preferred to proliferate during S/G{sub 2} phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G{sub 1} phase than in cells infected during S/G{sub 2} phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases.

  18. Video of Tissue Grown in Space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    2003-01-01

    Principal investigator Leland Chung grew prostate cancer and bone stromal cells aboard the Space Shuttle Columbia during the STS-107 mission. Although the experiment samples were lost along with the ill-fated spacecraft and crew, he did obtain downlinked video of the experiment that indicates the enormous potential of growing tissues in microgravity. Cells grown aboard Columbia had grown far larger tissue aggregates at day 5 than did the cells grown in a NASA bioreactor on the ground.

  19. Effect of passivation layer grown by atomic layer deposition and sputtering processes on Si quantum dot superlattice to generate high photocurrent for high-efficiency solar cells

    NASA Astrophysics Data System (ADS)

    Maksudur Rahman, Mohammad; Higo, Akio; Sekhar, Halubai; Erman Syazwan, Mohd; Hoshi, Yusuke; Usami, Noritaka; Samukawa, Seiji

    2016-03-01

    The effect of passivation films on a Si quantum dot superlattice (QDSL) was investigated to generate high photocurrent in solar-cell applications. Three types of passivation films, sputter-grown amorphous silicon carbide (a-SiC), hydrogenated a-SiC (a-SiC:H), and atomic-layer-deposited aluminum oxide (ALD-Al2O3), were used to passivate the Si QDSLs containing a stack of four 4 nm Si nanodisks (NDs) and 2 nm silicon carbide (SiC) films fabricated by neutral beam etching (NBE). Because of the high surface-to-volume ratio typically present in quantum Si-NDs formed in the top-down NBE process, there is a tendency to form larger surface dangling bonds on untreated Si-ND surfaces as well as to have short distance (<10 nm) between high-aspect-ratio nanopillars of stacked 4 nm Si-NDs/2 nm SiC films, which conventionally sputter SiC films cannot uniformly cover. Therefore, we optimized the passivation techniques with an ALD-Al2O3 film. Scanning electron microscopy (SEM) analysis helped to explain the surface morphology before and after the passivation of the QDSLs. After the completion of the passivation process, the quality of the top surface films of the QDSLs was analyzed from the surface roughness by atomic force microscopy (AFM) analysis, which revealed that ALD-Al2O3 passivated films had the smallest roughness (RMS) of 1.09 nm with respect to sputter-grown a-SiC (RMS: 1.75 nm) and a-SiC:H (RMS: 1.54 nm) films. Conductive atomic force microscopy (CAFM) revealed that ALD-Al2O3 passivation decreased the surface-leakage current as a result of proper passivation of side-wall surface defects in the QDSLs. The carrier transport characteristics were extracted from the QDSLs using the photovoltaic (PV) properties of p++/i/n+ solar cells, where the QDSLs consisted of different passivation layers acting as intermediate layers (i-layers) between the high-doping-density p++ Si (1 × 1020 cm-3) and n+ Si (1 × 1019 cm-3) substrates. High-doping-density p++ Si acted as a hole

  20. Inhibitory effect of essential oils obtained from plants grown in Colombia on yellow fever virus replication in vitro

    PubMed Central

    Meneses, Rocío; Ocazionez, Raquel E; Martínez, Jairo R; Stashenko, Elena E

    2009-01-01

    Background An antiviral drug is needed for the treatment of patients suffering from yellow fever. Several compounds present in plants can inactive in vitro a wide spectrum of animal viruses. Aim In the present study the inhibitory effect of essential oils of Lippia alba, Lippia origanoides, Oreganum vulgare and Artemisia vulgaris on yellow fever virus (YFV) replication was investigated. Methods The cytotoxicity (CC50) on Vero cells was evaluated by the MTT reduction method. The minimum concentration of the essential oil that inhibited virus titer by more than 50% (MIC) was determined by virus yield reduction assay. YFV was incubated 24 h at 4°C with essential oil before adsorption on Vero cell, and viral replication was carried out in the absence or presence of essential oil. Vero cells were exposed to essential oil 24 h at 37°C before the adsorption of untreated-virus. Results The CC50 values were less than 100 μg/mL and the MIC values were 3.7 and 11.1 μg/mL. The CC50/MIC ratio was of 22.9, 26.4, 26.5 and 8.8 for L. alba, L origanoides, O. vulgare and A. vulgaris, respectively. The presence of essential oil in the culture medium enhances the antiviral effect: L. origanoides oil at 11.1 μg/mLproduced a 100% reduction of virus yield, and the same result was observed with L. alba, O. vulgare and A. vulgaris oils at100 μg/mL. No reduction of virus yield was observed when Vero cells were treated with essential oil before the adsorption of untreated-virus. Conclusion The essential oils evaluated in the study showed antiviral activities against YFV. The mode of action seems to be direct virus inactivation. PMID:19267922

  1. Carrier dynamics in bulk 1eV InGaAsNSb materials and epitaxial lift off GaAs-InAlGaP layers grown by MOVPE for multi-junction solar cells

    NASA Astrophysics Data System (ADS)

    Sin, Yongkun; LaLumondiere, Stephen; Lotshaw, William; Moss, Steven C.; Kim, Tae Wan; Forghani, Kamran; Mawst, Luke J.; Kuech, Thomas F.; Tatavarti, Rao; Wibowo, Andree; Pan, Noren

    2013-03-01

    III-V multi-junction solar cells are based on a triple-junction design that consists of an InGaP top junction, a GaAs middle junction, and a bottom junction that employs either a 1eV material grown on the GaAs substrate or InGaAs grown on the Ge substrate. The most promising 1 eV material that is currently under extensive investigation is bulk dilute nitride such as InGaAsN(Sb) lattice matched to GaAs substrates. Both approaches utilizing dilute nitrides and lattice-mismatched InGaAs layers have a potential to achieve high performance triple-junction solar cells. In addition, it will be beneficial for both commercial and space applications if III-V triple-junction solar cells can significantly reduce weight and can be manufactured cost effectively while maintaining high efficiency. The most attractive approach to achieve these goals is to employ full-wafer epitaxial lift off (ELO) technology, which can eliminate the substrate weight and also enable multiple substrate re-usages. For the present study, we employed time-resolved photoluminescence (TR-PL) techniques to study carrier dynamics in MOVPE-grown bulk dilute nitride layers lattice matched to GaAs substrates, where carrier lifetime measurements are crucial in optimizing MOVPE materials growth. We studied carrier dynamics in InGaAsN(Sb) layers with different amounts of N incorporated. Carrier lifetimes were also measured from InGaAsN(Sb) layers at different stages of post-growth thermal annealing steps. Post-growth annealing yielded significant improvements in carrier lifetimes of InGaAsNSb double hetero-structure (DH) samples compared to InGaAsN DH samples possibly due to the surfactant effect of Sb. In addition, we studied carrier dynamics in MOVPE-grown GaAs-InAl(Ga)P layers grown on GaAs substrates. The structures were grown on top of a thin AlAs release layer, which allowed epitaxial layers grown on top of the AlAs layer to be removed from the substrate. The GaAs layers had various doping densities and

  2. Geometric Verification of Dynamic Wave Arc Delivery With the Vero System Using Orthogonal X-ray Fluoroscopic Imaging

    SciTech Connect

    Burghelea, Manuela; Verellen, Dirk; Poels, Kenneth; Gevaert, Thierry; Depuydt, Tom; Tournel, Koen; Hung, Cecilia; Simon, Viorica; Hiraoka, Masahiro; Ridder, Mark de

    2015-07-15

    Purpose: The purpose of this study was to define an independent verification method based on on-board orthogonal fluoroscopy to determine the geometric accuracy of synchronized gantry–ring (G/R) rotations during dynamic wave arc (DWA) delivery available on the Vero system. Methods and Materials: A verification method for DWA was developed to calculate O-ring-gantry (G/R) positional information from ball-bearing positions retrieved from fluoroscopic images of a cubic phantom acquired during DWA delivery. Different noncoplanar trajectories were generated in order to investigate the influence of path complexity on delivery accuracy. The G/R positions detected from the fluoroscopy images (DetPositions) were benchmarked against the G/R angulations retrieved from the control points (CP) of the DWA RT plan and the DWA log files recorded by the treatment console during DWA delivery (LogActed). The G/R rotational accuracy was quantified as the mean absolute deviation ± standard deviation. The maximum G/R absolute deviation was calculated as the maximum 3-dimensional distance between the CP and the closest DetPositions. Results: In the CP versus DetPositions comparison, an overall mean G/R deviation of 0.13°/0.16° ± 0.16°/0.16° was obtained, with a maximum G/R deviation of 0.6°/0.2°. For the LogActed versus DetPositions evaluation, the overall mean deviation was 0.08°/0.15° ± 0.10°/0.10° with a maximum G/R of 0.3°/0.4°. The largest decoupled deviations registered for gantry and ring were 0.6° and 0.4° respectively. No directional dependence was observed between clockwise and counterclockwise rotations. Doubling the dose resulted in a double number of detected points around each CP, and an angular deviation reduction in all cases. Conclusions: An independent geometric quality assurance approach was developed for DWA delivery verification and was successfully applied on diverse trajectories. Results showed that the Vero system is capable of following complex

  3. SU-E-J-156: Preclinical Inverstigation of Dynamic Tumor Tracking Using Vero SBRT Linear Accelerator: Motion Phantom Dosimetry Study

    SciTech Connect

    Mamalui-Hunter, M; Wu, J; Li, Z; Su, Z

    2014-06-01

    Purpose: Following the ‘end-to-end testing’ paradigm of Dynamic Target Tracking option in our Image-Guided dedicated SBRT VeroTM linac, we verify the capability of the system to deliver planned dose to moving targets in the heterogeneous thorax phantom (CIRSTM). The system includes gimbaled C-band linac head, robotic 6 degree of freedom couch and a tumor tracking method based on predictive modeling of target position using fluoroscopically tracked implanted markers and optically tracked infrared reflecting external markers. Methods: 4DCT scan of the motion phantom with the VisicoilTM implanted marker in the close vicinity of the target was acquired, the ‘exhale’=most prevalent phase was used for planning (iPlan by BrainLabTM). Typical 3D conformal SBRT treatment plans aimed to deliver 6-8Gy/fx to two types of targets: a)solid water-equivalent target 3cm in diameter; b)single VisicoilTM marker inserted within lung equivalent material. The planning GTV/CTV-to-PTV margins were 2mm, the block margins were 3 mm. The dose calculated by MonteCarlo algorithm with 1% variance using option Dose-to-water was compared to the ion chamber (CC01 by IBA Dosimetry) measurements in case (a) and GafchromicTM EBT3 film measurements in case (b). During delivery, the target 6 motion patterns available as a standard on CIRSTM motion phantom were investigated: in case (a), the target was moving along the designated sine or cosine4 3D trajectory; in case (b), the inserted marker was moving sinusoidally in 1D. Results: The ion chamber measurements have shown the agreement with the planned dose within 1% under all the studied motion conditions. The film measurements show 98.1% agreement with the planar calculated dose (gamma criteria: 3%/3mm). Conclusion: We successfully verified the capability of the SBRT VeroTM linac to perform real-time tumor tracking and accurate dose delivery to the target, based on predictive modeling of the correlation between implanted marker motion and

  4. Catalase Activity of Psychrophilic Bacteria Grown at 2 and 30 C1

    PubMed Central

    Frank, Hilmer A.; Ishibashi, Sandra T.; Reid, Ann; Ito, June S.

    1963-01-01

    Catalase activity was measured in resting-cell suspensions of psychrophilic bacteria grown at 2 and at 30 C. Enzyme activity decreased in both cell-suspension types as harvest age increased. At comparable physiological age, cells grown at 2 C had more catalase than cells grown at 30 C. PMID:13959237

  5. Phage-typing of Vero-cytotoxin (VT) producing Escherichia coli O157 isolated in the United Kingdom.

    PubMed Central

    Frost, J. A.; Smith, H. R.; Willshaw, G. A.; Scotland, S. M.; Gross, R. J.; Rowe, B.

    1989-01-01

    Vero-cytotoxin (VT) producing Escherichia coli serogroup O157 have been isolated from patients with diarrhoea, haemorrhagic colitis (HC) and haemolytic uraemic syndrome (HUS). A phage-typing scheme developed in Canada has been used to type 155 VT+ E. coli O157 serogroup isolated from sporadic infections in the UK since 1983, and 48 strains from HC or HUS outbreaks. Twelve phage types were identified of which three, types 49, 51 and 52, have not been found in North America. All strains carried a 60 x 10(6) plasmid and most VT1+VT2+ strains also had a 5 x 10(6) plasmid coding for colicin D production. The majority of strains producing both VT1 and VT2 belonged to phage type 1, or the related types 4, 8 and 14. Most strains producing only VT2 belonged to types 2 or 49. Four outbreaks were included in the survey. Three had strains of a single phage type while strains from the fourth outbreak were more variable. The distribution of phage types throughout the UK showed no marked geographical variations. PMID:2673827

  6. Investigation of anodic and chemical oxides grown on p-type InP with applications to surface passivation for n(+)-p solar cell fabrication

    NASA Technical Reports Server (NTRS)

    Faur, Maria; Faur, Mircea; Goradia, Manju; Goradia, Chandra; Jenkins, Phillip; Jayne, Douglas; Weinberg, Irving

    1991-01-01

    Most of the previously reported InP anodic oxides were grown on a n-type InP with applications to fabrication of MISFET structures and were described as a mixture of In2O3 and P2O5 stoichiometric compounds or nonstoichiometric phases which have properties similar to crystalline compounds In(OH)3, InPO4, and In(PO3)3. Details of the compositional change of the anodic oxides grown under different anodization conditions were previously reported. The use of P-rich oxides grown either by anodic or chemical oxidation are investigated for surface passivation of p-type InP and as a protective cap during junction formation by closed-ampoule sulfur diffusion. The investigation is based on but not limited to correlations between PL intensity and X-ray photoelectron spectroscopy (XPS) chemical composition data.

  7. Application of an immunoaffinity-based preconcentration method for mass spectrometric analysis of the O-chain polysaccharide of Aeromonas salmonicida from in vitro- and in vivo-grown cells.

    PubMed

    Wang, Zhan; Liu, Xin; Garduño, Elizabeth; Garduño, Rafael A; Li, Jianjun; Altman, Eleonora

    2009-06-01

    In this study, application of magnetic beads (Dynabeads) coated with Aeromonas salmonicida lipopolysaccharide-specific polyclonal antisera to MS-based characterization of bacterial lipopolysaccharides has been evaluated. The results showed that the affinity-based preconcentration strategy resulted in at least a 100-fold increase in the detection of sensitivity, affording direct capillary electrophoresis (CE)-MS analysis of A. salmonicida lipopolysaccharide O-chain polysaccharide from in vitro-cultured cells. Subsequent CE-MS analysis of in vivo-grown cells of A. salmonicida confirmed significant changes in the structure of the lipopolysaccharide O-chain polysaccharide as a result of in vivo cultivation. PMID:19456871

  8. Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based γ-evaluation and dose-area-histograms.

    PubMed

    Sothmann, T; Blanck, O; Poels, K; Werner, R; Gauer, T

    2016-02-21

    The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between  +1.5 Gy to +6.0 Gy (CyberKnife: +0.5 Gy to +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were  -1.0 mm to  +0.7 mm (lateral) /-0.6 mm to +0.1 mm (superior-inferior) for CyberKnife and  -0.8 mm to +0.2 mm /-0.8 mm to +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm. PMID:26836488

  9. Real time tracking in liver SBRT: comparison of CyberKnife and Vero by planning structure-based γ-evaluation and dose-area-histograms

    NASA Astrophysics Data System (ADS)

    Sothmann, T.; Blanck, O.; Poels, K.; Werner, R.; Gauer, T.

    2016-02-01

    The purpose of this study was to evaluate and compare two clinical tracking systems for radiosurgery with regard to their dosimetric and geometrical accuracy in liver SBRT: the robot-based CyberKnife and the gimbal-based Vero. Both systems perform real-time tumour tracking by correlating internal tumour and external surrogate motion. CyberKnife treatment plans were delivered to a high resolution 2D detector array mounted on a 4D motion platform, with the platform simulating (a) tumour motion trajectories extracted from the corresponding CyberKnife predictor log files and (b) the tumour motion trajectories with superimposed baseline-drift. Static reference and tracked dose measurements were compared and dosimetric as well as geometrical uncertainties analyzed by a planning structure-based evaluation. For (a), γ-passing rates inside the CTV (γ-criteria of 1% / 1 mm) ranged from 95% to 100% (CyberKnife) and 98% to 100% (Vero). However, dosimetric accuracy decreases in the presence of the baseline-drift. γ-passing rates for (b) ranged from 26% to 92% and 94% to 99%, respectively; i.e. the effect was more pronounced for CyberKnife. In contrast, the Vero system led to maximum dose deviations in the OAR between  +1.5 Gy to  +6.0 Gy (CyberKnife:  +0.5 Gy to  +3.5 Gy). Potential dose shifts were interpreted as motion-induced geometrical tracking errors. Maximum observed shift ranges were  -1.0 mm to  +0.7 mm (lateral) /-0.6 mm to  +0.1 mm (superior-inferior) for CyberKnife and  -0.8 mm to  +0.2 mm /-0.8 mm to  +0.4 mm for Vero. These values illustrate that CyberKnife and Vero provide high precision tracking of regular breathing patterns. Even for the modified motion trajectory, the obtained dose distributions appear to be clinical acceptable with regard to literature QA γ-criteria of 3% / 3 mm.

  10. Protein, free amino acid, phenloic, ß-carotene, and lycopene content, and antioxidative and cancer cell inhibitory effects of 12 greenhouse-grown commercial cherry tomato varieties

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The content of water, free amino acids, amino acid metabolites, crude protein, the carotene pigments ß-carotene and lycopene, and 9 characterized and 2 incompletely characterized individual phenolic (flavonoid) compounds of 12 greenhouse-grown cherry tomato varieties of various colors (green, yellow...

  11. Reinjury risk of nano-calcium oxalate monohydrate and calcium oxalate dihydrate crystals on injured renal epithelial cells: aggravation of crystal adhesion and aggregation

    PubMed Central

    Gan, Qiong-Zhi; Sun, Xin-Yuan; Bhadja, Poonam; Yao, Xiu-Qiong; Ouyang, Jian-Ming

    2016-01-01

    Background Renal epithelial cell injury facilitates crystal adhesion to cell surface and serves as a key step in renal stone formation. However, the effects of cell injury on the adhesion of nano-calcium oxalate crystals and the nano-crystal-induced reinjury risk of injured cells remain unclear. Methods African green monkey renal epithelial (Vero) cells were injured with H2O2 to establish a cell injury model. Cell viability, superoxide dismutase (SOD) activity, malonaldehyde (MDA) content, propidium iodide staining, hematoxylin–eosin staining, reactive oxygen species production, and mitochondrial membrane potential (Δψm) were determined to examine cell injury during adhesion. Changes in the surface structure of H2O2-injured cells were assessed through atomic force microscopy. The altered expression of hyaluronan during adhesion was examined through laser scanning confocal microscopy. The adhesion of nano-calcium oxalate monohydrate (COM) and calcium oxalate dihydrate (COD) crystals to Vero cells was observed through scanning electron microscopy. Nano-COM and COD binding was quantitatively determined through inductively coupled plasma emission spectrometry. Results The expression of hyaluronan on the cell surface was increased during wound healing because of Vero cell injury. The structure and function of the cell membrane were also altered by cell injury; thus, nano-crystal adhesion occurred. The ability of nano-COM to adhere to the injured Vero cells was higher than that of nano-COD crystals. The cell viability, SOD activity, and Δψm decreased when nano-crystals attached to the cell surface. By contrast, the MDA content, reactive oxygen species production, and cell death rate increased. Conclusion Cell injury contributes to crystal adhesion to Vero cell surface. The attached nano-COM and COD crystals can aggravate Vero cell injury. As a consequence, crystal adhesion and aggregation are enhanced. These findings provide further insights into kidney stone

  12. Evaluation of Cytotoxicity and Cell Death Induced In Vitro by Saxitoxin in Mammalian Cells.

    PubMed

    Melegari, Silvia P; de Carvalho Pinto, Cátia R S; Moukha, Serge; Creppy, Edmond E; Matias, William G

    2015-01-01

    Since the cyanotoxin saxitoxin (STX) is a neurotoxin and induces ecological changes in aquatic environments, a potential risk to public and environmental health exists. However, data on STX-mediated cytotoxic and genotoxic effects are still scare. In order to gain a better understanding of the effects of this toxin, the cytotoxic and genotoxic potential of STX was examined in two mammalian cell lines. Neuro 2A (N2A), a neuroblastoma mouse cell line, and Vero cell line, derived from Vero green monkey kidney cells, were exposed to several concentrations of STX ranging from 0.5 to 64 nM to determine cell viability, induction of apoptosis (DNA fragmentation assay), and formation of micronuclei (MN) (cytokinesis-block micronucleus assay; CBMN) following 24 h of incubation. The half maximal effective concentration (EC50) values for STX calculated in cell viability tests were 1.01 nM for N2A and 0.82 nM for Vero cells. With increasing STX concentration there was evidence of DNA fragmentation indicating apoptosis induction in Vero cells with a 50% increase in DNA fragmentation compared to control at the highest STX concentration tested (3 nM). The results demonstrated no significant changes in the frequency of micronucleated binucleated cells in N2A and Vero cells exposed to STX, indicating the absence of genotoxicity under these test conditions. There was no apparent cellular necrosis as evidenced by a lack of formation of multinucleated cells. In conclusion, data reported herein demonstrate that STX produced death of both cell types tested through an apoptotic process. PMID:26436995

  13. Host cell-free growth of the Q fever bacterium Coxiella burnetii

    PubMed Central

    Omsland, Anders; Cockrell, Diane C.; Howe, Dale; Fischer, Elizabeth R.; Virtaneva, Kimmo; Sturdevant, Daniel E.; Porcella, Stephen F.; Heinzen, Robert A.

    2009-01-01

    The inability to propagate obligate intracellular pathogens under axenic (host cell-free) culture conditions imposes severe experimental constraints that have negatively impacted progress in understanding pathogen virulence and disease mechanisms. Coxiella burnetii, the causative agent of human Q (Query) fever, is an obligate intracellular bacterial pathogen that replicates exclusively in an acidified, lysosome-like vacuole. To define conditions that support C. burnetii growth, we systematically evaluated the organism's metabolic requirements using expression microarrays, genomic reconstruction, and metabolite typing. This led to development of a complex nutrient medium that supported substantial growth (approximately 3 log10) of C. burnetii in a 2.5% oxygen environment. Importantly, axenically grown C. burnetii were highly infectious for Vero cells and exhibited developmental forms characteristic of in vivo grown organisms. Axenic cultivation of C. burnetii will facilitate studies of the organism's pathogenesis and genetics and aid development of Q fever preventatives such as an effective subunit vaccine. Furthermore, the systematic approach used here may be broadly applicable to development of axenic media that support growth of other medically important obligate intracellular pathogens. PMID:19246385

  14. Porcine aminopeptidase N mediated polarized infection by porcine epidemic diarrhea virus in target cells

    SciTech Connect

    Cong, Yingying; Li, Xiaoxue; Bai, Yunyun; Lv, Xiaonan; Herrler, Georg; Enjuanes, Luis; Zhou, Xingdong; Qu, Bo; Meng, Fandan; Cong, Chengcheng; Ren, Xiaofeng; Li, Guangxing

    2015-04-15

    Infection of polarized intestinal epithelial cells by porcine epidemic diarrhea virus (PEDV) was characterized. Indirect immunofluorescence assay, real-time PCR, and transmission electron microscopy confirmed PEDV can be successfully propagated in immortalized swine small intestine epithelial cells (IECs). Infection involved porcine aminpeptidase N (pAPN), a reported cellular receptor for PEDV, transient expression of pAPN and siRNA targeted pAPN increased and decreased the infectivity of PEDV in IECs, respectively. Subsequently, polarized entry into and release from both Vero E6 and IECs was analyzed. PEDV entry into polarized cells and pAPN grown on membrane inserts occurs via apical membrane. The progeny virus released into the medium was also quantified which demonstrated that PEDV is preferentially released from the apical membrane. Collectively, our data demonstrate that pAPN, the cellular receptor for PEDV, mediates polarized PEDV infection. These results imply the possibility that PEDV infection may proceed by lateral spread of virus in intestinal epithelial cells. - Highlights: • PEDV infection of polarized intestinal epithelial cells (IECs) was characterized. • Porcine aminpeptidase N (pAPN) facilitated PEDV infection in IECs. • PEDV entry into and release from polarized cell via its apical membrane. • PEDV infection may proceed by lateral spread of virus in IECs.

  15. Virological and serological findings in Rousettus aegyptiacus experimentally inoculated with vero cells-adapted hogan strain of Marburg virus.

    PubMed

    Paweska, Janusz T; Jansen van Vuren, Petrus; Masumu, Justin; Leman, Patricia A; Grobbelaar, Antoinette A; Birkhead, Monica; Clift, Sarah; Swanepoel, Robert; Kemp, Alan

    2012-01-01

    The Egyptian fruit bat, Rousettus aegyptiacus, is currently regarded as a potential reservoir host for Marburg virus (MARV). However, the modes of transmission, the level of viral replication, tissue tropism and viral shedding pattern remains to be described. Captive-bred R. aegyptiacus, including adult males, females and pups were exposed to MARV by different inoculation routes. Blood, tissues, feces and urine from 9 bats inoculated by combination of nasal and oral routes were all negative for the virus and ELISA IgG antibody could not be demonstrated for up to 21 days post inoculation (p.i.). In 21 bats inoculated by a combination of intraperitoneal/subcutaneous route, viremia and the presence of MARV in different tissues was detected on days 2-9 p.i., and IgG antibody on days 9-21 p.i. In 3 bats inoculated subcutaneously, viremia was detected on days 5 and 8 (termination of experiment), with virus isolation from different organs. MARV could not be detected in urine, feces or oral swabs in any of the 3 experimental groups. However, it was detected in tissues which might contribute to horizontal or vertical transmission, e.g. lung, intestines, kidney, bladder, salivary glands, and female reproductive tract. Viremia lasting at least 5 days could also facilitate MARV mechanical transmission by blood sucking arthropods and infections of susceptible vertebrate hosts by direct contact with infected blood. All bats were clinically normal and no gross pathology was identified on post mortem examination. This work confirms the susceptibility of R. aegyptiacus to infection with MARV irrespective of sex and age and contributes to establishing a bat-filovirus experimental model. Further studies are required to uncover the mode of MARV transmission, and to investigate the putative role of R. aegyptiacus as a reservoir host. PMID:23029039

  16. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aflatoxin (AF)-producing fungi contaminate food and feed during preharvest, storage and processing periods. Once consumed, AF accumulates in tissues, causing illnesses in animals and humans. At least 20 different types of AFs have been identified, and of these, aflatoxin B1 (AFB1) is the most ubiqui...

  17. Virological and Serological Findings in Rousettus aegyptiacus Experimentally Inoculated with Vero Cells-Adapted Hogan Strain of Marburg Virus

    PubMed Central

    Paweska, Janusz T.; Jansen van Vuren, Petrus; Masumu, Justin; Leman, Patricia A.; Grobbelaar, Antoinette A.; Birkhead, Monica; Clift, Sarah; Swanepoel, Robert; Kemp, Alan

    2012-01-01

    The Egyptian fruit bat, Rousettus aegyptiacus, is currently regarded as a potential reservoir host for Marburg virus (MARV). However, the modes of transmission, the level of viral replication, tissue tropism and viral shedding pattern remains to be described. Captive-bred R. aegyptiacus, including adult males, females and pups were exposed to MARV by different inoculation routes. Blood, tissues, feces and urine from 9 bats inoculated by combination of nasal and oral routes were all negative for the virus and ELISA IgG antibody could not be demonstrated for up to 21 days post inoculation (p.i.). In 21 bats inoculated by a combination of intraperitoneal/subcutaneous route, viremia and the presence of MARV in different tissues was detected on days 2–9 p.i., and IgG antibody on days 9–21 p.i. In 3 bats inoculated subcutaneously, viremia was detected on days 5 and 8 (termination of experiment), with virus isolation from different organs. MARV could not be detected in urine, feces or oral swabs in any of the 3 experimental groups. However, it was detected in tissues which might contribute to horizontal or vertical transmission, e.g. lung, intestines, kidney, bladder, salivary glands, and female reproductive tract. Viremia lasting at least 5 days could also facilitate MARV mechanical transmission by blood sucking arthropods and infections of susceptible vertebrate hosts by direct contact with infected blood. All bats were clinically normal and no gross pathology was identified on post mortem examination. This work confirms the susceptibility of R. aegyptiacus to infection with MARV irrespective of sex and age and contributes to establishing a bat-filovirus experimental model. Further studies are required to uncover the mode of MARV transmission, and to investigate the putative role of R. aegyptiacus as a reservoir host. PMID:23029039

  18. Intracellular inclusions of a n-alkane-grown Arthrobacter

    SciTech Connect

    Griffin, W.M.; Traxler, R.W.

    1983-01-01

    The ultrastructural changes associated with the growth of a marine Arthrobacter sp. on n-hexadecane were demonstrated by transmission electron microscopy. Multiple electron translucent areas (ETI), similar to inclusions described by other investigators, were found in hydrocarbon-grown cells but not in peptone-grown cells. Stereological planimetry demonstrated that the ETI occupy as much as 40% of the hydrocarbon-grown cell's volume. Electron dense structures (EDI) were observed in hexadecane and in peptone-grown cells. Gas chromatographic analysis indicated traces of n-hexadecane associated with the hydrocarbon-grown cells: however, the hydrocarbon levels were not high enough to suggest the presence of hydrocarbon inclusions in the cells. Solvent partition studies with disrupted UC-n-hexadecane-grown cells suggested that the intracellular radioactivity was associated with polar compounds. Acrylate-inhibited, hydrocarbon-grown Arthrobacter sp. did not form ETI, suggesting that the formation of ETI involves the participation of Coenzyme A. Thin-layer and gas chromatography indicated that the major intracellular components were glycerides, with one or more R groups composed of palmitic acid and free palmitic acid. 27 references, 5 figures, 2 tables.

