Science.gov

Sample records for versicolor metabolitos secundarios

  1. Tinea Versicolor

    MedlinePLUS

    ... Z Diseases and treatments Q - T Tinea versicolor Tinea versicolor Also called pityriasis versicolor Tinea versicolor: It ... have tinea versicolor year-round. Learn more about tinea versicolor: Tinea versicolor: Signs and symptoms Tinea versicolor: ...

  2. Onychomycosis caused by Aspergillus versicolor.

    PubMed

    Veraldi, Stefano; Chiaratti, Anna; Harak, Henry

    2010-07-01

    We report a case of onychomycosis caused by Aspergillus versicolor in a 66-year-old female patient. The infection was characterised clinically by yellowish pigmentation of the nail plate and mild nail bed hyperkeratosis of the first left toe. All other nails were normal. Three direct microscopical examinations of nail samples revealed the presence of hyaline hyphae as well as conidiophores. Pure colonies of A. versicolor were found in three cultures. The patient was successfully treated with oral itraconazole. PMID:19422523

  3. Tinea versicolor in dark-skinned individuals.

    PubMed

    Kallini, Joseph R; Riaz, Fauzia; Khachemoune, Amor

    2014-02-01

    In this article, we review the salient features of tinea versicolor and describe the epidemiology, clinical presentation, and histopathology of this mycosis in dark-skinned individuals. Tinea versicolor is caused by an overgrowth of the Malassezia genus. It manifests clinically as asymptomatic hypopigmented macules, hyperpigmented macules, or a combination of the two. Under light microscopy, Malassezia presents as a dimorphic fungus - in both the hyphal and yeast form. Most clinicians have found that the majority of dark-skinned patients present solely with hypopigmented lesions. Under light microscopy, lesions on dark skin involved with tinea versicolor tend to have a thicker stratum corneum, more tonofilaments in the granulosum, and more sequestered melanosomes. Differential diagnosis includes confluent and reticulated papillomatosis, seborrheic dermatitis, pityriasis rosea, pityriasis alba, and vitiligo. Tinea versicolor can be successfully managed in most cases with topical antifungal treatments. Cases of recurrence, such as those seen in immunocompromised patients, may necessitate scheduled oral or topical therapy. PMID:24320140

  4. Uncommon presentations of tinea versicolor

    PubMed Central

    Varada, Sowmya; Dabade, Tushar; Loo, Daniel S.

    2014-01-01

    Tinea versicolor (TV) is a common cutaneous fungal infection characterized by superficial scaling and a mild disturbance of skin pigmentation. It typically affects the chest, upper back, and shoulders. However, involvement of more unusual regions of the body such as the face and scalp, arms and legs, intertriginous sites, genitalia, areolae, and palms and soles has been reported. This report details two such cases observed at our institution: a 32-year-old woman with involvement of the popliteal fossa and a 16-year-old boy with involvement of the groin. The clinician must be aware of these variations in location and perform the appropriate diagnostic workup when lesions have the characteristic morphology of TV despite an unusual location. The etiology, pathophysiology, and epidemiology of TV are reviewed and current literature describing other instances of TV in uncommon locations is discussed. PMID:25126470

  5. Management of seborrheic dermatitis and pityriasis versicolor.

    PubMed

    Faergemann, J

    2000-01-01

    Pityriasis (tinea) versicolor and seborrheic dermatitis are two very common skin diseases. Pityriasis versicolor is a chronic superficial fungal disease usually located on the upper trunk, neck, or upper arms. In pityriasis versicolor, the lipophilic yeast Malassezia (also know as Pityrosporum ovale or P. orbiculare) changes from the blastospore form to the mycelial form under the influence of predisposing factors. The most important exogenous factors are high temperatures and a high relative humidity which probably explain why pityriasis versicolor is more common in the tropics. The most important endogenous factors are greasy skin, hyperhidrosis, hereditary factors, corticosteroid treatment and immunodeficiency. There are many ways of treating pityriasis versicolor topically. Options include propylene glycol, ketoconazole shampoo, zinc pyrithione shampoo, ciclopiroxamine, selenium sulfide, and topical antifungals. In difficult cases, short term treatment with fluconazole or itraconazole is effective and well tolerated. To avoid recurrence a prophylactic treatment regimen is mandatory. Seborrheic dermatitis is characterized by red scaly lesions predominantly located on the scalp, face and upper trunk. There are now many studies indicating that Malassezia plays an important role in this condition. Even a normal number of Malassezia will start an inflammatory reaction. Mild corticosteroids are effective in the treatment of seborrheic dermatitis. However, the disease recurs quickly, often within just a few days. Antifungal therapy is effective in the treatment of seborrheic dermatitis and, because it reduces the number of Malassezia, the time to recurrence is increased compared with treatment with corticosteroids. Antifungal therapy should be the primary treatment of this disease. PMID:11702314

  6. Case report. Pityriasis versicolor mimicking Pityriasis rotunda.

    PubMed

    Aste, Nicola; Pau, Monica; Aste, Natalia; Biggio, P

    2002-04-01

    Pityriasis versicolor is a common dermatomycosis, occurring throughout the world, characterized by irregular, slightly scaly patches, varying in color from red/light brown to white. Pityriasis rotunda, on the other hand, is an uncommon disease, reported in specific ethnic groups, and characterized by perfectly round or oval patches of varying color, with a scaly surface. The histologic pattern is that of ichthyosis vulgaris. We report here the case of a male patient, aged 31, from Sardinia (Italy), affected by Pityriasis versicolor mimicking Pityriasis rotunda. Mycological examination allowed us to formulate the correct diagnosis, and ensuing treatment with antifungal drugs was entirely successful. The authors, while pointing out the rarity of this case, stress the possibility that Pityriasis versicolor mimics Pityriasis rotunda and vice-versa, especially in those countries in which the two diseases are endemic. More widespread recourse to microscopic examination can help avoid the risk of mistaken diagnosis and consequent incorrect treatment. PMID:12000517

  7. Kipukasins: Nucleoside derivatives from Aspergillus versicolor.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Seven new aroyl uridine derivatives (kipukasins A-G; 1-7) were isolated from solid-substrate fermentation cultures of two different Hawaiian isolates of Aspergillus versicolor. The structures of compounds 1-7 were determined by analysis of NMR and MS data. The nucleoside portion of lead compound 1...

  8. Aflatoxin control in maize by Trametes versicolor.

    PubMed

    Scarpari, Marzia; Bello, Cristiano; Pietricola, Chiara; Zaccaria, Marco; Bertocchi, Luigi; Angelucci, Alessandra; Ricciardi, Maria Rosaria; Scala, Valeria; Parroni, Alessia; Fabbri, Anna A; Reverberi, Massimo; Zjalic, Slaven; Fanelli, Corrado

    2014-01-01

    Aspergillus flavus is a well-known ubiquitous fungus able to contaminate both in pre- and postharvest period different feed and food commodities. During their growth, these fungi can synthesise aflatoxins, secondary metabolites highly hazardous for animal and human health. The requirement of products with low impact on the environment and on human health, able to control aflatoxin production, has increased. In this work the effect of the basidiomycete Trametes versicolor on the aflatoxin production by A. flavus both in vitro and in maize, was investigated. The goal was to propose an environmental loyal tool for a significant control of aflatoxin production, in order to obtain feedstuffs and feed with a high standard of quality and safety to enhance the wellbeing of dairy cows. The presence of T. versicolor, grown on sugar beet pulp, inhibited the production of aflatoxin B1 in maize by A. flavus. Furthermore, treatment of contaminated maize with culture filtrates of T. versicolor containing ligninolytic enzymes, showed a significant reduction of the content of aflatoxin B1. PMID:25525683

  9. Aflatoxin Control in Maize by Trametes versicolor

    PubMed Central

    Scarpari, Marzia; Bello, Cristiano; Pietricola, Chiara; Zaccaria, Marco; Bertocchi, Luigi; Angelucci, Alessandra; Ricciardi, Maria Rosaria; Scala, Valeria; Parroni, Alessia; Fabbri, Anna A.; Reverberi, Massimo; Zjalic, Slaven; Fanelli, Corrado

    2014-01-01

    Aspergillus flavus is a well-known ubiquitous fungus able to contaminate both in pre- and postharvest period different feed and food commodities. During their growth, these fungi can synthesise aflatoxins, secondary metabolites highly hazardous for animal and human health. The requirement of products with low impact on the environment and on human health, able to control aflatoxin production, has increased. In this work the effect of the basidiomycete Trametes versicolor on the aflatoxin production by A. flavus both in vitro and in maize, was investigated. The goal was to propose an environmental loyal tool for a significant control of aflatoxin production, in order to obtain feedstuffs and feed with a high standard of quality and safety to enhance the wellbeing of dairy cows. The presence of T. versicolor, grown on sugar beet pulp, inhibited the production of aflatoxin B1 in maize by A. flavus. Furthermore, treatment of contaminated maize with culture filtrates of T. versicolor containing ligninolytic enzymes, showed a significant reduction of the content of aflatoxin B1. PMID:25525683

  10. Decoloration of textile dyes by alginate-immobilized Trametes versicolor

    E-print Network

    Ramsay, Juliana

    Decoloration of textile dyes by alginate-immobilized Trametes versicolor J.A. Ramsay *, W.H.W. Mok rights reserved. Keywords: Alginate; Decoloration; Textile dye; T. versicolor 1. Introduction White rot cinna- barinus (Schliephake and Lonergan, 1993) have been shown to decolorize textile dyes or colored

  11. Aspergillus versicolor, a New Causative Agent of Canine Disseminated Aspergillosis

    PubMed Central

    Corapi, Wayne; Quist, Erin; Griffin, Sarah; Zhang, Michael

    2012-01-01

    Disseminated aspergillosis in dogs has been associated with Aspergillus terreus or A. deflectus infection. We report a case of disseminated A. versicolor infection presenting as diskospondylitis, osteomyelitis, and pyelonephritis. The diagnosis was made based on clinical, radiographic, and pathological findings. The etiologic agent was identified by fungal culture and internal transcribed spacer (ITS) ribosomal DNA (rDNA) sequencing. This is the first description of canine aspergillosis caused by A. versicolor. PMID:22031699

  12. Ketoconazole 2% shampoo in pityriasis versicolor: an open trial.

    PubMed

    Rathi, S K

    2003-01-01

    Pityriasis versicolor is a common superficial fungal infection caused by a lipophilic yeast. The aim of the study was to evaluate the efficacy of ketoconazole 2% shampoo in the treatment of pityriasis versicolor, for which thirty patients were included. The shampoo was applied daily for 3 days and found to be very effective in clearing the signs and symptoms of the disease. There was no serious adverse effects. PMID:17642861

  13. Solubilization of Leonardite by an Extracellular Fraction from Coriolus versicolor.

    PubMed

    Pyne, J W; Stewart, D L; Fredrickson, J; Wilson, B W

    1987-12-01

    Coriolus versicolor has previously been shown to degrade leonardite, an oxidized form of lignite. An extracellular fraction containing protein purified from a C. versicolor culture solubilized leonardite in vitro. Expression of the activity did not require the presence of leonardite and appeared during idiophase. During ion-exchange and gel filtration column chromatography, leonardite-biosolubilizing activity eluted with syringaldazine oxidase activity and with protein, as measured by A(280) and the biuret protein assay. Syringaldazine is a substrate of the polyphenol oxidase formed by C. versicolor. Comparison of leonardite-biosolubilizing activity with the effects of chelators and surface-active agents on leonardite showed that biosolubilization was not due to either surfactant or chelating ability. Heat treatment of the preparation at 60 degrees C for 30 min significantly reduced both syringaldazine oxidase and leonardite-biosolubilizing activities. Cyanide, azide, and thioglycolate, which are known inhibitors of syringaldazine oxidase activity of C. versicolor, also inhibited leonardite biosolubilization. From these data, we conclude that the purified protein fraction from C. versicolor contains a syringaldazine oxidase activity that participates in leonardite biosolubilization by enzymatic action. PMID:16347501

  14. Solubilization of Leonardite by an Extracellular Fraction from Coriolus versicolor

    PubMed Central

    Pyne, John W.; Stewart, Dorothy L.; Fredrickson, James; Wilson, Bary W.

    1987-01-01

    Coriolus versicolor has previously been shown to degrade leonardite, an oxidized form of lignite. An extracellular fraction containing protein purified from a C. versicolor culture solubilized leonardite in vitro. Expression of the activity did not require the presence of leonardite and appeared during idiophase. During ion-exchange and gel filtration column chromatography, leonardite-biosolubilizing activity eluted with syringaldazine oxidase activity and with protein, as measured by A280 and the biuret protein assay. Syringaldazine is a substrate of the polyphenol oxidase formed by C. versicolor. Comparison of leonardite-biosolubilizing activity with the effects of chelators and surface-active agents on leonardite showed that biosolubilization was not due to either surfactant or chelating ability. Heat treatment of the preparation at 60°C for 30 min significantly reduced both syringaldazine oxidase and leonardite-biosolubilizing activities. Cyanide, azide, and thioglycolate, which are known inhibitors of syringaldazine oxidase activity of C. versicolor, also inhibited leonardite biosolubilization. From these data, we conclude that the purified protein fraction from C. versicolor contains a syringaldazine oxidase activity that participates in leonardite biosolubilization by enzymatic action. PMID:16347501

  15. Pityriasis versicolor: avoiding pitfalls in disease diagnosis and therapy.

    PubMed

    Rivard, Shayna C

    2013-08-01

    Pityriasis versicolor is common among young active duty members with overactive sweat glands working in humid environments and results in pigmentary changes that can be profound in those with darker skin. This article addresses several issues related to making the correct diagnosis and providing appropriate treatment, as well as the specific challenges military providers may face in these cases. PMID:23929053

  16. Trametes versicolor mushroom immune therapy in breast cancer.

    PubMed

    Standish, Leanna J; Wenner, Cynthia A; Sweet, Erin S; Bridge, Carly; Nelson, Ana; Martzen, Mark; Novack, Jeffrey; Torkelson, Carolyn

    2008-01-01

    Data from multiple epidemiologic and clinical studies on immune effects of conventional cancer treatment and the clinical benefits of polysaccharide immune therapy suggest that immune function has a role in breast cancer prevention. Immune therapy utilizing the polysaccharide constituents of Trametes versicolor (Tv) as concurrent adjuvant cancer therapy may be warranted as part of a comprehensive cancer treatment and secondary prevention strategy. PMID:19087769

  17. Trametes versicolor Mushroom Immune Therapy in Breast Cancer

    PubMed Central

    Standish, Leanna J.; Wenner, Cynthia A.; Sweet, Erin S.; Bridge, Carly; Nelson, Ana; Martzen, Mark; Novack, Jeffrey; Torkelson, Carolyn

    2009-01-01

    Data from multiple epidemiologic and clinical studies on immune effects of conventional cancer treatment and the clinical benefits of polysaccharide immune therapy suggest that immune function has a role in breast cancer prevention. Immune therapy utilizing the polysaccharide constituents of Trametes versicolor (Tv) as concurrent adjuvant cancer therapy may be warranted as part of a comprehensive cancer treatment and secondary prevention strategy. PMID:19087769

  18. The complete mitochondrial genome of Ceracris versicolor (Orthoptera: Acridoidea: Arcypteridae).

    PubMed

    Xu, Qiang; Hao, Yan; Mei, Kaitao; Yin, Hong; Zhang, Daochuan

    2016-01-01

    The complete mitochondrial genome of Ceracris versicolor is determined here. It is 15,616?bp in length and contains 75.2% AT. All 13 mitochondrial PCGs share the start codon ATN, except for cox1 (CCG start codon). The usual termination codons (TAA) and incomplete stop codons (T) are found from 13 protein-coding genes. All tRNA genes could be folded into the typical cloverleaf secondary structure, except trnS (AGN) lacking of the dihydrouridine arm. The most frequent amino acids in the PCGs of C. versicolor are Leucine (14.45%), Isoleucine (10.50%), Serine (9.53%), Phenylalanine (9.26%), and the total content of these amino acids was 43.74%. The sizes of the large and small ribosomal RNA genes are 1315 and 781?bp, respectively. The AT content of the A?+?T-rich region is 87.5%. PMID:24708129

  19. Cell-Free Solubilization of Coal by Polyporus versicolor

    PubMed Central

    Cohen, Martin S.; Bowers, William C.; Aronson, Harold; Gray, Edward T.

    1987-01-01

    Solubilization of coal was demonstrated with filtrates (0.45-?m-pore-size filters) obtained from the broth in which Polyporus versicolor had grown. The rate and extent of solubilization were dependent on the age of the fungal cultures, the particle size of the coal, the pH of the filtrates, and the presence of proteins in the filtrates. The rate of solubilization of coal was significantly reduced after proteins in the filtrates were denatured by acid hydrolysis. PMID:16347500

  20. Effects of glucose and NH4 concentrations on sequential dye decoloration by Trametes versicolor

    E-print Network

    Ramsay, Juliana

    Effects of glucose and NH4 concentrations on sequential dye decoloration by Trametes versicolor J Mycelial pellets of Trametes versicolor, grown at initial glucose and ammonium tartrate concentrations decolorized at high rates during the next 12 days. Glucose was consumed at a steady rate and was depleted

  1. Cuticular signature in the development of Polistes versicolor.

    PubMed

    Dos S Brito, J H; Montagna, T S; Maia, F S; Antonialli-Junior, W F; Cardoso, C A L

    2015-01-01

    Wasps belong to societies that are highly complex and diverse, especially considering social organization and parental care. They use chemicals in their daily communication, and act incisively in recognition of mates and non-nest mates, and can even identify individuals of different castes. In this study, cuticle composition was examined during the development of Polistes versicolor from the egg stage to adulthood, with the aim to assess changes in the chemical signature of the species, using gas chromatography. Linear alkanes and branched alkanes were identified that were important to distinguish the various developmental stages of P. versicolor. The variation in the linear alkanes and branched alkanes was quantitative, since most of them are present in all stages, with the exception of some linear alkanes that uniquely characterized the egg stage. At the egg stage, differences were predominant for linear alkanes C8, C24, C27, and C29. For the larval instars, there was a predominance of linear alkanes C8, C22 and C24 to C30. In the pre-pupae, pupae and adult stages, C8, C22, C24, and C26 to C30 showed a higher abundance during later developmental stages. The addition to branched alkanes increased their abundance from the egg (13.52%) to adult (22.96%) stages. PMID:26505402

  2. Geographic host use variabiliy and host range evolutionary dynamics in the phytophagous insect Apagomerella versicolor (Cerambycidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The high diversity of phytophagous insects has been explained by the tendency of the group towards specialization; however, generalism may be advantageous in some environments. The cerambycid Apagomerella versicolor exhibits intraspecific geographical variation in host use. In northern Argentina it ...

  3. Applications of Trametes versicolor crude culture filtrates in detoxification of biomass pretreatment hydrolyzates.

    PubMed

    Kapoor, Rajeev Kumar; Rajan, Kalavathy; Carrier, Danielle Julie

    2015-08-01

    Laccases have wide range of substrate specificity and find applications from pulp industry to waste water remediation. Laccases have also been used in combined pretreatment of biomass hydrolyzates to remove enzymatic and fermentation inhibitors. In this study, laccase production by Trametes versicolor strains isolated from different regions of the United States was induced using copper salts. T. versicolor crude culture filtrates (CCF), without any purification step, were tested for removal of model inhibitor compounds as well as in poplar and rice straw pretreatment hydrolyzates. Phenolic inhibitors were removed by 76% and 94% from the dilute acid hydrolyzates of rice straw and poplar, respectively, when incubated with the CCF for 12h, at room temperature. Xylo-oligosaccharide concentrations present in rice straw hydrolyzates were reduced by 64% when incubated with T. versicolor CCF. T. versicolor CCF could be a low cost technology for decreasing enzymatic and fermentation inhibitors. PMID:25876229

  4. Antiviral butyrolactones from the endophytic fungus Aspergillus versicolor.

    PubMed

    Zhou, Min; Du, Gang; Yang, Hai-Ying; Xia, Cong-Fang; Yang, Juan-Xia; Ye, Yan-qing; Gao, Xue-Mei; Li, Xiao-Nian; Hu, Qiu-Fen

    2015-02-01

    Versicolactones A-D (1-4), four new butyrolactones, along with four known butyrolactones (5-8) were isolated from the fermentation products of the endophytic fungus Aspergillus versicolor. The structures of compounds 1-4, including absolute configuration, were elucidated by interpretation of the NMR and CD data. Compound 2 was further confirmed by single-crystal X-ray diffraction analysis. In particular, compound 1 is the first naturally occurring butyrolactone possessing an unusual 2-oxopropyl group. More importantly, compounds 1 and 8 displayed significant antitobacco mosaic virus activities with inhibition rates of 46.4?% and 35.4?%, even more potent than the positive control ningnanmycin (30.8?%). Compound 1 also showed moderate cytotoxicity against A549 and MCF7 cells with IC50 values of 3.2 and 2.5?µM, respectively. PMID:25590371

  5. Effect of Residual Lignin Type and Amount on Bleaching of Kraft Pulp by Trametes versicolor

    PubMed Central

    Reid, Ian D.; Paice, Michael G.

    1994-01-01

    The white rot fungus Trametes (Coriolus) versicolor can delignify and brighten unbleached hardwood kraft pulp within a few days, but softwood kraft pulps require longer treatment. To determine the contributions of higher residual lignin contents (kappa numbers) and structural differences in lignins to the recalcitrance of softwood kraft pulps to biobleaching, we tested softwood and hardwood pulps cooked to the same kappa numbers, 26 and 12. A low-lignin-content (overcooked) softwood pulp resisted delignification by T. versicolor, but a high-lignin-content (lightly cooked) hardwood pulp was delignified at the same rate as a normal softwood pulp. Thus, the longer time taken by T. versicolor to brighten softwood kraft pulp than hardwood pulp results from the higher residual lignin content of the softwood pulp; possible differences in the structures of the residual lignins are important only when the lignin becomes highly condensed. Under the conditions used in this study, when an improved fungal inoculum was used, six different softwood pulps were all substantially brightened by T. versicolor. Softwood pulps whose lignin contents were decreased by extended modified continuous cooking or oxygen delignification to kappa numbers as low as 15 were delignified by T. versicolor at the same rate as normal softwood pulp. More intensive O2 delignification, like overcooking, decreased the susceptibility of the residual lignin in the pulps to degradation by T. versicolor. PMID:16349246

  6. Occurrence of Toxigenic Aspergillus versicolor Isolates and Sterigmatocystin in Carpet Dust from Damp Indoor Environments

    PubMed Central

    Engelhart, Steffen; Loock, Annette; Skutlarek, Dirk; Sagunski, Helmut; Lommel, Annette; Färber, Harald; Exner, Martin

    2002-01-01

    Over the past decade, there has been growing concern regarding the role of toxigenic fungi in damp indoor environments; however, there is still a lack of field investigations on exposure to mycotoxins. The goal of our pilot study was to quantify the proportion of toxigenic Aspergillus versicolor isolates in native carpet dust from damp dwellings with mold problems and to determine whether sterigmatocystin can be detected in this matrix. Carpet dust samples (n = 11) contained from <2.5 × 101 to 3.6 × 105 (median, 3.1 × 104) A. versicolor CFU/g of dust, and the median proportion of A. versicolor from total culturable fungi was 18%. Based on thin-layer chromatography detection of sterigmatocystin, 49 of 50 A. versicolor isolates (98%) were found to be toxigenic in vitro. By using high-performance liquid chromatography-electrospray ionization tandem mass spectrometry, sterigmatocystin could be detected in low concentrations (2 to 4 ng/g of dust) in 2 of 11 native carpet dust samples. From this preliminary study, we conclude that most strains of A. versicolor isolated from carpet dust are able to produce sterigmatocystin in vitro and that sterigmatocystin may occasionally occur in carpet dust from damp indoor environments. Further research and systematic field investigation are needed to confirm our results and to provide an understanding of the health implications of mycotoxins in indoor environments. PMID:12147486

  7. Polysaccharides of Trametes versicolor Improve Bone Properties in Diabetic Rats.

    PubMed

    Chen, Chung-Hwan; Kang, Lin; Lo, Hui-Chen; Hsu, Tai-Hao; Lin, Fang-Yi; Lin, Yi-Shan; Wang, Zai-Jie; Chen, Shih-Tse; Shen, Chwan-Li

    2015-10-28

    This study investigates the effects of Trametes versicolor (L.:Fr.) Pilát (TVP, also known as Yunzhi) on bone properties in diabetic rats. Forty-five male Wistar rats (8 weeks old) were fed either a chow diet (control) or a high-fat diet throughout the study period of 28 days. Animals in the high-fat-diet group were injected with nicotinamide and streptozotocin to induce diabetes mellitus (DM). The DM rats were divided into a group receiving distilled water (vehicle) and another group receiving TVP at 0.1 g/kg weight by gavage. Relative to the vehicle group, TVP gavage lowered postprandial blood sugar (225 ± 18 mg/dL for TVP vs 292 ± 15 mg/dL for vehicle, p < 0.001) on day 26. Compared to the vehicle group, TVP mitigated DM-induced bone deterioration as determined by increasing bone volume of proximal tibia (22.8 ± 1.4% for TVP vs 16.8 ± 1.3% for vehicle, p = 0.003), trabecular number (p = 0.011), and femoral bone strength (11% in maximal load, 22% in stiffness, 14% in modulus, p < 0.001), and by reducing loss of femoral cortical porosity by 25% (p < 0.001). Our study demonstrates the protective effect of TVP on bone properties was mediated through, in part, the improvement of hyperglycemic control in DM animals. PMID:26308886

  8. Chitosan multiple addition enhances laccase production from Trametes versicolor.

    PubMed

    Adekunle, Abiodun Emmanuel; Wang, Feng; Hu, Jianhua; Ma, Anzhou; Guo, Chen; Zhuang, Guoqiang; Liu, Chun-Zhao

    2015-10-01

    Chitosan multiple addition strategy was developed to improve laccase production from Trametes versicolor cultures. The optimized multiple addition strategy was carried out by two-time addition of 0.1 g L(-1) chitosan to a 2-day-old culture media, with 24-h interval between the treatments. Under these conditions, laccase activity of 644.9 U l(-1) was achieved on the seventh day and laccase production was improved by 93.5 % higher than the control. Chitosan treatment increased reactive oxygen species generation and extracellular protein concentration in the treated mycelia. In contrast, the inducer inhibited the mycelia growth. The result of the quantitative reverse transcription polymerase chain reaction showed that the copy number of the laccase gene transcript increased by 16.7-fold in the treated mycelia relative to the control. This study provides insight into some of the intrinsic metabolic processes involved in the upregulation of laccase production in the presence of chitosan inducer in fungal culture. PMID:26178243

  9. Fungal biodegradation and biotransformation of soluble lignocarbohydrate complexes from straw. [Aspergillus japonicus, Polyporus versicolor

    SciTech Connect

    Milstein, O.A.; Vared, Y.; Sharma, A.; Gressel, J.; Flowers, H.M.

    1983-08-01

    Aspergillus japonicus is an efficient degrader of phenolics and carbohydrates present in a mixture of soluble lignocarbohydrate complexes extracted from wheat straw. Trichoderma species attacked part of the carbohydrate but hardly affected the aromatic portion of this solution. Polyporus versicolor had a complex effect; polymerization of low-molecular-size phenolics accompanied the degradation of aromatic and carbohydrate polymers. The addition of xylose to the medium facilitated depolymerization of lignin by the fungi tested and prevented the polymerization of low-molecular-size fractions of lignocarbohydrate complexes by P. versicolor. P. versicolor, in contrast to A. japonicus and Trichoderma species, also excreted into the medium considerable amounts of laccase, but only in the absence of endogenous or exogenous carbohydrates. Apparently, laccase is involved in polymerization rather than degradation of lignin in this organism. A number of extracellular glycanases were also secreted by these fungi. 19 references

  10. Systematics of the Garden Lizards, Calotes versicolor Group (Reptilia, Squamata, Agamidae), in Myanmar

    E-print Network

    Schulte, Jim

    Systematics of the Garden Lizards, Calotes versicolor Group (Reptilia, Squamata, Agamidae of Biology, MRC 5805, Clarkson University, Potsdam, NY 13699-5805. The Burmese garden lizards represent commonly seen diurnal lizards in Myanmar. Both appear to be forest-edge species, hence readily adapted

  11. Diet of the Gray Treefrog (Hyla versicolor) in Relation to Foraging Site Location

    E-print Network

    Johnson, Jarrett

    what role terrestrial habitat plays in their life history. We examined the stomach contents of the Gray Treefrog (Hyla versicolor) in central Missouri using a stomach-flushing technique. Treefrogs were stomach-flushed; stomach contents were dried and weighed; and prey items were counted and identified for frogs caught

  12. Aspergillus section Versicolores, nine new species and multilocus DNA sequence based phylogeny

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ß-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase, DNA replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 62 A. versicolor clade isolates and analyzed phylogenetically using the concordance model to establis...

  13. Aspergillus section Versicolores: nine new species and multilocus DNA sequence based phylogeny

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ß-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase, DNA replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 62 A. versicolor clade isolates and analyzed phylogenetically using the concordance model to establis...

  14. Abstract The ability of Trametes versicolor ATCC 20869 to colonize several natural and synthetic materials (wheat

    E-print Network

    Ramsay, Juliana

    materials (wheat straw, jute, hemp, maple woodchips, and nylon and poly- ethylene teraphthalate fibers) and to subsequently decol- orize amaranth was evaluated. Jute was found to be the best support material as T. versicolor grew well on it without color leaching from the support and without loss of the jute's integrity

  15. Identification and Speciation of Malassezia in Patients Clinically Suspected of Having Pityriasis Versicolor

    PubMed Central

    Shah, Avani; Koticha, Avani; Ubale, Milind; Wanjare, Shashir; Mehta, Preeti; Khopkar, Uday

    2013-01-01

    Background: Malassezia is a lipid-dependent yeast known to cause Pityriasis versicolor, a chronic, recurrent superficial infection of skin and present as hypopigmented or hyperpigmented lesions on areas of skin. If not diagnosed and treated, it may lead to disfigurement of the areas involved and also result in deep invasive infections. Aim: The aim of the present study was to identify and speciate Malassezia in patients clinically suspected of having Pityriasis versicolor. Materials and Methods: Total 139 patients suspected of having Pityriasis versicolor were evaluated clinically and diagnosis was done by Wood's lamp examination, confirmed mycologically by using KOH, cultivation on Sabouraud's dextrose agar and modified Dixon agar at a tertiary care hospital in Mumbai. The total duration of study was 12 months. Results: Majority of the patients were males (59.71%) in the age group of 21-30 years (33.81%) who were students (30.21%) by profession. The incidence of Malassezia in Pityriasis versicolor was 50.35%. The most common isolate was M. globosa (48.57%), followed by M. furfur (34.28%). Majority of the patients had hypopigmented lesions, with M. globosa as the predominant isolate. Neck was the most common site affected; 88.48% were Wood's lamp positive of which 56.91% of Malassezia isolates grew on culture. KOH mount was positive in 82.01% of which 61.40% Malassezia isolates grew on culture. Conclusions: The procedure of culture and antifungal testing is required to be performed as different species of Malassezia are involved in Pityriasis versicolor and susceptibility is different among different species. Thus, it would help to prevent recurrences and any systemic complications. PMID:23723483

  16. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  17. Over production of lignocellulosic enzymes of Coriolus versicolor by genetic engineering methodology. Final report

    SciTech Connect

    Williams, A.L.

    1998-07-01

    The project seeks to understand the biological and chemical processes involved in the secretion of the enzyme polyphenol oxidase (PPO) by the hyphae, the basic unit of the filamentous fungus Coriolus versicolor. These studies are made to determine rational strategies for enhanced secretion of PPO, both with the use of recombinant DNA techniques and without. This effort focuses on recombinant DNA techniques to enhance enzyme production. The major thrust of this project was two-fold: to mass produce C. versicolor tyrosinase (polyphenol oxidase) by genetic engineering as well as cultural manipulations; and to utilize PPO as a biocatalyst in the processing of lignocellulose as a renewable energy resource. In this study, the assessment of genomic and cDNA recombinant clones with regards to the overproduction of PPO continued. Further, immunocytochemical techniques were employed to assess the mechanism(s) involved in the secretion of PPO by the hyphae. Also, factors influencing PPO secretion were examined.

  18. In situ biodecolorization kinetics of Acid Red 66 in aqueous solutions by Trametes versicolor.

    PubMed

    Sukumar, M; Sivasamy, A; Swaminathan, G

    2009-08-15

    The biological decolorization methodology and the mechanism involved in the degradation of Acid Red 66 was chosen as a model of azo dye using the white rot fungi Trametes versicolor was studied. Biodecolorization of Acid Red 66 using white rot fungi T. versicolor was demonstrated by the decolorization of the culture medium, the extent of which was determined by monitoring the decrease in absorbance at 506 nm. The biodecolorization kinetics of Acid Red 66 (100 ppm) was found to be first order and the degradation rate coefficient is 1.312 x 10(-2)min(-1) (R=0.96683, n=8) at 30 degrees C. The effects of independent variables such as carbon sources, nitrogen sources pH, and temperature on the biodecolorization of Acid Red 66 was also investigated. PMID:19201090

  19. Aroma Characterization and Safety Assessment of a Beverage Fermented by Trametes versicolor.

    PubMed

    Zhang, Yanyan; Fraatz, Marco Alexander; Müller, Julia; Schmitz, Hans-Joachim; Birk, Florian; Schrenk, Dieter; Zorn, Holger

    2015-08-12

    A cereal-based beverage was developed by fermentation of wort with the basidiomycete Trametes versicolor. The beverage possessed a fruity, fresh, and slightly floral aroma. The volatiles of the beverage were isolated by liquid-liquid extraction (LLE) and additionally by headspace solid phase microextraction (HS-SPME). The aroma compounds were analyzed by a gas chromatography system equipped with a tandem mass spectrometer and an olfactory detection port (GC-MS/MS-O) followed by aroma (extract) dilution analysis. Thirty-four different odor impressions were perceived, and 27 corresponding compounds were identified. Fifteen key odorants with flavor dilution (FD) factors ranging from 8 to 128 were quantitated, and their respective odor activity values (OAVs) were calculated. Six key odorants were synthesized de novo by T. versicolor. Furthermore, quantitative changes during the fermentation process were analyzed. To prepare for the market introduction of the beverage, a comprehensive safety assessment was performed. PMID:26189508

  20. Sociogenetic structure of Polistes (Aphanilopterus) versicolor Olivier, 1791 colonies (Hymenoptera, Vespidae, Polistini)

    PubMed Central

    2010-01-01

    The observation of two distinct, well-defined oviposition areas in nests of the primitively eusocial wasp Polistes versicolor suggests the presence of multiple egg-layers and territorial behaviors. Electrophoretic analysis of enzyme loci in pupae from 35 colonies revealed an average observed heterozygosity of 0.10 and the existence of private polymorphisms, thereby indicating a low dispersion in this species. No evidence of diploid males was found. Phenotypic segregation analysis revealed the presence of more than one egg-laying female in 15 out of 35 colonies, as well as spatially preferential oviposition in 2 out of 13 nests, with distinct oviposition areas. Genetic relatedness estimates for brood were lower than expected for haplodiploid species under monogynous conditions (r = 0.75 for female broods and r = 0.5 for male) in 4 of those 13 nests, thereby inferring complex sociogenetic structuring in Polistes versicolor colonies. PMID:21637576

  1. Role of laccase and low molecular weight metabolites from Trametes versicolor in dye decolorization.

    PubMed

    Moldes, Diego; Fernández-Fernández, María; Sanromán, M Ángeles

    2012-01-01

    The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs) also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds. PMID:22566767

  2. Macrophage-stimulating activity of polysaccharides extracted from fruiting bodies of Coriolus versicolor (Turkey Tail Mushroom).

    PubMed

    Jeong, Sang-Chul; Yang, Byung-Keun; Kim, Guk-Nam; Jeong, Hun; Wilson, Michael A; Cho, Yip; Rao, K Sundar; Song, Chi-Hyun

    2006-01-01

    The macrophage-stimulating effect of polysaccharides extracted from Coriolus versicolor (Turkey Tail mushroom) was investigated, and their effectiveness was compared with that of lipopolysaccharide (LPS). The purified polysaccharide (CV-S2-Fr.I) of C. versicolor obtained by Sepharose CL-6B gel chromatography stimulated macrophage lysosomal enzyme activity by 250% at a concentration of 100 microg/mL, which was higher than that of LPS at the same concentration. When CV-S2-Fr.I was used in combination with interferon-gamma, there was a marked cooperative induction of nitric oxide production. However, CV-S2-Fr.I had no effect on nitric oxide production by itself. The proportion of C3-positive macrophages in the CV-S2-Fr.I group increased by 7.2-fold compared with the control group. PMID:16822202

  3. Brevianamides with antitubercular potential from a marine-derived isolate of Aspergillus versicolor.

    PubMed

    Song, Fuhang; Liu, Xinru; Guo, Hui; Ren, Biao; Chen, Caixia; Piggott, Andrew M; Yu, Ke; Gao, Hong; Wang, Qian; Liu, Mei; Liu, Xueting; Dai, Huanqin; Zhang, Lixin; Capon, Robert J

    2012-09-21

    An Aspergillus versicolor isolated from sediment collected from the Bohai Sea, China, yielded the new dimeric diketopiperazine brevianamide S (1), together with three new monomeric cometabolites, brevianamides T (2), U (3), and V (4). Structures were determined by detailed spectroscopic analysis. Brevianamide S exhibited selective antibacterial activity against Bacille Calmette-Guérin (BCG), suggestive of a new mechanism of action that could inform the development of next-generation antitubercular drugs. PMID:22963079

  4. Cytotoxic polyphenols from a sponge-associated fungus Aspergillus versicolor Hmp-48.

    PubMed

    Wang, Xiao; Mou, Yanhua; Hu, Jiangchun; Wang, Nan; Zhao, Li; Liu, Li; Wang, Shujin; Meng, Dali

    2014-01-01

    A new dibenzo[1,4]dioxin 1, and two new prenylated diphenyl ethers, 2 and 3, together with six known compounds, 4-9, were isolated from a sponge-associated fungus Aspergillus versicolor Hmp-F48 by bioactivity-guided fractionation. Their structures were elucidated by 1D- and 2D-NMR, and MS analyses. The compounds showed potent cell growth inhibitory activities against HL-60 cell line. PMID:24443433

  5. Four new spiroaxane sesquiterpenes and one new rosenonolactone derivative from cultures of Basidiomycete Trametes versicolor.

    PubMed

    Wang, Su-Rui; Zhang, Ling; Chen, He-Ping; Li, Zheng-Hui; Dong, Ze-Jun; Wei, Kun; Liu, Ji-Kai

    2015-09-01

    Four new spiroaxane sesquiterpenes, tramspiroins A-D (1-4), one new rosenonolactone 15,16-acetonide (5), and the known drimane sesquiterpenes isodrimenediol (6) and funatrol D (7) have been isolated from the cultures of Basidiomycete Trametes versicolor. The structures of new compounds were elucidated by means of spectroscopic methods. Compounds 1-7 were investigated for their cytotoxicities against five human cancer cell lines. PMID:26136058

  6. Geratology and decomposition of Spartina versicolor in a brackish Mediterranean marsh

    NASA Astrophysics Data System (ADS)

    Menéndez, Margarita; Sanmartí, Neus

    2007-08-01

    Most studies on plant decomposition in salt marshes have been carried out in Spartina-dominated marshes in North America. In contrast, few have focused on marshes in Mediterranean systems. Moreover, research into litter decay in estuarine systems has been conducted with plant material collected before natural senescence and death. Here we followed the growth, senescence, leaf fall, and nutrient dynamics of Spartina versicolor to examine litter decay in a Mediterranean coastal system. We studied the dynamics of fungi, meiofauna and algae associated with detached S. versicolor litter, and the effect of the microenvironment (above and underneath wracks of dead Spartina) on decomposition. The exponential decay coefficient rate ( k, day -1) was higher for leaves attached to standing plants (0.0019) than after leaf abscission (0.0002-0.001). The decomposition rate of detached leaves was highly variable and depended on the position of the litter. The large differences in decomposition rates between the two experimental conditions indicate that the microenvironment affected the associated litter community during the initial phase of decay. Water availability and high temperatures over the sediment surface increased the density of meiofauna and epiphyton and decreased fungal biomass during the first 20 days of the experiment. Fungal biomass was at the lower end of reported values, probably as a result of the drier conditions and high salinity in the Mediterranean marsh. Spartina versicolor detritus acted as a nutrient sink by immobilizing large amounts of N and P for at least one year.

  7. Localized Hormone Fluxes and Early Haustorium Development in the Hemiparasitic Plant Triphysaria versicolor1

    PubMed Central

    Tomilov, Alexey A.; Tomilova, Natalia B.; Abdallah, Ibrahim; Yoder, John I.

    2005-01-01

    Perhaps the most obvious phenotypes associated with chemical signaling between plants are manifested by parasitic species of Orobanchaceae. The development of haustoria, invasive root structures that allow hemiparasitic plants to transition from autotrophic to heterotrophic growth, is rapid, highly synchronous, and readily observed in vitro. Haustorium development is initiated in aseptic roots of the facultative parasite Triphysaria versicolor when exposed to phenolic molecules associated with host root exudates and rhizosphere bioactivity. Morphological features of early haustorium ontogeny include rapid cessation of root elongation, expansion, and differentiation of epidermal cells into haustorial hairs, and cortical cell expansion. These developmental processes were stimulated in aseptic T. versicolor seedlings by the application of exogenous phytohormones and inhibited by the application of hormone antagonists. Surgically dissected root tips formed haustoria if the root was exposed to haustorial-inducing factors prior to dissection. In contrast, root tips that were dissected prior to inducing-factor treatment were unable to form haustoria unless supplemented with indole-3-acetic acid. A transient transformation assay demonstrated that auxin and ethylene-responsive promoters were up-regulated when T. versicolor was exposed to either exogenous hormones or purified haustoria-inducing factors. These experiments demonstrate that localized auxin and ethylene accumulation are early events in haustorium development and that parasitic plants recruit established plant developmental mechanisms to realize parasite-specific functions. PMID:15965023

  8. Transcriptional Responses in the Hemiparasitic Plant Triphysaria versicolor to Host Plant Signals1[w

    PubMed Central

    Matvienko, Marta; Torres, Manuel J.; Yoder, John I.

    2001-01-01

    Parasitic plants in the Scrophulariaceae use chemicals released by host plant roots to signal developmental processes critical for heterotrophy. Haustoria, parasitic plant structures that attach to and invade host roots, develop on roots of the hemiparasitic plant Triphysaria versicolor within a few hours of exposure to either maize (Zea mays) root exudate or purified haustoria-inducing factors. We prepared a normalized, subtractive cDNA library enriched for transcripts differentially abundant in T. versicolor root tips treated with the allelopathic quinone 2,6-dimethoxybenzoquinone (DMBQ). Northern analyses estimated that about 10% of the cDNAs represent transcripts strongly up-regulated in roots exposed to DMBQ. Northern and reverse northern analyses demonstrated that most DMBQ-responsive messages were similarly up-regulated in T. versicolor roots exposed to maize root exudates. From the cDNA sequences we assembled a unigene set of 137 distinct transcripts and assigned functions by homology comparisons. Many of the proteins encoded by the transcripts are predicted to function in quinone detoxification, whereas others are more likely associated with haustorium development. The identification of genes transcriptionally regulated by haustorium-inducing factors provides a framework for dissecting genetic pathways recruited by parasitic plants during the transition to heterotrophic growth. PMID:11553755

  9. Efficient removal of pollutants from olive washing wastewater in bubble-column bioreactor by Trametes versicolor.

    PubMed

    Cerrone, F; Barghini, P; Pesciaroli, C; Fenice, M

    2011-06-01

    The white-rot fungi Panus tigrinus, Funalia trogii and Trametes versicolor have been tested in shake flasks for the reduction of olive washing wastewater (OWW) pollutants and production of oxidases on OWW-based media. P. tigrinus was rejected for its scarce performance. F. trogii showed best production of laccase (27 000 Ug(-1)), while T. versicolor appeared a good pollutant degrader reducing colour, COD and phenols by 60, 72 and 87%, respectively. Only T. versicolor grew well in bubble-column bioreactor: its OWW depollution, in continuous process, led to colour, COD and phenols reduction by 65%, 73% and 89%, respectively. Optimal dilution rate was 0.225d(-1) (0.225 m(3) of effluent treated daily per m(3) of bioreactor). Thus, a small bioreactor (10 m(3)) could treat daily the amount of OWW produced by a standard olive washing machine (2m(3)d(-1)). For these reasons, this process could be proposed as a simple, efficient and low-cost OWW treatment. PMID:21524782

  10. Carbon and nitrogen balance of leaf-eating sesarmid crabs ( Neoepisesarma versicolor) offered different food sources

    NASA Astrophysics Data System (ADS)

    Thongtham, Nalinee; Kristensen, Erik

    2005-10-01

    Carbon and nitrogen budgets for the leaf-eating crab, Neoepisesarma versicolor, were established for individuals living on pure leaf diets. Crabs were fed fresh (green), senescent (yellow) and partly degraded (brown) leaves of the mangrove tree Rhizophora apiculata. Ingestion, egestion and metabolic loss of carbon and nitrogen were determined from laboratory experiments. In addition, bacterial abundance in various compartments of the crabs' digestive tract was enumerated after dissection of live individuals. Ingestion and egestion rates (in terms of dry weight) were highest, while the assimilation efficiency was poorest for crabs fed on brown leaves. The low assimilation efficiency was more than counteracted by the high ingestion rate providing more carbon for growth than for crabs fed green and yellow leaves. In any case, the results show that all types of leaves can provide adequate carbon while nitrogen was insufficient to support both maintenance (yellow leaves) and growth (green, yellow and brown leaves). Leaf-eating crabs must therefore obtain supplementary nitrogen by other means in order to meet their nitrogen requirement. Three hypotheses were evaluated: (1) crabs supplement their diet with bacteria and benthic microalgae by ingesting own faeces and/or selective grazing at the sediment surface; (2) assimilation of symbiotic nitrogen-fixing bacteria in the crabs' own intestinal system; and (3) nitrogen storage following occasional feeding on animal tissues (e.g. meiofauna and carcasses). It appears that hypothesis 1 is of limited importance for N. versicolor since faeces and sediment can only supply a minor fraction of the missing nitrogen due to physical constraints on the amount of material the crabs can consume. Hypothesis 2 can be ruled out because tests showed no nitrogen fixation activity in the intestinal system of N. versicolor. It is therefore likely that leaf-eating crabs provide most of their nitrogen requirement from intracellular deposits following occasionally ingestion of animal tissue (hypothesis 3).

  11. Degradation of pharmaceuticals from membrane biological reactor sludge with Trametes versicolor.

    PubMed

    Llorens-Blanch, Guillem; Badia-Fabregat, Marina; Lucas, Daniel; Rodriguez-Mozaz, Sara; Barceló, Damià; Pennanen, Taina; Caminal, Gloria; Blánquez, Paqui

    2015-02-01

    Emerging contaminants are a wide group of chemical products that are found at low concentrations in the environment. These contaminants can be either natural, e.g., estrogens, or synthetics, such as pesticides and pharmaceuticals, which can enter the environment through the water and sludge from wastewater treatment plants (WWTP). The growth of Trametes versicolor on membrane biological reactor (MBR) sludge in bioslurry systems at the Erlenmeyer scale was assessed and its capacity for removing pharmaceutical and personal care products (PPCPs) was evaluated. The ability of the fungus to remove hydrochlorothiazide (HZT) from liquid media cultures was initially assessed. Consequently, different bioslurry media (complete nutrient, glucose and no-nutrient addition) and conditions (sterile and non-sterile) were tested, and the removal of spiked HZT was monitored under each condition. The highest spiked HZT removal was assessed under non-sterile conditions without nutrient addition (93.2%). Finally, the removal assessment of a broad set of pharmaceuticals was performed in non-spiked bioslurry. Under non-sterile conditions, the fungus was able to completely degrade 12 out of the 28 drugs initially detected in the MBR sludge, achieving an overall degradation of 66.9%. Subsequent microbial analysis showed that the microbial diversity increased after 15 days of treatment, but there was still some T. versicolor in the bioslurry. Results showed that T. versicolor can be used to remove PPCPs in bioslurry systems under non-sterile conditions, without extra nutrients in the media, and in matrices as complex as an MBR sludge. PMID:25563204

  12. Corolla morphology influences diversification rates in bifid toadflaxes (Linaria sect. Versicolores)

    PubMed Central

    Fernández-Mazuecos, Mario; Blanco-Pastor, José Luis; Gómez, José M.; Vargas, Pablo

    2013-01-01

    Background and Aims The role of flower specialization in plant speciation and evolution remains controversial. In this study the evolution of flower traits restricting access to pollinators was analysed in the bifid toadflaxes (Linaria sect. Versicolores), a monophyletic group of ?30 species and subspecies with highly specialized corollas. Methods A time-calibrated phylogeny based on both nuclear and plastid DNA sequences was obtained using a coalescent-based method, and flower morphology was characterized by means of morphometric analyses. Directional trends in flower shape evolution and trait-dependent diversification rates were jointly analysed using recently developed methods, and morphological shifts were reconstructed along the phylogeny. Pollinator surveys were conducted for a representative sample of species. Key Results A restrictive character state (narrow corolla tube) was reconstructed in the most recent common ancestor of Linaria sect. Versicolores. After its early loss in the most species-rich clade, this character state has been convergently reacquired in multiple lineages of this clade in recent times, yet it seems to have exerted a negative influence on diversification rates. Comparative analyses and pollinator surveys suggest that the narrow- and broad-tubed flowers are evolutionary optima representing divergent strategies of pollen placement on nectar-feeding insects. Conclusions The results confirm that different forms of floral specialization can lead to dissimilar evolutionary success in terms of diversification. It is additionally suggested that opposing individual-level and species-level selection pressures may have driven the evolution of pollinator-restrictive traits in bifid toadflaxes. PMID:24142920

  13. The complete mitochondrial genome of the color changeable toad-headed agama, Phrynocephalus versicolor (Reptilia, Squamata, Agamidae).

    PubMed

    Song, Sen; Li, Donghai; Zhang, Caihong; Jiang, Kaiju; Zhang, Dandan; Chang, Cheng

    2016-03-01

    The complete mitochondrial genome sequence of color changeable toad-headed agama, Phrynocephalus versicolor, was determined using polymerase chain reaction (PCR), long-and-accurate PCR and directly sequencing by primer walking. The entire mitochondrial genome of P. versicolor was 16,429?bp in length, the accession was KJ749841 and the content of A, T, C, and G were 36.1%, 26.5%, 24.9% and 12.5%, respectively, which was similar to most vertebrate. The complete mitochondrial genome of P. versicolor contain 13 protein-coding genes, 2 rRNA genes, 23 tRNA genes, plus one control region and was similar to those of other Phrynocephalus sand lizards in gene arrangement and composition, except that tRNA-Phe and tRNA-Pro were exchanged and tRNA-Phe had two copies. The control region comprised three parts, one between tRNA-Thr and tRNA-Phe, a second between tRNA-Pro and tRNA-Phe, and a third between tRNA-Phe and 12S RNA. The complete mitochondrial genome of P. versicolor provided fundamental data for resolving phylogenetic relationship problems related to Agaimidae and genus Phrynocephalus. PMID:24989048

  14. Starch degradation and nutrition value improvement in corn grits by solid state fermentation technique with Coriolus versicolor

    PubMed Central

    Huang, Mian; Zhang, Song

    2011-01-01

    The study was conducted to evaluate effect of Coriolus versicolor mycelia on degrading starch and improving nutrition value in corn grits through solid state fermentation technique. The results showed that using soybean meal as a nitrogen source, ?-amylase secreted from C. versicolor expressed 407.25U/g of activity, leading to 45.15% of starch degraded. The activity grew with fermentation time until the 15th day, after that the amylase was deactivated rapidly. An orthogonal experiment designed for the study illustrated that degradation rate of starch in corn grits attained to maximum, 50.51%, when 100g of corn grits, added 16g of soybean meal, were fermented by C. versicolor for 12 days, in an initial pH 5.5. After fermenting, compared to the nonfermented control, contents of amino acids, total sugar, crude fat and crude protein were increased by 21.00%, 38.45%, 55.56%, 69.15% respectively. The significant improvement of nutrition value in corn grits is probably attributed to the intense metabolism of C. versicolor. PMID:24031762

  15. Leaf removal by sesarmid crabs in Bangrong mangrove forest, Phuket, Thailand; with emphasis on the feeding ecology of Neoepisesarma versicolor

    NASA Astrophysics Data System (ADS)

    Thongtham, Nalinee; Kristensen, Erik; Puangprasan, Som-Ying

    2008-12-01

    Field measurements on leaf removal by populations of sesarmid crabs at different locations in the Bangrong mangrove forest, Phuket, Thailand, indicated that crabs on average can remove 87% of the daily leaf litter fall by ingestion or burial. The removal rate is correlated positively with the number of crab burrows and negatively with tidal inundation time. The results from the field were supplemented with observations on the behavior of Neoepisesarma versicolor in laboratory microcosms and a mangrove mesocosm. N. versicolor feeds primarily at night and total time spent feeding was up to an order of magnitude higher in the artificial microcosms than under simulated in situ conditions in the mesocosm. Most of the time during both day and night was spent resting near the entrance or inside burrows. N. versicolor mainly feeds on mangrove leaves and scraps of food material from the sediment surface. This is supported by examinations of stomach content, which showed that 62% is composed of higher plant material and 38% of detritus and mineral particles from the sediment. The nutritive value of leaves and detritus is insufficient to maintain crab growth. Sesarmid crabs may instead obtain the needed nutrients by occasional consumption of nitrogen-rich animal tissues, such as carcasses of fish and crustaceans, as indicated by the presence of animal remains in the stomach and the willingness of crabs to consume fish meat. Laboratory experiments on leaf consumption and leaf preferences of N. versicolor indicate that they preferentially feed on brown leaves, if available, followed by green and yellow leaves. If all species of sesarmid crabs in the Bangrong mangrove forest consume leaves at the same rate as N. versicolor, they could potentially ingest 52% of the total litter fall.

  16. Comparative study of ketoconazole versus selenium sulphide shampoo in pityriasis versicolor.

    PubMed

    Aggarwal, K; Jain, V K; Sangwan, S

    2003-01-01

    Forty patients suffering from pityriasis versicolor were treated with either 2% ketoconazole shampoo (20 patients) or 2.5% selenium sulphide shampoo (20 patients), once a week for three weeks. On global assessment after one month of start of therapy, 19 (95%) out of 20 patients treated with ketoconazole shampoo were cured while one case had mild residual disease. In selenium sulphide shampoo group, 17 (85%) out of 20 patients were cured, one had mild residual disease and two had considerable residual disease. No significant difference was observed in the response rates in the two groups. Relapse occurred in one patient of ketoconazole group and two patients of selenium sulphide group during the follow-up period of three months. PMID:17642841

  17. Enhanced production of cellulose degrading CMCase by newly isolated strain of Aspergillus versicolor.

    PubMed

    Qaisar, Sofia; Zohra, Rashida Rahmat; Aman, Afsheen; Qader, Shah Ali Ul

    2014-04-15

    Production of CMCase from newly isolated strain of Aspergillus versicolor was studied by optimizing different physico-chemical parameters. Cellulolytic potential of the isolate was confirmed by the simple agar plate method and then subjected to variation of a single parameter at a time in CMC containing medium. Maximum enzyme production was obtained at 30°C in 120 h when medium was supplemented with 0.5 gm% carboxymethyl cellulose, 0.2 gm% Tween 80, 0.075 gm% peptone, 0.050 gm% CaCl2, 1.5 gm% NaNO3 and 0.2 gm% KH2PO4 at pH 4.0. Current study holds great potential as the organism reported here could easily be used for the production of cellulase using renewable biomass. PMID:24607178

  18. Synergistic effects of a combined exposure to herbicides and an insecticide in Hyla versicolor

    USGS Publications Warehouse

    Mazanti, L.; Sparling, D.W.; Rice, C.; Bialek, K.; Stevenson, C.; Teels, B.

    2003-01-01

    Combinations of the herbicides atrazine and metolachlor and the insecticide chlorpyrifos were tested under both laboratory and field conditions to determine their individual and combined effects on amphibian populations. In the lab Hyla versicolor tadpoles experienced 100% mortality when exposed to a high combination of the pesticides (2.0 mg/L atrazine, 2.54 mg/L metolachlor, 1.0 mg/L chlorpyrifos) whereas low concentrations of the pesticides (0.2 mg/L atrazine, 0.25 mg/L metolachlor, 0.1 mg/L chlorpyrifos) or high concentrations of either herbicides or insecticide alone caused lethargy, reduced growth and delayed metamorphosis but no significant mortality. In the field high herbicide, low insecticide and low herbicide, low insecticide mixtures significantly reduced amphibian populations compared to controls but in the low herbicide, low insecticide wetlands amphibian populations were able to recover through recruitment by the end of the season.

  19. [The effect of low radiation doses on the growth of Aspergillus versicolor and Paecilomyces lilacinus].

    PubMed

    Tuga?, T I; Tuga?, A V; Zheltonozhskaia, M V; Sadovnikov, L V

    2013-01-01

    Peculiarities of growth of the strains of two species of microscopic fungi Aspergillus versicolor and Paecilomyces lilacinus were analyzed under exposure to chronic irradiation. It was shown that the rate of radial growth increased nonuniformly in the range of doses from 0 to 250 mGy but with maximums at a certain dose of radiation. It was shown that the absorbed dose of radiation to 2 Gy did not influence the survival of investigated strains in comparison with the control ones without irradiation. It was shown that the doses of irradiation to 2 Gy (at capacity exposure dose 0.955 microC/kg) are small for these species of microscopic fungi. PMID:24006782

  20. Studies of laccase from Trametes versicolor in aqueous solutions of several methylimidazolium ionic liquids.

    PubMed

    Domínguez, Alberto; Rodríguez, Oscar; Tavares, Ana Paula M; Macedo, Eugenia A; Longo, María Asunción; Sanromán, María Angeles

    2011-08-01

    Stability and kinetic behavior of laccase from Trametes versicolor in the presence of several ionic liquids from the methylimidazolium family have been investigated. In general laccase stability diminished as the size of the alkylic substitute in the methylimidazolium ring increased. Higher concentrations of ionic liquids caused more destabilization than lower ones. Thus, low concentrations of [C(2)mim(+)][EtSO(4)(-)] allowed maintaining enzymatic stability. [C(4)mim(+)][Cl(-)] appeared to have a stabilizing effect on laccase, as little activity decay was observed within three weeks. Kinetic studies indicated that both [C(2)mim(+)][EtSO(4)(-)] and [C(4)mim(+)][Cl(-)] inhibited laccase activity, although 10-fold more [C(2)mim(+)][EtSO(4)(-)] than [C(4)mim(+)][Cl(-)] was required to cause the same degree of inhibition. A kinetic model was developed to represent the experimental data. PMID:21669518

  1. Degradation of selected agrochemicals by the white rot fungus Trametes versicolor.

    PubMed

    Mir-Tutusaus, Josep Anton; Masís-Mora, Mario; Corcellas, Cayo; Eljarrat, Ethel; Barceló, Damià; Sarrà, Montserrat; Caminal, Glòria; Vicent, Teresa; Rodríguez-Rodríguez, Carlos E

    2014-12-01

    Use of agrochemicals is a worldwide practice that exerts an important effect on the environment; therefore the search of approaches for the elimination of such pollutants should be encouraged. The degradation of the insecticides imiprothrin (IP) and cypermethrin (CP), the insecticide/nematicide carbofuran (CBF) and the antibiotic of agricultural use oxytetracycline (OTC) were assayed with the white rot fungus Trametes versicolor. Experiments with fungal pellets demonstrated extensive degradation of the four tested agrochemicals, at rates that followed the pattern IP>OTC>CP>CBF. In vitro assays with laccase-mediator systems showed that this extracellular enzyme participates in the transformation of IP but not in the cases of CBF and OTC. On the other hand, in vivo studies with inhibitors of cytochrome P450 revealed that this intracellular system plays an important role in the degradation of IP, OTC and CBF, but not for CP. The compounds 3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylic acid (DCCA) and 3-phenoxybenzoic acid (PBA) were detected as transformation products of CP, as a result of the breakdown of the molecule. Meanwhile, 3-hydroxycarbofuran was detected as a transformation product of CBF; this metabolite tended to accumulate during the process, nonetheless, the toxicity of the system was effectively reduced. Simultaneous degradation of CBF and OTC showed a reduction in toxicity; similarly, when successive additions of OTC were done during the slower degradation of CBF, the fungal pellets were able to degrade both compounds. The simultaneous degradation of the four compounds successfully took place with minimal inhibition of fungal activity and resulted in the reduction of the global toxicity, thus supporting the potential use of T. versicolor for the treatment of diverse agrochemicals. PMID:25217998

  2. Tinea versicolor

    MedlinePLUS

    ... Philadelphia, PA: Elsevier Churchill Livingstone; 2009:chap 267. James WD, Berger TG, Elston DM. Diseases resulting from fungi and yeasts. In: James WD, Berger TG, Elston DM, eds. Andrews' Diseases ...

  3. Tinea Versicolor

    MedlinePLUS

    ... Resource Center Join the AAD Boards study tools Online Learning Center Meetings and events AAD publications Make a difference Career planning Residents & Fellows Community Media Relations Toolkit Dermatology issues in the news Background materials Customized press ...

  4. Tinea Versicolor

    MedlinePLUS

    ... condition caused by surface (superficial) infection with a yeast that commonly lives on the skin. In the ... such as warm, oily, and moist skin, the yeast ( Malassezia ) can overgrow and cause a rash consisting ...

  5. ``Winter'' aggregations, colony cycle, and seasonal phenotypic change in the paper wasp Polistes versicolor in subtropical Brazil

    NASA Astrophysics Data System (ADS)

    Gobbi, Nivar; Noll, Fernando B.; Penna, Marcelo A. H.

    2006-10-01

    Social wasps from temperate zones have clear annual colony cycles, and the young queens hibernate during winter. In the subtropics, the only previously reported evidence for the existence of “hibernation” is the facultative winter aggregations of females during harsh climate conditions. As in temperate-zone species analyzed so far, we show in this study that in the paper wasp, Polistes versicolor, a subtropical species, body size increases as an unfavorable season approaches. Our morphological studies indicate that larger females come from winter aggregations—that is, they are new queens. Multivariate analyses indicate that size is the only variable analyzed that shows a relationship to the differences. Given the absence of a harsh climate, we suggest that the occurrence of winter aggregations in tropical P. versicolor functions to allow some females to wait for better environmental conditions to start a new nest, rather than all being obliged to start a new nest as soon as they emerge.

  6. Examining multiple sublethal contaminants on the gray treefrog (Hyla versicolor): Effects of an insecticide, herbicide, and fertilizer

    USGS Publications Warehouse

    Boone, M.D.; Bridges-Britton, C. M.

    2006-01-01

    We examined the single and interactive effects of an insecticide, an herbicide, and a fertilizer on gray treefrog (Hyla versicolor) tadpoles. Tadpoles were reared in mesocosms from hatching through metamorphosis and were exposed to the presence or absence of as many as three contaminants. Tadpoles did not appear to be more susceptible to single versus multiple contaminants, which may result from positive changes in food resources that compensate for the effects of other contaminants. ?? 2006 SETAC.

  7. Bioconversion of xylose, hexoses and biomass to ethanol by a new isolate of the white rot basidiomycete Trametes versicolor.

    PubMed

    Okamoto, Kenji; Uchii, Atsushi; Kanawaku, Ryuichi; Yanase, Hideshi

    2014-01-01

    Second-generation bioethanol production requires the development of economically feasible and sustainable processes that use renewable lignocellulosic biomass as a starting material. However, the microbial fermentation of xylose, which is the principal pentose sugar in hemicellulose, is a limiting factor in developing such processes. Here, a strain of the white rot basidiomycete Trametes versicolor that was capable of efficiently fermenting xylose was newly isolated and characterized. This strain, designated KT9427, was capable of assimilating and converting xylose to ethanol under anaerobic conditions with a yield of 0.44 g ethanol per 1 g of sugar consumed. In culture medium containing low yeast extract concentrations, xylose consumption and ethanol productivity were enhanced. Adjusting the initial pH between 3.0 and 5.0 did not markedly influence xylose fermentation. T. versicolor KT9427 also produced ethanol from glucose, mannose, fructose, cellobiose and maltose at yields ranging from 0.45 to 0.49 g ethanol per 1 g of sugar consumed. In addition, strain KT9427 exhibited favourable conversion of non-pretreated starch, cellulose, xylan, wheat bran and rice straw into ethanol compared to common recombinant yeast strains. Taken together, the present findings suggest that T. versicolor KT9427 is a promising candidate for environmentally friendly ethanol production directly from lignocellulosic biomass. PMID:24624317

  8. Identification of Malassezia Species Isolated from Patients with Pityriasis Versicolor Using PCR-RFLP Method in Markazi Province, Central Iran

    PubMed Central

    DIDEHDAR, Mojtaba; MEHBOD, Amir Sayed Ali; ESLAMIRAD, Zahra; MOSAYEBI, Mahdi; HAJIHOSSEIN, Reza; GHORBANZADE, Behzad; KHAZAEI, Mahmoud Reza

    2014-01-01

    Abstract Background The lipophilic yeasts of Malassezia species are members of the normal skin microbial that are cause of pityriasis versicolor. Pityriasis versicolor is a common superficial fungal infection with world-wide distribution. The phenotypic methods for identification of Malassezia species usually are time consuming and unreliable to differentiate newly identified species. But DNA-based techniques rapidly and accurately identified Malassezia species. The purpose of this study was isolation and identification of Malassezia Species from patients with pityriasis versicolor by molecular methods in Markazi Province, Central Iran in 2012. Methods Mycologic examinations including direct microscopy and culture were performed on clinical samples. DNA extraction was performed from colonies. The ITS1 region of rDNA from isolates of Malassezia species were amplified by PCR reaction. The PCR were digested by Cfo I enzyme. Results From 70 skin samples, were microscopically positive for Malassezia elements, 60 samples were grown on culture medium (85.7%). Using PCR-RFLP method, that was performed on 60 isolates, 37(61.6%) M. globosa, 14(23.3%) M. furfur, 5(8.4%) M. sympodialis and 4(6.7%) M. restrictawere identified. In one case was isolated M. globosa along with M. restricta. Conclusion The PCR-RFLP method is a useful and reliable technique for identification of differentiation of Malas-sezia species. PMID:26056657

  9. Flutrimazole shampoo 1% versus ketoconazole shampoo 2% in the treatment of pityriasis versicolor. A randomised double-blind comparative trial.

    PubMed

    Rigopoulos, D; Gregoriou, S; Kontochristopoulos, G; Ifantides, A; Katsambas, A

    2007-05-01

    Flutrimazole is an imidazole derivative that has been proven to be efficient in superficial skin fungal infections. The aim of this randomised double-blind study was to compare for the first time, the efficiency and safety of flutrimazole 1% shampoo versus ketoconazole 2% shampoo in the treatment of tinea versicolor. Study population consisted of 60 patients with pityriasis versicolor diagnosed clinically and through direct microscopy and culture. Patients were randomly assigned to two groups: one instructed to apply flutrimazole shampoo 1% and one instructed to apply ketoconazole shampoo 2% both on head and body for 14 days. Patients were re-evaluated 14 days after the end of treatment clinically and through direct microscopy and culture. Twenty-one of 26 patients (80.8%) in the ketoconazole and 22 of 29 patients (75.9%) in the flutrimazole group had both visual healing and negative mycological evaluation. Comparison of the response between the two groups with the Yates' corrected chi-square was found statistically not significant (chi(2) = 0.19, d.f. = 1, P = 0.91). None of the patients in the two groups reported any adverse effects. Fourteen (53%) patients in the ketoconazole group and 23 (79%) in the flutrimazole group assessed the shampoos as cosmetically acceptable regarding texture, smell and foam properties. Flutrimazole shampoo 1% appears to present efficacy comparable with ketoconazole 2% in the treatment of tinea versicolor. PMID:17472615

  10. RANDOMIZED COMPARATIVE CLINICAL TRIAL OF ARTEMISIA SIEBERI 5% LOTION AND CLOTRIMAZOLE 1% LOTION FOR THE TREATMENT OF PITYRIASIS VERSICOLOR

    PubMed Central

    Rad, Farrokh; Aala, Farzad; Reshadmanesh, Naser; Yaghmaie, Rokshana

    2008-01-01

    Aims: To compare the therapeutic effects of topical Artremisia sieberi 5% lotion with topical clotrimazole 1% lotion in the treatment of pityriasis versicolor. Materials and Methods: 100 patients with pityriasis versicolor and microscopic identification of Malassezia furfur were randomly assigned to treatment with either topical Artemisia sieberi 5% lotion (group 1) or topical clotrimazole 1% lotion (group 2) for 2 weeks. Group 1 and group 2 consisted of 51 and 49 patients respectively. The patients were evaluated both clinically and mycologically at baseline and every 2 weeks for a period of 4 weeks. Results: At the end of the second week, clinical cure rates were 86.3% and 65.3% for group 1 and group 2 respectively (P<0.01), but at the same time mycological cure rate was 92.2% for group 1 and 73.5% for group 2 (P<0.05). At the end of the fourth week, clinical cure rates were 86.3% and 59.2% for group 1 and group 2 respectively (P<0.01), and at the same time mycologic cure rate was 96.1% for group 1 and 65.3% for group 2 (P<0.01). Conclusions: The results of this study demonstrated that Artemisia sieberi 5% lotion was more effective than clotrimazole 1% lotion in the treatment of pityriasis versicolor. PMID:19882007

  11. Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity.

    PubMed

    Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, Michal; Lisá, Ludmila

    2015-12-01

    The strain Pleurotus ostreatus Florida f6, its 45 basidiospore-derived isolates (both monokaryons and dikaryons prepared in our laboratory), Trametes versicolor strain CCBAS 614 and 22 other T. versicolor isolates obtained from the sporocarps collected in distant localities were successfully preserved for 12 y using perlite and straw cryopreservation protocols. All tested isolates survived a 12-year storage in liquid nitrogen (LN) and their laccase production and Poly B411 decolorization capacity was preserved. Also mycelium extension rate and the types of colony appearance of individual isolates remained unchanged. Different cryopreservation techniques were also tested for the short time (24 h) and the long time (6 m) storage of the culture liquid with extracellular laccase produced by T. versicolor strain CCBAS 614. The results showed that 10 % glycerol was the most suitable cryopreservant. The absence of the cryopreservant did not cause high loss of laccase activity in the samples; the presence of DMSO (5 or 10 %) in LN-stored samples caused mostly a decrease of laccase activity. For the preservation of laccase activity in the liquid culture the storage in the freezer at -80 °C is more convenient than the storage in liquid nitrogen. PMID:26615755

  12. Purification of a novel pepsin inhibitor from Coriolus versicolor and its biochemical properties.

    PubMed

    Zhang, Guo-Qiang; Zhang, Qiu-Ping; Sun, Ying; Tian, Ya-Ping; Zhou, Nan-Di

    2012-03-01

    A novel pepsin inhibitor was isolated from Coriolus versicolor. The purification was carried out by a 2-step ultrafiltration followed by DEAE-52 and Mono Q ion-exchange chromatography. SDS-PAGE and gel filtration chromatography analysis showed that the isolated inhibitor was a 22.3 kDa protein with a single subunit. Heat stability of this inhibitor was estimated and only 7% of its inhibitory activity lost after treatment at 98 °C. The inhibitor was more specific against pepsin than several other proteases. The dissociation constant (K(i)) and concentration required for 50% pepsin inhibition (IC50) were 5.84 × 10(-5) M and 26.26 ?g/mL, respectively. Apparent decrease of ?-helix and increase of random coil were observed in the circular dichroism spectra of pepsin when an equimolar amount of the inhibitor was added. The inhibition mechanism of this inhibitor differs from the reported aspartic protease inhibitors, according to the secondary structure and the kinetic studies of this inhibitor. PMID:22384953

  13. Randomized comparative clinical trial of itraconazole and selenium sulfide shampoo for the treatment of pityriasis versicolor.

    PubMed

    del Palacio Hernanz, A; Delgado Vicente, S; Menéndez Ramos, F; Rodríguez-Noriega Belaustegui, A

    1987-01-01

    Forty patients with pityriasis versicolor, fluorescence of involved areas under Wood's light, and positive microscopic identification of Malassezia furfur were randomly assigned to treatment with either oral itraconazole (200 mg once daily for five consecutive days) or 2.5% selenium sulfide shampoo (once daily application for seven days). Each treatment group consisted of 20 patients. On assessment three weeks after the end of treatment, all patients given itraconazole showed a response: 17 were healed, and three had mild residual lesions. Likewise, all patients in the selenium sulfide group responded to therapy: 16 were healed, and four had mild residual lesions. Tolerability, acceptability, and compliance were excellent with itraconazole. All 20 patients given the drug stated a preference for oral treatment. In the selenium sulfide group, five patients (25%) had adverse reactions attributable to the medication; one of these patients experienced an irritation severe enough to warrant the discontinuation of treatment on the third day. Ten patients in this group stated a preference for oral treatment. PMID:3027836

  14. Phase 1 Clinical Trial of Trametes versicolor in Women with Breast Cancer.

    PubMed

    Torkelson, Carolyn J; Sweet, Erin; Martzen, Mark R; Sasagawa, Masa; Wenner, Cynthia A; Gay, Juliette; Putiri, Amy; Standish, Leanna J

    2012-01-01

    Introduction. Orally administered preparations from the Trametes versicolor (Tv) mushroom have been hypothesized to improve immune response in women with breast cancer after standard chemotherapy and radiotherapy. Methods. A phase I, two-center, dose escalation study was done to determine the maximum tolerated dose of a Tv preparation when taken daily in divided doses for 6 weeks after recent completion of radiotherapy. Eleven participants were recruited and nine women completed the study. Each cohort was comprised of three participants given one of three doses of Tv (3, 6, or 9?grams). Immune data was collected pre- and postradiation, at 3 on-treatment time points and after a 3-week washout. Results. Nine adverse events were reported (7 mild, 1 moderate, and 1 severe), suggesting that Tv was well tolerated. Immunological results indicated trends in (1) increased lymphocyte counts at 6 and 9?grams/day; (2) increased natural killer cell functional activity at 6?grams/day; (3) dose-related increases in CD8(+) T cells and CD19(+) B cells , but not CD4(+) T cells or CD16(+)56(+) NK cells. Conclusion. These findings show that up to 9?grams/day of a Tv preparation is safe and tolerable in women with breast cancer in the postprimary treatment setting. This Tv preparation may improve immune status in immunocompromised breast cancer patients following standard primary oncologic treatment. PMID:22701186

  15. Lethal and sublethal effects of embryonic and larval exposure of Hyla versicolor to Stormwater pond sediments.

    PubMed

    Brand, Adrianne B; Snodgrass, Joel W; Gallagher, Matthew T; Casey, Ryan E; Van Meter, Robin

    2010-02-01

    Stormwater ponds are common features of modern stormwater management practices. Stormwater ponds often retain standing water for extended periods of time, develop vegetative characteristics similar to natural wetlands, and attract wildlife. However, because stormwater ponds are designed to capture pollutants, wildlife that utilize ponds might be exposed to pollutants and suffer toxicological effects. To investigate the toxicity of stormwater pond sediments to Hyla versicolor, an anuran commonly found using retention ponds for breeding, we exposed embryos and larvae to sediments in laboratory microcosms. Exposure to pond sediments reduced survival of embryos by approximately 50% but did not affect larval survival. Larvae exposed to stormwater pond sediment developed significantly faster (x = 39 days compared to 42 days; p = 0.005) and were significantly larger at metamorphosis (x = 0.49 g compared to 0.36 g; p < 0.001) than controls that were exposed to clean sand. Substantial amounts (712-2215 mg/l) of chloride leached from pond sediments into the water column of treatment microcosms; subsequently, survival of embryos was negatively correlated (r (2) = 0.50; p < 0.001) with water conductivity during development. Our results, along with the limited number of other toxicological studies of stormwater ponds, suggest that road salt contributes to the degradation of stormwater pond habitat quality for amphibian reproduction and that future research should focus on understanding interactions among road salts and other pollutants and stressors characteristic of urban environments. PMID:19685097

  16. Isolation and Identification of the Coal-Solubilizing Agent Produced by Trametes versicolor

    PubMed Central

    Cohen, Martin S.; Feldman, Kathleen A.; Brown, Cynthia S.; Gray, Edward T.

    1990-01-01

    Low-ranked coals were dissolved by using cell extracts derived from liquid cultures of Trametes versicolor. The coal-solubilizing agent (CSA) was separated from the broth components by a multistep isolation procedure including reverse-phase high-pressure liquid chromatography, size exclusion chromatography, ethanol fractionation, and recrystallization. Staircase voltammetry was used to show that two CSA moieties can coordinate to aqueous copper(II) ion. A molecular weight determination (using amperometry) gave an apparent molecular weight of 1.34 × 102 g/mol ± 8%. Nuclear magnetic resonance indicated that all protons on CSA are exchangeable in D2O and that there is only one type of carbon in CSA. The infrared spectrum of recrystallized CSA is identical to that of ammonium oxalate, and X-ray studies confirmed the crystal structure and composition of CSA to be that of ammonium oxalate monohydrate. The equivalent weight of the coal in solution, when the coal was dissolved by ammonium oxalate, is 7,940 g of coal per mol of iron present in the coal. PMID:16348335

  17. Phase 1 Clinical Trial of Trametes versicolor in Women with Breast Cancer

    PubMed Central

    Torkelson, Carolyn J.; Sweet, Erin; Martzen, Mark R.; Sasagawa, Masa; Wenner, Cynthia A.; Gay, Juliette; Putiri, Amy; Standish, Leanna J.

    2012-01-01

    Introduction. Orally administered preparations from the Trametes versicolor (Tv) mushroom have been hypothesized to improve immune response in women with breast cancer after standard chemotherapy and radiotherapy. Methods. A phase I, two-center, dose escalation study was done to determine the maximum tolerated dose of a Tv preparation when taken daily in divided doses for 6 weeks after recent completion of radiotherapy. Eleven participants were recruited and nine women completed the study. Each cohort was comprised of three participants given one of three doses of Tv (3, 6, or 9?grams). Immune data was collected pre- and postradiation, at 3 on-treatment time points and after a 3-week washout. Results. Nine adverse events were reported (7 mild, 1 moderate, and 1 severe), suggesting that Tv was well tolerated. Immunological results indicated trends in (1) increased lymphocyte counts at 6 and 9?grams/day; (2) increased natural killer cell functional activity at 6?grams/day; (3) dose-related increases in CD8+ T cells and CD19+ B cells , but not CD4+ T cells or CD16+56+ NK cells. Conclusion. These findings show that up to 9?grams/day of a Tv preparation is safe and tolerable in women with breast cancer in the postprimary treatment setting. This Tv preparation may improve immune status in immunocompromised breast cancer patients following standard primary oncologic treatment. PMID:22701186

  18. Treatment of pityriasis versicolor with topical application of essential oil of Cymbopogon citratus (DC) Stapf - therapeutic pilot study*

    PubMed Central

    Carmo, Egberto Santos; Pereira, Fillipe de Oliveira; Cavalcante, Neuza Maria; Gayoso, Carla Wanderley; Lima, Edeltrudes de Oliveira

    2013-01-01

    BACKGROUND Pityriasis versicolor is a fungal infection caused by Malassezia spp. that has frequent relapses. OBJECTIVES The main objective of this research was to perform phase I and II clinical studies, using formulations containing essential oil of Cymbopogon citratus in patients with pityriasis versicolor. METHODS Phase I study included twenty volunteers to ascertain the safety of the formulations. In phase II, 47 volunteers randomly received essential oil formulations at 1.25 ?L/mL concentration, for forty days. The shampoo should be applied three times a week and the cream twice a day. A control group in phase II, consisting of 29 volunteers, received the same formulations but with 2% ketoconazole as the active ingredient. RESULTS No significant adverse events were observed in volunteers during Phase I. In Phase II, 30 (63.83%) volunteers using essential oil and 18 (62.07%) using ketoconazole remained until the end of the study. We observed a predominance of lesions in disseminated form, with M. sympodialis detected as the predominant agent identified in cultures. After 40 days of treatment, the rate of mycological cure was 60% (p <0.05) for the group treated with essential oil of C. citratus and over 80% (p <0.05) for the group treated with ketoconazole formulations. CONCLUSIONS Notwithstanding the safety and antifungal effects observed in this study after application of formulations containing the essential oil of C. citratus, further studies with larger populations should be performed to confirm the actual potential of these formulations in the treatment of patients with Pityriasis versicolor. PMID:23793205

  19. Characterization and immobilization of Trametes versicolor laccase on magnetic chitosan-clay composite beads for phenol removal.

    PubMed

    Aydemir, Tülin; Güler, Semra

    2015-12-01

    Laccase from Trametes versicolor was immobilized on magnetic chitosan-clay composite beads by glutaraldehyde crosslinking. The physical, chemical, and biochemical properties of the immobilized laccase and its application in phenol removal were comprehensively investigated. The structure and morphology of the composite beads were characterized by SEM, TGA, and FTIR analyses. The immobilized laccase showed better storage stability and higher tolerance to the changes in pH and temperature compared with free laccase. Moreover, the immobilized laccase retained more than 75% of its original activity after 10 cycles. The efficiency of phenol removal by immobilized laccase was about 80% under the optimum conditions after 4 h. PMID:26167845

  20. Interaction between perchlorate and iodine in the metamorphosis of Hyla versicolor

    USGS Publications Warehouse

    Sparling, D.W.; Harvey, G.; Nzengung, V.

    2003-01-01

    Perchlorate (ClO4-) is a water-soluble, inorganic anion that is often combined with ammonium, potassium or other cations for use in industry and agriculture. Ammonium perchlorate, for example, is a potent oxidizer and is used in various military applications including rocket fuel. It has also been found in an historically widely used fertilizer, Chilean nitrate and in other fertilizers. It has been found in ground and surface waters of over 30 states and is considered a human health risk. Because of its similar atomic radius and volume, perchlorate competes with iodide for thyroid uptake and storage and thereby inhibits production of thyroid hormones. Amphibians may be particularly affected by perchlorate because they rely on the thyroid for metamorphosis. This study exposed early larval Hyla versicolor to concentrations of perchlorate ranging from 2.2 to 50 ppm to determine the effects of perchlorate on a native amphibian. In addition, three controls, 0 perchlorate, 0 perchlorate with 0.10 ppm iodide (C + I) and 50 ppm perchlorate + 0.10 ppm iodide (50 + I) were tested. Mortality (<11% with all treatments) and growth appeared to be unaffected by perchlorate. Inhibition of development started with 2.2 ppm perchlorate and little or no development occurred at 22.9 ppm and above. This inhibition was particularly apparent at the latter stages of development including hindlimb formation and metamorphosis. The estimated EC50 for total inhibition of metamorphosis at 70 days of treatment was 3.63 ppm. There was no evidence of inhibition of development with the 50 + I, C + I, or controls, indicating that the presence of small concentrations of iodide could counter the effects of perchlorate. When tadpoles that had been inhibited by perchlorate were subsequently treated with iodide, development through prometamorphosis progressed but mortality was very high.

  1. Interaction between perchlorate and iodine in the metamorphosis of Hyla versicolor

    USGS Publications Warehouse

    Sparling, D.; Harvey, G.; Nzengung, V.

    2003-01-01

    Perchlorate (ClO4-) is a water-soluble, inorganic anion that is often combined with ammonium, potassium or other cations for use in industry and agriculture. Ammonium perchlorate, for example, is a potent oxidizer and is used in various military applications including rocket fuel. It has also been found in an historically widely used fertilizer, Chilean nitrate and in other fertilizers. It has been found in ground and surface waters of over 30 states and is considered a human health risk. Because of its similar atomic radius and volume, perchlorate competes with iodide for thyroid uptake and storage and thereby inhibits production of thyroid hormones. Amphibians may be particularly affected by perchlorate because they rely on the thyroid for metamorphosis. This study exposed early larval Hyla versicolor to concentrations of perchlorate ranging from 2.2 to 50 ppm to determine the effects of perchlorate on a native amphibian. In addition, three controls, 0 perchlorate, 0 perchlorate with 0.10 ppm iodide (C + I) and 50 ppm perchlorate + 0.10 ppm iodide (50 + I) were tested. Mortality (< 11% with all treatments) and growth appeared to be unaffected by perchlorate. Inhibition of development started with 2.2 ppm perchlorate and little or no development occurred at 22.9 ppm and above. This inhibition was particularly apparent at the latter stages of development including hindlimb formation and metamorphosis. The estimated EC50 for total inhibition of metamorphosis at 70 days of treatment was 3.63 ppm. There was no evidence of inhibition of development with the 50 + I, C + I, or controls, indicating that the presence of small concentrations of iodide could counter the effects of perchlorate. When tadpoles that had been inhibited by perchlorate were subsequently treated with iodide, development through prometamorphosis progressed but mortality was very high.

  2. Solid-phase treatment with the fungus Trametes versicolor substantially reduces pharmaceutical concentrations and toxicity from sewage sludge.

    PubMed

    Rodríguez-Rodríguez, Carlos E; Jeli?, Aleksandra; Llorca, Marta; Farré, Marinella; Caminal, Glòria; Petrovi?, Mira; Barceló, Damià; Vicent, Teresa

    2011-05-01

    For safe biosolid-land-applying, sludge should be contaminant-free. However, it may contain important amounts of micropollutants, not removed in the wastewater-treatment-processes. An alternative treatment with the fungus Trametes versicolor was applied in sterile solid-phase systems consisting of sludge and a lignocellulosic substrate. Fungal colonization and activity were demonstrated during the process, according to monitoring of ergosterol, laccase activity and the naproxen-degradation test (ND24). Fourteen out of 43 analyzed pharmaceuticals were found in the raw sludge. After treatment, phenazone, bezafibrate, fenofibrate, cimetidine, clarithromycin, sulfamethazine and atenolol were completely removed, while removals between 42% and 80% were obtained for the remaining pharmaceuticals. Toxicological analyses (Daphnia magna, Vibrio fischeri and seed germination) showed an important reduction in sludge toxicity after treatment. Results suggest that a solid-phase treatment with T. versicolor may reduce the ecotoxicological impact of micropollutants present in sewage sludge. This is the first report of a fungal-approach for elimination of emerging pollutants from biosolids. PMID:21376580

  3. Terbinafin 1% Cream and Ketoconazole 2% Cream in the Treatment of Pityriasis Versicolor: A randomized comparative clinical trial

    PubMed Central

    Rad, Farrokh; Nik-Khoo, Bahram; Yaghmaee, Roxana; Gharibi, Fardin

    2014-01-01

    Objective: To make a comparison between terbinafine 1% cream and ketoconazole 2% cream in the treatment of pityriasis versicolor. Methods: This randomized single blind study included 110 patients with clinical diagnosis of pityriasis versicolor and positive mycological test for Malassezia furfur. The patients were randomly assigned to two groups. Group 1 used terbinafine cream and group 2 applied ketoconazole cream on the skin lesions for two weeks. Each group consisted of 55 patients. Clinical and mycological examinations were performed at baseline, at the end of the 2nd, 4th and 8th week of starting the treatment regimens. Results: At the end of the 2nd week we achieved cure rates of 72% and 64.3% for group 1 and group 2 respectively. At the end of the 4th week the respective cure rates for group 1 and group 2 were 81.2% and 69%, and at the end of the 8th week 70.8% of the patients in group 1 and 61.9% of the patients in group 2 were cured. Conclusion: The results of this study showed no significant statistical differences between the two groups in regard to cure and recurrence rates. But the numbers of cured patients were higher and recurrent cases were lower in group 1. PMID:25674122

  4. Non conventional biological treatment based on Trametes versicolor for the elimination of recalcitrant anticancer drugs in hospital wastewater.

    PubMed

    Ferrando-Climent, Laura; Cruz-Morató, Carles; Marco-Urrea, Ernest; Vicent, Teresa; Sarrà, Montserrat; Rodriguez-Mozaz, Sara; Barceló, Damià

    2015-10-01

    This work presents a study about the elimination of anticancer drugs, a group of pollutants considered recalcitrant during conventional activated sludge wastewater treatment, using a biological treatment based on the fungus Trametes versicolor. A 10-L fluidized bed bioreactor inoculated with this fungus was set up in order to evaluate the removal of 10 selected anticancer drugs in real hospital wastewater. Almost all the tested anticancer drugs were completely removed from the wastewater at the end of the batch experiment (8 days) with the exception of Ifosfamide and Tamoxifen. These two recalcitrant compounds, together with Cyclophosphamide, were selected for further studies to test their degradability by T. versicolor under optimal growth conditions. Cyclophosphamide and Ifosfamide were inalterable during batch experiments both at high and low concentration, whereas Tamoxifen exhibited a decrease in its concentration along the treatment. Two positional isomers of a hydroxylated form of Tamoxifen were identified during this experiment using a high resolution mass spectrometry based on ultra-high performance chromatography coupled to an Orbitrap detector (LTQ-Velos Orbitrap). Finally the identified transformation products of Tamoxifen were monitored in the bioreactor run with real hospital wastewater. PMID:25911328

  5. Isolation, structure elucidation, and biomimetic total synthesis of versicolamide B and the isolation of antipodal (-)-stephacidin A and (+)-notoamide B from Aspergillus versicolor

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new prenylated indole alkaloid, versicolamide B, was isolated from cultures of Aspergillus versicolor NRRL 35600. The structure was assigned by 2D NMR data, and confirmed by a biomimetic total synthesis. Versicolamide B is the first member of the paraherquamide-stephacidin family of alkaloids fo...

  6. Production of laccase from Trametes versicolor by solid-state fermentation using olive leaves as a phenolic substrate.

    PubMed

    Aydino?lu, Tu?ba; Sargin, Sayit

    2013-02-01

    The aim of the present study was to investigate whether olive leaves were feasible as a substrate for laccase production by the white-rot fungus Trametes versicolor FPRL 28A INI under solid-state fermentation conditions. Different experiments were conducted to select the variables that allow obtaining high levels of laccase activity. In particular, the effects of the initial moisture content, substrate particle size, supplementation with inorganic and organic nitrogen sources were evaluated. Highest laccase activity (276.62 ± 25.67 U/g dry substrate) was achieved with 80 % initial moisture content and 1.4-1.6 mm particle size of the substrate supplemented with yeast extract (1 % (w/w) nitrogen). Such a high activity was obtained without any addition of inducers. PMID:22763778

  7. Avertoxins A-D, Prenyl Asteltoxin Derivatives from Aspergillus versicolor Y10, an Endophytic Fungus of Huperzia serrata.

    PubMed

    Wang, Mingzi; Sun, Mingwei; Hao, Huilin; Lu, Chunhua

    2015-12-24

    Aspergillus versicolor Y10 is an endophytic fungus isolated from Huperzia serrata, which showed inhibitory activity against acetylcholinesterase. An investigation of the chemical constituents of Y10 led to the isolation of four new prenylated asteltoxin derivatives, named avertoxins A-D (2-5), together with the known mycotoxin asteltoxin (1). In the present study, we report structure elucidation for 2-5 and the revised NMR assignments for asteltoxin and demonstrated that avertoxin B (3) is an active inhibitor against human acetylcholinesterase with the IC50 value of 14.9 ?M (huperzine A as the positive control had an IC50 of 0.6 ?M). In addition, the cytotoxicity of asteltoxin (1) and avertoxins A-D (2-5) against MDA-MB-231, HCT116, and HeLa cell lines was evaluated. PMID:26618211

  8. Secondary metabolites of a deep sea derived fungus Aspergillus versicolor CXCTD-06-6a and their bioactivity

    NASA Astrophysics Data System (ADS)

    Kong, Xianglan; Cai, Shengxin; Zhu, Tianjiao; Gu, Qianqun; Li, Dehai; Luan, Yepeng

    2014-08-01

    In order to obtain novel secondary metabolites, a deep sea inhabiting fungus Aspergillus versicolor CXCTD-06-6a was investigated. One new diketopiperazine brevianamide W ( 1a), as well as five known diketopiperazine alkaloids, diketopiperazine V ( 1b), brevianamide Q ( 2), brevianamide R ( 3), brevianamide K ( 4), and brevianamide E ( 5), were isolated from the EtOAc extract of the fermentation broth. Their structures were elucidated by spectroscopy techniques (NMR, MS). The six compounds exhibited moderate radical scavenging activity against DPPH with clearance ratio of 55.0% ( 1a and 1b), 53.7% ( 2), 46.2% ( 3), 61.4% ( 4) and 19.3% ( 5) at a concentration of 13.9 ?mol L-1, respectively; while the positive control ascorbic acid showed a ratio of 70.3% at the concentration of 28.4 ?mol L-1.

  9. Versixanthones A-F, Cytotoxic Xanthone-Chromanone Dimers from the Marine-Derived Fungus Aspergillus versicolor HDN1009.

    PubMed

    Wu, Guangwei; Yu, Guihong; Kurtán, Tibor; Mándi, Attila; Peng, Jixing; Mo, Xiaomei; Liu, Ming; Li, Hui; Sun, Xinhua; Li, Jing; Zhu, Tianjiao; Gu, Qianqun; Li, Dehai

    2015-11-25

    Six unusual xanthone-chromanone dimers, versixanthones A-F (1-6), featuring different formal linkages of tetrahydroxanthone and 2,2-disubstituted chroman-4-one monomers, were isolated from a culture of the mangrove-derived fungus Aspergillus versicolor HDN1009. The absolute configurations of 1-6, representing the central and axial chirality elements or preferred helicities, were established by a combination of X-ray diffraction analysis, chemical conversions, and TDDFT-ECD calculations. The interconversion of different biaryl linkages between 1 and 4 and between 2 and 3 in DMSO by a retro-oxa-Michael mechanism provided insight into the formation of the xanthone-chromanone dimers and supported the assignments of their absolute configurations. Compounds 1-6 exhibited cytotoxicities against the seven tested cancer cell lines, with the best IC50 value of 0.7 ?M. Compound 5 showed further inhibitory activity against topoisomerase I. PMID:26506221

  10. Historical Isolation versus Recent Long-Distance Connections between Europe and Africa in Bifid Toadflaxes (Linaria sect. Versicolores)

    PubMed Central

    Fernández-Mazuecos, Mario; Vargas, Pablo

    2011-01-01

    Background Due to its complex, dynamic and well-known paleogeography, the Mediterranean region provides an ideal framework to study the colonization history of plant lineages. The genus Linaria has its diversity centre in the Mediterranean region, both in Europe and Africa. The last land connection between both continental plates occurred during the Messinian Salinity Crisis, in the late Miocene (5.96 to 5.33 Ma). Methodology/Principal Findings We analyzed the colonization history of Linaria sect. Versicolores (bifid toadflaxes), which includes c. 22 species distributed across the Mediterranean, including Europe and Africa. Two cpDNA regions (rpl32-trnLUAG and trnK-matK) were sequenced from 66 samples of Linaria. We conducted phylogenetic, dating, biogeographic and phylogeographic analyses to reconstruct colonization patterns in space and time. Four major clades were found: two of them exclusively contain Iberian samples, while the other two include northern African samples together with some European samples. The bifid toadflaxes have been split in African and European clades since the late Miocene, and most lineage and speciation differentiation occurred during the Pliocene and Quaternary. We have strongly inferred four events of post-Messinian colonization following long-distance dispersal from northern Africa to the Iberian Peninsula, Sicily and Greece. Conclusions/Significance The current distribution of Linaria sect. Versicolores lineages is explained by both ancient isolation between African and European populations and recent events of long-distance dispersal over sea barriers. This result provides new evidence for the biogeographic complexity of the Mediterranean region. PMID:21779399

  11. A Novel Contrast Stain for the Rapid Diagnosis of Pityriasis Versicolor: A Comparison of Chicago Sky Blue 6B Stain, Potassium Hydroxide Mount and Culture

    PubMed Central

    Lodha, Nikita; Poojary, Shital Amin

    2015-01-01

    Background: The mycological study of pityriasis versicolor is usually done by potassium hydroxide (KOH) mount and culture. However, KOH mount lacks a color contrast and requires a trained eye to interpret, while culture is difficult to perform, time consuming and has low sensitivity. Chicago Sky Blue 6B (CSB) is a new contrast stain that highlights the fungal hyphae and spores, blue against a purplish background. Aims and Objectives: This study was done to compare the utility of a novel contrast stain (CSB stain) with KOH mount and culture. Materials and Methods: Skin scrapings from the lesions of 100 clinically diagnosed cases of P. versicolor were subjected to (1) KOH mount and CSB stain for direct microscopic examination and (2) culture using Sabouraud's dextrose agar. The statistical analysis of CSB stain and culture was done using KOH mount as the reference method, as it is the most commonly performed and practical diagnostic test available for P. versicolor. An interrater reliability analysis using the Cohen's Kappa statistic was performed to determine consistency (agreement) among the different modalities. Observations and Results: Direct microscopy with CSB stain, KOH mount and mycological culture showed positive results in 98 (98%), 92 (92%) and 56 (56%) patients, respectively. Using KOH mount as the reference method, CSB stain had a sensitivity of 100% which was significantly higher than culture (60.9%). Statistically significant fair agreement was found between CSB stain and KOH mount (94% with ?=0.38, P < 0.001). Negligible agreement was found between CSB stain and culture (66%, ?=0.199, P = 0.001) as well as between KOH mount and culture (64%, ?=0.051, P = 0.107). Conclusion: CSB staining of skin scrapings is the most sensitive method for the diagnosis of pityriasis versicolor. Due to the distinct contrast provided by CSB, it is easy to perform, rapid and qualitatively superior to KOH mount. PMID:26288400

  12. Trametes versicolor Protein YZP Activates Regulatory B Lymphocytes – Gene Identification through De Novo Assembly and Function Analysis in a Murine Acute Colitis Model

    PubMed Central

    Kuan, Yen-Chou; Wu, Ying-Jou; Hung, Chih-Liang; Sheu, Fuu

    2013-01-01

    Background Trametes versicolor (Yun-Zhi) is a medicinal fungus used as a chemotherapy co-treatment to enhance anti-tumor immunity. Although the efficacies of T. versicolor extracts have been documented, the active ingredients and mechanisms underlying the actions of these extracts remain uncharacterized. Results We purified a new protein, YZP, from the fruiting bodies of T. versicolor and identified the gene encoding YZP using RNA-seq and de novo assembly technologies. YZP is a 12-kDa non-glycosylated protein comprising 139 amino acids, including an 18-amino acids signal peptide. YZP induced a greater than 60-fold increase in IL-10 secretion in mice B lymphocytes; moreover, YZP specifically triggered the differentiation of CD1d+ B cells into IL-10-producing regulatory B cells (Bregs) and enhanced the expression of CD1d. YZP-induced B cells suppressed approximately 40% of the LPS-activated macrophage production of inflammatory cytokines in a mixed leukocyte reaction and significantly alleviated the disease activity and colonic inflammation in a DSS-induced acute colitis murine model. Furthermore, YZP activated Breg function via interaction with TLR2 and TLR4 and up-regulation of the TLR-mediated signaling pathway. Conclusions We purified a novel Breg-stimulating protein, YZP, from T. versicolor and developed an advanced approach combining RNA-seq and de novo assembly technologies.to clone its gene. We demonstrated that YZP activated CD1d+ Breg differentiation through TLR2/4-mediated signaling pathway, and the YZP-stimulated B cells exhibited anti-inflammatory efficacies in vitro and in murine acute colitis models. PMID:24019869

  13. Activation of Dormant Secondary Metabolite Production by Introducing Neomycin Resistance into the Deep-Sea Fungus, Aspergillus versicolor ZBY-3

    PubMed Central

    Dong, Yuan; Cui, Cheng-Bin; Li, Chang-Wei; Hua, Wei; Wu, Chang-Jing; Zhu, Tian-Jiao; Gu, Qian-Qun

    2014-01-01

    A new ultrasound-mediated approach has been developed to introduce neomycin-resistance to activate silent pathways for secondary metabolite production in a bio-inactive, deep-sea fungus, Aspergillus versicolor ZBY-3. Upon treatment of the ZBY-3 spores with a high concentration of neomycin by proper ultrasound irradiation, a total of 30 mutants were obtained by single colony isolation. The acquired resistance of the mutants to neomycin was confirmed by a resistance test. In contrast to the ZBY-3 strain, the EtOAc extracts of 22 of the 30 mutants inhibited the human cancer K562 cells, indicating that these mutants acquired a capability to produce antitumor metabolites. HPLC-photodiode array detector (PDAD)-UV and HPLC-electron spray ionization (ESI)-MS analyses of the EtOAc extracts of seven bioactive mutants and the ZBY-3 strain indicated that diverse secondary metabolites have been newly produced in the mutant extracts in contrast to the ZBY-3 extract. The followed isolation and characterization demonstrated that six metabolites, cyclo(d-Pro-d-Phe) (1), cyclo(d-Tyr-d-Pro) (2), phenethyl 5-oxo-l-prolinate (3), cyclo(l-Ile-l-Pro) (4), cyclo(l-Leu-l-Pro) (5) and 3?,5?,9?-trihydroxy-(22E,24R)-ergosta-7,22-dien-6-one (6), were newly produced by the mutant u2n2h3-3 compared to the parent ZBY-3 strain. Compound 3 was a new compound; 2 was isolated from a natural source for the first time, and all of these compounds were also not yet found in the metabolites of other A. versicolor strains. Compounds 1–6 inhibited the K562 cells, with inhibition rates of 54.6% (1), 72.9% (2), 23.5% (3), 29.6% (4), 30.9% (5) and 51.1% (6) at 100 ?g/mL, and inhibited also other human cancer HL-60, BGC-823 and HeLa cells, to some extent. The present study demonstrated the effectiveness of the ultrasound-mediated approach to activate silent metabolite production in fungi by introducing acquired resistance to aminoglycosides and its potential for discovering new compounds from silent fungal metabolic pathways. This approach could be applied to elicit the metabolic potentials of other fungal isolates to discover new compounds from cryptic secondary metabolites. PMID:25076061

  14. Development and performance assessment of a qualitative SYBR® green real-time PCR assay for the detection of Aspergillus versicolor in indoor air.

    PubMed

    Libert, X; Chasseur, C; Bladt, S; Packeu, A; Bureau, F; Roosens, N H; De Keersmaecker, S C J

    2015-09-01

    Currently, contamination of indoor environment by fungi and molds is considered as a public health problem. The monitoring of indoor airborne fungal contamination is a common tool to help understanding the link between fungi in houses and respiratory problems. Classical analytical monitoring methods, based on cultivation and microscopic identification, depend on the growth of the fungi. Consequently, they are biased by difficulties to grow some species on certain culture media and under certain conditions or by noncultivable or dead fungi that can consequently not be identified. However, they could have an impact on human health as they might be allergenic. Since molecular methods do not require a culture step, they seem an excellent alternative for the monitoring of indoor fungal contaminations. As a case study, we developed a SYBR® green real-time PCR-based assay for the specific detection and identification of Aspergillus versicolor, which is frequently observed in indoor environment and known to be allergenic. The developed primers amplify a short region of the internal transcribed spacer 1 from the 18S ribosomal DNA complex. Subsequently, the performance of this quantitative polymerase chain reaction (qPCR) method was assessed using specific criteria, including an evaluation of the selectivity, PCR efficiency, dynamic range, and repeatability. The limit of detection was determined to be 1 or 2 copies of genomic DNA of A. versicolor. In order to demonstrate that this SYBR® green qPCR assay is a valuable alternative for monitoring indoor fungal contamination with A. versicolor, environmental samples collected in contaminated houses were analyzed and the results were compared to the ones obtained with the traditional methods. PMID:26184975

  15. Co-composting of spent coffee ground with olive mill wastewater sludge and poultry manure and effect of Trametes versicolor inoculation on the compost maturity.

    PubMed

    Hachicha, Ridha; Rekik, Olfa; Hachicha, Salma; Ferchichi, Mounir; Woodward, Steve; Moncef, Nasri; Cegarra, Juan; Mechichi, Tahar

    2012-07-01

    The co-composting of spent coffee grounds, olive mill wastewater sludge and poultry manure was investigated on a semi-industrial scale. In order to reduce the toxicity of the phenolic fraction and to improve the degree of composting humification, composts were inoculated with the white-rot fungus Trametes versicolor in the early stages of the maturation phase. During composting, a range of physico-chemical parameters (temperature and both organic matter and C/N reduction), total organic carbon, total nitrogen, elemental composition, lignin degradation and spectroscopic characteristics of the humic acids (HAs) were determined; impacts of the composting process on germination index of Hordeum vulgare and Lactuca sativa were assessed. The coffee waste proved to be a highly compostable feedstock, resulting in mature final compost with a germination index of 120% in less than 5 months composting. In addition, inoculation with T. versicolor led to a greater degree of aromatization of HA than in the control pile. Moreover, in the inoculated mixture, lignin degradation was three times greater and HA increased by 30% (P<0.05), compared to the control pile. In the T. versicolor inoculated mixture, the averages of C and N were significantly enhanced in the HA molecules (P<0.05), by 26% and 22%, respectively. This improvement in the degree of humification was confirmed by the ratio of optical densities of HA solutions at 465 and 665 nm which was lower for HA from the treated mixture (4.5) than that from the control pile (5.4). PMID:22537889

  16. Pityriasis versicolor: clinical-epidemiological characterization of patients in the urban area of Buerarema-BA, Brazil*

    PubMed Central

    Santana, Juliano Oliveira; de Azevedo, Fernanda Luiza Andrade; Campos, Pedro Costa

    2013-01-01

    BACKGROUND: Pityriasis versicolor (PV) is a cutaneous pigmentation disorder caused by a lipophilic yeast of the genus Malassezia sp. It is a superficial mycosis characterized by well-defined, slightly scaly skin lesions of variable color. In Brazil, the number of reported cases is small, and there are few epidemiological studies. OBJECTIVES: to assess incidence, characteristics of the lesions, effectiveness of the Zileri's Sign procedure, and the epidemiological profile of PV in the urban area of Buerarema - Bahia. METHODS: Biological samples were collected on pre-established days at Basic Health Care Units from July to September 2010. Sample collection was followed by laboratory diagnosis using Porto's Method. RESULTS: Of the 158 patients with suspected PV participating in the study, 105 (66.5%) were positive; 72 (68.6%) were female and 33 (31.4%) were male. Sex and location of lesions showed statistically significant differences (p<0.05). The region with the highest rate of cases of PV was found to be the center of the city, with 40.9% of diagnosed cases. The most affected age group was between 10 and 19 years. There was a significant association between the results produced through Zileri's Sign and Porto's Method in relation to positive and negative results (p<0.05). CONCLUSIONS: The results showed a higher prevalence of PV among individuals at puberty. The Zileri's Sign method proved to be counterproductive, because it showed low efficacy as a method for clinical diagnosis, yielding negative results for 36 (34.3%) patients who had been diagnosed with PV through laboratory examination. PMID:23739695

  17. A PCR method for the detection and differentiation of Lentinus edodes and Trametes versicolor in defined-mixed cultures used for wastewater treatment.

    PubMed

    García-Mena, Jaime; Cano-Ramirez, Claudia; Garibay-Orijel, Claudio; Ramirez-Canseco, Sergio; Poggi-Varaldo, Héctor M

    2005-06-01

    A PCR-based method for the quantitative detection of Lentinus edodes and Trametes versicolor, two ligninolytic fungi applied for wastewater treatment and bioremediation, was developed. Genomic DNA was used to optimize a PCR method targeting the conserved copper-binding sequence of laccase genes. The method allowed the quantitative detection and differentiation of these fungi in single and defined-mixed cultures after fractionation of the PCR products by electrophoresis in agarose gels. Amplified products of about 150 bp for L. edodes, and about 200 bp for T. versicolor were purified and cloned. The PCR method showed a linear detection response in the 1.0 microg-1 ng range. The same method was tested with genomic DNA from a third fungus (Phanerochaete chrysosporium), yielding a fragment of about 400 bp. Southern-blot and DNA sequence analysis indicated that a specific PCR product was amplified from each genome, and that these corresponded to sequences of laccase genes. This PCR protocol permits the detection and differentiation of three ligninolytic fungi by amplifying DNA fragments of different sizes using a single pair of primers, without further enzymatic restriction of the PCR products. This method has potential use in the monitoring, evaluation, and improvement of fungal cultures used in wastewater treatment processes. PMID:15586279

  18. Flocculation and haze removal from crude beer using in-house produced laccase from Trametes versicolor cultured on brewer's spent grain.

    PubMed

    Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur; Verma, Mausam

    2012-08-15

    The potential of brewer's spent grain (BSG), a common waste from the brewing industry, as a support-substrate for laccase production by the well-known laccase producer Trametes versicolor ATCC 20869 under solid-state fermentation conditions was assessed. An attempt was made to improve the laccase production by T. versicolor through supplementing the cultures with inducers, such as 2,2-azino bis(3-ethylbenzthiazoline-6-sulfonic acid), copper sulfate, ethanol, gallic acid, veratryl alcohol, and phenol. A higher laccase activity of 13506.2 ± 138.2 IU/gds (gram dry substrate) was obtained with a phenol concentration of 10 mg/kg substrate in a tray bioreactor after 12 days of incubation time. The flocculation properties of the laccase treated crude beer samples have been studied by using various parameters, such as viscosity, turbidity, ? potential, total polyphenols, and total protein content. The present results indicated that laccase (25 IU/L) showed promising results as a good flocculating agent. The laccase treatment showed better flocculation capacity compared to the industrial flocculation process using stabifix as a flocculant. The laccase treatments (25 IU/L) at 4 ± 1 °C and room temperature have shown almost similar flocculation properties without much variability. The study demonstrated the potential of in-house produced laccase using brewer's spent grain for the clarification and flocculation of crude beer as a sustainable alternative to traditional flocculants, such as stabifix and bentonite. PMID:22866699

  19. Mycochemical Investigation of the Turkey Tail Medicinal Mushroom Trametes versicolor (Higher Basidiomycetes): A Potential Application of the Isolated Compounds in Documented Pharmacological Studies.

    PubMed

    Habibi, Emran; Sadat-Ebrahimi, Seyed Esmaeel; Mousazadeh, Saeed Ali; Amanzadeh, Yaghoub

    2015-01-01

    The purpose of this study was to elucidate the chemical properties of the n-hexane, chloroform, and ethyl acetate extracts of the fruiting body of the medicinal mushroom Trametes versicolor. The study led to the isolation of 5 sterols, 2 triterpene derivatives, 1 hydroquinone-derived aromatic compound, and, finally, 1 cerebroside and 1 triglyceride derivative. These compounds were identified for first time in T. versicolor and were named as follows: 4-isobutoxyphenyl palmitate (5), N-D-2'-hydroxyheptanoic-1-O-?-D-glucopyranosyl-9-methyl-4,8-sphinga-dienine(cerebroside) (6), 3?-linoleyloxyergosta-7,22-diene (7), 3?-linoleyloxyergosta-7-ene (8), and betulinic acid (9). Other compounds elucidated in our study were ergosterol (1), ergosterol peroxide (2), trilinolein (3), ergosta-7, 22-dien-3?-ol (4), and betuline (10). These compounds were obtained via column or thin-layer chromatography before being identified by nuclear magnetic resonance spectroscopic analyses and infrared data. In addition, the beneficial pharmacological effects of the compounds are described here. PMID:25954909

  20. High-quality permanent draft genome sequence of Bradyrhizobium sp. Tv2a.2, a microsymbiont of Tachigali versicolor discovered in Barro Colorado Island of Panama.