  19. Graphic Grown Up

    ERIC Educational Resources Information Center

    Kim, Ann

    2009-01-01

    It's no secret that children and YAs are clued in to graphic novels (GNs) and that comics-loving adults are positively giddy that this format is getting the recognition it deserves. Still, there is a whole swath of library card-carrying grown-up readers out there with no idea where to start. Splashy movies such as "300" and "Spider-Man" and their…

  20. 1.7eV Al0.2Ga0.8As solar cells epitaxially grown on silicon by SSMBE using a superlattice and dislocation filters

    NASA Astrophysics Data System (ADS)

    Onno, Arthur; Wu, Jiang; Jiang, Qi; Chen, Siming; Tang, Mingchu; Maidaniuk, Yurii; Benamara, Mourad; Mazur, Yuriy I.; Salamo, Gregory J.; Harder, Nils-Peter; Oberbeck, Lars; Liu, Huiyin

    2016-03-01

    Lattice-mismatched 1.7eV Al0.2Ga0.8As photovoltaic solar cells have been monolithically grown on Si substrates using Solid Source Molecular Beam Epitaxy (SSMBE). As a consequence of the 4%-lattice-mismatch, threading dislocations (TDs) nucleate at the interface between the Si substrate and III-V epilayers and propagate to the active regions of the cell. There they act as recombination centers and degrade the performances of the cell. In our case, direct AlAs/GaAs superlattice growth coupled with InAlAs/AlAs strained layer superlattice (SLS) dislocation filter layers (DFLSs) have been used to reduce the TD density from 1×109cm-2 to 1(+/-0.2)×107cm-2. Lattice-matched Al0.2Ga0.8As cells have also been grown on GaAs as a reference. The best cell grown on silicon exhibits a Voc of 964mV, compared with a Voc of 1128mV on GaAs. Fill factors of respectively 77.6% and 80.2% have been calculated. Due to the lack of an anti-reflection coating and the non-optimized architecture of the devices, relatively low Jsc have been measured: 7.30mA.cm-2 on Si and 6.74mA.cm-2 on GaAs. The difference in short-circuit currents is believed to be caused by a difference of thickness between the samples due to discrepancies in the calibration of the MBE prior to each growth. The bandgap-voltage offset of the cells, defined as Eg/q-Voc, is relatively high on both substrates with 736mV measured on Si versus 572mV on GaAs. The non-negligible TD density partly explains this result on Si. On GaAs, non-ideal growth conditions are possibly responsible for these suboptimal performances.

  1. High-efficiency, one-sun (22. 3% at air mass 0; 23. 9% at air mass 1. 5) monolithic two-junction cascade solar cell grown by metalorganic vapor phase epitaxy

    SciTech Connect

    Chung, B.; Virshup, G.F.; Werthen, J.G.

    1988-05-30

    A high-efficiency monolithic two-junction solar cell consisting of an Al/sub 0.37/Ga/sub 0.63/As (E/sub g/ = 1.93 eV) upper cell and a GaAs lower cell has been grown by metalorganic vapor phase epitaxy. Since both component cells have the n-on-p configuration, the unwanted p-n junction has been eliminated with the use of metal-interconnect contact during post-growth processing. As a two-terminal device, an efficiency of 22.3% has been achieved under 1 sun, air mass 0 illumination conditions, whereas an efficiency of 23.9% was obtained when the cascade cell was operated as a three-terminal device under 1 sun, air mass 1.5 illumination. This result represents the highest 1 sun efficiency ever reported. The advantages of utilizing this multijunction solar cell for terrestrial and space applications are also described.

  2. The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

    PubMed

    Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

    2015-04-17

    Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. PMID:25680810

  3. Porcine aminopeptidase N mediated polarized infection by porcine epidemic diarrhea virus in target cells.

    PubMed

    Cong, Yingying; Li, Xiaoxue; Bai, Yunyun; Lv, Xiaonan; Herrler, Georg; Enjuanes, Luis; Zhou, Xingdong; Qu, Bo; Meng, Fandan; Cong, Chengcheng; Ren, Xiaofeng; Li, Guangxing

    2015-04-01

    Infection of polarized intestinal epithelial cells by porcine epidemic diarrhea virus (PEDV) was characterized. Indirect immunofluorescence assay, real-time PCR, and transmission electron microscopy confirmed PEDV can be successfully propagated in immortalized swine small intestine epithelial cells (IECs). Infection involved porcine aminpeptidase N (pAPN), a reported cellular receptor for PEDV, transient expression of pAPN and siRNA targeted pAPN increased and decreased the infectivity of PEDV in IECs, respectively. Subsequently, polarized entry into and release from both Vero E6 and IECs was analyzed. PEDV entry into polarized cells and pAPN grown on membrane inserts occurs via apical membrane. The progeny virus released into the medium was also quantified which demonstrated that PEDV is preferentially released from the apical membrane. Collectively, our data demonstrate that pAPN, the cellular receptor for PEDV, mediates polarized PEDV infection. These results imply the possibility that PEDV infection may proceed by lateral spread of virus in intestinal epithelial cells. PMID:25681796

  4. Cyclic AMP stimulation of transferrin secretion by breast cancer cell grown on extracellular matrix or in two-compartment culture chambers

    SciTech Connect

    Vandewalle, B.; Hornez, L.; Revillion, F.; Lefebvre, J. )

    1991-06-28

    Extrahepatic synthesis and secretion of transferrin (Tf), the major iron-carrying protein, have been described in normal and tumoral tissues suggesting a potential role for paracrine or autocrine function. In breast tumor cell MCF-7, we have previously shown a Tf secretion stimulated by estradiol which might confer selective growth advantages of these rapidly proliferating cells. The present work refers to possible additional Tf functions related to differentiation of breast tumor cells. We induced MCF-7 cell differentiation by the cyclic AMP derivative, dibutyryl cAMP (dB cAMP) and studied Tf secretion in different culture conditions after labeling with (35S) methionine. Our results demonstrate that dB cAMP stimulates Tf secretion only in culture environment that permits access to the basolateral surface and caters to the polarity requirements of the cell. These results suggest that Tf may also act as a modulator of cellular differentiation in breast cancer cells.

  5. Effects of electron and proton irradiations on n/p and p/n GaAs cells grown by MOCVD

    NASA Technical Reports Server (NTRS)

    Weinberg, Irving; Swartz, Clifford K.; Hart, Russell E., Jr.

    1987-01-01

    State-of-the-art n/p and p/n heteroface GaAs cells, processed by metal organic chemical vapor deposition, were irradiated by 1 MeV electrons and 37 MeV protons and their performance determined as a function of fluence. It was found that the p/n cells were more radiation resistant than the n/p cells. The increased loss in the n/p cells was attributed to increases in series resistance and losses in the p-region resulting from the irradiation. The greater loss in fill factor observed for the n/p cells introduces the possibility that the presently observed superiority of the p/n cells may not be an intrinsic property of this configuration in GaAs.

  6. Differences in Chlamydia trachomatis Serovar E Growth Rate in Polarized Endometrial and Endocervical Epithelial Cells Grown in Three-Dimensional Culture▿

    PubMed Central

    Guseva, Natalia V.; Dessus-Babus, Sophie; Moore, Cheryl G.; Whittimore, Judy D.; Wyrick, Priscilla B.

    2007-01-01

    In vitro studies of obligate intracellular chlamydia biology and pathogenesis are highly dependent on the use of experimental models and growth conditions that mimic the mucosal architecture and environment these pathogens encounter during natural infections. In this study, the growth of Chlamydia trachomatis genital serovar E was monitored in mouse fibroblast McCoy cells and compared to more relevant host human epithelial endometrium-derived HEC-1B and cervix-derived HeLa cells, seeded and polarized on collagen-coated microcarrier beads, using a three-dimensional culture system. Microscopy analysis of these cell lines prior to infection revealed morphological differences reminiscent of their in vivo architecture. Upon infection, early chlamydial inclusion distribution was uniform in McCoy cells but patchy in both epithelial cell lines. Although no difference in chlamydial attachment to or entry into the two genital epithelial cell lines was noted, active bacterial genome replication and transcription, as well as initial transformation of elementary bodies to reticulate bodies, were detected earlier in HEC-1B than in HeLa cells, suggesting a faster growth, which led to higher progeny counts and titers in HEC-1B cells upon completion of the developmental cycle. Chlamydial development in the less relevant McCoy cells was very similar to that in HeLa cells, although higher progeny counts were obtained. In conclusion, this three-dimensional bead culture system represents an improved model for harvesting large quantities of infectious chlamydia progeny from their more natural polarized epithelial host cells. PMID:17088348

  7. Investigation of crystallinity and planar defects in the Si nanowires grown by vapor-liquid-solid mode using indium catalyst for solar cell applications

    NASA Astrophysics Data System (ADS)

    Ajmal Khan, Muhammad; Ishikawa, Yasuaki; Kita, Ippei; Tani, Ayumi; Yano, Hiroshi; Fuyuki, Takashi; Konagai, Makoto

    2016-01-01

    Stacking-fault-free and planar defect (twinning plane)-free In-catalyzed Si nanowires (NWs) are essential for carrier transport and nanoscale device applications. In this article, In-catalyzed, vertically aligned, and cone-shaped Si NWs on Si(111) were grown successfully, in the vapor-liquid-solid (VLS) mode. In particular, the influences of substrate temperature (TS) and cooling rate (ΔTS/Δt) on the formation of planar defects, twinning planes along the [112] direction, and stacking faults in Si NWs were investigated. When TS was decreased from 600 °C to room temperature at a rate of 100 °C/240 s after Si NW growth, twinning plane defects perpendicular to the substrate and along different segments of (111)-oriented Si NWs were observed. Finally, one simple model was proposed to explain the stacking fault formation as well as Si NW length limitation due to the In-nanoparticle (In-NP) migration, and root causes of the twinning plane defects in the Si-NWs.

  8. High spectral response and photoluminescence of Al/sub x/Ga/sub 1-x/As solar cell structures grown by metalorganic chemical vapor deposition (0. 28< or =x< or =0. 53)

    SciTech Connect

    Ludowise, M.J.; Dietze, W.T.

    1984-06-15

    Internal quantum efficiency (spectral response) data are presented for metalorganic chemical vapor deposition-grown Al/sub x/Ga/sub 1-x/As (0.28< or =x< or =0.53) solar cell structures. Quantum efficiencies as high as 90% are obtained for x = 0.28, falling to approx.45% for x = 0.53. Electron diffusion lengths are derived from these data by fitting to theoretical predictions. Photoluminescence data on the samples are also presented showing strong intensity (comparable to GaAs) for 0.28< or =x< or =0.35. Degradation in performance above x = 0.38 is attributed to increased deep level densities and direct-indirect band-edge crossover effects.

  9. N/P InP homojunction solar cells with an In0.53Ga0.47As contacting layer grown by liquid phase epitaxy

    NASA Technical Reports Server (NTRS)

    Shen, C. C.; Choi, K. Y.

    1989-01-01

    N/P InP homojunction solar cells with an In sub 0.53 Ga sub 0.47 As contacting layer were fabricated by liquid phase epitaxy (LPE). Electron-Beam-Induced-Current (EBIC) measurements were performed on several selected samples. It was found that the background doping level in the base region sometimes results in a deep junction, which greatly affects the cell performance.

  10. Chemical constituents and antiproliferative effects of cultured Mougeotia nummuloides and Spirulina major against cancerous cell lines.

    PubMed

    Erenler, Ramazan; Pabuccu, Koksal; Yaglioglu, Ayse Sahin; Demirtas, Ibrahim; Gul, Fatih

    2016-03-01

    In this study, the effect of Mougeotia nummuloides and Spirulina major on Vero cells (African green monkey kidney), C6 cells (rat brain tumor cells) and HeLa cells (human uterus carcinoma) was investigated in vitro. The antiproliferative effect of the methanol extract of M. nummuloides and S. major compared with 5-fluorourasil (5-FU) and cisplatin was tested at various concentrations using the BrdU Cell Proliferation ELISA. Both M. nummuloides and S. major extracts significantly inhibited the proliferation of Vero, HeLa and C6 cancer cell lines with IC50 and IC75 values. The M. nummuloides extract exhibited higher activity than 5-FU and cisplatin on Vero and C6 cells at high concentrations. The S. major extract revealed better antifproliferative activity than standards against Vero cells at 500 μg/mL. The compounds of methanol extracts were determined by GC-MS after the silylation process. Trehalose, monostearin and 1-monopalmitin were detected as major products in the M. nummuloides extract where as in the S. major extract; monostearin, 1-monopalmitin and hexyl alcohol were the main constituents. PMID:26985685

  11. Guidelines for the control of infection with Vero cytotoxin producing Escherichia coli (VTEC). Subcommittee of the PHLS Advisory Committee on Gastrointestinal Infections.

    PubMed

    2000-03-01

    Increasing numbers of cases of Vero cytotoxin producing Escherichia coli (VTEC) O157 infection, well published incidents, and new scientific evidence make it appropriate to produce new guidelines for their control. This document reviews the clinical and epidemiological features of VTEC O157 infection, describes the principles of microbiological investigation and laboratory safety, and presents recommendations for the prevention of spread of VTEC) O157. The recommendations consider direct spread of infection from animals, foodborne spread, the institutions in which spread is more likely to occur (nursing homes, schools, and children's day nurseries), and groups at particular risk of acquiring and transmitting infection (in essence, food handlers, and those unable to maintain high standards of hygiene for themselves and their carers). PMID:10743313

  12. What is the influence of ordinary epidermal cells and stomata on the leaf plasticity of coffee plants grown under full-sun and shady conditions?

    PubMed

    Pompelli, M F; Martins, S C V; Celin, E F; Ventrella, M C; Damatta, F M

    2010-11-01

    Stomata are crucial in land plant productivity and survival. In general, with lower irradiance, stomatal and epidermal cell frequency per unit leaf area decreases, whereas guard-cell length or width increases. Nevertheless, the stomatal index is accepted as remaining constant. The aim of this paper to study the influence of ordinary epidermal cells and stomata on leaf plasticity and the influence of these characteristics on stomata density, index, and sizes, in the total number of stomata, as well as the detailed distribution of stomata on a leaf blade. As a result, a highly significant positive correlation (R²(a) = 0.767 p ≤ 0.001) between stomatal index and stomatal density, and with ordinary epidermal cell density (R²(a) = 0.500 p ≤ 0.05), and a highly negative correlation between stomatal index and ordinary epidermal cell area (R²(a) = -0.571 p ≤ 0.001), were obtained. However in no instance was the correlation between stomatal index or stomatal density and stomatal dimensions taken into consideration. The study also indicated that in coffee, the stomatal index was 19.09% in shaded leaves and 20.08% in full-sun leaves. In this sense, variations in the stomatal index by irradiance, its causes and the consequences on plant physiology were discussed. PMID:21180918

  13. Feasibility evaluation of a new irradiation technique: three-dimensional unicursal irradiation with the Vero4DRT (MHI-TM2000)

    PubMed Central

    Mizowaki, Takashi; Takayama, Kenji; Nagano, Kazuo; Miyabe, Yuki; Matsuo, Yukinori; Kaneko, Shuji; Kokubo, Masaki; Hiraoka, Masahiro

    2013-01-01

    The Vero4DRT (MHI-TM2000) is a newly designed unique image-guided radiotherapy system consisting of an O-ring gantry. This system can realize a new irradiation technique in which both the gantry head and O-ring continuously and simultaneously rotate around the inner circumference of the O-ring and the vertical axis of the O-ring, respectively, during irradiation. This technique creates three-dimensional (3D) rotational dynamic conformal arc irradiation, which we term ‘3D unicursal irradiation’. The aim of this study was to present the concept and to estimate feasibility and potential advantages of the new irradiation technique. Collision maps were developed for the technique and a 3D unicursal plan was experimentally created in reference to the collision map for a pancreatic cancer case. Thereafter, dosimetric comparisons among the 3D unicursal, a two-dimensionally rotational dynamic conformal arc irradiation (2D–DCART), and an intensity-modulated radiation therapy (IMRT) plan were conducted. Dose volume data of the 3D unicursal plan were comparable or improved compared to those of the 2D–DCART and IMRT plans with respect to both the target and the organs at risk. The expected monitor unit (MU) number for the 3D unicursal plan was only 7% higher and 22.1% lower than the MUs for the 2D–DCART plan and IMRT plan, respectively. It is expected that the 3D unicursal irradiation technique has potential advantages in both treatment time and dose distribution, which should be validated under various conditions with a future version of the Vero4DRT fully implemented the function. PMID:22923744

  14. The induction of transformed-like morphology and enhanced growth in Syrian hamster embryo cells grown at acidic pH.

    PubMed

    LeBoeuf, R A; Kerckaert, G A

    1986-09-01

    The effect of the pH, Na+ concentration and osmolality of the culture medium on early passage Syrian hamster embryo (SHE) clonal cell proliferation was examined. The pH of the medium was adjusted from 6.49 to 7.45 by addition of different amounts of NaHCO3 to the medium and incubating the cell cultures in a fixed atmosphere of 10% CO2/90% air. Our results indicate that clonal SHE cell proliferation is optimal at pH 6.65-6.80 while plating efficiency is independent of pH between 6.65 and 7.45. Adjustment of Na+ to that concentration in the medium (3450 p.p.m., 0.15 M) of the greatest NaHCO3 addition caused a moderate depression of cell proliferation over the entire pH series. Adjusting the osmolality of the culture medium to a constant value of 338 mOsm/kg did not alter the pH effect on cell proliferation. The pH of the medium also affected cellular and colony morphology. Below pH 6.90 there was an increase in the number of colonies which exhibited a transformed-like morphology ('altered' colonies). The 'altered' phenotype was characterized by a multilayered, criss-cross pattern of growth throughout the colony. This phenotype was stable upon sub-cloning into pH 6.65 medium but was reversible if sub-cloned into pH 7.36 medium. The induction of 'altered' colonies at low pH could be partially suppressed by Na+ or osmolality adjustment. These results are discussed in terms of optimizing growth conditions for SHE cells in order to enhance their usefulness for cell transformation studies. The induction of 'altered' colonies by low pH is also discussed relative to the involvement of pH regulation in tumor-promoter and growth-factor action on cells in culture. PMID:3742717

  15. Prostate tumor grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    2001-01-01

    This prostate cancer construct was grown during NASA-sponsored bioreactor studies on Earth. Cells are attached to a biodegradable plastic lattice that gives them a head start in growth. Prostate tumor cells are to be grown in a NASA-sponsored Bioreactor experiment aboard the STS-107 Research-1 mission in 2002. Dr. Leland Chung of the University of Virginia is the principal investigator. The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. Credit: NASA and the University of Virginia.

  16. Freestanding aligned carbon nanotube array grown on a large-area single-layered graphene sheet for efficient dye-sensitized solar cell.

    PubMed

    Qiu, Longbin; Wu, Qiong; Yang, Zhibin; Sun, Xuemei; Zhang, Yuanbo; Peng, Huisheng

    2015-03-01

    A novel carbon nanomaterial with aligned carbon nanotubes (CNTs) chemically bonded to a single-layered, large area graphene sheet is designed and fabricated, showing remarkable electronic and electrocatalytic properties. When the carbon nanomaterial is used as a counter electrode, the resulting dye-sensitized solar cell exhibits ≈11% enhancement of energy conversion efficiency than aligned CNT array. PMID:24889384

  17. Comparative Characterization of Shiga Toxin Type 2 and Subtilase Cytotoxin Effects on Human Renal Epithelial and Endothelial Cells Grown in Monolayer and Bilayer Conditions

    PubMed Central

    Álvarez, Romina S.; Sacerdoti, Flavia; Jancic, Carolina; Paton, Adrienne W.; Paton, James C.; Ibarra, Cristina; Amaral, María M.

    2016-01-01

    Postdiarrheal hemolytic uremic syndrome (HUS) affects children under 5 years old and is responsible for the development of acute and chronic renal failure, particularly in Argentina. This pathology is a complication of Shiga toxin (Stx)-producing Escherichia coli infection and renal damage is attributed to Stx types 1 and 2 (Stx1, Stx2) produced by Escherichia coli O157:H7 and many other STEC serotypes. It has been reported the production of Subtilase cytotoxin (SubAB) by non-O157 STEC isolated from cases of childhood diarrhea. Therefore, it is proposed that SubAB may contribute to HUS pathogenesis. The human kidney is the most affected organ because very Stx-sensitive cells express high amounts of biologically active receptor. In this study, we investigated the effects of Stx2 and SubAB on primary cultures of human glomerular endothelial cells (HGEC) and on a human tubular epithelial cell line (HK-2) in monoculture and coculture conditions. We have established the coculture as a human renal proximal tubule model to study water absorption and cytotoxicity in the presence of Stx2 and SubAB. We obtained and characterized cocultures of HGEC and HK-2. Under basal conditions, HGEC monolayers exhibited the lowest electrical resistance (TEER) and the highest water permeability, while the HGEC/HK-2 bilayers showed the highest TEER and the lowest water permeability. In addition, at times as short as 20–30 minutes, Stx2 and SubAB caused the inhibition of water absorption across HK-2 and HGEC monolayers and this effect was not related to a decrease in cell viability. However, toxins did not have inhibitory effects on water movement across HGEC/HK-2 bilayers. After 72 h, Stx2 inhibited the cell viability of HGEC and HK-2 monolayers, but these effects were attenuated in HGEC/HK-2 bilayers. On the other hand, SubAB cytotoxicity shows a tendency to be attenuated by the bilayers. Our data provide evidence about the different effects of these toxins on the bilayers respect to the

  18. Rapid assessment of induced cytochrome P4501A protein and catalytic activity in fish hepatoma cells grown in multiwell plates: Response to TCDD, TCDF, and two planar PCBs

    SciTech Connect

    Hahn, M.E.; Woodward, B.L.; Stegeman, J.J.; Kennedy, S.W.

    1996-04-01

    Induction of cytochrome P450 1A1 (CYP1A1) in cultured cells can be used to determine taxon-specific relative potencies of Ah receptor agonists. This report describes optimized methods for growth and treatment of PLHC-1 fish hepatoma cells in multiwell plates, in situ analysis of ethoxyresorufin O-deethylase (EROD) activity, and measurement of CYP1A protein by immunoblotting of cell lysates. EROD activity was undetectable (< 1 pmol min{sup {minus}1} mg{sup {minus}1}) in untreated or dimethyl sulfoxide-treated cells, but was highly induced (up to 150 pmol min{sup {minus}1} mg{sup {minus}1}) in cells exposed to Ah receptor agonists such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), 2,3,7,8-tetrachlorodibenzofuran (TCDF), or plant chlorobiphenyls (CB). Addition of exogenous NADPH was not required for measurement of EROD activity in PLHC-1 cells. As inducers of EROD activity, TCDD, TCDF, 3,3{prime},4,4{prime},5-pentachlorobiphenyl (CB-126), and 3,3{prime},4,4{prime}-tetrachlorobiphenyl (CB-77) differed both in potency and in apparent efficacy (maximal level of induced activity). In each case, EROD induction was biphasic, with stronger induction at lower concentrations and an attenuated response at higher concentrations. In contrast, the content of immunodetectable CYP1A protein increased monotonically with dose of CB, and the maximum level achieved was similar for all inducers. The discrepancy in results obtained for EROD activity versus CYP1A protein may result from inhibition or inactivation of catalytic function at high concentrations of inducer. By reducing peak EROD values, this inhibition leads to lower apparent EC50 values and thus the overestimation of relative potencies or toxic equivalency factors (TEFs) for many inducers. These studies demonstrate the necessity of measuring both EROD activity and immunodetectable CYP1A protein for the accurate assessment of CYP1A induction and relative potencies in cultured cells.

  19. Protein content and enzyme activities in methanol- and acetate-grown Methanosarcina thermophila.

    PubMed Central

    Jablonski, P E; DiMarco, A A; Bobik, T A; Cabell, M C; Ferry, J G

    1990-01-01

    The cell extract protein content of acetate- and methanol-grown Methanosarcina thermophila TM-1 was examined by two-dimensional polyacrylamide gel electrophoresis. More than 100 mutually exclusive spots were present in acetate- and methanol-grown cells. Spots corresponding to acetate kinase, phosphotransacetylase, and the five subunits of the carbon monoxide dehydrogenase complex were identified in acetate-grown cells. Activities of formylmethanofuran dehydrogenase, formylmethanofuran:tetrahydromethanopterin formyltransferase, 5,10-methenyltetrahydromethanopterin cyclohydrolase, methylene tetrahydromethanopterin:coenzyme F420 oxidoreductase, formate dehydrogenase, and carbonic anhydrase were examined in acetate- and methanol-grown Methanosarcina thermophila. Levels of formyltransferase in either acetate- or methanol-grown Methanosarcina thermophila were approximately half the levels detected in H2-CO2-grown Methanobacterium thermoautotrophicum. All other enzyme activities were significantly lower in acetate- and methanol-grown Methanosarcina thermophila. Images FIG. 1 FIG. 2 PMID:2307649

  20. Novel Cell-Based Method To Detect Shiga Toxin 2 from Escherichia coli O157:H7 and Inhibitors of Toxin Activity▿

    PubMed Central

    Quiñones, Beatriz; Massey, Shane; Friedman, Mendel; Swimley, Michelle S.; Teter, Ken

    2009-01-01

    Escherichia coli O157:H7 is a leading cause of food-borne illness. This human pathogen produces Shiga toxins (Stx1 and Stx2) which inhibit protein synthesis by inactivating ribosome function. The present study describes a novel cell-based assay to detect Stx2 and inhibitors of toxin activity. A Vero cell line harboring a destabilized variant (half-life, 2 h) of the enhanced green fluorescent protein (d2EGFP) was used to monitor the toxin-induced inhibition of protein synthesis. This Vero-d2EGFP cell line produced a fluorescent signal which could be detected by microscopy or with a plate reader. However, a greatly attenuated fluorescent signal was detected in Vero-d2EGFP cells that had been incubated overnight with either purified Stx2 or a cell-free culture supernatant from Stx1- and Stx2-producing E. coli O157:H7. Dose-response curves demonstrated that the Stx2-induced inhibition of enhanced green fluorescent protein fluorescence mirrored the Stx2-induced inhibition of overall protein synthesis and identified a picogram-per-milliliter threshold for toxin detection. To establish our Vero-d2EGFP assay as a useful tool for the identification of toxin inhibitors, we screened a panel of plant compounds for antitoxin activities. Fluorescent signals were maintained when Vero-d2EGFP cells were exposed to Stx1- and Stx2-containing medium in the presence of either grape seed or grape pomace extract. The antitoxin properties of the grape extracts were confirmed with an independent toxicity assay that monitored the overall level of protein synthesis in cells treated with purified Stx2. These results indicate that the Vero-d2EGFP fluorescence assay is an accurate and sensitive method to detect Stx2 activity and can be utilized to identify toxin inhibitors. PMID:19139230

  1. Use of a feline respiratory epithelial cell culture system grown at the air-liquid interface to characterize the innate immune response following feline herpesvirus 1 infection.

    PubMed

    Nelli, Rahul K; Maes, Roger; Kiupel, Matti; Hussey, Gisela Soboll

    2016-03-01

    Infection with feline herpesvirus-1 (FHV-1) accounts for 50% of viral upper respiratory diseases in domestic cats and is a significant cause of ocular diseases. Despite the clinical significance and high prevalence of FHV-1 infection, currently available vaccines cannot completely protect cats from infection and lifelong latency. FHV-1 infects via the mucous membranes and replicates in respiratory epithelial cells, but very little is known about the early innate immunity at this site. To address questions about immunity to FHV-1, feline respiratory epithelial cells cultured at air-liquid interface (ALI-FRECs) were established by collecting respiratory tracts from 6 healthy cats after euthanasia. Cells were isolated, cultured and characterized histologically and immunologically before infection with FHV-1. The expression of Toll-like receptors (TLRs), cytokine and chemokine responses were measured by real time PCR. ALI-FRECs morphologically resembled the natural airways of cats with multilayered columnar epithelial cells and cilia. Immunological properties of the natural airways were maintained in ALI-FRECs, as evidenced by the expression of TLRs, cytokines, chemokines, interferons, beta-defensins, and other regulatory genes. Furthermore, ALI-FRECs were able to support infection and replication of FHV-1, as well as modulate transcriptional regulation of various immune genes in response to infection. IL-1β and TNFα were increased in ALI-FRECs by 24hpi, whereas expression levels of IFN-α and TLR9 were not increased until 36hpi. In contrast, TLR3, GM-CSF and TGF-1β expression was down-regulated at 36hpi. The data presented show the development of a system ideal for investigating the molecular pathogenesis and immunity of FHV-1 or other respiratory pathogens. PMID:26795546

  2. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation

    NASA Astrophysics Data System (ADS)

    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu

    2016-01-01

    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation.

  3. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation

    PubMed Central

    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu

    2016-01-01

    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation. PMID:26727026

  4. Angiogenic tube formation of bovine aortic endothelial cells grown on patterns formed by H2/He plasma treatment of the plasma polymerized hexamethyldisiloxane film.

    PubMed

    Park, Jisoo; Ha, Myunghoon; Lee, Hye-Rim; Park, Heonyong; Yu, Jung-Hoon; Boo, Jin-Hyo; Jung, Donggeun

    2015-01-01

    Angiogenesis, the process to generate new vessels, is necessary for normal development in children as well as the wound healing and the tumor growth in adults. Therefore, it is physiologically and/or pathophysiologically significant to monitor angiogenesis. However, classical in vitro methods to evaluate angiogenesis take a long time and are expensive. Here, the authors developed a novel method to analyze the angiogenesis in a simple and economical way, using patterned films. In this study, the authors fabricated a plasma polymerized hexamethyldisiloxane (PPHMDSO) thin film deposited by capacitively coupled plasma chemical vapor deposition system with various plasma powers. The patterned PPHMDSO film was plasma treated by 10:90 H2/He mixture gas through a metal shadow mask. The films were characterized by water contact angle, atomic force microscopy, x-ray photoelectron spectroscopy, and Fourier-transform infrared spectroscopy analyses. Our results show that the PPHMDSO film suppresses the cell adhesion, whereas surface modified PPHMDSO film enhances the cell adhesion and proliferation. From cell culture experiments, the authors found that the patterned film with 300 μm line interval was most efficient to evaluate the tube formation, a sapient angiogenic indicator. This patterned film will provide an effective and promising method for evaluating angiogenesis. PMID:25724221

  5. Potent Inhibitory Effect of δ-Tocopherol on Prostate Cancer Cells Cultured in Vitro and Grown As Xenograft Tumors in Vivo

    PubMed Central

    2015-01-01

    In the present study, the effects of δ-tocopherol (δ-T) on growth and apoptosis of human prostate cancer cells were determined and compared with that of α-tocopherol (α-T), a commonly used form of vitamin E. Treatment of human prostate cancer cells with δ-T resulted in strong growth inhibition and apoptosis stimulation, while the effects of α-T were modest. The strong effects of δ-T on the cells were associated with suppression of androgen receptor (AR) activity and decreased level of prostate specific antigen (PSA) that is a downstream target of the AR signaling. In the in vivo study, we found that δ-T had a more potent inhibitory effect on the formation and growth of prostate xenograft tumors than that of α-T. Moreover, δ-T inhibited proliferation and stimulated apoptosis in the tumors. The present study identified δ-T as a better form of vitamin E than α-T for future clinical studies of prostate cancer prevention. PMID:25322450

  6. Biological behaviour of human umbilical artery smooth muscle cell grown on nickel-free and nickel-containing stainless steel for stent implantation.

    PubMed

    Li, Liming; An, Liwen; Zhou, Xiaohang; Pan, Shuang; Meng, Xin; Ren, Yibin; Yang, Ke; Guan, Yifu

    2016-01-01

    To evaluate the clinical potential of high nitrogen nickel-free austenitic stainless steel (HNNF SS), we have compared the cellular and molecular responses of human umbilical artery smooth muscle cells (HUASMCs) to HNNF SS and 316L SS (nickel-containing austenitic 316L stainless steel). CCK-8 analysis and flow cytometric analysis were used to assess the cellular responses (proliferation, apoptosis, and cell cycle), and quantitative real-time PCR (qRT-PCR) was used to analyze the gene expression profiles of HUASMCs exposed to HNNF SS and 316L SS, respectively. CCK-8 analysis demonstrated that HUASMCs cultured on HNNF SS proliferated more slowly than those on 316L SS. Flow cytometric analysis revealed that HNNF SS could activate more cellular apoptosis. The qRT-PCR results showed that the genes regulating cell apoptosis and autophagy were up-regulated on HNNF SS. Thus, HNNF SS could reduce the HUASMC proliferation in comparison to 316L SS. The findings furnish valuable information for developing new biomedical materials for stent implantation. PMID:26727026

  7. Antigenic properties and diagnostic potential of puumala virus nucleocapsid protein expressed in insect cells.

    PubMed Central

    Vapalahti, O; Lundkvist, A; Kallio-Kokko, H; Paukku, K; Julkunen, I; Lankinen, H; Vaheri, A

    1996-01-01

    Puumala virus (PUU) is a member of the genus Hantavirus in the family Bunyaviridae and the causative agent of nephropathia epidemica, a European form of hemorrhagic fever with renal syndrome. Sera of nephropathia epidemica patients react specifically with PUU nucleocapsid (N) protein. In order to safely provide large quantities of antigen for diagnostic purposes, PUU Sotkamo strain N protein was expressed by using the baculovirus system in Sf9 insect cells to up to 30 to 50% of the total cellular protein. The recombinant N protein (bac-PUU-N) was solubilized with 6 M urea, dialyzed, and purified by anion-exchange liquid chromatography. In an immunoglobulin M mu-capture assay purified and unpurified bac-PUU-N antigen showed identical results compared with the results of a similar assay based on native PUU antigen grown in Vero E6 cells. An immunoglobulin G monoclonal antibody-capture assay based on unpurified bac-PUU-N also showed results identical to those of an assay with native PUU-N antigen. Moreover, a panel of monoclonal antibodies reactive with eight different epitopes showed identical reactivity patterns with both natural and bac-PUU-N antigen, while two epitopes in PUU-N expressed as a fusion protein in Escherichia coli were not recognized. Puumala hantavirus N protein expressed by the baculovirus system offers a safe and inexpensive source of specific antigen for large-scale diagnostic and seroepidemiological purposes. PMID:8748286

  8. Alterations of leaf cell ultrastructures and AFLP DNA profiles in Earth-grown tomato plants propagated from long-term six years Mir-flown seeds

    NASA Astrophysics Data System (ADS)

    Liu, Min; Xue, Huai; Pan, Yi; Zhang, Chunhua; Lu, Jinying

    Leaf cell ultrastructures and DNA variations in the firstand the second-generation of Earthgrown tomato (Lycopersicon esculentun Mill) plants that had been endured a long-term six years spaceflight in the Mir were compared to their ground-based control plants, under observations with a Transmission Electron Microscope and the Amplification Fragment Length Polymorphism (AFLP) analysis. For alterations in the morphological ultrastructures, one plant among the 11 first-generation plants generated from 30 Mir-flown seeds had a three-layered palisade cell structure, while other 10 first-generation plants and all ground-based controls had one-layered palisade cell structure in leaves. Starch grains were larger and in clusters, numbers of starch grains increased in the chloroplasts in the Mir-flown plants. Leaf cells became contracted and deformed, and cell shape patterns were different in the Mir-flown plants. For the leaf genomic DNA alterations, 34 DNA bands were polymorphic with a 1.32% polymorphism among 2582 DNA bands in the first-generation Mir-flown plants. Band types in the spaceflight treated plants were also different from those in the ground-based control. Of 11 survived first-generation plants, 7 spaceflight treated plants (Plant Nos. 1-6 and No. 9) had a same 7 polymorphic bands and a same 0.27%DNA mutation. The DNA mutation rate was greatest in Plants No.10 and No.7 (0.90% and 0.94%), less in Plant No.11 (0.31%) and least in Plant No.8 (0.20%). For the 38 send-generation plants propagated from the No. 5 Mir-flown seed, 6 DNA bands were polymorphic with a 0.23% polymorphism among 2564 amplified DNA bands. Among those 38 second-generation plants amplified by primer pair (E4: ACC, M8: CTT), one DNA band disappeared in 29 second-generation plants and in the original Mir-flown No. 5 plant, compared to the ground-base controls. Among the 38 second-generation plants generated from the Mir-flown No. 5 seed, the DNA band types of 29 second-generation plants were

  9. Detection of the quantity of kinesin and microgravity-sensitive kinesin genes in rat bone marrow stromal cells grown in a simulated microgravity environment

    NASA Astrophysics Data System (ADS)

    Ni, Chengzhi; Wang, Chunyan; Li, Yuan; Li, Yinghui; Dai, Zhongquan; Zhao, Dongming; Sun, Hongyi; Wu, Bin

    2011-06-01

    Kinesin and kinesin-like proteins (KLPs) constitute a superfamily of microtubule motor proteins found in all eukaryotic organisms. Members of the kinesin superfamily are known to play important roles in many fundamental cellular and developmental processes. To date, few published studies have reported on the effects of microgravity on kinesin expression. In this paper, we describe the expression pattern and microgravity-sensitive genes of kinesin in rat bone marrow stromal cells cultured in a ground-based rotating bioreactor. The quantity of kinesin under the clinorotation condition was examined by immunoblot analysis with anti-kinesin. Furthermore, the distribution of kinesin at various times during clinorotation was determined by dual immunostaining, using anti-kinesin monoclonal antibody or anti-β-tubulin monoclonal antibody. In terms of kinesin quantity, we found that the ratios of the amounts of clinorotated/stationary KLPs decreased from clinorotation day 5 to day 10, although it increased on days 2 and 3. Immunofluorescence analysis revealed that kinesin in the nucleus was the first to be affected by simulated microgravity, following the kinesin at the periphery that was affected at various times during clinorotation. Real-time RT-PCR analysis of kinesin mRNA expression was performed and led to the identification of 3 microgravity-sensitive kinesin genes: KIF9, KIFC1, and KIF21A. Our results suggest that kinesin has a distinct expression pattern, and the identification of microgravity-sensitive kinesin genes offers insight into fundamental cell biology.

  10. Quantification of confocal images of biofilms grown on irregular surfaces.

    PubMed

    Sommerfeld Ross, Stacy; Tu, Mai Han; Falsetta, Megan L; Ketterer, Margaret R; Kiedrowski, Megan R; Horswill, Alexander R; Apicella, Michael A; Reinhardt, Joseph M; Fiegel, Jennifer

    2014-05-01

    Bacterial biofilms grow on many types of surfaces, including flat surfaces such as glass and metal and irregular surfaces such as rocks, biological tissues and polymers. While laser scanning confocal microscopy can provide high-resolution images of biofilms grown on any surface, quantification of biofilm-associated bacteria is currently limited to bacteria grown on flat surfaces. This can limit researchers studying irregular surfaces to qualitative analysis or quantification of only the total bacteria in an image. In this work, we introduce a new algorithm called modified connected volume filtration (MCVF) to quantify bacteria grown on top of an irregular surface that is fluorescently labeled or reflective. Using the MCVF algorithm, two new quantification parameters are introduced. The modified substratum coverage parameter enables quantification of the connected-biofilm bacteria on top of the surface and on the imaging substratum. The utility of MCVF and the modified substratum coverage parameter were shown with Pseudomonas aeruginosa and Staphylococcus aureus biofilms grown on human airway epithelial cells. A second parameter, the percent association, provides quantified data on the colocalization of the bacteria with a labeled component, including bacteria within a labeled tissue. The utility of quantifying the bacteria associated with the cell cytoplasm was demonstrated with Neisseria gonorrhoeae biofilms grown on cervical epithelial cells. This algorithm provides more flexibility and quantitative ability to researchers studying biofilms grown on a variety of irregular substrata. PMID:24632515

  11. Characteristics of Ga-Rich Cu(In, Ga)Se2 Solar Cells Grown on Ga-Doped ZnO Back Contact.

    PubMed

    Sun, Qian; Kim, Kyoung-Bo; Jeon, Chan-Wook

    2016-05-01

    Wide bandgap Cu(In,Ga)Se2 (CIGS) thin films were deposited on Ga-rich Ga:ZnO (GZO) or MoN/GZO by single-stage co-evaporation. CIGS/TCO interface phases, such as resistive n-type Ga2O3, which are likely to have formed during the high temperature growth of Ga-rich CIGS, can deteriorate the solar cell performance. Although some Ga accumulation was observed in both of the CIGS/GZO and CIGS/MoN/GZO interfaces formed at 520 degrees C, the Ga oxide layer was absent. On the other hand, their current-voltage characteristics showed strong roll-over behavior regardless of the MoN diffusion barrier. The strong Schottky barrier formation at the CLGS/GZO junction due to the low work function of GZO, was attributed to current blocking at a high forward bias. PMID:27483870

  12. Authentication of the R06E Fruit Bat Cell Line

    PubMed Central

    Jordan, Ingo; Munster, Vincent J.; Sandig, Volker

    2012-01-01

    Fruit bats and insectivorous bats are believed to provide a natural reservoir for a wide variety of infectious diseases. Several lines of evidence, including the successful isolation of infectious viruses, indicate that Marburg virus and Ravn virus have found a major reservoir in colonies of the Egyptian rousette (Rousettus aegyptiacus). To facilitate molecular studies on virus-reservoir host interactions and isolation of viruses from environmental samples, we established cell lines from primary cells of this animal. The cell lines were given to several laboratories until we realized that a contamination with Vero cells in one of the cultures had occurred. Here we describe a general diagnostic procedure for identification of cross-species contamination with the focus on Vero and Rousettus cell lines, and summarize newly discovered properties of the cell lines that may pertain to pathogen discovery. PMID:22754654

  13. Parameters in three-dimensional osteospheroids of telomerized human mesenchymal (stromal) stem cells grown on osteoconductive scaffolds that predict in vivo bone-forming potential.

    PubMed

    Burns, Jorge S; Rasmussen, Pernille L; Larsen, Kenneth H; Schrøder, Henrik Daa; Kassem, Moustapha

    2010-07-01

    Osteoblastic differentiation of human mesenchymal stem cells (hMSC) in monolayer culture is artefactual, lacking an organized bone-like matrix. We present a highly reproducible microwell protocol generating three-dimensional ex vivo multicellular aggregates of telomerized hMSC (hMSC-telomerase reverse transcriptase (TERT)) with improved mimicry of in vivo tissue-engineered bone. In osteogenic induction medium the hMSC were transitioned with time-dependent specification toward the osteoblastic lineage characterized by production of alkaline phosphatase, type I collagen, osteonectin, and osteocalcin. Introducing a 1-2 mm(3) crystalline hydroxyapatite/beta-tricalcium phosphate scaffold generated osteospheroids with upregulated gene expression of transcription factors RUNX2/CBFA1, Msx-2, and Dlx-5. An organized lamellar bone-like collagen matrix, evident by birefringence of polarized light, was deposited in the scaffold concavities. Here, mature osteoblasts stained positively for differentiated osteoblast markers TAZ, biglycan, osteocalcin, and phospho-AKT. Quantification of collagen birefringence and relatively high expression of genes for matrix proteins, including type I collagen, biglycan, decorin, lumican, elastin, microfibrillar-associated proteins (MFAP2 and MFAP5), periostin, and tetranectin, in vitro correlated predictively with in vivo bone formation. The three-dimensional hMSC-TERT/hydroxyapatite-tricalcium phosphate osteospheroid cultures in osteogenic induction medium recapitulated many characteristics of in vivo bone formation, providing a highly reproducible and resourceful platform for improved in vitro modeling of osteogenesis and refinement of bone tissue engineering. PMID:20196644

  14. Nucleolus in clinostat-grown plants

    SciTech Connect

    Shen-Miller, J.; Dannenhoffer, J. ); Hinchman, R. )

    1991-05-01

    The clinostat is an apparatus that is used to mimic zero gravity in studies of plant growth in the absence of gravitropic response. Clinostat-grown tissue cultures of carrot exhibit significant increases both in the number of nuclei containing more than one nucleolus and in nucleolar volume. Oat seedlings germinated and grown on clinostats exhibit a decreased rate of shoot elongation, increased tissue sensitivity to applied auxin, and an increased response to gravitropic stimulation. Clinostat treatment clearly affects plant metabolism. The nucleolus is the region in the nucleus where ribosome synthesis and assembly take place. The 18S, 5.8S, and 25S ribosomal genes, in tandem units, are located in the nucleolus. Ribosomes orchestrate the production of all proteins that are necessary for the maintenance of cell growth, development, and survival. A full study of the effects of nullification of gravitropism, by clinostat rotation, on nucleolar development in barley has been initiated. The authors study developmental changes of nucleolar number and diameter in clinostat-grown root tissues. Preliminary results show that barley roots exhibit changes in nucleolar number and diameter. Growth rates of barley root and shoot also appear to be reduced, in measurements of both length and weight.

  15. Photorespiration in Air and High CO(2)-Grown Chlorella pyrenoidosa.

    PubMed

    Shelp, B J; Canvin, D T

    1981-12-01

    Oxygen inhibition of photosynthesis and CO(2) evolution during photorespiration were compared in high CO(2)-grown and air-grown Chlorella pyrenoidosa, using the artificial leaf technique at pH 5.0. High CO(2) cells, in contrast to air-grown cells, exhibited a marked inhibition of photosynthesis by O(2), which appeared to be competitive and similar in magnitude to that in higher C(3) plants. With increasing time after transfer to air, the photosynthetic rate in high CO(2) cells increased while the O(2) effect declined. Photorespiration, measured as the difference between (14)CO(2) and (12)CO(2) uptake, was much greater and sensitive to O(2) in high CO(2) cells. Some CO(2) evolution was also present in air-grown algae; however, it did not appear to be sensitive to O(2). True photosynthesis was not affected by O(2) in either case. The data indicate that the difference between high CO(2) and air-grown algae could be attributed to the magnitude of CO(2) evolution. This conclusion is discussed with reference to the oxygenase reaction and the control of photorespiration in algae. PMID:16662134

  16. The impact of meteorology on the occurrence of waterborne outbreaks of vero cytotoxin-producing Escherichia coli (VTEC): a logistic regression approach.

    PubMed

    O'Dwyer, Jean; Morris Downes, Margaret; Adley, Catherine C

    2016-02-01

    This study analyses the relationship between meteorological phenomena and outbreaks of waterborne-transmitted vero cytotoxin-producing Escherichia coli (VTEC) in the Republic of Ireland over an 8-year period (2005-2012). Data pertaining to the notification of waterborne VTEC outbreaks were extracted from the Computerised Infectious Disease Reporting system, which is administered through the national Health Protection Surveillance Centre as part of the Health Service Executive. Rainfall and temperature data were obtained from the national meteorological office and categorised as cumulative rainfall, heavy rainfall events in the previous 7 days, and mean temperature. Regression analysis was performed using logistic regression (LR) analysis. The LR model was significant (p < 0.001), with all independent variables: cumulative rainfall, heavy rainfall and mean temperature making a statistically significant contribution to the model. The study has found that rainfall, particularly heavy rainfall in the preceding 7 days of an outbreak, is a strong statistical indicator of a waterborne outbreak and that temperature also impacts waterborne VTEC outbreak occurrence. PMID:26837828

  17. CELLULAR LIPIDS OF A NOCARDIA GROWN ON PROPANE AND N-BUTANE.

    PubMed

    DAVIS, J B

    1964-07-01

    Lipid fractions of propane- and n-butane-grown nocardial cells each contain a chloroform-soluble, ether-insoluble polymer not observed previously in liquid n-alkane-grown cells. The polymer in propane-grown cells is poly-beta-hydroxybutyrate. The polymer in n-butane-grown cells apparently contains unsaturation in the molecule, and is identified tentatively as a co-polymer of beta-hydroxybutyric and beta-hydroxybutenoic (specifically 3-hydroxy 2-butenoic) acids. The other major component of the lipid fraction consists of triglycerides containing principally palmitic and stearic acids. There seems to be little qualitative distinction in the glycerides of propane- or n-butane-grown cells. Oxidative assimilation of n-butane is described. PMID:14199017

  18. Protein Crystals Grown in Space

    NASA Technical Reports Server (NTRS)

    2000-01-01

    A collage of protein and virus crystals, many of which were grown on the U.S. Space Shuttle or Russian Space Station, Mir. The crystals include the proteins canavalin; mouse monoclonal antibody; a sweet protein, thaumatin; and a fungal protease. Viruses are represented here by crystals of turnip yellow mosaic virus and satellite tobacco mosaic virus. The crystals are photographed under polarized light (thus causing the colors) and range in size from a few hundred microns in edge length up to more than a millimeter. All the crystals are grown from aqueous solutions and are useful for X-ray diffraction analysis. Credit: Dr. Alex McPherson, University of California, Irvine.

  19. Evidence that an internal carbonic anhydrase is present in 5% CO/sub 2/-grown and air-grown Chlamydomonas. [Chlamydomonas reinhardtii

    SciTech Connect

    Moroney, J.V.; Togasaki, R.K.; Husic, H.D.; Tolbert, N.E.

    1987-07-01

    Inorganic carbon (C/sub i/) uptake was measured in wild-type cells of Chlamydomonas reinhardtii, and in cia-3, a mutant strain of C. reinhardtii that cannot grow with air levels of CO/sub 2/. Both air-grown cells, that have a CO/sub 2/ concentrating system, and 5% CO/sub 2/-grown cells that do not have this system, were used. When the external pH was 5.1 or 7.3, air-grown, wild-type cells accumulated inorganic carbon (C/sub i/) and this accumulation was enhanced when the permeant carbonic anhydrase inhibitor, ethoxyzolamide, was added. When the external pH was 5.1, 5% CO/sub 2/-grown cells also accumulated some C/sub i/, although not as much as air-grown cells and this accumulation was stimulated by the addition of ethoxyzolamide. At the same time, ethoxyzolamide inhibited CO/sub 2/ fixation by high CO/sub 2/-grown, wild-type cells at both pH 5.1 and 7.3. These observations imply that 5% CO/sub 2/-grown, wild-type cells, have a physiologically important internal carbonic anhydrase, although the major carbonic anhydrase located in the periplasmic space is only present in air-grown cells. Inorganic carbon uptake by cia-3 cells supported this conclusion. This mutant strain, which is thought to lack an internal carbonic anhydrase, was unaffected by ethoxyzolamide at pH 5.1. Other physiological characteristics of cia-3 resemble those of wild-type cells that have been treated with ethoxyzolamide. It is concluded that an internal carbonic anhydrase is under different regulatory control than the periplasmic carbonic anhydrase.

  20. Analysis of thymic stromal cell subpopulations grown in vitro on extracellular matrix in defined medium. III. Growth conditions of human thymic epithelial cells and immunomodulatory activities in their culture supernatant.

    PubMed Central

    Schreiber, L; Eshel, I; Meilin, A; Sharabi, Y; Shoham, J

    1991-01-01

    We report here on a new approach to the cultivation of human thymic epithelial (HTE) cells, which apparently allows more faithful preservation of cell function. This approach, previously developed by us for mouse thymic epithelial (MTE) cells, is based on the use of culture plates coated with extracellular matrix (ECM), and on the use of serum-free, growth factor-supplemented medium. The nutritional requirements of HTE and MTE are somewhat different. Although both are critically dependent on ECM and insulin, they differ in their dependency on other growth factors: selenium and transferrin are much more important for HTE cells, whereas epidermal growth factor and hydrocortisone play a more essential role in MTE cultures. The epithelial nature of the cultured cells is indicated by positive staining with anti-keratin antibodies and by the presence of desmosomes and tonofilaments. The ultrastructural appearance of the cells further suggests high metabolic and secretory activities, not usually found in corresponding cell lines. The culture supernatant (CS) of HTE cells exhibited a strong enhancing effect on thymocyte response to Con A stimulation, as measured by cell proliferation and lymphokine production. The effect was observed on both human and mouse thymocytes, but was much stronger in the homologous combination. Thymic factors tested in parallel did not have such a differential effect. The dose-effect relationships were in the form of a bell-shaped curve, with fivefold enhancement of response at the peak and a measurable effect even with 1:1000 dilution, when human thymocytes were used. The responding thymocytes were those which do not bind peanut agglutinin and are resistant to hydrocortisone. The culture system described here may have advantages for the in vitro study of thymic stromal cell function. Images Figure 1 Figure 3 Figure 4 PMID:1783421

  1. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Dr. Lisa E. Freed of the Massachusetts Institute of Technology and her colleagues have reported that initially disc-like specimens of cartilage tend to become spherical in space, demonstrating that tissues can grow and differentiate into distinct structures in microgravity. The Mir Increment 3 (Sept. 16, 1996 - Jan. 22, 1997) samples were smaller, more spherical, and mechanically weaker than Earth-grown control samples. These results demonstrate the feasibility of microgravity tissue engineering and may have implications for long human space voyages and for treating musculoskeletal disorders on earth. Constructs grown on Mir (A) tended to become more spherical, whereas those grown on Earth (B) maintained their initial disc shape. These findings might be related to differences in cultivation conditions, i.e., videotapes showed that constructs floated freely in microgravity but settled and collided with the rotating vessel wall at 1g (Earth's gravity). In particular, on Mir the constructs were exposed to uniform shear and mass transfer at all surfaces such that the tissue grew equally in all directions, whereas on Earth the settling of discoid constructs tended to align their flat circular areas perpendicular to the direction of motion, increasing shear and mass transfer circumferentially such that the tissue grew preferentially in the radial direction. A and B are full cross sections of constructs from Mir and Earth groups shown at 10-power. C and D are representative areas at the construct surfaces enlarged to 200-power. They are stained red with safranin-O. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Photo credit: Proceedings of the National Academy of Sciences.

  2. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    2001-01-01

    Dr. Lisa E. Freed of the Massachusetts Institute of Technology and her colleagues have reported that initially disc-like specimens tend to become spherical in space, demonstrating that tissues can grow and differentiate into distinct structures in microgravity. The Mir Increment 3 (Sept. 16, 1996 - Jan. 22, 1997) samples were smaller, more spherical, and mechanically weaker than Earth-grown control samples. These results demonstrate the feasibility of microgravity tissue engineering and may have implications for long human space voyages and for treating musculoskeletal disorders on earth. Final samples from Mir and Earth appeared histologically cartilaginous throughout their entire cross sections (5-8 mm thick), with the exception of fibrous outer capsules. Constructs grown on Earth (A) appeared to have a more organized extracellular matrix with more uniform collagen orientation as compared with constructs grown on Mir (B), but the average collagen fiber diameter was similar in the two groups (22 +- 2 nm) and comparable to that previously reported for developing articular cartilage. Randomly oriented collagen in Mir samples would be consistent with previous reports that microgravity disrupts fibrillogenesis. These are transmission electron micrographs of constructs from Mir (A) and Earth (B) groups at magnifications of x3,500 and x120,000 (Inset). The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Credit: Proceedings of the National Academy of Sciences.

  3. Extremely low-frequency electromagnetic fields cause DNA strand breaks in normal cells

    PubMed Central

    2014-01-01

    Background Extremely low frequency electromagnetic fields aren’t considered as a real carcinogenic agent despite the fact that some studies have showed impairment of the DNA integrity in different cells lines. The aim of this study was evaluation of the late effects of a 100 Hz and 5.6 mT electromagnetic field, applied continuously or discontinuously, on the DNA integrity of Vero cells assessed by alkaline Comet assay and by cell cycle analysis. Normal Vero cells were exposed to extremely low frequency electromagnetic fields (100 Hz, 5.6 mT) for 45 minutes. The Comet assay and cell cycle analysis were performed 48 hours after the treatment. Results Exposed samples presented an increase of the number of cells with high damaged DNA as compared with non-exposed cells. Quantitative evaluation of the comet assay showed a significantly (<0.001) increase of the tail lengths, of the quantity of DNA in tail and of Olive tail moments, respectively. Cell cycle analysis showed an increase of the frequency of the cells in S phase, proving the occurrence of single strand breaks. The most probable mechanism of induction of the registered effects is the production of different types of reactive oxygen species. Conclusions The analysis of the registered comet indices and of cell cycle showed that extremely low frequency electromagnetic field of 100 Hz and 5.6 mT had a genotoxic impact on Vero cells. PMID:24401758

  4. Tissue grown in space in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    1998-01-01

    For 5 days on the STS-70 mission, a bioreactor cultivated human colon cancer cells, such as the culture section shown here, which grew to 30 times the volume of control specimens grown on Earth. This significant result was reproduced on STS-85 which grew mature structures that more closely match what are found in tumors in humans. The two white circles within the tumor are part of a plastic lattice that helped the cells associate. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators.

  5. Electron microscopy of Mycoplasma pneumoniae microcolonies grown on solid surfaces.

    PubMed Central

    Kim, C K; Pfister, R M; Somerson, N L

    1977-01-01

    Mycoplasma pneumoniae sprain CL-8 was studied by using various surfaces for adherence and growth. Cells grown on Epon 812, Formvar, carbon, and glass were of similar morphology. Thin Epon pieces were good material for culturing the organisms and examining thin-sectioned microcolonies by transmission electron microscopy. Images PMID:931378

  6. A Novel Cell-Based Method to Detect Shiga Toxin 2 from Escherichia coli O157:H7 and Inhibitors of Toxin Activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Escherichia coli O157:H7 is a leading cause of foodborne illness. This human pathogen produces Shiga toxins (Stx1 and Stx2) which inhibit protein synthesis by inactivating ribosome function. The present study describes a novel cell-based assay to detect Stxs and inhibitors of Stx activity. A Vero...

  7. Partial purification and characterization of an escherichia coli toxic factor that induces morphological cell alterations.

    PubMed Central

    Caprioli, A; Falbo, V; Roda, L G; Ruggeri, F M; Zona, C

    1983-01-01

    A factor produced by several strains of Escherichia coli isolated from enteritis-affected children has been shown to produce both a necrotizing effect on rabbit skin and striking morphological alterations on CHO, Vero, and HeLa cells. The same strains were found to have hemolytic activity on sheep erythrocytes. The toxic, cell-altering factor was demonstrated to be different from both heat-labile and heat-stable enterotoxins and from Vero toxin. The main effect induced by the isolated factor on cultured cells was the formation of large multinucleated cells. The partial purification achieved suggests that the same factor (most likely a protein with a molecular weight of 70,000 to 80,000) is responsible for toxic and cell-altering activities, whereas a different molecular species is responsible for hemolytic activity. Images PMID:6341235

  8. Response to copper of Acidithiobacillus ferrooxidans ATCC 23270 grown in elemental sulfur.

    PubMed

    Almárcegui, Rodrigo J; Navarro, Claudio A; Paradela, Alberto; Albar, Juan Pablo; von Bernath, Diego; Jerez, Carlos A

    2014-11-01

    The response of Acidithiobacillus ferrooxidans ATCC 23270 to copper was analyzed in sulfur-grown cells by using quantitative proteomics. Forty-seven proteins showed altered levels in cells grown in the presence of 50 mM copper sulfate. Of these proteins, 24 were up-regulated and 23 down-regulated. As seen before in ferrous iron-grown cells, there was a notorious up-regulation of RND-type Cus systems and different RND-type efflux pumps, indicating that these proteins are very important in copper resistance. Copper also triggered the down-regulation of the major outer membrane porin of A. ferrooxidans in sulfur-grown bacteria, suggesting they respond to the metal by decreasing the influx of cations into the cell. On the contrary, copper in sulfur-grown cells caused an overexpression of putative TadA and TadB proteins known to be essential for biofilm formation in bacteria. Surprisingly, sulfur-grown microorganisms showed increased levels of proteins related with energy generation (rus and petII operons) in the presence of copper. Although rus operon is overexpressed mainly in cells grown in ferrous iron, the up-regulation of rusticyanin in sulfur indicates a possible role for this protein in copper resistance as well. Finally, copper response in A. ferrooxidans appears to be influenced by the substrate being oxidized by the microorganism. PMID:25041950

  9. Comparative sensitivity of four different cell lines for the isolation of Coxiella burnetii.

    PubMed

    Lockhart, Michelle G; Islam, Aminul; Fenwick, Stan G; Graves, Stephen R; Stenos, John

    2012-09-01

    Coxiella burnetii is an obligate intracellular bacterium that causes the disease Q-fever. This is usually diagnosed by serology (immunofluorescence assay) and/or PCR detection of C. burnetii DNA. However, neither of these methods can determine the viability of the bacterium. Four different cell lines were compared for their ability to amplify very low numbers of viable C. burnetii. Two different isolates of C. burnetii were used. For the Henzerling isolate, DH82 (dog macrophage) cells were the most sensitive with an ID (50) (dose required to infect 50% of cell cultures) of 14.6 bacterial copies. For the Arandale isolate, Vero (monkey epithelial) cells were the most sensitive with an ID (50) of less than one bacterium in a 100-μL inoculum. The Vero cell line appeared highly useful as vacuoles could be seen microscopically in unstained infected cells. The findings of this study favour the use of Vero and DH82 tissue culture cell lines for isolation and growth of C. burnetii in vitro. The other cell lines, XTC-2 and L929, were less suitable. PMID:22681323

  10. Electron microscopy studies on Gardnerella vaginalis grown in conventional and biofilm systems.

    PubMed

    Muli, F W; Struthers, J K; Tarpey, P A

    1999-02-01

    The cell-wall characteristics of Gardnerella vaginalis grown in conventional and biofilm systems were studied by electron microscopy. The gram-positive nature of the cell wall was confirmed. Novel cell-wall particles which appeared to be associated with cell division were also identified, particularly in organisms of biofilm origin. PMID:9989650

  11. Chromosome Conformation of Human Fibroblasts Grown in 3-Dimensional Spheroids

    PubMed Central

    Chen, Haiming; Comment, Nicholas; Chen, Jie; Ronquist, Scott; Hero, Alfred; Ried, Thomas; Rajapakse, Indika

    2015-01-01

    In the study of interphase chromosome organization, genome-wide chromosome conformation capture (Hi-C) maps are often generated using 2-dimensional (2D) monolayer cultures. These 2D cells have morphological deviations from cells that exist in 3-dimensional (3D) tissues in vivo, and may not maintain the same chromosome conformation. We used Hi-C maps to test the extent of differences in chromosome conformation between human fibroblasts grown in 2D cultures and those grown in 3D spheroids. Significant differences in chromosome conformation were found between 2D cells and those grown in spheroids. Intra-chromosomal interactions were generally increased in spheroid cells, with a few exceptions, while inter-chromosomal interactions were generally decreased. Overall, chromosomes located closer to the nuclear periphery had increased intra-chromosomal contacts in spheroid cells, while those located more centrally had decreased interactions. This study highlights the necessity to conduct studies on the topography of the interphase nucleus under conditions that mimic an in vivo environment. PMID:25738643

  12. Nuclear Factor of Activated T-cells (NFAT) plays a role in SV40 infection

    PubMed Central

    Manley, Kate; O’Hara, Bethany A; Atwood, Walter J

    2008-01-01

    Recent evidence highlighted a role for the transcription factor, Nuclear Factor of Activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through κB sites located within the 72bp repeated enhancer region. In Vero cells NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter. PMID:18031784

  13. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.