    PubMed

    Tian, Rui; Parker, Matthew; Seshadri, Rekha; Reddy, Tbk; Markowitz, Victor; Ivanova, Natalia; Pati, Amrita; Woyke, Tanja; Baeshen, Mohammed N; Baeshen, Nabih A; Kyrpides, Nikos; Reeve, Wayne

    2015-01-01

    Bradyrhizobiumsp. Tv2a.2 is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing root nodule of Tachigali versicolor collected in Barro Colorado Island of Panama. Here we describe the features of Bradyrhizobiumsp. Tv2a.2, together with high-quality permanent draft genome sequence information and annotation. The 8,496,279 bp high-quality draft genome is arranged in 87 scaffolds of 87 contigs, contains 8,109 protein-coding genes and 72 RNA-only encoding genes. This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) project. PMID:26203338

  1. Correlation between mesopore volume of carbon supports and the immobilization of laccase from Trametes versicolor for the decolorization of Acid Orange 7.

    PubMed

    Ramírez-Montoya, Luis A; Hernández-Montoya, Virginia; Montes-Morán, Miguel A; Cervantes, Francisco J

    2015-10-01

    Immobilization of laccase from Trametes versicolor was carried out using carbon supports prepared from different lignocellulosic wastes. Enzymes were immobilized by physical adsorption. Taguchi methodology was selected for the design of experiments regarding the preparation of the carbon materials, which included the use of activating agents for the promotion of mesoporosity. A good correlation between the mesopore volumes of the carbon supports and the corresponding laccase loadings attained was observed. Specifically, the chemical activation of pecan nut shell with FeCl3 led to a highly mesoporous material that also behaved as the most efficient support for the immobilization of laccase. This particular laccase/carbon support system was used as biocatalyst for the decolorization of aqueous solutions containing Acid Orange 7. Mass spectrometry coupled to a liquid chromatograph allowed us to identify the products of the dye degradation. PMID:26241936

  2. Cell growth and gene modulatory activities of Yunzhi (Windsor Wunxi) from mushroom Trametes versicolor in androgen-dependent and androgen-insensitive human prostate cancer cells.

    PubMed

    Hsieh, T C; Wu, J M

    2001-01-01

    The incidence of prostate cancer varies greatly throughout the world; it is highest in African-Americans and lowest in the Asian populations of China, India, and Japan. Geographical differences in both prevalence of latent prostate cancer and mortality have been postulated to be influenced by diverse tumor-promoting and protective factors, both environmental and dietary. Prostate cancer is a tumor with an extremely long latency; the pattern of prostate tumorigenesis, in terms of the display and sequence of appearance of particular molecular or biochemical features, or morphological changes, characterizing different stages of the carcinogenic process, is expected to be heterogeneous. Some insights into tumor heterogeneity and progression can be obtained from studies using cell lines, particularly those derived from different anatomical sites. The present study aims to investigate whether hormone-responsive LNCaP and androgen-refractory JCA-1, PC-3, and DU-145 prostate cancer cells are responsive to Yunzhi (YZ), a proprietary dietary supplement prepared from extracts of Trametes versicolor, also known as Coriolus versicolor (a mushroom consumed by Chinese for its purported health benefits), and to elucidate its mechanism of action. Ethanolic extracts (70%) of YZ significantly reduced LNCaP cell growth, down-regulated the levels of secreted PSA, but had less effects on the expression of intracellular PSA and did not affect levels of the androgen receptor. In androgen-unresponsive prostate cancer cells, YZ had a much less pronounced suppressive effect on proliferation of PC-3 and DU-145 cells, compared to LNCaP, and was inactive against JCA-1 cells. Western blot analyses show that the expression of Rb, a key regulatory protein in G1/S transition, and PCNA, integrally involved in mammalian cell DNA replication, were significantly reduced by treatment with YZ in PC-3 and DU-145 cells, respectively. In contradiction, none of these biochemical parameters were affected in JCA-1 cells under identical treatment conditions. Further analysis shows that YZ increased the levels of signal transducer and activator family of transcription factors STAT 1 and STAT 3 in JCA-1 and not LNCaP cells. The greater sensitivity of LNCaP cells to this polysaccharopeptide raises the possibility that YZ may be considered as an adjuvant therapy in the treatment of hormone responsive prostate cancer; additionally, it may have chemopreventive potential to restrict prostate tumorigenic progression from the hormone-dependent to the hormone-refractory state. PMID:11115542

  3. A Ca-alginate particle co-immobilized with Phanerochaete chrysosporium cells and the combined cross-linked enzyme aggregates from Trametes versicolor.

    PubMed

    Li, Yanchun; Wang, Zhi; Xu, Xudong; Jin, Liqiang

    2015-12-01

    For improving stability of immobilized white-rot fungus to treat various effluents, Phanerochaete chrysosporium cells and the combined cross-link enzyme aggregates (combi-CLEAs) prepared from Trametes versicolor were co-immobilized into the Ca-alginate gel particles in this paper. The activity yields of obtained combi-CLEAs were 42.7% for lignin peroxidases (LiPs), 31.4% for manganese peroxidases (MnPs) and 40.4% for laccase (Lac), respectively. And their specific activities were 30.2U/g as combi-CLEAs-LiPs, 9.5U/g as combi-CLEAs-MnPs and 28.4U/g as combi-CLEAs-Lac. Further, the present of the combi-CLEAs in the particles extremely improved their ability to degrade the dyes. Compared to the immobilized Ph. chrysosporium without the combi-CLEAs, the co-immobilized particles enhanced the decolorized rate of Acid Violet 7 (from 45.2% to 93.4%) and Basic Fuchsin (from 12.1% to 67.9%). In addition, the addition of the combi-CLEAs improved the adaptability of the white-rot fungal particles to adverse environmental conditions. PMID:26413897

  4. Efficient biotransformation of ginsenoside Rb1 to Rd by isolated Aspergillus versicolor, excreting ?-glucosidase in the spore production phase of solid culture.

    PubMed

    Lin, Fujian; Guo, Xiaoyan; Lu, Wenyu

    2015-11-01

    Ginsenosides are the major pharmacological components in ginseng. Microorganisms from a ginseng field were isolated to identify transformation of ginsenosides. Based on HPLC and LC-MS analysis, strain LFJ1403 showed strong activities to transform ginsenoside Rb1 to Rd as the sole product. Phylogenetic analysis of 18S rDNA indicated that LFJ1403 belonged to Aspergillus versicolor. Through comparing four systems of transforming Rb1 to Rd, strain LFJ1403 was found to secrete ginsenoside-converting enzymes in the spore production phase of plate culture. This result suggested that the enzyme could be directly obtained from the plate. The spore suspension, which contained the exocrine enzyme, was easy to prepare and efficient for biotransformation of ginsenoside Rb1 to Rd. Further study showed that the maximum bioconversion rate was 96 % (w/w) in shake flasks when a spore suspension system was used with optimized biotransformation conditions. Scale-up of this system to 2L resulted in an 85 % conversion rate. The ginsenoside Rb1 converting enzyme was separated by gradient HPLC with Q-Sepharose column, and its ?-glucosidase activity and Rb1-converting ability was assayed by the 4-Nitrophenyl-?-D-glucopyranoside (PNPG) method and HPLC with C18 column, respectively. We obtained 130 U ml(-1) enzymatic activity with the purified ?-glucosidase. This is the first report on efficiently converting ginsenoside using extracellular enzyme directly from the fungus spore production phase of solid culture. PMID:26373416

  5. 28-day oral safety evaluation of extracellular polysaccharopeptides produced in submerged culture from the turkey tail medicinal mushroom Trametes versicolor (L.:Fr.) Pilát LH-1 in mice.

    PubMed

    Lai, Chun-Hong; Teng, Ju-Fang; Hsu, Tai-Hao; Lin, Fang-Yi; Yang, Po-Wen; Lo, Hui-chen

    2011-01-01

    Turkey tail medicinal mushroom, Trametes versicolor (TV), is a species with a variety of pharmacological activities. Its intracellular polysaccharopeptides are widely commercialized. Recently, we found a novel TV strain LH-1 in Taiwan and demonstrated that the extracellular polysaccharopeptide (ePSP) of LH-1 obtained from submerged culture exhibits significant immunomodulatory activity. In this in vivo study, we further evaluated the safety of orally administered LH-1 ePSP using both male and female ICR mice. The LH-1 ePSP was orally administered to mice at levels of 0 (water), 100 (low dose), 500 (medium dose), or 1000 mg/kg/day (high dose) for 28 days. Clinical observations, growth, food consumption, histopathological examination, and clinical biochemical analyses revealed no adverse effects of LH-1 ePSP in mice. There were no significant differences in the results of target organ weights, hematological analyses, and urinalysis examination among groups. However, male mice that ingested high doses of LH-1 ePSP tended to have decreased lung weights and platelet numbers. In conclusion, the results of the present study suggested that oral administration of LH-1 ePSP for 28 days is accompanied by no obvious signs of toxicity. The lack of toxicity supports the potential use of LH-1 ePSP as a food or dietary supplement. PMID:22135874

  6. Microbiological transformation of L-tyrosine to L-dopa from methanol pretreated biomass of a novel Coriolus versicolor under submerged culture.

    PubMed

    Ali, Sikander; Rizvi, Nazia

    2014-02-01

    The present study is concerned with the microbiological transformation of L-tyrosine to L-dopa by a newly isolated turkey tail mushroom Coriolus versicolor DOB-4. As tyrosinase (catechol oxidase, EC 1.10.3.1) is an extracellular enzyme, therefore biomass was used as an enzyme source in the reaction mixture. Biomass particles were pretreated with methanol and oven dried at 105 °C for 2 h. The optimal L-dopa production was achieved when 1.5 mg/ml L-tyrosine was used as the basal substrate. Thin layer chromatography and high-performance liquid chromatography analysis depicted that citric acid supports higher substrate conversion and product formation rates. A noticeable enhancement was observed when process parameters viz. L-tyrosine concentration (1.5 mg/ml), citric acid (1.5 mg/ml), time of incubation (50 min), and reaction temperature (60 °C) were optimized using Plackett-Burman design. The maximum production of L-dopa was found to be 0.872 mg/ml with L-tyrosine consumption of 1.002 mg/ml. The model terms were found highly significant (HS, p ? 0.05), suggesting the potential commercial utility of the culture (df = 3, LSD = 0.342). PMID:24326681

  7. In vivo and in vitro anti-tumor and anti-metastasis effects of Coriolus versicolor aqueous extract on mouse mammary 4T1 carcinoma.

    PubMed

    Luo, Ke-Wang; Yue, Grace Gar-Lee; Ko, Chun-Hay; Lee, Julia Kin-Ming; Gao, Si; Li, Long-Fei; Li, Gang; Fung, Kwok-Pui; Leung, Ping-Chung; Lau, Clara Bik-San

    2014-01-01

    Coriolus versicolor (CV), a medicinal mushroom widely consumed in Asian countries, has been demonstrated to be effective in stimulation of immune system and inhibition of tumor growth. The present study aimed to investigate the anti-tumor and anti-metastasis effects of CV aqueous extract in mouse mammary carcinoma 4T1 cells and in 4T1-tumor bearing mouse model. Our results showed that CV aqueous extract (0.125-2 mg/ml) did not inhibit 4T1 cell proliferation while the non-cytotoxic dose of CV extract (1-2 mg/ml) significantly inhibited cell migration and invasion (p<0.05). Besides, the enzyme activities and protein levels of MMP-9 were suppressed by CV extract significantly. Animal studies showed that CV aqueous extract (1 g/kg, orally-fed daily for 4 weeks) was effective in decreasing the tumor weight by 36%, and decreased the lung metastasis by 70.8% against untreated control. Besides, micro-CT analysis of the tumor-bearing mice tibias indicated that CV extract was effective in bone protection against breast cancer-induced bone destruction as the bone volume was significantly increased. On the other hand, CV aqueous extract treatments resulted in remarkable immunomodulatory effects, which was reflected by the augmentation of IL-2, 6, 12, TNF-? and IFN-? productions from the spleen lymphocytes of CV-treated tumor-bearing mice. In conclusion, our results demonstrated for the first time that the CV aqueous extract exhibited anti-tumor, anti-metastasis and immunomodulation effects in metastatic breast cancer mouse model, and could protect the bone from breast cancer-induced bone destruction. These findings provided scientific evidences for the clinical application of CV aqueous extract in breast cancer patients. PMID:24856767

  8. DNA Damage and DNA Damage Responses in THP-1 Monocytes after Exposure to Spores of either Stachybotrys chartarum or Aspergillus versicolor or to T-2 toxin

    PubMed Central

    Rakkestad, Kirsten E.; Skaar, Ida; Ansteinsson, Vibeke E.; Solhaug, Anita; Holme, Jørn A.; Pestka, James J.; Samuelsen, Jan T.; Dahlman, Hans J.; Hongslo, Jan K.; Becher, Rune

    2010-01-01

    We have characterized cell death in THP-1 cells after exposure to heat-treated spores from satratoxin G–producing Stachybotrys chartarum isolate IBT 9631, atranone-producing S. chartarum isolate IBT 9634, and sterigmatocystin-producing Aspergillus versicolor isolate IBT 3781, as well as the trichothecenes T-2 and satratoxin G. Spores induced cell death within 3–6 h, with Stachybotrys appearing most potent. IBT 9631 induced both apoptosis and necrosis, while IBT 9634 and IBT 3781 induced mostly necrosis. T-2 toxin and satratoxin G caused mainly apoptosis. Comet assay ± formamidopyrimidine DNA glycosylase showed that only the spore exposures induced early (3h) oxidative DNA damage. Likewise, only the spores increased the formation of reactive oxygen species (ROS), suggesting that spores as particles may induce ROS formation and oxidative DNA damage. Increased Ataxia Telangiectasia Mutated (ATM) phosphorylation, indicating DNA damage, was observed after all exposures. The DNA damage response induced by IBT 9631 as well as satratoxin G was characterized by rapid (15 min) activation of p38 and H2AX. The p38 inhibitor SB 202190 reduced IBT 9631–induced H2AX activation. Both IBT 9631 and T-2 induced activation of Chk2 and H2AX after 3 h. The ATM inhibitor KU 55933, as well as transfection of cells with ATM siRNA, reduced this activation, suggesting a partial role for ATM as upstream activator for Chk2 and H2AX. In conclusion, activation of Chk2 and H2AX correlated with spore- and toxin-induced apoptosis. For IBT 9631 and satratoxin G, additional factors may be involved in triggering apoptosis, most notably p38 activation. PMID:20150440

  9. DNA damage and DNA damage responses in THP-1 monocytes after exposure to spores of either Stachybotrys chartarum or Aspergillus versicolor or to T-2 toxin.

    PubMed

    Rakkestad, Kirsten E; Skaar, Ida; Ansteinsson, Vibeke E; Solhaug, Anita; Holme, Jørn A; Pestka, James J; Samuelsen, Jan T; Dahlman, Hans J; Hongslo, Jan K; Becher, Rune

    2010-05-01

    We have characterized cell death in THP-1 cells after exposure to heat-treated spores from satratoxin G-producing Stachybotrys chartarum isolate IBT 9631, atranone-producing S. chartarum isolate IBT 9634, and sterigmatocystin-producing Aspergillus versicolor isolate IBT 3781, as well as the trichothecenes T-2 and satratoxin G. Spores induced cell death within 3-6 h, with Stachybotrys appearing most potent. IBT 9631 induced both apoptosis and necrosis, while IBT 9634 and IBT 3781 induced mostly necrosis. T-2 toxin and satratoxin G caused mainly apoptosis. Comet assay +/- formamidopyrimidine DNA glycosylase showed that only the spore exposures induced early (3h) oxidative DNA damage. Likewise, only the spores increased the formation of reactive oxygen species (ROS), suggesting that spores as particles may induce ROS formation and oxidative DNA damage. Increased Ataxia Telangiectasia Mutated (ATM) phosphorylation, indicating DNA damage, was observed after all exposures. The DNA damage response induced by IBT 9631 as well as satratoxin G was characterized by rapid (15 min) activation of p38 and H2AX. The p38 inhibitor SB 202190 reduced IBT 9631-induced H2AX activation. Both IBT 9631 and T-2 induced activation of Chk2 and H2AX after 3 h. The ATM inhibitor KU 55933, as well as transfection of cells with ATM siRNA, reduced this activation, suggesting a partial role for ATM as upstream activator for Chk2 and H2AX. In conclusion, activation of Chk2 and H2AX correlated with spore- and toxin-induced apoptosis. For IBT 9631 and satratoxin G, additional factors may be involved in triggering apoptosis, most notably p38 activation. PMID:20150440

  10. Regulation of cell cycle transition and induction of apoptosis in HL-60 leukemia cells by the combination of Coriolus versicolor and Ganoderma lucidum.

    PubMed

    Hsieh, Tze-Chen; Wu, Joseph M

    2013-07-01

    Medicinal mushrooms have served as the mainstay of treatment for a variety of human illnesses in Asian countries, mostly as supplements by cancer patients. Extracts prepared from Trametes versicolor under the trade name of I'm-Yunity exhibit anti-tumorigenic activities, as supported by inhibition of the proliferation and induction of apoptosis in malignant cells. Similar effects have also been observed for the Reishi mushroom Ganoderma lucidum. The two mushrooms exert their medicinal activities primarily through a family of polysaccharo-peptides. Despite the common identity in their bioactive ingredients, whether their combination might elicit an expanded efficacy and mechanism has not been investigated. In the present study, we investigated similarities and differences between extracts prepared from I'm-Yunity and from a formulation denoted I'm-Yunity-Too combining I'm-Yunity and Ganoderma lucidum. By assaying their anti-proliferative and anti-apoptotic effects using human promyelocytic HL-60 cells, we found that the ethanolic extract of I'm-Yunity-Too was more active in inducing cell death compared to I'm-Yunity, based on measured changes in the expression of caspase 3 and Bax. Moreover, ethanolic extracts of I'm-Yunity-Too exhibited more potent activity compared to its aqueous extracts with regard to suppression of the growth and induction of apoptosis, as assayed by the more pronounced downregulation of phosphorylation of Rb and increased cleavage of poly(ADP?ribose) polymerase (PARP) from its native 112-kDa form to the inactive 89-kDa product. These results suggested that the chemopreventive potential of I'm-Yunity may be enhanced by adding Ganoderma lucidum and that their bioactive ingre-dients potentially exhibit mechanistic synergism suggesting a more efficacious adjunct in chemotherapy. PMID:23670292

  11. Mediator-assisted rhodamine B decolorization by Tramates versicolor laccase.

    PubMed

    Khammuang, S; Sarnthima, R

    2009-04-15

    This study reported the decolorization of hazardous xanthenes dye, Rhodamine B by the Laccase Mediator System (LMS). Seven redox mediators were investigated in the mediators-assisted lacase catalyze oxidation reactions. Among redox mediators tested, 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) was the best one which gave the highest Rhodamine B decolorization for more than 80% within 48 h while only 20% achieved with no mediator added. In the laccase-ABTS mediator system, the best molar ratio of dye/mediator was 1:10 and dye/enzyme ratio was 0.5 micromol U(-1). The optimum conditions for Rhodamine B decolorization were at pH 4.0-5.0 and temperature 35-40 degrees C. The laccase-ABTS system could be a promising biotechnology developed for treatment of textile waste waters containing Rhodamine B. PMID:19634486

  12. Development of recombinant biocatalysts expressing laccase enzyme from Trametes versicolor

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Increasing demands for sustainable energy necessitate the use of biorenewable sources such as agricultural and forestry wastes. A major challenge of using lignocellulosic biomass for biofuel production is the recalcitrant nature of the lignin structure. Laccase is a multi-copper oxidase that catal...

  13. Influence of the immobilization procedures on the electroanalytical performances of Trametes versicolor laccase based bioelectrode

    E-print Network

    Tuscia, Università Degli Studi Della

    to its good permeability to mediators and the ability to keep the enzyme bioelectrochemical properties plants [4], and in some bacteria [5]. Laccase is a polyphenol oxidase catalyzing the oxidation of several of biosensors [12,13] or biofuel cells [14,15]. In the case of laccase-based biosensor the enzymatic

  14. Potential of acetylacetone as a mediator for Trametes versicolor laccase in enzymatic transformation of organic pollutants.

    PubMed

    Yang, Hua; Sun, Hongfei; Zhang, Shujuan; Wu, Bingdang; Pan, Bingcai

    2015-07-01

    Low-cost and environmentally friendly mediators could facilitate the application of laccase (EC 1.10.3.2) in variant biotechnological processes. Acetylacetone (AA) represents an inexpensive and low toxic small molecular diketone that has been proven as an effective mediator for laccase in free radical polymerization. However, the potential of AA as a mediator for laccase in pollutant detoxification and/or degradation is still unknown. In this work, the roles of AA in laccase-induced polymerization and transformation were investigated. AA was demonstrated to be a highly efficient mediator in the laccase-induced grafting copolymerization of acrylamide and chitosan. The efficacy of AA in the laccase-induced decoloration of malachite green (MG) was compared with that of the widely used 1-hydroxybenzotriazole (HBT). The laccase-AA system had the highest turnover number (TON, 39.1 ?mol/U), followed by the laccase-only system (28.5 ?mol/U), while the TON of the laccase-HBT system was the lowest (14.9 ?mol/U). The pseudo-first-order transformation rate constant (k 1) of MG in the laccase-AA system was up to 0.283 h(-1) under the given conditions, while the k 1 of AA caused by laccase was only 0.008 h(-1). In the five-cycle run, the concentration of AA remained stable. The larger TON of the laccase-AA system and the stability of AA in the cycling runs demonstrate that AA was more recyclable than HBT in the LMS, leading to a prolonged serving life of laccase. These results suggest that AA might be a potential redox mediator for laccase. PMID:25772881

  15. Synthesis and effect of modification on methacylate - acrylate microspheres for Trametes versicolor laccase enzyme immobilization

    NASA Astrophysics Data System (ADS)

    Mazlan, Siti Zulaikha; Hanifah, Sharina Abu

    2014-09-01

    Immobilization of laccase on the modified copolymer methacrylate-acrylate microspheres was studied. A poly (glycidyl methacrylate-co-n-butyl acrylate) microsphere consists of epoxy groups were synthesized using suspension photocuring technique. The epoxy group in poly (GMA-nBA) microspheres were converted into amino groups with aldehyde group. Laccase immobilization is based on having the amino groups on the enzyme surface and aldehyde group on the microspheres via covalent binding. Fourier transform infrared spectroscopy (FT-IR) analysis proved the successful surface modification on microspheres. The FTIR spectrum shows the characteristic peaks at 1646 cm-1 assigned to the conformation of the polymerization that took place between monomer GMA and nBA respectively. In addition, after modification, FTIR peaks that assigned to the epoxy ring (844 cm-1 and 904 cm-1) were decreased. The results obtained from FTIR method signify good agreement with the epoxy content method. Hence, the activity of the laccase-immobilized microspheres increased upon increasing the epoxy content. Furthermore, poly (GMA-nBA) exhibited uniform microspheres with below 2 ?m surface. Immobilized enzyme showed a broader pH profile and higher temperature compared native enzyme.

  16. Plan de estudios de nivel secundario para adultos (Study Plan for Adult Secondary Education).

    ERIC Educational Resources Information Center

    Boletin del Centro Nacional de Documentacion e Informacion Educativa, Parte II: Informaciones, 1970

    1970-01-01

    This document describes an experimental, multinational plan for adult secondary education sponsored through the Organization of American States and the Argentine Ministry of Culture and Education. General and specific goals of the program are listed here along with details of the proposed curriculum and areas of study, entrance requirements,…

  17. Biomarker Analysis of American Toad (Anaxyrus Americanus) and Grey Tree Frog (Hyla Versicolor) Tadpoles Following Exposure to Atrazine

    EPA Science Inventory

    To better understand the mode of action of atrazine in amphibians, we utilized mass spectrometry-based metabolomics to investigate the biochemical changes in two species of larval amphibians exposed to atrazine. Our objectives were to 1) Use changes in endogenous metabolites to f...

  18. Degradation of pharmaceuticals in non-sterile urban wastewater by Trametes versicolor in a fluidized bed bioreactor.

    PubMed

    Cruz-Morató, Carles; Ferrando-Climent, Laura; Rodriguez-Mozaz, Sara; Barceló, Damià; Marco-Urrea, Ernest; Vicent, Teresa; Sarrà, Montserrat

    2013-09-15

    The constant detection of pharmaceuticals (PhACs) in the environment demonstrates the inefficiency of conventional wastewater treatment plants to completely remove them from wastewaters. So far, many studies have shown the feasibility of using white rot fungi to remove these contaminants. However, none of them have studied the degradation of several PhACs in real urban wastewater under non-sterile conditions, where mixtures of contaminants presents at low concentrations (ng L(-1) to ?g L(-1)) as well as other active microorganisms are present. In this work, a batch fluidized bed bioreactor was used to study, for the first time, the degradation of PhACs present in urban wastewaters at their pre-existent concentrations under non-sterile conditions. Glucose and ammonium tartrate were continuously supplied as carbon and nitrogen source, respectively, and pH was maintained at 4.5. Complete removal of 7 out of the 10 initially detected PhACs was achieved in non-sterile treatment, while only 2 were partially removed and 1 of the PhACs analyzed increased its concentration. In addition, Microtox test showed an important reduction of toxicity in the wastewater after the treatment. PMID:23866144

  19. ENVIRONMENTAL BIODEGRADABILITY OF [14C] SINGLE-WALLED CARBON NANOTUBESBY TRAMETES VERSICOLOR AND NATURAL MICROBIAL CULTURES FOUND IN NEWBEDFORD HARBOR SEDIMENT AND AERATED WASTEWATER TREATMENT PLANT SLUDGE

    EPA Science Inventory

    Little is known about environmental biodegradability or biotransformations of single-walled carbon nanotubes (SWNT). Because of their strong association with aquatic organic matter, detailed knowledge of the ultimate fate and persistence of SWNT requires investigation of possible...

  20. Role for toll-like receptor 4 in TNF-alpha secretion by murine macrophages in response to polysaccharide Krestin, a Trametes versicolor mushroom extract.

    PubMed

    Price, Lisa A; Wenner, Cynthia A; Sloper, Daniel T; Slaton, Joel W; Novack, Jeffrey P

    2010-10-01

    Woody fungi and yeast preparations show promise in cancer treatment by activating anti-tumor immune responses. Macrophages (J774A.1) were treated with PSK, Reishi extract, scleroglucan or vehicle control. Pre-incubation with TLR4 blocking antibody inhibited TNF-alpha secretion by both J774A.1 cells and primary splenocytes but had inconclusive effect on scleroglucan-induced secretion of TNF-alpha. PSK induced TNF-alpha and IL-6 secretion by wild type but not by TLR4-deficient peritoneal macrophages. We conclude that constituents from PSK act as ligands for TLR4 receptors leading to induction of TNF-alpha and IL-6 inflammatory cytokines. Receptor-mediated differences may be due to structural differences in beta glucans or non-glucan constituents. PMID:20550956

  1. Skin color - patchy

    MedlinePLUS

    ... medication reactions or certain drugs Sunburn or suntan Tinea versicolor Unevenly applying sunscreen, leading to areas of ... ketoconazole, or tolnaftate (Tinactin) lotion can help treat tinea versicolor. Apply as directed to the affected area ...

  2. Approved by the UHS Patient Education Committee Page 1 of 1 Reviewed 3/11/12

    E-print Network

    Maroncelli, Mark

    Causes Tinea Versicolor? Tinea versicolor is a harmless skin disorder caused by a yeast fungus living clear the yeast fungus, we do not have a permanent cure. Although the infection is gone, the return

  3. Insertion of Astronomy as a High School Subject. (Spanish Title: Inserción de Astronomia Como Materia del Ciclo Secundario.) Inserção da Astronomia Como Disciplina Curricular do Ensino Médio

    NASA Astrophysics Data System (ADS)

    Dias, Claudio André C. M.; Santa Rita, Josué R.

    2008-12-01

    Astronomy is considered among the first sciences that man dominated, however, the basic skills for the construction of knowledge, relatively to the contents "Earth and the Universe" are not being developed properly for the majority of students concluding the high school level. The students are concluding this teaching cycle without proper knowledge of several subjects in the area of Astronomy, which are mandatory in the national Curricular National Parameters (PCN). Because of this discrepancy, this work stresses the need of the incorporation of a specific subject of Astronomy in the high school, in order to reduce the gap between what is taught and which should be taught. La Astronomía es considerada una de las primeras ciencias que el hombre dominó. Sin embargo, las habilidades básicas para la construcción del conocimento, relativo al eje temático "Tierra y Universo", no vienen siendo trabajadas adecuadamente con la mayoría de los alumnos que concluyen el ciclo escolar medio. Los alumnos están concluyendo este nivel de enseñanza sin conocimentos de varios temas en el área de Astronomía, que son obligatorios según los Parámetros Curriculares Nacionales (PCN). En virtud de esta discrepancia, este trabajo enfatiza la necesidad de incorporar una disciplina específica de Astronomía em el ciclo medio, em pro de la reducción de las distorsiones entre lo que es enseñado y lo que se debe enseñar. A Astronomia é considerada uma das primeiras ciências que o homem dominou, porém as competências básicas para a construção do conhecimento, relativo ao eixo temático "Terra e Universo", não vêm sendo trabalhadas a contento com a maioria dos alunos que concluem o ensino médio. Os alunos estão concluindo este nível de ensino sem conhecimento de vários temas na área de Astronomia, que são obrigatórios nos Parâmetros Curriculares Nacionais (PCN). Em virtude desta discrepância, este trabalho vem evidenciar a necessidade da incorporação de uma disciplina específica de Astronomia, no ensino médio, em prol da redução das distorções entre o que é ensinado e o que se deve ensinar.

  4. Estilo de Liderazgo de Maestros y Maestras de Salud Escolar del Nivel Secundario en la Implantacion del Programa de Educacion en Salud Escolar en Puerto Rico

    ERIC Educational Resources Information Center

    Rosario Arroyo, Luis Antonio

    2012-01-01

    Health education school programs have a planned activity structure that focus on developing awareness on the need of keeping an adequate integral health, through the teaching and learning processes within an appropriate methodological context that promotes students full development. It is expected that school health teachers are effective leaders;…

  5. Matematicas Para El Primer Ciclo Secundario, Volumen II (Parte 2). Traduccion Preliminar de la Edicion en Ingles Revisada. (Mathematics for Junior High School, Volume II, Part 2. Preliminary Translation of the Revised English Edition).

    ERIC Educational Resources Information Center

    Anderson, R. D.; And Others

    This is part two of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system as a progressing development, and metric and non-metric relations in geometry. Chapter topics include real numbers, similar triangles, variation, polyhedrons,…

  6. Matematicas Para El Primer Ciclo Secundario, Volumen II (Parte 1). Traduccion Preliminar de la Edicion en Ingles Revisada. (Mathematics for Junior High School, Volume II, Part 1. Preliminary Translation of the Revised English Edition).

    ERIC Educational Resources Information Center

    Anderson, R. D.; And Others

    This is part one of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system as a progressing development, and metric and non-metric relations in geometry. Chapter topics include number line and coordinates, equations, scientific notation,…

  7. Matematicas Para El Primer Ciclo Secundario, Volumen I (Parte 2). Traduccion Preliminar de la Edicion Inglesa Revisada. (Mathematics for Junior High School, Volume I, Part 2. Preliminary Translation of the Revised English Edition).

    ERIC Educational Resources Information Center

    Anderson, R. D.; And Others

    This is part two of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system, and metric and non-metric relations in geometry. Included are chapters on the rational number system; parallels, parallelograms, triangles, and right prisms;…

  8. Matematicas Para El Primer Ciclo Secundario, Volumen I (Parte 1). Traduccion Preliminar de la Edicion Inglesa Revisada. (Mathematics for Junior High School, Volume I, Part 1, Preliminary Translation of the Revised English Edition).

    ERIC Educational Resources Information Center

    Anderson, R. D.; And Others

    This is part one of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system, and metric and non-metric relations in geometry. Topics included are numbers; cardinal numbers; geometry of lines, points, and planes; geometry of angles,…

  9. Consejos para pacientes que reciben radioterapia

    Cancer.gov

    Serie de nueve (9) hojas sobre los efectos secundarios de la radioterapia. Cada hoja contiene recomendaciones y sugerencias prácticas para ayudarle a controlar los efectos secundarios durante la radioterapia, y a que se sienta mejor durante el tratamiento.

  10. NORTHEASTERN NATURALIST2004 11(1):3340 THE DEMI-LICHENIZATION OF TRAMETES

    E-print Network

    Toth, Charles

    . ZAVADA 1 , LAURA DIMICHELE 2 , AND CHARLES R. TOTH 1 Abstract - Basidiocarps of Trametes versicolor also vary and can range from minutes, e.g., in Peltigera polydactyla (Neck.) Hoffm. (Drew and Smith

  11. EVALUATION OF DIFFERENT METHODS FOR THE EXTRACTION OF DNA FROM FUNGAL CONIDIA BY QUANTITATIVE COMPETITIVE PCR ANALYSIS

    EPA Science Inventory

    Five different DNA extraction methods were evaluated for their effectiveness in recovering PCR templates from the conidia of a series of fungal species often encountered in indoor air. The test organisms were Aspergillus versicolor, Penicillium chrysogenum, Stachybotrys chartaru...

  12. Skin - abnormally dark or light

    MedlinePLUS

    ... fungal infections (such as tinea versicolor) Pityriasis alba Vitiligo ... Ortonne JP, Passeron T. Vitiligo and other disorders of hypopigmentation. In: Bolognia JL, Jorizzo JL, Schaffer JV, eds. Dermatology . 3rd ed. Philadelphia, PA: Elsevier Saunders; ...

  13. Laboratory research on the efficacy of chlorine dioxide fumigation for the remediation of mold-contaminated buildings--conference paper

    EPA Science Inventory

    The purpose of this project was to determine the efficacy ofCl02 fumigation to inactivate viable mold, mycotoxins, and allergens on building materials. Alternaria alternata, Aspergillus versicolor, Aspergillus Jumigatus, Chaetomium globosum, and Stachybotrys chartarum were indivi...

  14. Skin Cancer

    MedlinePLUS

    ... Signs, symptoms Who gets, causes Diagnosis, treatment Tips Squamous cell carcinoma Stasis dermatitis Tattoo removal Tinea versicolor U - W ... of this very serious skin cancer. Learn more. Squamous cell carcinoma (SCC) This skin cancer tends to form on ...

  15. Skin Cancer: Diagnosis, Treatment, and Outcome

    MedlinePLUS

    ... Signs, symptoms Who gets, causes Diagnosis, treatment Tips Squamous cell carcinoma Stasis dermatitis Tattoo removal Tinea versicolor U - W ... Actinic keratoses (AKs) Basal cell carcinoma (BCC) Melanoma Squamous cell carcinoma (SCC) Merkel cell carcinoma (MCC) Sebaceous carcinoma Dermatofibrosarcoma ...

  16. Skin Cancer: Who Gets and Causes

    MedlinePLUS

    ... Signs, symptoms Who gets, causes Diagnosis, treatment Tips Squamous cell carcinoma Stasis dermatitis Tattoo removal Tinea versicolor U - W ... progress to a type of skin cancer called squamous cell carcinoma. Organ transplant. The medicine that prevents the body ...

  17. Regulation of coal polymer degradation by fungi. Eighth quarterly report, [January--March 1996

    SciTech Connect

    Irvine, R.L.; Bumpus, J.A.

    1996-07-28

    Progress is reported on solubilization of low-rank coal by enzyme activity derived from Trametes versicolor or P. chrysosporium. Specifically during the reporting period efforts were directed towards the determining the effect of pH on solubilization of leonardite, the role of laccase in low coal solubilization and metabolism, the decolorization of soluble coal macromolecule by P. chrysosprium and T. versicolor in solid agar gel, and the solubilization of low rank coal in slurry cultures and solid phase reactors.

  18. Degradation of hop bitter acids by fungi

    SciTech Connect

    Huszcza, Ewa Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw

    2008-07-01

    Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops.

  19. Embryonic thermosensitivity and hatchling morphology differ between two coexisting lizards

    NASA Astrophysics Data System (ADS)

    Qu, Yan-Fu; Li, Hong; Gao, Jian-Fang; Ji, Xiang

    2011-07-01

    We incubated eggs of two coexisting lizards, Phrynocephalus frontalis and Phrynocephalus versicolor, at three constant temperatures (24, 28 and 32 °C) to examine whether they differ in embryonic thermosensitivity and hatchling morphology. Eggs incubated at the three temperatures produced morphologically different hatchlings in P. versicolor but not in P. frontalis. Snout-vent length (SVL), body mass and head width were greater in P. versicolor hatchlings from the 24 °C treatment than those from the 32 °C treatment when accounting for differences in initial egg mass, and tail length was smaller in P. versicolor hatchlings from the 24 °C treatment than those from the 32 °C treatment when accounting for differences in final egg mass. Body mass, head length, head width, tail length, fore-limb length and hind-limb length were greater in P. frontalis hatchlings than in P. versicolor hatchling when accounting for differences in initial or final egg mass. Moreover, P. frontalis females produce larger hatchlings than do P. versicolor females of the same SVL not only by laying larger eggs, but also by investing more dry materials (and thus, more energy) into the egg. Given a link between interspecific competition (and niche restriction) and morphology, it seems likely that morphological differences at hatching may facilitate the coexistence of the two lizards. The two lizards differed in embryonic thermosensitivity and water uptake by eggs during incubation, suggesting that they use different microhabitats in the area of sympatry.

  20. Functional genomics of a generalist parasitic plant: Laser microdissection of host-parasite interface reveals host-specific patterns of parasite gene expression

    PubMed Central

    2013-01-01

    Background Orobanchaceae is the only plant family with members representing the full range of parasitic lifestyles plus a free-living lineage sister to all parasitic lineages, Lindenbergia. A generalist member of this family, and an important parasitic plant model, Triphysaria versicolor regularly feeds upon a wide range of host plants. Here, we compare de novo assembled transcriptomes generated from laser micro-dissected tissues at the host-parasite interface to uncover details of the largely uncharacterized interaction between parasitic plants and their hosts. Results The interaction of Triphysaria with the distantly related hosts Zea mays and Medicago truncatula reveals dramatic host-specific gene expression patterns. Relative to above ground tissues, gene families are disproportionally represented at the interface including enrichment for transcription factors and genes of unknown function. Quantitative Real-Time PCR of a T. versicolor ?-expansin shows strong differential (120x) upregulation in response to the monocot host Z. mays; a result that is concordant with our read count estimates. Pathogenesis-related proteins, other cell wall modifying enzymes, and orthologs of genes with unknown function (annotated as such in sequenced plant genomes) are among the parasite genes highly expressed by T. versicolor at the parasite-host interface. Conclusions Laser capture microdissection makes it possible to sample the small region of cells at the epicenter of parasite host interactions. The results of our analysis suggest that T. versicolor’s generalist strategy involves a reliance on overlapping but distinct gene sets, depending upon the host plant it is parasitizing. The massive upregulation of a T. versicolor ?-expansin is suggestive of a mechanism for parasite success on grass hosts. In this preliminary study of the interface transcriptomes, we have shown that T. versicolor, and the Orobanchaceae in general, provide excellent opportunities for the characterization of plant genes with unknown functions. PMID:23302495

  1. A study of over production and enhanced secretion of enzymes. Quarterly report 1

    SciTech Connect

    Dashek, W.V.

    1992-12-28

    The current project is concerned with the over-production and enhanced secretion of PPO, cellulase and lignin peroxidase. The project is divided into two segments: over-production of lignocellulolytic enzymes by genetic engineering methodologies and hyper-production and enhanced secretion of these enzymes by biochemical/electron microscopical techniques. The former approach employs recombinant DNA procedures, ligation of appropriate nuclease generated DNA fragments into a vector and the subsequent transformation of Escherichia coli to yield E. coli harboring a C. versicolor DNA insert. The biochemistry/electron microscopical method involves substrate induction and the time-dependent addition of respiration and PPO inhibitors to elevate C.versicolor`s ability to synthesize and secrete lignocellulosic enzymes. In this connection, cell fractionation/kinetic analysis, TEM immunoelectron microscopic localization and TEM substrate localization of PPO are being employed to assess the route of secretion. Both approaches will culminate in the batch culture of either E. coli or C. versicolor, in a fermentor with the subsequent development of rapid isolation and purification procedures to yield elevated quantities of pure lignocellulosic enzymes. During the past year, research effort were directed toward determining the route of polyphenol oxidase (PPO) secretion by the wood-decay fungus, Coriolus versicolor. In addition, research activities were continued to over-produce and to purify PPO as well as define the time-dependent intra- and extra-cellular appearances of C. versicolor ligninases and cellulases.

  2. Food partitioning of leaf-eating mangrove crabs ( Sesarminae): Experimental and stable isotope ( 13C and 15N) evidence

    NASA Astrophysics Data System (ADS)

    Kristensen, Ditte K.; Kristensen, Erik; Mangion, Perrine

    2010-05-01

    The feasibility of mangrove leaves as a full diet for sesarmid crabs has been questioned for decades. Since these leaves are nitrogen-poor, sesarmids probably obtain nitrogen from other sources to sustain growth. The aim of this study was to assess the food partitioning of the sesarmid species Neoepisesarma versicolor with emphasis on nitrogen allocation. The preference for animal tissue when crabs were pre-fed diets of different nitrogen content was determined in the laboratory. Furthermore, the possible in situ diet composition of N. versicolor was established from carbon and nitrogen stable isotope signature ( ?13C and ?15N) of freshly caught individuals and their potential food sources, using a concentration-dependent mixing model. N. versicolor showed significantly higher feeding preferences for fish meat when pre-fed leaf material without than with access to meat, indicating that this crab species can meet its nitrogen demand by ingesting animal tissue. The stable isotope mixing model based on in situ materials suggests that the diet of N. versicolor consists of ˜60% leaves in terms of biomass, leaving ˜40% for other sources such as animal tissue and benthic microorganisms. The biomass contribution from animal tissues, in form of e.g. other crustaceans and fish carcasses, was found to account for ˜15%. Despite the relative low biomass fraction, animal food sources may contribute with up to half of the nitrogen in the diet of N. versicolor. The quantity of ingested sediment most likely exceeds that of animal tissues. However, due to the low concentration of assimilable microalgae and other microorganism, we propose that sediment associated sources are less important as a nitrogen source for N. versicolor than hitherto presumed.

  3. Superficial fungal infections. Getting rid of lesions that don't want to go away.

    PubMed

    Kovacs, S O; Hruza, L L

    1995-12-01

    Systematic analysis of possible dermatophyte and candidal skin infections leads to an accurate diagnosis and prompt treatment with a specific regimen. The first steps are thorough skin examination and evaluation with a potassium hydroxide preparation. Tinea corporis, tinea cruris, tinea pedis, cutaneous candidiasis, and tinea versicolor can be treated with many topical antifungal agents, whereas tinea capitis requires oral griseofulvin therapy. Frequently used topical medications for tinea and candidal infections include clotrimazole (Lotrimin, Mycelex), econazole nitrate (Spectazole), ketoconazole (Nizoral), miconazole nitrate (Monistat-Derm, Micatin), oxiconazole nitrate (Oxistat), and ciclopirox olamine (Loprox). Topical selenium sulfide lotion can also be used for tinea versicolor, which is often a recalcitrant problem. PMID:7501581

  4. Volume 7(4): 177-181 (2015) -177 J Microb Biochem Technol

    E-print Network

    Qin, Wensheng

    2015-01-01

    and ligninolytic enzymes production profiles of the four fungi were monitored and reported here. The highest laccase activity of 202 U/L was obtained in T. albidus at day 25 while the maximum manganese-dependent peroxidase (MnP) activity of 50 U/L was obtained in C. versicolor from day 15 to 25. The P. ostreatus showed

  5. [Cutaneous Malassezia infections and Malassezia associated dermatoses: An update].

    PubMed

    Nenoff, P; Krüger, C; Mayser, P

    2015-06-01

    The lipophilic yeast fungus Malassezia (M.) spp. is the only fungal genus or species which is part of the physiological human microbiome. Today, at least 14 different Malassezia species are known; most of them can only be identified using molecular biological techniques. As a facultative pathogenic microorganism, Malassezia represents the causative agent both of superficial cutaneous infections and of blood stream infections. Pityriasis versicolor is the probably most frequent infection caused by Malassezia. Less common, Malassezia folliculitis occurs. There is only an episodic report on Malassezia-induced onychomycosis. Seborrhoeic dermatitis represents a Malassezia-associated inflammatory dermatosis. In addition, Malassezia allergenes should be considered as the trigger of "Head-Neck"-type atopic dermatitis. Ketoconazole possesses the strongest in vitro activity against Malassezia, and represents the treatment of choice for topical therapy of pityriasis versicolor. Alternatives include other azole antifungals but also the allylamine terbinafine and the hydroxypyridone antifungal agent ciclopirox olamine. "Antiseborrhoeic" agents, e.g. zinc pyrithione, selenium disulfide, and salicylic acid, are also effective in pityriasis versicolor. The drug of choice for oral treatment of pityriasis versicolor is itraconazole; an effective alternative represents fluconazole. Seborrhoeic dermatitis is best treated with topical medication, including topical corticosteroids and antifungal agents like ketoconazole or sertaconazole. Calcineurin inhibitors, e.g. pimecrolimus and tacrolimus, are reliable in seborrhoeic dermatitis, however are used off-label. PMID:25968082

  6. A diversified approach to evaluate biostimulation and bioaugmentation strategies for heavy-oil-contaminated soil.

    PubMed

    Lladó, S; Solanas, A M; de Lapuente, J; Borràs, M; Viñas, M

    2012-10-01

    A diversified approach involving chemical, microbiological and ecotoxicity assessment of soil polluted by heavy mineral oil was adopted, in order to improve our understanding of the biodegradability of pollutants, microbial community dynamics and ecotoxicological effects of various bioremediation strategies. With the aim of improving hydrocarbon degradation, the following bioremediation treatments were assayed: i) addition of inorganic nutrients; ii) addition of the rhamnolipid-based biosurfactant M(AT10); iii) inoculation of an aliphatic hydrocarbon-degrading microbial consortium (TD); and iv) inoculation of a known hydrocarbon-degrading white-rot fungus strain of Trametes versicolor. After 200 days, all the bioremediation assays achieved between 30% and 50% total petroleum hydrocarbon (TPH) biodegradation, with the T. versicolor inoculation degrading it the most. Biostimulation and T. versicolor inoculation promoted the Brevundimonas genus concurrently with other ?-proteobacteria, ?-proteobacteria and Cytophaga-Flexibacter-Bacteroides (CFB) as well as Actinobacteria groups. However, T. versicolor inoculation, which produced the highest hydrocarbon degradation in soil, also promoted autochthonous Gram-positive bacterial groups, such as Firmicutes and Actinobacteria. An acute toxicity test using Eisenia fetida confirmed the improvement in the quality of the soil after all biostimulation and bioaugmentation strategies. PMID:22858534

  7. The evaluation of white rot fungi in the decoloration of textile dyes

    E-print Network

    Ramsay, Juliana

    The evaluation of white rot fungi in the decoloration of textile dyes J. Swamy and J. A. Ramsay of white rot fungi evaluated for their ability to decolorize Amaranth, Remazol Black B, Remazol Orange Science Inc. Keywords: Dye decoloration; textile dyes; white rot fungi; Trametes versicolor; sequential

  8. ENHANCED ENZYMATIC REMOVAL OF CHLOROPHENOLS IN THE PRESENCE OF CO-SUBSTRATES. (R823847)

    EPA Science Inventory

    The effect of reactive co-substrates such as guaiacol and 2,6-dimethoxyphenol on the removal of chlorinated phenols by horseradish peroxidase (HRP) and a
    laccase from the fungus Trametes versicolor was investigated. Addition of 50 mM guaiacol enhanced the precipitation of 4-ch...

  9. Preparation of starch-sodium lignosulfonate graft copolymers via laccase catalysis and characterization of antioxidant activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Graft copolymers of waxy maize starch and sodium lignosulfonate (SLS) were prepared by T. Versicolor laccase catalysis in aqueous solution. Amount of SLS grafted based on phenol analysis was 0.5% and 1.0% in the absence and presence of 1-hydroxybenzotriazole (HBT), respectively. Starch-SLS graft cop...

  10. 23USDA Forest Service Proceedings, RMRS-P-72. 2014 Introduction

    E-print Network

    23USDA Forest Service Proceedings, RMRS-P-72. 2014 Introduction Mushroom-forming fungi mushroom-forming fungi of the phylum basidiomycota, which includes well known species such as the oyster mushroom (Pleurotus ostreatus) and turkey tail mushroom (Trametes versicolor) are further characterized

  11. Circular Polarization of Transmitted Light by Sapphirinidae Copepods

    E-print Network

    Rosen, Joseph

    observed occurring naturally only near the water surface [3,4]. Among animals, the production of circularly. versicolor firefly larvae, in reflections from beetles of the Scarabaeidae family, in Panulirus argus microfibril layers in the exocuticle of beetles belonging to the Scarabaeidae family is usually left handed [5

  12. Biodecontamination of water from bisphenol A using ligninolytic fungi and the modulation role of humic acids.

    PubMed

    Loffredo, Elisabetta; Traversa, Andreina; Senesi, Nicola

    2012-05-01

    Bisphenol A (BPA) is an endocrine disruptor compound (EDC) of xenobiotic origin occurring in natural waters and wastewaters, especially in the most industrialized and urbanized areas. Recent investigations report the use of ligninolytic fungi for the removal of aromatic contaminants, including some EDCs, from different matrices. Humic acids (HA) are widely spread in all natural systems and their presence is ascertained to interfere with microbial growth and activity. The objective of this study was to assess the capacity of three ligninolytic fungi, Trametes versicolor, Stereum hirsutum and Pleurotus ostreatus, to remove BPA at the concentration of 4.6 mg L(-1) from water. Fungal growth on potato dextrose agar (PDA), in the absence and in the presence of a leonardite HA or a green compost HA, was evaluated during the biodecontamination process. The methodological approach adopted in this study excluded the presence of the mycelium in the contaminated water. Results obtained evidenced a relevant removal of BPA by any fungus when PDA only was used as growing medium. The addition of leonardite HA and compost HA stimulated the mycelial growth of any fungus, especially T. versicolor, and significantly enhanced the removal of the contaminant from water by, respectively, T. versicolor only and T. versicolor and S. hirsutum. PMID:22305120

  13. Submicronic Fungal Bioaerosols: High-Resolution Microscopic Characterization and Quantification

    PubMed Central

    Afanou, Komlavi Anani; Straumfors, Anne; Skogstad, Asbjørn; Nilsen, Terje; Synnes, Ole; Skaar, Ida; Hjeljord, Linda; Tronsmo, Arne; Green, Brett James

    2014-01-01

    Submicronic particles released from fungal cultures have been suggested to be additional sources of personal exposure in mold-contaminated buildings. In vitro generation of these particles has been studied with particle counters, eventually supplemented by autofluorescence, that recognize fragments by size and discriminate biotic from abiotic particles. However, the fungal origin of submicronic particles remains unclear. In this study, submicronic fungal particles derived from Aspergillus fumigatus, A. versicolor, and Penicillium chrysogenum cultures grown on agar and gypsum board were aerosolized and enumerated using field emission scanning electron microscopy (FESEM). A novel bioaerosol generator and a fungal spores source strength tester were compared at 12 and 20 liters min?1 airflow. The overall median numbers of aerosolized submicronic particles were 2 × 105 cm?2, 2.6 × 103 cm?2, and 0.9 × 103 cm?2 for A. fumigatus, A. versicolor, and P. chrysogenum, respectively. A. fumigatus released significantly (P < 0.001) more particles than A. versicolor and P. chrysogenum. The ratios of submicronic fragments to larger particles, regardless of media type, were 1:3, 5:1, and 1:2 for A. fumigatus, A. versicolor, and P. chrysogenum, respectively. Spore fragments identified by the presence of rodlets amounted to 13%, 2%, and 0% of the submicronic particles released from A. fumigatus, A. versicolor, and P. chrysogenum, respectively. Submicronic particles with and without rodlets were also aerosolized from cultures grown on cellophane-covered media, indirectly confirming their fungal origin. Both hyphae and conidia could fragment into submicronic particles and aerosolize in vitro. These findings further highlight the potential contribution of fungal fragments to personal fungal exposure. PMID:25217010

  14. Aerodynamic characteristics and respiratory deposition of fungal fragments

    NASA Astrophysics Data System (ADS)

    Cho, Seung-Hyun; Seo, Sung-Chul; Schmechel, Detlef; Grinshpun, Sergey A.; Reponen, Tiina

    The purpose of this study was to investigate the aerodynamic characteristics of fungal fragments and to estimate their respiratory deposition. Fragments and spores of three different fungal species ( Aspergillus versicolor, Penicillium melinii, and Stachybotrys chartarum) were aerosolized by the fungal spore source strength tester (FSSST). An electrical low-pressure impactor (ELPI) measured the size distribution in real-time and collected the aerosolized fungal particles simultaneously onto 12 impactor stages in the size range of 0.3-10 ?m utilizing water-soluble ZEF-X10 coating of the impaction stages to prevent spore bounce. For S. chartarum, the average concentration of released fungal fragments was 380 particles cm -3, which was about 514 times higher than that of spores. A. versicolor was found to release comparable amount of spores and fragments. Microscopic analysis confirmed that S. chartarum and A. versicolor did not show any significant spore bounce, whereas the size distribution of P. melinii fragments was masked by spore bounce. Respiratory deposition was calculated using a computer-based model, LUDEP 2.07, for an adult male and a 3-month-old infant utilizing the database on the concentration and size distribution of S. chartarum and A. versicolor aerosols measured by the ELPI. Total deposition fractions for fragments and spores were 27-46% and 84-95%, respectively, showing slightly higher values in an infant than in an adult. For S. chartarum, fragments demonstrated 230-250 fold higher respiratory deposition than spores, while the number of deposited fragments and spores of A. versicolor were comparable. It was revealed that the deposition ratio (the number of deposited fragments divided by that of deposited spores) in the lower airways for an infant was 4-5 times higher than that for an adult. As fungal fragments have been shown to contain mycotoxins and antigens, further exposure assessment should include the measurement of fungal fragments for evaluating mold exposures in damp buildings.