    2008-03-01

    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  14. Influence of FcγRIIa-Expressing Cells on the Assessment of Neutralizing and Enhancing Serum Antibodies Elicited by a Live-Attenuated Tetravalent Dengue Vaccine.

    PubMed

    Byers, Anthony M; Broder, Ryan; Haupfear, Kelly; Timiryasova, Tatyana M; Hu, Branda T; Boaz, Mark; Warren, William L; Jackson, Nicholas; Moser, Janice M; Guy, Bruno

    2015-12-01

    Background.  Recent trials of recombinant, live-attenuated chimeric yellow fever-dengue tetravalent dengue vaccine (CYD-TDV) demonstrated efficacy against symptomatic, virologically confirmed dengue disease with higher point estimates of efficacy toward dengue virus (DENV)3 and DENV4 and moderate levels toward DENV1 and DENV2. It is interesting to note that serotype-specific efficacy did not correlate with absolute neutralizing antibody (nAb) geometric mean titer (GMT) values measured in a Vero-based plaque reduction neutralization test assay. The absence of Fcγ receptors on Vero cells may explain this observation. Methods.  We performed parallel seroneutralization assays in Vero cells and CV-1 cells that express FcγRIIa (CV-1-Fc) to determine the neutralizing and enhancing capacity of serotype-specific DENV Abs present in CYD-TDV clinical trial sera. Results.  Enhancement of DENV infection was observed in CV-1-Fc cells in naturally exposed nonvaccine sera, mostly for DENV3 and DENV4, at high dilutions. The CYD-TDV-vaccinated sera showed similar enhancement patterns. The CV-1-Fc nAb GMT values were 2- to 9-fold lower than Vero for all serotypes in both naturally infected individuals and CYD-TDV-vaccinated subjects with and without previous dengue immunity. The relative (CV-1-Fc/Vero) GMT decrease for anti-DENV1 and anti-DENV2 responses was not greater than for the other serotypes. Conclusions.  In vitro neutralization assays utilizing FcγRIIa-expressing cells provide evidence that serotype-specific Ab enhancement may not be a primary factor in the serotype-specific efficacy differences exhibited in the CYD-TDV trials. PMID:26719844

  15. In vitro toxicity of rivastigmine and donepezil in cells of epithelial origin.

    PubMed

    Goldblum, David; Gygax, Monika; Böhnke, Mattias; Garweg, Justus G

    2002-01-01

    Neurospecific acetylcholinesterase inhibitors have been shown to lower intraocular pressure (IOP) in normal rabbits and might have additional neuroprotective effects. This study was set out to explore and compare the toxicity of two selective acetylcholinesterase inhibitors, rivastigmine and donepezil, on two standardized cell lines of epithelial origin. Chang and Vero cells were incubated with various concentrations of rivastigmine or donepezil. Acute toxicity (4 h) was assessed by monitoring the permeability of cells to propidium iodide. Chronic toxicity (7 days) was determined by monitoring the effect of the two drugs on esterase activity and cell proliferation. The viability of cells was also assessed morphologically by microscopic inspection. Signs of acute toxicity became manifest at a rivastigmine concentration of 50 mg/ml in both Chang and Vero cells. Indications of chronic toxicity became obvious at concentrations of as low as 1 x 10(-5) mg/ml. In contrast, degenerative morphological changes became manifest only at a concentration of as high as 1 mg/ml. In donepezil-treated cells, acute toxicity was not observed in the concentration range tested, whereas chronic toxicity was detected at 1 x 10(-1) mg/ml in both Chang and Vero cells, a concentration at which degenerative morphological changes became evident as well. In contrast to rivastigmine, donepezil elicited no signs of acute or chronic toxicity in either Chang or Vero cells at the IOP-lowering concentration of 1 x 10(-4) mg/ml. At this dose, the drug is therefore unlikely to evoke deleterious effects on ocular surface tissues in the clinical setting. PMID:11914613

  16. Comparative analysis of the lipids of Acinetobacter species grown on hexadecane.

    PubMed Central

    Makula, R A; Lockwood, P J; Finnerty, W R

    1975-01-01

    A comparative analysis of the cellular and extracellular lipids of Acinetobacter species HO1-N indicated basic physiological differences in hexadecane-grown cells. The cellular lipids obtained from hexadecane-grown cells were characterized by 3- and 18-fold increases in the phospholipid fraction and the mono- and diglyceride fraction, respectively, over that obtained from nutrient broth-yeast extract-grown cells. The cellular-associated pools of hexadecane were shown to comprise approximately 8% of the dry cell weight of hexadecane-grown cells. The extracellular lipids obtained from the culture broths of hexadecane-grown cells were comprised of triglyceride, mono- and diglyceride, free fatty acid, and wax ester. These lipids were either absent or present in minor concentrations in the culture broths of nutrient broth-yeast extract-grown cells. The exponential growth of Acinetobacter sp. on hexadecane was characterized by the significant accumulation of free fatty acid, monoglyceride, and diglyceride in the culture medium. Wax ester was shown to represent a minor portion of the extracellular lipids during the exponential growth phase, appearing in significant proportion only after the culture had entered the stationary phase of growth. PMID:1116989

  17. High-efficiency solar cells fabricated from direct-current magnetron sputtered n-indium tin oxide onto p-InP grown by atmospheric pressure metalorganic vapor phase epitaxy

    NASA Technical Reports Server (NTRS)

    Li, X.; Wanlass, M. W.; Gessert, T. A.; Emery, K. A.; Coutts, T. J.

    1989-01-01

    An attempt is made to improve device efficiencies by depositing indium tin oxide onto epitaxially grown p-InP on p(+)-InP substrates. This leads to a reduction in the device series resistance, high-quality reproducible surfaces, and an improvement in the transport properties of the base layer. Moreover, many of the facets associated with badly characterized bulk liquid encapsulated Czochralski substrates used in previous investigations are removed in this way.

  18. Harvesting microalgae grown on wastewater.

    PubMed

    Udom, Innocent; Zaribaf, Behnaz H; Halfhide, Trina; Gillie, Benjamin; Dalrymple, Omatoyo; Zhang, Qiong; Ergas, Sarina J

    2013-07-01

    The costs and life cycle impacts of microalgae harvesting for biofuel production were investigated. Algae were grown in semi-continuous culture in pilot-scale photobioreactors under natural light with anaerobic digester centrate as the feed source. Algae suspensions were collected and the optimal coagulant dosages for metal salts (alum, ferric chloride), cationic polymer (Zetag 8819), anionic polymer (E-38) and natural coagulants (Moringa Oleifera and Opuntia ficus-indica cactus) were determined using jar tests. The relative dewaterability of the algae cake was estimated by centrifugation. Alum, ferric chloride and cationic polymer could all achieve >91% algae recovery at optimal dosages. Life cycle assessment (LCA) and cost analysis results revealed that cationic polymer had the lowest cost but the highest environmental impacts, while ferric chloride had the highest cost and lowest environmental impacts. Based on the LCA results, belt presses are the recommended algae dewatering technology prior to oil extraction. PMID:23648758

  19. Characteristics of Nipah virus and Hendra virus replication in different cell-lines and their suitability for anti-viral screening

    PubMed Central

    Aljofan, Mohamad; Saubern, Simon; Meyer, Adam G.; Marsh, Glenn; Meers, Joanne; Mungall, Bruce A.

    2009-01-01

    We have recently described the development and validation of a High Throughput Screening assay suitable for Henipavirus antiviral identification. While we are confident this assay is robust and effective, we wished to investigate assay performance in a range of alternative cell lines to determine if assay sensitivity and specificity could be improved. We evaluated ten different cell lines for their susceptibility to Hendra and Nipah virus infection and their sensitivity of detection of the effects of the broad spectrum antiviral, ribavirin and nine novel antivirals identified using our initial screening approach. Cell lines were grouped into three categories with respect to viral replication. Virus replicated best in Vero and BSR cells, followed by Hep2, HeLa, BHK-21 and M17 cells. The lowest levels of RNA replication and viral protein expression were observed in BAEC, MMEC, A549 and ECV304 cells. Eight cell lines appeared to be similarly effective at discriminating the antiviral effects of ribavirin (<2.7 fold difference). The two cells lines most sensitive to the effect of ribavirin (ECV304 and BAEC) also displayed the lowest levels of viral replication while Vero cells were the least sensitive suggesting excess viral replication may limit drug efficacy and cell lines which limit viral replication may result in enhanced antiviral efficacy. However, there was no consistent trend observed with the other nine antivirals tested. While improvements in antiviral sensitivity in other cell lines may indicate an important role in future HTS assays, the slightly lower sensitivity to antiviral detection in Vero cells has inherent advantages in reducing the number of partially effective lead molecules identified during initial screens. Comparison of a panel of 54 novel antiviral compounds identified during routine screening of an in-house compound library in Vero, BHK-21 and BSR cells suggests no clear advantage of screening in either cell type. PMID:19428741

  20. Pullulan production by Aureobasidium pullulans grown on ethanol stillage as a nitrogen source.

    PubMed

    West, T P; Strohfus, B

    1996-01-01

    Pullulan production by Aureobasidium pullulans strain RP-1 using thin stillage from fuel ethanol production as a nitrogen source was studied in a medium using corn syrup as a carbon source. The use of 1% thin stillage as a nitrogen source instead of ammonium sulphate elevated polysaccharide production by strain RP-1 cells when grown on a concentration of up to 7.5% corn syrup, independent of yeast extract supplementation. Dry weights of cells grown in medium containing ammonium sulphate as the nitrogen source were higher than the stillage-grown cells after 7 days of growth. The viscosity of the polysaccharide on day 7 was higher for cells grown on thin stillage rather than ammonium sulphate as a nitrogen source. The pullulan content of the polysaccharide elaborated by ammonium sulphate-grown cells on day 7 was higher than the pullulan content of polysaccharide produced by stillage-grown cells regardless of whether yeast extract was added to the culture medium. PMID:9121381

  1. Characterization of dengue virus 2 growth in megakaryocyte-erythrocyte progenitor cells.

    PubMed

    Clark, Kristina B; Hsiao, Hui-Mien; Bassit, Leda; Crowe, James E; Schinazi, Raymond F; Perng, Guey Chuen; Villinger, Francois

    2016-06-01

    Megakaryocyte-erythrocyte progenitor (MEP) cells are potential in vivo targets of dengue virus (DENV); the virus has been found associated with megakaryocytes ex vivo and platelets during DENV-induced thrombocytopenia. We report here that DENV serotype 2 (DENV2) propagates well in human nondifferentiated MEP cell lines (Meg01 and K562). In comparison to virus propagated in Vero cells, viruses from MEP cell lines had similar structure and buoyant density. However, differences in MEP-DENV2 stability and composition were suggested by distinct protein patterns in western blot analysis. Also, antibody neutralization of envelope domain I/II on MEP-DENV2 was reduced relative to that on Vero-DENV2. Infectious DENV2 was produced at comparable kinetics and magnitude in MEP and Vero cells. However, fewer virion structures appeared in electron micrographs of MEP cells. We propose that DENV2 infects and produces virus efficiently in megakaryocytes and that megakaryocyte impairment might contribute to dengue disease pathogenesis. PMID:27058763

  2. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.

    1981-04-01

    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  3. Infectious dengue vesicles derived from CD61+ cells in acute patient plasma exhibited a diaphanous appearance

    PubMed Central

    Hsu, Alan Yi-Hui; Wu, Shang-Rung; Tsai, Jih-Jin; Chen, Po-Lin; Chen, Ya-Ping; Chen, Tsai-Yun; Lo, Yu-Chih; Ho, Tzu-Chuan; Lee, Meed; Chen, Min-Ting; Chiu, Yen-Chi; Perng, Guey Chuen

    2015-01-01

    The levels of neutralizing antibody to a pathogen are an effective indicator to predict efficacy of a vaccine in trial. And yet not all the trial vaccines are in line with the theory. Using dengue virus (DENV) to investigate the viral morphology affecting the predictive value, we evaluated the viral morphology in acute dengue plasma compared to that of Vero cells derived DENV. The virions in plasma were infectious and heterogeneous in shape with a “sunny-side up egg” appearance, viral RNA was enclosed with CD61+ cell-derived membrane interspersed by the viral envelope protein, defined as dengue vesicles. The unique viral features were also observed from ex vivo infected human bone marrow. Dengue vesicles were less efficiently neutralized by convalescent patient serum, compared to virions produced from Vero cells. Our results exhibit a reason why potencies of protective immunity fail in vivo and significantly impact dengue vaccine and drug development. PMID:26657027

  4. Tissue grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Cells from kidneys lose some of their special features in conventional culture but form spheres replete with specialized cell microvilli (hair) and synthesize hormones that may be clinically useful. Ground-based research studies have demonstrated that both normal and neoplastic cells and tissues recreate many of the characteristics in the NASA bioreactor that they display in vivo. Proximal kidney tubule cells that normally have rich apically oriented microvilli with intercellular clefts in the kidney do not form any of these structures in conventional two-dimensional monolayer culture. However, when normal proximal renal tubule cells are cultured in three-dimensions in the bioreactor, both the microvilli and the intercellular clefts form. This is important because, when the morphology is recreated, the function is more likely also to be rejuvenated. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC).

  5. Characterization of sodium chloride crystals grown in microgravity

    NASA Astrophysics Data System (ADS)

    Fontana, Pietro; Schefer, Jürg; Pettit, Donald

    2011-06-01

    NaCl crystals grown by the evaporation of an aqueous salt solution in microgravity on the International Space Station (ISS) were characterized and compared to salt crystals grown on earth. NaCl crystallized as thin wafers in a supersaturated film of 200-700 μm thickness and 50 mm diameter, or as hopper cubes in 10 mm diameter supersaturated spheres. Neutron diffraction shows no change in crystal structure and in cell parameters compared to earth-grown crystals. However, the morphology can be different, frequently showing circular, disk-like shapes of single crystals with <1 1 1> perpendicular to the disks, an unusual morphology for salt crystals. In contrast to the growth on earth the lateral faces of the microgravity tabular hopper crystals are symmetrical because they are free floating during the crystallization process. Hopper cubes were produced without the need to suspend the growing crystals by an ongoing stirring. "Fleur de Sel" is shown as an example of two-dimensional growth of salt on earth and compared to the space grown crystals. It is shown that in microgravity conditions brine fluid inclusions form within the salt crystals.

  6. Cooling by means of passively grown ice

    SciTech Connect

    Gorski, A.; Schertz, W.; Wantroba, A.; Rush, R.; Falkenberg, J.

    1981-01-01

    A solar cooling technique is described that uses ice passively-grown the previous winter. Using heat pipes (thermal syphons), ice is grown and stored in the same container ready for the coming cooling season. This modern adaption of an old cooling technique may have side application both in this country as well as in more northern regions.

  7. Vitamin C content of organically grown produce

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organically grown produce is the fastest growing sector of fresh market sales in the U.S. While accounting for only 3% of total produce sales, it is growing by 20% per year. There has been much debate over the relative health merits of organically grown fruits and vegetables. Most consumers believ...

  8. Phase I clinical trial with IL-2-transfected xenogeneic cells administered in subcutaneous metastatic tumours: clinical and immunological findings

    PubMed Central

    Tartour, E; Mehtali, M; Sastre-Garau, X; Joyeux, I; Mathiot, C; Pleau, J M; Squiban, P; Rochlitz, C; Courtney, M; Jantscheff, P; Herrmann, R; Pouillart, P; Fridman, W H; Dorval, T

    2000-01-01

    Various studies have emphasized an immunodepression state observed at the tumour site. To reverse this defect and based upon animal studies, we initiated a phase I clinical trial of gene therapy in which various doses of xenogeneic monkey fibroblasts (Vero cells) genetically engineered to produce human IL-2 were administered intratumorally in 8 patients with metastatic solid tumours. No severe adverse effect was observed in the 8 patients analysed during this clinical trial even in the highest dose (5 ¥ 107 cells) group. This absence of toxicity seems to be associated with rapid elimination of Vero-IL-2 cells from the organism. Indeed, exogenous IL-2 mRNA could no longer be detected in the peripheral whole blood 48 hours after Vero-IL-2 cell administration. In addition, we did not find any expression of exogenous IL-2 mRNA in post-therapeutic lesions removed 29 days after the start of therapy. A major finding of this trial concerns the two histological responses of two treated subcutaneous nodules not associated with an apparent clinical response. The relationship between local treatment and tumour regression was supported by replacement of tumour cells by inflammatory cells in regressing lesions and marked induction of T and natural killer cell derived cytokines (IL-2, IL-4, IFNg …) in post-therapeutic lesions analysed 28 days after the start of Vero-IL-2 administration. Gene therapy using xenogeneic cells as vehicle may therefore present certain advantages over other vectors, such as its complete absence of toxicity. Furthermore, the in vivo biological effect of immunostimulatory genes, i.e IL-2-, may be potentiated by the xenogeneic rejection reaction. © 2000 Cancer Research Campaign http://www.bjcancer.com PMID:11076653

  9. SU-E-J-70: Feasibility Study of Dynamic Arc and IMRT Treatment Plans Utilizing Vero Treatment Unit and IPlan Planning Computer for SRS/FSRT Brain Cancer Patients

    SciTech Connect

    Huh, S; Lee, S; Dagan, R; Malyapa, R; Mendenhall, N; Mendenhall, W; Ho, M; Hough, D; Yam, M; Li, Z

    2014-06-01

    Purpose: To investigate the feasibility of utilizing Dynamic Arc (DA) and IMRT with 5mm MLC leaf of VERO treatment unit for SRS/FSRT brain cancer patients with non-invasive stereotactic treatments. The DA and IMRT plans using the VERO unit (BrainLab Inc, USA) are compared with cone-based planning and proton plans to evaluate their dosimetric advantages. Methods: The Vero treatment has unique features like no rotational or translational movements of the table during treatments, Dynamic Arc/IMRT, tracking of IR markers, limitation of Ring rotation. Accuracies of the image fusions using CBCT, orthogonal x-rays, and CT are evaluated less than ∼ 0.7mm with a custom-made target phantom with 18 hidden targets. 1mm margin is given to GTV to determine PTV for planning constraints considering all the uncertainties of planning computer and mechanical uncertainties of the treatment unit. Also, double-scattering proton plans with 6F to 9F beams and typical clinical parameters, multiple isocenter plans with 6 to 21 isocenters, and DA/IMRT plans are evaluated to investigate the dosimetric advantages of the DA/IMRT for complex shape of targets. Results: 3 Groups of the patients are divided: (1) Group A (complex target shape), CI's are same for IMRT, and DGI of the proton plan are better by 9.5% than that of the IMRT, (2) Group B, CI of the DA plans (1.91+/−0.4) are better than cone-based plan, while DGI of the DA plan is 4.60+/−1.1 is better than cone-based plan (5.32+/−1.4), (3) Group C (small spherical targets), CI of the DA and cone-based plans are almost the same. Conclusion: For small spherical targets, cone-based plans are superior to other 2 plans: DS proton and DA plans. For complex or irregular plans, dynamic and IMRT plans are comparable to cone-based and proton plans for complex targets.

  10. Heat resistance of Yersinia enterocolitica grown at different temperatures and heated in different media.

    PubMed

    Pagán, R; Mañas, P; Raso, J; Trepat, F J

    1999-03-01

    In the range of 4-20 degrees C, growth temperature did not influence the heat resistance at 54-66 degrees C for Yersinia enterocolitica at pH 7 in citrate phosphate buffer. However, when cells were grown at 37 degrees C. the D62 increased from 0.044 to 0.17 min. This increase was constant at all heating temperatures tested (z = 5.7-5.8). Growth temperature did not influence the proportion of heat-damaged cells after a heat treatment, as measured by their response to a 2% of sodium chloride added to the recovery medium. The sensitivity of heat treated cells to nisin or lysozyme depended on growth temperature: Whereas the number of cells grown at 4 degrees C surviving heat treatment was the same regardless of the presence of 100 IU/ml of nisin or 100 microg/ml of lysozyme in the recovery medium, that of cells grown at 37 degrees C was, in these media, lower. The pH of maximum heat resistance in citrate phosphate buffer was pH 7 for cells grown at 37 degrees C, but pH 5 for those grown at 4 degrees C. In both suspensions the magnitude of the effect of pH on heat resistance was constant at all heating temperatures. For cells grown at 4 degrees C the heat resistance at 54-66 degrees C, in skimmed milk or pH 7 buffer, was the same. For cells grown at 37 degrees C this also applied for heat treatment at 66 degrees C but at 56 degrees C the heat resistance in skimmed milk was higher. PMID:10357274

  11. The fertilization ability and developmental competence of bovine oocytes grown in vitro

    PubMed Central

    MAKITA, Miho; UEDA, Mayuko; MIYANO, Takashi

    2016-01-01

    In vitro growth culture systems for oocytes are being developed in several mammalian species. In these growth culture systems, in vitro grown oocytes usually have lower blastocyst formation than in vivo grown oocytes after in vitro fertilization. Furthermore, there have been a few reports that investigated the fertilization ability of in vitro grown oocytes in large animals. The purpose of this study was to investigate the fertilization process and developmental competence of bovine oocytes grown in vitro. Oocyte-granulosa cell complexes collected from bovine early antral follicles (0.4−0.7 mm in diameter) were cultured for growth with 17β-estradiol and androstenedione for 14 days and matured in vitro. These oocytes were then inseminated for 6 or 12 h, and further cultured for development up to 8 days in vitro. After growth culture, oocytes grew from 95 µm to around 120 µm and acquired maturation competence (79%). Although fertilization rates of in vitro grown oocytes were low after 6 h of insemination, 34% of in vitro grown oocytes fertilized normally after 12 h of insemination, having two polar bodies and two pronuclei with a sperm tail, and 22% of these oocytes developed into blastocysts after 8 days of culture. The fertilization and blastocyst formation rates were similar to those of in vivo grown oocytes. In addition, blastocyst cell numbers were also similar between in vitro and in vivo grown oocytes. In conclusion, in vitro grown bovine oocytes are similar to in vivo grown oocytes in fertilization ability and can develop into blastocysts. PMID:27151093

  12. PER.C6(®) cells as a serum-free suspension cell platform for the production of high titer poliovirus: a potential low cost of goods option for world supply of inactivated poliovirus vaccine.

    PubMed

    Sanders, Barbara P; Edo-Matas, Diana; Custers, Jerome H H V; Koldijk, Martin H; Klaren, Vincent; Turk, Marije; Luitjens, Alfred; Bakker, Wilfried A M; Uytdehaag, Fons; Goudsmit, Jaap; Lewis, John A; Schuitemaker, Hanneke

    2013-01-21

    There are two highly efficacious poliovirus vaccines: Sabin's live-attenuated oral polio vaccine (OPV) and Salk's inactivated polio vaccine (IPV). OPV can be made at low costs per dose and is easily administrated. However, the major drawback is the frequent reversion of the OPV vaccine strains to virulent poliovirus strains which can result in Vaccine Associated Paralytic Poliomyelitis (VAPP) in vaccinees. Furthermore, some OPV revertants with high transmissibility can circulate in the population as circulating Vaccine Derived Polioviruses (cVDPVs). IPV does not convey VAPP and cVDPVs but the high costs per dose and insufficient supply have rendered IPV an unfavorable option for low and middle-income countries. Here, we explored whether the human PER.C6(®) cell-line, which has the unique capability to grow at high density in suspension, under serum-free conditions, could be used as a platform for high yield production of poliovirus. PER.C6(®) cells supported replication of all three poliovirus serotypes with virus titers ranging from 9.4 log(10) to 11.1 log(10)TCID(50)/ml irrespective of the volume scale (10 ml in shaker flasks to 2 L in bioreactors). This production yield was 10-30 fold higher than in Vero cell cultures performed here, and even 100-fold higher than what has been reported for Vero cell cultures in literature [38]. In agreement, the D-antigen content per volume PER.C6(®)-derived poliovirus was on average 30-fold higher than Vero-derived poliovirus. Interestingly, PER.C6(®) cells produced on average 2.5-fold more D-antigen units per cell than Vero cells. Based on our findings, we are exploring PER.C6(®) as an interesting platform for large-scale production of poliovirus at low costs, potentially providing the basis for global supply of an affordable IPV. PMID:23123018

  13. Functional arteries grown in vitro.

    PubMed

    Niklason, L E; Gao, J; Abbott, W M; Hirschi, K K; Houser, S; Marini, R; Langer, R

    1999-04-16

    A tissue engineering approach was developed to produce arbitrary lengths of vascular graft material from smooth muscle and endothelial cells that were derived from a biopsy of vascular tissue. Bovine vessels cultured under pulsatile conditions had rupture strengths greater than 2000 millimeters of mercury, suture retention strengths of up to 90 grams, and collagen contents of up to 50 percent. Cultured vessels also showed contractile responses to pharmacological agents and contained smooth muscle cells that displayed markers of differentiation such as calponin and myosin heavy chains. Tissue-engineered arteries were implanted in miniature swine, with patency documented up to 24 days by digital angiography. PMID:10205057

  14. Molecule diagram from space-grown crystals

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Researchers' at Hauptman-Woodward Medical Research Institute, in Buffalo, N.Y. have analyzed the molecular structures of insulin crystals grown during Space Shuttle experiments and are unlocking the mystery of how insulin works.

  15. African Swine Fever Virus IAP Homologue Inhibits Caspase Activation and Promotes Cell Survival in Mammalian Cells

    PubMed Central

    Nogal, María L.; González de Buitrago, Gonzalo; Rodríguez, Clara; Cubelos, Beatriz; Carrascosa, Angel L.; Salas, María L.; Revilla, Yolanda

    2001-01-01

    African swine fever virus (ASFV) A224L is a member of the inhibitor of apoptosis protein (IAP) family. We have investigated the antiapoptotic function of the viral IAP both in stably transfected cells and in ASFV-infected cells. A224L was able to substantially inhibit caspase activity and cell death induced by treatment with tumor necrosis factor alpha and cycloheximide or staurosporine when overexpressed in Vero cells by gene transfection. We have also observed that ASFV infection induces caspase activation and apoptosis in Vero cells. Furthermore, using a deletion mutant of ASFV lacking the A224L gene, we have shown that the viral IAP modulates the proteolytic processing of the effector cell death protease caspase-3 and the apoptosis which are induced in the infected cells. Our findings indicate that A224L interacts with the proteolytic fragment of caspase-3 and inhibits the activity of this protease during ASFV infection. These observations could indicate a conserved mechanism of action for ASFV IAP and other IAP family members to suppress apoptosis. PMID:11222676

  16. Surface characteristics of Pseudomonas aeruginosa grown in a chamber implant model in mice and rats.

    PubMed Central

    Kelly, N M; Bell, A; Hancock, R E

    1989-01-01

    Pseudomonas aeruginosa PAO1 was grown in vivo in chambers implanted into the peritoneums of mice and rats. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of extracts of bacterial cells taken from the chambers and washed to remove loosely bound host proteins revealed the presence of the major outer membrane proteins D2, E, F, G, and H2. Western immunoblotting with specific antisera confirmed the presence of porin protein F and lipoprotein H2. However, there was no apparent induction of the phosphate starvation-inducible porin P or the divalent cation starvation-inducible protein H1. Small amounts of proteins with molecular weights similar to those of the iron-regulated outer membrane proteins were found in cells grown in vivo; however, their presence could not be confirmed immunologically. The presence of pili and flagella on the cells grown in vivo was demonstrated by electron microscopy and Western immunoblotting. A consistent alteration in the lipopolysaccharide banding pattern was observed after growth in vivo. Compared with cells of strain PAO1 grown in vitro, cells grown in vivo appeared to lack a series of high-molecular-weight O-antigen-containing lipopolysaccharide bands and gained a new series of lower-molecular-weight lipopolysaccharide bands. This alteration in the lipopolysaccharide after growth in vivo did not affect the O-antigen serotype or the resistance of the bacteria to serum. Images PMID:2492257

  17. Reconstitution of Iron Oxidase from Sulfur-Grown Acidithiobacillus ferrooxidans▿ †

    PubMed Central

    Taha, Taher M.; Kanao, Tadayoshi; Takeuchi, Fumiaki; Sugio, Tsuyoshi

    2008-01-01

    The iron oxidation system from sulfur-grown Acidithiobacillus ferrooxidans ATCC 23270 cells was reconstituted in vitro. Purified rusticyanin, cytochrome c, and aa3-type cytochrome oxidase were essential for reconstitution. The iron-oxidizing activity of the reconstituted system was 3.3-fold higher than that of the cell extract from which these components were purified. PMID:18791023

  18. Floc Formation by Azospirillum lipoferum Grown on Poly-β-Hydroxybutyrate †

    PubMed Central

    Bleakley, Bruce H.; Gaskins, Murray H.; Hubbell, David H.; Zam, Stephan G.

    1988-01-01

    Azospirillum lipoferum RG6xx was grown under conditions similar to those resulting in encystment of Azotobacter spp. A. lipoferum produced cells of uniform shape when grown on nitrogen-free β-hydroxybutyrate agar. Cells accumulated poly-β-hydroxybutyrate and often grew as chains or filaments that eventually lost motility and formed capsules. Within 1 week, vegetative A. lipoferum inocula were converted into microflocs arising from filaments or chains. Cells within microflocs were pleomorphic, contained much poly-β-hydroxybutyrate, and were encapsulated. Some cells had a cystlike morphology. Up to 57% of the dry weight of encapsulated flocs was poly-β-hydroxybutyrate, whereas vegetative cells grown in broth with combined nitrogen had only 3% of their dry weight as poly-β-hydroxybutyrate. Neither encapsulated cells in flocs nor nonencapsulated vegetative cells were significantly desiccation resistant. Under starvation conditions (9 days) only 25% of encapsulated cells remained viable, whereas vegetative cells multiplied severalfold. In short-term germination experiments with encapsulated flocs, nitrate, ammonium, and soil extract promoted formation of motile vegetative cells. Most cells in treatments lacking combined nitrogen eventually depleted their visible poly-β-hydroxybutyrate reserves without germinating. The remaining cells retained the reserve polymer and underwent size reduction. Images PMID:16347792

  19. C4 Photosynthetic Gene Expression in Light- and Dark-Grown Amaranth Cotyledons.

    PubMed

    Wang, J. L.; Long, J. J.; Hotchkiss, T.; Berry, J. O.

    1993-08-01

    The patterns of expression for genes encoding several C4 photosynthetic enzymes were examined in light-grown and dark-grown (etiolated) cotyledons of amaranth (Amaranthus hypochondriacus), a dicotyledonous C4 plant. The large subunit and small subunit of ribulose-1,5-bisphosphate carboxylase (RuBPCase), phosphoenolpyruvate carboxylase (PEPCase), and pyruvate orthophosphate dikinase (PPdK) were all present in the cotyledons by d 2 after planting when the seedlings first emerged from the seed coat. Kranz anatomy was apparent in light-grown cotyledons throughout development, and the overall patterns of C4 gene expression were similar to those recently described for developing amaranth leaves (J.L. Wang, D.F. Klessig, J.O. Berry [1992] Plant Cell 4: 173-184). RuBPCase mRNA and proteins were present in both bundle sheath and mesophyll cells in a C3-like pattern during early development and became progressively more localized to bundle sheath cells in the C4-type pattern as the cotyledons expanded over 2 to 7 d. PEPCase and PPdK polypeptides were localized to mesophyll cells throughout development, even though PEPCase transcripts were detected in both bundle sheath and mesophyll cells. Kranz anatomy also developed in cotyledons grown in complete darkness. In 7-d-old dark-grown cotyledons, RuBPCase, PPdK, and PEPCase were all localized to the appropriate cell types, although at somewhat lower levels than in light-grown cotyledons. These findings demonstrate that the leaves and postembryonic cotyledons of amaranth undergo common developmental programs of C4 gene expression during maturation. Furthermore, light is not required for the cell-type-specific expression of genes encoding RuBPCase and other photosynthetic enzymes in this dicotyledonous C4 plant. PMID:12231890

  20. [Analyses of chromosomal karyotypes and cytogenetic variations of animal cell lines].

    PubMed

    Zhang, D L; Li, L J; Xia, G T; He, X Y; Gao, B X; Bai, X H; Huang, G S; Liu, S G; Yan, L F; Fang, F D; Hu, C L; Wang, L J; Jiang, H H; Feng, A M; Zhang, G M; An, S G; Ren, Y Q; Guo, J M; Hu, S X; Fan, J X; Niu, Y L; Song, Z J; Li, Y; Fan, S J

    2001-01-01

    After the master cell stock(mcs) and working cell bank of more than 30 different strains of 7 animal kidney cell lines (F-81 or CRFK cell line, MDCK cell line, Vero or Vero-2 cell line, MA-104 cell line and BHK-21 cell line) were established in China, the chromosomal number variations and structural aberrations of the above lines, primary feline or canine kidney cell (FKC or CKC) and HeLa cell line were investigated and their karyotypes of routine or Giemsa chromosomal bands were analyzed. The carcinogenesis or tumorigenicity testing of these cells in about 700 nude mice and for colony formation in soft agar (SA) and for agglutination under different concentration of plant lectins was carried out. Both tumorigenicity-negative strains of F-81, CRFK, Vero or Vero-2 lines and very-low-tumorigenicity strains of MDCK line were successfully selected and evaluated for the production of canine or feline combination viral vaccines, which are free of infectious agents, and described with respect to cytogenetic characteristics and tumorigenicity. Rate of modal chromosome number represents the ratio of cell number having modal chromosome number to all the split cell number analyzed at random. Rate of difference represents the ratio of difference of the rate of modal chromosome number between mcs (master cell stock) + n and mcs passages. The chromosomal analysis results showed that the ratio of difference of the rate of modal chromosome number between mcs + n and mcs passages was not more than 5%-15% and the structure aberrations was generally 0%-3%, not more than 5%-10%, thus the hereditary character of cell lines is comparatively stable without significant difference between different passages. The genetic characteristics of chromosomal number of cell lines determines their tumorigenicity, but it is species specific. Experimental models were established for the researches on the prevention and prophylaxis of malignant tumors or cancers and their genetically biological

  1. Some karyological observations on plants grown in space

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.; Oconnor, S. A.

    1982-01-01

    Experiments were conducted to assess whether cell division in a plant root would be affected by prolonged exposure to microgravity. Root materials from sunflower, oat, and mung bean plants grown on STS-2 and STS-3 were utilized for the experiments. It is found that all oat, sunflower, and mung seedlings showed a reduced number of cells in division as they went through their first cell division cycle on earth when compared to their ground controls. A significant number of oat, mung, and sunflower plantlets exhibited random root orientation and the lack of strictly orthotropic growth of their shoot systems in the flight samples. In addition, it is found that the mung roots were apparently least affected in terms of their cytology despite the fact that their roots were often randomly oriented.

  2. Detection of mitomycin C-DNA adducts in human breast cancer cells grown in culture, as xenografted tumors in nude mice, and in biopsies of human breast cancer patient tumors as determined by (32)P-postlabeling.

    PubMed

    Warren, A J; Mustra, D J; Hamilton, J W

    2001-04-01

    Mitomycin C (MMC) is a DNA cross-linking agent that has been used in cancer chemotherapy for >20 years. However, little is known either qualitatively or quantitatively about the relationship between formation and repair of specific MMC-DNA adducts and specific biological outcomes. The goal of this study was to examine formation and removal of specific MMC-DNA adducts in breast cancer cells using a (32)P-postlabeling assay in relation to cytotoxicity and other biological end points. MMC-DNA adducts were measured in cultured human metastatic MDA-MB-435 cells, in the same cells xenografted as a mammary tumor in nude mice, and in metastatic tumor biopsies obtained from human breast cancer patients undergoing MMC-based therapy. MMC adducts corresponding to the CpG interstrand cross-link, the MMC-G bifunctional monoadduct, and two isomers of the MMC-G monofunctional monoadduct were detected in most samples. Despite similarities in the overall patterns of adduct formation, there were substantial differences between the cultured cells and the in vivo tumors in their adduct distribution profile, kinetics of adduct formation and removal, and relationship of specific adduct levels to cytotoxicity, suggesting that the in vivo microenvironment (e.g., degree of oxygenation, pH, activity of oxidoreductases, and other factors) of breast cancer cells may significantly modulate these parameters. PMID:11309355

  3. Adaptation of the WHO guideline for residual DNA in parenteral vaccines produced on continuous cell lines to a limit for oral vaccines.

    PubMed

    Lebron, J A; Troilol, P J; Pacchione, S; Griffiths, T G; Harper, L B; Mixson, L A; Jackson, B E; Michna, L; Barnum, A B; Denisova, L; Johnson, C N; Maurer, K L; Morgan-Hoffman, S; Niu, Z; Roden, D F; Wang, Z; Wolf, J J; Hamilton, T R; Laux, K M; Soper, K A; Ledwith, B J

    2006-01-01

    Although there is a WHO guidance for a limit on residual DNA for parenterally administered vaccines produced on continuous cell lines, there is no corresponding guidance for oral vaccines. To help determine an oral limit, we performed a study of Vero cell DNA uptake in rats, in which the relative uptake and persistence of Vero cell DNA administered orally was compared to its uptake when delivered intramuscularly (IM). The results of this study allowed the generation of an empirically derived IM versus oral factor (10(6)) representing the relative inefficiency of DNA uptake by oral administration. This factor was then applied to the WHO recommended parenteral limit of 10 ng/dose to determine a corresponding upper limit on the level of residual Vero cell DNA for an oral vaccine of 10 mg. As a conservative approach, this empirically determined limit was reduced 100-fold to 100 microg. Thus, the results of this animal study, together with additional evidence in the literature, support a residual DNA safety limit of 100 microg per dose for an oral vaccine produced on a continuous cell line. PMID:16566435

  4. Inorganic nanostructures grown on graphene layers

    NASA Astrophysics Data System (ADS)

    Park, Won Il; Lee, Chul-Ho; Lee, Jung Min; Kim, Nam-Jung; Yi, Gyu-Chul

    2011-09-01

    This article presents a review of current research activities on the hybrid heterostructures of inorganic nanostructures grown directly on graphene layers, which can be categorized primarily as zero-dimensional nanoparticles; one-dimensional nanorods, nanowires, and nanotubes; and two-dimensional nanowalls. For the hybrid structures, the nanostructures exhibit excellent material characteristics including high carrier mobility and radiative recombination rate as well as long-term stability while graphene films show good optical transparency, mechanical flexibility, and electrical conductivity. Accordingly, the versatile and fascinating properties of the nanostructures grown on graphene layers make it possible to fabricate high-performance optoelectronic and electronic devices even in transferable, flexible, or stretchable forms. Here, we review preparation methods and possible device applications of the hybrid structures consisting of various types of inorganic nanostructures grown on graphene layers.

  5. Degradation of pentachlorophenol by a Flavobacterium species grown in continuous culture under various nutrient limitations.

    PubMed Central

    Topp, E; Hanson, R S

    1990-01-01

    A Flavobacterium sp. was grown in continuous culture limited for growth with ammonium, phosphate, sulfate, glucose, glucose + pentachlorophenol (PCP) (0.065 h -1), or PCP. Cells ere harvested, washed, and suspended to 3 x 10(7) cells ml (-1) in shake flasks containing a complete mineral salts medium without added carbon or supplemented with 50 mg of PCP ml(-1) or 50 mg of PCP ml(-1) + 100 mg of glucose ml(-1). The PCP concentration and the viable cell density were determined periodically. Cells that were grown under phosphate, glucose, or glucose + PCP limitation were more sensitive to PCP and took longer to degrade 50 mg of PCP ml(-1) than did cells that very were grown under ammonium, sulfate, or PCP limitation. Glucose stimulated viability and PCP degradation in all cases except when the cells were grown under carbon limitation with glucose and PCP added together as the carbon source. These results indicate that there is a relationship between nutrient limitation, phenotypic variation, and the sensitivity to and degradation of PCP by this organism. PMID:2306092

  6. Stability of Detached Grown Germanium Single Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Volz, M. P.; Cobb, S. D.; Vujisic, L.; Szofran, F. R.; Rose, M. Franklin (Technical Monitor)

    2001-01-01

    Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years, especially under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 micrometers, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5 mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 micrometers. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be

  7. Stability of Detached Grown Germanium Single Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Volz, M. P.; Cobb, S. D.; Motakef, S.; Szofran, F. R.; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    Detachment of the melt meniscus from the crucible during semiconductor Bridgman growth experiments has been observed in recent years especially, under microgravity experiments. Under earth conditions, the hydrostatic pressure counteracts the mechanism, whereby it is more difficult to achieve detached Bridgman growth. Attempts to get stable detached growth under terrestrial conditions have been discussed in the literature and have been the subject of recent experiments in our own group. The advantage of crystals grown without wall contact is obvious: In general, they possess a higher crystal quality than conventional Bridgman grown crystals with wall contact. However, due to the interaction of different parameters such as the wetting behavior of the melt with the crucible, and the dependence of the growth angle with the shape of the melt meniscus, the mechanism leading to detachment is very complicated and not completely understood. We have grown several doped and undoped Germanium crystals with the detached Bridgman and the normal Bridgman growth technique. Pyrolytic boron nitride containers were used for all growth experiments. In the detached grown crystals the typical gap thickness between the pBN crucible and the crystal is in the range of 10 to 100 microns, which was determined by performing profilometer measurements. Etch pit density measurements were also performed and a comparison between detached and attached grown crystals will be given. An interesting feature was detected on the surface of a detached grown crystal. Strong surface striations with an average axial distance of 0.5mm were observed around the whole circumference. The maximum fluctuation of the gap thickness is in the range of 5-10 microns. These variations of the detached gap along the crystal axis can be explained by a kind of stiction of the melt/crucible interface and thus by a variation of the meniscus shape. This phenomenon leading to the fluctuation of the gap thickness will be

  8. Ion implanted epitaxially grown ZnSe

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The epitaxial growth of ZnSe on (100) Ge using the close-spaced transport process is described. Substrate temperature of 575 C and source temperatures of 675 C yield 10 micron, single crystal layers in 10 hours. The Ge substrates provides a nonreplenishable chemical transport agent and the epitaxial layer thickness is limited to approximately 10 microns. Grown epitaxial layers show excellent photoluminescence structure at 77 K. Grown layers exhibit high resistivity, and annealing in Zn vapor at 575 C reduces the resistivity to 10-100 ohms-cm. Zinc vapor annealing quenches the visible photoluminescence.

  9. Pyrophen Produced by Endophytic Fungi Aspergillus sp Isolated from Piper crocatum Ruiz and Pav Exhibits Cytotoxic Activity and Induces S Phase Arrest in T47D Breast Cancer Cells.

    PubMed

    Astuti, Puji; Erden, Willy; Wahyono; Wahyuono, Subagus; Hertiani, Triana

    2016-01-01

    Ethyl acetate extracts obtained from culture of endophytic fungi Aspergillus sp isolated from Piper crocatum Ruiz and Pav, have been shown to possess cytotoxic activity against T47D breast cancer cells. Investigations were here conducted to determine bioactive compounds responsible for the activity. Bioassay guided fractionation was employed to obtain active compounds. Structure elucidation was performed based on analysis of LC-MS, 1H-NMR, 13C-NMR, COSY, DEPT, HMQC, HMBC data. Cytotoxity assays were conducted in 96 well plates against T47D and Vero cell lines. Bioassay guided isolation and chemical investigation led to the isolation of pyrophen, a 4-methoxy-6-(1'-acetamido-2'-phenylethyl)-2H-pyran-2-one. Further analysis of its activity against T47D and Vero cells showed an ability to inhibit the growth of T47D cells with IC50 values of 9.2 μg/mL but less cytotoxicity to Vero cells with an IC50 of 109 μg/mL. This compound at a concentration of 400 ng/mL induced S-phase arrest in T47D cells. PMID:26925652

  10. Ultrastructure of Zika virus particles in cell cultures.

    PubMed

    Barreto-Vieira, Debora Ferreira; Barth, Ortrud Monika; Silva, Marcos Alexandre Nunes da; Santos, Carolina Cardoso; Santos, Aline da Silva; F, Joaquim Batista; Filippis, Ana Maria Bispo de

    2016-08-01

    Zika virus (ZIKV) has infected thousands of Brazilian people and spread to other American countries since 2015. The introduction of ZIKV brought a strong impact to public health in Brazil. It is of utmost importance to identify a susceptible cell line that will enable the isolation and identification of the virus from patient samples, viral mass production, and testing of drug and vaccine candidates. Besides real-time reverse transcriptase polymerase chain reaction diagnosis for detecting the viral genome, virus isolation in cell lines was useful in order to study the structure of the viral particle and its behaviour inside cells. Analysis of ZIKV infected cell lines was achieved using transmission electron microscopy (TEM). Blood was obtained from a Brazilian patient during the first days after presenting with signs of the disease, and ZIKV from the patient's blood was isolated in the C6/36 mosquito cell line. Afterwards, Vero cells were inoculated with the viral suspension, fixed six days after inoculation, embedded in polymers, and ultra-thin cut. Like dengue viruses, this flavivirus showed numerous virus particles present inside cellular vesicles thereby confirming the susceptibility of the Vero cell line to ZIKV replication. TEM is a unique technique available to make the virus visible. PMID:27581122

  11. Ultrastructure of Zika virus particles in cell cultures

    PubMed Central

    Barreto-Vieira, Debora Ferreira; Barth, Ortrud Monika; da Silva, Marcos Alexandre Nunes; Santos, Carolina Cardoso; Santos, Aline da Silva; F, Joaquim Batista; de Filippis, Ana Maria Bispo

    2016-01-01

    Zika virus (ZIKV) has infected thousands of Brazilian people and spread to other American countries since 2015. The introduction of ZIKV brought a strong impact to public health in Brazil. It is of utmost importance to identify a susceptible cell line that will enable the isolation and identification of the virus from patient samples, viral mass production, and testing of drug and vaccine candidates. Besides real-time reverse transcriptase polymerase chain reaction diagnosis for detecting the viral genome, virus isolation in cell lines was useful in order to study the structure of the viral particle and its behaviour inside cells. Analysis of ZIKV infected cell lines was achieved using transmission electron microscopy (TEM). Blood was obtained from a Brazilian patient during the first days after presenting with signs of the disease, and ZIKV from the patient’s blood was isolated in the C6/36 mosquito cell line. Afterwards, Vero cells were inoculated with the viral suspension, fixed six days after inoculation, embedded in polymers, and ultra-thin cut. Like dengue viruses, this flavivirus showed numerous virus particles present inside cellular vesicles thereby confirming the susceptibility of the Vero cell line to ZIKV replication. TEM is a unique technique available to make the virus visible. PMID:27581122

  12. Automorphogenesis and gravitropism of plant seedlings grown under microgravity conditions

    NASA Astrophysics Data System (ADS)

    Hoson, T.; Saiki, M.; Kamisaka, S.; Yamashita, M.

    Plant seedlings exhibit automorphogenesis on clinostats. The occurrence of automorphogenesis was confirmed under microgravity in Space Shuttle STS-95 flight. Rice coleoptiles showed an inclination toward the caryopsis in the basal region and a spontaneous curvature in the same adaxial direction in the elongating region both on a three-dimensional (3-D) clinostat and in space. Both rice roots and Arabidopsis hypocotyls also showed a similar morphology in space and on the 3-D clinostat. In rice coleoptiles, the mechanisms inducing such an automorphic curvature were studied. The faster-expanding convex side of rice coleoptiles showed a higher extensibility of the cell wall than the opposite side. Also, in the convex side, the cell wall thickness was smaller, the turnover of the matrix polysaccharides was more active, and the microtubules oriented more transversely than the concave side, and these differences appear to be causes of the curvature. When rice coleoptiles grown on the 3-D clinostat were placed horizontally, the gravitropic curvature was delayed as compared with control coleoptiles. In clinostatted coleoptiles, the corresponding suppression of the amyloplast development was also observed. Similar results were obtained in Arabidopsis hypocotyls. Thus, the induction of automorphogenesis and a concomitant decrease in graviresponsiveness occurred in plant shoots grown under microgravity conditions.

  13. Mechanoresponses of human primary osteoblasts grown on carbon nanotubes.

    PubMed

    Kroustalli, A; Kotsikoris, V; Karamitri, A; Topouzis, S; Deligianni, D

    2015-03-01

    Bone mechanotransduction is strongly influenced by the biomaterial properties. A good understanding of these mechanosensory mechanisms in bone has the potential to provide new strategies in the highly evolving field of bone tissue engineering. The aim of the present investigation was to study the interactive effects of local mechanical stimuli on multiwalled carbon nanotubes (MWCNTs)/osteoblast interface, using an in vitro model that allows the study of cell growth, attachment and differentiation. Strain was applied at physiological levels [strain magnitudes 500 microstrain (μɛ), at frequency of load application 0.5 Hz]. The effect of mechanical strain and substrate was thus studied by measuring the messenger RNA expression of alkaline phosphatase, vinculin, collagen 1A, and integrins β1, β3, α4, and αv, using real-time quantitative polymerase chain reaction. The osteoblasts grown on MWCNTs displayed quick adaptation to the new environment by modulating the expression of key adhesion integrins. Furthermore, the addition of mechanical strain interplayed with the extracellular matrix and was efficiently transduced by cells grown on MWCNTs, providing stronger adhesion and survival. MWCNTs are therefore a material perfectly compatible with osteoblast differentiation, adhesion, and growth, and should be further evaluated, to derive new-generation biomaterial scaffolds for the treatment of skeletal defects which require bone reconstruction. PMID:24910375

  14. LYCOPENE CONTENT OF ORGANICALLY GROWN TOMATOES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Reports on the lycopene content of tomatoes vary widely with country and source of fruit (field, greenhouse, retail). This study was done to compare the lycopene content of organically grown tomatoes, and to compare fully red fruit to those ripened after harvest. Thirteen tomato cultivars (12 beef...

  15. Efflux Of Nitrate From Hydroponically Grown Wheat

    NASA Technical Reports Server (NTRS)

    Huffaker, R. C.; Aslam, M.; Ward, M. R.

    1992-01-01

    Report describes experiments to measure influx, and efflux of nitrate from hydroponically grown wheat seedlings. Ratio between efflux and influx greater in darkness than in light; increased with concentration of nitrate in nutrient solution. On basis of experiments, authors suggest nutrient solution optimized at lowest possible concentration of nitrate.

  16. Molecule diagram from earth-grown crystals

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Like many chemicals in the body, the three-dimensional structure of insulin is extremely complex. When grown on the ground, insulin crystals do not grow as large or as ordered as researchers desire--obscuring the blueprint of the insulin molecules.

  17. Grown-ups Ought To Know Better.

    ERIC Educational Resources Information Center

    Brightman, Samuel C.

    Among the articles by Sam Brightman collected in this volume from the newsletter, "Adult & Continuing Education Today (ACET)" are the following: "Grown-Ups Ought to Know Better"; "Adult Education: The Only Sure Factor Is Growth"; "Adult Education Important in This Election Year"; "Will Nursery School External Degree Programs Come Next?";…

  18. Effect of nitrogen source on pullulan production by Aureobasidium pullulans grown in a batch bioreactor.

    PubMed

    West, T P; Strohfus, B

    1999-01-01

    Pullulan production by Aureobasidium pullulans ATCC 201253 using selected nitrogen sources was studied in a medium using corn syrup as a carbon source. Independent of the corn syrup concentration present, the use of corn steep liquor or hydrolysed soy protein as a nitrogen source instead of ammonium sulphate did not elevate polysaccharide production by ATCC 201253 cells grown in an aerated, batch bioreactor containing 4 litres of medium. Pullulan production on corn steep liquor or hydrolysed soy protein as a nitrogen source became more comparable as the concentration of corn syrup was increased. Cell weights after 7 days of growth on any of the nitrogen sources were similar. The viscosity of the polysaccharide on day 7 was highest for cells grown on ammonium sulphate and 12.5% corn syrup. The pullulan content of the polysaccharide elaborated by ammonium sulphate-grown cells on day 7 decreased as the corn syrup level rose in the medium while the pullulan content of polysaccharide produced by cells grown on corn steep liquor or soytone generally increased. PMID:10581727

  19. A recombinant measles vaccine virus expressing wild-type glycoproteins: consequences for viral spread and cell tropism.

    PubMed

    Johnston, I C; ter Meulen, V; Schneider-Schaulies, J; Schneider-Schaulies, S

    1999-08-01

    Wild-type, lymphotropic strains of measles virus (MV) and tissue culture-adapted MV vaccine strains possess different cell tropisms. This observation has led to attempts to identify the viral receptors and to characterize the functions of the MV glycoproteins. We have functionally analyzed the interactions of MV hemagglutinin (H) and fusion (F) proteins of vaccine (Edmonston) and wild-type (WTF) strains in different combinations in transfected cells. Cell-cell fusion occurs when both Edmonston F and H proteins are expressed in HeLa or Vero cells. The expression of WTF glycoproteins in HeLa cells did not result in syncytia, yet they fused efficiently with cells of lymphocytic origin. To further investigate the role of the MV glycoproteins in virus cell entry and also the role of other viral proteins in cell tropism, we generated recombinant vaccine MVs containing one or both glycoproteins from WTF. These viruses were viable and grew similarly in lymphocytic cells. Recombinant viruses expressing the WTFH protein showed a restricted spread in HeLa cells but spread efficiently in Vero cells. Parental WTF remained restricted in both cell types. Therefore, not only differential receptor usage but also other cell-specific factors are important in determining MV cell tropism. PMID:10400788

  20. Photovoltaic properties of CdTe layers grown by OMVPE

    NASA Astrophysics Data System (ADS)

    Bhimnathwala, H. G.; Taskar, N. R.; Lee, W. I.; Bhat, I.; Ghandhi, S. K.

    Photovoltaic characteristics of single-crystal cadmium telluride epitaxial layers grown by organometallic vapor phase epitaxy (OMVPE) on InSb substrates are reported. Electrical characterization of Schottky solar cells fabricated by depositing thin transparent gold shows that a hole diffusion length of 2 microns can be obtained in n-CdTe. The current flow in the p-n junction in the forward bias is determined by recombination in the depletion region. Theoretical calculations show that n+p CdTe solar cells could have an open-circuit voltage of 0.90 V, a short-circuit current of 22.2 mA/sq cm and an efficiency of 21 percent under AM1.5 illumination.

  1. Morphology of fibroblasts grown on substrates formed by dielectrophoretically aligned carbon nanotubes

    PubMed Central

    Yuen, Felix L.-Y.; Zak, Gene; Waldman, Stephen D.

    2007-01-01

    Multiwall carbon nanotube templates formed on the surfaces of planar interdigitated microelectrode arrays by means of AC electric field-guided assembly are being explored as potential substrates for tissue engineering. The objective of the present study is to examine whether surface patterns of aligned multiwall carbon nanotubes can have an effect on cell growth, morphology, and alignment. Bovine fibroblasts grown on aligned carbon nanotubes for a period of 2 weeks were found to have raised bodies and pronounced cell extensions for anchoring themselves to the substrate similar to that of the cells found in native tissues. On the other hand, cells grown on various control surfaces had a flat, circular morphology. The cell cultures were visualized by means of SEM imaging and the resulting morphologies were statistically analyzed and compared. PMID:19002836

  2. [Safety assessment of stevia rebaudiana bertoni grown in southeastern Mexico as food sweetener].

    PubMed

    Aranda-González, Irma; Barbosa-Martín, Enrique; Toraya-Avilés, Rocío; Segura-Campos, Maira; Moguel-Ordoñez, Yolanda; Betancur-Ancona, David

    2014-01-01

    Stevia rebaudiana leaves and their glycosides have been recently and significantly used so important as sweeteners. However, it has been reported an antihyperglycemic effect of the extract and a glycoside. The aim of this study was to quantify S. rebaudiana glycosides, assess cytotoxicity of the extract and its acute and chronic effect on blood glucose in animal models and in human. The glycosides of the Morita II and Criolla extract were quantified by HPLC, using a C18 column (250 mm x 4.6 mm and particle size of 5 uM) with UV detection at 210 nm, mobile phase of acetonitrile/sodium phosphate buffer 10 mmol/L, pH 2.6 (32:68 v/v). Cytotoxicity study was performed in Vero cells, whereas an intraperitoneal glucose tolerance test (IPGTT) and a chronic consumption assay (4 weeks) were executed in an animal model of diabetes; finally the glycemic index (G.I.) was determined in healthy individuals. The glycoside content is higher in the Morita variety II although both had a CC50 >300 g/mL. The areas under the curve of the IPGTT and fasting glucose of the animals were not significantly different (p> 0.05) and the I.G. extract was 11.11 %, which classifies the extract as low I.G. The extract of S. rebaudiana Morita II has a low glycemic index and, in the doses tested, is not cytotoxic nor has acute or chronic effect on blood sugar, which makes it a safe sweetener. PMID:25238836

  3. Cells infected with herpes simplex virus 1 export to uninfected cells exosomes containing STING, viral mRNAs, and microRNAs

    PubMed Central

    Kalamvoki, Maria; Du, Te; Roizman, Bernard

    2014-01-01

    STING (stimulator of IFN genes) activates the IFN-dependent innate immune response to infection on sensing the presence of DNA in cytosol. The quantity of STING accumulating in cultured cells varies; it is relatively high in some cell lines [e.g., HEp-2, human embryonic lung fibroblasts (HEL), and HeLa] and low in others (e.g., Vero cells). In a preceding publication we reported that STING was stable in four cell lines infected with herpes simplex virus 1 and that it was actively stabilized in at least two cell lines derived from human cancers. In this report we show that STING is exported from HEp-2 cells to Vero cells along with virions, viral mRNAs, microRNAs, and the exosome marker protein CD9. The virions and exosomes copurified. The quantity of STING and CD9 exported from one cell line to another was inoculum-size–dependent and reflected the levels of STING and CD9 accumulating in the cells in which the virus inoculum was made. The export of STING, an innate immune sensor, and of viral mRNAs whose major role may be in silencing viral genes in latently infected neurons, suggests that the virus has evolved mechanisms that curtail rather than foster the spread of infection under certain conditions. PMID:25368198

  4. Lethal photosensitization of biofilm-grown bacteria

    NASA Astrophysics Data System (ADS)

    Wilson, Michael

    1997-12-01

    Antibacterial agents are increasingly being used for the prophylaxis and treatment of oral diseases. As these agents can be rendered ineffective by resistance development in the target organisms there is a need to develop alternative antimicrobial approaches. Light-activated antimicrobial agents release singlet oxygen and free radicals which can kill adjacent bacteria and a wide range of cariogenic and periodontopathogenic bacteria has been shown to be susceptible to such agents. In the oral cavity these organisms are present as biofilms (dental plaques) which are less susceptible to traditional antimicrobial agents than bacterial suspensions. The results of these studies have shown that biofilm-grown oral bacteria are also susceptible to lethal photosensitization although the light energy doses required are grater than those needed to kill the organisms when they are grown as aqueous suspensions.

  5. GaAsP Nanowires Grown by Aerotaxy.

    PubMed

    Metaferia, Wondwosen; Persson, Axel R; Mergenthaler, Kilian; Yang, Fangfang; Zhang, Wei; Yartsev, Arkady; Wallenberg, Reine; Pistol, Mats-Erik; Deppert, Knut; Samuelson, Lars; Magnusson, Martin H

    2016-09-14

    We have grown GaAsP nanowires with high optical and structural quality by Aerotaxy, a new continuous gas phase mass production process to grow III-V semiconductor based nanowires. By varying the PH3/AsH3 ratio and growth temperature, size selected GaAs1-xPx nanowires (80 nm diameter) with pure zinc-blende structure and with direct band gap energies ranging from 1.42 to 1.90 eV (at 300 K), (i.e., 0 ≤ x ≤ 0.43) were grown, which is the energy range needed for creating tandem III-V solar cells on silicon. The phosphorus content in the NWs is shown to be controlled by both growth temperature and input gas phase ratio. The distribution of P in the wires is uniform over the length of the wires and among the wires. This proves the feasibility of growing GaAsP nanowires by Aerotaxy and results indicate that it is a generic process that can be applied to the growth of other III-V semiconductor based ternary nanowires. PMID:27564139

  6. Chirality of electrodeposits grown in a magnetic field

    NASA Astrophysics Data System (ADS)

    Mhíocháin, T. R.; Coey, J. M.