  15. Submicronic fungal bioaerosols: high-resolution microscopic characterization and quantification.

    PubMed

    Afanou, Komlavi Anani; Straumfors, Anne; Skogstad, Asbjørn; Nilsen, Terje; Synnes, Ole; Skaar, Ida; Hjeljord, Linda; Tronsmo, Arne; Green, Brett James; Eduard, Wijnand

    2014-11-01

    Submicronic particles released from fungal cultures have been suggested to be additional sources of personal exposure in mold-contaminated buildings. In vitro generation of these particles has been studied with particle counters, eventually supplemented by autofluorescence, that recognize fragments by size and discriminate biotic from abiotic particles. However, the fungal origin of submicronic particles remains unclear. In this study, submicronic fungal particles derived from Aspergillus fumigatus, A. versicolor, and Penicillium chrysogenum cultures grown on agar and gypsum board were aerosolized and enumerated using field emission scanning electron microscopy (FESEM). A novel bioaerosol generator and a fungal spores source strength tester were compared at 12 and 20 liters min(-1) airflow. The overall median numbers of aerosolized submicronic particles were 2 × 10(5) cm(-2), 2.6 × 10(3) cm(-2), and 0.9 × 10(3) cm(-2) for A. fumigatus, A. versicolor, and P. chrysogenum, respectively. A. fumigatus released significantly (P < 0.001) more particles than A. versicolor and P. chrysogenum. The ratios of submicronic fragments to larger particles, regardless of media type, were 1:3, 5:1, and 1:2 for A. fumigatus, A. versicolor, and P. chrysogenum, respectively. Spore fragments identified by the presence of rodlets amounted to 13%, 2%, and 0% of the submicronic particles released from A. fumigatus, A. versicolor, and P. chrysogenum, respectively. Submicronic particles with and without rodlets were also aerosolized from cultures grown on cellophane-covered media, indirectly confirming their fungal origin. Both hyphae and conidia could fragment into submicronic particles and aerosolize in vitro. These findings further highlight the potential contribution of fungal fragments to personal fungal exposure. PMID:25217010

  16. Neuropatía periférica inducida por quimioterapia

    Cancer.gov

    Artículo sobre un efecto secundario de la quimioterapia que causa dolor y malestar en las manos y los pies. También incluye información sobre los esfuerzos para mejorar las opciones de detección, tratamiento y prevención.

  17. Cannabis y canabinoides (PDQ)—Versión para pacientes

    Cancer.gov

    Resumen de información revisada por expertos sobre el uso del Cannabis y canabinoides para el tratamiento de los efectos secundarios relacionados con el tratamiento del cáncer como la náusea y el vómito.

  18. Cannabis y canabinoides (PDQ)—Versión para profesionales de salud

    Cancer.gov

    Resumen de información revisada por expertos de información sobre el uso del Cannabis y canabinoides para el tratamiento de los efectos secundarios relacionados con el tratamiento del cáncer como la náusea y el vómito.

  19. Tratamiento del cáncer sin daño al corazón

    Cancer.gov

    Investigadores de los campos de oncología y de cardiología están trabajando para encontrar formas de impedir, manejar y posiblemente aun revertir los efectos secundarios cardiovasculares de ciertas terapias del cáncer.

  20. Terapia hormonal para el cáncer de seno

    Cancer.gov

    Hoja informativa que describe la terapia hormonal y su función en la prevención y tratamiento del cáncer de seno. Incluye información acerca de los efectos secundarios posibles y de los fármacos que pueden interferir con la terapia hormonal.

  1. Terapia hormonal para el cáncer de próstata Hoja informativa

    Cancer.gov

    Hoja informativa que describe la terapia hormonal y su función en el tratamiento del cáncer de próstata. Incluye información acerca de los tipos diferentes de terapia hormonal, cómo se usan y los efectos secundarios posibles.

  2. Evidence-based Danish guidelines for the treatment of Malassezia-related skin diseases.

    PubMed

    Hald, Marianne; Arendrup, Maiken C; Svejgaard, Else L; Lindskov, Rune; Foged, Erik K; Saunte, Ditte Marie L

    2015-01-01

    Internationally approved guidelines for the diagnosis and management of Malassezia-related skin diseases are lacking. Therefore, a panel of experts consisting of dermatologists and a microbiologist under the auspices of the Danish Society of Dermatology undertook a data review and compiled guidelines for the diagnostic procedures and management of pityriasis versicolor, seborrhoeic dermatitis and Malassezia folliculitis. Main recommendations in most cases of pityriasis versicolor and seborrhoeic dermatitis include topical treatment which has been shown to be sufficient. As first choice, treatment should be based on topical antifungal medication. A short course of topical corticosteroid or topical calcineurin inhibitors has an anti-inflammatory effect in seborrhoeic dermatitis. Systemic antifungal therapy may be indicated for widespread lesions or lesions refractory to topical treatment. Maintenance therapy is often necessary to prevent relapses. In the treatment of Malassezia folliculitis systemic antifungal treatment is probably more effective than topical treatment but a combination may be favourable. PMID:24556907

  3. Microbial desulphurization of Turkish lignites by White Rot Fungi

    SciTech Connect

    Pinar Aytar; Mesut Sam; Ahmet Cabuk

    2008-03-15

    Biodesulphurization experiments were carried out with Tuncbilek lignite, characterized by high sulfur content (2.59%) by using Trametes versicolor ATCC 200801 and Phanerochaete chrysosporium ME 446. At fungal biomass studies, the effects of various parameters on fungal desulphurization of coals such as pH, temperature, pulp density, incubation time, and sterilization were investigated for both microorganisms. The maximum desulphurization (40%) was observed after 6 days of incubation at 35{sup o}C for T. versicolor. The optimum pH was measured at 6, and the agitation rate was fixed at 125 rpm. The pulp density was found as 5% (w/v) for the high extent of desulphurization. Also, calorific value did not change during this experiment. However, the ash and metal contents of coal were eliminated. 30 refs., 6 figs., 2 tabs.

  4. A protein from Pleurotus eryngii var. tuoliensis C.J. Mou with strong removal activity against the natural steroid hormone, estriol: purification, characterization, and identification as a laccase.

    PubMed

    Ueda, Mitsuhiro; Shintani, Kayo; Nakanishi-Anjyuin, Akiko; Nakazawa, Masami; Kusuda, Mizuho; Nakatani, Fumiki; Kawaguchi, Takashi; Tsujiyama, Sho-Ichi; Kawanishi, Masanobu; Yagi, Takashi; Miyatake, Kazutaka

    2012-12-10

    A protein with strong removal activity against the natural estrogen estriol was purified from a culture supernatant of Pleurotus eryngii var. tuoliensis C.J. Mou. The protein was characterized as a laccase and had a molecular mass of 60kDa on SDS-PAGE. The enzyme was most active at pH 7.0 and 50°C. The partial N-terminal amino acid sequence of the enzyme showed homology with laccases from mushrooms, such as Pleurotus ostreatus, Coriolus versicolor (current name: Trametes versicolor), Pycnoporus cinnabarinus, and P. eryngii. A recombinant yeast assay confirmed that laccase treatment was very efficient for removing the estrogenic activity of steroid estrogens. Our results suggest that the enzyme may be applicable as a potential factor for removing natural steroid hormones. PMID:23040398

  5. Bacterial versus fungal laccase: potential for micropollutant degradation

    PubMed Central

    2013-01-01

    Relatively high concentrations of micropollutants in municipal wastewater treatment plant (WWTP) effluents underscore the necessity to develop additional treatment steps prior to discharge of treated wastewater. Microorganisms that produce unspecific oxidative enzymes such as laccases are a potential means to improve biodegradation of these compounds. Four strains of the bacterial genus Streptomyces (S. cyaneus, S. ipomoea, S. griseus and S. psammoticus) and the white-rot fungus Trametes versicolor were studied for their ability to produce active extracellular laccase in biologically treated wastewater with different carbon sources. Among the Streptomyces strains evaluated, only S. cyaneus produced extracellular laccase with sufficient activity to envisage its potential use in WWTPs. Laccase activity produced by T. versicolor was more than 20 times greater, the highest activity being observed with ash branches as the sole carbon source. The laccase preparation of S. cyaneus (abbreviated LSc) and commercial laccase from T. versicolor (LTv) were further compared in terms of their activity at different pH and temperatures, their stability, their substrate range, and their micropollutant oxidation efficiency. LSc and LTv showed highest activities under acidic conditions (around pH 3 to 5), but LTv was active over wider pH and temperature ranges than LSc, especially at near-neutral pH and between 10 and 25°C (typical conditions found in WWTPs). LTv was also less affected by pH inactivation. Both laccase preparations oxidized the three micropollutants tested, bisphenol A, diclofenac and mefenamic acid, with faster degradation kinetics observed for LTv. Overall, T. versicolor appeared to be the better candidate to remove micropollutants from wastewater in a dedicated post-treatment step. PMID:24152339

  6. Fungal DNA in hotel rooms in Europe and Asia--associations with latitude, precipitation, building data, room characteristics and hotel ranking.

    PubMed

    Norbäck, Dan; Cai, Gui-Hong

    2011-10-01

    There is little information on the indoor environment in hotels. Analysis of fungal DNA by quantitative PCR (qPCR) is a new method which can detect general and specific sequences. Dust was collected through swab sampling of door frames in 69 hotel rooms in 20 countries in Europe and Asia (2007-2009). Five sequences were detected by qPCR: total fungal DNA, Aspergillus and Penicillium DNA (Asp/Pen DNA), Aspergillus versicolor (A. versicolor DNA), Stachybotrys chartarum (S. chartarum DNA) and Streptomyces spp. (Streptomyces DNA). Associations were analysed by multiple linear regression. Total fungal DNA (GM = 1.08 × 10(8) cell equivalents m(-2); GSD = 6.36) and Asp/Pen DNA (GM = 1.79 × 10(7) cell equivalents m(-2); GSD = 10.12) were detected in all rooms. A. versicolor DNA, S. chartarum DNA and Streptomyces DNA were detected in 84%, 28% and 47% of the samples. In total, 20% of the rooms had observed dampness/mould, and 30% had odour. Low latitude (range 1.5-64.2 degrees) was a predictor of Asp/Pen DNA. Seaside location, lack of mechanical ventilation, and dampness or mould were other predictors of total fungal DNA and Asp/Pen DNA. Hotel ranking (Trip Advisor) or self-rated quality of the interior of the hotel room was a predictor of total fungal DNA, A. versicolor DNA and Streptomyces DNA. Odour was a predictor of S. chartarum DNA. In conclusion, fungal DNA in swab samples from hotel rooms was related to latitude, seaside location, ventilation, visible dampness and indoor mould growth. Hotels in tropical areas may have 10-100 times higher levels of common moulds such as Aspergillus and Penicillium species, as compared to a temperate climate zone. PMID:21897974

  7. Utilizing pigment-producing fungi to add commercial value to American beech (Fagus grandifolia).

    PubMed

    Robinson, Sara C; Tudor, Daniela; Cooper, Paul A

    2012-02-01

    American beech (Fagus grandifolia) is an abundant, underutilized tree in certain areas of North America, and methods to increase its market value are of considerable interest. This research utilized pigment-producing fungi to induce color in American beech to potentially establish its use as a decorative wood. Wood samples were inoculated with Trametes versicolor, Xylaria polymorpha, Inonotus hispidus, and Arthrographis cuboidea to induce fungal pigmentation. Black pigmentation (T. versicolor, X. polymorpha, I. hispidus) was sporadic, occurred primarily on the surfaces of the heartwood, but not internally. Pink pigmentation (A. cuboidea) occurred throughout all of the tested beech samples, but was difficult to see in the heartwood due to the darker color of the wood. To increase the visibility of the pink stain, beech blocks were pretreated with T. versicolor for 4 weeks before being inoculated with A. cuboidea. This method significantly increased the saturation of the pink stain on both beech heartwood and sapwood, creating coloration similar to that found on sugar maple. This value-adding process should be particularly effective for small-scale wood pigmentation, and should help establish a market for this currently underutilized wood species. PMID:21931972

  8. Indirect Immunodetection of Fungal Fragments by Field Emission Scanning Electron Microscopy.

    PubMed

    Afanou, Komlavi Anani; Straumfors, Anne; Skogstad, Asbjørn; Nayak, Ajay P; Skaar, Ida; Hjeljord, Linda; Tronsmo, Arne; Eduard, Wijnand; Green, Brett James

    2015-09-01

    Submicronic fungal fragments have been observed in in vitro aerosolization experiments. The occurrence of these particles has therefore been suggested to contribute to respiratory health problems observed in mold-contaminated indoor environments. However, the role of submicronic fragments in exacerbating adverse health effects has remained unclear due to limitations associated with detection methods. In the present study, we report the development of an indirect immunodetection assay that utilizes chicken polyclonal antibodies developed against spores from Aspergillus versicolor and high-resolution field emission scanning electron microscopy (FESEM). Immunolabeling was performed with A. versicolor fragments immobilized and fixed onto poly-l-lysine-coated polycarbonate filters. Ninety percent of submicronic fragments and 1- to 2-?m fragments, compared to 100% of >2-?m fragments generated from pure freeze-dried mycelial fragments of A. versicolor, were positively labeled. In proof-of-concept experiments, air samples collected from moldy indoor environments were evaluated using the immunolabeling technique. Our results indicated that 13% of the total collected particles were derived from fungi. This fraction comprises 79% of the fragments that were detected by immunolabeling and 21% of the spore particles that were morphologically identified. The methods reported in this study enable the enumeration of fungal particles, including submicronic fragments, in a complex heterogeneous environmental sample. PMID:26092450

  9. Heritable Variation in Quinone-Induced Haustorium Development in the Parasitic Plant Triphysaria1

    PubMed Central

    Jamison, Denneal S.; Yoder, John I.

    2001-01-01

    We are using the facultative hemiparasite, Triphysaria, as a model for studying host-parasite signaling in the Scrophulariaceae. Parasitic members of this family form subterranean connections, or haustoria, on neighboring host roots to access host water and nutrients. These parasitic organs develop in response to haustorial-inducing factors contained in host root exudates. A well-characterized inducing factor, 2, 6-dimethoxy-p-benzoquinone (DMBQ), can be used to trigger in vitro haustorium formation in the roots of Triphysaria. We have assayed three species, Triphysaria eriantha (Benth.) Chuang and Heckard, Triphysaria pusilla (Benth.) Chuang and Heckard, and Triphysaria versicolor Fischer and C. Meyer, for haustorium development in response to DMBQ. There were significant differences between the species in their ability to recognize and respond to this quinone. Ninety percent of T. versicolor individuals responded, whereas only 40% of T. pusilla and less than 10% of T. eriantha formed haustoria. Within field collections of self-pollinating T. pusilla, differential responsiveness to DMBQ was seen in distinct maternal families. Assaying haustorium development in subsequent generations of self-pollinated T. pusilla showed that DMBQ responsiveness was heritable. Reciprocal crosses between T. eriantha and T. versicolor demonstrated that DMBQ responsiveness was influenced by maternal factors. These results demonstrate heritable, natural variation in the recognition of a haustorial-inducing factor by a parasitic member of the Scrophulariaceae. PMID:11299366

  10. Antigenotoxic Effect of Trametes spp. Extracts against DNA Damage on Human Peripheral White Blood Cells

    PubMed Central

    Kneževi?, Aleksandar; Živkovi?, Lada; Staji?, Mirjana; Vukojevi?, Jelena; Milovanovi?, Ivan; Spremo-Potparevi?, Biljana

    2015-01-01

    Trametes species have been used for thousands of years in traditional and conventional medicine for the treatment of various types of diseases. The goal was to evaluate possible antigenotoxic effects of mycelium and basidiocarp extracts of selected Trametes species and to assess dependence on their antioxidant potential. Trametes versicolor, T. hirsuta, and T. gibbosa were the species studied. Antigenotoxic potentials of extracts were assessed on human peripheral white blood cells with basidiocarp and mycelium extracts of the species. The alkaline comet test was used for detection of DNA strand breaks and alkali-labile sites, as well as the extent of DNA migration. DPPH assay was used to estimate antioxidative properties of extracts. Fruiting body extracts of T. versicolor and T. gibbosa as well as T. hirsuta extracts, except that at 20.0?mg/mL, were not genotoxic agents. T. versicolor extract had at 5.0?mg/mL the greatest antigenotoxic effect in both pre- and posttreatment of leukocytes. The mycelium extracts of the three species had no genotoxic activity and significant antigenotoxic effect against H2O2-induced DNA damage, both in pre- and posttreatment. The results suggest that extracts of these three species could be considered as strong antigenotoxic agents able to stimulate genoprotective response of cells. PMID:26258163

  11. Problemas sexuales y de fecundidad (hombres)

    Cancer.gov

    Muchos tratamientos del cáncer y algunos tipos de cáncer pueden causar efectos secundarios relacionados con la sexualidad y con la fecundidad. Ya sea que usted tenga o no estos problemas depende del tipo de tratamiento que recibe, de su edad al tiempo del tratamiento y del tiempo que ha pasado desde el tratamiento.

  12. Investigacin Centro de Investigacin y de Estudios Avanzados del Instituto Politcnico Nacional

    E-print Network

    moleculares microbianos en suelos. Ana Carmela Ramos Valdivia Biotecnología del metabolismo secundario y la interés industrial Refugio Rodríguez Vázquez Biorremediación de suelo y agua. Aplicación de residuos agroindustriales en la biorremediación de suelos, enzimas fúngicas en la degradación de compuestos orgánicos

  13. Medicina de precisión y terapia dirigida

    Cancer.gov

    Información sobre la función que desempeñan las terapias dirigidas en la medicina de precisión. Explica cómo las terapias dirigidas actúan contra el cáncer, quién recibe estas terapias, los efectos secundarios más comunes y lo que se debe esperar al recibir este tipo de tratamientos.

  14. Vctor Vilarrasa Sebasti Olivella

    E-print Network

    Politècnica de Catalunya, Universitat

    almacenes y sellos secundarios #12;PILOT TEST #12;Human Induced Climate Change MOTIVATION #12;CO2 emissions METHODOLOGY H M Hydraulic properties change Effective stress change Water and CO2 flux Stress-Strain -Pressure Viscoplastic deformation: Yield function: Flow rule: Stress function: G F dt d cMpqF ' )'( cMpqG 321

  15. Regulation of coal polymer degradation by fungi. Tenth Quartery report, October 1996--December 1996

    SciTech Connect

    Irvine, R.L.; Bumpus, J.A.

    1997-01-28

    It has long been known that low rank coal such as leonardite can be solubilized by strong base (>pH 12). Recent discoveries have also shown that leonardite is solubilized by Lewis bases at considerably lower pH values and by fungi that secrete certain Lewis bases (i.e., oxalate ion). During the current reporting period we have studied the ability of a strong base (sodium hydroxide, pH 12), and two fungi, Phanerochaete chrysosporium and Trametes versicolor, to solubilize Argonne Premium Coals. In general, Argonne Premium Coals were relatively resistant to base mediated solubilization. However, when these coals were preoxidized (150{degrees}C for seven days), substantial amounts of several coals were solubilized. Most affected were the Lewiston-Stockton bituminous coal, the Beulah-Zap lignite, the Wyodak-Anderson subbituminous coal and the Blind Canyon bituminous coal. Argonne Premium Coals were previously shown by us to be relatively resistant to solubilization by sodium oxalate. When preoxidized coals were treated with sodium oxalate, only the Beulah-Zap lignite was substantially solubilized. Although very small amounts of the other preoxidized coals were solubilized by treatment with oxalate, the small amount of solubilization that did take place was generally increased relative to that observed for coals that were not preoxidized. None of the Argonne Premium Coals were solubilized by P. chrysosporium or T. versicolor. Of considerable interest, however, is the observation that P. chrysosporium and T. versicolor mediated extensive solubilization of Lewiston-Stockton bituminous coal, the Beulah-Zap lignite and the Wyodak-Anderson subbituminous coal.

  16. Evaluation of ten wild nigerian mushrooms for amylase and cellulase activities.

    PubMed

    Jonathan, Segun Gbolagade; Adeoyo, Olusegun Richard

    2011-06-01

    Amylases and cellulases are important enzymes that can be utilized for various biological activities. Ten different wild Nigerian mushrooms (Agaricus blazei, Agaricus sp., Corilopsis occidentalis, Coriolus versicolor, Termitomyces clypeatus, Termitomyces globulus, Pleurotus tuber-regium, Podoscypha bolleana, Pogonomyces hydnoides, and Nothopanus hygrophanus) were assayed for production of these secondary metabolites. The results revealed that most of the tested wild fungi demonstrated very good amylase and cellulase activities. With the incorporation of carboxymethyl-cellulose (a carbon source) into the culture medium, Agaricus blazei had the highest amylolytic activity of 0.60 unit/mL (at 25?, pH 6.8). This was followed in order by P. tuber-regium and Agaricus sp. with 0.42 and 0.39 unit/mL, respectively (p ? 0.05). Maltose and sucrose supplementation into the submerged liquid medium made N. hygrophanus and P. hydnoides to exhibit very low amylase activities of 0.09 and 0.11 unit/mL, respectively. Introducing peptone (an organic nitrogen source) into the basal medium enhanced the ability of C. versicolor to produce a cellulase value of 0.74 unit/mL. Other organic nitrogen sources that supported good cellulase activities were yeast extract and urea. Sodium nitrate (inorganic nitrogen source) generally inhibited cellulase production in all mushrooms. The best carbon source was carboxymethyl-cellulose, which promoted very high cellulase activity of 0.67 unit/mL in C. versicolor, which was followed in order by P. tuber-regium, T. chypeatus, and C. occidentalis (p ? 0.05). Sucrose was the poorest carbon compound, supporting the lowest values of 0.01, 0.01, and 0.14 unit/mL in P. hydnoides, A. blazei, and Agaricus sp., respectively. PMID:22783085

  17. Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation.

    PubMed

    Sitarz, Anna K; Mikkelsen, Jørn D; Højrup, Peter; Meyer, Anne S

    2013-12-10

    Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt extract or minimal media supplemented with alkali lignin. When grown on malt extract or minimal medium supplemented with lignocellulose (sugar cane bagasse), the crude G. lucidum protein extract exhibited high laccase activity, ?3U/mL toward syringaldazine. This activity was 13-17 fold higher than the corresponding activities of the crude protein extracts of P. brumalis, P. ciliatus and T. versicolor. Native PAGE electrophoresis of the crude G. lucidum extract confirmed the presence of an active laccase. The G. lucidum laccase had a molecular weight of ?62.5kDa, and a Km value of 0.107mM (determined on ABTS). A partial amino acid sequence analysis of four short de novo sequenced peptides, defined after trypsin digest analysis using MALDI-TOF MS/MS analysis, revealed 64-100% homology to sequences in related laccases in the UniProt database, but also indicated that certain sequence stretches had low homology. Addition of the laccase-rich G. lucidum broth to lignocellulosic biomass (pretreated sugar cane bagasse) together with a state-of-the-art cellulase enzyme preparation (Cellic™CTec1) produced significantly increased cellulolytic yields, which were also better than those obtained with a T. versicolor laccase addition, indicating that the laccase from G. lucidum has unique properties that may be momentous in lignocellulosic biomass conversion. PMID:24315640

  18. Climatic variation and the distribution of an amphibian polyploid complex.

    PubMed

    Otto, Clint R V; Snodgrass, Joel W; Forester, Don C; Mitchell, Joseph C; Miller, Robert W

    2007-11-01

    The establishment of polyploid populations involves the persistence and growth of the polyploid in the presence of the progenitor species. Although there have been a number of animal polyploid species documented, relatively few inquiries have been made into the large-scale mechanisms of polyploid establishment in animal groups. Herein we investigate the influence of regional climatic conditions on the distributional patterns of a diploid-tetraploid species pair of gray treefrogs, Hyla chrysoscelis and H. versicolor (Anura: Hylidae) in the mid-Atlantic region of eastern North America. Calling surveys at breeding sites were used to document the distribution of each species. Twelve climatic models and one elevation model were generated to predict climatic and elevation values for gray treefrog breeding sites. A canonical analysis of discriminants was used to describe relationships between climatic variables, elevation and the distribution of H. chrysoscelis and H. versicolor. There was a strong correlation between several climatic variables, elevation and the distribution of the gray treefrog complex. Specifically, the tetraploid species almost exclusively occupied areas of higher elevation, where climatic conditions were relatively severe (colder, drier, greater annual variation). In contrast, the diploid species was restricted to lower elevations, where climatic conditions were warmer, wetter and exhibited less annual variation. Clusters of syntopic sites were associated with areas of high variation in annual temperature and precipitation during the breeding season. Our data suggest that large-scale climatic conditions have played a role in the establishment of the polyploid H. versicolor in at least some portions of its range. The occurrence of the polyploid and absence of the progenitor in colder, drier and more varied environments suggests the polyploid may possess a tolerance of severe environmental conditions that is not possessed by the diploid progenitor. Our findings support the hypothesis that increased tolerance to severe environmental conditions is a plausible mechanism of polyploid establishment. PMID:17922702

  19. Climatic variation and the distribution of an amphibian polyploid complex

    USGS Publications Warehouse

    Otto, C.R.V.; Snodgrass, J.W.; Forester, D.C.; Mitchell, J.C.; Miller, R.W.

    2007-01-01

    1. The establishment of polyploid populations involves the persistence and growth of the polyploid in the presence of the progenitor species. Although there have been a number of animal polyploid species documented, relatively few inquiries have been made into the large-scale mechanisms of polyploid establishment in animal groups. Herein we investigate the influence of regional climatic conditions on the distributional patterns of a diploid-tetraploid species pair of gray treefrogs, Hyla chrysoscelis and H. versicolor (Anura: Hylidae) in the mid-Atlantic region of eastern North America. 2. Calling surveys at breeding sites were used to document the distribution of each species. Twelve climatic models and one elevation model were generated to predict climatic and elevation values for gray treefrog breeding sites. A canonical analysis of discriminants was used to describe relationships between climatic variables, elevation and the distribution of H. chrysoscelis and H. versicolor. 3. There was a strong correlation between several climatic variables, elevation and the distribution of the gray treefrog complex. Specifically, the tetraploid species almost exclusively occupied areas of higher elevation, where climatic conditions were relatively severe (colder, drier, greater annual variation). In contrast, the diploid species was restricted to lower elevations, where climatic conditions were warmer, wetter and exhibited less annual variation. 4. Clusters of syntopic sites were associated with areas of high variation in annual temperature and precipitation during the breeding season. 5. Our data suggest that large-scale climatic conditions have played a role in the establishment of the polyploid H. versicolor in at least some portions of its range. The occurrence of the polyploid and absence of the progenitor in colder, drier and more varied environments suggests the polyploid may posses a tolerance of severe environmental conditions that is not possessed by the diploid progenitor. 6. Our findings support the hypothesis that increased tolerance to severe environmental conditions is a plausible mechanism of polyploid establishment.

  20. Molecular Identification and Amphotericin B Susceptibility Testing of Clinical Isolates of Aspergillus From 11 Hospitals in Korea

    PubMed Central

    Heo, Min Seok; Choi, Min Ji; Park, Yeon-Joon; Lee, Hye Soo; Koo, Sun Hoe; Lee, Won Gil; Kim, Soo Hyun; Shin, Myung-Geun; Suh, Soon-Pal; Ryang, Dong-Wook

    2015-01-01

    Background We investigated the species distribution and amphotericin B (AMB) susceptibility of Korean clinical Aspergillus isolates by using two Etests and the CLSI broth microdilution method. Methods A total of 136 Aspergillus isolates obtained from 11 university hospitals were identified by sequencing the internal transcribed spacer (ITS) and ?-tubulin genomic regions. Minimal inhibitory concentrations (MICs) of AMB were determined in Etests using Mueller-Hinton agar (Etest-MH) and RPMI agar (Etest-RPG), and categorical agreement with the CLSI method was assessed by using epidemiological cutoff values. Results ITS sequencing identified the following six Aspergillus species complexes: Aspergillus fumigatus (42.6% of the isolates), A. niger (23.5%), A. flavus (17.6%), A. terreus (11.0%), A. versicolor (4.4%), and A. ustus (0.7%). Cryptic species identifiable by ?-tubulin sequencing accounted for 25.7% (35/136) of the isolates. Of all 136 isolates, 36 (26.5%) had AMB MICs of ?2 µg/mL by the CLSI method. The categorical agreement of Etest-RPG with the CLSI method was 98% for the A. fumigatus, A. niger, and A. versicolor complexes, 87% for the A. terreus complex, and 37.5% for the A. flavus complex. That of Etest-MH was ?75% for the A. niger, A. flavus, A. terreus, and A. versicolor complexes but was higher for the A. fumigatus complex (98.3%). Conclusions Aspergillus species other than A. fumigatus constitute about 60% of clinical Aspergillus isolates, and reduced AMB susceptibility is common among clinical isolates of Aspergillus in Korea. Molecular identification and AMB susceptibility testing by Etest-RPG may be useful for characterizing Aspergillus isolates of clinical relevance. PMID:26354348

  1. [Preparation and biological properties of basidiomycete aqueous extracts and their mycelial compositions].

    PubMed

    Bukhman, V M; Treshchalina, E M; Krasnopol'skaia, L M; Isakova, E B; Sedakova, L A; Avtonomova, A V; Leont'eva, M I; Soboleva, N Iu; Belitski?, I V; Bakanov, A V

    2007-01-01

    The basidiomycetes Ganoderma lucidum, Hericium erinaceus, Lentinus edodes and Trametes versicolor were used for preparation of aqueous extracts. A polysaccharide preparation (VPG) was isolated from the G. lucidum aqueous extracts. The mycelium was grown under submerged conditions according to an original procedure. Preliminary exposure of mice with tumors to cyclosphosphamide in a low dose for prolonged elimination of T-suppressors and rapid recovery of T-killers induced an increase in the efficacy of the H. erinaceus and L. edodes extracts. Investigation of the aqueous extracts and VPG on different tumor strain lines for the potential Modifiers of Biological Response (Ca755, s/c P388, s-180) demonstrated antitumor activity and satisfactory tolerabily after oral administration. Inhibition of the tumor growth by the H. erinaceus and T. versicolor extracts and VPG amounted to 88-99% and that of s-180 treated with the L. edodes aqueous extract amounted to 66-75%. Compositions 1, 2, 4 amd 5 were significantly more active by the duration and value of the effect on the animal tumor nodes as compared to the aqueous extracts and VPG included to the compositions and composition 4. Composition 5 (T. versicolor + H. erinaceus + G. Lucidum) proved to be the most efficient by all the criteria. The results of the design of the technologies for cultivation of the mycelum of the medicinal basidiomycetes, investigation of the antumor properties of the extracts and polysaccharide fraction of the mycelium and development of efficient compositions on their basis are summarized. Composition 5 proved to be the most promising for the clinical trials. PMID:18461802

  2. Regulation of coal polymer degradation by fungi. Eighth quarterly report, [April--June 1996

    SciTech Connect

    Irvine, R.L.; Bumpus, J.A.

    1996-07-28

    This project addresses the solubilization of low-rank coal (leonardite) by lignin degrading fungi. During this reporting period efforts were focused on determining the effect of pH on coal solubilization by oxalate ion and other biologically important compounds that might function as metal chelators, on the role of laccase in coal solubilization and metabolism, on decolorization of soluble coal macromolecule by Phanerochaete chrysosporium and T. versicolor in solid agar media, and on solubilization of coal in slurry cultures and solid phase reactors.

  3. The transmembrane channel-like protein family and human papillomaviruses

    PubMed Central

    Horton, Jaime S; Stokes, Alexander J

    2014-01-01

    Epidermodysplasia verruciformis (EV) is a rare genodermatosis characterized by increased sensitivity to infection by the ?-subtype of human papillomaviruses (?-HPVs), causing persistent, tinea versicolor-like dermal lesions. In a majority of affected individuals, these macular lesions progress to invasive cutaneous squamous cell carcinoma (CSCC) in sun-exposed areas. While mutations in transmembrane channel-like 6 (TMC6 / EVER1) and 8 (TMC8 / EVER2) have been causally linked to EV, their molecular functions are unclear. It is likely that their protective effects involve regulation of the ?-HPV life cycle, host keratinocyte apoptosis vs. survival balance and/or T-cell interaction with infected host cells. PMID:24800179

  4. Complete mitochondrial genome of the ring-necked pheasant, Phasianus colchicus (Galliformes: Phasianidae).

    PubMed

    Li, Xifeng; Ren, Qiongqiong; Kan, Xianzhao; Qian, Chaoju; Li, Xixi; Qian, Min

    2013-04-01

    The complete mitochondrial genome of Phasianus colchicus is 16,692 bp in length and composed of 13 typical protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and 1 putative control region. One extra nucleotide "C" is present in nad3 of P. colchicus, which is found in many other birds and is thought not to be translated. All protein-coding, rRNA, and tRNA genes have more than 99.0% nucleotide sequence similarity with the previously reported individual, except for cox3 and tRNA (Pro) genes which has more similarity with Phasianus versicolor. PMID:22950703

  5. Mycology - an update Part 3: Dermatomycoses: topical and systemic therapy.

    PubMed

    Nenoff, Pietro; Krüger, Constanze; Paasch, Uwe; Ginter-Hanselmayer, Gabriele

    2015-05-01

    Treatment of dermatophyte infections is based on the clinical picture and mycological detection of the causative pathogen. Based on the appropriate indication, onychomycosis can be treated topically using an antimycotic nail lacquer. Atraumatic nail abrasion with 40 % urea ointment has a beneficial effect on healing. Continuous treatment of onychomycosis with terbinafine represents the most effective systemic therapy. Terbinafine or itraconazole are the safest and most effective antimycotic agents for the treatment of onychomycosis in children. For laser therapy of onychomycosis, only a few studies on clinical efficacy are available. Regarding tinea capitis, targeted species-specific therapy of dermatophytosis of the scalp is currently recommended. Terbinafine, yet also itraconazole and fluconazole, are effective in tinea capitis caused by Trichophyton species. Microsporum infections of the scalp are preferably treated with griseofulvin, alternatively with itraconazole or fluconazole. Terbinafine is less effective. Candidal intertrigo are topically treated with nystatin, but azoles or ciclopirox olamine are also suitable candidates. Systemically, fluconazole or itraconazole are used. Topical and systemic antimycotics are equivalent forms of therapy in acute vulvovaginal mycosis. Fluconazole is the drug of choice in chronic recurrent vulvovaginal mycosis caused by Candida albicans. Ketoconazole shows very good efficacy in tinea versicolor. With respect to systemic treatment of severe and widespread tinea versicolor, itraconazole is the drug of choice. PMID:25918080

  6. Degradation of C60 Fullerol by White-Rot Basidiomycete Fungi: Implications for Environmental Release of Nanomaterials

    NASA Astrophysics Data System (ADS)

    Schreiner, K. M.; Filley, T. R.; Bolskar, R. D.; Blanchette, R. A.

    2008-12-01

    Industrially produced carbon-based nanomaterials, including fullerenes and fullerols, will be introduced into the environment in increasing amounts over the next century. Oxygenated fullerenes are likely to be produced in the environment through both biotic and abiotic weathering, and yet the environmental fate of compounds like hydroxylated fullerenes are almost unknown. This study examines the ability of two white rot basidiomycete fungi (Phlebia tremellosa and Trametes versicolor) to metabolize and degrade 13C-labeled C60 fullerol. Both of these fungi were shown to degrade fullerol to CO2 both in the presence of wood tissue and without, and incorporate trace amounts of the carbon into fungal biomass. Absorbance data also indicate that a significant portion of the original fullerol was broken down into small molecular weight metabolites. Phlebia tremellosa proved to be, in general, more aggressive towards fullerol degradation than Trametes versicolor. These findings represent the report of fungal degradation of this important nanomaterial and also provide valuable information about the possible environmental fates of this compound.

  7. Microfungal contamination of damp buildings--examples of risk constructions and risk materials.

    PubMed

    Gravesen, S; Nielsen, P A; Iversen, R; Nielsen, K F

    1999-06-01

    To elucidate problems with microfungal infestation in indoor environments, a multidisciplinary collaborative pilot study, supported by a grant from the Danish Ministry of Housing and Urban Affairs, was performed on 72 mold-infected building materials from 23 buildings. Water leakage through roofs, rising damp, and defective plumbing installations were the main reasons for water damage with subsequent infestation of molds. From a score system assessing the bioavailability of the building materials, products most vulnerable to mold attacks were water damaged, aged organic materials containing cellulose, such as wooden materials, jute, wallpaper, and cardboard. The microfungal genera most frequently encountered were Penicillium (68%), Aspergillus (56%), Chaetomium (22%), Ulocladium, (21%), Stachybotrys (19%) and Cladosporium (15%). Penicillium chrysogenum, Aspergillus versicolor, and Stachybotrys chartarum were the most frequently occurring species. Under field conditions, several trichothecenes were detected in each of three commonly used building materials, heavily contaminated with S. chartarum. Under experimental conditions, four out of five isolates of S. chartarum produced satratoxin H and G when growing on new and old, very humid gypsum boards. A. versicolor produced the carcinogenic mycotoxin sterigmatocystin and 5-methoxysterigmatocystin under the same conditions. PMID:10347000

  8. Regulation of coal polymer degradation by fungi. Fourth quarterly progress report, May 1995--June 1995

    SciTech Connect

    Irvine, R.L.

    1995-07-24

    To test the hypothesis that coal (leonardite) Solubilization and the subsequent depolymerization of the solubilized coal macromolecules are distinct events in lignin degrading fungi. In addition to T versicolor, Phanerochaete chrysosporium, another lignin degrading fungus that also has the ability to solubilize coal, will be studied. To test the hypothesis that the processes of coal (leonardite) solubilization and coal macro molecule depolymerization in lignin degrading fungi can be regulated by altering the nutritional status of the microorganism. Coal solubilization is expected to occur in nutrient rich media whereas depolymerization of solubilized coal macromolecules is expected to occur in nutrient limited media. To determine the role of extracellular enzymes (laccases, lignin peroxidases and Mn peroxidases) that are secreted by lignin degrading fungi during coal solubilization or coal macro molecule depolymerization. To assess the role of enzymatically generated oxygen radicals, non-radical active oxygen species, veratryl alcohol radicals and Mn{sup +++} complexes in coal macro molecule depolymerization. To characterize products of coal solubilization and coal macro molecule depolymerization that are formed by T. versicolor and P. chrysosporium and their respective extracellular enzymes. Solubilization products formed using oxalic acid and other metal chelators will also be characterized and compared.

  9. Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing

    PubMed Central

    Rittenour, William R.; Park, Ju-Hyeong; Cox-Ganser, Jean M.; Beezhold, Donald H.; Green, Brett J.

    2015-01-01

    Traditional methods of assessing fungal exposure have been confounded by a number of limiting variables. The recent utilization of molecular methods such as internal transcribed spacer (ITS) sequencing of ribosomal RNA genes has provided improved insight into the diversity of fungal bioaerosols in indoor, outdoor and occupational environments. However, ITS analyses may also be confounded by a number of methodological limitations. In this study, we have optimized this technology for use in occupational or environmental studies. Three commonly used DNA extraction methodologies (UltraClean Soil kit, High Pure PCR Template kit, and EluQuik/DNeasy kit) were compared in terms of sensitivity and susceptibility to PCR inhibitors in dust for three common fungal bioaerosols, Aspergillus versicolor, Rhizopus microsporus and Wallemia sebi. Environmental dust samples were then studied using each extraction methodology and results were compared to viable culture data. The extraction methods differed in terms of their ability to efficiently extract DNA from particular species of fungi (e.g. Aspergillus versicolor). In addition, the ability to remove PCR inhibitors from dust samples was most effective using the soil DNA extraction kit. The species composition varied greatly between ITS clone libraries generated with the different DNA extraction kits. However, compared to viable culture data, ITS clone libraries included additional fungal species that are incapable of growth on solid culture medium. Collectively, our data indicated that DNA extraction methodologies used in ITS sequencing studies of occupational or environmental dust samples can greatly influence the fungal species that are detected. PMID:22230933

  10. Screening of ligninolytic fungi for biological pretreatment of lignocellulosic biomass.

    PubMed

    Xu, Chunyan; Singh, Deepak; Dorgan, Kathleen M; Zhang, Xiaoyu; Chen, Shulin

    2015-10-01

    To identify white rot fungi with high potential in biological pretreatment of lignocellulosic biomass, preliminary screening was carried out on plates by testing different strains for their ability to oxidize guaiacol and decolorize the dyes azure B and Poly R-478. Of the 86 strains screened, 16 were selected for secondary screening for their ligninolytic ability; however, low manganese peroxidase activity and no lignin peroxidase activity were detected. Strain BBEL0970 proved to be the most efficient in laccase production and was subsequently identified as Trametes versicolor by analysis of the ribosomal DNA internal transcribed spacer gene sequence. In combining laccase production with biological pretreatment, the replacement of glucose with barley straw significantly improved the laccase activity by up to 10.3 U/mL, which provided evidence toward potential utilization of barley straw in laccase production by BBEL0970. Simultaneously, comparison by thermogravimetric analysis of the untreated and pretreated barley straw in liquid fermentation of laccase also demonstrated the high potential of BBEL0970 in biological pretreatment of lignocellulosic biomass. This work sheds light on further exploration on the integrated process of low-cost laccase production and efficient biological pretreatment of barley straw by T. versicolor BBEL0970. PMID:26286682

  11. Biotransformation of fluoroquinolone antibiotics by ligninolytic fungi--Metabolites, enzymes and residual antibacterial activity.

    PubMed

    ?van?arová, Monika; Moeder, Monika; Filipová, Alena; Cajthaml, Tomáš

    2015-10-01

    A group of white rot fungi (Irpex lacteus, Panus tigrinus, Dichomitus squalens, Trametes versicolor and Pleurotus ostreatus) was investigated for the biodegradation of norfloxacin (NOR), ofloxacin (OF) and ciprofloxacin (CIP). The selected fluoroquinolones were readily degraded almost completely by I. lacteus and T. versicolor within 10 and 14 d of incubation in liquid medium, respectively. The biodegradation products were identified by liquid chromatography-mass spectrometry. The analyses indicated that the fungi use similar mechanisms to degrade structurally related antibiotics. The piperazine ring of the molecules is preferably attacked via either substitution or/and decomposition. In addition to the degradation efficiency, attention was devoted to the residual antibiotic activities estimated using Gram-positive and Gram-negative bacteria. Only I. lacteus was able to remove the antibiotic activity during the course of the degradation of NOR and OF. The product-effect correlations evaluated by Principal Component Analysis (PCA) enabled elucidation of the participation of the individual metabolites in the residual antibacterial activity. Most of the metabolites correlated with the antibacterial activity, explaining the rather high residual activity remaining after the biodegradation. PCA of ligninolytic enzyme activities indicated that manganese peroxidase might participate in the degradation. PMID:25592459

  12. White-rot fungi capable of decolourising textile dyes under alkaline conditions.

    PubMed

    Ottoni, Cristiane A; Santos, Cledir; Kozakiewicz, Zofia; Lima, Nelson

    2013-05-01

    Twelve white-rot fungal strains belonging to seven different species were screened on plates under alkaline condition to study the decolourisation of the textile dyes Reactive Black 5 and Poly R-478. Three strains of Trametes versicolor (Micoteca da Universidade do Minho (MUM) 94.04, 04.100 and 04.101) and one strain of Phanerochaete chrysosporium (MUM 94.15) showed better decolourisation results. These four strains were used for decolourisation studies in liquid culture medium. All four selected strains presented more efficient decolourisation rates on Reactive Black 5 than on Poly R-478. For both dyes on solid and liquid culture media, the decolourisation capability exhibited by these strains depended on dye concentration and pH values of the media. Finally, the decolourisation of Reactive Black 5 by T. versicolor strains MUM 94.04 and 04.100 reached 100 %. In addition, the highest white-rot fungi ligninolytic enzyme activities were found for these two strains. PMID:23008155

  13. Synthetic dye decolorization by three sources of fungal laccase.

    PubMed

    Forootanfar, Hamid; Moezzi, Atefeh; Aghaie-Khozani, Marzieh; Mahmoudjanlou, Yasaman; Ameri, Alieh; Niknejad, Farhad; Faramarzi, Mohammad Ali

    2012-01-01

    Decolorization of six synthetic dyes using three sources of fungal laccase with the origin of Aspergillus oryzae, Trametes versicolor, and Paraconiothyrium variabile was investigated. Among them, the enzyme from P. variabile was the most efficient which decolorized bromophenol blue (100%), commassie brilliant blue (91%), panseu-S (56%), Rimazol brilliant blue R (RBBR; 47%), Congo red (18.5%), and methylene blue (21.3%) after 3 h incubation in presence of hydroxybenzotriazole (HBT; 5 mM) as the laccase mediator. It was also observed that decolorization efficiency of all dyes was enhanced by increasing of HBT concentration from 0.1 mM to 5 mM. Laccase from A. oryzae was able to remove 53% of methylene blue and 26% of RBBR after 30 min incubation in absence of HBT, but the enzyme could not efficiently decolorize other dyes even in presence of 5 mM of HBT. In the case of laccase from T. versicolor, only RBBR was decolorized (93%) in absence of HBT after 3 h incubation. PMID:23369690

  14. Microfungal contamination of damp buildings--examples of risk constructions and risk materials.

    PubMed Central

    Gravesen, S; Nielsen, P A; Iversen, R; Nielsen, K F

    1999-01-01

    To elucidate problems with microfungal infestation in indoor environments, a multidisciplinary collaborative pilot study, supported by a grant from the Danish Ministry of Housing and Urban Affairs, was performed on 72 mold-infected building materials from 23 buildings. Water leakage through roofs, rising damp, and defective plumbing installations were the main reasons for water damage with subsequent infestation of molds. From a score system assessing the bioavailability of the building materials, products most vulnerable to mold attacks were water damaged, aged organic materials containing cellulose, such as wooden materials, jute, wallpaper, and cardboard. The microfungal genera most frequently encountered were Penicillium (68%), Aspergillus (56%), Chaetomium (22%), Ulocladium, (21%), Stachybotrys (19%) and Cladosporium (15%). Penicillium chrysogenum, Aspergillus versicolor, and Stachybotrys chartarum were the most frequently occurring species. Under field conditions, several trichothecenes were detected in each of three commonly used building materials, heavily contaminated with S. chartarum. Under experimental conditions, four out of five isolates of S. chartarum produced satratoxin H and G when growing on new and old, very humid gypsum boards. A. versicolor produced the carcinogenic mycotoxin sterigmatocystin and 5-methoxysterigmatocystin under the same conditions. PMID:10347000

  15. Trametes meyenii possesses elevated dye degradation abilities under normal nutritional conditions compared to other white rot fungi

    PubMed Central

    2014-01-01

    Several species of white-rot fungi were investigated for their utility in prolonged decolouration of the recalcitrant sulfonated azo dye, amaranth. Trametes pubescens, T. multicolor, T. meyenii and T. versicolor decoloured amaranth azo-dye best on low-nitrogen agar-solidified media whereas Bjerkandera adusta and Phlebia radiata were most effective in low nitrogen medium supplemented with manganese. Trametes cotonea did not decolour effectively under any condition. The decolouring Trametes species were also effective in liquid culture whereas B. adusta and P. radiata were not. Trametes meyenii, T. pubescens and T. multicolor were equal to or better than commonly employed T. versicolor at decolouring amaranth. This is the first study to show the dye decolouration potential of T. meyenii, T. pubescens, and T. multicolor. Supplementing with Mn(II) increased assayable manganese peroxidase activity, but not long-term decolouration, indicating that laccase is the main decolourizing enzyme in these Trametes species. This appears to be because of inadequate Mn3+ chelation required by manganese peroxidase because adding relatively low amounts of malonate enhanced decolouration rates. The ability of Trametes meyenii to simultaneously decolour dye over prolonged periods of time while growing in relatively nutrient-rich medium appears to be unique amongst white-rot fungi, indicating its potential in wastewater bioremediation. PMID:25401075

  16. Antiviral activity of Basidiomycete mycelia against influenza type A (serotype H1N1) and herpes simplex virus type 2 in cell culture.

    PubMed

    Krupodorova, Tetiana; Rybalko, Svetlana; Barshteyn, Victor

    2014-10-01

    In this study, we investigated the in vitro antiviral activity of the mycelia of higher mushrooms against influenza virus type A (serotype H1N1) and herpes simplex virus type 2 (HSV-2), strain BH. All 10 investigated mushroom species inhibited the reproduction of influenza virus strain A/FM/1/47 (H1N1) in MDCK cells reducing the infectious titer by 2.0-6.0 lg ID50. Four species, Pleurotus ostreatus, Fomes fomentarius, Auriporia aurea, and Trametes versicolor, were also determined to be effective against HSV-2 strain BH in RK-13 cells, with similar levels of inhibition as for influenza. For some of the investigated mushroom species-Pleurotus eryngii, Lyophyllum shimeji, and Flammulina velutipes-this is the first report of an anti-influenza effect. This study also reports the first data on the medicinal properties of A. aurea, including anti-influenza and antiherpetic activities. T. versicolor 353 mycelium was found to have a high therapeutic index (324.67), and may be a promising material for the pharmaceutical industry as an anti-influenza and antiherpetic agent with low toxicity. Mycelia with antiviral activity were obtained in our investigation by bioconversion of agricultural wastes (amaranth flour after CO2 extraction), which would reduce the cost of the final product and solve some ecological problems. PMID:25358999

  17. [Influence of different types of ionizing radiation on fatty acid profiles of cell lipids in microscopic fungi with radioadaptive properties].

    PubMed

    Tuha?, T I; Buzarova, O I; Zheltonozhz'ky?, V A; Sadovnykov, L V

    2011-01-01

    The fatty acid profiles of strains of dark-pigmented (melanin-containing) species Cladosporium cladosporioides and Hormoconis resinae, and light-pigmented Aspergillus versicolor and Paecilomyces lilacinus, showing radioadaptive properties in comparison with control strains of the same species, which did not have such properties and the influence on them of two (121Sn; 137Cs) types of ionizing radiation have been studied. It was established that the most important fatty acids were hexadecanoic acid (C16:0), octadecanoic acid (C18:0), octadecenoic acid (C18:1) and octadecadienoic acid (C18:2). The strains, showing radioadaptive properties in comparison with control differed in the relative concentrations of saturated and unsaturated fatty acids and some minor components. The two types of radiation had different influence on the fatty acid profiles of the investigated strains. At dark-pigmented species C. cladosportoides, H. resinae the fatty acid unsaturation rate was higher, at strains showing radioadaptive properties (0.98) as against control ones (0.73; 0.9), and at light-pigmented species A. versicolor and P lilacinus--it was lower at strains with radioadaptive properties (1.00; 0.83) as against control ones (1.08; 0.92). The paper is presented in Ukrainian. PMID:21598656

  18. La quimioterapia y usted

    Cancer.gov

    Hable con su doctor y enfermera sobre lo que puede esperar durante la quimioterapia. Es posible que le sugieran que lea ciertas secciones de este libro. También podrían sugerirle que siga algunos consejos que se dan en este libro para controlar los efectos secundarios. No lea este libro de principio a fin. Lea sólo aquellas secciones que necesita ahora. Consulte el índice para ver una lista de los temas que se tratan en este libro.

  19. Miami: Meca del exilio cubano y escenario medido aunque efervescente

    E-print Network

    Rizk, Beatriz J.

    2000-10-01

    esenciales de una identidad cultural" (2000); o por "transparentar mediante los personajes secundarios las coordenadas históricas y la relación entre el medio familiar y la sociedad..[que] conectan el microcosmos del taller con la amplitud del universo..., El extravío (1987-88) de Julio Matas y hasta a la singular parodia Las hetairas habaneras (una melotragedia cubana) (1977) de José Corrales y Manuel Pereira, escritas en el exilio. Ahora, si dentro de estas familias, microcosmos de la sociedad, los...

  20. Educación no formal

    NASA Astrophysics Data System (ADS)

    Tignanelli, H.

    Se comentan en esta comunicación, las principales contribuciones realizadas en el campo de la educación en astronomía en los niveles primario, secundario y terciario, como punto de partida para la discusión de la actual inserción de los contenidos astronómicos en los nuevos contenidos curriculares de la EGB - Educación General Básica- y Polimodal, de la Reforma Educativa. En particular, se discuten los alcances de la educación formal y no formal, su importancia para la capacitación de profesores y maestros, y perspectivas a futuro.

  1. [Tropical and travel-related dermatomycoses : Part 2: cutaneous infections due to yeasts, moulds, and dimorphic fungi].

    PubMed

    Nenoff, P; Reinel, D; Krüger, C; Grob, H; Mugisha, P; Süß, A; Mayser, P

    2015-07-01

    Besides dermatophytoses, a broad range of cutaneous infections due to yeasts and moulds may occur in subtropical and tropical countries where they can affect travellers. Not to be forgotten are endemic occurring dimorphic or biphasic fungi in countries with hot climate, which cause systemic and secondary cutaneous infections in immunosuppressed and immunocompetent people. In the tropics, the prevalence of pityriasis versicolor, caused by the lipophilic yeast Malassezia spp., is about 30-40?%, in distinct areas even 50?%. Increased hyperhidrosis under tropical conditions and simultaneously humidity congestion have to be considered as significant disposing factors for pityriasis versicolor. In tropical countries, therefore, an exacerbation of a preexisting pityriasis versicolor in travellers is not rare. Today, mostly genital yeast infections due to the new species Candida africana can be found worldwide. Due to migration from Africa this yeast pathogen has reached Germany and Europe. Eumycetomas due to mould fungi are rarely diagnosed in Europe. These deep cutaneous mould infections are only found in immigrants from African countries. The therapy of eumycetoma is protracted and often not successful. Cutaneous cryptococcoses due to the yeast species Cryptococcus neoformans and Cryptococcus gattii occur worldwide; however, they are found more frequently in the tropics. Immunosuppressed patients, especially those with HIV/AIDS, are affected by cryptococcoses. Furthermore, Cryptococcus gattii also causes infections in immunocompetent hosts in Central Africa, Australia, California, and Central America.Rarely found are infections due to dimorphic fungi after travel to countries where these fungal pathogens are endemic. In individual cases, cutaneous or lymphogenic transferred sporotrichosis due to Sporothrix schenkii can occur. Furthermore, scarcely known is secondary cutaneous coccidioidomycosis due to Coccidioides immitis after travelling to desert-like endemic regions in southwestern states of the United States and in Latin America, where primary respiratory infection due to this biphasic fungus can be acquired. The antifungal agent itraconazole is the treatment of choice for sporotrichosis and coccidioidomycosis. Talaromyces marneffei-until recently known as Penicillium marneffei-is only found in Southeastern Asia. Mycosis due to this dimorphic fungus has to be considered as an AIDS-defining opportunistic infection. After hematogeneous spread, Talaromyces marneffei affects the skin and mucous membranes of the mouth. Amphotericin B and itraconazole can be used for therapy. PMID:25924703

  2. Dermatophytes and other associated fungi in patients attending to some hospitals in Egypt

    PubMed Central

    Abd Elmegeed, Al Shimaa M.; Ouf, S.A.; Moussa, Tarek A.A.; Eltahlawi, S.M.R.

    2015-01-01

    Dermatophytes are keratinophilic fungi that infect keratinized tissues causing diseases known as dermatophytoses. Dermatophytes are classified in three genera, Epidermophyton, Microsporum, and Trichophyton. This investigation was performed to study the prevalence of dermatomycosis among 640 patients being evaluated at the dermatology clinics at Kasr elainy, El-Husein and Said Galal hospitals in Cairo and Giza between January 2005 and December 2006. The patients were checked for various diseases. Tinea capitis was the most common clinical disease followed by tinea pedis and tinea corporis. Tinea cruris and tinea unguium were the least in occurrence. Tinea versicolor also was detected. The most susceptible persons were children below 10 years followed by those aged 31–40 years. Unicellular yeast was the most common etiological agent and T. tonsuranswas the second most frequent causative agent followed by M. canis. PMID:26413063

  3. Screening for ligninolytic enzymes from autochthonous fungi and applications for decolorization of Remazole Marine Blue.

    PubMed

    Erden, Emre; Ucar, M Cigdem; Gezer, Tekin; Pazarlioglu, Nurdan Kasikara

    2009-04-01

    This study presents new and alternative fungal strains for the production of ligninolytic enzymes which have great potential to use in industrial and biotechnological processes. Thirty autochthonous fungal strains were harvested from Bornova-Izmir in Turkiye. In the fresh fruitbody extracts laccase, manganese peroxidase and lignin peroxidase activities, which are the principal enzymes responsible for ligninocellulose degradation by Basidiomycetes, were screened. Spores of some of the basidiomycetes species such as Cortinarius sp., Trametes versicolor, Pleurotus ostreatus, Abortiporus biennis, Lyophyllum subglobisporium, Ramaria stricta, Ganoderma carnosum, Lactarius delicious ve Lepista nuda were isolated and investigated optimum cultivation conditions in submerged fermentation for high yields of ligninolytic enzyme production. In addition, isolated fungal strains were monitored on agar plates whether having the capability of decolorization of a textile dye Remazol Marine Blue. PMID:24031371

  4. [Skin sampling for the general practitioner].