    2004-06-01

    Electrodeposits grown around a point cathode in a flat, horizontal electrochemical cell have fractal form. When grown in the presence of a perpendicular applied magnetic field, the deposits develop a spiral structure with chirality which reverses on switching the field direction. These structures are modeled numerically using biased variants of the diffusion limited aggregation (DLA) model. The effects of electric and magnetic fields are modeled successfully by varying the probabilities that a random walker will move in a given direction as a result of a Coulomb force and the Lorentz force-induced flow of electrolyte past the deposit surface. By contrast, a numerical model which considers only the effect of the Lorentz force on individual ions, without reference to the surface of the growing deposit, produces spiral structures with incorrect chirality. The modified DLA model is related to the differential equations for diffusion, migration, and convection. Length scales in the problem are understood by associating the step length of the random walker with the diffusion layer thickness, the lookup radius with the hydrodynamic boundary layer thickness and a point on the numerical deposit with a nucleation center for growth of a crystallite.

  7. Characterization of cellulolytic bacterial cultures grown in different substrates.

    PubMed

    Alshelmani, Mohamed Idris; Loh, Teck Chwen; Foo, Hooi Ling; Lau, Wei Hong; Sazili, Awis Qurni

    2013-01-01

    Nine aerobic cellulolytic bacterial cultures were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ) and the American Type Culture Collection (ATCC). The objectives of this study were to characterize the cellulolytic bacteria and to determine the optimum moisture ratio required for solid state fermentation (SSF) of palm kernel cake (PKC). The bacteria cultures were grown on reconstituted nutrient broth, incubated at 30°C and agitated at 200 rpm. Carboxymethyl cellulase, xylanase, and mannanase activities were determined using different substrates and after SSF of PKC. The SSF was conducted for 4 and 7 days with inoculum size of 10% (v/w) on different PKC concentration-to-moisture ratios: 1 : 0.2, 1 : 0.3, 1 : 0.4, and 1 : 0.5. Results showed that Bacillus amyloliquefaciens 1067 DSMZ, Bacillus megaterium 9885 ATCC, Paenibacillus curdlanolyticus 10248 DSMZ, and Paenibacillus polymyxa 842 ATCC produced higher enzyme activities as compared to other bacterial cultures grown on different substrates. The cultures mentioned above also produced higher enzyme activities when they were incubated under SSF using PKC as a substrate in different PKC-to-moisture ratios after 4 days of incubation, indicating that these cellulolytic bacteria can be used to degrade and improve the nutrient quality of PKC. PMID:24319380

  8. Chirality of electrodeposits grown in a magnetic field.

    PubMed

    Mhíocháin, T R Ní; Coey, J M D

    2004-06-01

    Electrodeposits grown around a point cathode in a flat, horizontal electrochemical cell have fractal form. When grown in the presence of a perpendicular applied magnetic field, the deposits develop a spiral structure with chirality which reverses on switching the field direction. These structures are modeled numerically using biased variants of the diffusion limited aggregation (DLA) model. The effects of electric and magnetic fields are modeled successfully by varying the probabilities that a random walker will move in a given direction as a result of a Coulomb force and the Lorentz force-induced flow of electrolyte past the deposit surface. By contrast, a numerical model which considers only the effect of the Lorentz force on individual ions, without reference to the surface of the growing deposit, produces spiral structures with incorrect chirality. The modified DLA model is related to the differential equations for diffusion, migration, and convection. Length scales in the problem are understood by associating the step length of the random walker with the diffusion layer thickness, the lookup radius with the hydrodynamic boundary layer thickness and a point on the numerical deposit with a nucleation center for growth of a crystallite. PMID:15244565

  9. Mineral composition of organically grown tomato

    NASA Astrophysics Data System (ADS)

    Ghambashidze, Giorgi

    2014-05-01

    In recent years, consumer concerns on environmental and health issues related to food products have increased and, as a result, the demand for organically grown production has grown. Results indicate that consumers concerned about healthy diet and environmental degradation are the most likely to buy organic food, and are willing to pay a high premium. Therefore, it is important to ensure the quality of the produce, especially for highly consumed products. The tomato (Lycopersicon esculentum) is one of the most widely consumed fresh vegetables in the world. It is also widely used by the food industries as a raw material for the production of derived products such as purees or ketchup. Consequently, many investigations have addressed the impact of plant nutrition on the quality of tomato fruit. The concentrations of minerals (P, Na, K, Ca and Mg) and trace elements (Cu, Zn and Mn) were determined in tomatoes grown organically in East Georgia, Marneuli District. The contents of minerals and Mn seem to be in the range as shown in literature. Cu and Zn were found in considerably high amounts in comparison to maximum permissible values established in Georgia. Some correlations were observed between the minerals and trace elements studied. K and Mg were strongly correlated with Cu and Zn. Statistically significant difference have shown also P, K and Mg based between period of sampling.

  10. Human Colon Cancer Cells Cultivated in Space

    NASA Technical Reports Server (NTRS)

    1995-01-01

    Within five days, bioreactor cultivated human colon cancer cells (shown) grown in Microgravity on the STS-70 mission in 1995, had grown 30 times the volume of the control specimens on Earth. The samples grown in space had a higher level of cellular organization and specialization. Because they more closely resemble tumors found in the body, microgravity grown cell cultures are ideal for research purposes.

  11. miR-146a Attenuates Inflammatory Pathways Mediated by TLR4/NF-κB and TNFα to Protect Primary Human Retinal Microvascular Endothelial Cells Grown in High Glucose

    PubMed Central

    Ye, Eun-Ah; Steinle, Jena J.

    2016-01-01

    Pathological mechanisms underlying diabetic retinopathy are still not completely understood. Increased understanding of potential cellular pathways responsive to hyperglycemia is essential to develop novel therapeutic strategies for diabetic retinopathy. A growing body of evidence shows that microRNA (miRNA) play important roles in pathological mechanisms involved in diabetic retinopathy, as well as possessing potential as novel therapeutic targets. The hypothesis of this study was that miR-146a plays a key role in attenuating hyperglycemia-induced inflammatory pathways through reduced TLR4/NF-κB and TNFα signaling in primary human retinal microvascular endothelial cells (REC). We cultured human REC in normal (5 mM) glucose or transferred to high glucose medium (25 mM) for 3 days. Transfection was performed on REC with miRNA mimic (hsa-miR-146a-5p). Our results demonstrate that miR-146a expression was decreased in human REC cultured in high glucose. Overexpression of miR-146a using mimics reduced the levels of TLR4/NF-κB and TNFα in REC cultured in high glucose. Both MyD88-dependent and -independent signaling were decreased by miR-146a overexpression in REC in high glucose conditions. The results suggest that miR-146a is a potential therapeutic target for reducing inflammation in REC through inhibition of TLR4/NF-κB and TNFα. Our study will contribute to understanding of diabetic retinal pathology, as well as providing important clues to develop therapeutics for clinical applications. PMID:26997759

  12. miR-146a Attenuates Inflammatory Pathways Mediated by TLR4/NF-κB and TNFα to Protect Primary Human Retinal Microvascular Endothelial Cells Grown in High Glucose.

    PubMed

    Ye, Eun-Ah; Steinle, Jena J

    2016-01-01

    Pathological mechanisms underlying diabetic retinopathy are still not completely understood. Increased understanding of potential cellular pathways responsive to hyperglycemia is essential to develop novel therapeutic strategies for diabetic retinopathy. A growing body of evidence shows that microRNA (miRNA) play important roles in pathological mechanisms involved in diabetic retinopathy, as well as possessing potential as novel therapeutic targets. The hypothesis of this study was that miR-146a plays a key role in attenuating hyperglycemia-induced inflammatory pathways through reduced TLR4/NF-κB and TNFα signaling in primary human retinal microvascular endothelial cells (REC). We cultured human REC in normal (5 mM) glucose or transferred to high glucose medium (25 mM) for 3 days. Transfection was performed on REC with miRNA mimic (hsa-miR-146a-5p). Our results demonstrate that miR-146a expression was decreased in human REC cultured in high glucose. Overexpression of miR-146a using mimics reduced the levels of TLR4/NF-κB and TNFα in REC cultured in high glucose. Both MyD88-dependent and -independent signaling were decreased by miR-146a overexpression in REC in high glucose conditions. The results suggest that miR-146a is a potential therapeutic target for reducing inflammation in REC through inhibition of TLR4/NF-κB and TNFα. Our study will contribute to understanding of diabetic retinal pathology, as well as providing important clues to develop therapeutics for clinical applications. PMID:26997759

  13. Morphometric analyses of petioles of seedlings grown in a spaceflight experiment.

    PubMed

    Johnson, Christina M; Subramanian, Aswati; Edelmann, Richard E; Kiss, John Z

    2015-11-01

    Gravity is a constant unidirectional stimulus on Earth, and gravitropism in plants involves three phases: perception, transduction, and response. In shoots, perception takes place within the endodermis. To investigate the cellular machinery of perception in microgravity, we conducted a spaceflight study with Arabidopsis thaliana seedlings, which were grown in microgravity in darkness using the Biological Research in Canisters (BRIC) hardware during space shuttle mission STS-131. In the 14-day-old etiolated plants, we studied seedling development and the morphological parameters of the endodermal cells in the petiole. Seedlings from the spaceflight experiment (FL) were compared to a ground control (GC), which both were in the BRIC flight hardware. In addition, to assay any potential effects from growth in spaceflight hardware, we performed another control by growing seedlings in Petri dishes in standard laboratory conditions (termed the hardware control, HC). Seed germination was significantly lower in samples grown in flight hardware (FL, GC) compared to the HC. In terms of cellular parameters of endodermal cells, the greatest differences also were between seedlings grown in spaceflight hardware (FL, GC) compared to those grown outside of this hardware (HC). Specifically, the endodermal cells were significantly smaller in seedlings grown in the BRIC system compared to those in the HC. However, a change in the shape of the cell, suggesting alterations in the cell wall, was one parameter that appears to be a true microgravity effect. Taken together, our results suggest that caution must be taken when interpreting results from the increasingly utilized BRIC spaceflight hardware system and that it is important to perform additional ground controls to aid in the analysis of spaceflight experiments. PMID:26376793

  14. Fluorescence assay for the detection of adherent Candida yeasts to target cells in microtest plates.

    PubMed

    Borg-von Zepelin, M; Wagner, T

    1995-01-01

    We describe an assay based on photometric analysis for the measurement of adherence of Candida species to epithelial target cells (Vero cell line). Adherent Candida cells were detected by staining the cells with the fluorescent dye Calcofluor white (CFW), which binds to chitin and glucan in the yeasts. The tests were performed on microtest plates, which were analysed automatically by fluorescence plate readers. The assay is based on the following steps: (i) coating of the microtest plates with target cells (e.g. Vero cells); (ii) infection with Candida: (iii) staining of Candida with CFW; (iv) rinsing to remove non-adherent Candida cells and unbound dye; (v) detection of adherent fluorescent Candida cells. The test was able to detect 4 x 10(4) cells ml-1. The standard deviation was +/- 8%. Day-to-day variation was +/- 10% at most. The adherence of strains of different Candida species was assayed by a standard procedure. The results confirmed the order of adherence, with C. albicans ranking first, followed by C. tropicalis, C. parapsilosis and C. glabrata. PMID:8569807

  15. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat...

  16. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat...

  17. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... (INSPECTION, CERTIFICATION, AND STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long...

  18. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long stems (commonly termed “rat...

  19. 7 CFR 51.1356 - Pears grown from late blooms.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Pears grown from late blooms. 51.1356 Section 51.1356... (INSPECTION, CERTIFICATION, AND STANDARDS) United States Standards for Pears for Canning Definitions § 51.1356 Pears grown from late blooms. Pears grown from late blooms. Such pears often have excessively long...

  20. Degradation of Trichloroethylene by Methanol-Grown Cultures of Methylosinus trichosporium OB3b PP358

    PubMed Central

    Fitch, M. W.; Speitel, G. E.; Georgiou, G.

    1996-01-01

    A soluble methane monooxygenase-constitutive mutant strain of Methylosinus trichosporium OB3b, strain PP358, was grown with methanol as the carbon source, and the kinetics of trichloroethylene (TCE) degradation were determined. PP358 exhibited high TCE degradation rates under both oxygen- and carbon-limiting conditions. The optimal pseudo first-order rate constant for TCE was comparable to the values measured for cells grown with methane. We found that growth under oxygen-limiting conditions results in increased accumulation of polyhydroxybutyrate, which in turn correlates with higher transformation capacities for TCE. It was also shown that methanol inhibits TCE degradation only at high concentrations. Thus, methanol-grown cultures of PP358 represent an efficient system for the biodegradation of chlorinated hydrocarbons. PMID:16535263

  1. Sonochemically grown 1D ZnO nanostructures and their applications

    NASA Astrophysics Data System (ADS)

    Bayam, Yavuz; Rodrigues, Debora; Atalay, Ramazan; Zafer, Ceylan; Okur, Salih; Bala, Rukayya K.; Okyay, Tugba O.; Gültekin, Burak; Caha, Ihsan; Tural, Enis E.; Duyar, Sinem; Özbek, Cebrail; Guler, Telat

    2015-08-01

    Sonochemical growth technique is based upon the chemical effect of ultrasound on chemical reactions. This process is carried out at an ambient atmosphere without the need for a complex experimental set up and additional heating. This method is of significant importance because of it's vital application in various fields. ZnO nanorods were grown on glass substrates without any additional heat or surfactance by sonochemical growth technique. The grown nanostructures were characterized by Raman spectroscopy, scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). Sonochemically grown ZnO nanorod networks were characterized for their antibacterial properties toward B.subtilis. These structures were also characterized for their CO sensing properties and photovoltaic performances for dye sensitized solar cell (DSSC) application. All material characterization and device performances suggest that sonochemsitry can be utilized as an alternative growth method for 1D ZnO nanostructures.

  2. Quinoprotein alcohol dehydrogenase from ethanol-grown Pseudomonas aeruginosa.

    PubMed Central

    Groen, B; Frank, J; Duine, J A

    1984-01-01

    Cell-free extracts of Pseudomonas aeruginosa strains, grown on ethanol, showed dye-linked alcohol dehydrogenase activities. The enzyme responsible for this activity was purified to homogeneity. It appeared to contain two molecules of pyrroloquinoline quinone per enzyme molecule. In many respects, it resembled other quinoprotein alcohol dehydrogenases (EC 1.1.99.8), having a substrate specificity intermediate between that of methanol dehydrogenases and ethanol dehydrogenases in this group. On the other hand, it also showed dissimilarities: the enzyme was found to be a monomer (Mr 101 000), to need only one molecule of the suicide substrate cyclopropanol to become fully inactivated, and to have a different aromatic amino acid composition. PMID:6439190

  3. Photoresponse properties of BaSi2 film grown on Si (100) by vacuum evaporation

    NASA Astrophysics Data System (ADS)

    Thi Trinh, Cham; Nakagawa, Yoshihiko; Hara, Kosuke O.; Takabe, Ryota; Suemasu, Takashi; Usami, Noritaka

    2016-07-01

    We have succeeded in the observation of high photoresponsivity of orthorhombic BaSi2 film grown on crystalline Si by a vacuum evaporation method, raising the prospect of its promising application in high-efficiency thin-film solar cells. Photocurrent was observed at photon energies larger than 1.28 eV, which corresponds to the band gap of evaporated BaSi2 film, indicating that the photoresponsivity originates from the BaSi2 film. The effect of the substrate temperature on the film’s properties was also investigated. The films grown at a substrate temperature larger than 500 °C are single-phase polycrystalline BaSi2 films, while those grown at a substrate temperature of 400 °C is a mixture of phases. We confirmed that undoped evaporated BaSi2 films are an n-type material with high carrier concentration. High carrier lifetime of 4.8 and 2.7 μs can be found for the films grown at 500 °C and 400 °C, respectively. BaSi2 film grown at a substrate temperature of 500 °C, which is crack-free and single-phase, shows the best photoresponsivity. The maximum value of photocurrent was obtained at photon energy of 1.9 eV, corresponding to an external quantum efficiency of 22% under reverse applied voltage of 2 V.

  4. Distinct impact of targeted actin cytoskeleton reorganization on mechanical properties of normal and malignant cells.

    PubMed

    Efremov, Yu M; Dokrunova, A A; Efremenko, A V; Kirpichnikov, M P; Shaitan, K V; Sokolova, O S

    2015-11-01

    The actin cytoskeleton is substantially modified in cancer cells because of changes in actin-binding protein abundance and functional activity. As a consequence, cancer cells have distinctive motility and mechanical properties, which are important for many processes, including invasion and metastasis. Here, we studied the effects of actin cytoskeleton alterations induced by specific nucleation inhibitors (SMIFH2, CK-666), cytochalasin D, Y-27632 and detachment from the surface by trypsinization on the mechanical properties of normal Vero and prostate cancer cell line DU145. The Young's modulus of Vero cells was 1300±900 Pa, while the prostate cancer cell line DU145 exhibited significantly lower Young's moduli (600±400 Pa). The Young's moduli exhibited a log-normal distribution for both cell lines. Unlike normal cells, cancer cells demonstrated diverse viscoelastic behavior and different responses to actin cytoskeleton reorganization. They were more resistant to specific formin-dependent nucleation inhibition, and reinforced their cortical actin after detachment from the substrate. This article is part of a Special Issue entitled: Mechanobiology. PMID:25970206

  5. Effect of sodium acetate on the adhesion to porcine gastric mucin in a Lactococcus lactis strain grown on fructose.

    PubMed

    Kimoto-Nira, Hiromi; Moriya, Naoko; Yamasaki, Seishi; Takenaka, Akio; Suzuki, Chise

    2016-06-01

    The association of lactic acid bacteria with mucosal surfaces plays important roles in the beneficial effects of these bacteria on human health, such as colonization of the gastrointestinal tract for pathogen antagonism. Previously, we found that the adhesion of Lactococcus lactis 7-1 to porcine gastric mucin was higher with fructose than with lactose, galactose or xylose as the carbon source. In this study, we examined the effect of growth conditions on the adhesion of strain 7-1 grown on fructose. Medium components affect the adhesion: the adhesion of strain 7-1 grown with sodium acetate was higher than that without it. The enhancement of adhesion by sodium acetate was not observed under aerobic conditions. Cellular properties grown with or without sodium acetate were characterized: strain 7-1 grown with sodium acetate had similar sugar contents, and different fatty acid composition to those grown without it. Strain 7-1 grown with sodium acetate showed significantly lower cell yield and significantly higher hydrophobicity than those grown without it, which is associated with higher adhesion. Fructose and sodium acetate are frequently used in the food industry; this study may reveal a simple way to enhance the adhesion of lactic acid bacteria by growing them with these substances. PMID:26302882

  6. Magnetization dynamics of cobalt grown on graphene

    SciTech Connect

    Berger, A. J.; White, S. P.; Adur, R.; Pu, Y.; Hammel, P. C.; Amamou, W.; Kawakami, R. K.

    2014-05-07

    Ferromagnetic resonance (FMR) spin pumping is a rapidly growing field which has demonstrated promising results in a variety of material systems. This technique utilizes the resonant precession of magnetization in a ferromagnet to inject spin into an adjacent non-magnetic material. Spin pumping into graphene is attractive on account of its exceptional spin transport properties. This article reports on FMR characterization of cobalt grown on chemical vapor deposition graphene and examines the validity of linewidth broadening as an indicator of spin pumping. In comparison to cobalt samples without graphene, direct contact cobalt-on-graphene exhibits increased FMR linewidth—an often used signature of spin pumping. Similar results are obtained in Co/MgO/graphene structures, where a 1 nm MgO layer acts as a tunnel barrier. However, magnetometry, magnetic force microscopy, and Kerr microscopy measurements demonstrate increased magnetic disorder in cobalt grown on graphene, perhaps due to changes in the growth process and an increase in defects. This magnetic disorder may account for the observed linewidth enhancement due to effects such as two-magnon scattering or mosaicity. As such, it is not possible to conclude successful spin injection into graphene from FMR linewidth measurements alone.

  7. Phytochemical phenolics in organically grown vegetables.

    PubMed

    Young, Janice E; Zhao, Xin; Carey, Edward E; Welti, Ruth; Yang, Shie-Shien; Wang, Weiqun

    2005-12-01

    Fruit and vegetable intake is inversely correlated with risks for several chronic diseases in humans. Phytochemicals, and in particular, phenolic compounds, present in plant foods may be partly responsible for these health benefits through a variety of mechanisms. Since environmental factors play a role in a plant's production of secondary metabolites, it was hypothesized that an organic agricultural production system would increase phenolic levels. Cultivars of leaf lettuce, collards, and pac choi were grown either on organically certified plots or on adjacent conventional plots. Nine prominent phenolic agents were quantified by HPLC, including phenolic acids (e. g. caffeic acid and gallic acid) and aglycone or glycoside flavonoids (e. g. apigenin, kaempferol, luteolin, and quercetin). Statistically, we did not find significant higher levels of phenolic agents in lettuce and collard samples grown organically. The total phenolic content of organic pac choi samples as measured by the Folin-Ciocalteu assay, however, was significantly higher than conventional samples (p < 0.01), and seemed to be associated with a greater attack the plants in organic plots by flea beetles. These results indicated that although organic production method alone did not enhance biosynthesis of phytochemicals in lettuce and collards, the organic system provided an increased opportunity for insect attack, resulting in a higher level of total phenolic agents in pac choi. PMID:16302198

  8. Magnetization dynamics of cobalt grown on graphene

    NASA Astrophysics Data System (ADS)

    Berger, A. J.; Amamou, W.; White, S. P.; Adur, R.; Pu, Y.; Kawakami, R. K.; Hammel, P. C.

    2014-05-01

    Ferromagnetic resonance (FMR) spin pumping is a rapidly growing field which has demonstrated promising results in a variety of material systems. This technique utilizes the resonant precession of magnetization in a ferromagnet to inject spin into an adjacent non-magnetic material. Spin pumping into graphene is attractive on account of its exceptional spin transport properties. This article reports on FMR characterization of cobalt grown on chemical vapor deposition graphene and examines the validity of linewidth broadening as an indicator of spin pumping. In comparison to cobalt samples without graphene, direct contact cobalt-on-graphene exhibits increased FMR linewidth—an often used signature of spin pumping. Similar results are obtained in Co/MgO/graphene structures, where a 1 nm MgO layer acts as a tunnel barrier. However, magnetometry, magnetic force microscopy, and Kerr microscopy measurements demonstrate increased magnetic disorder in cobalt grown on graphene, perhaps due to changes in the growth process and an increase in defects. This magnetic disorder may account for the observed linewidth enhancement due to effects such as two-magnon scattering or mosaicity. As such, it is not possible to conclude successful spin injection into graphene from FMR linewidth measurements alone.

  9. Activation of the Nipah Virus Fusion Protein in MDCK Cells Is Mediated by Cathepsin B within the Endosome-Recycling Compartment

    PubMed Central

    Diederich, Sandra; Sauerhering, Lucie; Weis, Michael; Altmeppen, Hermann; Schaschke, Norbert; Reinheckel, Thomas; Erbar, Stephanie

    2012-01-01

    Proteolytic activation of the fusion protein of the highly pathogenic Nipah virus (NiV F) is a prerequisite for the production of infectious particles and for virus spread via cell-to-cell fusion. Unlike other paramyxoviral fusion proteins, functional NiV F activation requires endocytosis and pH-dependent cleavage at a monobasic cleavage site by endosomal proteases. Using prototype Vero cells, cathepsin L was previously identified to be a cleavage enzyme. Compared to Vero cells, MDCK cells showed substantially higher F cleavage rates in both NiV-infected and NiV F-transfected cells. Surprisingly, this could not be explained either by an increased F endocytosis rate or by elevated cathepsin L activities. On the contrary, MDCK cells did not display any detectable cathepsin L activity. Though we could confirm cathepsin L to be responsible for F activation in Vero cells, inhibitor studies revealed that in MDCK cells, cathepsin B was required for F-protein cleavage and productive replication of pathogenic NiV. Supporting the idea of an efficient F cleavage in early and recycling endosomes of MDCK cells, endocytosed F proteins and cathepsin B colocalized markedly with the endosomal marker proteins early endosomal antigen 1 (EEA-1), Rab4, and Rab11, while NiV F trafficking through late endosomal compartments was not needed for F activation. In summary, this study shows for the first time that endosomal cathepsin B can play a functional role in the activation of highly pathogenic NiV. PMID:22278224

  10. Cometabolism of Methyl tertiary Butyl Ether and Gaseous n-Alkanes by Pseudomonas mendocina KR-1 Grown on C5 to C8 n-Alkanes

    PubMed Central

    Smith, Christy A.; O'Reilly, Kirk T.; Hyman, Michael R.

    2003-01-01

    Pseudomonas mendocina KR-1 grew well on toluene, n-alkanes (C5 to C8), and 1° alcohols (C2 to C8) but not on other aromatics, gaseous n-alkanes (C1 to C4), isoalkanes (C4 to C6), 2° alcohols (C3 to C8), methyl tertiary butyl ether (MTBE), or tertiary butyl alcohol (TBA). Cells grown under carbon-limited conditions on n-alkanes in the presence of MTBE (42 μmol) oxidized up to 94% of the added MTBE to TBA. Less than 3% of the added MTBE was oxidized to TBA when cells were grown on either 1° alcohols, toluene, or dextrose in the presence of MTBE. Concentrated n-pentane-grown cells oxidized MTBE to TBA without a lag phase and without generating tertiary butyl formate (TBF) as an intermediate. Neither TBF nor TBA was consumed by n-pentane-grown cells, while formaldehyde, the expected C1 product of MTBE dealkylation, was rapidly consumed. Similar Ks values for MTBE were observed for cells grown on C5 to C8 n-alkanes (12.95 ± 2.04 mM), suggesting that the same enzyme oxidizes MTBE in cells grown on each n-alkane. All growth-supporting n-alkanes (C5 to C8) inhibited MTBE oxidation by resting n-pentane-grown cells. Propane (Ki = 53 μM) and n-butane (Ki = 16 μM) also inhibited MTBE oxidation, and both gases were also consumed by cells during growth on n-pentane. Cultures grown on C5 to C8 n-alkanes also exhibited up to twofold-higher levels of growth in the presence of propane or n-butane, whereas no growth stimulation was observed with methane, ethane, MTBE, TBA, or formaldehyde. The results are discussed in terms of their impacts on our understanding of MTBE biodegradation and cometabolism. PMID:14660389

  11. Growth and heavy metals accumulation potential of microalgae grown in sewage wastewater and petrochemical effluents.

    PubMed

    Ajayan, K V; Selvaraju, M; Thirugnanamoorthy, K

    2011-08-15

    Microalgae exhibit a number of heavy metal uptake process by different metabolism. In this study, the ability of microalgae for removal of heavy metal from wastewater was studied. Growth and biochemical contents of microalgae were determined by spectrophotometer. Heavy metal analysis of wastewater effluents were performed by atomic absorption spectrophotometer before and after treatment at laboratory scale. The growth of Scenedesmus bijuga and Oscillatoria quadripunctulata in sewage wastewater was higher than those grown in synthetic medium. Whereas, the growth of S. bijuga and O. quadripunctulata in sterilized petrochemical effluents was slightly lower than that grown in the standard synthetic medium. The chlorophyll, carotenoid and protein content of S. bijuga and O. quadripunctulata grown in sterilized sewage wastewater were higher than those grown in the standard medium. Similarly S. bijuga and O. quadripunctulata grown in sterilized petrochemical effluents showed lower contents of pigments and protein than those grown in sewage and synthetic medium. Heavy metals copper, cobalt, lead and zinc were removed by 37-50, 20.3-33.3, 34.6-100 and 32.1-100%, respectively from sewage wastewater and petrochemical effluent using Ocillatoria culture. The metal absorption by S. bijuga were (Cu, Co, Pb, Zn) 60-50, 29.6-66, 15.4-25 and 42.9-50%, respectively from sewage and petrochemical effluents. Both species showed high level of heavy metal removal efficiency and metal sorption efficiency of both microalgae depended on the type of biosorbent, the physiological status of the cells, availability of heavy metal, concentration of heavy metal and chemical composition of wastewater. PMID:22545355

  12. Cytotoxicity of municipal solid waste incinerator ash wastes toward mammalian kidney cell lines.

    PubMed

    Huang, Wu-Jang; Tsai, Jia-Lin; Liao, Ming-Huei

    2008-05-01

    In this study, three municipal solid waste incinerator (MSWI) ash wastes-bottom ash, scrubber residue, and baghouse ash-were extracted using a toxicity characteristic leaching procedure (TCLP) extractant. These so-called final TCLP extracts were applied to African green monkey kidney cells (Vero), baby hamster kidney cells (BHK-21), and pig kidney cells (PK-15), multi-well absorption reader analysis was performed to test how the cytotoxicity of the incineration ashes would affect the digestive systems of animals. Ion-coupled plasma analyses indicated that the baghouse ash extract possessed the highest pH and heavy metal concentration, its cytotoxicity was also the highest. In contrast, the bottom ash and the scrubber residue exhibited very low cytotoxicities. The cytotoxicities of mixtures of baghouse ash and scrubber residue toward the three tested cell lines increased as the relative ratio of the baghouse ash increased, especially for the Vero cells. The slight cytotoxicity of the scrubber residue arose mainly from the presence of Cr species, whereas the high cytotoxicity of the baghouse ash resulted from its high content of heavy metals and alkali ions. In addition, it appears that the dissolved total organic carbon content of these ash wastes can reduce the cytotoxicity of ash wastes that collect in animal cells. PMID:18329068

  13. In vitro antiproliferativeactivity of Annona reticulata roots on human cancer cell lines

    PubMed Central

    Suresh, H. M.; Shivakumar, B.; Hemalatha, K.; Heroor, S. S.; Hugar, D. S.; Rao, K. R. S. Sambasiva

    2011-01-01

    Background: The phytochemical and pharmacological activities of Annona reticulata components suggest a wide range of clinical application in lieu of cancer chemotherapy. Materials and Methods: Ethanol and aqueous extracts of roots of Annona reticulata Linn were studied for their in vitro antiproliferative activity on A-549 (human lung carcinoma), K-562 (human chronic myelogenous leukemia bone marrow), HeLa (human cervix) and MDA-MB (human adenocarcinoma mammary gland) cancer cell lines by MTT [3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyl tetrazolium bromide] colorimetric assay. Results: The ethanol extract exhibited a prominent inhibitory effect against A-549, K-562, HeLa and MDA-MB human cancer cell lines at a concentration range between 10 and 40 μg/ml, whereas the aqueous extract showed a lower activity at the same concentration. Simultaneously, the effect of the ethanol extract toward the inhibition of Vero cell line proliferation was lower in comparison with the cancer cell lines. Conclusion: The significant antiproliferative activity of the ethanol extract of Annona reticulata roots against A-549, K-562, HeLa and MDA-MB human cancer cell lines may be attributed toward the collective presence of acetogenins, alkaloids and lower inhibitory effect on Vero cell line, which suggests Annona reticulata be used as a chemopreventive agent in cancer therapy. PMID:21731389

  14. Enhancement of Immune Activation Activities of Spirulina maxima Grown in Deep-Sea Water

    PubMed Central

    Choi, Woon Yong; Kang, Do Hyung; Lee, Hyeon Yong

    2013-01-01

    In this study, the immuno-modulatory and anticancer activities of marine algae, Spirulina maxima grown in deep-sea water (DSW), were investigated. It was found that the extract of S. maxima, cultured in DSW, effectively suppressed the expression of Bcl2 in A549 cells as well as inhibiting various human cancer cells with concentration dependency, which possibly implies that the extracts may play more important roles in controlling cancer cell growth. The secretion of cytokines IL-6 and TNF-α from human B cells was also greatly increased, compared to those of the extract grown in conventional sea-water. The growth of Human Natural Killer (NK) cells in the presence of the extracts from DSW was significantly higher (12.2 × 104 viable cells/mL) when compared to the control (1.1 × 104 viable cells/mL). Based on HPLC analysis, the increase in the biological activities of the extracts from DSW was caused by considerably high amounts of β-carotene and ascorbic acid because the DSW contained high concentrations and good ratios of several key minerals for biosynthesizing β-carotene and ascorbic acid, as well as maintaining high cell growth. PMID:23743830

  15. Enhancement of immune activation activities of Spirulina maxima grown in deep-sea water.

    PubMed

    Choi, Woon Yong; Kang, Do Hyung; Lee, Hyeon Yong

    2013-01-01

    In this study, the immuno-modulatory and anticancer activities of marine algae, Spirulina maxima grown in deep-sea water (DSW), were investigated. It was found that the extract of S. maxima, cultured in DSW, effectively suppressed the expression of Bcl2 in A549 cells as well as inhibiting various human cancer cells with concentration dependency, which possibly implies that the extracts may play more important roles in controlling cancer cell growth. The secretion of cytokines IL-6 and TNF-α from human B cells was also greatly increased, compared to those of the extract grown in conventional sea-water. The growth of Human Natural Killer (NK) cells in the presence of the extracts from DSW was significantly higher (12.2 × 104 viable cells/mL) when compared to the control (1.1 × 104 viable cells/mL). Based on HPLC analysis, the increase in the biological activities of the extracts from DSW was caused by considerably high amounts of β-carotene and ascorbic acid because the DSW contained high concentrations and good ratios of several key minerals for biosynthesizing β-carotene and ascorbic acid, as well as maintaining high cell growth. PMID:23743830

  16. Vapor grown carbon fiber (VGCF) composites

    SciTech Connect

    Ciminelli, D.L.; Kearns, K.M.; Ragland, W.R.

    1996-12-31

    Vapor grown carbon fibers (VGCF) offer a unique opportunity for carbon fiber composites to expand into a multitude of new markets due to their low cost of only $3 to 5 per pound. Additionally, VGCFs are extremely graphitic and have demonstrated the highest thermal conductivity of any graphite material. Pyrograf-III{reg_sign}, a VGCF produced by Applied Sciences, Inc (ASI), is a small diameter (0.1 {mu}m) fiber with a high aspect ratio (100- 1000). The primary interest of the work is for thermal management applications. The focus of the work has been developing novel process methodologies for these unusual fibers using phenolic and epoxy resin to produce low cost composites. The development of VGCF composites is being performed through a Cooperative Research and Development Agreement (CRDA) between ASI and the Materials Directorate (WL/ML), Wright Laboratory, United States Air Force.

  17. Nanoelectronic biosensors based on CVD grown graphene

    NASA Astrophysics Data System (ADS)

    Huang, Yinxi; Dong, Xiaochen; Shi, Yumeng; Li, Chang Ming; Li, Lain-Jong; Chen, Peng

    2010-08-01

    Graphene, a single-atom-thick and two-dimensional carbon material, has attracted great attention recently. Because of its unique electrical, physical, and optical properties, graphene has great potential to be a novel alternative to carbon nanotubes in biosensing. We demonstrate the use of large-sized CVD grown graphene films configured as field-effect transistors for real-time biomolecular sensing. Glucose or glutamate molecules were detected by the conductance change of the graphene transistor as the molecules are oxidized by the specific redox enzyme (glucose oxidase or glutamic dehydrogenase) functionalized onto the graphene film. This study indicates that graphene is a promising candidate for the development of real-time nanoelectronic biosensors.Graphene, a single-atom-thick and two-dimensional carbon material, has attracted great attention recently. Because of its unique electrical, physical, and optical properties, graphene has great potential to be a novel alternative to carbon nanotubes in biosensing. We demonstrate the use of large-sized CVD grown graphene films configured as field-effect transistors for real-time biomolecular sensing. Glucose or glutamate molecules were detected by the conductance change of the graphene transistor as the molecules are oxidized by the specific redox enzyme (glucose oxidase or glutamic dehydrogenase) functionalized onto the graphene film. This study indicates that graphene is a promising candidate for the development of real-time nanoelectronic biosensors. Electronic supplementary information (ESI) available: AFM images of graphene film before and after functionalization, transfer curves of graphene after every step, SEM image of CNT-net, and detection results using CNT-net devices. See DOI: 10.1039/c0nr00142b

  18. van der Waals Heterostructures Grown by MBE

    NASA Astrophysics Data System (ADS)

    Hinkle, Christopher

    In this work, we demonstrate the high-quality MBE heterostructure growth of various layered 2D materials by van der Waals epitaxy (VDWE). The coupling of different types of van der Waals materials including transition metal dichalcogenide thin films (e.g., WSe2, WTe2, HfSe2) , insulating hexagonal boron nitride (h-BN), and topological insulators (e.g., Bi2Se3) allows for the fabrication of novel electronic devices that take advantage of unique quantum confinement and spin-based characteristics. The relaxed lattice-matching criteria of van der Waals epitaxy has allowed for high-quality heterostructure growth with atomically abrupt interfaces, allowing us to couple these materials based primarily on their band alignment and electronic properties. We will discuss the impact of sample preparation, surface reactivity, and lattice mismatch of various substrates (sapphire, graphene, TMDs, Bi2Se3) on the growth mode and quality of the films and will discuss our studies of substrate temperature and flux rates on the resultant growth and grain size. Structural and chemical characterization was conducted via reflection high energy electron diffraction (RHEED, X-ray diffraction (XRD), transmission electron microscopy (TEM), scanning tunneling microscopy/spectroscopy (STM/S), atomic force microscopy (AFM), X-ray photoelectron spectroscopy (XPS), and Raman spectroscopy. Experimentally determined band alignments have been determined and compared with first-principles calculations allowing the design of novel low-power logic and magnetic memory devices. Initial results from the electrical characterization of these grown thin films and some simple devices will also be presented. These VDWE grown layered 2D materials show significant potential for fabricating novel heterostructures with tunable band alignments and magnetic properties for a variety of nanoelectronic and optoelectronic applications.

  19. Quantitative Schlieren analysis applied to holograms of crystals grown on Spacelab 3

    NASA Technical Reports Server (NTRS)

    Brooks, Howard L.

    1986-01-01

    In order to extract additional information about crystals grown in the microgravity environment of Spacelab, a quantitative schlieren analysis technique was developed for use in a Holography Ground System of the Fluid Experiment System. Utilizing the Unidex position controller, it was possible to measure deviation angles produced by refractive index gradients of 0.5 milliradians. Additionally, refractive index gradient maps for any recorded time during the crystal growth were drawn and used to create solute concentration maps for the environment around the crystal. The technique was applied to flight holograms of Cell 204 of the Fluid Experiment System that were recorded during the Spacelab 3 mission on STS 51B. A triglycine sulfate crystal was grown under isothermal conditions in the cell and the data gathered with the quantitative schlieren analysis technique is consistent with a diffusion limited growth process.

  20. Nine new diterpenes from the leaves of plantation-grown Cunninghamia lanceolata.

    PubMed

    Zhao, Shuangshuang; Ling, Junhong; Li, Zhanlin; Wang, Silong; Hu, Jiangchun; Wang, Nan

    2015-04-01

    Nine new diterpenes named lanceolatanol hydroperoxide (1), epilanceolatanol hydroperoxide (2), lanceolatanoic acid hydroperoxide (3), epilanceolatanoic acid hydroperoxide (4), lanceolatanol (5), lanceolatanoic acid (6), 11-acetoxylanceolatanoic acid (7), 11-acetoxylanceolatanoic acid methyl ester (8) and epoxyhinokiol (13) were characterized from the leaves of plantation-grown Cunninghamia lanceolata along with twelve known compounds. The compounds were evaluated for their growth inhibitory activities against the human prostate cell line (PC-3). PMID:25736997

  1. Cell lines that support replication of a novel herpes simplex virus 1 U{sub L}31 deletion mutant can properly target U{sub L}34 protein to the nuclear rim in the absence of U{sub L}31

    SciTech Connect

    Liang Li; Tanaka, Michiko; Kawaguchi, Yasushi; Baines, Joel D. . E-mail: jdb11@cornell.edu

    2004-11-10

    Previous results indicated that the herpes simplex virus 1 (HSV-1) U{sub L}31 gene is necessary and sufficient for localization of the U{sub L}34 protein exclusively to the nuclear membrane of infected Hep2 cells. In the current studies, a bacterial artificial chromosome containing the entire HSV-1 strain F genome was used to construct a recombinant viral genome in which a gene encoding kanamycin resistance was inserted in place of 262 codons of the 306 codon U{sub L}31 open reading frame. The deletion virus produced virus titers approximately 10- to 50-fold lower in rabbit skin cells, more than 2000-fold lower in Vero cells, and more than 1500-fold lower in CV1 cells, compared to a virus bearing a restored U{sub L}31 gene. The replication of the U{sub L}31 deletion virus was restored on U{sub L}31-complementing cell lines derived either from rabbit skin cells or CV1 cells. Confocal microscopy indicated that the majority of U{sub L}34 protein localized aberrantly in the cytoplasm and nucleoplasm of Vero cells and CV1 cells, whereas U{sub L}34 protein localized at the nuclear membrane in rabbit skin cells, and U{sub L}31 complementing CV1 cells infected with the U{sub L}31 deletion virus. We conclude that rabbit skin cells encode a function that allows proper localization of U{sub L}34 protein to the nuclear membrane. We speculate that this function partially complements that of U{sub L}31 and may explain why U{sub L}31 is less critical for replication in rabbit skin cells as opposed to Vero and CV1 cells.

  2. Metabolic responses of Rhodococcus erythropolis PR4 grown on diesel oil and various hydrocarbons.

    PubMed

    Laczi, Krisztián; Kis, Ágnes; Horváth, Balázs; Maróti, Gergely; Hegedüs, Botond; Perei, Katalin; Rákhely, Gábor

    2015-11-01

    Rhodococcus erythropolis PR4 is able to degrade diesel oil, normal-, iso- and cycloparaffins and aromatic compounds. The complete DNA content of the strain was previously sequenced and numerous oxygenase genes were identified. In order to identify the key elements participating in biodegradation of various hydrocarbons, we performed a comparative whole transcriptome analysis of cells grown on hexadecane, diesel oil and acetate. The transcriptomic data for the most prominent genes were validated by RT-qPCR. The expression of two genes coding for alkane-1-monooxygenase enzymes was highly upregulated in the presence of hydrocarbon substrates. The transcription of eight phylogenetically diverse cytochrome P450 (cyp) genes was upregulated in the presence of diesel oil. The transcript levels of various oxygenase genes were determined in cells grown in an artificial mixture, containing hexadecane, cycloparaffin and aromatic compounds and six cyp genes were induced by this hydrocarbon mixture. Five of them were not upregulated by linear and branched hydrocarbons. The expression of fatty acid synthase I genes was downregulated by hydrocarbon substrates, indicating the utilization of external alkanes for fatty acid synthesis. Moreover, the transcription of genes involved in siderophore synthesis, iron transport and exopolysaccharide biosynthesis was also upregulated, indicating their important role in hydrocarbon metabolism. Based on the results, complex metabolic response profiles were established for cells grown on various hydrocarbons. Our results represent a functional annotation of a rhodococcal genome, provide deeper insight into molecular events in diesel/hydrocarbon utilization and suggest novel target genes for environmental monitoring projects. PMID:26346267

  3. Multicellularity and Antibiotic Resistance in Klebsiella pneumoniae Grown Under Bloodstream-Mimicking Fluid Dynamic Conditions

    PubMed Central

    Thornton, Margaret M.; Chung-Esaki, Hangyul M.; Irvin, Charlene B.; Bortz, David M.; Solomon, Michael J.; Younger, John G.

    2012-01-01

    Background. While the importance of fluid dynamical conditions is well recognized in the growth of biofilms, their role during bacteremia is unknown. We examined the impact of physiological fluid shear forces on the development of multicellular aggregates of Klebsiella pneumoniae. Methods. Wild-type and O-antigen or capsular mutants of K. pneumoniae were grown as broth culture in a Taylor-Couette flow cell configured to provide continuous shear forces comparable to those encountered in the human arterial circulation (ie, on the order of 1.0 Pa). The size distribution and antibiotic resistance of aggregates formed in this apparatus were determined, as was their ability to persist in the bloodstream of mice following intravenous injection. Results. Unlike growth in shaking flasks, bacteria grown in the test apparatus readily formed aggregates, a phenotype largely absent in capsular mutants and to a lesser degree in O-antigen mutants. Aggregates were found to persist in the bloodstream of mice. Importantly, organisms grown under physiological shear were found to have an antibiotic resistance phenotype intermediate between that of fully planktonic and biofilm states. Conclusions. When grown under intravascular-magnitude fluid dynamic conditions, K. pneumoniae spontaneously develops into multicellular aggregates that are capable of persisting in the circulation and exhibit increased antibiotic resistance. PMID:22711903

  4. Dynamic and selective HERV RNA expression in neuroblastoma cells subjected to variation in oxygen tension and demethylation.

    PubMed

    Hu, Lijuan; Uzhameckis, Dmitrijs; Hedborg, Fredrik; Blomberg, Jonas

    2016-01-01

    We studied HERV expression in cell lines after hypoxia, mitogenic stimulation, and demethylation, to better understand if hypoxia may play a role in ERV activation also within the nervous system, as represented by neuroblastoma cell lines. The level of RNA of four human ERV groups (HERVs) (HERVE, I/T, H, and W), and three housekeeping genes, of different cell lines including A549, COS-1, Namalwa, RD-L and Vero-E6, as well as human neuroblastoma cell lines SH-SY5Y, SK-N-DZ, and SK-N-AS were studied using reverse transcription and real-time quantitative PCR (QPCR). During the course of recovery from hypoxia a pronounced and selective activation of RNA expression of HERVW-like sequences, but not of HERVE, I/T, H, and three housekeeping genes, was found in the neuroblastoma cell lines, most pronounced in SK-N-DZ. In the SK-N-DZ cell line, we also tested the expression of HERVs after chemical treatments. HERVW-like sequences were selectively upregulated by 5-azacytidine, a demethylating agent. Some HERVW loci seem especially responsive to hypoxia and demethylation. HERV expression in neuroblastoma cells is selectively and profoundly influenced by some physiological and chemical stimuli. PMID:26818268

  5. Radiative efficiency of MOCVD grown QD lasers

    NASA Astrophysics Data System (ADS)

    Mawst, Luke; Tsvid, Gene; Dudley, Peter; Kirch, Jeremy; Park, J. H.; Kim, N.

    2010-02-01

    The optical spectral gain characteristics and overall radiative efficiency of MOCVD grown InGaAs quantum dot lasers have been evaluated. Single-pass, multi-segmented amplified spontaneous emission measurements are used to obtain the gain, absorption, and spontaneous emission spectra in real units. Integration of the calibrated spontaneous emission spectra then allows for determining the overall radiative efficiency, which gives important insights into the role which nonradiative recombination plays in the active region under study. We use single pass, multi-segmented edge-emitting in which electrically isolated segments allow to vary the length of a pumped region. In this study we used 8 section devices (the size of a segment is 50x300 μm) with only the first 5 segments used for varying the pump length. The remaining unpumped segments and scribed back facet minimize round trip feedback. Measured gain spectra for different pump currents allow for extraction of the peak gain vs. current density, which is fitted to a logarithmic dependence and directly compared to conventional cavity length analysis, (CLA). The extracted spontaneous emission spectrum is calibrated and integrated over all frequencies and modes to obtain total spontaneous radiation current density and radiative efficiency, ηr. We find ηr values of approximately 17% at RT for 5 stack QD active regions. By contrast, high performance InGaAs QW lasers exhibit ηr ~50% at RT.

  6. Vapor grown silicon dioxide improves transistor base-collector junctions

    NASA Technical Reports Server (NTRS)

    Carley, D. R.; Duclos, R. A.

    1966-01-01

    Vapor grown silicon dioxide layer protects base-collector junction in silicon planar transistors during the emitter diffusion process. This oxide fills in any imperfections that exist in the thermally grown oxide layer and is of greater thickness than that layer. This process is used to deposit protective silicon dioxide coatings on optical surfaces.

  7. 76 FR 16323 - Irish Potatoes Grown in Washington; Continuance Referendum

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-23

    ... Agricultural Marketing Service 7 CFR Part 946 Irish Potatoes Grown in Washington; Continuance Referendum AGENCY... referendum be conducted among eligible Washington potato growers to determine whether they favor continuance of the marketing order regulating the handling of Irish potatoes grown in Washington. DATES:...

  8. 78 FR 77367 - Almonds Grown in California; Continuance Referendum

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-23

    ... Agricultural Marketing Service 7 CFR Part 981 Almonds Grown in California; Continuance Referendum AGENCY: Agricultural Marketing Service, USDA. ACTION: Referendum order. SUMMARY: This document directs that a... continuance of the marketing order that regulates the handling of almonds grown in California. DATES:...

  9. 78 FR 45898 - Vidalia Onions Grown in Georgia; Continuance Referendum

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-30

    ...; ] DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 955 Vidalia Onions Grown in Georgia... document directs that a referendum be conducted among eligible producers of Vidalia onions grown in Georgia... Vidalia onions produced in the production area. DATES: The referendum will be conducted from September...

  10. Influence of shading on container-grown flowering dogwoods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bare root dogwoods can be successfully grown when transplanted into a container production system. Shade treatments regardless of color or density did have an effect on the plant growth of Cherokee Brave™ and Cherokee Princess dogwood. Plants grown under 50% black and 50% white shade had more heigh...

  11. Plasma-Mediated Inactivation of Pseudomonas aeruginosa Biofilms Grown on Borosilicate Surfaces under Continuous Culture System

    PubMed Central

    Vandervoort, Kurt G.; Brelles-Mariño, Graciela

    2014-01-01

    Biofilms are microbial communities attached to a surface and embedded in a matrix composed of exopolysaccharides and excreted nucleic acids. Bacterial biofilms are responsible for undesirable effects such as disease, prostheses colonization, biofouling, equipment damage, and pipe plugging. Biofilms are also more resilient than free-living cells to regular sterilization methods and therefore it is indispensable to develop better ways to control and remove them. The use of gas discharge plasmas is a good alternative since plasmas contain a mixture of reactive agents well-known for their decontamination potential against free microorganisms. We have previously reported that Pseudomonas aeruginosa biofilms were inactivated after a 1-min plasma exposure. We determined that the adhesiveness and the thickness of Pseudomonas biofilms grown on borosilicate were reduced. We also reported sequential morphological changes and loss of viability upon plasma treatment. However, the studies were carried out in batch cultures. The use of a continuous culture results in a more homogenous environment ensuring reproducible biofilm growth. The aim of this work was to study plasma-mediated inactivation of P. aeruginosa biofilms grown on borosilicate in a continuous culture system. In this paper we show that biofilms grown on glass under continuous culture can be inactivated by using gas discharge plasma. Both biofilm architecture and cell culturabilty are impacted by the plasma treatment. The inactivation kinetics is similar to previously described ones and cells go through sequential changes ranging from minimal modification without loss of viability at short plasma exposure times, to major structure and viability loss at longer exposure times. We report that changes in biofilm structure leading to the loss of culturability and viability are related to a decrease of the biofilm matrix adhesiveness. To our knowledge, there has been no attempt to evaluate the inactivation

  12. Methyl sterol and cyclopropane fatty acid composition of Methylococcus capsulatus grown at low oxygen tensions.

    PubMed Central

    Jahnke, L L; Nichols, P D

    1986-01-01

    Methylococcus capsulatus contained extensive intracytoplasmic membranes when grown in fed-batch cultures over a wide range of oxygen tensions (0.1 to 10.6%, vol/vol) and at a constant methane level. Although the biomass decreased as oxygen levels were lowered, consistently high amounts of phospholipid and methyl sterol were synthesized. The greatest amounts of sterol and phospholipid were found in cells grown between 0.5 and 1.1% oxygen (7.2 and 203 mumol/g [dry weight], respectively). While sterol was still synthesized in significant amounts in cells grown at 0.1% oxygen, the major sterol product was the dimethyl form. Analysis by capillary gas chromatography-mass spectrophotometry showed that the phospholipid esterified fatty acids were predominantly 16:0 and 16:1 and that the hexadecenoates consisted of cis delta 9, delta 10, and delta 11 isomers. At low oxygen tensions, the presence of large amounts (25%) of cyclopropane fatty acids (cy 17:0) with the methylene groups at the delta 9, delta 10, and delta 11 positions was detected. Although the delta 9 monoenoic isomer was predominant, growth at low oxygen levels enhanced the synthesis of the delta 10 isomers of 16:1 and cy 17:0. As the oxygen level was increased, the amount of cyclopropanes decreased, such that only a trace of cy 17:0 could be detected in cells grown at 10.6% oxygen. Although M. capsulatus grew at very low oxygen tensions, this growth was accompanied by changes in the membrane lipids. PMID:3087955

  13. The virion N protein of infectious bronchitis virus is more phosphorylated than the N protein from infected cell lysates

    SciTech Connect

    Jayaram, Jyothi; Youn, Soonjeon; Collisson, Ellen W. . E-mail: ecollisson@cvm.tamu.edu

    2005-08-15

    Because phosphorylation of the infectious bronchitis virus (IBV) nucleocapsid protein (N) may regulate its multiple roles in viral replication, the dynamics of N phosphorylation were examined. {sup 32}P-orthophosphate labeling and Western blot analyses confirmed that N was the only viral protein that was phosphorylated. Pulse labeling with {sup 32}P-orthophosphate indicated that the IBV N protein was phosphorylated in the virion, as well as at all times during infection in either chicken embryo kidney cells or Vero cells. Pulse-chase analyses followed by immunoprecipitation of IBV N proteins using rabbit anti-IBV N polyclonal antibody demonstrated that the phosphate on the N protein was stable for at least 1 h. Simultaneous labeling with {sup 32}P-orthophosphate and {sup 3}H-leucine identified a 3.5-fold increase in the {sup 32}P:{sup 3}H counts per minute (cpm) ratio of N in the virion as compared to the {sup 32}P:{sup 3}H cpm ratio of N in the cell lysates from chicken embryo kidney cells, whereas in Vero cells the {sup 32}P:{sup 3}H cpm ratio of N from the virion was 10.5-fold greater than the {sup 32}P:{sup 3}H cpm ratio of N from the cell lysates. These studies are consistent with the phosphorylation of the IBV N playing a role in assembly or maturation of the viral particle.

  14. Revised stereochemistry of ficifolidione and its biological activities against insects and cells.

    PubMed

    Nishiwaki, Hisashi; Fujiwara, Satomi; Wukirsari, Tuti; Iwamoto, Hiroyuki; Mori, Shigeki; Nishi, Kosuke; Sugahara, Takuya; Yamauchi, Satoshi; Shuto, Yoshihiro

    2015-01-23

    Ficifolidione (1), a moderately active insecticidal compound from two species of Myrtaceae, and its derivatives were synthesized to evaluate their insecticidal activity. X-ray crystallographic analyses and specific rotation values of ficifolidione and its C-4 (2) demonstrated that the structure of ficifolidione differs from the reported absolute structure; that is, the C-4 configuration of ficifolidione should have an S configuration. The reported insecticidal activity of ficifolidione (1) and its C-4 epimer (2) against adult houseflies (Musca domestica), mosquito larvae (Culex pipiens), and cutworms (Spodoptera litura) was not observed. The cytotoxicities of ficifolidione and its derivatives (1-4) against four cell lines, Sf9, Colon26, HL60, and Vero, were also measured because ficifolidione has a phloroglucinol-derived moiety, a motif that is often present in the structure of cytotoxic chemicals. Compound 1 exhibited IC50 values of ca. 32, 9, 3, and 12 μM for Sf9, Colon26, HL60, and Vero cells, respectively, indicating that ficifolidione possesses selective cytotoxicity against the four cell lines. In HL60 cells treated with 1, DNA fragmentation and the activation of procaspase 3 were observed, suggesting that the cytotoxicity is induced by apoptosis. PMID:25495518

  15. Properties of Streptococcus mutans Grown in a Synthetic Medium: Binding of Glucosyltransferase and In Vitro Adherence, and Binding of Dextran/Glucan and Glycoprotein and Agglutination

    PubMed Central

    Wu-Yuan, Christine D.; Tai, Stella; Slade, Hutton D.

    1979-01-01

    The influence of culture media on various properties of Streptococcus mutans was investigated. Strains of S. mutans (serotypes c, d, f, and g) were grown in a complex medium (Todd-Hewitt broth [THB]) or a synthetic medium (SYN). The SYN cells, in contrast to THB cells, did not bind extracellular glucosyltransferase and did not produce in vitro adherence. Both types of cells possessed constitutive levels of glucosyltransferase. B13 cells grown in SYN plus invertase-treated glucose possessed the same level of constitutive enzyme as THB cells. In contrast to THB cells, the SYN cells of seven serotype strains did not agglutinate upon the addition of high-molecular-weight dextran/glucan. Significant quantities of lower-molecular-weight (2 × 104 or 7 × 104) dextran and B13 glucan were bound by SYN cells. SYN cells agglutinated weakly in anti-glucan serum (titers, 0 to 16), whereas THB cells possessed titers of 32 to 256. Evidence for the existence of a second binding site in agglutination which does not possess a glucan-like polymer has been obtained. B13 cells grown in invertase-treated THB agglutinated to the same degree as normal THB cells. The nature of this site is unknown. SYN cells possess the type-specific polysaccharide antigen. B13 cells did not bind from THB a glycoprotein which reacts with antisera to the A, B, or T blood group antigens or which allows agglutination upon the addition of dextran. The results demonstrate that S. mutans grown in a chemically defined medium possesse markedly different biochemical and biological activities than cells grown in a complex organic medium. PMID:457252

  16. Different variation behaviors of resistivity for high-temperature-grown and low-temperature-grown p-GaN films

    NASA Astrophysics Data System (ADS)

    Jing, Yang; De-Gang, Zhao; De-Sheng, Jiang; Ping, Chen; Zong-Shun, Liu; Jian-Jun, Zhu; Ling-Cong, Le; Xiao-Jing, Li; Xiao-Guang, He; Li-Qun, Zhang; Hui, Yang

    2016-02-01

    Two series of p-GaN films grown at different temperatures are obtained by metal organic chemical vapor deposition (MOCVD). And the different variation behaviors of resistivity with growth condition for high- temperature(HT)-grown and low-temperature(LT)-grown p-GaN films are investigated. It is found that the resistivity of HT-grown p-GaN film is nearly unchanged when the NH3 flow rate or reactor pressure increases. However, it decreases largely for LT-grown p-GaN film. These different variations may be attributed to the fact that carbon impurities are easy to incorporate into p-GaN film when the growth temperature is low. It results in a relatively high carbon concentration in LT-grown p-GaN film compared with HT-grown one. Therefore, carbon concentration is more sensitive to the growth condition in these samples, ultimately, leading to the different variation behaviors of resistivity for HT- and LT-grown ones. Project supported by the National Natural Science Foundation of China (Grant Nos. 61474110, 61377020, 61376089, 61223005, and 61176126), the National Natural Science Fund for Distinguished Young Scholars, China (Grant No. 60925017), the One Hundred Person Project of the Chinese Academy of Sciences, and the Basic Research Project of Jiangsu Province, China (Grant No. BK20130362).

  17. Irrigation frequency alters nutrient uptake in container-grown Rhododendron plants grown with different rates of nitrogen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The influence of irrigation frequency (same amount of water per day given at different times) on nutrient uptake of container-grown evergreen Rhododendron ‘P.J.M. Compact’ (PJM) and ‘English Roseum’ (ER) and deciduous Rhododendron ‘Gibraltar’ (AZ) grown with different rates of nitrogen (N) fertilize...

  18. Exceptional gettering response of epitaxially grown kerfless silicon

    DOE PAGESBeta

    Powell, D. M.; Markevich, V. P.; Hofstetter, J.; Jensen, M. A.; Morishige, A. E.; Castellanos, S.; Lai, B.; Peaker, A. R.; Buonassisi, T.

    2016-02-08

    The bulk minority-carrier lifetime in p- and n-type kerfless epitaxial (epi) crystalline silicon wafers is shown to increase >500 during phosphorus gettering. We employ kinetic defect simulations and microstructural characterization techniques to elucidate the root cause of this exceptional gettering response. Simulations and deep-level transient spectroscopy (DLTS) indicate that a high concentra- tion of point defects (likely Pt) is “locked in” during fast (60 C/min) cooling during epi wafer growth. The fine dispersion of moderately fast-diffusing recombination-active point defects limits as-grown lifetime but can also be removed during gettering, confirmed by DLTS measurements. Synchrotron-based X-ray fluorescence microscopy indicates metal agglomeratesmore » at structural defects, yet the structural defect density is sufficiently low to enable high lifetimes. Consequently, after phosphorus diffusion gettering, epi silicon exhibits a higher lifetime than materials with similar bulk impurity contents but higher densities of structural defects, including multicrystalline ingot and ribbon silicon materials. As a result, device simulations suggest a solar-cell efficiency potential of this material >23%.« less

  19. Exceptional gettering response of epitaxially grown kerfless silicon

    NASA Astrophysics Data System (ADS)

    Powell, D. M.; Markevich, V. P.; Hofstetter, J.; Jensen, M. A.; Morishige, A. E.; Castellanos, S.; Lai, B.; Peaker, A. R.; Buonassisi, T.