    PubMed

    André, J; Richert, B

    2015-09-01

    Skin samplings are easily performed in general practice. They include skin biopsies, nail clippings, skin scrappings, hair pluckings as well as trichograms. The different types of skin biopsies are curetage, shaving, punch and elliptic biopsies. They are most commonly used for the diagnosis of inflammatory skin conditions and cutaneous tumors. The biopsies are performed under local anesthesia and each has specific indications. Their complications are minimal. In order to obtain as much information as possible the lesion to be biopsied should be judiciously selected, harvested without being harmed and sent to a skin-oriented pathologist. Nail clippings, skin scrapings and hair plucking allow diagnosis of superficial skin mycosis (tinea, pityriasis versicolor) and are mandatory before prescribing systemic treatment. Scrapping of an itch mite burrow may sometimes reveal the sarcopte. Trichogram may be useful in the work up of a hair loss. PMID:26591312

  5. Regulation of Coal Polymer Degradation by Fungi

    SciTech Connect

    Irvin, R.L.; Bumpus, J.A.

    1997-04-30

    Previous studies in our laboratory used a spectrophotometric assay to study biomimetic solubilization of leonardite by sodium oxalate. It was found, however, that in extended incubations of several days, this assay resulted in overestimation of the percent of leonardite that was solubilized. This problem did not appear to be significant for short term incubations (ie., up to -24 h) and was circumvented in long term incubations by using a gravimetric assay to assay for solubilization. In other studies during this reporting period we examined oxalate production by P. chrysosporium and T. versicolor grown in Fahreus-Reinhammar medium in agitated pelleted culture. It was found that in this system concentrations of oxalate are produced that are much lower than those that would be optimal for leonardite solubilization.

  6. The GSTome Reflects the Chemical Environment of White-Rot Fungi

    PubMed Central

    Deroy, Aurélie; Saiag, Fanny; Kebbi-Benkeder, Zineb; Touahri, Nassim; Hecker, Arnaud; Morel-Rouhier, Mélanie; Colin, Francis; Dumarcay, Stephane; Gérardin, Philippe; Gelhaye, Eric

    2015-01-01

    White-rot fungi possess the unique ability to degrade and mineralize all the different components of wood. In other respects, wood durability, among other factors, is due to the presence of extractives that are potential antimicrobial molecules. To cope with these molecules, wood decay fungi have developed a complex detoxification network including glutathione transferases (GST). The interactions between GSTs from two white-rot fungi, Trametes versicolor and Phanerochaete chrysosporium, and an environmental library of wood extracts have been studied. The results demonstrate that the specificity of these interactions is closely related to the chemical composition of the extracts in accordance with the tree species and their localization inside the wood (sapwood vs heartwood vs knotwood). These data suggest that the fungal GSTome could reflect the chemical environment encountered by these fungi during wood degradation and could be a way to study their adaptation to their way of life. PMID:26426695

  7. The GSTome Reflects the Chemical Environment of White-Rot Fungi.

    PubMed

    Deroy, Aurélie; Saiag, Fanny; Kebbi-Benkeder, Zineb; Touahri, Nassim; Hecker, Arnaud; Morel-Rouhier, Mélanie; Colin, Francis; Dumarcay, Stephane; Gérardin, Philippe; Gelhaye, Eric

    2015-01-01

    White-rot fungi possess the unique ability to degrade and mineralize all the different components of wood. In other respects, wood durability, among other factors, is due to the presence of extractives that are potential antimicrobial molecules. To cope with these molecules, wood decay fungi have developed a complex detoxification network including glutathione transferases (GST). The interactions between GSTs from two white-rot fungi, Trametes versicolor and Phanerochaete chrysosporium, and an environmental library of wood extracts have been studied. The results demonstrate that the specificity of these interactions is closely related to the chemical composition of the extracts in accordance with the tree species and their localization inside the wood (sapwood vs heartwood vs knotwood). These data suggest that the fungal GSTome could reflect the chemical environment encountered by these fungi during wood degradation and could be a way to study their adaptation to their way of life. PMID:26426695

  8. Identification of some factors affecting pharmaceutical active compounds (PhACs) removal in real wastewater. Case study of fungal treatment of reverse osmosis concentrate.

    PubMed

    Badia-Fabregat, Marina; Lucas, Daniel; Gros, Meritxell; Rodríguez-Mozaz, Sara; Barceló, Damià; Caminal, Glòria; Vicent, Teresa

    2015-02-11

    Many technologies are being developed for the efficient removal of micropollutants from wastewater and, among them, fungal degradation is one of the possible alternative biological treatments. In this article, some factors that might affect pharmaceutically active compounds (PhACs) removal in a fungal treatment of real wastewater were identified in batch bioreactor treating reverse osmosis concentrate (ROC) from urban wastewater treatment plant (WWTP). We found that degradation of PhACs by Trametes versicolor was enhanced by addition of external nutrients (global removal of 44%). Moreover, our results point out that high aeration might be involved in the increase in the concentration of some PhACs. In fact, conjugation and deconjugation processes (among others) affect the removal assessment of emerging contaminants when working with real concentrations in comparison to experiments with spiked samples. Moreover, factors that could affect the quantification of micropollutants at lab-scale experiments were studied. PMID:25464308

  9. New microsatellite markers for Campanula pyramidalis (Campanulaceae) and cross-amplification in closely related species1

    PubMed Central

    Radosavljevi?, Ivan; Jakse, Jernej; Satovic, Zlatko; Javornik, Branka; Jankovi?, Ivana; Liber, Zlatko

    2015-01-01

    Premise of the study: Microsatellite markers were identified and characterized to study the genetic diversity and structure, conservation status, taxonomy, and biogeography of subspecific taxa and populations of Campanula pyramidalis (Campanulaceae). Methods and Results: Eleven microsatellite markers were developed from genomic libraries enriched for di- and trinucleotide repeats. A total of 80 alleles were observed in the tested natural population. The number of alleles per locus, observed heterozygosity, and expected heterozygosity ranged from four to 13, 0.217 to 0.913, and 0.521 to 0.895, respectively. Conclusions: The new microsatellite markers will be useful for studying genetic diversity and structure as well as for better assessing the conservation status of subspecific taxa and populations of C. pyramidalis. Furthermore, a set of seven loci was successfully cross-amplified in C. secundiflora and C. versicolor and will be of great value for addressing unsolved taxonomic and biogeographic issues within the C. pyramidalis species complex. PMID:25798343

  10. Combined submerged and solid substrate fermentation for the bioconversion of lignocellulose

    SciTech Connect

    Viesturs, U.E.; Strikauska, S.V.; Leite, M.P.; Berzins, A.J.; Tengerdy, R.P.

    1987-01-01

    A novel two-stage bioreactor has been designed for a combined submerged (SF) and solid substrate fermentation (SSF) of wheat straw. The straw was pretreated with steam, and cellulases from the culture fluid of Trichoderma reesei were adsorbed on it for increased bio-convertibility. SSF was conducted in the top part of the bioreactor by inoculating the straw with a 36-h mycelial culture of T. reesei, or Coriolus versicolor. In the bottom part of the fermenter, Endomycopsis fibuliger was grown in SF. The SF liquor was recirculated through the SSF stage at 24 hour intervals to remove glucose and other metabolites that may inhibit growth, and to maintain optimum moisture level and temperature. The removed glucose and other metabolites provided nutrients for the yeast in the SF stage. The combined fermentation resulted in overall higher biomass yield, increased bioconversion, increased cellulase production, and increased digestibility compared with single SSF or SF. (Refs. 16).

  11. Distribution and mycotoxin-producing ability of some fungal isolates from the air

    NASA Astrophysics Data System (ADS)

    Cvetni?, Zdenka; Pepeljnjak, S.

    Research was carried out on presence and prevalence of common fungal air spores at locations in Croatia. The sampling method employed in the study was by exposure 350 of Petri agar plates to the air for 10 min. Approximately 3400 colonies were found and mould spores belonging to 22 fungal genera were identified. Cladosporium (44.7%), Penicillium (34.4%), Alternaria (26.3%), Aspergillus (21.6%) and Absidia (12.2%) were the most prevalent fungi encountered. Investigation of toxigenic potential of airborne fungi isolates of genera Aspergillus, Fusarium and Trichoderma showed 16.9% mycotoxin-producing strains. The production of aflatoxin B 1 by A. flavus sterigmatocystin by A. versicolor zearalenon and T-2 toxin by F. graminearum and diacetoscirpenol by strains of T. viride were obtained.

  12. Common disorders of pigmentation: when are more than cosmetic cover-ups required?

    PubMed

    Hacker, S M

    1996-06-01

    The many types of pigmentation disorders may present in diverse forms and distributions and have various causes. They can be inherited (eg, vitiligo, familial periorbital hyperpigmentation), acquired (eg, postinflammatory pityriasis alba, idiopathic guttate hypomelanosis, Becker's nevus, melasma), infectious (eg, tinea versicolor), benign and self-limiting (eg, isolated café au lait spots, photocontact dermatitis), or a sign of more serious underlying disease (eg, multiple café au lait spots, malignant acanthosis nigricans). Primary care physicians see many patients with skin complaints and can often accomplish the early recognition and appropriate treatment that is paramount to cost-effective medicine. In many cases, an important aspect of patient care is education toward realistic expectations, because even with referral and use of extensive treatment, cosmetic results may be disappointing. Assuring patients that the disorder is not dangerous and providing tips on sunscreen and cosmetic use may be the best approach in some cases. PMID:8668630

  13. Management of Cosmetic Embarrassment Caused by Malassezia spp. with Fruticose Lichen Cladia Using Phylogenetic Approach

    PubMed Central

    Pandey, Anand; Mishra, Rohit K.; Tiwari, Amit K.; Kumar, Awadhesh; Bajaj, A. K.; Dikshit, Anupam

    2013-01-01

    During anti-Malassezia screening of plants by CLSI broth microdilution method, Cladia aggregata (Swartz) Nyl. (family Cladoniaceae), a fruticose lichen from Sikkim (northeast Himalayan region), has been found effective at minimum inhibitory concentrations (mg/mL) of 2.72, 0.63, and 1.28 against yeast-like fungi namely, M. furfur, M. globosa and M. sympodialis, respectively. These test pathogens are responsible for pityriasis versicolor (PV) and seborrheic dermatitis (SD) in humans. We tried to establish the reason for variable MICs against various Malassezia spp. using bioinformatical tools, thereby reducing the cost of the experimentation. This is the first report on anti-Malassezia activity of C. aggregata and thus can serve as a potential source for the development of cosmaceuticals. PMID:24069589

  14. Differential Expression of Extracellular Lipase and Protease Activities of Mycelial and Yeast Forms in Malassezia furfur.

    PubMed

    Juntachai, Weerapong; Kajiwara, Susumu

    2015-10-01

    Malassezia furfur is a dimorphic yeast that is part of the human skin microflora. This fungus is a pathogen of a certain skin diseases, such as pityriasis versicolor, and in rare cases causes systemic infection in neonates. However, the role of dimorphism in the pathogenicity remains unclear. A modified induction medium (IM) was successfully able to induce mycelial growth of M. furfur under both solid and liquid condition. Filamentous elements with branching hyphae were observed when cultured in the IM. Furthermore, addition of bovine fetus serum into the liquid IM did not promote hyphal formation; on the contrary, it retrograded hyphae to the yeast form. Plate-washing assay showed that M. furfur hyphae did not possess the ability of invasive growth. Secretory proteins from both yeast and hyphal forms were isolated, and lipase and protease activities were analyzed. Intriguingly, the hyphal form showed higher activities than those of the yeast form, particularly the protease activity. PMID:26173769

  15. Degradation of lignin in pulp mill wastewaters by white-rot fungi on biofilm.

    PubMed

    Wu, Juan; Xiao, Ya-Zhong; Yu, Han-Qing

    2005-08-01

    An investigation was conducted to explore the lignin-degrading capacity of attached-growth white-rot fungi. Five white-rot fungi, Phanerochaete chrysosporium, Pleurotus ostreatus, Lentinus edodes, Trametes versicolor and S22, grown on a porous plastic media, were individually used to treat black liquor from a pulp and paper mill. Over 71% of lignin and 48% of chemical oxygen demand (COD) were removed from the wastewater. Several factors, including pH, concentrations of carbon, nitrogen and trace elements in wastewater, all had significant effects on the degradation of lignin and the removal of COD. Three white-rot fungi, P. chrysosporium, P. ostreatus and S22, showed high capacity for lignin degradation at pH 9.0-11.0. The addition of 1 g l-1 glucose and 0.2 g l-1 ammonium tartrate was beneficial for the degradation of lignin by the white-rot fungi studied. PMID:15792583

  16. Biological solubilization of low-rank coal

    SciTech Connect

    Cohen, M.S.

    1991-07-01

    Low-ranked coals have been solubilized using cell-free extracts derived from liquid cultures of the white-rot fungus Trametes versicolor. The coal solubilizing agent (CSA) has been separated from the broth components and purified by several analytical techniques including rotary evaporation, reverse osmosis, and solvent extraction. The recrystallized CSA retains coal solubilizing activity. Results from polarography, FTIR, and x-ray crystallography confirm that the purified CSA crystals responsible for coal-solubilization are ammonium oxalate monohydrate. The mechanism of solubilization has been deduced to involve removal of divalent cations (particularly iron FE(III)) from low-rank coals. This is followed by dissolution of the macromolecular coal structure. 38 figs., 9 tabs.

  17. The Wood-rotting Fungal Flora of Three Islands in the Yellow Sea, Korea

    PubMed Central

    Kim, Changmu; Lee, Jin Sung; Jung, Hack Sung

    2009-01-01

    The wood-rotting fungi of three Korean islands in the Yellow Sea, Soyeonpyung-do (SY), Oeyeon-do (OY), and Gageo-do (GG), were investigated from October 2004 to November 2005. During four sampling trips on each island, a total of 46, 44, and 44 specimens were collected from SY, OY, and GG, respectively. The identified wood-rotting fungi from SY included 29 species of 22 genera and nine families; OY had 31 species of 26 genera and 10 families; and GG had 34 species of 27 genera and 11 families. The majority of the fungi were in the Polyporaceae, which was represented by 23 genera and 30 species. Auricularia polytricha, Daedaleopsis tricolor, Daldinia concentrica, Hymenochaete cinnamomea, Hymenochaete yasudai, Hyphoderma setigerum, Lopharia mirabilis, Schizopora paradoxa, and Trametes versicolor were collected from all three islands. PMID:23983524

  18. Potentialities of a Membrane Reactor with Laccase Grafted Membranes for the Enzymatic Degradation of Phenolic Compounds in Water

    PubMed Central

    Chea, Vorleak; Paolucci-Jeanjean, Delphine; Sanchez, José; Belleville, Marie-Pierre

    2014-01-01

    This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR). The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto ?-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP) was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP) to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L?1), consumption increased with flux (up to 7.9 × 103 mg·h?1·m?2 at 128 L·h?1·m?2), whereas at the highest substrate concentration (500 mg·L?1), it was shown that the reaction was limited by the oxygen content. PMID:25295628

  19. The effect of combination enzymatic and advanced oxidation process treatments on the colour of pulp and paper mill effluent.

    PubMed

    Karimi, Samaneh; Abdulkhani, Ali; Karimi, Alinaghi; Ghazali, Abdul Halim B; Ahmadun, Fakhru L-Razi

    2010-04-01

    The efficiency of advanced oxidation processes (AOPs), enzymatic treatment and combined enzymatic/AOP sequences for the colour remediation of soda and chemimechanical pulp and paper mill effluent was investigated. The results indicated that under all circumstances, the AOP using ultraviolet irradiation (photo-Fenton) was more efficient in the degradation of effluent components in comparison with the dark reaction. It was found that both versatile peroxidase (VP) from Bjerkandera adusta and laccase from Trametes versicolor, as pure enzymes, decolorize the deep brown effluent to a clear light-yellow solution. In addition, it was found that in the laccase treatment, the decolorization rates of both effluents were enhanced in the presence of 2, 2'-azinobis (3-ethylbenzthiazoline-6-sulfonate), while in the case of VP, Mn(+2) decreased the efficiency of the decolorization treatment. The concomitant use of enzymes and AOPs imposes a considerable effect on the colour remediation of effluent samples. PMID:20450108

  20. The comparative study of a laccase-natural clinoptilolite-based catalyst activity and free laccase activity on model compounds.

    PubMed

    Donati, Enrica; Polcaro, Chiara M; Ciccioli, Piero; Galli, Emanuela

    2015-05-30

    For the first time a laccase from Trametes versicolor was immobilized on a natural clinoptilolite with Si/Al=5 to obtain a biocatalyst for environmental applications. Immobilization procedures exploiting adsorption and covalent binding were both tested, and only the last provided enough activity for practical applications. The optimal conditions for the immobilization of the enzyme on the support and the kinetic parameters for the free and covalent bonded laccase were determined. The laccase bonded to the zeolitic support showed a lower activity than the free laccase, but the pH and thermal stability were greater. 20 mg of dry biocatalyst containing 1 U of laccase were able to remove in 50h 73-78% of 2-chlorophenol and 2,4-dichlorophenol in relatively concentrated aqueous solutions (100 ?mol L(-1)). PMID:25710818

  1. Dermatophytes and other associated fungi in patients attending to some hospitals in Egypt.

    PubMed

    Abd Elmegeed, Al Shimaa M; Ouf, S A; Moussa, Tarek A A; Eltahlawi, S M R

    2015-01-01

    Dermatophytes are keratinophilic fungi that infect keratinized tissues causing diseases known as dermatophytoses. Dermatophytes are classified in three genera, Epidermophyton, Microsporum, and Trichophyton. This investigation was performed to study the prevalence of dermatomycosis among 640 patients being evaluated at the dermatology clinics at Kasr elainy, El-Husein and Said Galal hospitals in Cairo and Giza between January 2005 and December 2006. The patients were checked for various diseases. Tinea capitis was the most common clinical disease followed by tinea pedis and tinea corporis. Tinea cruris and tinea unguium were the least in occurrence. Tinea versicolor also was detected. The most susceptible persons were children below 10 years followed by those aged 31-40 years. Unicellular yeast was the most common etiological agent and T. tonsuranswas the second most frequent causative agent followed by M. canis. PMID:26413063

  2. Screening for ligninolytic enzymes from autochthonous fungi and applications for decolorization of Remazole Marine Blue

    PubMed Central

    Erden, Emre; Ucar, M. Cigdem; Gezer, Tekin; Pazarlioglu, Nurdan Kasikara

    2009-01-01

    This study presents new and alternative fungal strains for the production of ligninolytic enzymes which have great potential to use in industrial and biotechnological processes. Thirty autochthonous fungal strains were harvested from Bornova-Izmir in Turkiye. In the fresh fruitbody extracts laccase, manganese peroxidase and lignin peroxidase activities, which are the principal enzymes responsible for ligninocellulose degradation by Basidiomycetes, were screened. Spores of some of the basidiomycetes species such as Cortinarius sp., Trametes versicolor, Pleurotus ostreatus, Abortiporus biennis, Lyophyllum subglobisporium, Ramaria stricta, Ganoderma carnosum, Lactarius delicious ve Lepista nuda were isolated and investigated optimum cultivation conditions in submerged fermentation for high yields of ligninolytic enzyme production. In addition, isolated fungal strains were monitored on agar plates whether having the capability of decolorization of a textile dye Remazol Marine Blue. PMID:24031371

  3. Northeast regional and state trends in anuran occupancy from calling survey data (2001-2011) from the North American Amphibian Monitoring Program

    USGS Publications Warehouse

    Weir, Linda A.; Royle, Andy; Gazenski, Kimberly D.; Villena Carpio, Oswaldo

    2014-01-01

    We present the first regional trends in anuran occupancy from North American Amphibian Monitoring Program (NAAMP) data from 11 northeastern states using an 11 years of data. NAAMP is a long-term monitoring program where observers collect data at assigned random roadside routes using a calling survey technique. We assessed occupancy trends for 17 species. Eight species had statistically significant regional trends, of these seven were negative (Anaxyrus fowleri, Acris crepitans, Pseudacris brachyphona, Pseudacris feriarum-kalmi complex, Lithobates palustris, Lithobates pipiens, and Lithobates sphenocephalus) and one was positive (Hyla versicolor-chrysoscelis complex). We also assessed state level trends for 101 species/state combinations, of these 29 showed a significant decline and nine showed a significant increase in occupancy.

  4. [The role of clothing in the transmission of pathogenic fungi ].

    PubMed

    Thurner, J; Poitschek, C

    1982-07-15

    Laboratory studies were made to examine the possibility of transmission of pathogenic fungi through textiles. 1. Dermatophytes were proven to be present in clothing and leather articles worn over areas infected by fungi. In patients known to be infected with Pityriasis versicolor, contaminated scales were obtained from their textiles, the fungi could be demonstrated. 2. Artificially infected textiles were found to harbor dermatophytes and pathogenic yeasts for a number of weeks without limiting the survival capacity of the fungi. 3. At low temperatures, fungi were not affected by various detergents. Under conditions simulating machine washings (30 minutes exposure time) at a temperature of 60 degrees C any washing agent was sufficient to cause irreversible damage. At higher temperatures the time for killing the fungi was diminished. These results were confirmed by experiments with contaminated material from patients (scales, hairs, nail particles). PMID:6750944

  5. Fungal endophytes characterization from four species of Diplazium Swartz

    NASA Astrophysics Data System (ADS)

    Affina-Eliya, A. A.; Noraini, T.; Nazlina, I.; Ruzi, A. R.

    2014-09-01

    Four species on genus Diplazium namely Diplazium tomentosum, D. sorzogonense, D. asperum and D. accedens of Peninsular Malaysia were studied for presence of fungal endophyte. The objective of this study is to characterize fungal endophytes in the rhizome of four Diplazium species. The rhizome was surface sterilized and incubated to isolate fungal endophytes. Characterization of the colonies was performed by macroscopic morphological, microscopic identification, types of hyphae and mycelium, and spore structure. For isolation that produces spores, the structure of conidiophores and conidia were identified. From this study, four fungal have been isolated and determined as Aspergillus sp. (isolates AE 1), Aspergillus fumigatus (isolates AE 2), Aspergillus versicolor (isolates AE 3) and Verticillium sp. (isolates AE 4). The fungal isolates from this study were classified from the same family Moniliaceae.

  6. Environmental isolates of fungi from aquarium pools housing killer whales (Orcinus orca).

    PubMed

    Kohata, Erina; Kano, Rui; Akune, Yuichiro; Ohno, Yoshito; Soichi, Makoto; Yanai, Tokuma; Hasegawa, Atsuhiko; Kamata, Hiroshi

    2013-12-01

    Systemic mycoses in killer whales (Orcinus orca) are rare diseases, but have been reported. Two killer whales died by fungal infections at the Port of Nagoya Public Aquarium in Japan. In this study, the fungal flora of the pool environment at the aquarium was characterized. Alternaria spp., Aspergillus spp. (A. fumigatus, A. niger, A. versicolor), Fusarium spp. and Penicillium spp. were isolated from the air and the pool surroundings. The other isolates were identified as fungal species non-pathogenic for mammals. However, the species of fungi isolated from the environmental samples in this study were not the same as those isolated from the cases of disease in killer whales previously reported. PMID:24045935

  7. A study of overproduction and enhanced secretion of enzymes. Quarterly report

    SciTech Connect

    Dashek, W.V.

    1993-09-01

    Wood decay within forests, a significant renewable photosynthetic energy resource, is caused primarily by Basidiomycetous fungi, e.g., white rot fungi. These organisms possess the ability to degrade lignin, cellulose and hemicellulose, the main organic polymers of wood. In the case of the white rot fungi, e.g., Coriolus versicolor, the capacity results from the fungus` ability to elaborate extracellular cellulolytic and ligninolytic enzymes. With regard to the latter, at least one of the enzymes, polyphenol oxidase (PPO) appears within a defined growth medium. This proposal focuses on the over-production and enhanced secretion of PPO, cellulase and lignin peroxidase. There are two major sections to the proposal: (1) overproduction of lignocellulolytic enzymes by genetic engineering methodologies and hyper-production and enhanced secretion of these enzymes by biochemical/electro microscopical techniques and (2) the biochemical/electron microscopical method involves substrate induction and the time-dependent addition of respiration and PPO enzymes.

  8. Bacterial-fungal interactions enhance power generation in microbial fuel cells and drive dye decolourisation by an ex situ and in situ electro-Fenton process.

    PubMed

    Fernández de Dios, María Ángeles; del Campo, Araceli González; Fernández, Francisco Jesús; Rodrigo, Manuel; Pazos, Marta; Sanromán, María Ángeles

    2013-11-01

    In this work, the potential for sustainable energy production from wastes has been exploited using a combination fungus-bacterium in microbial fuel cell (MFC) and electro-Fenton technology. The fungus Trametes versicolor was grown with Shewanella oneidensis so that the bacterium would use the networks of the fungus to transport the electrons to the anode. This system generated stable electricity that was enhanced when the electro-Fenton reactions occurred in the cathode chamber. This configuration reached a stable voltage of approximately 1000 mV. Thus, the dual benefits of the in situ-designed MFC electro-Fenton, the simultaneous dye decolourisation and the electricity generation, were demonstrated. Moreover, the generated power was effectively used to drive an ex situ electro-Fenton process in batch and continuous mode. This newly developed MFC fungus-bacterium with an in situ electro-Fenton system can ensure a high power output and a continuous degradation of organic pollutants. PMID:24035817

  9. Landscape associations of frog and toad species in Iowa and Wisconsin, U.S.A

    USGS Publications Warehouse

    Knutson, M.G.; Sauer, J.R.; Olsen, D.A.; Mossman, M.J.; Hemesath, L.M.; Lannoo, M.J.

    2000-01-01

    Landscape habitat associations of frogs and toads in Iowa and Wisconsin were tested to determine whether they support or refute previous general habitat classifications. We examined which Midwestern species shared similar habitats to see if these associations were consistent across large geographic areas (states). Rana sylvatica (wood frog), Hyla versicolor (eastern gray treefrog), Pseudacris crucifer (spring peeper), and Acris crepitans (cricket frog) were identified as forest species, P. triseriata (chorus frog), H. chrysoscelis (Cope's gray treefrog), R. pipiens (leopard frog), and Bufo americanus (American toad) as grassland species, and R. catesbeiana (bullfrog), R. clamitans (green frog), R. palustris (pickerel frog), and R. septentrionalis (mink frog) as lake or stream species. The best candidates to serve as bioindicators of habitat quality were the forest species R. sylvatica, H. versicolor, and P. crucifer, the grassland species R. pipiens and P. triseriata, and a cold water wetland species, R. palustris. Declines of P. crucifer, R. pipiens, and R. palustris populations in one or both states may reflect changes in habitat quality. Habitat and community associations of some species differed between states, indicating that these relationships may change across the range of a species. Acris crepitans may have shifted its habitat affinities from open habitats, recorded historically, to the more forested habitat associations we recorded. We suggest contaminants deserve more investigation regarding the abrupt and widespread declines of this species. Interspersion of different habitat types was positively associated with several species. A larger number of wetland patches may increase breeding opportunities and increase the probability of at least one site being suitable. We noted consistently negative associations between anuran species and urban development. Given the current trend of urban growth and increasing density of the human population, declines of amphibian populations are likely to continue.

  10. Mercury contamination of fungi genus Xerocomus in the Yunnan province in China and the region of Europe.

    PubMed

    Kojta, Anna K; Zhang, Ji; Wang, Yuanzhong; Li, Tao; Saba, Martyna; Falandysz, Jerzy

    2015-01-01

    This article presents the results of the study on accumulation, distribution, contamination and probable dietary intake of total mercury (THg) in fruiting bodies of several species of Fungi genus Xerocomus, which emerged in the circum-Pacific mercuriferous belt region in southwestern China in Yunnan and beyond of the mercuriferous belts in the region of Europe. The mushrooms X. puniceus (Boletus amygdalinus), X. spadiceus (Boletus ferrugineus) and X. versicolor (X. rubellus) were from the Yunnan land, and X. badius (Boletus badius) was from the region of Europe in Belarus and X. badius, X. chrysenteron, X. ferrugineus, X. versicolor (X. rubellus) and X. subtomentosus from Poland. The THg in the fungal and soil materials was determined using validated method by cold-vapour atomic absorption spectroscopy. Estimated was also probable dietary intake and health risk from THg in Xerocomus spp. examined by consumers. The data showed that THg content of Xerocomus spp. emerged in the European localizations in Poland and Belarus is at an order of magnitude lower level than determined in samples from the Yunnan Province. A reason for an elevated content of THg in mushrooms from Yunnan can be related to abundance of Hg in the geochemical background of soils there. The assessed doses showed that a single meal composed of 300 g of fresh fruiting bodies of X. spadiceus from the Wuding localization in Yunnan in China if consumed once a week will provide THg at dose close to the provisional tolerable weekly intake (PTWI) value set for THg, while doses will be lower for all other localizations in Yunnan and Europe. In the Wuding localization in Yunnan a frequent consumption of X. spadiceus in volume exceeding 300 g of fresh fruiting bodies per week will provide THg at a dose exceeding the value of PTWI. PMID:26251972

  11. Oxiconazole nitrate: pharmacology, efficacy, and safety of a new imidazole antifungal agent.

    PubMed

    Jegasothy, B V; Pakes, G E

    1991-01-01

    Oxiconazole nitrate (1%) cream became available in the United States in 1989 for the once-daily treatment of tinea pedis, tinea cruris, and tinea corporis. It has also proved valuable in the once-daily treatment of tinea (pityriasis) versicolor. In vitro oxiconazole is highly effective against many dermatophytes, including Trichophyton rubrum, Trichophyton mentagrophytes, Trichophyton tonsurans, and Epidermophyton floccosum. After application to the skin, oxiconazole is rapidly absorbed into the stratum corneum, maximum concentrations often being attained within 100 minutes. Fungicidal concentrations are maintained in the epidermis, upper corium, and deeper corium for at least five hours, and levels exceeding the minimum inhibitory concentrations of susceptible fungi are present in the corneum, epidermis, upper corium, and the hair follicle for over 16 hours. Applied once daily for four weeks in the treatment of tinea pedis or for two weeks in the treatment of tinea corporis, tinea cruris, and tinea versicolor, 1% oxiconazole cream has produced mycologic and clinical cures in at least 80% of patients. In plantar-type tinea pedis caused primarily by T rubrum, once-daily oxiconazole cream resulted in a mycologic cure in 76% of patients. The efficacy of once-daily and twice-daily regimens is similar. In comparative clinical trials of various types of dermatophytoses, oxiconazole was shown to be as effective as or more effective than miconazole, clotrimazole, and tolnaftate creams, and as effective as econazole and bifonazole creams. Tolerability of oxiconazole and the other antifungal creams was similar; in irritation studies oxiconazole was better tolerated than econazole. Oxiconazole cream exerts no detectable systemic effect since only a negligible amount is absorbed from the skin. Once-daily use of oxiconazole cream could be valuable in patients with a history of noncompliance with multiple-daily regimens of other topical antifungal agents. PMID:2029718

  12. Fungal degradation of calcium-, lead- and silicon-bearing minerals.

    PubMed

    Adeyemi, Ademola O; Gadd, Geoffrey M

    2005-06-01

    The aim of this study was to examine nutritional influence on the ability of selected filamentous fungi to mediate biogenic weathering of the minerals, apatite, galena and obsidian in order to provide further understanding of the roles of fungi as biogeochemical agents, particularly in relation to the cycling of metals and associated elements found in minerals. The impact of three organic acid producing fungi (Aspergillus niger, Serpula himantioides and Trametes versicolor) on apatite, galena and obsidian was examined in the absence and presence of a carbon and energy source (glucose). Manifestation of fungal weathering included corrosion of mineral surfaces, modification of the mineral substrate through transformation into secondary minerals (i.e. crystal formation) and hyphal penetration of the mineral substrate. Physicochemical interactions of fungal metabolites, e.g. H+ and organic acids, with the minerals are thought to be the primary driving forces responsible. All experimental fungi were capable of mineral surface colonization in the absence and presence of glucose but corrosion of the mineral surface and secondary mineral formation were affected by glucose availability. Only S. himantioides and T. versicolor were able to corrode apatite in the absence of glucose but none of the fungi were capable of doing so with the other minerals. In addition, crystal formation with galena was entirely dependent on the availability of glucose. Penetration of the mineral substrates by fungal hyphae occurred but this did not follow any particular pattern. Although the presence of glucose in the media appeared to influence positively the mineral penetrating abilities of the fungi, the results obtained also showed that some geochemical change(s) might occur under nutrient-limited conditions. It was, however, unclear whether the hyphae actively penetrated the minerals or were growing into pre-existing pores or cracks. PMID:15984571

  13. Current treatment of cutaneous Pityrosporum and Candida-infections.

    PubMed

    Faergemann, J

    1986-01-01

    Pityrosporum and Candida-yeasts are opportunistic pathogens and infections require predisposing factors. These factors are also of major importance in treatment and the reason for recurrence and sometimes chronicity of the disease caused by these yeasts. Pityrosporum orbiculare and P.ovale are both lipophilic, probably identical, and both are members of the normal human cutaneous flora. In pityriasis versicolor they change from the blastospore form to the mycelial form. My favourite treatment for pityriasis versicolor is propylene glycol 50% in water applied with a gauze pad twice daily for 2 weeks. This will clear 95-100%. Other treatment modalities are: zinc pyrithione shampoo, selenium sulfide shampoo and the imidazoles. For extensive cases, patients who frequently relapse, and infections refractary to other treatments ketoconazole orally may be an effective alternative both therapeutically and prophylactically. In another disease caused by these yeasts, Pityrosporum folliculitis, both propylene glycol and ketoconazole are effective. Although Candida species are only seldom found on normal-looking skin predisposing factors are still the main reason for disease. Under the influence of these factors the organism changes from the blastospore to the mycelial form. The main predisposing factors important to control are: occlusion, underlying skin diseases, diabetes mellitus and immunodeficiency diseases. The imidazoles in a cream vehicle are very effective for many infections and applied for 2-3 weeks they will clear most lesions. The addition of a corticosteroid to the imidazole will not shorten the time of treatment but will give a more prompt symptomatic relief. In extensive cutaneous lesions and lesions refractary to other treatments ketoconazole is an effective alternative. PMID:3459338

  14. Visualization of aerocolloidal biological particles using 2D particle image velocimetry (PIV)

    NASA Astrophysics Data System (ADS)

    Hall, Carsie A., III; Masabattula, Sree; Akyuzlu, Kazim M.; Russo, Edwin P.; Klich, Maren A.

    2003-11-01

    Recent concerns over the possible use of airborne biological particles as weapons of mass destruction have significantly increased the attention that researchers are giving to this threat. The size of these particles, ranging from a fraction of a micrometer to several tens of micrometers, allows them to travel over long distances before settling out of the airstreams carrying these particles. Furthermore, the odd shapes of many of these particles along with uncertainties about their light scattering characteristics make detection and tracking quite a challenge. In the present paper, results are reported on the visualization of airborne biological particles using two-dimensional particle image velocimetry (PIV). These initial results show the utility of PIV in illuminating and tracking airborne biological particles. A compressed air nebulizer is used to aerosolize the biological particles inside a Plexiglas test section. The biological particles prepared for the nebulizer are first inoculated and cultured onto agar media, gypsum board, and acoustic ceiling tile to achieve an abundant growth of spores. A colloidal suspension of biological particles is then made using sterilized, de-ionized water and a mild surfactant to de-agglomerate the biological particles in the suspension. The concentration of biological particles in the colloidal suspension is determined using a hemacytometer. In the visualization experiments, images are captured for polystyrene latex (PSL) test particles, liquid water droplets, and spores of the fungal species Aspergillus versicolor. During the PIV system operation, two successive images are captured with a time delay of 50 ?m to develop flow field velocities of the PSL test particles, liquid water droplets, and the A. versicolor spores.

  15. Exploring the Antibacterial and Antifungal Potential of Jellyfish-Associated Marine Fungi by Cultivation-Dependent Approaches

    PubMed Central

    Yue, Yang; Yu, Huahua; Li, Rongfeng; Xing, Ronge; Liu, Song; Li, Pengcheng

    2015-01-01

    Fungi isolated from marine invertebrates are of considerable importance as new promising sources of unique secondary metabolites with significant biomedical potential. However, the cultivable fungal community harbored in jellyfish was less investigated. In this work, we seek to recover symbiotic fungi from different tissues of jellyfish Nemopilema nomurai. A total of seven morphotypes were isolated, which were assigned into four genera (Aspergillus, Cladosporium, Purpureocillium, and Tilletiopsis) from two phyla (Ascomycota and Basidiomycota) by comparing the rDNA-ITS sequences with the reference sequences in GenBank. The most fungi were found in the inner tissues of subumbrella. Two of the cultivation-independent procedures, changing media type and co-cultivation, were employed to maximize the complexity of metabolites. Thus, thirteen EtOAc gum were obtained and fingerprinted by High Performance Liquid Chromatography (HPLC) equipped with a photodiode array (PDA) detector. Antibacterial and antifungal activities of these complex mixtures were tested against a panel of bacterial and fungal pathogens. The antimicrobial results showed that all of the 13 EtOAc extracts displayed different levels of antibacterial activity, three of which exhibited strong to significant antibacterial activity to the bacterial pathogens Staphylococcus aureus and Salmonella entrica. Antifungal activity indicated that the EtOAc extracts from pure culture of Aspergillus versicolor and co-culture of A. versicolor and Tilletiopsis sp. in rice media were promising for searching new compounds, with the maximal mycelial growth inhibition of 82.32% ± 0.61% for Rhizoctonia solani and 48.41% ± 11.02% for Botrytis cinerea at 200 ?g/ml, respectively. This study is the first report on the antibacterial and antifungal activity of jellyfish-associated fungi and allows the first sight into cultivable fungal community residing in jellyfish. Induced metabolites by cultivation-dependent approaches provides a new reservoir for drug discovery from jellyfish-derived fungi. PMID:26637162

  16. Endotoxin, Ergosterol, Fungal DNA and Allergens in Dust from Schools in Johor Bahru, Malaysia- Associations with Asthma and Respiratory Infections in Pupils

    PubMed Central

    Norbäck, Dan; Markowicz, Pawel; Cai, Gui-Hong; Hashim, Zailina; Ali, Faridah; Zheng, Yi-Wu; Lai, Xu-Xin; Spangfort, Michael Dho; Larsson, Lennart; Hashim, Jamal Hisham

    2014-01-01

    There are few studies on associations between respiratory health and allergens, fungal and bacterial compounds in schools in tropical countries. The aim was to study associations between respiratory symptoms in pupils and ethnicity, chemical microbial markers, allergens and fungal DNA in settled dust in schools in Malaysia. Totally 462 pupils (96%) from 8 randomly selected secondary schools in Johor Bahru, Malaysia, participated. Dust was vacuumed from 32 classrooms and analysed for levels of different types of endotoxin as 3-hydroxy fatty acids (3-OH), muramic acid, ergosterol, allergens and five fungal DNA sequences. Multiple logistic regression was applied. Totally 13.1% pupils reported doctor’s diagnosed asthma, 10.3% wheeze and 21.1% pollen or pet allergy. Indian and Chinese children had less atopy and asthma than Malay. Carbon dioxide levels were low (380–690 ppm). No cat (Fel d1), dog (Can f 1) or horse allergens (Ecu cx) were detected. The levels of Bloomia tropicalis (Blo t), house dust mite allergens (Der p 1, Der f 1, Der m 1) and cockroach allergens (Per a 1 and Bla g 1) were low. There were positive associations between levels of Aspergillus versicolor DNA and daytime breathlessness, between C14 3-OH and respiratory infections and between ergosterol and doctors diagnosed asthma. There were negative (protective) associations between levels of C10 3-OH and wheeze, between C16 3-OH and day time and night time breathlessness, between cockroach allergens and doctors diagnosed asthma. Moreover there were negative associations between amount of fine dust, total endotoxin (LPS) and respiratory infections. In conclusion, endotoxin at school seems to be mainly protective for respiratory illness but different types of endotoxin could have different effects. Fungal contamination measured as ergosterol and Aspergillus versicolor DNA can be risk factors for respiratory illness. The ethnical differences for atopy and asthma deserve further attention. PMID:24523884

  17. El americano ilustrado de Cabrujas

    E-print Network

    Azparren Gimé nez, Leonardo

    1988-04-01

    puedan encon- tarse indicios serios en Fiésole (1967). Es una columna vertebral que sostiene las obras, donde se dan la mano el desacoplamiento de la pareja y el autoengaño político. En el primer caso, y con un con tenido erótico no escondido, bajo la... épicamente la vida de San Rafael de Egido al nivel de la aven tura de Cristóbal Colón, znActo Cultural. Cabrujas representa esta situación con personajes centrales muy fuertes, en casos en perjuicio de algunos secundarios que son relegados a un simple rol...

  18. Mineral-microorganism interactions in Acid Mine Drainage environments: preliminary results

    NASA Astrophysics Data System (ADS)

    Carbone, Cristina; Zotti, Mirca; Pozzolini, Marina; Giovine, Marco; Di Piazza, Simone; Mariotti, Mauro; Lucchetti, Gabriella

    2014-05-01

    Minerals play a key role in controlling the mobility and distribution of metals and metalloids of environmental concern in supergenic environments. These are involved in a variety of processes, spanning the alteration of primary minerals to the formation of secondary authigenic phases and can represent a source or a trap for Potentially Ecotoxic Elements (PTEs). Soil, sediments, and waters heavily polluted with PTEs through AMD processes are a reservoir of a unusual bacteria and fungi well adapted to these toxic environments. Classical studies of biotic weathering have mainly focused on water-mineral interaction and on the ability of microorganism to influence the soil solution chemical composition. In this work, we analyzed two different representative ochreous and greenish-blue AMD colloidal precipitates in order to i) characterize the biota population present in these colloidal minerals and ii) verify the bioaccumulation of PTEs into the fungi and the potential impact of bacteria in the geochemistry of the system. The samples are composed by nanocrystalline goethite which contains high amounts of Fe, Cu, Zn, Pb, and Ni and woodwardite that is characterized by Cu, Zn, Ni, Y, and Ce. These precipitates were examined in order to evaluate the presence of fungal strains and to extract bacteria DNA. The preliminary results of fungi characterization show an interesting and selected mycobiota able to survive under unfavourable environmental conditions. A significant number of fungal strains was isolated in pure culture. Most of them belong to the genus Mucor and Penicillium. It is worth noting the presence of Trametes versicolor, a macrofungal lignicolous species already known for heavy metal biosorption capability from aqueous solution (Gülay et al 2003). The same colloidal precipitates have been processed to extract bacteria DNA, using a specific procedure developed for DNA extraction from sediments. The results gave a good yield of nucleic acids and the positive PCR amplification of 16S rDNA accomplished the first step for future metagenomic analysis. Gülay B., Sema B., M. Yakup A.. 2003 Biosorption of heavy metal ions on immobilized white-rot fungus Trametes versicolor. Journal of Hazardous Materials B101 (2003) 285-300

  19. Skin changes in patients with chronic renal failure.

    PubMed

    Falodun, Olarenwaju; Ogunbiyi, Adebola; Salako, Babatunde; George, Ade Kunle

    2011-03-01

    Management of patients with renal failure remains a major problem in poor-resource nations. Cutaneous manifestations in this group of patients are varied and remain helpful in differentiating acute from chronic renal failure (CRF). We studied the prevalence and pattern of skin disorders in patients with CRF at The University College Hospital, Ibadan, Nigeria, during the period between May 2006 and February 2007. Relevant information was collected with the aid of a questionnaire. The patients were then examined for skin disorders. One hundred and twenty patients who met the inclusion criteria were recruited into the study. The mean age of the CRF patients was 43.12 ± 15.38 years, while that of the control subjects was 43.13 ± 15.38 years. Seventy-six of the 120 patients (63.3%) were on chronic hemodialysis while 44 (36.5%) were on conservative management. A total of 107 patients (89.1%) had at least one skin problem. The skin disorders seen include xerosis in 72 (60%), pruritus in 32 (26.7%), hyperpigmentation, icthyosis and pityriasis versicolor in nine patients each (7.5%), either singly or in combination. Pallor of the skin was seen in three of the patients (2.5%), while uremic frost was seen in one (0.8%). Nail changes were seen in 48 patients (40%). We conclude that xerosis, pruritus, pigmentary and nail changes were the most common skin disorders in patients with CRF in our environment. PMID:21422624

  20. Development of the dichlorvos-ammonia (DV-AM) method for the visual detection of aflatoxigenic fungi.

    PubMed

    Yabe, Kimiko; Hatabayashi, Hidemi; Ikehata, Akifumi; Zheng, Yazhi; Kushiro, Masayo

    2015-12-01

    Aflatoxins (AFs) are carcinogenic and toxic secondary metabolites produced mainly by Aspergillus flavus and Aspergillus parasiticus. To monitor and regulate the AF contamination of crops, a sensitive and precise detection method for these toxigenic fungi in environments is necessary. We herein developed a novel visual detection method, the dichlorvos-ammonia (DV-AM) method, for identifying AF-producing fungi using DV and AM vapor on agar culture plates, in which DV inhibits the esterase in AF biosynthesis, causing the accumulation of anthraquinone precursors (versiconal hemiacetal acetate and versiconol acetate) of AFs in mycelia on the agar plate, followed by a change in the color of the colonies from light yellow to brilliant purple-red by the AM vapor treatment. We also investigated the appropriate culture conditions to increase the color intensity. It should be noted that other species producing the same precursors of AFs such as Aspergillus nidulans and Aspergillus versicolor could be discriminated from the Aspergillus section Flavi based on the differences of their phenotypes. The DV-AM method was also useful for the isolation of nonaflatoxigenic fungi showing no color change, for screening microorganisms that inhibit the AF production by fungi, and for the characterization of the fungi infecting corn kernels. Thus, the DV-AM method can provide a highly sensitive and visible indicator for the detection of aflatoxigenic fungi. PMID:26300294

  1. Surface Lipids as Multifunctional Mediators of Skin Responses to Environmental Stimuli

    PubMed Central

    De Luca, Chiara; Valacchi, Giuseppe

    2010-01-01

    Skin surface lipid (SSL) film is a mixture of sebum and keratinocyte membrane lipids, protecting skin from environment. Its composition is unique for the high percentage of long chain fatty acids, and of the polyterpenoid squalene, absent in other human tissues, and in non-human Primates sebum. Here, the still incomplete body of information on SSL as mediators of external chemical, physical, and microbial signals and stressors is revised, focusing on the central event of the continuous oxidative modification induced by the metabolic activity of residential and pathological microbial flora, natural or iatrogenic UV irradiation, exposure to chemicals and cosmetics. Once alpha-tocopherol and ubiquinol-10 antioxidant defences of SSL are overcome, oxidation of squalene and cholesterol gives rise to reactive by-products penetrating deeper into skin layers, to mediate local defensive inflammatory, photo-protective, immune reactions or, at higher concentrations, inducing local but also systemic immune depression, ultimately implicating skin cancerogenesis. Qualitative modifications of SSL represent a pathogenetic sign of diagnostic value in dermatological disorders involving altered sebum production, like pytiriasis versicolor, acne, atopic or seborrheic dermatitis, as well as photo-aging. Achievements of nutriceutical interventions aimed at restoring normal SSL composition and homeostasis are discussed, as feasible therapeutic goals and major means of photo-protection. PMID:20981292

  2. Quantification of C. globosum spores in house dust samples.

    PubMed

    Shi, Chunhua; Provost, Natacha B; Desroches, Tamara; Miller, J David

    2014-01-01

    Chaetomium globosum is one of the most common fungi that grows in damp buildings and occurs in agricultural and forestry workplaces. Using sera from atopic patients, we characterized and purified an extracellular chitosanase (Chg47) from C. globosum that is antigenic to humans. The study reports the production of monoclonal antibodies to the protein. Three capture ELISAs were developed for Chg47 for detection of spores and spore and mycelial fragments in dust samples using different mono- and polyclonal antibody combinations. One method is based on an enhanced biotinylated polyclonal antibody as the secondary antibody and coating anti-IgM to capture one of two clones of IgM monoclonal antibodies as the capture antibody. The other method makes use of an enhanced rabbit polyclonal antibody as both the primary and capture antibody. The detection limit of the double PAb method for the Chg47 antigen was 7.6 pg/ml. When the anti-IgM+10B3 clone was used, the detection limit was 61 pg/ml and for anti-IgM+5F12, 122 pg/ml. The detection limit of double PAb method is comparable to methods for the allergen and spores of Aspergillus versicolor in house dust and is more sensitive than other immunoassays for allergens in house including for Stachybotrys chartarum, Aspergillus fumigatus and Alternaria alternata. All three methods had limited cross-reactivity to fungi common in house dust representing a diverse array of taxa. PMID:25292122

  3. The effect of anatase and rutile crystallites isolated from titania P25 photocatalyst on growth of selected mould fungi.

    PubMed

    Markowska-Szczupak, Agata; Wang, Kunlei; Rokicka, Paulina; Endo, Maya; Wei, Zhishun; Ohtani, Bunsho; Morawski, Antoni W; Kowalska, Ewa

    2015-10-01

    Antifungal properties of anatase and rutile crystallites isolated from commercial titania P25 photocatalyst were investigated by mycelium growth in the dark and under indoor light. Investigated fungi, i.e., Pseudallescheria boydii, Scedosporium apiospermum, Pseudallescheria ellipsoidea, Scedosporium aurantiacum, Aspergillus versicolor, Aspergillus flavus, Stachybotrys chartarum, Penicillium chrysogenum, Aspergillus melleus, were isolated from air and from moisture condensed on walls. Anatase and rutile were isolated from homogenized P25 (homo-P25) by chemical dissolution, and then purified by washing and thermal treatment. For comparison, homo-P25 was also thermally treated at 200°C and 500°C. Titania samples were characterized by X-ray diffractometry (XRD), X-ray photoelectron spectroscopy (XPS), diffuse reflectance spectroscopy (DRS) and scanning transmission electron microscopy (STEM). It was found that properties of titania, i.e., band-gap energy, impurities adsorbed on the surface, nanoparticle aggregation, and kind of fungal structure, highly influenced resultant antifungal activities. It is proposed that some fungi could uptake necessary water and nutrient from titania surface. It was also found that even when differences in mycelium growth were not significant, the sporulation and mycotoxin generation were highly inhibited by light and presence of titania. PMID:26177513

  4. [Unusual fungal species causing onychomycosis.].

    PubMed

    López-Jodra, O; Torres-Rodríguez, J M

    1999-10-01

    Dermatomycoses caused by non-dermatophytic mycelial fungi are very rare with the exception of onychomycoses. Controversies regarding the pathogenic role often arise when these species and yeasts are isolated from nail scrapings. Candida albicans and Candida parapsilosis are the species identified more frequently from nails, particularly from finger nails. Because they could be resident flora of the skin, cultures should be interpreted according to clinical data, direct microscopic observation of clinical samples, and quantification of colonies. The recognition of other yeasts, such as Candida guillermondii, Candida famata or Candida krusei is more problematic. Isolation of moulds form toe nails accounts for 2 to 12% in different studies, with a prevalence of 7.6% in Barcelona being Scopulariopsis brevicaulis the most frequent species, but Aspergillus versicolor is also a particular etiologic agent of onychomycosis (2.5%). To confirm the etiology of any onychomycosis, standard criteria for mycological diagnosis and identification of moulds should be strictly applied. Experience in the diagnosis of superficial mycosis due to new species of fungi is required for improving current knowledge on the prevalence and clinical importance of this type of infections. PMID:18473597

  5. Oral terbinafine (Lamisil) in the treatment of fungal infections of the skin and nails.

    PubMed

    Roberts, D T

    1997-01-01

    The efficacy and safety of antifungal drugs depend upon their mode of action, the minimal inhibitory concentration (MIC) and its relationship to the minimal fungicidal concentration (MFC), the spectrum of activity and drug kinetics at the involved site. Terbinafine acts at the fungal cell wall. Its MIC against dermatophytes is the lowest of all currently available systemic antifungal agents. It is the only one with an MIC:MFC ratio of 1:1 so that terbinafine should be effective over very short treatment durations in dermatophyte infections of the scalp, palms and soles, and nail, providing that drug penetration is adequate, as it appears to be. Therapeutic levels persist for a considerable period after the cessation of treatment, also favouring short-duration therapy. Terbinafine is effective against all varieties of dermatophyte. Terbinafine given over 4 weeks or less is effective against Trichophyton of the scalp in children and adults. Its efficacy in zoophilic ectrothrix infection is anecdotal, but it is likely on theoretical grounds. Terbinafine is also effective against pityriasis versicolor and vaginal candidosis, but only topically. As of March 1996, around 3,000,000 patients have been treated worldwide with terbinafine, mostly for 12 weeks for toe-nail onychomycosis. Gastro-intestinal disturbance and minor skin rashes are seen in 5 and 2% of patients, respectively. PMID:9154400

  6. Cutaneous fungal infection following renal transplantation: a case control study.

    PubMed

    Shuttleworth, D; Philpot, C M; Salaman, J R

    1987-11-01

    The prevalence of cutaneous fungal infection was studied in 72 patients who had undergone renal transplantation and compared with a group of age and sex matched controls. Samples were obtained from toe nails, toe webs, and the upper back; clinically suspicious lesions from other areas were also examined. A total of 576 sites were sampled (288 in each group). Pathogenic fungi were identified from 44 sites (15%) in the renal transplant (RT) group compared with 26 sites (9%) in the control group, (P less than 0.05). However, site-specific differences were less marked; no difference was found between the RT group and controls when the results from the toe nails and toe webs were analysed separately. Trichophyton mentagrophytes was the most common species isolated from both groups. Colonization of the back with Pityrosporum yeasts was significantly more common in the RT group, but few patients in either group had tinea versicolor. 'Mixed infections', with more than one species of fungus isolated in an individual, were only found in the RT group. We also examined the relationship between the presence of fungal infection and the presence or absence of cutaneous malignancy in the renal transplant group. No increase in the prevalence of fungal colonization was found in those patients who had developed cutaneous malignancy compared with those who had not. PMID:3318908

  7. The Prevalence and Pattern of Superficial Fungal Infections among School Children in Ile-Ife, South-Western Nigeria

    PubMed Central

    Oke, Olaide Olutoyin; Onayemi, Olaniyi; Olasode, Olayinka Abimbola; Omisore, Akinlolu Gabriel; Oninla, Olumayowa Abimbola

    2014-01-01

    Fungal infections of the skin and nails are common global problems with attendant morbidity among affected individuals. Children are mostly affected due to predisposing factors such as overcrowding and low socioeconomic factors. The aim of this study was to determine the prevalence and the clinical patterns of superficial fungal infections among primary school children in Ile-Ife. A multistage sampling was conducted to select eight hundred pupils from ten primary schools in Ile-Ife. Data on epidemiological characteristics and clinical history was collected using a semistructured questionnaire and skin scrapings were done. The prevalence of superficial fungal infections among the 800 respondents was 35.0%. Male pupils constituted 51.0% of respondents while the females were 49.0%. The mean age for all the respondents was 9.42 ± 2.00. Tinea capitis was the commonest infection with a prevalence of 26.9% and tinea unguium, tinea corporis, and tinea faciei had a prevalence of 0.8%, 0.6%, and 0.5%, respectively. Tinea manuum had the least prevalence of 0.1%. Pityriasis versicolor had a prevalence of 4.4%. Microsporum audouinii was the leading organism isolated. The study shows that the prevalence of superficial fungal infection (SFI) among primary school children in Ile-Ife is high with tinea capitis as the commonest SFI. PMID:25574161

  8. White-rot basidiomycete-mediated decomposition of C60 fullerol.

    PubMed

    Schreiner, Kathryn M; Filley, Timothy R; Blanchette, Robert A; Bowen, Brenda Beitler; Bolskar, Robert D; Hockaday, William C; Masiello, Caroline A; Raebiger, James W

    2009-05-01

    Industrially produced carbon-based nanomaterials (CNM), including fullerenes and nanotubes, will be introduced into the environment in increasing amounts in the next decades. One likely environmental chemical transformation of C60 is oxidation to C60 fullerol through both abiotic- and biotic-mediated means. Unfortunately, knowledge of the environmental fate of oxidized CNM is lacking. This study used bulk and compound-specific 13C stable isotope ratio mass spectrometry techniques and spectroradiometry analysis to examine the ability of two white rot basidiomycete fungi (Phlebia tremellosa and Trametes versicolor) to metabolize and degrade an oxygenated CNM, C60 fullerol. After 32 weeks of decay, both fungi were able to bleach and oxidize fullerol to CO2. Additionally, the fungi incorporated minor amounts of the fullerol carbon into lipid biomass. These findings are significant in that they represent the first report of direct biodegradation and utilization of any fullerene derivative and provide valuable information about the possible environmental fates of other CNM. PMID:19534129

  9. White-Rot Basidiomycete-mediated Decomposition of C60 Fullerol

    PubMed Central

    Schreiner, Kathryn M.; Filley, Timothy R.; Blanchette, Robert A.; Bowen, Brenda Beitler; Bolskar, Robert D.; Hockaday, William C.; Masiello, Caroline A.; Raebiger, James W.

    2009-01-01

    Industrially produced carbon-based nanomaterials (CNM), including fullerenes and nanotubes, will be introduced into the environment in increasing amounts in the next decades. One likely environmental chemical transformation of C60 is oxidation to C60 fullerol through both abiotic- and biotic-mediated means. Unfortunately, knowledge of the environmental fate of oxidized CNM is lacking. This study used bulk and compound specific 13C stable isotope ratio mass spectrometry techniques and spectroradiometry analysis to examine the ability of two white rot basidiomycete fungi (Phlebia tremellosa and Trametes versicolor) to metabolize and degrade an oxygenated CNM, C60 fullerol. After 32 weeks of decay, both fungi were able to bleach and oxidize fullerol to CO2. Additionally, the fungi incorporated minor amounts of the fullerol carbon into lipid biomass. These findings are significant in that they represent the first report of direct biodegradation and utilization of any fullerene derivative and provide valuable information about the possible environmental fates of other CNM. PMID:19534129

  10. Influence of very low doses of mediators on fungal laccase activity - nonlinearity beyond imagination

    PubMed Central

    Malarczyk, Elzbieta; Kochmanska-Rdest, Janina; Jarosz-Wilkolazka, Anna

    2009-01-01

    Laccase, an enzyme responsible for aerobic transformations of natural phenolics, in industrial applications requires the presence of low-molecular substances known as mediators, which accelerate oxidation processes. However, the use of mediators is limited by their toxicity and the high costs of exploitation. The activation of extracellular laccase in growing fungal culture with highly diluted mediators, ABTS and HBT is described. Two high laccase-producing fungal strains, Trametes versicolor and Cerrena unicolor, were used in this study as a source of enzyme. Selected dilutions of the mediators significantly increased the activity of extracellular laccase during 14 days of cultivation what was distinctly visible in PAGE technique and in colorimetric tests. The same mediator dilutions increased demethylation properties of laccase, which was demonstrated during incubation of enzyme with veratric acid. It was established that the activation effect was assigned to specific dilutions of mediators. Our dose-response dilution process smoothly passes into the range of action of homeopathic dilutions and is of interest for homeopaths. PMID:19732425

  11. Molecular docking and dynamics simulation analyses unraveling the differential enzymatic catalysis by plant and fungal laccases with respect to lignin biosynthesis and degradation.

    PubMed

    Awasthi, Manika; Jaiswal, Nivedita; Singh, Swati; Pandey, Veda P; Dwivedi, Upendra N

    2015-09-01

    Laccase, widely distributed in bacteria, fungi, and plants, catalyzes the oxidation of wide range of compounds. With regards to one of the important physiological functions, plant laccases are considered to catalyze lignin biosynthesis while fungal laccases are considered for lignin degradation. The present study was undertaken to explain this dual function of laccases using in-silico molecular docking and dynamics simulation approaches. Modeling and superimposition analyses of one each representative of plant and fungal laccases, namely, Populus trichocarpa and Trametes versicolor, respectively, revealed low level of similarity in the folding of two laccases at 3D levels. Docking analyses revealed significantly higher binding efficiency for lignin model compounds, in proportion to their size, for fungal laccase as compared to that of plant laccase. Residues interacting with the model compounds at the respective enzyme active sites were found to be in conformity with their role in lignin biosynthesis and degradation. Molecular dynamics simulation analyses for the stability of docked complexes of plant and fungal laccases with lignin model compounds revealed that tetrameric lignin model compound remains attached to the active site of fungal laccase throughout the simulation period, while it protrudes outwards from the active site of plant laccase. Stability of these complexes was further analyzed on the basis of binding energy which revealed significantly higher stability of fungal laccase with tetrameric compound than that of plant. The overall data suggested a situation favorable for the degradation of lignin polymer by fungal laccase while its synthesis by plant laccase. PMID:25301391

  12. JEM Spotlight: Fungi, mycotoxins and microbial volatile organic compounds in mouldy interiors from water-damaged buildings.

    PubMed

    Polizzi, Viviana; Delmulle, Barbara; Adams, An; Moretti, Antonio; Susca, Antonia; Picco, Anna Maria; Rosseel, Yves; Kindt, Ruben't; Van Bocxlaer, Jan; De Kimpe, Norbert; Van Peteghem, Carlos; De Saeger, Sarah

    2009-10-01

    Concerns have been raised about exposure to mycotoxin producing fungi and the microbial volatile organic compounds (MVOCs) they produce in indoor environments. Therefore, the presence of fungi and mycotoxins was investigated in 99 samples (air, dust, wallpaper, mycelium or silicone) collected in the mouldy interiors of seven water-damaged buildings. In addition, volatile organic compounds (VOCs) were sampled. The mycotoxins were analysed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) (20 target mycotoxins) and quadrupole time-of-flight mass spectrometry (LC-Q-TOF-MS). Morphological and molecular identifications of fungi were performed. Of the 99 samples analysed, the presence of one or more mycotoxins was shown in 62 samples by means of LC-MS/MS analysis. The mycotoxins found were mainly roquefortine C, chaetoglobosin A and sterigmatocystin but also roridin E, ochratoxin A, aflatoxin B(1) and aflatoxin B(2) were detected. Q-TOF-MS analysis elucidated the possible occurrence of another 42 different fungal metabolites. In general, the fungi identified matched well with the mycotoxins detected. The most common fungal species found were Penicillium chrysogenum, Aspergillus versicolor (group), Chaetomium spp. and Cladosporium spp. In addition, one hundred and seventeen (M)VOCs were identified, especially linear alkanes (C(9)-C(17)), aldehydes, aromatic compounds and monoterpenes. PMID:19809708

  13. Susceptibility of green and conventional building materials to microbial growth.

    PubMed

    Mensah-Attipoe, J; Reponen, T; Salmela, A; Veijalainen, A-M; Pasanen, P

    2015-06-01

    Green building materials are becoming more popular. However, little is known about their ability to support or limit microbial growth. The growth of fungi was evaluated on five building materials. Two green, two conventional building materials and wood as a positive control were selected. The materials were inoculated with Aspergillus versicolor, Cladosporium cladosporioides and Penicillium brevicompactum, in the absence and presence of house dust. Microbial growth was assessed at four different time points by cultivation and determining fungal biomass using the N-acetylhexosaminidase (NAHA) enzyme assay. No clear differences were seen between green and conventional building materials in their susceptibility to support microbial growth. The presence of dust, an external source of nutrients, promoted growth of all the fungal species similarly on green and conventional materials. The results also showed a correlation coefficient ranging from 0.81 to 0.88 between NAHA activity and culturable counts. The results suggest that the growth of microbes on a material surface depends on the availability of organic matter rather than the classification of the material as green or conventional. NAHA activity and culturability correlated well indicating that the two methods used in the experiments gave similar trends for the growth of fungi on material surfaces. PMID:24975616

  14. Widespread Polycistronic Transcripts in Fungi Revealed by Single-Molecule mRNA Sequencing

    PubMed Central

    Salamov, Asaf; Zhang, Jiwei; Meng, Xiandong; Zhao, Zhiying; Kang, Dongwan; Underwood, Jason; Grigoriev, Igor V.; Figueroa, Melania; Schilling, Jonathan S.; Chen, Feng; Wang, Zhong

    2015-01-01

    Genes in prokaryotic genomes are often arranged into clusters and co-transcribed into polycistronic RNAs. Isolated examples of polycistronic RNAs were also reported in some higher eukaryotes but their presence was generally considered rare. Here we developed a long-read sequencing strategy to identify polycistronic transcripts in several mushroom forming fungal species including Plicaturopsis crispa, Phanerochaete chrysosporium, Trametes versicolor, and Gloeophyllum trabeum. We found genome-wide prevalence of polycistronic transcription in these Agaricomycetes, involving up to 8% of the transcribed genes. Unlike polycistronic mRNAs in prokaryotes, these co-transcribed genes are also independently transcribed. We show that polycistronic transcription may interfere with expression of the downstream tandem gene. Further comparative genomic analysis indicates that polycistronic transcription is conserved among a wide range of mushroom forming fungi. In summary, our study revealed, for the first time, the genome prevalence of polycistronic transcription in a phylogenetic range of higher fungi. Furthermore, we systematically show that our long-read sequencing approach and combined bioinformatics pipeline is a generic powerful tool for precise characterization of complex transcriptomes that enables identification of mRNA isoforms not recovered via short-read assembly. PMID:26177194

  15. The application of dermal papillary rings in dermatology by in vivo confocal laser scanning microscopy

    NASA Astrophysics Data System (ADS)

    Xiang, W. Z.; Xu, A. E.; Xu, J.; Bi, Z. G.; Shang, Y. B.; Ren, Q. S.

    2010-08-01

    Confocal laser scanning microscopy (CLSM) allows noninvasive visualization of human skin in vivo, without needing to fix or section the tissue. Melanocytes and pigmented keratinocytes at the level of the basal layer form bright dermal papillary rings which are readily amenable to identify in confocal images. Our purpose was to explore the role of dermal papillary rings in assessment of lesion location, the diagnosis, differential diagnosis of lesions and assessment of therapeutic efficacy by in vivo CLSM. Seventy-one patients were imaged with the VivaScope 1500 reflectance confocal microscope provided by Lucid, Inc. The results indicate that dermal papillary rings can assess the location of lesion; the application of dermal papillary rings can provide diagnostic support and differential diagnosis for vitiligo, nevus depigmentosus, tinea versicolor, halo nevus, common nevi, and assess the therapeutic efficacy of NBUVB phototherapy plus topical 0.1 percent tacrolimus ointment for vitiligo. In conclusion, our findings indicate that the dermal papillary rings play an important role in the assessment the location of lesion, diagnosis, differential diagnosis of lesions and assessment of therapeutic efficacy by in vivo CLSM. CLSM may be a promising tool for noninvasive examination in dermatology. However, larger studies are needed to expand the application of dermal papillary rings in dermatology.

  16. Radiocesium Concentration Change in Game Animals: Use of Food Monitoring Data - 13168

    SciTech Connect

    Tagami, Keiko; Uchida, Shigeo

    2013-07-01

    Radionuclides were released into the environment in the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident. Radiocesium (Cs-134+137) concentrations in most agricultural products became lower than the detection limit (?10 Bq kg{sup -1}) from June 2011, and the concentrations have remained low. However, some wild food materials such as meat of game animals (e.g., bear and wild boar) caught in Fukushima and surrounding areas some times showed higher values than the detection limits. In this study, monitoring data on game animal meat were summarized to understand the amount of activities found in wild animals and the activity distribution in the contaminated areas. Concentration data are available from monthly reports issued by the Ministry of Health, Labour and Welfare. Data were collected on wild boar (Sus scrofa), deer (Cervus nippon), Asian black bear (Ursus thibetanus), Japanese pheasant (Phasianus versicolor), and duck (e.g. Anas poecilorhynch). There is a tendency that the concentration decreases with distance from the FDNPP; in order to compare the Cs-137 concentrations among animals, one collection site was selected. The results showed that the concentration was in the following order within one year: Asian black bear>wild boar> deer >duck and Japanese pheasant. Bear and boar are omnivorous animals and their feeding pattern would affect the concentrations in their meats. (authors)

  17. Malassezia species and their associated skin diseases.

    PubMed

    Harada, Kazutoshi; Saito, Mami; Sugita, Takashi; Tsuboi, Ryoji

    2015-03-01

    Malassezia spp. are lipophilic fungi that occur on all skin surfaces of humans and animals as commensal and pathogenic organisms. In the 2000s, several new species were added to the Malassezia genus by Japanese researchers. The genus Malassezia now includes 14 species of basidiomycetous yeast. Culture-independent molecular analysis clearly demonstrated that the DNA of Malassezia spp. was predominantly detected in core body and arm sites, suggesting that they are the dominant fungal flora of the human body. Malassezia spp. have been implicated in skin diseases including pityriasis versicolor (PV), Malassezia folliculitis (MF), seborrheic dermatitis (SD) and atopic dermatitis (AD). While Malassezia spp. are directly responsible for the infectious diseases, PV and MF, they act as an exacerbating factor in AD and SD. The fatty acids generated by Malassezia lipase can induce inflammation of the skin, resulting in development of SD. Patch and serum immunoglobulin E tests revealed that AD patients were hypersensitive to Malassezia. However, these findings only partially elucidated the mechanism by which Malassezia spp. induce inflammation in the skin; understanding of the pathogenetic role of Malassezia spp. in SD or AD remains incomplete. In this article, the latest findings of Malassezia research are reviewed with special attention to skin diseases. PMID:25736318

  18. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    SciTech Connect

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  19. Filamentous fungi as a source of natural antioxidants.

    PubMed

    Smith, Helen; Doyle, Sean; Murphy, Richard

    2015-10-15

    Ten species of filamentous fungi grown in submerged flask cultures were investigated for antioxidant capacity. Effective antioxidant activity was demonstrated in terms of ?-carotene/linoleic acid bleaching, radical scavenging, reduction of metal ions and chelating abilities against ferrous ions. Different extraction methods affected antioxidant activities through their effect on biologically active compounds produced in fungal mycelia. The methanolic extract of each fungus was typically more effective in antioxidant properties. Phenolic content was established in the range of 0.44-9.33 mg/g, flavonoid contents were in the range of 0.02-3.90 mg/g and condensed tannin contents were in the range of 1.77-18.83 mg/g. Total phenol content of each extract was attributed to overall antioxidant capacity (r ? 0.883-1.000). Submerged cultivation of Grifola frondosa, Monascus purpureus, Pleurotus spp., Lentinula edodes and Trametes versicolor proved to be an effective method for the production of natural antioxidants. PMID:25952884

  20. Immobilization of laccase in a sponge-like hydrogel for enhanced durability in enzymatic degradation of dye pollutants.

    PubMed

    Sun, Hongfei; Yang, Hua; Huang, Wenguang; Zhang, Shujuan

    2015-07-15

    A highly stable and efficient biocatalyst was fabricated by encapsulating Trametes versicolor laccase within a chitosan grafted polyacrylamide hydrogel (denoted as Lac-PAM-CTS). Scanning electron microscopy and nitrogen adsorption-desorption tests demonstrated that channels of diameter of 10-20 ?m were regularly distributed throughout the sponge-like Lac-PAM-CTS. Besides, there were massive mesopores and macropores in the lamellar walls of the hydrogel. Such a network structure reduced the diffusion resistance of the hydrogel to the target substrates. The recovered activity of the obtained Lac-PAM-CTS was 40.8%. As compared to free laccase, the Lac-PAM-CTS showed enhanced thermal and chemical stability. The positive surface charge of the Lac-PAM-CTS endowed it with a pre-enrichment effect in the treatment of anionic dyes. In a continuous six-cycle batch decoloration of Malachite Green, the Lac-PAM-CTS showed much better durability than the free laccase. The results here suggest that sponge-like hydrogel is a good supporting matrix for laccase. PMID:25841061

  1. Effects of fungal species, cultivation time, growth substrate, and air exposure velocity on the fluorescence properties of airborne fungal spores.

    PubMed

    Saari, S; Mensah-Attipoe, J; Reponen, T; Veijalainen, A M; Salmela, A; Pasanen, P; Keskinen, J

    2015-12-01

    Real-time bioaerosol monitoring is possible with fluorescence based instruments. This study provides information on major factors that can affect the fluorescence properties of airborne fungal spores. Two fluorescence-based bioaerosol detectors, BioScout, and ultraviolet aerodynamic particle sizer (UVAPS), were used to study fluorescent particle fractions (FPFs) of released spores of three fungal species (Aspergillus versicolor, Cladosporium cladosporioides, and Penicillium brevicompactum). Two culture media (agar and gypsum board), three ages of the culture (one week, one month, and four months), and three aerosolization air velocities (5, 15, and 27 m/s) were tested. The results showed that the FPF values for spores released from gypsum were typically lower than for those released from agar indicating that poor nutrient substrate produces spores with lower amounts of fluorescent compounds. The results also showed higher FPF values with lower air velocities in aerosolization. This indicates that easily released fully developed spores have more fluorescent compounds compared to forcibly extracted non-matured spores. The FPFs typically were lower with older samples. The FPF results between the two instruments were similar, except with four-month-old samples. The results can be utilized in field measurements of fungal spores to estimate actual concentrations and compare different instruments with fluorescence-based devices as well as in instrument calibration and testing in laboratory conditions. PMID:25292152

  2. Geographical variation of St. Lucia Parrot flight vocalizations

    USGS Publications Warehouse

    Kleeman, P.M.; Gilardi, J.D.

    2005-01-01

    Parrots are vocal learners and many species of parrots are capable of learning new calls, even as adults. This capability gives parrots the potential to develop communication systems that can vary dramatically over space. St. Lucia Parrot (Amazona versicolor) flight vocalizations were examined for geographic variation between four different sites on the island of St. Lucia. Spectrographic cross-correlation analysis of a commonly used flight vocalization, the p-chow call, demonstrated quantitative differences between sites. Additionally, the similarity of p-chows decreased as the distance between sites increased. Flight call repertoires also differed among sites; parrots at the Des Bottes and Quilesse sites each used one flight call unique to those sites, while parrots at the Barre de L'Isle site used a flight call that Quilesse parrots gave only while perched. It is unclear whether the vocal variation changed clinally with distance, or whether there were discrete dialect boundaries as in a congener, the Yellow-naped Parrot (Amazona auropalliata, Wright 1996). The geographical scale over which the St. Lucia Parrot's vocal variation occurred was dramatically smaller than that of the Yellow-naped Parrot. Similar patterns of fine-scale vocal variation may be more widespread among other parrot species in the Caribbean than previously documented.

  3. Improving the performance of a biofuel cell cathode with laccase-containing culture supernatant from Pycnoporus sanguineus.

    PubMed

    Fokina, Oleksandra; Eipper, Jens; Winandy, Lex; Kerzenmacher, Sven; Fischer, Reinhard

    2014-11-01

    Laccases are multicopper oxidoreductases that can be used in biofuel cells to improve cathode performance by cathodic oxygen reduction. Here we present a laccase from the ligninolytic white-rot fungus Pycnoporus sanguineus that, in contrast to the Trametes versicolor laccase, can be produced in the absence of inducers in a standard culture medium. After 7days of cultivation the activity of this laccase in culture supernatant reached 2.5U/ml, which is high enough for direct application of the supernatant in biofuel cells. The highest current density of 115.0±3.5?A/cm(2) at 400mV vs. SCE was obtained at pH 5 with a buckypaper cathode with a laccase-containing culture supernatant. The enzyme also showed electrocatalytic activity at pH 6 and 7. These results not only present a new cost-efficient laccase for improving cathode performance, but also show that new laccases with different catalytic properties can be suitable for biofuel cells. PMID:25459854

  4. Biosupercapacitors for powering oxygen sensing devices.

    PubMed

    Kizling, Michal; Draminska, Sylwia; Stolarczyk, Krzysztof; Tammela, Petter; Wang, Zhaohui; Nyholm, Leif; Bilewicz, Renata

    2015-12-01

    A biofuel cell comprising electrodes based on supercapacitive materials - carbon nanotubes and nanocellulose/polypyrrole composite was utilized to power an oxygen biosensor. Laccase Trametes versicolor, immobilized on naphthylated multi walled carbon nanotubes, and fructose dehydrogenase, adsorbed on a porous polypyrrole matrix, were used as the cathode and anode bioelectrocatalysts, respectively. The nanomaterials employed as the supports for the enzymes increased the surface area of the electrodes and provide direct contact with the active sites of the enzymes. The anode modified with the conducting polymer layer exhibited significant pseudocapacitive properties providing superior performance also in the high energy mode, e.g., when switching on/off the powered device. Three air-fructose biofuel cells connected in a series converted chemical energy into electrical giving 2 mW power and open circuit potential of 2V. The biofuel cell system was tested under various externally applied resistances and used as a powering unit for a laboratory designed two-electrode minipotentiostat and a laccase based sensor for oxygen sensing. Best results in terms of long time measurement of oxygen levels were obtained in the pulse mode -45 s for measurement and 15 min for self-recharging of the powering unit. PMID:25960258

  5. Genotoxicity of fungi evaluated by SOS microplate assay.

    PubMed

    Sakai, M; Abe, K; Okumura, H; Kawamura, O; Sugiura, Y; Horie, Y; Ueno, Y

    1992-01-01

    By an introduction of sodium dodecylsulfate for cell lysis and immunomicroplate for mass assay, the modified SOS microplate assay method was established and applied for the evaluation of genotoxicity of mycotoxins and fungal cultures. Among 20 mycotoxins, the carcinogenic dihydrobisfuranoids such as aflatoxin B1, sterigmatocystin, and versicolorin A were positive in the presence of the activation system. While, the carcinogenic anthraquinones and lactones such as luteoskyrin, rugulosin, ochratoxin A, patulin, and citrinin were negative. The survey on genotoxic fungi revealed that, among 15 fungal isolates Aspergillus versicolor, Emericella acristata, and others were positive. Additional survey on 265 fungal isolates have revealed that various Aspergillus genera such as A. flavus, A. parasiticus, A. ustus, A. nidulans, and others were positive for SOS induction, along with several isolates of Fusarium moniliforme. The chemical analysis revealed that the dihydrobisfuranoids such as aflatoxin B1, and sterigmatocystin were the major genotoxic metabolites of several Aspergillus species. The SOS microplate assay system is a simple and rapid procedure for the mass screening of genotoxic fungi, particularly of the dihydrobisfuranoids-producing strains. PMID:1344897

  6. [Epidemiology of mycoses in submariners based on the Kola Peninsula].

    PubMed

    Vakulova, I N; Myznikov, I L; Kutelev, G M; Kopylova, N S

    2003-01-01

    Subject of the study was spreading of mycoses in the troops based on the Kola Peninsula. Examined were the military serving on atomic submarines, maintenance crews of deactivated atomic submarines awaiting disposal, and coastal units. Spreading of skin lesions among the submariners was not same as among the coastal military. Signs of clinical mycoses were observed in 41.2% of submariners of the active unit, in 66.9% of the maintenance crews, and in 38.1% of the coastal military. Infection agents were fungi g. Candida (albicans, guilliermondii, krusei, pseudotropicalis), Epidermophytia plicarum, Ptyriasis versicolor, Trichophyton interdigitale. Among the fighters on active submarines, 53.8% of the clinical observations were accounted for onychomycosis and foot skin lesions and 38.5%--for erythema, maceration and suppuration. Among the maintenance crews 51.8% of the observations were accounted for onychomycosis and foot skin lesions and maceration; hyperkeratosis and fissures prevailed in the coastal military (31.1%). For submariners most common were Candida albicans (80.7%) and guilliermondii (11.6%), and Trichophyton interdigitale (7.7%). In the maintenance crew those were Candida albicans (84.1%) and guilliermondii (11.6%) and in the coastal military, Candida albicans (70.6%), guilliermondii (11.8%) and krusei (14.7%). PMID:14503184

  7. Potential of fungal co-culturing for accelerated biodegradation of petroleum hydrocarbons in soil.

    PubMed

    Yanto, Dede Heri Yuli; Tachibana, Sanro

    2014-08-15

    The potential of fungal co-culture of the filamentous Pestalotiopsis sp. NG007 with four different basidiomycetes--Trametes versicolor U97, Pleurotus ostreatus PL1, Cerena sp. F0607, and Polyporus sp. S133--for accelerating biodegradation of petroleum hydrocarbons (PHCs) was studied using three different physicochemical characteristic PHCs in soil. All the combinations showed a mutual intermingling mycelial interaction on the agar plates. However, only NG007/S133 (50/50) exhibited an optimum growth rate and enzymatic activities that supported the degradation of asphalt in soil. The co-culture also degraded all fractions at even higher concentrations of the different PHCs. In addition, asphaltene, which is a difficult fraction for a single microorganism to degrade, was markedly degraded by the co-culture, which indicated that the simultaneous biodegradation of aliphatic, aromatic, resin, and asphaltene fractions had occurred in the co-culture. An examination of in-vitro degradation by the crude enzymes and the retrieval fungal culture from the soil after the experiment confirmed the accelerated biodegradation due to enhanced enzyme activities in the co-culture. The addition of piperonyl butoxide or AgNO3 inhibited biodegradation by 81-99%, which demonstrated the important role of P450 monooxygenases and/or dioxygenases in the initial degradation of the aliphatic and aromatic fractions in PHCs. PMID:24997261

  8. In Vitro Bleaching of Hardwood Kraft Pulp by Extracellular Enzymes Excreted from White Rot Fungi in a Cultivation System Using a Membrane Filter

    PubMed Central

    Kondo, Ryuichiro; Kurashiki, Kenji; Sakai, Kokki

    1994-01-01

    To clarify the role of excreted extracellular enzymes during long-term incubation in a pulp biobleaching system with white rot fungi, we developed a cultivation system in which a membrane filter is used; this membrane filter can prevent direct contact between hyphae and kraft pulp, but allows extracellular enzymes to attack the kraft pulp. Phanerochaete sordida YK-624 brightened the pulp 21.4 points to 54.0% brightness after a 5-day in vitro treatment; this value was significantly higher than the values obtained with Phanerochaete chrysosporium and Coriolus versicolor after a 7-day treatment. Our results indicate that cell-free, membrane-filtered components from the in vitro bleaching system are capable of delignifying unbleached kraft pulp. Obvious candidates for filterable reagents capable of delignifying and bleaching kraft pulp are peroxidase and phenoloxidase proteins. The level of secreted manganese peroxidase activity in the filterable components was substantial during strain YK-624 in vitro bleaching. A positive correlation between the level of manganese peroxidase and brightening of the pulp was observed. PMID:16349219

  9. Pityriasis alba revisited: perspectives on an enigmatic disorder of childhood.

    PubMed

    Jadotte, Yuri T; Janniger, Camila K

    2011-02-01

    Pityriasis alba (PA) is a localized hypopigmented disorder of childhood with many existing clinical variants. It is more often detected in individuals with a darker complexion but may occur in individuals of all skin types. Atopy, xerosis, and mineral deficiencies are potential risk factors. Sun exposure exacerbates the contrast between normal and lesional skin, making lesions more visible and patients more likely to seek medical attention. Poor cutaneous hydration appears to be a common theme for most risk factors and may help elucidate the pathogenesis of this disorder. The end result of this mechanism is inappropriate melanosis manifesting as hypopigmentation. It must be differentiated from other disorders of hypopigmentation, such as pityriasis versicolor alba, vitiligo, nevus depigmentosus, and nevus anemicus. Alleviation of the various risk factors via patient education on proper skin care and hygiene, use of lubricants and emollients, topical corticosteroid therapy in the presence of inflammation, and the novel administration of topical anti-inflammatory drugs such as calcineurin inhibitors can play a crucial role in promoting remission or resolution. PMID:21416771

  10. The Malassezia Genus in Skin and Systemic Diseases

    PubMed Central

    Magiatis, Prokopios; Hantschke, Markus; Bassukas, Ioannis D.; Velegraki, Aristea

    2012-01-01

    Summary: In the last 15 years, the genus Malassezia has been a topic of intense basic research on taxonomy, physiology, biochemistry, ecology, immunology, and metabolomics. Currently, the genus encompasses 14 species. The 1996 revision of the genus resulted in seven accepted taxa: M. furfur, M. pachydermatis, M. sympodialis, M. globosa, M. obtusa, M. restricta, and M. slooffiae. In the last decade, seven new taxa isolated from healthy and lesional human and animal skin have been accepted: M. dermatis, M. japonica, M. yamatoensis, M. nana, M. caprae, M. equina, and M. cuniculi. However, forthcoming multidisciplinary research is expected to show the etiopathological relationships between these new species and skin diseases. Hitherto, basic and clinical research has established etiological links between Malassezia yeasts, pityriasis versicolor, and sepsis of neonates and immunocompromised individuals. Their role in aggravating seborrheic dermatitis, dandruff, folliculitis, and onychomycosis, though often supported by histopathological evidence and favorable antifungal therapeutic outcomes, remains under investigation. A close association between skin and Malassezia IgE binding allergens in atopic eczema has been shown, while laboratory data support a role in psoriasis exacerbations. Finally, metabolomic research resulted in the proposal of a hypothesis on the contribution of Malassezia-synthesized aryl hydrocarbon receptor (AhR) ligands to basal cell carcinoma through UV radiation-induced carcinogenesis. PMID:22232373

  11. Preparation of a reference material containing sterigmatocystin.

    PubMed

    Tanaka, K; Sagou, Y; Nakagawa, H; Naito, S; Kushiro, M

    2008-09-01

    To assure the homogeneity of a reference material for the mycotoxin sterigmatocystin (STE), a study was first conducted to prepare a reference material of rice containing the colouring Food Red 106. The protocol developed was then used to prepare a reference material of rice containing STE. Initially, a V-shaped mixer was used to mix Food Red 106 and ground brown rice, but the resulting mixture was non-homogeneous. However, when a ShakeMaster was used for the simultaneous grinding and mixing of brown rice with Food Red 106, good homogeneity was obtained. Accordingly, a dried culture of Aspergillus versicolor NRRL5219 and brown rice was ground and mixed with the ShakeMaster. To assess the distribution of the STE an Autoprep MF-A 1000 mini-column was used to isolate the STE, and a 115-120% recovery rate was obtained. Repeatability (variability within a day) and intermediate precision (variability between days) were good. According to the IUPAC/ISO/AOAC International Harmonized Protocol for the Proficiency Testing of Analytical Chemistry Laboratories, a homogeneous candidate reference material was obtained. The particle sizes of ground brown rice, ground brown rice containing Food Red 106, and ground brown rice containing a non-STE producing culture of A. oryzae were analysed and they ranged from 10 to 700 microm. PMID:18798039

  12. Study of dermatoses in kidney transplant patients*

    PubMed Central

    de Lima, Alexandre Moretti; da Rocha, Sheila Pereira; Reis Filho, Eugênio Galdino de Mendonça; Eid, Danglades Resende Macedo; Reis, Carmelia Matos Santiago

    2013-01-01

    BACKGROUND The increasing in the number of kidney transplant recipients has favored, more frequently than before, the emergence of dermatoses and warranted their study through subsequent publications. OBJECTIVES to evaluate the frequency of dermatoses in kidney transplant recipients. METHODS kidney transplant recipients with suspected dermatoses between March 1st 2009 and June 30th 2010. RESULTS 53 patients (28 males and 25 females), aged between 22 and 69 (mean age = 45 years) were evaluated. Most of them came from the cities of Ceilândia, Samambaia and São Sebastião/DF, and had already been transplanted for 5 to 10 years before (37.7%); 62.3% were recipients of living donors and 83% were prednisone-treated. The most prevalent dermatoses were of fungal (45.3%) and viral (39.6%) etiologies. Among the non-melanoma malignant neoplasms, the basal cell carcinoma prevailed (six cases), in spite of the low incidence. Concerning fungal dermatoses, 12 cases of onychomycosis, five of pityriasis versicolor and four of pityrosporum folliculitis were reported. For diagnosis, in most cases (64.2%), laboratory examinations (mycological and histopathological) were performed. CONCLUSION cutaneous manifestations in kidney transplant recipients are generally secondary to immunosuppression. The infectious dermatoses, especially those of fungal origin, are frequently found in kidney transplant recipients and their occurrence increases progressively according to the time elapsed from the transplantation, which makes follow-up important. PMID:23793196

  13. The Response of Gray Treefrogs to Anesthesia by Tricaine Methanesulfonate (TMS or MS-222)

    PubMed Central

    Paduano, Mary; Colafrancesco, Kaitlen C.; Wong, Sarah A.; Caldwell, Michael S.; Gridi-Papp, Marcos

    2014-01-01

    The design of anesthetic protocols for frogs is commonly hindered by lack of information. Results from fishes and rodents do not always apply to frogs, and the literature in anurans is concentrated on a few species. We report on the response of treefrogs (Hyla chrysoscelis and H. versicolor) to tricaine methanesulfonate. Body mass did not differ significantly between the species or between sexes. In the first exposure of a frog to TMS, variation in induction time was best explained by species (H. chrysoscelis resisted longer) and body mass (larger animals resisted longer). Multiple exposures revealed a strong effect of individual variation on induction time and a significant increase of induction time with number of previous anesthesia events within the same day. Recovery time was mostly explained by individual variation, but it increased with total time in anesthetic and decreased with induction time. It also increased with number of days since the last series of anesthesias and decreased with number of previous uses of the anesthetic bath. This is one of the first studies of anesthesia in hylids and also one of the first assessments of the factors that influence the variability of the response to anesthesia within a species. PMID:24851186

  14. Evaluation of Fungal Laccase Immobilized on Natural Nanostructured Bacterial Cellulose

    PubMed Central

    Chen, Lin; Zou, Min; Hong, Feng F.

    2015-01-01

    The aim of this work was to assess the possibility of using native bacterial nanocellulose (BC) as a carrier for laccase immobilization. BC was synthesized by Gluconacetobacter xylinus, which was statically cultivated in a mannitol-based medium and was freeze-dried to form BC sponge after purification. For the first time, fungal laccase from Trametes versicolor was immobilized on the native nanofibril network-structured BC sponge through physical adsorption and cross-linking with glutaraldehyde. The properties including morphologic and structural features of the BC as well as the immobilized enzyme were thoroughly investigated. It was found that enzyme immobilized by cross-linking exhibited broader pH operation range of high catalytic activity as well as higher running stability compared to free and adsorbed enzyme. Using ABTS as substrate, the optimum pH value was 3.5 for the adsorption-immobilized laccase and 4.0 for the crosslinking-immobilized laccase. The immobilized enzyme retained 69% of the original activity after being recycled seven times. Novel applications of the BC-immobilized enzyme tentatively include active packaging, construction of biosensors, and establishment of bioreactors. PMID:26617585

  15. A high throughput colorimetric assay of ?-1,3-D-glucans by Congo red dye.

    PubMed

    Semedo, Magda C; Karmali, Amin; Fonseca, Luís

    2015-02-01

    Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, ?-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for ?-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and ?-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 ?g of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. ?-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of ?-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of ?-1,3-D-glucans was investigated in several mushroom species. PMID:25555819

  16. Medicinal and edible lignicolous fungi as natural sources of antioxidative and antibacterial agents.

    PubMed

    Karaman, M; Jovin, E; Malbasa, R; Matavuly, M; Popovi?, M

    2010-10-01

    The antioxidant activity of organic extracts of eight fungal species, Ganoderma lucidum, Ganoderma applanatum, Meripilus giganteus, Laetiporus sulphureus, Flammulina velutipes, Coriolus versicolor, Pleurotus ostreatus and Panus tigrinus, was evaluated for free radical (DPPH· and OH·) scavenging capacity and an effect on lipid peroxidation, and the antibacterial activity was tested by the agar well diffusion method. The highest DPPH· scavenging activity was found in the methanol extract of G. applanatum (12.5 ?g/mL, 82.80%) and the chloroform extract of G. lucidum (510.2??g/mL, 69.12%). The same extracts also showed the highest LP inhibition (91.83%, 85.09%) at 500 ?g/mL, while the methanol extracts of G. applanatum and L. sulphureus showed the highest scavenging effect on OH· radicals (68.47%, 57.06%, respectively) at 400 ?g/mL. A strong antibacterial activity against Gram-positive bacteria was also manifested. The antioxidative potencies correlated generally with the total phenol content (0.19-9.98 mg/g). The HPLC determination showed that the majority of analysed species contained gallic and protocatechic acids. Consequently, these fungi are shown to be potential sources of antioxidative and antibacterial agents. PMID:20878697

  17. Amperometric catechol biosensor based on laccase immobilized on nitrogen-doped ordered mesoporous carbon (N-OMC)/PVA matrix

    NASA Astrophysics Data System (ADS)

    Guo, Meiqing; Wang, Hefeng; Huang, Di; Han, Zhijun; Li, Qiang; Wang, Xiaojun; Chen, Jing

    2014-06-01

    A functionalized nitrogen-containing ordered mesoporous carbon (N-OMC), which shows good electrical properties, was synthesized by the carbonization of polyaniline inside a SBA-15 mesoporous silica template. Based on this, through entrapping laccase onto the N-OMC/polyvinyl alcohol (PVA) film a facilely fabricated amperometric biosensor was developed. Laccase from Trametes versicolor was assembled on a composite film of a N-OMC/PVA modified Au electrode and the electrochemical behavior was investigated. The results indicated that the N-OMC modified electrode exhibits electrical properties towards catechol. The optimum experimental conditions of a biosensor for the detection of catechol were studied in detail. Under the optimal conditions, the sensitivity of the biosensor was 0.29 A*M-1 with a detection limit of 0.31 ?M and a linear detection range from 0.39 ?M to 8.98 ?M for catechol. The calibration curve followed the Michaelis-Menten kinetics and the apparent Michaelis-Menten \\left( K_{M}^{app} \\right) was 6.28 ?M. This work demonstrated that the N-OMC/PVA composite provides a suitable support for laccase immobilization and the construction of a biosensor.

  18. Birds of a high-altitude cloud forest in Alta Verapaz, Guatemala.

    PubMed

    Eisermann, Knut; Schulz, Ulrich

    2005-01-01

    The Northern Central American Highlands have been recognized as endemic bird area, but little is known about bird communities in Guatemalan cloud forests. From 1997 to 2001 a total of 142 bird species were recorded between 2000 and 2400 masl in cloud forest and agricultural clearings on Montaña Caquipec (Alta Verapaz, Guatemala). The bird community is described based on line transect counts within the forest. Pooling census data from undisturbed and disturbed forest, the Gray-breasted Wood-Wren (Henicorhina leucophrys) was found to be the most abundant species, followed in descending order by the Common Bush-Tanager (Chlorospingus ophthalmicus), the Paltry Tyrannulet (Zimmerius vilissimus), the Yellowish Flycatcher (Empidonax flavescens), the Ruddy-capped Nightingale-Thrush (Catharus frantzi), and the Amethyst-throated Hummingbird (Lampornis amethystinus). Bird communities in undisturbed and disturbed forest were found to be similar (Serensen similarity index 0.85), indicating low human impact. Of all recorded species, approximately 27% were Nearctic-Neotropical migratory birds. The most abundant one was the Wilson's Warbler (Wilsonia pusilla). The Montaña Caquipec is an important area for bird conservation, which is indicated by the presence of four species listed in the IUCN Red List (Highland Guan Penelopina nigra, Resplendent Quetzal Pharomachrus mocinno, Pink-headed Warbler Ergaticus versicolor, Golden-cheeked Warbler Dendroica chrysoparia), and 42 Mesoamerican endemics, of which 14 species are endemic to the Central American Highlands. The results presented here will be useful as baseline data for a long-term monitoring. PMID:17354466

  19. Production and degradation of oxalic acid by brown rot fungi

    SciTech Connect

    Espejo, E.; Agosin, E. )

    1991-07-01

    Our results show that all of the brown rot fungi tested produce oxalic acid in liquid as well as in semisolid cultures. Gloeophyllum trabeum, which accumulates the lowest amount of oxalic acid during decay of pine holocellulose, showed the highest polysaccharide-depolymerizing activity. Semisolid cultures inoculated with this fungus rapidly converted {sup 14}C-labeled oxalic acid to CO{sub 2} during cellulose depolymerization. The other brown rot fungi also oxidized {sup 14}C-labeled oxalic acid, although less rapidly. In contrast, semisolid cultures inoculated with the white rot fungus Coriolus versicolor did not significantly catabolize the acid and did not depolymerize the holocellulose during decay. Semisolid cultures of G. trabeum amended with desferrioxamine, a specific iron-chelating agent, were unable to lower the degree of polymerization of cellulose or to oxidize {sup 14}C-labeled oxalic acid to the extent or at the rate that control cultures did. These results suggest that both iron and oxalic acid are involved in cellulose depolymerization by brown rot fungi.

  20. Production and Degradation of Oxalic Acid by Brown Rot Fungi

    PubMed Central

    Espejo, Eduardo; Agosin, Eduardo

    1991-01-01

    Our results show that all of the brown rot fungi tested produce oxalic acid in liquid as well as in semisolid cultures. Gloeophyllum trabeum, which accumulates the lowest amount of oxalic acid during decay of pine holocellulose, showed the highest polysaccharide-depolymerizing activity. Semisolid cultures inoculated with this fungus rapidly converted 14C-labeled oxalic acid to CO2 during cellulose depolymerization. The other brown rot fungi also oxidized 14C-labeled oxalic acid, although less rapidly. In contrast, semisolid cultures inoculated with the white rot fungus Coriolus versicolor did not significantly catabolize the acid and did not depolymerize the holocellulose during decay. Semisolid cultures of G. trabeum amended with desferrioxamine, a specific iron-chelating agent, were unable to lower the degree of polymerization of cellulose or to oxidize 14C-labeled oxalic acid to the extent or at the rate that control cultures did. These results suggest that both iron and oxalic acid are involved in cellulose depolymerization by brown rot fungi. PMID:16348522

  1. Echinostome-induced mortality varies across amphibian species in the field.

    PubMed

    Holland, Manja P

    2010-10-01

    Echinostomes are receiving increased attention because of their emerging parasite status in landscapes associated with human development and their ability to infect and kill many North American larval amphibians. While laboratory experiments have shown that echinostomes can cause extensive mortality in their amphibian hosts, their effect on tadpoles in the field is less clear. I conducted a controlled-infection field-enclosure experiment in 4 ponds to compare the effects of echinostomes on green frog (Rana clamitans) and gray tree frog (Hyla versicolor) tadpoles in the field. I measured tadpole growth, development, mortality, and infection intensity. Echinostome infection resulted in high mortality in green frog tadpoles and less mortality in gray tree frogs. However, metacercariae encystment rates were higher in gray tree frog tadpoles than in green frog tadpoles. The effect of echinostomes on mortality varies across amphibian species, with the result that some species may experience more extensive echinostome-induced mortality than others. Mortality as a result of echinostome infection in green frog tadpoles was similar to mortality observed in predation experiments. PMID:20469948

  2. The effects of the El Niño Southern Oscillation on skin and skin-related diseases: a message from the International Society of Dermatology Climate Change Task Force.

    PubMed

    Andersen, Louise K; Davis, Mark D P

    2015-12-01

    The El Niño Southern Oscillation (ENSO) is a complex climate phenomenon occurring in the Pacific Ocean at intervals of 2-7 years. The term refers to fluctuations in ocean temperatures in the tropical eastern Pacific Ocean (El Niño [the warm phase of ENSO] and La Niña [the cool phase of ENSO]) and in atmospheric pressure across the Pacific basin (Southern Oscillation). This weather pattern is attributed with causing climate change in certain parts of the world and is associated with disease outbreaks. The question of how ENSO affects skin and skin-related disease is relatively unanswered. We aimed to review the literature describing the effects of this complex weather pattern on skin. El Niño has been associated with increases in the occurrence of actinic keratosis, tinea, pityriasis versicolor, miliaria, folliculitis, rosacea, dermatitis by Paederus irritans and Paederus sabaeus, and certain vector-borne and waterborne diseases, such as dengue fever, leishmaniasis, Chagas' disease, Barmah Forest virus, and leptospirosis, and with decreases in the occurrence of dermatitis, scabies, psoriasis, and papular urticaria. La Niña has been associated with increases in the occurrence of varicella, hand, foot, and mouth disease, and Ross River virus (in certain areas), and decreases in viral warts and leishmaniasis. Reports on the effects of ENSO on skin and skin-related disease are limited, and more studies could be helpful in the future. PMID:26471012

  3. Biodegradation of DDT [1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane] by the white rot fungus Phanerochaete chrysosporium.

    PubMed Central

    Bumpus, J A; Aust, S D

    1987-01-01

    Extensive biodegradation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by the white rot fungus Phanerochaete chrysosporium was demonstrated by disappearance and mineralization of [14C]DDT in nutrient nitrogen-deficient cultures. Mass balance studies demonstrated the formation of polar and water-soluble metabolites during degradation. Hexane-extractable metabolites identified by gas chromatography-mass spectrometry included 1,1,-dichloro-2,2-bis(4-chlorophenyl)ethane (DDD), 2,2,2-trichloro-1,1-bis(4-chlorophenyl)ethanol (dicofol), 2,2-dichloro-1,1-bis(4-chlorophenyl)ethanol (FW-152), and 4,4'-dichlorobenzophenone (DBP). DDD was the first metabolite observed; it appeared after 3 days of incubation and disappeared from culture upon continued incubation. This, as well as the fact that [14C]dicofol was mineralized, demonstrates that intermediates formed during DDT degradation are also metabolized. These results demonstrate that the pathway for DDT degradation in P. chrysosporium is clearly different from the major pathway proposed for microbial or environmental degradation of DDT. Like P. chrysosporium ME-446 and BKM-F-1767, the white rot fungi Pleurotus ostreatus, Phellinus weirii, and Polyporus versicolor also mineralized DDT. PMID:3674869

  4. Effects of subsidy quality on reciprocal subsidies: how leaf litter species changes frog biomass export.

    PubMed

    Earl, Julia E; Castello, Paula O; Cohagen, Kara E; Semlitsch, Raymond D

    2014-05-01

    Spatial subsidies are resources transferred from one ecosystem to another and which can greatly affect recipient systems. Increased subsidy quantity is known to increase these effects, but subsidy quality is likely also important. We examined the effects of leaf litter quality (varying in nutrient and tannin content) in pond mesocosms on gray treefrog (Hyla versicolor) biomass export, as well as water quality and ecosystem processes. We used litter from three different tree species native to Missouri [white oak (Quercus alba), northern red oak (Quercus rubra), and sugar maple (Acer saccharum)], one non-native tree [white pine (Pinus strobus)], and a common aquatic grass [prairie cordgrass (Spartina pectinata)]. We found that leaf litter species affected almost every variable we measured. Gray treefrog biomass export was greatest in mesocosms with grass litter and lowest with white oak litter. Differences in biomass export were affected by high tannin concentrations (or possibly the correlated variable, dissolved oxygen) via their effects on survival, and by primary production, which altered mean body mass. Effects of litter species could often be traced back to the characteristics of the litter itself: leaf nitrogen, phosphorus, and tannin content, which highlights the importance of plant functional traits in affecting aquatic ecosystems. This work and others stress that changes in forest species composition could greatly influence aquatic systems and aquatic-terrestrial linkages. PMID:24399483

  5. Effects of leachate from tree leaves and grass litter on tadpoles.

    PubMed

    Earl, Julia E; Cohagen, Kara E; Semlitsch, Raymond D

    2012-07-01

    Tree species composition can change as a result of succession, climate change, fire suppression, and invasive species. These changes clearly affect forests, but they can also affect aquatic ecosystems based on differences in the input quality of leaf litter, such as plant secondary compounds. These compounds vary in type and concentration depending on species and can be toxic to aquatic organisms. To examine toxic effects on Pseudacris maculata and Pseudacris crucifer tadpoles, we conducted 60-d laboratory experiments to compare leaf litter leachate from a dominant canopy species (red oak) and nonnative species (white pine) with an aquatic grass (prairie cordgrass) and plain water control. An additional experiment examined the effects of white pine on Bufo americanus, Hyla versicolor, and tannin concentrations in natural ponds. Compared with the control and grass, tree leaf extracts resulted in reduced tadpole survival. Leached compounds from pine reduced tadpole survival to 3 d or less. Tadpoles were able to metamorphose in significant numbers only from the two controls. The lowered survival with the red oak treatment might have been caused by lowered dissolved oxygen or high tannin concentrations. However, pine is known to have high concentrations of toxic monoterpenes, which should be investigated further. We found that tannin concentrations in natural ponds were much lower than the test concentrations, indicating that these results may represent worst-case scenarios or unrealistic concentrations. PMID:22488805

  6. Protein-bound polysaccharide-K (PSK) directly enhanced IgM production in the human B cell line BALL-1.

    PubMed

    Maruyama, Shinjiro; Akasaka, Taiki; Yamada, Koji; Tachibana, Hirofumi

    2009-07-01

    Protein-bound polysaccharide-K (PSK) prepared from the basidiomycete Coriolus versicolor has been used as a biological response modifier for the treatment of cancer patients. Many studies describing the immunomodulatory effects and direct anti-cancer effects of PSK have been reported. Most of studies describing the immunomodulatory effects focused on cellular immunity, although there were several studies which focused on humoral immunity where PSK was shown to be able to induce antibody production in vivo. However, even in these humoral immunity studies, it is thought that the enhancement of antibody production was due to the activation of cellular immunity. In this study, we investigated the direct effect of PSK on B cells and discovered that PSK was able to enhance IgM production in the human B cell line BALL-1. Furthermore, BALL-1 was shown to have the characteristic features of B-1a cells, which are independently involved in the primary immune response. These results show that there is a possibility that PSK directly acts on B cells and simultaneously enhances both humoral immunity and cellular immunity. PMID:18848763

  7. Polysaccharide-K augments docetaxel-induced tumor suppression and antitumor immune response in an immunocompetent murine model of human prostate cancer

    PubMed Central

    WENNER, CYNTHIA A.; MARTZEN, MARK R.; LU, HAILING; VERNERIS, MICHAEL R.; WANG, HONGBO; SLATON, JOEL W.

    2012-01-01

    Advanced castration-resistant prostate cancer has high mortality rates and limited treatment options. Novel therapies are needed to better contend with this disease. Polysaccharide-K® (PSK), an extract of the mushroom Trametes versicolor, has immunomodulatory and tumor suppressive activities. PSK is used in Asia as a cancer immunotherapy. However, its benefit in combination with taxanes for prostate cancer is unknown. We examined whether PSK would enhance docetaxel-induced apoptosis and augment anti-tumor immune responses in orthotopic tumors using transgenic adenocarcinoma of the mouse prostate (TRAMP)-C2-bearing mice. Combining PSK with docetaxel induced significantly higher tumor suppression than either treatment alone (p<0.05), including a reduction in tumor proliferation and enhanced apoptosis. Combined PSK and docetaxel treatment led to a lower decrease in number of white blood cells than docetaxel alone, an effect accompanied by increased numbers of tumor-infiltrating CD4+ and CD8+ T cells. PSK with or without docetaxel significantly enhanced mRNA expression of IFN-? compared to control, but did not significantly alter T-regulatory FoxP3 mRNA expression in tumors. PSK also augmented docetaxel-induced splenic natural killer cell cytolytic activity against YAC-1 target cells (p=0.045). This study is the first to show that PSK enhances docetaxel-induced prostate cancer tumor suppression, apoptosis and antitumor responses. PMID:22159900

  8. Protein-bound polysaccharide activates dendritic cells and enhances OVA-specific T cell response as vaccine adjuvant

    PubMed Central

    Engel, Abbi L.; Sun, Guan-Cheng; Gad, Ekram; Rastetter, Lauren R.; Strobe, Katie; Yang, Yi; Dang, Yushe; Disis, Mary L; Lu, Hailing

    2013-01-01

    Protein-bound polysaccharide-K (PSK) is a hot water extract from Trametes versicolor mushroom. It has been used traditionally in Asian countries for its immune stimulating and anti-cancer effects. We have recently found that PSK can activate toll-like receptor 2 (TLR2). TLR2 is highly expressed on dendritic cells (DC), so the currently study was undertaken to evaluate the effect of PSK on DC activation and the potential of using PSK as a vaccine adjuvant. In vitro experiments using mouse bone marrow-derived DC (BMDC) demonstrated that PSK induces DC maturation as shown by dose-dependent increase in the expression of CD80, CD86, MHCII, and CD40. PSK also induces the production of multiple inflammatory cytokines by DC, including IL-12, TNF-?, and IL-6, at both mRNA and protein levels. In vivo experiments using PSK as an adjuvant to OVAp323-339 vaccine showed that PSK as adjuvant leads to enlarged draining lymph nodes with higher number of activated DC. PSK also stimulates proliferation of OVA-specific T cells, and induces T cells that produce multiple cytokines, IFN-?, IL-2, and TNF-?. Altogether, these results demonstrate the ability of PSK to activate DC in vitro and in vivo and the potential of using PSK as a novel vaccine adjuvant. PMID:23735481

  9. Protein-bound polysaccharide-K induces IL-1? via TLR2 and NLRP3 inflammasome activation

    PubMed Central

    Yang, Yi; Inatsuka, Carol; Gad, Ekram; Disis, Mary L; Standish, Leanna J; Pugh, Nirmal; Pasco, David S; Lu, Hailing

    2015-01-01

    Inflammasome activation has been shown to regulate both innate and adaptive immune responses. It is important to investigate whether immune-enhancing natural products can also activate inflammasome. The current study examined the potential of protein-bound polysaccharide-K (PSK), a hot water extract from Trametes versicolor, to activate inflammasome. Using THP-1 cells, we have demonstrated that PSK induces both pro-IL-1? and mature IL-1? in THP-1 cells in a caspase 1- and NLRP3-dependent manner. PSK also induces IL-1? and IL-18 in human PBMC. Cathepsin B is required for PSK-induced inflammasome activation as CA-074-Me, a cathepsin B inhibitor, significantly decreased PSK-induced IL-1?. PSK induces NLRP3 at both mRNA and protein level. Comparison of PSK-induced IL-1? in bone marrow-derived macrophages from wild type C57BL/6 mice, TLR2?/?, P2X7R?/? and NLRP3?/? mice demonstrated that PSK-induced IL-1? is dependent on both TLR2 and NLRP3. P2X7R is not required for PSK-induced inflammasome activation, but enhances PSK-induced caspase-1 activation and IL-1? induction. Altogether, these results demonstrated that PSK induces inflammasome activation and production of IL-1? in a TLR2- and NLRP3-dependent mechanism. These results provide novel insights into the mechanisms of the immune modulatory effects of PSK. PMID:24323452

  10. Polysaccharide-K augments docetaxel-induced tumor suppression and antitumor immune response in an immunocompetent murine model of human prostate cancer.