    2016-02-01

    The bulk minority-carrier lifetime in p- and n-type kerfless epitaxial (epi) crystalline silicon wafers is shown to increase >500× during phosphorus gettering. We employ kinetic defect simulations and microstructural characterization techniques to elucidate the root cause of this exceptional gettering response. Simulations and deep-level transient spectroscopy (DLTS) indicate that a high concentration of point defects (likely Pt) is "locked in" during fast (60 °C/min) cooling during epi wafer growth. The fine dispersion of moderately fast-diffusing recombination-active point defects limits as-grown lifetime but can also be removed during gettering, confirmed by DLTS measurements. Synchrotron-based X-ray fluorescence microscopy indicates metal agglomerates at structural defects, yet the structural defect density is sufficiently low to enable high lifetimes. Consequently, after phosphorus diffusion gettering, epi silicon exhibits a higher lifetime than materials with similar bulk impurity contents but higher densities of structural defects, including multicrystalline ingot and ribbon silicon materials. Device simulations suggest a solar-cell efficiency potential of this material >23%.

  20. Nutritional Characteristics of Forage Grown in South of Benin.

    PubMed

    Musco, Nadia; Koura, Ivan B; Tudisco, Raffaella; Awadjihè, Ghislain; Adjolohoun, Sebastien; Cutrignelli, Monica I; Mollica, Maria Pina; Houinato, Marcel; Infascelli, Federico; Calabrò, Serena

    2016-01-01

    In order to provide recommendations on the most useful forage species to smallholder farmers, eleven grass and eleven legume forages grown in Abomey-Calavi in Republic of Benin were investigated for nutritive value (i.e. chemical composition and energy content) and fermentation characteristics (i.e. gas and volatile fatty acid production, organic matter degradability). The in vitro gas production technique was used, incubating the forages for 120 h under anaerobic condition with buffalo rumen fluid. Compared to legume, tropical grass forages showed lower energy (8.07 vs 10.57 MJ/kg dry matter [DM]) and crude protein level (16.10% vs 19.91% DM) and higher cell wall content (neutral detergent fiber: 63.8% vs 40.45% DM), respectively. In grass forages, the chemical composition showed a quite high crude protein content; the in vitro degradability was slightly lower than the range of tropical pasture. The woody legumes were richer in protein and energy and lower in structural carbohydrates than herbaceous plants, however, their in vitro results are influenced by the presence of complex compounds (i.e. tannins). Significant correlations were found between chemical composition and in vitro fermentation characteristics. The in vitro gas production method appears to be a suitable technique for the evaluation of the nutritive value of forages in developing countries. PMID:26732328

  1. Nutritional Characteristics of Forage Grown in South of Benin

    PubMed Central

    Musco, Nadia; Koura, Ivan B.; Tudisco, Raffaella; Awadjihè, Ghislain; Adjolohoun, Sebastien; Cutrignelli, Monica I.; Mollica, Maria Pina; Houinato, Marcel; Infascelli, Federico; Calabrò, Serena

    2016-01-01

    In order to provide recommendations on the most useful forage species to smallholder farmers, eleven grass and eleven legume forages grown in Abomey-Calavi in Republic of Benin were investigated for nutritive value (i.e. chemical composition and energy content) and fermentation characteristics (i.e. gas and volatile fatty acid production, organic matter degradability). The in vitro gas production technique was used, incubating the forages for 120 h under anaerobic condition with buffalo rumen fluid. Compared to legume, tropical grass forages showed lower energy (8.07 vs 10.57 MJ/kg dry matter [DM]) and crude protein level (16.10% vs 19.91% DM) and higher cell wall content (neutral detergent fiber: 63.8% vs 40.45% DM), respectively. In grass forages, the chemical composition showed a quite high crude protein content; the in vitro degradability was slightly lower than the range of tropical pasture. The woody legumes were richer in protein and energy and lower in structural carbohydrates than herbaceous plants, however, their in vitro results are influenced by the presence of complex compounds (i.e. tannins). Significant correlations were found between chemical composition and in vitro fermentation characteristics. The in vitro gas production method appears to be a suitable technique for the evaluation of the nutritive value of forages in developing countries. PMID:26732328

  2. Comparison of leucine-rich repeat-containing G protein-coupled receptor 5 expression in different cancer and normal cell lines

    PubMed Central

    ALIZADEH-NAVAEI, REZA; RAFIEI, ALIREZA; ABEDIAN-KENARI, SAEID; ASGARIAN-OMRAN, HOSSEIN; VALADAN, REZA; HEDAYATIZADEH-OMRAN, AKBAR

    2016-01-01

    Evaluating the expression of leucine-rich repeat-containing G protein-coupled receptor 5 (LGR5) may be useful for predicting the best models and achieving more accurate results in cancer research. Therefore, the aim of the present study was to analyze the LGR5 expression levels in different cell lines. Eight commonly used cell lines were assessed (COS-7, NIH3T3, HEK293, VERO, HeLa, BHK, HepG2 and AGS). All the cell lines were cultured in RPMI-1640 medium contain 10% fetal calf serum at 37°C in humidified conditions with 5% CO2. According to the western blotting results, LGR5 was expressed in all cell lines. Densitometry results of LGR5 expression in the different cell lines showed that high LGR5 expression levels were apparent in BHK, AGS, VERO and NIH3T3 cell lines compared with the other cell lines. The results indicate that for the normal and cancer cell lines, BNK and AGS may be a better choice, respectively, for in vitro cancer studies. PMID:27347416

  3. Carbon Nanotube Microarrays Grown on Nanoflake Substrates

    NASA Technical Reports Server (NTRS)

    Schmidt, Howard K.; Hauge, Robert H.; Pint, Cary; Pheasant, Sean

    2013-01-01

    This innovation consists of a new composition of matter where single-walled carbon nanotubes (SWNTs) are grown in aligned arrays from nanostructured flakes that are coated in Fe catalyst. This method of growth of aligned SWNTs, which can yield well over 400 percent SWNT mass per unit substrate mass, exceeds current yields for entangled SWNT growth. In addition, processing can be performed with minimal wet etching treatments, leaving aligned SWNTs with superior properties over those that exist in entangled mats. The alignment of the nanotubes is similar to that achieved in vertically aligned nanotubes, which are called "carpets. " Because these flakes are grown in a state where they are airborne in a reactor, these flakes, after growing SWNTs, are termed "flying carpets. " These flakes are created in a roll-to-roll evaporator system, where three subsequent evaporations are performed on a 100-ft (approx. =30-m) roll of Mylar. The first layer is composed of a water-soluble "release layer, " which can be a material such as NaCl. After depositing NaCl, the second layer involves 40 nm of supporting layer material . either Al2O3 or MgO. The thickness of the layer can be tuned to synthesize flakes that are larger or smaller than those obtained with a 40-nm deposition. Finally, the third layer consists of a thin Fe catalyst layer with a thickness of 0.5 nm. The thickness of this layer ultimately determines the diameter of SWNT growth, and a layer that is too thick will result in the growth of multiwalled carbon nanotubes instead of single-wall nanotubes. However, between a thickness of 0.5 nm to 1 nm, single-walled carbon nanotubes are known to be the primary constituent. After this three-layer deposition process, the Mylar is rolled through a bath of water, which allows catalyst-coated flakes to detach from the Mylar. The flakes are then collected and dried. The method described here for making such flakes is analogous to that which is used to make birefringent ink that is

  4. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction-positive wild bird surveillance samples.

    PubMed

    Moresco, Kira A; Stallknecht, David E; Swayne, David E

    2012-05-01

    Virus isolation rates for influenza A virus (FLUAV) and Avian paramyxovirus serotype 1 (APMV-1) from wild bird surveillance samples are lower than molecular detection rates for the specific viral genomes. The current study was conducted to examine the possibility of increased virus isolation rates from real-time reverse transcription polymerase chain reaction (real-time RT-PCR) using alternative virus isolation substrates such as embryonating duck eggs (EDEs), embryonating turkey eggs (ETEs), Madin-Darby canine kidney (MDCK) cell cultures, and African green monkey kidney (Vero) cell cultures. Rectal swabs of birds in the orders Anseriformes and Charadriiformes were tested by real-time RT-PCR for the presence of FLUAV and APMV-1 genomes, and virus isolation (VI) was attempted on all real-time RT-PCR-positive samples. Samples with threshold cycle (Ct) ≤ 37 had VI rates for FLUAV of 62.5%, 50%, 43.8%, 31.5%, and 31.5% in embryonating chicken eggs (ECEs), ETEs, EDEs, MDCK cells, and Vero cells, respectively. A higher isolation rate was seen with ECEs compared to either cell culture method, but similar isolation rates were identified between the different embryonating avian eggs. Virus isolation rates for APMV-1 on samples with real-time RT-PCR Ct ≤ 37 were 75%, 100%, 100%, 0%, and 37.5% in ECEs, ETEs, EDEs, MDCK cells, and Vero cells, respectively. Significantly higher VI rates were seen with ECEs as compared to either cell culture method for all real-time RT-PCR-positive samples. Because of the limited availability and high cost of ETEs and EDEs, the data support the continuing usage of ECEs for primary isolation of both FLUAV and APMV-1 from real-time RT-PCR-positive wild bird surveillance samples. PMID:22529126

  5. Heart tissue grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    2001-01-01

    Lisa Freed and Gordana Vunjak-Novakovic, both of the Massachusetts Institute of Technology (MIT), have taken the first steps toward engineering heart muscle tissue that could one day be used to patch damaged human hearts. Cells isolated from very young animals are attached to a three-dimensional polymer scaffold, then placed in a NASA bioreactor. The cells do not divide, but after about a week start to cornect to form a functional piece of tissue. Functionally connected heart cells that are capable of transmitting electrical signals are the goal for Freed and Vunjak-Novakovic. Electrophysiological recordings of engineered tissue show spontaneous contractions at a rate of 70 beats per minute (a), and paced contractions at rates of 80, 150, and 200 beats per minute respectively (b, c, and d). The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Credit: NASA and MIT.

  6. The respiratory system of the piezophile Photobacterium profundum SS9 grown under various pressures.

    PubMed

    Tamegai, Hideyuki; Nishikawa, Shun; Haga, Minami; Bartlett, Douglas H

    2012-01-01

    It is known that the facultative piezophile Shewanella violacea DSS12 alters its respiratory components under the influence of hydrostatic pressure during growth. This can be considered one of the mechanisms of bacterial adaptation to high pressure. In this study, we investigated the respiratory system of another well-studied piezophile, Photobacterium profundum SS9. We analyzed cytochrome contents, the expression of genes encoding respiratory components in P. profundum SS9 grown under various conditions, and the pressure dependency of the terminal oxidase activities. Activity was more tolerant of relatively high pressures, such as 125 MPa when the cells were grown under high pressure as compared with cells grown under atmospheric pressure. Such properties observed are similar to the case of S. violacea. However, the contents of the cytochromes and expression of the respiratory genes were not influenced by growth pressure in P. profundum SS9, inconsistent with the case of S. violacea. We suggest that the mechanism of the piezoadaptation of the respiratory system of P. profundum SS9 differs from that of S. violacea, as described above, and that each strain chooses its own strategy. PMID:22878211

  7. Internode length in pisum: do the internode length genes effect growth in dark-grown plants?

    PubMed

    Reid, J B

    1983-07-01

    Internode length in light-grown peas (Pisum sativum L.) is controlled by the interaction of genes occupying at least five major loci, Le, La, Cry, Na, and Lm. The present work shows that the genes at all of the loci examined (Le, Cry, and Na) also exert an effect on internode length in plants grown in complete darkness. Preliminary results using pure lines were verified using either segregating progenies or near isogenic lines. The major cause of the differences was due to a change in the number of cells per internode rather than to an alteration of the cell length. Since the genes occupying at least two of these loci, Le and Na, have been shown to be directly involved with gibberellin metabolism, it appears that gibberellins are not only essential for elongation in the dark but are limiting for elongation in the nana (extremely short, na), dwarf (Na le), and tall (Na Le) phenotypes. These results are supported by the large inhibitory effects of AMO 1618 treatments on stem elongation in dwarf and tall lines grown in the dark and the fact that applied gibberellic acid could overcome this inhibition and greatly promote elongation in a gibberellin-deficient na line. It is clear that the internode length genes, and in particular the alleles at the Le locus, are not acting by simply controlling the sensitivity of the plant to light. PMID:16663081

  8. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method.

    PubMed

    Khan, J A; Rathore, R S; Khan, S; Ahmad, I

    2013-01-01

    Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 μL and 50 μL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong

  9. Inhibition of Sindbis virus maturation after treatment of infected cells with trypsin.

    PubMed Central

    Adams, R H; Brown, D T

    1982-01-01

    Brief treatment of Sindbis virus-infected BHK-21 or Vero cells with low concentrations of trypsin irreversibly blocked further production of progeny virions after removal of the enzyme. The inhibitory effects of the trypsin treatment could only be demonstrated in cells in which virus infection was established; optimal inhibition occurred at ca. 3 h postinfection. Production of virus structural proteins PE2, E1, and C occurred at normal levels in inhibited cells. PE2 and E1 were also transported to the cell plasma membrane during inhibition; however, PE2 was not cleaved to E2, and little capsid protein became membrane associated relative to control cells. Although trypsin treatment had no effect on Sindbis protein synthesis, the production of both 26S and 42S RNA was greatly reduced. Similar trypsin treatment of BHK cells infected with vesicular stomatitis virus had no detectable effect on the course of virus infection. Images PMID:6281478

  10. Heart tissue grown in NASA Bioreactor

    NASA Technical Reports Server (NTRS)

    2001-01-01

    Lisa Freed and Gordana Vunjak-Novakovic, both of the Massachusetts Institute of Technology (MIT), have taken the first steps toward engineering heart muscle tissue that could one day be used to patch damaged human hearts. Cells isolated from very young animals are attached to a three-dimensional polymer scaffold, then placed in a NASA bioreactor. The cells do not divide, but after about a week start to cornect to form a functional piece of tissue. Here, a transmission electron micrograph of engineered tissue shows a number of important landmarks present in functional heart tissue: (A) well-organized myofilaments (Mfl), z-lines (Z), and abundant glycogen granules (Gly); and (D) intercalcated disc (ID) and desmosomes (DES). The NASA Bioreactor provides a low turbulence culture environment which promotes the formation of large, three-dimensional cell clusters. The Bioreactor is rotated to provide gentle mixing of fresh and spent nutrient without inducing shear forces that would damage the cells. Due to their high level of cellular organization and specialization, samples constructed in the bioreactor more closely resemble the original tumor or tissue found in the body. NASA-sponsored bioreactor research has been instrumental in helping scientists to better understand normal and cancerous tissue development. In cooperation with the medical community, the bioreactor design is being used to prepare better models of human colon, prostate, breast and ovarian tumors. Cartilage, bone marrow, heart muscle, skeletal muscle, pancreatic islet cells, liver and kidney are just a few of the normal tissues being cultured in rotating bioreactors by investigators. The work is sponsored by NASA's Office of Biological and Physical Research. The bioreactor is managed by the Biotechnology Cell Science Program at NASA's Johnson Space Center (JSC). Credit: MIT

  11. Cryopreservation of in vitro grown shoot tips

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter in Plant Cell Culture, Development and Biotechnology describes student laboratory exercises for cryopreservation of the growing shoot tips of plants in liquid nitrogen. It includes two exercises involving step by step protocols for use with shoot tips. Vitrification (fast freezing) an...

  12. A role for pectin de-methylesterification in a developmentally regulated growth acceleration in dark-grown Arabidopsis hypocotyls.

    PubMed

    Pelletier, Sandra; Van Orden, Jürgen; Wolf, Sebastian; Vissenberg, Kris; Delacourt, Julien; Ndong, Yves Assoumou; Pelloux, Jérôme; Bischoff, Volker; Urbain, Aurélie; Mouille, Grégory; Lemonnier, Gaëtan; Renou, Jean-Pierre; Höfte, Herman

    2010-11-01

    • We focused on a developmentally regulated growth acceleration in the dark-grown Arabidopsis hypocotyl to study the role of changes in cell wall metabolism in the control of cell elongation. • To this end, precise transcriptome analysis on dissected dark-grown hypocotyls, Fourier transform infrared (FT-IR) microspectroscopy and kinematic analysis were used. • Using a cellulose synthesis inhibitor, we showed that the growth acceleration marks a developmental transition during which growth becomes uncoupled from cellulose synthesis. We next investigated the cellular changes that take place during this transition. FT-IR microspectroscopy revealed significant changes in cell wall composition during, but not after, the growth acceleration. Transcriptome analysis suggested a role for cell wall remodeling, in particular pectin modification, in this growth acceleration. This was confirmed by the overexpression of a pectin methylesterase inhibitor, which caused a delay in the growth acceleration. • This study shows that the acceleration of cell elongation marks a developmental transition in dark-grown hypocotyl cells and supports a role for pectin de-methylesterification in the timing of this event. PMID:20819179

  13. Correlating microscopy techniques and ToF-SIMS analysis of fully grown mammalian oocytes.

    PubMed

    Gulin, Alexander; Nadtochenko, Victor; Astafiev, Artyom; Pogorelova, Valentina; Rtimi, Sami; Pogorelov, Alexander

    2016-06-20

    The 2D-molecular thin film analysis protocol for fully grown mice oocytes is described using an innovative approach. Time-of-flight secondary ion mass spectrometry (ToF-SIMS), scanning electron microscopy (SEM), atomic force microscopy (AFM) and optical microscopy imaging were applied to the same mice oocyte section on the same sample holder. A freeze-dried mice oocyte was infiltrated into embedding media, e.g. Epon, and then was cut with a microtome and 2 μm thick sections were transferred onto an ITO coated conductive glass. Mammalian oocytes can contain "nucleolus-like body" (NLB) units and ToF-SIMS analysis was used to investigate the NLB composition. The ion-spatial distribution in the cell components was identified and compared with the images acquired by SEM, AFM and optical microscopy. This study presents a significant advancement in cell embryology, cell physiology and cancer-cell biochemistry. PMID:27160416

  14. Nanowire LEDs grown directly on flexible metal foil

    NASA Astrophysics Data System (ADS)

    May, Brelon J.; Sarwar, A. T. M. Golam; Myers, Roberto C.

    2016-04-01

    Using molecular beam epitaxy, self-assembled AlGaN nanowires are grown directly on Ta and Ti foils. Scanning electron microscopy shows that the nanowires are locally textured with the underlying metallic grains. Photoluminescence spectra of GaN nanowires grown on metal foils are comparable to GaN nanowires grown on single crystal Si wafers. Similarly, photoluminescence lifetimes do not vary significantly between these samples. Operational AlGaN light emitting diodes are grown directly on flexible Ta foil with an electroluminescence peak emission of ˜350 nm and a turn-on voltage of ˜5 V. These results pave the way for roll-to-roll manufacturing of solid state optoelectronics.

  15. GaN grown on nano-patterned sapphire substrates

    NASA Astrophysics Data System (ADS)

    Jing, Kong; Meixin, Feng; Jin, Cai; Hui, Wang; Huaibing, Wang; Hui, Yang

    2015-04-01

    High-quality gallium nitride (GaN) film was grown on nano-patterned sapphire substrates (NPSS) and investigated using XRD and SEM. It was found that the optimum thickness of the GaN buffer layer on the NPSS is 15 nm, which is thinner than that on micro-patterned sapphire substrates (MPSS). An interesting phenomenon was observed for GaN film grown on NPSS:GaN mainly grows on the trench regions and little grows on the sidewalls of the patterns at the initial growth stage, which is dramatically different from GaN grown on MPSS. In addition, the electrical and optical properties of LEDs grown on NPSS were characterized. Project supported by the Suzhou Nanojoin Photonics Co., Ltd and the High-Tech Achievements Transformation of Jiangsu Province, China (No.BA2012010).

  16. At last, a medical website designed for grown-ups

    MedlinePlus

    ... At last, a medical website designed for grown-ups Past Issues / Winter 2007 Table of Contents For ... U.S. Department of Health and Human Services. For up-to-date health information tailor-made just for ...

  17. Localization of cytochromes to the outer membrane of anaerobically grown Shewanella putrefaciens MR-1.

    PubMed Central

    Myers, C R; Myers, J M

    1992-01-01

    In gram-negative bacteria, numerous cell functions, including respiration-linked electron transport, have been ascribed to the cytoplasmic membrane. Gram-negative bacteria which use solid substrates (e.g., oxidized manganese or iron) as terminal electron acceptors for anaerobic respiration are presented with a unique problem: they must somehow establish an electron transport link across the outer membrane between large particulate metal oxides and the electron transport chain in the cytoplasmic membrane. When the metal-reducing bacterium Shewanella putrefaciens MR-1 is grown under anaerobic conditions and membrane fractions are purified from cells lysed by an EDTA-lysozyme-polyoxyethylene cetyl ether (Brij 58) protocol, approximately 80% of its membrane-bound cytochromes are localized in its outer membrane. These outer membrane cytochromes could not be dislodged by treatment with chaotropic agents or by increased concentrations of the nonionic detergent Brij 58, suggesting that they are integral membrane proteins. Cytochrome distribution in cells lysed by a French press protocol confirm the localization of cytochromes to the outer membrane of anaerobically grown cells. This novel cytochrome distribution could play a key role in the anaerobic respiratory capabilities of this bacterium, especially in its ability to mediate manganese and iron reduction. Images PMID:1592800

  18. Defect Density Characterization of Detached-Grown Germanium Crystals

    NASA Technical Reports Server (NTRS)

    Schweizer, M.; Cobb, S. D.; Volz, M. P.; Szoke, J.; Szofran, F. R.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    Several (111)-oriented, Ga-doped germanium crystals were grown in pyrolytic boron nitride (pBN) containers by the Bridgman and the detached Bridgman growth techniques. Growth experiments in closed-bottom pBN containers resulted in nearly completely detached-grown crystals, because the gas pressure below the melt can build up to a higher pressure than above the melt. With open-bottom tubes the gas pressure above and below the melt is balanced during the experiment, and thus no additional force supports the detachment. In this case the crystals grew attached to the wall. Etch pit density (EPD) measurements along the axial growth direction indicated a strong improvement of the crystal quality of the detached-grown samples compared to the attached samples. Starting in the seed with an EPD of 6-8 x 10(exp 3)/square cm it decreased in the detached-grown crystals continuously to about 200-500/square cm . No significant radial difference between the EPD on the edge and the middle of the crystal exists. In the attached grown samples the EPD increases up to a value of about 2-4 x 10(exp 4)/square cm (near the edge) and up to 1 x 10(exp 4)/square cm in the middle of the sample. Thus the difference between the detached- and the attached-grown crystals with respect to the EPD is approximately two orders of magnitude.

  19. Cratoxylum formosum (Jack) Dyer ssp. pruniflorum (Kurz) Gogel. (Hóng yá mù) extract induces apoptosis in human hepatocellular carcinoma HepG2 cells through caspase-dependent pathways

    PubMed Central

    2014-01-01

    Background Cratoxylum formosum (Jack) Dyer ssp. pruniflorum (Kurz) Gogel. (Hóng yá mù) (CF) has been used for treatment of fever, cough, and peptic ulcer. Previously, a 50% ethanol-water extract from twigs of CF was shown highly selective in cytotoxicity against cancer cells. This study aims to investigate the molecular mechanisms underlying the apoptosis-inducing effect of CF. Methods The cytotoxicity of CF was evaluated in the human hepatocellular carcinoma (HCC) HepG2 cell line in comparison with a non-cancerous African green monkey kidney epithelial cell line (Vero) by a neutral red assay. The apoptosis induction mechanisms were investigated through nuclear morphological changes, DNA fragmentation, mitochondrial membrane potential alterations, and caspase enzyme activities. Results CF selectively induced HepG2 cell death compared with non-cancerous Vero cells. A 1.5-fold higher apoptotic effect compared with melphalan was induced by 120 μg/mL of the 50% ethanol-water extract of CF. The apoptotic cell death in HepG2 cells occurred via extrinsic and intrinsic caspase-dependent pathways in dose- and time-dependent manners by significantly increasing the activities of caspase 3/7, 8, and 9, decreasing the mitochondrial membrane potential, and causing apoptotic body formation and DNA fragmentation. Conclusions CF extract induced a caspase-dependent apoptosis in HepG2 cells. PMID:24708784

  20. Clostridium perfringens Iota-Toxin b Induces Rapid Cell Necrosis▿

    PubMed Central

    Nagahama, Masahiro; Umezaki, Mariko; Oda, Masataka; Kobayashi, Keiko; Tone, Shigenobu; Suda, Taiji; Ishidoh, Kazumi; Sakurai, Jun

    2011-01-01

    Clostridium perfringens iota-toxin is a binary toxin composed of an enzyme component (Ia) and a binding component (Ib). Each component alone lacks toxic activity, but together they produce cytotoxic effects. We examined the cytotoxicity of iota-toxin Ib in eight cell lines. A431 and A549 cells were susceptible to Ib, but MDCK, Vero, CHO, Caco-2, HT-29, and DLD-1 cells were not. Ib bound and formed oligomers in the membranes of A431 and MDCK cells. However, Ib entered MDCK cells but not A431 cells, suggesting that uptake is essential for cellular survival. Ib also induced cell swelling and the rapid depletion of cellular ATP in A431 and A549 cells but not the insensitive cell lines. In A431 cells, Ib binds and oligomerizes mainly in nonlipid rafts in the membranes. Disruption of lipid rafts by methyl-β-cyclodextrin did not impair ATP depletion or cell death caused by Ib. Ib induced permeabilization by propidium iodide without DNA fragmentation in A431 cells. Ultrastructural studies revealed that A431 cells undergo necrosis after treatment with Ib. Ib caused a disruption of mitochondrial permeability and the release of cytochrome c. Staining with active-form-specific antibodies showed that the proapoptotic Bcl-2-family proteins Bax and Bak were activated and colocalized with mitochondria in Ib-treated A431 cells. We demonstrate that Ib by itself produces cytotoxic activity through necrosis. PMID:21911469

  1. Tailoring the optical characteristics of microsized InP nanoneedles directly grown on silicon.

    PubMed

    Li, Kun; Sun, Hao; Ren, Fan; Ng, Kar Wei; Tran, Thai-Truong D; Chen, Roger; Chang-Hasnain, Connie J

    2014-01-01

    Nanoscale self-assembly offers a pathway to realize heterogeneous integration of III-V materials on silicon. However, for III-V nanowires directly grown on silicon, dislocation-free single-crystal quality could only be attained below certain critical dimensions. We recently reported a new approach that overcomes this size constraint, demonstrating the growth of single-crystal InGaAs/GaAs and InP nanoneedles with the base diameters exceeding 1 μm. Here, we report distinct optical characteristics of InP nanoneedles which are varied from mostly zincblende, zincblende/wurtzite-mixed, to pure wurtzite crystalline phase. We achieved, for the first time, pure single-crystal wurtzite-phase InP nanoneedles grown on silicon with bandgaps of 80 meV larger than that of zincblende-phase InP. Being able to attain excellent material quality while scaling up in size promises outstanding device performance of these nanoneedles. At room temperature, a high internal quantum efficiency of 25% and optically pumped lasing are demonstrated for single nanoneedle as-grown on silicon substrate. Recombination dynamics proves the excellent surface quality of the InP nanoneedles, which paves the way toward achieving multijunction photovoltaic cells, long-wavelength heterostructure lasers, and advanced photonic integrated circuits. PMID:24299042

  2. Nanogenerators consisting of direct-grown piezoelectrics on multi-walled carbon nanotubes using flexoelectric effects

    NASA Astrophysics Data System (ADS)

    Han, Jin Kyu; Jeon, Do Hyun; Cho, Sam Yeon; Kang, Sin Wook; Yang, Sun A.; Bu, Sang Don; Myung, Sung; Lim, Jongsun; Choi, Moonkang; Lee, Minbaek; Lee, Min Ku

    2016-07-01

    We report the first attempt to prepare a flexoelectric nanogenerator consisting of direct-grown piezoelectrics on multi-walled carbon nanotubes (mwCNT). Direct-grown piezoelectrics on mwCNTs are formed by a stirring and heating method using a Pb(Zr0.52Ti0.48)O3 (PZT)-mwCNT precursor solution. We studied the unit cell mismatch and strain distribution of epitaxial PZT nanoparticles, and found that lattice strain is relaxed along the growth direction. A PZT-mwCNT nanogenerator was found to produce a peak output voltage of 8.6 V and an output current of 47 nA when a force of 20 N is applied. Direct-grown piezoelectric nanogenerators generate a higher voltage and current than simple mixtures of PZT and CNTs resulting from the stronger connection between PZT crystals and mwCNTs and an enhanced flexoelectric effect caused by the strain gradient. These experiments represent a significant step toward the application of nanogenerators using piezoelectric nanocomposite materials.

  3. Nanogenerators consisting of direct-grown piezoelectrics on multi-walled carbon nanotubes using flexoelectric effects

    PubMed Central

    Han, Jin Kyu; Jeon, Do Hyun; Cho, Sam Yeon; Kang, Sin Wook; Yang, Sun A.; Bu, Sang Don; Myung, Sung; Lim, Jongsun; Choi, Moonkang; Lee, Minbaek; Lee, Min Ku

    2016-01-01

    We report the first attempt to prepare a flexoelectric nanogenerator consisting of direct-grown piezoelectrics on multi-walled carbon nanotubes (mwCNT). Direct-grown piezoelectrics on mwCNTs are formed by a stirring and heating method using a Pb(Zr0.52Ti0.48)O3 (PZT)-mwCNT precursor solution. We studied the unit cell mismatch and strain distribution of epitaxial PZT nanoparticles, and found that lattice strain is relaxed along the growth direction. A PZT-mwCNT nanogenerator was found to produce a peak output voltage of 8.6 V and an output current of 47 nA when a force of 20 N is applied. Direct-grown piezoelectric nanogenerators generate a higher voltage and current than simple mixtures of PZT and CNTs resulting from the stronger connection between PZT crystals and mwCNTs and an enhanced flexoelectric effect caused by the strain gradient. These ex