    PubMed

    Wenner, Cynthia A; Martzen, Mark R; Lu, Hailing; Verneris, Michael R; Wang, Hongbo; Slaton, Joel W

    2012-04-01

    Advanced castration-resistant prostate cancer has high mortality rates and limited treatment options. Novel therapies are needed to better contend with this disease. Polysaccharide-K® (PSK), an extract of the mushroom Trametes versicolor, has immunomodulatory and tumor suppressive activities. PSK is used in Asia as a cancer immunotherapy. However, its benefit in combination with taxanes for prostate cancer is unknown. We examined whether PSK would enhance docetaxel-induced apoptosis and augment anti-tumor immune responses in orthotopic tumors using transgenic adenocarcinoma of the mouse prostate (TRAMP)-C2-bearing mice. Combining PSK with docetaxel induced significantly higher tumor suppression than either treatment alone (p<0.05), including a reduction in tumor proliferation and enhanced apoptosis. Combined PSK and docetaxel treatment led to a lower decrease in number of white blood cells than docetaxel alone, an effect accompanied by increased numbers of tumor-infiltrating CD4+ and CD8+ T cells. PSK with or without docetaxel significantly enhanced mRNA expression of IFN-? compared to control, but did not significantly alter T-regulatory FoxP3 mRNA expression in tumors. PSK also augmented docetaxel-induced splenic natural killer cell cytolytic activity against YAC-1 target cells (p=0.045). This study is the first to show that PSK enhances docetaxel-induced prostate cancer tumor suppression, apoptosis and antitumor responses. PMID:22159900

  11. PSP activates monocytes in resting human peripheral blood mononuclear cells: immunomodulatory implications for cancer treatment.

    PubMed

    Sekhon, Bhagwant Kaur; Sze, Daniel Man-Yuen; Chan, Wing Keung; Fan, Kei; Li, George Qian; Moore, Douglas Edwin; Roubin, Rebecca Heidi

    2013-06-15

    Polysaccharopeptide (PSP), from Coriolus versicolor, has been used as an adjuvant to chemotherapy, and has demonstrated anti-tumor and immunomodulating effects. However its mechanism remains unknown. To elucidate how PSP affects immune populations, we compared PSP treatments both with and without prior incubation in phytohaemagglutinin (PHA) - a process commonly used in immune population experimentation. We first standardised a capillary electrophoresis fingerprinting technique for PSP identification and characterisation. We then established the proliferative capability of PSP on various immune populations in peripheral blood mononuclear cells, using flow cytometry, without prior PHA treatment. It was found that PSP significantly increased the number of monocytes (CD14(+)/CD16(-)) compared to controls without PHA. This increase in monocytes was confirmed using another antibody panel of CD14 and MHCII. In contrast, proliferations of T-cells, NK, and B-cells were not significantly changed by PSP. Thus, stimulating monocyte/macrophage function with PSP could be an effective therapeutic intervention in targeting tumors. PMID:23497877

  12. Protein-bound polysaccharide activates dendritic cells and enhances OVA-specific T cell response as vaccine adjuvant.

    PubMed

    Engel, Abbi L; Sun, Guan-Cheng; Gad, Ekram; Rastetter, Lauren R; Strobe, Katie; Yang, Yi; Dang, Yushe; Disis, Mary L; Lu, Hailing

    2013-12-01

    Protein-bound polysaccharide-K (PSK) is a hot water extract from Trametes versicolor mushroom. It has been used traditionally in Asian countries for its immune stimulating and anti-cancer effects. We have recently found that PSK can activate Toll-like receptor 2 (TLR2). TLR2 is highly expressed on dendritic cells (DC), so the current study was undertaken to evaluate the effect of PSK on DC activation and the potential of using PSK as a vaccine adjuvant. In vitro experiments using mouse bone marrow-derived DC (BMDC) demonstrated that PSK induces DC maturation as shown by dose-dependent increase in the expression of CD80, CD86, MHCII, and CD40. PSK also induces the production of multiple inflammatory cytokines by DC, including IL-12, TNF-?, and IL-6, at both mRNA and protein levels. In vivo experiments using PSK as an adjuvant to OVAp323-339 vaccine showed that PSK as adjuvant leads to enlarged draining lymph nodes with higher number of activated DC. PSK also stimulates proliferation of OVA-specific T cells, and induces T cells that produce multiple cytokines, IFN-?, IL-2, and TNF-?. Altogether, these results demonstrate the ability of PSK to activate DC in vitro and in vivo and the potential of using PSK as a novel vaccine adjuvant. PMID:23735481

  13. Comparative assessment of bioremediation approaches to highly recalcitrant PAH degradation in a real industrial polluted soil.

    PubMed

    Lladó, S; Covino, S; Solanas, A M; Viñas, M; Petruccioli, M; D'annibale, A

    2013-03-15

    High recalcitrant characteristics and low bioavailability rates due to aging processes can hinder high molecular weight polycyclic aromatic hydrocarbons (HMW-PAHs) bioremediation in real industrial polluted soils. With the aim of reducing the residual fraction of total petroleum hydrocarbons (TPH) and (HMW-PAHs) in creosote-contaminated soil remaining after a 180-d treatment in a pilot-scale biopile, either biostimulation (BS) of indigenous microbial populations with a lignocellulosic substrate (LS) or fungal bioaugmentation with two strains of white-rot fungi (WRF) (i.e., Trametes versicolor and Lentinus tigrinus) were comparatively tested. The impact of bivalent manganese ions and two mobilizing agents (MAs) (i.e., Soybean Oil and Brij 30) on the degradation performances of biostimulated and bioaugmented microcosms was also compared. The results reveal soil colonization by both WRF strains was clearly hampered by an active native soil microbiota. In fact, a proper enhancement of native microbiota by means of LS amendment promoted the highest biodegradation of HMW-PAHs, even of those with five aromatic rings after 60 days of treatment, but HMW-PAH-degrading bacteria were specifically inhibited when non-ionic surfactant Brij 30 was amended. Effects of bioaugmentation and other additives such as non-ionic surfactants on the degrading capability of autochthonous soil microbiota should be evaluated in polluted soils before scaling up the remediation process at field scale. PMID:23416485

  14. Degradation of Bunker C Fuel Oil by White-Rot Fungi in Sawdust Cultures Suggests Potential Applications in Bioremediation

    PubMed Central

    Young, Darcy; Rice, James; Martin, Rachael; Lindquist, Erika; Lipzen, Anna; Grigoriev, Igor; Hibbett, David

    2015-01-01

    Fungal lignocellulolytic enzymes are promising agents for oxidizing pollutants. This study investigated degradation of Number 6 “Bunker C” fuel oil compounds by the white-rot fungi Irpex lacteus, Trichaptum biforme, Phlebia radiata, Trametes versicolor, and Pleurotus ostreatus (Basidiomycota, Agaricomycetes). Averaging across all studied species, 98.1%, 48.6%, and 76.4% of the initial Bunker C C10 alkane, C14 alkane, and phenanthrene, respectively were degraded after 180 days of fungal growth on pine media. This study also investigated whether Bunker C oil induces changes in gene expression in the white-rot fungus Punctularia strigosozonata, for which a complete reference genome is available. After 20 days of growth, a monokaryon P. strigosozonata strain degraded 99% of the initial C10 alkane in both pine and aspen media but did not affect the amounts of the C14 alkane or phenanthrene. Differential gene expression analysis identified 119 genes with ? log2(2-fold) greater expression in one or more treatment comparisons. Six genes were significantly upregulated in media containing oil; these genes included three enzymes with potential roles in xenobiotic biotransformation. Carbohydrate metabolism genes showing differential expression significantly accumulated transcripts on aspen vs. pine substrates, perhaps reflecting white-rot adaptations to growth on hardwood substrates. The mechanisms by which P. strigosozonata may degrade complex oil compounds remain obscure, but degradation results of the 180-day cultures suggest that diverse white-rot fungi have promise for bioremediation of petroleum fuels. PMID:26111162

  15. Mycotoxins in Crude Building Materials from Water-Damaged Buildings

    PubMed Central

    Tuomi, Tapani; Reijula, Kari; Johnsson, Tom; Hemminki, Kaisa; Hintikka, Eeva-Liisa; Lindroos, Outi; Kalso, Seija; Koukila-Kähkölä, Pirkko; Mussalo-Rauhamaa, Helena; Haahtela, Tari

    2000-01-01

    We analyzed 79 bulk samples of moldy interior finishes from Finnish buildings with moisture problems for 17 mycotoxins, as well as for fungi that could be isolated using one medium and one set of growth conditions. We found the aflatoxin precursor, sterigmatocystin, in 24% of the samples and trichothecenes in 19% of the samples. Trichothecenes found included satratoxin G or H in five samples; diacetoxyscirpenol in five samples; and 3-acetyl-deoxynivalenol, deoxynivalenol, verrucarol, or T-2-tetraol in an additional five samples. Citrinine was found in three samples. Aspergillus versicolor was present in most sterigmatocystin-containing samples, and Stachybotrys spp. were present in the samples where satratoxins were found. In many cases, however, the presence of fungi thought to produce the mycotoxins was not correlated with the presence of the expected compounds. However, when mycotoxins were found, some toxigenic fungi usually were present, even if the species originally responsible for producing the mycotoxin was not isolated. We conclude that the identification and enumeration of fungal species present in bulk materials are important to verify the severity of mold damage but that chemical analyses are necessary if the goal is to establish the presence of mycotoxins in moldy materials. PMID:10788357

  16. Three-dimensional organization of three-domain copper oxidases: A review

    SciTech Connect

    Zhukhlistova, N. E. Zhukova, Yu. N.; Lyashenko, A. V.; Zaitsev, V. N.; Mikhailov, A. M.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  17. Biosensor for the determination of phenols based on cross-linked enzyme crystals (CLEC) of laccase.

    PubMed

    Roy, J Jegan; Abraham, T Emilia; Abhijith, K S; Kumar, P V Sujith; Thakur, M S

    2005-07-15

    Cross-linked enzyme crystals (CLECs) are a versatile form of biocatalyst that can also be used for biosensor application. Laccase from Trametes versicolor (E.C.1.10.3.2) was crystallized, cross-linked and lyophilized with beta-cyclodextrin. The CLEC laccase was found to be highly active towards phenols like 2-amino phenol, guaiacol, catechol, pyrogallol, catechin and ABTS (non-phenolic). The CLEC laccase was embedded in 30% polyvinylpropylidone (PVP) gel and mounted into an electrode to make the sensor. The biosensor was used to detect the phenols in 50-1000 micromol concentration level. Phenols with lower molecular weight such as 2-amino phenol, catechol and pyrogallol gave a short response time where as the higher molecular weight substrates like catechin and ABTS had comparatively a long response time. The optimum pH of the analyte was 5.5-6.0 when catechol was used as substrate. The CLEC laccase retained good activity for over 3 months. PMID:15967371

  18. Purification and characterization of an extracellular laccase from the edible mushroom Lentinula edodes, and decolorization of chemically different dyes.

    PubMed

    Nagai, M; Sato, T; Watanabe, H; Saito, K; Kawata, M; Enei, H

    2002-11-01

    A laccase (EC 1.10.3.2) was isolated from the culture filtrate of Lentinula edodes. The enzyme was purified to a homogeneous preparation using hydrophobic, anion-exchange, and size-exclusion chromatographies. SDS-PAGE analysis showed the purified laccase, Lcc 1, to be a monomeric protein of 72.2 kDa. The enzyme had an isoelectric point of around pH 3.0. The optimum pH for enzyme activity was around 4.0, and it was most active at 40 degrees C and stable up to 35 degrees C. The enzyme contained 23.8% carbohydrate and some copper atoms. The enzyme oxidized 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, p-phenylendiamine, pyrogallol, guaiacol, 2,6-dimethoxyphenol, catechol, and ferulic acid, but not veratryl alcohol, tyrosine, and beta-(3,4-dihydroxyphenyl) alanine. The N-terminal amino acid sequence of Lcc 1 showed close homology to the N-terminal sequences determined for laccases from Phlebia radiata, Trametes villosa, and Trametes versicolor, but only low similarity was observed to a previously reported laccase from L. edodes. Lcc 1 was effective in the decolorization of chemically different dyes - Remazole Brilliant Blue R, Bromophenol Blue, methyl red, and Naphtol Blue Black - without any mediators, but the decolorization of two dyes - red poly(vinylamine)sulfonate-anthrapyridone dye and Reactive Orange 16 - did require some redox mediators. PMID:12436315

  19. Photoenhanced toxicity of a carbamate insecticide to early life stage anuran amphibians

    USGS Publications Warehouse

    Zaga, A.; Little, E.E.; Rabeni, C.F.; Ellersieck, Mark R.

    1998-01-01

    African clawed frog (Xenopus laevis) and gray tree frog (Hyla versicolor) embryos and tadpoles were exposed to sublethal levels of carbaryl, a broad-spectrum insecticide, and ultraviolet radiation to determine interactive and sublethal effects. Ultraviolet intensity (UV-B [285-320 nm] plus LIV-A [321-400 nm]) was controlled with various types of plastic filters and quantified with a scanning spectroradiometer. Significant differences in swimming activity and mortality of both species were evident during the 96-h experiments. Ultraviolet-B radiation alone and carbaryl in the presence of UV-B significantly decreased swimming activity of both species. As little as 1.5% intensity of ambient solar UV-B radiation photoactivated carbaryl. Toxicity of 7.5 mg/L earbaryl increased by 10-fold in the presence of UV-B in all species and life stages tested. Our results indicate that photoenhancement by solar UV-B radiation should be considered when evaluating the toxicity of contaminants to amphibians and other organisms.

  20. Evaluation of the Antioxidant Activities and Tyrosinase Inhibitory Property from Mycelium Culture Extracts

    PubMed Central

    Park, Ki Moon; Kwon, Kyung Min; Lee, Seung Ho

    2015-01-01

    Since mushrooms have many bioactive components, they have been used as components in folk medicine. Because mycelium has an advantage when it comes to large-scale production, this study aimed to evaluate the antioxidant properties and anti-tyrosinase activity from 55 mycelia in culture media. Relatively high 2,2-diphenyl-1-picrylhydrazyl (DPPH) scavenging capacity was detected from the ethanol extract of culture media including mycelium (EECiM) of Morchella esculenta var. esculenta (MEVE), Auricularia polytricha (APO), Tremella aurantia (TAU), Volvariella bombycina (VBO), and Oudemansiella sp. (Osp), which also showed strong reducing power and inhibitory activity in relation to the thiobarbituric acid (TBA) value. On the other hand, relatively high tyrosinase inhibitory activity was detected in Inonotus mikadoi (IMI), Coriolus versicolor (CVE), Volvariella volvacea (VVO), Panellus serotinus (PSE), Auricularia auricula (AAU), and Fomitopsis sp. (Fsp). Interestingly, the APO EECiM exhibited the highest DPPH radical scavenging rate (77.5 ± 4.3%) and reducing power (1.18 ± 0.041), while the highest inhibitory power of the TBA value and antityrosinase activity were detected in that of TAU (64.5 ± 4.1%) and IMI (46.0 ± 7.5%), respectively. Overall, our study suggested potential candidates for EECiMs that exhibited powerful antioxidant and tyrosinase inhibitory properties and might be used as natural antioxidant tyrosinase inhibitor. PMID:26345142

  1. Recombinant expression of four oxidoreductases in Phanerochaete chrysosporium improves degradation of phenolic and non-phenolic substrates.

    PubMed

    Coconi-Linares, Nancy; Ortiz-Vázquez, Elizabeth; Fernández, Francisco; Loske, Achim M; Gómez-Lim, Miguel A

    2015-09-10

    Phanerochaete chrysosporium belongs to a group of lignin-degrading fungi that secretes various oxidoreductive enzymes, including lignin peroxidase (LiP) and manganese peroxidase (MnP). Previously, we demonstrated that the heterologous expression of a versatile peroxidase (VP) in P. chrysosporium recombinant strains is possible. However, the production of laccases (Lac) in this fungus has not been completely demonstrated and remains controversial. In order to investigate if the co-expression of Lac and VP in P. chrysosporium would improve the degradation of phenolic and non-phenolic substrates, we tested the constitutive co-expression of the lacIIIb gene from Trametes versicolor and the vpl2 gene from Pleurotus eryngii, and also the endogenous genes mnp1 and lipH8 by shock wave mediated transformation. The co-overexpression of peroxidases and laccases was improved up to five-fold as compared with wild type species. Transformant strains showed a broad spectrum in phenolic/non-phenolic biotransformation and a high percentage in synthetic dye decolorization in comparison with the parental strain. Our results show that the four enzymes can be constitutively expressed in a single transformant of P. chrysosporium in minimal medium. These data offer new possibilities for an easy and efficient co-expression of laccases and peroxidases in suitable basidiomycete species. PMID:26113215

  2. Evaluation of pretreatment with Pleurotus ostreatus for enzymatic hydrolysis of rice straw.

    PubMed

    Taniguchi, Masayuki; Suzuki, Hiroyuki; Watanabe, Daisuke; Sakai, Kenji; Hoshino, Kazuhiro; Tanaka, Takaaki

    2005-12-01

    The effects of biological pretreatment of rice straw using four white-rot fungi (Phanerochaete chrysosporium, Trametes versicolor, Ceriporiopsis subvermispora, and Pleurotus ostreatus) were evaluated on the basis of quantitative and structural changes in the components of the pretreated rice straw as well as susceptibility to enzymatic hydrolysis. Of these white-rot fungi, P. ostreatus selectively degraded the lignin fraction of rice straw rather than the holocellulose component. When rice straw (water content of 60%) was pretreated with P. ostreatus for 60 d, the total weight loss and the degree of Klason lignin degraded were 25% and 41%, respectively. After the pretreatment, the residual amounts of cellulose and hemicellulose were 83% and 52% of those in untreated rice straw, respectively. By enzymatic hydrolysis with a commercial cellulase preparation for 48 h, 52% holocellulose and 44% cellulose in the pretreated rice straw were solubilized. The net sugar yields based on the amounts of holocellulose and cellulose of untreated rice straw were 33% for total soluble sugar from holocellulose and 32% for glucose from cellulose. The SEM observations showed that the increase in susceptibility of rice straw to enzymatic hydrolysis by pretreatment with P. ostreatus is caused by partial degradation of the lignin seal. When the content of Klason lignin was less than 15% of the total weight of the pretreated straw, enhanced degrees of enzymatic solubilization of holocellulose and cellulose fractions were observed as the content of Klason lignin decreased. PMID:16473773

  3. Prediction of Toxigenic Fungal Growth in Buildings by Using a Novel Modelling System

    PubMed Central

    Rowan, Neil J.; Johnstone, Cameron M.; McLean, R. Craig; Anderson, John G.; Clarke, Joe A.

    1999-01-01

    There is growing concern about the adverse effects of fungal bioaerosols on the occupants of damp dwellings. Based on an extensive analysis of previously published data and on experiments carried out within this study, critical limits for the growth of the indoor fungi Eurotium herbariorum, Aspergillus versicolor, and Stachybotrys chartarum were mathematically described in terms of growth limit curves (isopleths) which define the minimum combination of temperature (T) and relative humidity (RH) at which growth will occur. Each growth limit curve was generated from a series of data points on a T-RH plot and mathematically fitted by using a third-order polynomial equation of the form RH = a3T3 + a2T2 + a1T + a0. This fungal growth prediction model was incorporated within the ESP-r (Environmental Systems Performance [r stands for “research”]) computer-based program for transient simulation of the energy and environmental performance of buildings. For any specified location, the ESP-r system is able to predict the time series evolution of local surface temperature and relative humidity, taking explicit account of constructional moisture flow, moisture generation sources, and air movement. This allows the predicted local conditions to be superimposed directly onto fungal growth curves. The concentration of plotted points relative to the curves allows an assessment of the risk of fungal growth. The system’s predictive capability was tested via laboratory experiments and by comparison with monitored data from a fungus-contaminated house. PMID:10543791

  4. A Single-Electron Reducing Quinone Oxidoreductase Is Necessary to Induce Haustorium Development in the Root Parasitic Plant Triphysaria[C][W

    PubMed Central

    Bandaranayake, Pradeepa C.G.; Filappova, Tatiana; Tomilov, Alexey; Tomilova, Natalya B.; Jamison-McClung, Denneal; Ngo, Quy; Inoue, Kentaro; Yoder, John I.

    2010-01-01

    Parasitic plants in the Orobanchaceae develop haustoria in response to contact with host roots or chemical haustoria-inducing factors. Experiments in this manuscript test the hypothesis that quinolic-inducing factors activate haustorium development via a signal mechanism initiated by redox cycling between quinone and hydroquinone states. Two cDNAs were previously isolated from roots of the parasitic plant Triphysaria versicolor that encode distinct quinone oxidoreductases. QR1 encodes a single-electron reducing NADPH quinone oxidoreductase similar to ?-crystallin. The QR2 enzyme catalyzes two electron reductions typical of xenobiotic detoxification. QR1 and QR2 transcripts are upregulated in a primary response to chemical-inducing factors, but only QR1 was upregulated in response to host roots. RNA interference technology was used to reduce QR1 and QR2 transcripts in Triphysaria roots that were evaluated for their ability to form haustoria. There was a significant decrease in haustorium development in roots silenced for QR1 but not in roots silenced for QR2. The infrequent QR1 transgenic roots that did develop haustoria had levels of QR1 similar to those of nontransgenic roots. These experiments implicate QR1 as one of the earliest genes on the haustorium signal transduction pathway, encoding a quinone oxidoreductase necessary for the redox bioactivation of haustorial inducing factors. PMID:20424175

  5. Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris

    PubMed Central

    Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.

    1999-01-01

    The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI?LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10?4 cm s?1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012

  6. Chemopreventive Effect of PSP Through Targeting of Prostate Cancer Stem Cell-Like Population

    PubMed Central

    Liu, Ji; Lee, Davy Tak-Wing; Chiu, Yung-Tuen; Ma, Stephanie; Ng, Irene Oi-Lin; Wong, Yong-Chuan; Chan, Franky Leung; Ling, Ming-Tat

    2011-01-01

    Recent evidence suggested that prostate cancer stem/progenitor cells (CSC) are responsible for cancer initiation as well as disease progression. Unfortunately, conventional therapies are only effective in targeting the more differentiated cancer cells and spare the CSCs. Here, we report that PSP, an active component extracted from the mushroom Turkey tail (also known as Coriolus versicolor), is effective in targeting prostate CSCs. We found that treatment of the prostate cancer cell line PC-3 with PSP led to the down-regulation of CSC markers (CD133 and CD44) in a time and dose-dependent manner. Meanwhile, PSP treatment not only suppressed the ability of PC-3 cells to form prostaspheres under non-adherent culture conditions, but also inhibited their tumorigenicity in vivo, further proving that PSP can suppress prostate CSC properties. To investigate if the anti-CSC effect of PSP may lead to prostate cancer chemoprevention, transgenic mice (TgMAP) that spontaneously develop prostate tumors were orally fed with PSP for 20 weeks. Whereas 100% of the mice that fed with water only developed prostate tumors at the end of experiment, no tumors could be found in any of the mice fed with PSP, suggesting that PSP treatment can completely inhibit prostate tumor formation. Our results not only demonstrated the intriguing anti-CSC effect of PSP, but also revealed, for the first time, the surprising chemopreventive property of oral PSP consumption against prostate cancer. PMID:21603625

  7. Single Agent Polysaccharopeptide Delays Metastases and Improves Survival in Naturally Occurring Hemangiosarcoma

    PubMed Central

    Brown, Dorothy Cimino; Reetz, Jennifer

    2012-01-01

    The 2008 World Health Organization World Cancer Report describes global cancer incidence soaring with many patients living in countries that lack resources for cancer control. Alternative treatment strategies that can reduce the global disease burden at manageable costs must be developed. Polysaccharopeptide (PSP) is the bioactive agent from the mushroom Coriolus versicolor. Studies indicate PSP has in vitro antitumor activities and inhibits the growth of induced tumors in animal models. Clear evidence of clinically relevant benefits of PSP in cancer patients, however, is lacking. The investment of resources required to complete large-scale, randomized controlled trials of PSP in cancer patients is more easily justified if antitumor and survival benefits are documented in a complex animal model of a naturally occurring cancer that parallels human disease. Because of its high metastatic rate and vascular origin, canine hemangiosarcoma is used for investigations in antimetastatic and antiangiogenic therapies. In this double-blind randomized multidose pilot study, high-dose PSP significantly delayed the progression of metastases and afforded the longest survival times reported in canine hemangiosarcoma. These data suggest that, for those cancer patients for whom advanced treatments are not accessible, PSP as a single agent might offer significant improvements in morbidity and mortality. PMID:22988473

  8. Chemopreventive effect of PSP through targeting of prostate cancer stem cell-like population.

    PubMed

    Luk, Sze-Ue; Lee, Terence Kin-Wah; Liu, Ji; Lee, Davy Tak-Wing; Chiu, Yung-Tuen; Ma, Stephanie; Ng, Irene Oi-Lin; Wong, Yong-Chuan; Chan, Franky Leung; Ling, Ming-Tat

    2011-01-01

    Recent evidence suggested that prostate cancer stem/progenitor cells (CSC) are responsible for cancer initiation as well as disease progression. Unfortunately, conventional therapies are only effective in targeting the more differentiated cancer cells and spare the CSCs. Here, we report that PSP, an active component extracted from the mushroom Turkey tail (also known as Coriolus versicolor), is effective in targeting prostate CSCs. We found that treatment of the prostate cancer cell line PC-3 with PSP led to the down-regulation of CSC markers (CD133 and CD44) in a time and dose-dependent manner. Meanwhile, PSP treatment not only suppressed the ability of PC-3 cells to form prostaspheres under non-adherent culture conditions, but also inhibited their tumorigenicity in vivo, further proving that PSP can suppress prostate CSC properties. To investigate if the anti-CSC effect of PSP may lead to prostate cancer chemoprevention, transgenic mice (TgMAP) that spontaneously develop prostate tumors were orally fed with PSP for 20 weeks. Whereas 100% of the mice that fed with water only developed prostate tumors at the end of experiment, no tumors could be found in any of the mice fed with PSP, suggesting that PSP treatment can completely inhibit prostate tumor formation. Our results not only demonstrated the intriguing anti-CSC effect of PSP, but also revealed, for the first time, the surprising chemopreventive property of oral PSP consumption against prostate cancer. PMID:21603625

  9. Antihyperglycemic effect of crude extracts of some Egyptian plants and algae.

    PubMed

    AbouZid, Sameh Fekry; Ahmed, Osama Mohamed; Ahmed, Rasha Rashad; Mahmoud, Ayman; Abdella, Ehab; Ashour, Mohamed Badr

    2014-03-01

    Diabetes mellitus is a major global health problem. Various plant extracts have proven antidiabetic activity and are considered as promising substitution for antidiabetic drugs. The antihyperglycemic effect of 16 plants and 4 algae, commonly used in Egypt for the treatment of diabetes mellitus, was investigated. A diabetes model was induced by intraperitoneal injection of nicotinamide (120?mg/kg body weight [b.wt.]), then streptozotocin (200?mg/kg b.wt.) after 15?min. Hydroethanolic extracts (80%) of the plants and algae under investigation were prepared. The extracts were orally administered to nicotinamide-streptozotocin-induced diabetic mice by a gastric tube at doses 10 or 50?mg/kg b.wt. for 1 week. The antidiabetic activity was assessed by detection of serum glucose concentrations at the fasting state and after 2?h of oral glucose loading (4.2?mg/kg b.wt.). Extracts prepared from Cassia acutifolia, Fraxinus ornus, Salix aegyptiaca, Cichorium intybus, and Eucalyptus globulus showed the highest antihyperglycemic activity among the tested plants. Extracts prepared from Sonchus oleraceus, Bougainvillea spectabilis (leaves), Plantago psyllium (seeds), Morus nigra (leaves), and Serena repens (fruits) were found to have antihyperglycemic potentials. Extracts prepared from Caulerpa lentillifera and Spirulina versicolor showed the most potent antihyperglycemic activity among the tested algae. However, some of the tested plants have insulinotropic effects, all assessed algae have not. Identification of lead compounds from these plants and algae for novel antidiabetic drug development is recommended. PMID:24404976

  10. MALDI-TOF mass spectrometry fingerprinting: A diagnostic tool to differentiate dematiaceous fungi Stachybotrys chartarum and Stachybotrys chlorohalonata.

    PubMed

    Gruenwald, Maike; Rabenstein, Andreas; Remesch, Markko; Kuever, Jan

    2015-08-01

    Stachybotrys chartarum and Stachybotrys chlorohalonata are two closely related species. Unambiguous identification of these two species is a challenging task if relying solely on morphological criteria and therefore smarter and less labor-intensive approaches are needed. Here we show that even such closely related species of fungi as S. chartarum and S. chlorohalonata are unequivocally discriminated by their highly reproducible MALDI-TOF-MS fingerprints (matrix assisted laser desorption/ionization time-of-flight mass spectrometry fingerprints). We examined 19 Stachybotrys and one Aspergillus isolate by MALDI-TOF-MS. All but one isolate produced melanin containing conidia on malt extract agar. Mass spectra were obtained in good quality from the analysis of hyaline and darkly pigmented conidia by circumventing the property of melanin which causes signal suppression. MALDI-TOF fingerprint analysis clearly discriminated not only the two morphologically similar species S. chartarum and S. chlorohalonata from each other but separated them precisely from Stachybotrys bisbyi and Aspergillus versicolor isolates. Furthermore, even S. chartarum chemotypes A and S could be differentiated into two distinct groups by their MALDI-TOF fingerprints. The chemotypes of S. chartarum isolates were identified by trichodiene synthase 5 (tri5) sequences prior to mass spectra analysis. Additionally, species identities of all isolates were verified by their 18S rRNA and tri5 gene sequences. PMID:26036596

  11. Sistemas Correctores de Campo Para EL Telescopio Cassegrain IAC80

    NASA Astrophysics Data System (ADS)

    Galan, M. J.; Cobos, F. J.

    1987-05-01

    El proyecto de instrumentación de mayor importancia que ha tenido el Instituto de Astrofisica de Canarias en los últimos afios ha sido el diseflo y construcción del te1escopio IAC8O. Este requería del esfuerzo con junto en mec´nica, óptica y electrónica, lo que facilitó la estructuración y el crecimiento de los respectivos grupos de trabajo, que posteriormente se integraron en departamentos En su origen (1977), el telescopio IAC80 fue concebido como un sistema clásico tipo Cassegrain, con una razón focal F/i 1.3 para el sistema Casse grain y una razón focal F/20 para el sistema Coudé. Posteriormente, aunque se mantuvo la filosofia de que el sistema básico fuera el F/11.3, se consideró conveniente el diseño de secundarios para razones focales F/16 y F/32, y se eliminó el de F/20. Sin embargo, dada la importancia relativa que un foco estrictamente fotográfico tiene en un telescopio moderno, diseñado básicamente para fotometría fotoeléctrica y con un campo util mínimamente de 40 minutos de arco, se decídió Ilevar a cabo el diseño de un secundario F/8 con un sistema corrector de campo, pero que estuviera formado únicamente por lentes con superficies esféricas para que asl su construcción fuera posible en España ó en México. La creciente utilización de detectores bidimensionales para fines de investigación astron6mica y la viabilidad de que en un futuro cercano éstos tengan un área sensible cada vez mayor, hicieron atractiva la idea de tener diseñado un sistema corrector de campo para el foco primario (F/3), con un campo útil mínimo de un grado, y también con la limitante de que sus componentes tuvieron sólamente supérficies esféricas. Ambos diseños de los sis-temas correctores de campo se llevaron a cabo, en gran medida, como parte de un proyecto de colaboración e intercambio en el área de diseño y evaluación de sistemas ópticos.

  12. The toxicity of Roundup Original Max to 13 species of larval amphibians.

    PubMed

    Relyea, Rick A; Jones, Devin K

    2009-09-01

    With the increased use of glyphosate-based herbicides (marketed under several names, including Roundup and Vision), there has been a concomitant increased concern about the unintended impacts that particular formulations containing the popular surfactant polyethoxylated tallowamine (POEA) might have on amphibians. Published studies have examined a relatively small number of anuran species (primarily from Australia and eastern North America) and, surprisingly, no species of salamanders. Using a popular formulation of glyphosate (Roundup Original Max), the goal of the present study was to conduct tests of lethal concentrations estimated to kill 50% of a population after 96 h (LC50(96-h)) on a wider diversity of species from both eastern and western North America. Tests were conducted on nine species of stage 25, larval anurans from three families (Ranidae: Rana pipiens, R. clamitans, R. sylvatica, R. catesbeiana, R. cascadae; Bufonidae: Bufo americanus, B. boreas; and Hylidae: Hyla versicolor, Pseudacris crucifer) and four species of larval salamanders from two families (Ambystomatidae: Ambystoma gracile, A. maculatum, A. laterale; and Salamandridae: Notophthalmus viridescens). For the nine species of larval anurans, LC50(96-h) values ranged from 0.8- to 2.0-mg acid equivalents per liter with relatively little pattern in differential sensitivity among the species or families. The four species of larval salamanders were less sensitive than the anurans, with LC50(96-h) values ranging from 2.7- to 3.2-mg acid equivalents per liter and no substantial differences among the species of salamanders. This work substantially increases the available data on amphibian sensitivity to glyphosate formulations that include either POEA surfactants or the equally moderately to highly toxic surfactants of Roundup Original Max and should be useful for improving future risk assessments. PMID:19405783

  13. (Physiology and molecular biology of extracellular peroxidases, H sub 2 O sub 2 -generating system and deregulated mutants of Phanerochaete chrysosporium)

    SciTech Connect

    Not Available

    1992-01-01

    We have expanded the work on the LIP genes to Trametes versicolor, the second most studied white-rot fungus after P. chrysosporium. Six LIP genes have been cloned from this organism and one of these has been completely sequenced and compared to the known LIP genes that have been described to date. Our studies gave us further insights into the novel non-integrative transformation system of P. chrysosporium. Our recombinant plasmid pUGLGl-kan, which contains a LIP gene disrupted by the insertion of kan{sup r} determinant, also failed to integrate into the chromosome. Instead, it was maintained as a circular extrachromosomal element and was recoverable as a plasmid both from the meiotic and mitotic progeny. Basic characterization of the lignin peroxidase-negative mutant (lip mutant) and nitrogen-deregulated mutant has been completed. We also investigated the question whether carbon, nitrogen, and Mn(II) regulate LIP expression coordinately or independently. Results indicate that these three environmental controls independently regulate LIP and MNP gene expression. Furthermore, an idiophasic protease has been shown to be responsible for the sharp decline in LIP activity after day 6 of incubation in low nitrogen cultures and addition of glucose to these day 6 cultures has been shown to suppress the protease levels and maintain high levels of LIP. The results further indicated that this protease is synthesized de novo during the idiophase. Additional studies showed that MNPs play a dominant role in the decolorization of chlorolignols in bleached kraft pulp effluents and that LIPs play a relatively minor role in this process. These studies have since been confirmed independently by an Austrian group.

  14. [Physiology and molecular biology of extracellular peroxidases, H{sub 2}O{sub 2}-generating system and deregulated mutants of Phanerochaete chrysosporium]. Progress report

    SciTech Connect

    Not Available

    1992-07-01

    We have expanded the work on the LIP genes to Trametes versicolor, the second most studied white-rot fungus after P. chrysosporium. Six LIP genes have been cloned from this organism and one of these has been completely sequenced and compared to the known LIP genes that have been described to date. Our studies gave us further insights into the novel non-integrative transformation system of P. chrysosporium. Our recombinant plasmid pUGLGl-kan, which contains a LIP gene disrupted by the insertion of kan{sup r} determinant, also failed to integrate into the chromosome. Instead, it was maintained as a circular extrachromosomal element and was recoverable as a plasmid both from the meiotic and mitotic progeny. Basic characterization of the lignin peroxidase-negative mutant (lip mutant) and nitrogen-deregulated mutant has been completed. We also investigated the question whether carbon, nitrogen, and Mn(II) regulate LIP expression coordinately or independently. Results indicate that these three environmental controls independently regulate LIP and MNP gene expression. Furthermore, an idiophasic protease has been shown to be responsible for the sharp decline in LIP activity after day 6 of incubation in low nitrogen cultures and addition of glucose to these day 6 cultures has been shown to suppress the protease levels and maintain high levels of LIP. The results further indicated that this protease is synthesized de novo during the idiophase. Additional studies showed that MNPs play a dominant role in the decolorization of chlorolignols in bleached kraft pulp effluents and that LIPs play a relatively minor role in this process. These studies have since been confirmed independently by an Austrian group.

  15. Formaldehyde as a proof and response to various kind of stress in some Basidiomycetes.

    PubMed

    Jarosz-Wilkolazka, A; Fink-Boots, M; Malarczyk, E; Leonowicz, A

    1998-01-01

    The influence of cadmium chloride and/or high temperature on the level of selected parameters were examined in both medium and mycelium of some Basidiomycetes belonging to white-rot fungi: Abortiporus biennis, Trametes versicolor and Cerrena unicolor. We investigated changes in the formaldehyde (FA) level and in the level of superoxide radical anions (SR). Accordingly, the capacity of three enzymes was also studied: two enzymes of the cellular antioxidative system - superoxide dismutase (SOD; EC 1.15.1.1), and catalase (CAT; EC 1.11.1.6), and laccase (LAC; EC 1.10.3.2) the main lignin-modifying enzyme, which is produced by white-rot fungi. During the first 24 hours after application of separate stressors, or jointly with two stressors to 10-day-old cultivation, changes in all selected parameters were observed. Moreover, we found significant changes in the levels of extracellular SR, FA and extra- and intracellular activity of LAC. Simultaneous action of two stressors in the fungal cultures decreased the extracellular LAC level, intracellular CAT activity and the level of SR in the medium compared to the control values, while using the two stress factors separately would strongly make these values increase. Stressful conditions brought a rapid increase in the level of FA in all fungal species. The results of our study, carried out on selected strains of Basidiomycetes, seem to have shown that: (I) LAC, the lignin-modifying enzyme, may have an important application in fungal stress response, and take part in the cross-protection between responses to heat shock and cadmium resistance; (2) the oxidative burst as a result of cadmium and high temperature treatment is an additional factor to damage fungal cells; (3) FA may be a determining factor in the phases of fungal stress syndrome. PMID:10526985

  16. Associations between fungal species and water-damaged building materials.

    PubMed

    Andersen, Birgitte; Frisvad, Jens C; Søndergaard, Ib; Rasmussen, Ib S; Larsen, Lisbeth S

    2011-06-01

    Fungal growth in damp or water-damaged buildings worldwide is an increasing problem, which has adverse effects on both the occupants and the buildings. Air sampling alone in moldy buildings does not reveal the full diversity of fungal species growing on building materials. One aim of this study was to estimate the qualitative and quantitative diversity of fungi growing on damp or water-damaged building materials. Another was to determine if associations exist between the most commonly found fungal species and different types of materials. More than 5,300 surface samples were taken by means of V8 contact plates from materials with visible fungal growth. Fungal identifications and information on building material components were analyzed using multivariate statistic methods to determine associations between fungi and material components. The results confirmed that Penicillium chrysogenum and Aspergillus versicolor are the most common fungal species in water-damaged buildings. The results also showed Chaetomium spp., Acremonium spp., and Ulocladium spp. to be very common on damp building materials. Analyses show that associated mycobiotas exist on different building materials. Associations were found between (i) Acremonium spp., Penicillium chrysogenum, Stachybotrys spp., Ulocladium spp., and gypsum and wallpaper, (ii) Arthrinium phaeospermum, Aureobasidium pullulans, Cladosporium herbarum, Trichoderma spp., yeasts, and different types of wood and plywood, and (iii) Aspergillus fumigatus, Aspergillus melleus, Aspergillus niger, Aspergillus ochraceus, Chaetomium spp., Mucor racemosus, Mucor spinosus, and concrete and other floor-related materials. These results can be used to develop new and resistant building materials and relevant allergen extracts and to help focus research on relevant mycotoxins, microbial volatile organic compounds (MVOCs), and microparticles released into the indoor environment. PMID:21531835

  17. Production of mycotoxins on artificially and naturally infested building materials.

    PubMed

    Nielsen, K F; Gravesen, S; Nielsen, P A; Andersen, B; Thrane, U; Frisvad, J C

    1999-01-01

    In this study, the ability to produce mycotoxins during growth on artificially infested building materials was investigated for Penicillium chrysogenum, Pen. polonicum, Pen. brevicompactum, Chaetomium spp., Aspergillus ustus, Asp. niger, Ulocladium spp., Alternaria spp., and Paecilomyces spp., all isolated from water-damaged building materials. Spores from the different isolates of the above mentioned species were inoculated on gypsum board with and without wallpaper and on chipboard with and without wallpaper. Fungal material was scraped off the materials, extracted, and analyzed using high performance liquid chromatography-diode array detection and thin layer chromatography. All six isolates of C. globosum produced the toxic chaetoglobosins A and C, at levels of up to 50 and 7 microg/cm2 respectively. The quantities of secondary metabolites produced by Penicillia were generally low, and no toxin production was detected from any of the five isolates of Pen. chrysogenum. Both isolates of Pen. polonicum produced 3-methoxy-viridicatin, verrucosidin, and verrucofortine. Two of five isolates of Pen. brevicompactum produced mycophenolic acid. From five out of six isolates of Alternaria spp., altenariol and alternariol monomethyl ether were detected. From Ulocladium spp., Paecilomyces spp., and Asp. ustus no known mycotoxins were detected, although the latter two are known mycotoxin producers. Asp. niger produced several naphtho-gamma-pyrones and tetra-cyclic compounds. All investigated species, especially Asp. ustus and Asp. niger produced many unknown secondary metabolites on the building materials. Analyses of wallpaper and glass-fibre wallpaper naturally infested with Asp. versicolor revealed sterigmatocystin and 5-methoxysterigmatocystin. Analyses of naturally infested wallpaper showed that C. globosum produced the chaetoglobosins A and C, and Pen. chrysogenum produced the antibiotic meleagrin. PMID:10560628

  18. Swimming with predators and pesticides: how environmental stressors affect the thermal physiology of tadpoles.

    PubMed

    Katzenberger, Marco; Hammond, John; Duarte, Helder; Tejedo, Miguel; Calabuig, Cecilia; Relyea, Rick A

    2014-01-01

    To forecast biological responses to changing environments, we need to understand how a species's physiology varies through space and time and assess how changes in physiological function due to environmental changes may interact with phenotypic changes caused by other types of environmental variation. Amphibian larvae are well known for expressing environmentally induced phenotypes, but relatively little is known about how these responses might interact with changing temperatures and their thermal physiology. To address this question, we studied the thermal physiology of grey treefrog tadpoles (Hyla versicolor) by determining whether exposures to predator cues and an herbicide (Roundup) can alter their critical maximum temperature (CTmax) and their swimming speed across a range of temperatures, which provides estimates of optimal temperature (Topt) for swimming speed and the shape of the thermal performance curve (TPC). We discovered that predator cues induced a 0.4°C higher CTmax value, whereas the herbicide had no effect. Tadpoles exposed to predator cues or the herbicide swam faster than control tadpoles and the increase in burst speed was higher near Topt. In regard to the shape of the TPC, exposure to predator cues increased Topt by 1.5°C, while exposure to the herbicide marginally lowered Topt by 0.4°C. Combining predator cues and the herbicide produced an intermediate Topt that was 0.5°C higher than the control. To our knowledge this is the first study to demonstrate a predator altering the thermal physiology of amphibian larvae (prey) by increasing CTmax, increasing the optimum temperature, and producing changes in the thermal performance curves. Furthermore, these plastic responses of CTmax and TPC to different inducing environments should be considered when forecasting biological responses to global warming. PMID:24869960

  19. Chemical composition and antifungal activity of essential oils from different tissues of Japanese Cedar (Cryptomeria japonica).

    PubMed

    Cheng, Sen-Sung; Lin, Huang-Yuan; Chang, Shang-Tzen

    2005-02-01

    In this study antifungal activities of essential oils from different tissues of Japanese cedar (Cryptomeria japonica D. Don) against four wood decay fungi and six tree pathogenic fungi were investigated. In addition, the yields of essential oils obtained by water distillation were compared and their constituents determined by GC-MS analyses. The yield of essential oils from four tissues of Japanese cedar is in the decreasing order of leaf (27.38 mL/kg) > bark (6.31 mL/kg) > heartwood (3.80 mL/kg) > sapwood (1.27 mL/kg). Results obtained from the antifungal tests demonstrate that the essential oil of Japanese cedar heartwood used against Laetiporus sulphureus and Trametes versicolor and sapwood essential oil used against L. sulphureus had strong antifungal activities at 500 mug/mL, with IC(50) values of 39, 91, and 94 microg/mL, respectively. Besides, the essential oils of Japanese cedar heartwood used against Rhizoctonia solani, Collectotrichum gloeosporioides, Fusarium solani, and Ganoderma australe had strong antifungal activities at 500 microg/mL, with IC(50) values of 65, 80, 80, and 110 microg/mL, respectively. GC-MS analyses showed that the sesquiterpene hydrocarbon compounds dominate in the essential oil from Japanese cedar heartwood, amounting to a total percentage of 82.56%, with the major compounds of delta-cadinene (18.60%), isoledene (12.41%), and gamma-muurolene (11.82%). It is proposed that the excellent antifungal activities of Japanese cedar heartwood essential oils might correlate with the presence of these compounds. PMID:15686410

  20. Differential metamorphosis alters the endocrine response in anuran larvae exposed to T3 and atrazine.

    PubMed

    Freeman, Jennifer L; Beccue, Nathan; Rayburn, A Lane

    2005-11-10

    Pesticide chemical contamination is one of the suspected contributors of the amphibian population decline. The herbicide atrazine is one of the major surface water contaminants in the U.S. A previous study has shown that atrazine at concentrations as low as 100 parts per billion (ppb) increased the time to metamorphosis in Xenopus laevis tadpoles. However, questions remain as to the applicability of a study of a non-native species to a native organism. The possible effects of atrazine on developing Bufo americanus were explored. Atrazine at potentially (albeit high) environmental concentrations was found not to delay the metamorphosis of developing B. americanus tadpoles as observed in X. laevis. Several studies have indicated that atrazine affects thyroid hormones. Since thyroid hormones are critical in amphibian metamorphosis, B. americanus and X. laevis tadpoles were exposed to exogenous 3,5,3'-triiodothyronine (T3). X. laevis were found to be more responsive to the effects of exogenous T3 compared to B. americanus, indicating that X. laevis may be more sensitive to endocrine active chemicals than B. americanus. In X. laevis, nuclear heterogeneity has been associated with metamorphosis. Flow cytometric analysis of the nuclei of normal metamorphing B. americanus indicates a decrease in the amount of thyroid mediated chromatin alterations relative to the nuclei of metamorphing X. laevis. Indications are that the differential response to endocrine disruption is due to the differential role of chromatin associated gene expression during metamorphosis of B. americanus versus X. laevis. A second native species, Hyla versicolor, was observed to have the X. laevis nuclear pattern with respect to metamorphosis. As such, sensitivity to endocrine disruption is hypothesized not to be limited to laboratory non-native species. PMID:16213604

  1. Associations between Fungal Species and Water-Damaged Building Materials ?

    PubMed Central

    Andersen, Birgitte; Frisvad, Jens C.; Søndergaard, Ib; Rasmussen, Ib S.; Larsen, Lisbeth S.

    2011-01-01

    Fungal growth in damp or water-damaged buildings worldwide is an increasing problem, which has adverse effects on both the occupants and the buildings. Air sampling alone in moldy buildings does not reveal the full diversity of fungal species growing on building materials. One aim of this study was to estimate the qualitative and quantitative diversity of fungi growing on damp or water-damaged building materials. Another was to determine if associations exist between the most commonly found fungal species and different types of materials. More than 5,300 surface samples were taken by means of V8 contact plates from materials with visible fungal growth. Fungal identifications and information on building material components were analyzed using multivariate statistic methods to determine associations between fungi and material components. The results confirmed that Penicillium chrysogenum and Aspergillus versicolor are the most common fungal species in water-damaged buildings. The results also showed Chaetomium spp., Acremonium spp., and Ulocladium spp. to be very common on damp building materials. Analyses show that associated mycobiotas exist on different building materials. Associations were found between (i) Acremonium spp., Penicillium chrysogenum, Stachybotrys spp., Ulocladium spp., and gypsum and wallpaper, (ii) Arthrinium phaeospermum, Aureobasidium pullulans, Cladosporium herbarum, Trichoderma spp., yeasts, and different types of wood and plywood, and (iii) Aspergillus fumigatus, Aspergillus melleus, Aspergillus niger, Aspergillus ochraceus, Chaetomium spp., Mucor racemosus, Mucor spinosus, and concrete and other floor-related materials. These results can be used to develop new and resistant building materials and relevant allergen extracts and to help focus research on relevant mycotoxins, microbial volatile organic compounds (MVOCs), and microparticles released into the indoor environment. PMID:21531835

  2. Phytochemical screening, antimicrobial and antioxidant efficacy of different extracts of Rumex dentatus L. - A locally used medicinal herb of Kashmir Himalaya

    PubMed Central

    Nisa, Humeera; Kamili, Azra N.; Bandh, Suhaib A.; Amin, Shajr-ul; Lone, Bashir A.; Parray, Javaid A.

    2013-01-01

    Objective To elucidate the antimicrobial and antioxidant activities of Rumex dentatus L. (R. dentatus) along with its phytochemical analysis. Methods Agar disk diffusion method for antimicrobial activity and DPPH, riboflavin photo-oxidation, deoxyribose and lipid peroxidation assay for antioxidant activity. Results The antimicrobial and antioxidant activities of different concentrations of five R. dentatus extracts were tested against different clinical bacterial strains (Shigella flexneri, Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus and Salmonella typhimurium) and fungal strains (Aspergillus versicolor, Aspergillus flavus, Accremonium spp., Penicillium dimorphosporum, Candida albicans, Candida parapsilosis, and Candida kruesie). Among all extracts, the butanol extract showed strong antibacterial activity against Klebsiella pneumoniae (inhibition zone diameter of 20 mm) and aqueous extract showed no activity against any of the bacterial strains. While as in case of the fungal strains, the maximum antifungal activity was observed against Aspergillus flavus by aqueous extract. The antioxidant activity revealed that the extracts exhibited scavenging effect in concentration-dependent manner on superoxide anion radicals and hydroxyl radicals. The phytochemical tests carried out with the crude extracts of R. dentatus showed the presence of flavonoids, terpenoids, alkaloids, saponins, tannins, anthraquinones and cardiac glycosides in it. The total phenolic content of these extracts was estimated quantitatively from standard calibration curve of gallic acid and it varied from 145 µg/mg in butanol extract to 45 µg/mg in petroleum ether extract. Conclusions It can be concluded that the plant has got a broad spectrum antimicrobial and antioxidant activity and could be used as a potential alternative for treating various diseases.

  3. 2011 Epidemiological Survey of Dermatomycoses in Japan.

    PubMed

    Sei, Yoshihiro

    2015-01-01

    An epidemiological survey of dermatomycoses and their causative fungus flora in Japan for 2011 was conducted in accordance with methods and criteria of the past four surveys. The survey covered a total number of 36,052 outpatients who visited 12 dermatological clinics throughout Japan. The results were as follows. 1?Dermatophytosis was the most prevalent cutaneous fungal infection (2,980 cases) seen in these clinics, followed by candidiasis (378 cases) and then Malassezia infections (152 cases). 2?Among dermatophytoses, tinea pedis was the most frequent (1,930 cases : male, 980 ; female, 950), then in decreasing order, tinea unguium (780 cases : male, 409 ; female, 371), tinea corporis (203 cases : male, 132 ; female, 71), tinea cruris (112 cases : male, 86 ; female, 26), tinea manuum (43 cases : male, 25 ; female, 18), and tinea capitis including kerion (16 cases : male, 13 ; female, 3). 3?Tinea pedis and tinea unguium were seen to increase in the summer season and occur mostly among the aged population. Compared to the last survey, by clinical form, there was a marked decrease in dermatophytosis patients. 4?As the causative dermatophyte species, Trichophyton rubrum was the most frequently isolated at about 80 % among all dermatophyte infections excluding tinea capitis. T. mentagrophytes was about 10 %. Microsporum canis was isolated in five cases. M. gypseum was isolated in three cases, and Epidermophyton floccosum was isolated in only one case. T. tonsurans was isolated in 13 cases. 5?Cutaneous candidiasis was seen in 378 cases (305, male ; 537, female). Intertrigo (298 cases) was the most frequent clinical form, followed by diaporcandidiasis (79 cases), erosion interdigitalis (62 cases), genital candidiasis (46 cases). 6?Tinea versicolor was seen in 97 cases. Malassezia folliculitis was isolated in 55 cases. PMID:26617109

  4. Mycology - an update. Part 1: Dermatomycoses: causative agents, epidemiology and pathogenesis.

    PubMed

    Nenoff, Pietro; Krüger, Constanze; Ginter-Hanselmayer, Gabriele; Tietz, Hans-Jürgen

    2014-03-01

    Dermatomycoses are caused most commonly by dermatophytes. The anthropophilic dermatophyte Trichophyton rubrum is still the most frequent causative agent worldwide. Keratinolytic enzymes, e.g. hydrolases and keratinases, are important virulence factors of T. rubrum. Recently, the cysteine dioxygenase was found as new virulence factor. Predisposing host factors play a similarly important role for the development of dermatophytosis of the skin and nails. Chronic venous insufficiency, diabetes mellitus, disorders of cellular immunity, and genetic predisposition should be considered as risk factors for onychomycosis. A new alarming trend is the increasing number of cases of onychomycosis - mostly due to T. rubrum - in infancy. In Germany, tinea capitis is mostly caused by zoophilic dermatophytes, in particular Microsporum canis. New zoophilic fungi, primarily Trichophyton species of Arthroderma benhamiae, should be taken into differential diagnostic considerations of tinea capitis, tinea faciei, and tinea corporis. Source of infection are small household pets, particularly rodents, like guinea pigs. Anthropophilic dermatophytes may be introduced by families which immigrate from Africa or Asia to Europe. The anthropophilic dermatophytes T. violaceum, T. tonsurans (infections occurring in fighting sports clubs as "tinea gladiatorum capitis et corporis") and M. audouinii are causing outbreaks of small epidemics of tinea corporis and tinea capitis in kindergartens and schools. Superficial infections of the skin and mucous membranes due to yeasts are caused by Candida species. Also common are infections due to the lipophilic yeast fungus Malassezia. Today, within the genus Malassezia more than 10 different species are known. Malassezia globosa seems to play the crucial role in pityriasis versicolor. Molds (also designated non-dermatophyte molds, NDM) are increasingly found as causative agents in onychomycosis. Besides Scopulariopsis brevicaulis, several species of Fusarium and Aspergillus are found. PMID:24533779

  5. Potential of Wood-Rotting Fungi to Attack Polystyrene Sulfonate and Its Depolymerisation by Gloeophyllum trabeum via Hydroquinone-Driven Fenton Chemistry

    PubMed Central

    Krueger, Martin C.; Hofmann, Ulrike; Moeder, Monika; Schlosser, Dietmar

    2015-01-01

    Synthetic polymers often pose environmental hazards due to low biodegradation rates and resulting accumulation. In this study, a selection of wood-rotting fungi representing different lignocellulose decay types was screened for oxidative biodegradation of the polymer polystyrene sulfonate (PSS). Brown-rot basidiomycetes showed PSS depolymerisation of up to 50 % reduction in number-average molecular mass (Mn) within 20 days. In-depth investigations with the most efficient depolymeriser, a Gloeophyllum trabeum strain, pointed at extracellular hydroquinone-driven Fenton chemistry responsible for depolymerisation. Detection of hydroxyl radicals present in the culture supernatants showed good compliance with depolymerisation over the time course of PSS degradation. 2,5-Dimethoxy-1,4-hydroquinone (2,5-DMHQ), which was detected in supernatants of active cultures via liquid chromatography and mass spectrometry, was demonstrated to drive the Fenton processes in G. trabeum cultures. Up to 80% reduction in Mn of PSS where observed when fungal cultures were additionally supplemented with 2,5-dimethoxy benzoquinone, the oxidized from of 2,5-DMHQ. Furthermore, 2,5-DMHQ could initiate the Fenton's reagent-mediated PSS depolymerisation in cell-free systems. In contrast, white-rot fungi were unable to cause substantial depolymerising effects despite the expression of lignin-modifying exo-enzymes. Detailed investigations with laccase from Trametes versicolor revealed that only in presence of certain redox mediators limited PSS depolymerisation occurred. Our results indicate that brown-rot fungi might be suitable organisms for the biodegradation of recalcitrant synthetic polymeric pollutants. PMID:26147966

  6. Insecticidal Activity of Ethyl Acetate Extracts from Culture Filtrates of Mangrove Fungal Endophytes

    PubMed Central

    Abraham, Silva; Basukriadi, Adi; Pawiroharsono, Suyanto

    2015-01-01

    In the search for novel potent fungi-derived bioactive compounds for bioinsecticide applications, crude ethyl acetate culture filtrate extracts from 110 mangrove fungal endophytes were screened for their toxicity. Toxicity tests of all extracts against brine shrimp (Artemia salina) larvae were performed. The extracts with the highest toxicity were further examined for insecticidal activity against Spodoptera litura larvae and acetylcholinesterase (AChE) inhibition activity. The results showed that the extracts of five isolates exhibited the highest toxicity to brine shrimp at 50% lethal concentration (LC50) values of 7.45 to 10.24 ppm. These five fungal isolates that obtained from Rhizophora mucronata were identified based on sequence data analysis of the internal transcribed spacer region of rDNA as Aspergillus oryzae (strain BPPTCC 6036), Emericella nidulans (strains BPPTCC 6035 and BPPTCC 6038), A. tamarii (strain BPPTCC 6037), and A. versicolor (strain BPPTCC 6039). The mean percentage of S. litura larval mortality following topical application of the five extracts ranged from 16.7% to 43.3%. In the AChE inhibition assay, the inhibition rates of the five extracts ranged from 40.7% to 48.9%, while eserine (positive control) had an inhibition rate of 96.8%, at a concentration of 100 ppm. The extracts used were crude extracts, so their potential as sources of AChE inhibition compounds makes them likely candidates as neurotoxins. The high-performance liquid chromatography profiles of the five extracts differed, indicating variations in their chemical constituents. This study highlights the potential of culture filtrate ethyl acetate extracts of mangrove fungal endophytes as a source of new potential bioactive compounds for bioinsecticide applications. PMID:26190921

  7. An approach to management of critical indoor air problems in school buildings.

    PubMed Central

    Haverinen, U; Husman, T; Toivola, M; Suonketo, J; Pentti, M; Lindberg, R; Leinonen, J; Hyvärinen, A; Meklin, T; Nevalainen, A

    1999-01-01

    This study was conducted in a school center that had been the focus of intense public concern over 2 years because of suspected mold and health problems. Because several attempts to find solutions to the problem within the community were not satisfactory, outside specialists were needed for support in solving the problem. The study group consisted of experts in civil engineering, indoor mycology, and epidemiology. The studies were conducted in close cooperation with the city administration. Structures at risk were opened, moisture and temperature were measured, and the causes of damage were analyzed. Microbial samples were taken from the air, surfaces, and materials. Health questionnaires were sent to the schoolchildren and personnel. Information on the measurements and their results was released regularly to school employees, students and their parents, and to the media. Repairs were designed on the basis of this information. Moisture damage was caused mainly by difficult moisture conditions at the building site, poor ventilation, and water leaks. Fungal genera (concentrations <200 colony-forming units (cfu)/m(3), <3000 cfu/cm(2)) typical to buildings with mold problems (e.g., Aspergillus versicolor, Eurotium) were collected from the indoor air and surfaces of the school buildings. Where moisture-prone structures were identified and visible signs of damage or elevated moisture content were recorded, the numbers of microbes also were high; thus microbial results from material samples supported the conclusions made in the structural studies. Several irritative and recurrent symptoms were common among the upper secondary and high school students. The prevalence of asthma was high (13%) among the upper secondary school students. During the last 4 years, the incidence of asthma was 3-fold that of the previous 4-year period. Images Figure 1 PMID:10423392

  8. Swimming with Predators and Pesticides: How Environmental Stressors Affect the Thermal Physiology of Tadpoles

    PubMed Central

    Katzenberger, Marco; Hammond, John; Duarte, Helder; Tejedo, Miguel; Calabuig, Cecilia; Relyea, Rick A.

    2014-01-01

    To forecast biological responses to changing environments, we need to understand how a species's physiology varies through space and time and assess how changes in physiological function due to environmental changes may interact with phenotypic changes caused by other types of environmental variation. Amphibian larvae are well known for expressing environmentally induced phenotypes, but relatively little is known about how these responses might interact with changing temperatures and their thermal physiology. To address this question, we studied the thermal physiology of grey treefrog tadpoles (Hyla versicolor) by determining whether exposures to predator cues and an herbicide (Roundup) can alter their critical maximum temperature (CTmax) and their swimming speed across a range of temperatures, which provides estimates of optimal temperature (Topt) for swimming speed and the shape of the thermal performance curve (TPC). We discovered that predator cues induced a 0.4°C higher CTmax value, whereas the herbicide had no effect. Tadpoles exposed to predator cues or the herbicide swam faster than control tadpoles and the increase in burst speed was higher near Topt. In regard to the shape of the TPC, exposure to predator cues increased Topt by 1.5°C, while exposure to the herbicide marginally lowered Topt by 0.4°C. Combining predator cues and the herbicide produced an intermediate Topt that was 0.5°C higher than the control. To our knowledge this is the first study to demonstrate a predator altering the thermal physiology of amphibian larvae (prey) by increasing CTmax, increasing the optimum temperature, and producing changes in the thermal performance curves. Furthermore, these plastic responses of CTmax and TPC to different inducing environments should be considered when forecasting biological responses to global warming. PMID:24869960

  9. Polyphenoloxidases immobilized in organic gels: Properties and applications in the detoxification of aromatic compounds

    SciTech Connect

    Crecchio, C.; Ruggiero, P.; Pizzigallo, M.D.R.

    1995-12-20

    Gelatine gels originate from water in oil microemulsions in which the ternary system consists of isooctane/sulfosuccinic acid bis [2-ethyl hexyl] ester/water; the solubilization of gelatin in the water pool of these microemulsions transforms them into viscous gels in which it is possible to cosolubilize various reactive molecules. These gels were used to immobilize two phenoloxidases, a laccase from Trametes versicolor and a tyrosinase from mushroom. The best balance between gel retention and catalytic activity was reached at a gelatine concentration of 2.5% (w/v) in the case of tyrosinase, while laccase immobilization was independent of gelatine concentration. Both enzymes kept the same optimum pH as the corresponding soluble controls, while a partial loss of activity was observed when they were immobilized. Immobilized enzymes showed an increased stability when incubated for several days at 4 C with a very low release from the gels in the incubation solutions. The immobilization of tyrosinase and of laccase enhanced stability to thermal inactivation. Furthermore, gel-entrapped tyrosinase was almost completely preserved from proteolysis: more than 80% of the activity was maintained, while only 25% of the soluble control activity was detected after the same proteolytic treatments. A column packed with gel-immobilized tyrosinase was used to demonstrate that enzymes immobilized with this technique may be reused several times in the same reaction without loosing their efficiency. Finally, gel-entrapped tyrosinase and laccase were capable of removing naturally occurring and xenobiotic aromatic compounds from aqueous suspensions with different degrees of efficiency.

  10. Mitogenomic analysis of decapod crustacean phylogeny corroborates traditional views on their relationships.

    PubMed

    Shen, Hong; Braband, Anke; Scholtz, Gerhard

    2013-03-01

    Phylogenetic relationships within decapod crustaceans are highly controversial. Even recent analyses based on molecular datasets have shown largely contradictory results. Previous studies using mitochondrial genomes are promising but suffer from a poor and unbalanced taxon sampling. To fill these gaps we sequenced the (nearly) complete mitochondrial genomes of 13 decapod species: Stenopus hispidus, Polycheles typhlops, Panulirus versicolor, Scyllarides latus, Enoplometopus occidentalis, Homarus gammarus, Procambarus fallax f. virginalis, Upogebia major, Neaxius acanthus, Calocaris macandreae, Corallianassa coutierei, Cryptolithodes sitchensis, Neopetrolisthes maculatus, and add that of Dromia personata. Our new data allow for comprehensive analyses of decapod phylogeny using the mitochondrial genomes of 50 species covering all major taxa of the Decapoda. Five species of Stomatopoda and one species of Euphausiacea serve as outgroups. Most of our analyses using Maximum Likelihood (ML) and Bayesian inference (BI) of nucleotide and amino acid datasets revealed congruent topologies for higher level decapod relationships: (((((((Anomala, Brachyura), Thalassinida: Gebiidea), Thalassinida: Axiidea), (Astacidea, Polychelida), Achelata), Stenopodidea), Caridea), Dendrobranchiata). This result corroborates several traditional morphological views and adds new perspectives. In particular, the position of Polychelida is surprising. Nevertheless, some problems can be identified. In a minority of analyses the basal branching of Reptantia is not fully resolved, Thalassinida are monophyletic; Polychelida are the sister group to Achelata, and Stenopodidea are resolved as sister group to Caridea. Despite this and although some nodal supports are low in our phylogenetic trees, we think that the largely stable topology of the trees regardless of different types of analyses suggests that mitochondrial genomes show good potential to resolve the relationship within Decapoda. PMID:23202543

  11. Aspergillus flavus contamination in two Portuguese wastewater treatment plants.

    PubMed

    Viegas, C; Dias, R; Gomes, A Quintal; Meneses, M; Sabino, R; Viegas, S

    2014-01-01

    Filamentous fungi from genus Aspergillus were previously detected in wastewater treatment plants (WWTP) as being Aspergillus flavus (A. flavus), an important toxigenic fungus producing aflatoxins. This study aimed to determine occupational exposure adverse effects due to fungal contamination produced by A. flavus complex in two Portuguese WWTP using conventional and molecular methodologies. Air samples from two WWTP were collected at 1 m height through impaction method. Surface samples were collected by swabbing surfaces of the same indoor sites. After counting A. flavus and identification, detection of aflatoxin production was ensured through inoculation of seven inoculates in coconut-milk agar. Plates were examined under long-wave ultraviolet (UV; 365 nm) illumination to search for the presence of fluorescence in the growing colonies. To apply molecular methods, air samples were also collected using the impinger method. Samples were collected and collection liquid was subsequently used for DNA extraction. Molecular identification of A. flavus was achieved by real-time polymerase chain reaction (RT-PCR) using the Rotor-Gene 6000 qPCR detection system (Corbett). Among the Aspergillus genus, the species that were more abundant in air samples from both WWTP were Aspergillus versicolor (38%), Aspergillus candidus (29.1%), and Aspergillus sydowii (12.7%). However, the most commonly species found on surfaces were A. flavus (47.3%), Aspergillus fumigatus (34.4%), and Aspergillus sydowii (10.8%). Aspergillus flavus isolates that were inoculated in coconut agar medium were not identified as toxigenic strains and were not detected by RT-PCR in any of the analyzed samples from both plants. Data in this study indicate the need for monitoring fungal contamination in this setting. Although toxigenic strains were not detected from A. flavus complex, one cannot disregard the eventual presence and potential toxicity of aflatoxins. PMID:25072712

  12. Rare and new etiological agents revealed among 178 clinical Aspergillus strains obtained from Czech patients and characterized by molecular sequencing.

    PubMed

    Hubka, Vit; Kubatova, Alena; Mallatova, Nada; Sedlacek, Petr; Melichar, Jan; Skorepova, Magdalena; Mencl, Karel; Lyskova, Pavlina; Sramkova, Blanka; Chudickova, Milada; Hamal, Petr; Kolarik, Miroslav

    2012-08-01

    A collection of 178 Aspergillus isolates, recovered from Czech patients, mostly from 2007-2011, was subjected to multilocus DNA sequence typing using the ITS region, ?-tubulin, and calmodulin genes. An unusually wide spectrum of etiologic agents that included 36 species of Aspergillus is discussed in the context of recent taxonomic and clinical reports. Invasive aspergillosis (IA), onychomycosis, and otitis externa were the predominant clinical entities. Five cases due to species newly proven as etiologic agents of human mycoses, as well as cases with unique clinical manifestations caused by unusual agents are discussed in more detail. Three species (i.e., A. insulicola, A. westerdijkiae and A. tritici) were identified as the confirmed etiologic agents of non-dermatophytic onychomycosis. Emericella rugulosa was recovered from a premature newborn with a fatal necrotising disseminated infection and is reported for only the second time as the cause of IA. Furthermore, we document the first infection due to A. calidoustus in a patient with chronic granulomatous disease. The infection manifested as a latent brain aspergilloma with an unusual clinical-laboratory finding. In addition to the well-known agents of human mycosis, several rarely isolated or poorly documented species were identified. An undescribed cryptic species related to A. versicolor was found to be common among isolates linked to proven and probable onychomycosis. An isolate representing A. fresenii, or an unnamed sister species, were causal agents of otomycosis. Three well defined, and tentative new species belonging to section Cervini, Candidi and Aspergillus (Eurotium spp.), were associated with cases of probable onychomycosis. PMID:22458252

  13. Formation of hydroxylated polybrominated diphenyl ethers from laccase-catalyzed oxidation of bromophenols.

    PubMed

    Lin, Kunde; Zhou, Shiyang; Chen, Xi; Ding, Jiafeng; Kong, Xiaoyan; Gan, Jay

    2015-11-01

    Hydroxylated polybrominated diphenyl ethers (OH-PBDEs) have been frequently found in the marine biosphere as emerging organic contaminants. Studies to date have suggested that OH-PBDEs in marine biota are natural products. However, the mechanisms leading to the biogenesis of OH-PBDEs are still far from clear. In this study, using a laccase isolated from Trametes versicolor as the model enzyme, we explored the formation of OH-PBDEs from the laccase-catalyzed oxidation of simple bromophenols (e.g., 2,4-DBP and 2,4,6-TBP). Experiments under ambient conditions clearly showed that OH-PBDEs were produced from 2,4-DBP and 2,4,6-TBP in presence of laccase. Polybrominated compounds 2'-OH-BDE68, 2,2'-diOH-BB80, and 1,3,8-TrBDD were identified as the products from 2,4-DBP, and 2'-OH-BDE121 and 4'-OH-BDE121 from 2,4,6-TBP. The production of OH-PBDEs was likely a result of the coupling of bromophenoxy radicals, generated from the laccase-catalyzed oxidation of 2,4-DBP or 2,4,6-TBP. The transformation of bromophenols by laccase was pH-dependant, and was also influenced by enzymatic activity. In view of the abundance of 2,4-DBP and 2,4,6-TBP and the phylogenetic distribution of laccases in the environment, laccase-catalyzed conversion of bromophenols may be potentially an important route for the natural biosynthesis of OH-PBDEs. PMID:26295539

  14. A comparison between the oxidation with laccase and horseradish peroxidase for triclosan conversion.

    PubMed

    Melo, C F; Dezotti, M; Marques, M R C

    2016-02-01

    Triclosan is a broad-spectrum biocide used in personal-care products that is suspected to be linked to the emergence of antibiotic-resistant bacteria. In the present work, the enzymes horseradish peroxidase and laccase from Trametes versicolor were evaluated for the conversion of triclosan in an aqueous matrix. The removal of antibacterial activity by the enzymatic processes was evaluated by an assay based on the growth inhibition of Escherichia coli K12. The horseradish peroxidase (HRP) process appears more advantageous than the laccase process in removing triclosan from an aqueous matrix, considering the reaction parameters pH, temperature, catalytic efficiency, and enzyme concentration. The highest conversion of triclosan catalysed by laccase was observed at pH 5.0, that is, lower than the typical pH range (6.5-7.5) of sewage treatment plants' effluents. The efficiency of laccase process was much more impacted by variations in the temperature in the range of 10-40°C. Kinetic studies showed that triclosan is a substrate more specific for HRP than for laccase. The protein content for the HRP-catalysed process was 14 times lower than that for the laccase process. Decay kinetics suggest that reaction mechanisms depend on enzyme concentration and its concentration. Both processes were able to reduce the antibacterial activity, and the residual activity of the treated solution is probably due to non-converted triclosan and not due to the reaction products. The laccase-catalysed conversion of triclosan in an environmental relevant concentration required a higher amount of enzyme than that required in the HRP process. PMID:26165135

  15. Here today, gone tomorrow: Short-term retention of pesticide-induced tolerance in amphibians.

    PubMed

    Jones, Devin K; Relyea, Rick A

    2015-10-01

    Pesticide use has led to the ubiquitous contamination of natural habitats, which has inadvertently increased pesticide tolerance in target and nontarget species. Historically, increased pesticide tolerance has been attributed to natural selection for tolerance among individuals of affected populations. Recent research, however, has discovered that pesticide tolerance can be increased through phenotypic plasticity. Although induced pesticide tolerance may benefit organisms experiencing contaminated systems, little is known about its occurrence in vertebrates, its retention through ontogeny, or potential life history tradeoffs. Using time-to-death assays at 2 distinct developmental windows, the authors discovered that gray treefrog (Hyla versicolor) tadpoles exposed to sublethal concentrations (0?mg a.i./L, 0.5?mg a.i./L, and 1.0?mg a.i./L) of the insecticide Sevin® (carbaryl) early in life increased their pesticide tolerance to a lethal carbaryl concentration 5 d after sublethal exposure. However, this increased tolerance was not retained later in ontogeny (23?d post-sublethal exposure). Moreover, no indication was found of pesticide-induced treefrogs experiencing life-history tradeoffs in terms of survival to metamorphosis, mass, or snout-vent length. Gray treefrogs are only the second vertebrate species and the second amphibian family to exhibit pesticide-induced tolerance after sublethal exposure. The authors' data suggest that the ability to induce increased pesticide tolerance may play a critical role in amphibian survival in contaminated ecosystems. However, future work is needed to test the occurrence of inducible pesticide tolerance among numerous amphibian populations worldwide. PMID:25940070

  16. Antimicrobial properties of black grape (Vitis vinifera L.) peel extracts against antibiotic-resistant pathogenic bacteria and toxin producing molds

    PubMed Central

    Yadav, Devbrat; Kumar, Arvind; Kumar, Pramod; Mishra, Diwaker

    2015-01-01

    Aim: Black grape peel possesses a substantial amount of polyphenolic antimicrobial compounds that can be used for controlling the growth of pathogenic microorganisms. The purpose of this study was to assess antibacterial and antifungal activity of black grape peel extracts against antibiotic-resistant pathogenic bacteria and toxin producing molds, respectively. Materials and Methods: Peel of grape was subjected to polyphenolic extraction using different solvents viz., water, ethanol, acetone, and methanol. Antibiotic-resistant strains of Staphylococcus aureus, Enterococcus faecalis, Enterobacter aerogenes, Salmonella typhimurium, and Escherichia coli were screened for the antibacterial activity of different grape extracts. Antibacterial activity was analyzed using agar well diffusion method. Penicillium chrysogenum, Penicillium expansum, Aspergillus niger and Aspergillus versicolor were screened for the antifungal activity. Antifungal activity was determined by counting nongerminated spores in the presence of peel extracts. Results: As compared to other solvent extracts, methanol extracts possessed high antibacterial and antifungal activity. S. typhimurium and E. coli showed complete resistance against antibacterial action at screened concentrations of grape peel extracts. Maximum zone of inhibition was found in case of S. aureus, i.e., 22 mm followed by E. faecalis and E. aerogenes, i.e., 18 and 21 mm, respectively, at 1080 mg tannic acid equivalent (TAE)/ml. The maximum and minimum percent of growth inhibition was shown by P. expansum and A. niger as 73% and 15% at 1080 TAE/ml concentration of grape peel extract, respectively. Conclusions: Except S. typhimurium and E. coli, growth of all bacterial and mold species were found to be significantly (P < 0.05) inhibited by all the solvent extracts.

  17. Characterization of combined cross-linked enzyme aggregates from laccase, versatile peroxidase and glucose oxidase, and their utilization for the elimination of pharmaceuticals.

    PubMed

    Touahar, Imad E; Haroune, Lounès; Ba, Sidy; Bellenger, Jean-Phillipe; Cabana, Hubert

    2014-05-15

    In order to transform a wide range of pharmaceutically active compounds (PhACs), the three oxidative enzymes laccase (Lac) from Trametes versicolor, versatile peroxidase (VP) from Bjerkandera adusta and glucose oxidase (GOD) from Aspergillus niger were concomitantly cross-linked after aggregation, thus, making a combined cross-linked enzyme aggregate (combi-CLEA) that was versatile and involved in an enzymatic cascade reaction. From the initial enzymes about 30% of initial laccase activity was recovered along with 40% for each of VP and GOD. The combi-CLEA showed good results in conditions close to those of real wastewater (neutral pH and medium temperature) as well as a good ability to resist to denaturing conditions such as high temperature (60°C) and low pH (3). Batch experiments were realized to test the free enzyme's ability to degrade, a PhACs cocktail, mainly in a synthetic wastewater containing acetaminophen, naproxen, mefenamic acid, indometacin, diclofenac, ketoprofen, caffeine, diazepam, ciprofloxacin, trimethoprim, fenofibrate and bezafibrate, carbamazepine and its by-product 10-11 epoxy-carbamazepine. High removal was achieved (more than 80%) for the five first compounds. Then, the elimination ability of the combi-CLEA with or without hydrogen peroxide, glucose or manganese sulfate was determined. Globally, our results demonstrated that VP has a wider removal spectrum than Lac. These removal features are enhanced under more specific conditions, whereas the combi-CLEA combined advantages of both VP and laccase. Finally, the elimination of PhACs in a municipal wastewater treatment plant effluent using the combi-CLEA was marginally investigated. Concentrations of most of the selected PhACs were below the limit of quantification (lower than 20 ng/L) except for acetaminophen. Its combi-CLEA-mediated removal reached up to 25%. PMID:24589758

  18. Molecular and microscopic analysis of the gut contents of abundant rove beetle species (Coleoptera, Staphylinidae) in the boreal balsam fir forest of Quebec, Canada

    PubMed Central

    Klimaszewski, Jan; Morency, Marie-Josee; Labrie, Philippe; Séguin, Armand; Langor, David; Work, Timothy; Bourdon, Caroline; Thiffault, Evelyne; Paré, David; Newton, Alfred F.; Thayer, Margaret K.

    2013-01-01

    Abstract Experimental research on beetle responses to removal of logging residues following clearcut harvesting in the boreal balsam fir forest of Quebec revealed several abundant rove beetle (Staphylinidae) species potentially important for long-term monitoring. To understand the trophic affiliations of these species in forest ecosystems, it was necessary to analyze their gut contents. We used microscopic and molecular (DNA) methods to identify the gut contents of the following rove beetles: Atheta capsularis Klimaszewski, Atheta klagesi Bernhauer, Oxypoda grandipennis (Casey), Bryophacis smetanai Campbell, Ischnosoma longicorne (Mäklin), Mycetoporus montanus Luze, Tachinus frigidus Erichson, Tachinus fumipennis (Say), Tachinus quebecensis Robert, and Pseudopsis subulata Herman. We found no apparent arthropod fragments within the guts; however, a number of fungi were identified by DNA sequences, including filamentous fungi and budding yeasts [Ascomycota: Candida derodonti Suh & Blackwell (accession number FJ623605), Candida mesenterica (Geiger) Diddens & Lodder (accession number FM178362), Candida railenensis Ramirez and Gonzáles (accession number JX455763), Candida sophie-reginae Ramirez & González (accession number HQ652073), Candida sp. (accession number AY498864), Pichia delftensis Beech (accession number AY923246), Pichia membranifaciens Hansen (accession number JQ26345), Pichia misumaiensis Y. Sasaki and Tak. Yoshida ex Kurtzman 2000 (accession number U73581), Pichia sp. (accession number AM261630), Cladosporium sp. (accession number KF367501), Acremoniumpsammosporum W. Gams (accession number GU566287), Alternaria sp. (accession number GU584946), Aspergillus versicolor Bubak (accession number AJ937750), and Aspergillusamstelodami (L. Mangin) Thom and Church (accession number HQ728257)]. In addition, two species of bacteria [Bradyrhizobium japonicum (Kirchner) Jordan (accession number BA000040) and Serratia marcescens Bizio accession number CP003942] were found in the guts. These results not only provide evidence of the consumer-resource relations of these beetles but also clarify the relationship between rove beetles, woody debris and fungi. Predominance of yeast-feeding by abundant rove beetles suggests that it may play an important role in their dietary requirements. PMID:24294095

  19. Ecotoxicological analysis during the removal of carbofuran in fungal bioaugmented matrices.

    PubMed

    Ruíz-Hidalgo, Karla; Masís-Mora, Mario; Barbieri, Edison; Carazo-Rojas, Elizabeth; Rodríguez-Rodríguez, Carlos E

    2016-02-01

    Biomixtures are used for the removal of pesticides from agricultural wastewater. As biomixtures employ high content of lignocellulosic substrates, their bioaugmentation with ligninolytic fungi represents a novel approach for their enhancement. Nonetheless, the decrease in the concentration of the pesticide may result in sublethal concentrations that still affect ecosystems. Two matrices, a microcosm of rice husk (lignocellulosic substrate) bioaugmented with the fungus Trametes versicolor and a biomixture that contained fungally colonized rice husk were used in the degradation of the insecticide/nematicide carbofuran (CFN). Elutriates simulating lixiviates from these matrices were used to assay the ecotoxicological effects at sublethal level over Daphnia magna (Straus) and the fish Oreochromis aureus (Steindachner) and Oncorhynchus mykiss (Walbaum). Elutriates obtained after 30 d of treatment in the rice husk microcosms at dilutions over 2.5% increased the offspring of D. magna as a trade-off stress response, and produced mortality of neonates at dilutions over 5%. Elutriates (dilution 1:200) obtained during a 30 d period did not produce alterations on the oxygen consumption and ammonium excretion of O. mykiss, however these physiological parameters were affected in O. aureus at every time point of treatment, irrespective of the decrease in CFN concentration. When the fungally colonized rice husk was used to prepare a biomixture, where more accelerated degradation is expected, similar alterations on the responses by O. aureus were achieved. Results suggest that despite the good removal of the pesticide, it is necessary to optimize biomixtures to minimize their residual toxicity and potential chronic effects on aquatic life. PMID:26421626

  20. [Superficial mycoses in patients from Anzoátegui state, Venezuela, period 2002-2012].

    PubMed

    Lemus-Espinoza, Druvic; Teresa Maniscalchi, María; Villarroel, Oskarina; Bónoli, Stefano B; Wahab, Fadi; García, Oswaldo

    2014-12-01

    Superficial fungal diseases that affect the skin and its appendages are frequently seen in basic triage and in dermatology services. These diseases are distributed in Venezuela with an incidence of 92.9%. The aim of this study was to determine the genera and species that cause dermatomycoses in residents of Anzoátegui state, Venezuela, during the period 2002-2012. A total of 4257 patients with a presumptive diagnosis of superficial mycoses were studied, with ages from 7 months to 79 years. The overall prevalence was 30.9%. The most frequent were dermatophytosis (44.7%). M. canis produced 148 cases of tinea capitis. Three dermatophytic agents represented 95% of all cases, with a significant predominance of T. mentagrophytes with 50%. Candidosis occurred in 28.4%. C. albicans, and the C. parapsilosis complex, were responsible for 80% of the cases. The other species identified were C. tropicalis (n = 41, 11.0%), C. glabrata (n = 10, 2.7%), C. guilliermondii (n = 6, 1.6%), C. krusei (n = 4, 1.1%). Pityriasis versicolor occurred in 22.4% of the cases studied, and less frequently were present onychomycosis produced by a non dermatophytic mold: Fusarium oxysporum (n = 34, 65.4%), Aspergillus terreus (n=16, 30.8%) and Scytalidium dimidiatum (n=2; 3.8%). Rare cases of Trichosporon onychomycosis (0.5%) and one case of black tinea were also found. Health education in the population is recommended to promote measures to prevent transmission of these fungi and prevent the spread of this silent public health problem. PMID:25558751

  1. Use of stable isotope probing to assess the fate of emerging contaminants degraded by white-rot fungus.

    PubMed

    Badia-Fabregat, Marina; Rosell, Mònica; Caminal, Glòria; Vicent, Teresa; Marco-Urrea, Ernest

    2014-05-01

    The widespread of emerging contaminants in the environment and their potential impact on humans is a matter of concern. White-rot fungi are cosmopolitan organisms able to remove a wide range of pharmaceuticals and personal care products (PPCP) through cometabolism (i.e. laccases and peroxidases) or detoxification mechanisms (i.e. cytochrome P450 system). However, the use of PPCP as carbon source for these organisms is largely unexplored. Here, we used carbon stable isotope tracer experiments to assess the fate of anti-inflammatory diclofenac (DCF) and UV filter benzophenone-3 (BP3) during degradation by Trametes versicolor. The comparison between carbon isotopic composition of emitted carbon dioxide from 13C-labelled DCF ([acetophenyl ring-13C6]-DCF) and 13C-BP3 ([phenyl-13C6]-BP3) versus their 12C-homologue compounds showed mineralization of about 45% and 10% of the 13C contained in their respective molecules after 9 days of incubation. The carbon isotopic composition of the bulk biomass and the application of amino acid-stable isotope probing (SIP) allowed distinguishing between incorporation of 13C from BP3 into amino acids, which implies the use of this emerging contaminant as carbon source, and major intracellular accumulation of 13C from DCF without implying the transformation of its labelled phenyl ring into anabolic products. A mass balance of 13C in different compartments over time provided a comprehensive picture of the fate of DCF and BP3 across their different transformation processes. This is the first report assessing biodegradation of PPCP by SIP techniques and the use of emerging contaminants as carbon source for amino acid biosynthesis. PMID:24393565

  2. Road Salts as Environmental Constraints in Urban Pond Food Webs

    PubMed Central

    Van Meter, Robin J.; Swan, Christopher M.

    2014-01-01

    Freshwater salinization is an emerging environmental filter in urban aquatic ecosystems that receive chloride road salt runoff from vast expanses of impervious surface cover. Our study was designed to evaluate the effects of chloride contamination on urban stormwater pond food webs through changes in zooplankton community composition as well as density and biomass of primary producers and consumers. From May – July 2009, we employed a 2×2×2 full-factorial design to manipulate chloride concentration (low?=?177 mg L?1 Cl?/high?=?1067 mg L?1 Cl?), gray treefrog (Hyla versicolor) tadpoles (presence/absence) and source of stormwater pond algae and zooplankton inoculum (low conductance/high conductance urban ponds) in 40, 600-L mesocosms. Road salt did serve as a constraint on zooplankton community structure, driving community divergence between the low and high chloride treatments. Phytoplankton biomass (chlorophyll [a] µg L?1) in the mesocosms was significantly greater for the high conductance inoculum (P<0.001) and in the high chloride treatment (P?=?0.046), whereas periphyton biomass was significantly lower in the high chloride treatment (P?=?0.049). Gray treefrog tadpole time to metamorphosis did not vary significantly between treatments. However, mass at metamorphosis was greater among tadpoles that experienced a faster than average time to metamorphosis and exposure to high chloride concentrations (P?=?0.039). Our results indicate differential susceptibility to chloride salts among algal resources and zooplankton taxa, and further suggest that road salts can act as a significant environmental constraint on urban stormwater pond communities. PMID:24587259

  3. Anthropometry and Prevalence of Common Health Problems among School Going Children in Surathkal, Karnataka

    PubMed Central

    Airody, Sathyajith Karanth; Mahale, Ramnath; SR, Ravikiran; Shetty, Suresh; Rao, Aarathi R

    2014-01-01

    Aims: To measure the anthropometric data of school children and to compare with the CDC and Agarwal centile Growth charts. The prevalence of thinness, stunting, overweight and obesity were estimated. Children were also screened for hypertension, refractory errors, dental problems, skin disease and other abnormalities. Design: Study was conducted in November in a central school in Surathkal, Dakshina Kannada, Karnataka, India. All children from nursery up to 10th standard were screened. Materials and Methods: Weight and Height were measured using standard equipment and plotted on CDC and Agarwal Charts. BMI was calculated and plotted on both charts. Blood Pressure (BP) was taken using mercury sphygmomanometer by a trained nurse. Vision was tested using Snellens chart by refractionist. Dental evaluation was done by dentist. Statistical analysis: Chi-square test and Student’s unpaired t test were used for statistical analysis. A statistical package SPSS version 17.0 were used. p<0.05 was considered as significant. Results: Total 755 children were screened. Among these 392 (51.9%) were females and 363 (48.1%) were males. Eighty five (11.3%) children had short stature and 283 (37.5%) had under nutrition when plotted on CDC chart. Values were lower when plotted on Agarwal charts. Thinness was more prevalent than obesity and overweight. Majority were normotensive though hypertension was noted in 6(0.8%) children and prehypertension in 14(1.9%).112 children (16.3%) had undetected refractory error. Common skin disease noted was T.Versicolor in 27 children. Common dental problem noted was Caries teeth (22.9%). Conclusion: Weight and height were below the CDC centile charts. Under nutrition was more prevalent than overweight and obesity. Majority were normotensive. High prevalence of undetected refractory error and caries teeth were noted. Prevalence of skin disease was low. PMID:25653997

  4. Immunomodulatory dietary polysaccharides: a systematic review of the literature

    PubMed Central

    2010-01-01

    Background A large body of literature suggests that certain polysaccharides affect immune system function. Much of this literature, however, consists of in vitro studies or studies in which polysaccharides were injected. Their immunologic effects following oral administration is less clear. The purpose of this systematic review was to consolidate and evaluate the available data regarding the specific immunologic effects of dietary polysaccharides. Methods Studies were identified by conducting PubMed and Google Scholar electronic searches and through reviews of polysaccharide article bibliographies. Only articles published in English were included in this review. Two researchers reviewed data on study design, control, sample size, results, and nature of outcome measures. Subsequent searches were conducted to gather information about polysaccharide safety, structure and composition, and disposition. Results We found 62 publications reporting statistically significant effects of orally ingested glucans, pectins, heteroglycans, glucomannans, fucoidans, galactomannans, arabinogalactans and mixed polysaccharide products in rodents. Fifteen controlled human studies reported that oral glucans, arabinogalactans, heteroglycans, and fucoidans exerted significant effects. Although some studies investigated anti-inflammatory effects, most studies investigated the ability of oral polysaccharides to stimulate the immune system. These studies, as well as safety and toxicity studies, suggest that these polysaccharide products appear to be largely well-tolerated. Conclusions Taken as a whole, the oral polysaccharide literature is highly heterogenous and is not sufficient to support broad product structure/function generalizations. Numerous dietary polysaccharides, particularly glucans, appear to elicit diverse immunomodulatory effects in numerous animal tissues, including the blood, GI tract and spleen. Glucan extracts from the Trametes versicolor mushroom improved survival and immune function in human RCTs of cancer patients; glucans, arabinogalactans and fucoidans elicited immunomodulatory effects in controlled studies of healthy adults and patients with canker sores and seasonal allergies. This review provides a foundation that can serve to guide future research on immune modulation by well-characterized polysaccharide compounds. PMID:21087484

  5. The TLR2 agonist in polysaccharide-K is a structurally distinct lipid which acts synergistically with the protein-bound ?-glucan.

    PubMed

    Quayle, Kenneth; Coy, Catherine; Standish, Leanna; Lu, Hailing

    2015-04-01

    Protein-bound polysaccharide-K (Krestin; PSK) is a hot-water extract of Trametes versicolor with immune stimulatory activity. It has been used for the past 30 years and has demonstrated anti-tumor efficacy in multiple types of cancer. The ability of PSK to activate dendritic cells and T cells is dependent on its ability to stimulate Toll-like receptor 2 (TLR2), yet it remains unknown which structural component within PSK activates TLR2. The purpose of this study was to identify the TLR2 agonist within PSK and understand its role in the overall mechanism of PSK's immunogenic activity. TLR2 activity was eliminated by treatment with lipoprotein lipase but not by trypsin or lyticase. Rapid centrifugation of PSK can separate the fraction with TLR2 agonist activity from the soluble ?-glucan fraction. To study the potential interaction between the ?-glucan component and the lipid component, we labeled the soluble ?-glucan with fluorescein. Uptake of the labeled ?-glucan by J774A macrophages and JAWSII dendritic cells was inhibited by anti-Dectin-1 antibody but not by anti-TLR2 antibody, confirming that Dectin-1 is the receptor for ?-glucan. Interestingly, pre-treatment of JAWSII cells with the TLR2-active lipid fraction significantly enhanced the uptake of the soluble ?-glucan, indicating the synergy between the TLR2 agonist component and the ?-glucan component. Altogether, these results present evidence that PSK has two active components-the well-characterized protein-bound ?-glucan and a previously unreported lipid-which work synergistically via the Dectin-1 and TLR2 receptors. PMID:25510899

  6. A cocktail of contaminants: how mixtures of pesticides at low concentrations affect aquatic communities.

    PubMed

    Relyea, Rick A

    2009-03-01

    The ubiquity of anthropogenic chemicals in nature poses a challenge to understanding how ecological communities are impacted by them. While we are rapidly gaining an understanding of how individual contaminants affect communities, communities are exposed to suites of contaminants yet investigations of the effects of diverse contaminant mixtures in aquatic communities are rare. I examined how a single application of five insecticides (malathion, carbaryl, chlorpyrifos, diazinon, and endosulfan) and five herbicides (glyphosate, atrazine, acetochlor, metolachlor, and 2,4-D) at low concentrations (2-16 p.p.b.) affected aquatic communities composed of zooplankton, phytoplankton, periphyton, and larval amphibians (gray tree frogs, Hyla versicolor, and leopard frogs, Rana pipiens). Using outdoor mesocosms, I examined each pesticide alone, a mix of insecticides, a mix of herbicides, and a mix of all ten pesticides. Individual pesticides had a wide range of direct and indirect effects on all trophic groups. For some taxa (i.e., zooplankton and algae), the impact of pesticide mixtures could largely be predicted from the impacts of individual pesticides; for other taxa (i.e., amphibians) it could not. For amphibians, there was an apparent direct toxic effect of endosulfan that caused 84% mortality of leopard frogs and an indirect effect induced by diazinon that caused 24% mortality of leopard frogs. When pesticides were combined, the mix of herbicides had no negative effects on the survival and metamorphosis of amphibians, but the mix of insecticides and the mix of all ten pesticides eliminated 99% of leopard frogs. Interestingly, these mixtures did not cause mortality in the gray tree frogs and, as a result, the gray tree frogs grew nearly twice as large due to reduced competition with leopard frogs. In short, wetland communities can be dramatically impacted by low concentrations of pesticides (both separate and combined) and these results offer important insights for the conservation of wetland communities. PMID:19002502

  7. Road salts as environmental constraints in urban pond food webs.

    PubMed

    Van Meter, Robin J; Swan, Christopher M

    2014-01-01

    Freshwater salinization is an emerging environmental filter in urban aquatic ecosystems that receive chloride road salt runoff from vast expanses of impervious surface cover. Our study was designed to evaluate the effects of chloride contamination on urban stormwater pond food webs through changes in zooplankton community composition as well as density and biomass of primary producers and consumers. From May - July 2009, we employed a 2×2×2 full-factorial design to manipulate chloride concentration (low?=?177 mg L(-1) Cl(-/)high?=?1067 mg L(-1) Cl(-)), gray treefrog (Hyla versicolor) tadpoles (presence/absence) and source of stormwater pond algae and zooplankton inoculum (low conductance/high conductance urban ponds) in 40, 600-L mesocosms. Road salt did serve as a constraint on zooplankton community structure, driving community divergence between the low and high chloride treatments. Phytoplankton biomass (chlorophyll [a] µg L(-1)) in the mesocosms was significantly greater for the high conductance inoculum (P<0.001) and in the high chloride treatment (P?=?0.046), whereas periphyton biomass was significantly lower in the high chloride treatment (P?=?0.049). Gray treefrog tadpole time to metamorphosis did not vary significantly between treatments. However, mass at metamorphosis was greater among tadpoles that experienced a faster than average time to metamorphosis and exposure to high chloride concentrations (P?=?0.039). Our results indicate differential susceptibility to chloride salts among algal resources and zooplankton taxa, and further suggest that road salts can act as a significant environmental constraint on urban stormwater pond communities. PMID:24587259

  8. Chemosensory Perception of Predators by Larval Amphibians Depends on Water Quality

    PubMed Central

    Troyer, Rachael R.; Turner, Andrew M.

    2015-01-01

    The acquisition of sensory information by animals is central to species interactions. In aquatic environments, most taxa use chemical cues to assess predation risk and other key ecological factors. A number of laboratory studies suggest that anthropogenic pollutants can disrupt chemoreception, even when at low, non-toxic concentrations, but there are few tests of whether real-world variation in water quality affects chemoreception. Here we investigate whether chemosensory perception of predators by the gray treefrog, Hyla versicolor, depends on water quality. We evaluated the anti-predator response of anuran tadpoles housed in water collected from three sites that represent strong contrasts in the concentration and types of dissolved solids: de-chlorinated tap water, water from an impaired stream, and treated wastewater effluent. Behavioral assays were conducted in laboratory aquaria. Chemical cues associated with predation were generated by feeding tadpoles to dragonfly predators held in containers, and then transferring aliquots of water from dragonfly containers to experimental aquaria. Tadpoles housed in tap water responded to predator cues with an activity reduction of 49%. Tadpoles housed in stream water and wastewater effluent responded to predator cues by reducing activity by 29% and 24% respectively. The results of factorial ANOVA support the hypothesis that the response to predator cues depended on water type. These results show that alteration of the chemical environment can mediate chemical perception of predators in aquatic ecosystems. Because most aquatic species rely on chemoreception to gather information on the location of food and predators, any impairment of sensory perception likely has important ecological consequences. PMID:26114749

  9. A two-stage cyclone using microcentrifuge tubes for personal bioaerosol sampling.

    PubMed

    Lindsley, William G; Schmechel, Detlef; Chen, Bean T

    2006-11-01

    Personal aerosol samplers are widely used to monitor human exposure to airborne materials. For bioaerosols, interest is growing in analyzing samples using molecular and immunological techniques. This paper presents a personal sampler that uses a two-stage cyclone to collect bioaerosols into disposable 1.5 ml Eppendorf-type microcentrifuge tubes. Samples can be processed in the tubes for polymerase chain reaction (PCR) or immunoassays, and the use of multiple stages fractionates aerosol particles by aerodynamic diameter. The sampler was tested using fluorescent microspheres and aerosolized fungal spores. The sampler had first and second stage cut-off diameters of 2.6 microm and 1.6 microm at 2 l min(-1)(geometric standard deviation, GSD = 1.45 and 1.75), and 1.8 microm and 1 microm at 3.5 l min(-1)(GSD = 1.42 and 1.55). The sampler aspiration efficiency was >or=98% at both flow rates for particles with aerodynamic diameters of 3.1 microm or less. For 6.2 microm particles, the aspiration efficiency was 89% at 2 l min(-1) and 96% at 3.5 l min(-1). At 3.5 l min(-1), the sampler collected 92% of aerosolized Aspergillus versicolor and Penicillium chrysogenum spores inside the two microcentrifuge tubes, with less than 0.4% of the spores collecting on the back-up filter. The design and techniques given here are suitable for personal bioaerosol sampling, and could also be adapted to design larger aerosol samplers for longer-term atmospheric and indoor air quality sampling. PMID:17075620

  10. Bottom-up meets top-down: leaf litter inputs influence predator-prey interactions in wetlands.

    PubMed

    Stoler, Aaron B; Relyea, Rick A

    2013-09-01

    While the common conceptual role of resource subsidies is one of bottom-up nutrient and energy supply, inputs can also alter the structural complexity of environments. This can further impact resource flow by providing refuge for prey and decreasing predation rates. However, the direct influence of different organic subsidies on predator-prey dynamics is rarely examined. In forested wetlands, leaf litter inputs are a dominant energy and nutrient resource and they can also increase benthic surface cover and decrease water clarity, which may provide refugia for prey and subsequently reduce predation rates. In outdoor mesocosms, we investigated how inputs of leaf litter that alter benthic surface cover and water clarity influence the mortality and growth of gray treefrog tadpoles (Hyla versicolor) in the presence of free-swimming adult newts (Notophthalmus viridiscens), which are visual predators. To manipulate surface cover, we added either oak (Quercus spp.) or red pine (Pinus resinosa) litter and crossed these treatments with three levels of red maple (Acer rubrum) litter leachate to manipulate water clarity. In contrast to our predictions, benthic surface cover had no effect on tadpole survival while darkening the water caused lower survival. In addition, individual tadpole mass was lowest in the high maple leachate treatments, suggesting an interaction between bottom-up effects of leaf litter and top-down effects of predation risk that altered mortality and growth of tadpoles. Our results indicate that realistic changes in forest tree composition, which cause concomitant changes in litter inputs to wetlands, can substantially alter community interactions. PMID:23386045

  11. Survivorship in micro fungi and crustacean resting stages during ultraviolet (UV) and vacuum land testing of EXPOSE unit

    NASA Astrophysics Data System (ADS)

    Alekseev, Victor; Alekseev, Victor; Novikova, Nataliya; Sychev, Vladimir; Levinskikh, Margarita; Deshevaya, Elena; Brancelj, Anton; Malyavin, Stanislav

    Dormancy protects animals and plants in harsh environmental conditions within a special resting phases of life cycle lasting from months up to hundred years. This phenomenon is perspective for space researches on interplanetary quarantine within space missions. Direct experiments in open space supported in principle the fact of survivorship of bacteria and fungi spores in open space during long time experiments (Novikova et al. 2007). The rate of survivorship in long-term mission was low but enough to conclude that biological invasion to Mars is a real danger. The possibility for resting stages to survive under UV treatment in vacuum without some protection was not clear. To test it dormant stages (spores) of primitive fungi Aspergillus versicolor, Aspergillus sydowii, Penicillium expansum, and Penicillium aurantiogriseum derived from ISS environment were used in the land EXPOSE imitation of outside space station UV and vacuum conditions. Survivorship in resting eggs of some crustaceans with dried (cladoceran Daphnia magna, fair-shrimp Streptocephalus torvicornis and ostracode Eucypris ornate from hemi desert Caspian area) and wet diapause state (copepod Mixodiaptomus tatricus from the Tatra mountains, altitude 1510 m) was tested also. The total UV dose of 9,1x10 to the 4th KJ/m2 during this imitation was accomplished with a SOL 2000 sun simulator lamp. The final vacuum value achieved during EST was 10 to the minus 6 Pa. Temperature during the experiment fluctuated in the range 19-25 o C. Micro fungi showed a high level of survivorship in samples treated with UV samples varied from 95 till 100 Supported by RFBR grant 07-04-00006.

  12. TLR2 agonist PSK activates human NK cells and enhances the anti-tumor effect of HER2-targeted monoclonal antibody therapy

    PubMed Central

    Lu, Hailing; Yang, Yi; Gad, Ekram; Inatsuka, Carol; Wenner, Cynthia A.; Disis, Mary L.; Standish, Leanna J.

    2011-01-01

    Purpose The therapeutic effect of trastuzumab monoclonal antibody (mAb) therapy has been shown to be partially dependent on functional NK cells. Novel agents that enhance NK cell function could potentially improve the anti-tumor effect of trastuzumab. We recently identified polysaccharide krestin (PSK), a natural product extracted from medicinal mushroom Trametes Versicolor, as a potent TLR2 agonist. The current study was undertaken to evaluate the effect of PSK on human NK cells and the potential of using PSK to enhance HER2-targeted mAb therapy. Experimental Design Human PBMC were stimulated with PSK to evaluate the effect of PSK on NK cell activation, IFN-? production, cytotoxicity, and trastuzumab-mediated ADCC. Whether the effect of PSK on NK cells is direct or indirect was also investigated. Then in vivo experiment in neu transgenic mice was carried out to determine the potential of using PSK to augment the anti-tumor effect of HER2-targeted mAb therapy. Results PSK activated human NK cells to produce IFN-? and to lyse K562 target cells. PSK also enhanced trastuzumab-mediated ADCC against SKBR3 and MDA-MB-231 breast cancer cells. Both direct and IL-12-dependent indirect effects seem to be involved in the effect of PSK on NK cells. Oral administration of PSK significantly potentiated the anti-tumor effect of anti-HER2/neu mAb therapy in neu-transgenic mice. Conclusion These results demonstrated that PSK activates human NK cells and potentiates trastuzumab-mediated ADCC. Concurrent treatment of PSK and trastuzumab may be a novel way to augment the anti-tumor effect of trastuzumab. PMID:21918170

  13. Inclusion of Astronomy Themes in an Inovative Approach of Informal Physics Teaching for High School Students. (Spanish Title: Inclusión de Temas Astronómicos en Uma Abordaje Innovadora de la Enseñanza Informal de Física Para Estudiantes de Secumdaria.) Inclusão de Temas Astronômicos Numa Abordagem Inovadora do Ensino Informal de Física Para Estudantes do Ensino Médio

    NASA Astrophysics Data System (ADS)

    Tiara Mota, Aline; de Morais Bonomini, Iracema Ariel; Meloni Martins Rosado, Ricardo

    2009-12-01

    The current work reports on an experience on Astronomy education at the Federal University of Itajubá through an extra-curricular course offered for High School students. This initiative was motivated by the low attention paid to the Astronomy subjects at this stage of the Brazilian Formal Education, in spite that the National Curricular Parameters (PCN and PCN+, in Brazil) point out the importance of their inclusion Este artículo relata una experiencia en la enseñanza de la astronomía efectuada en la Universidad Federal de Itajubá en la forma de un curso de extensión orientado para los estudiantes del colegio secundario. Esta iniciativa surgió de constatar la poca atención dada a la Astronomía en esta etapa de la Educación formal brasileña, a pesar que los Parámetros Curriculares Nacionales (PCN y PCN+, en Brasil) destacan la importancia de su inclusión. Este artigo relata uma experiência em ensino de Astronomia realizada na Universidade Federal de Itajubá na forma de um curso de extensão voltado para alunos do Ensino Médio. Esta iniciativa surgiu da pouca atenção que se dá à Astronomia nesta etapa da Educação embora os Parâmetros Curriculares Nacionais (PCN e PCN+) apontem a importância de sua inclusão.

  14. [Epidemiological transition of mycosis diseases in sub-Saharan Africa: from surface to depth.

    PubMed

    Chandenier, J; Desoubeaux, G

    2014-07-01

    Fungi are schematically responsible for three distinct kinds of infections: superficial mycoses, subcutaneous and deep ones. The current socio-epidemiological transition observed in sub-Saharan Africa does not actually lead to similar consequences regarding these three categories of fungal entities. For instance, it has long been known that superficial mycoses are very prevalent in tropical areas, since they are partly due to the warm climate and the promiscuity. They are mostly caused by dermatophytic fungi or Malassezia sp. (Pityriasis versicolor). Subcutaneous mycoses are rarer, and usually due to dimorphic fungi which are accidentally inoculated into the body after a skin injury or a trauma. Sometimes very spectacular, the clinical outcome is then described as chronic. Thus, chromoblastomycosis, rhinoentomophtoromycosis or mycetoma are some examples of subcutaneous mycoses which remain well-known by practitioners of endemic countries. Deep mycoses (or invasive / systemic mycoses) are defined by fungal infections of deep anatomical sites that should be normally sterile. By contrast with the other entities mentioned above, the outcome may be rapidly fatal for the patient. One of the most outstanding examples was the great increasing of cryptococcal meningitis during the HIV outbreak in the 80'. A few other similar mycoses may be feared in a near future, since they usually occur in contexts of important immunosuppression which are about to be definitely experienced in Africa: overall increase of chronic diseases like diabetes, lengthening life expectancy and its associated diseases, widespread medical practices which were only seen in advanced intensive care units, onco-haematology departments or graft centers so far. Thus, the deep mycoses will inevitably increase in Africa, as they did in all developed countries over the last two decades. The consequences will not only be limited to the clinical management as described above: the diagnostic approach is also quite particular, since the identification of the involved fungal species should be established in emergency, if not the outcome will be fatal. Besides, the antifungal drugs are expensive, and their therapeutic monitoring is quite challenging all along the follow up. Overall, we have to thoroughly take into account the emergence of invasive mycoses right now in Intertropical Africa, in order to successfully achieve the socio-economic development of this continent. PMID:24997574

  15. [Genetic methods for the reintroduction of primates Saguinus, Aotus and Cebus (Primates: Cebidae) seized in Bogota, Colombia].

    PubMed

    Ruiz-García, Manuel; Leguizamón, Norberto; Vásquez, Catalina; Rodríguez, Karen; Castillo, María Ignacia

    2010-09-01

    Primates are one of more confiscated taxa by the environmental authorities in Bogota, Colombia. During 2008, 133 monkeys were confiscated; samples from 115 of them were sequenced by the mitochondrial cythocrome oxidase II gene (mtCOII) and 112 sequences obtained were of high quality. These sequences were compared with those obtained by our research group from individuals directly sampled in the field, with precise geographic origin. So, a more specific geographic area of the Colombian territory could be considered for a correct rehabilitation treatment during the reintroduction of these confiscated animals. The main results with five primate species were: 1--For all the specimens analyzed of Saguinus leucopus, they could be liberated in any geographical area of its distribution range, since only one gene pool was found. 2--For the 14 Aotus sp. individuals sequenced from the SDA (Environmental District Secretariat), one of them (A. vociferans) was coming from the Amazon, seven exemplars belonged to A. griseimembra from the Magdalena Valley and the Colombian Caribbean coasts, four individuals represented to A. brumbacki from the Colombian Eastern Llanos, and two were associated to A. azarae azarae from Northern Argentina and Paraguay (which means that illegal traffic of animals is arriving to Colombia from other South-American countries). 3--Out 14 Cebus albifrons sequenced, two belonged to the geographical area of C. a. versicolor, one to C. a. pleei, 10 to C a. leucocephalus and one could be not assigned because its sequence yielded a great genetic divergence with respect to the other specimens sequenced of this species. 4--The two Cebus capucinus sequenced showed to be associated to a gene pool found in the Northern of Chocó, Sucre and Córdoba Departments. 5--Out 11 Cebus apella sequenced, 10 showed to belong to the gene pool presented in the Colombian Eastern Llanos and highly related (but differentiable) to Cebus apella apella from the French Guyana. It could be named C. a. fatuellus sensu Groves (2001). One exemplar sequenced could be not related with the other C. apella analyzed, nor the related taxa to the aforementioned species (C. a. paraguayanus = C. cay; C. xanthosternos; C. nigritus). PMID:20737854

  16. Whole-cell fungal transformation of precursors into dyes

    PubMed Central

    2010-01-01

    Background Chemical methods of producing dyes involve extreme temperatures and unsafe toxic compounds. Application of oxidizing enzymes obtained from fungal species, for example laccase, is an alternative to chemical synthesis of dyes. Laccase can be replaced by fungal biomass acting as a whole-cell biocatalyst with properties comparable to the isolated form of the enzyme. The application of the whole-cell system simplifies the transformation process and reduces the time required for its completion. In the present work, four fungal strains with a well-known ability to produce laccase were tested for oxidation of 17 phenolic and non-phenolic precursors into stable and non-toxic dyes. Results An agar-plate screening test of the organic precursors was carried out using four fungal strains: Trametes versicolor, Fomes fomentarius, Abortiporus biennis, and Cerrena unicolor. Out of 17 precursors, nine were transformed into coloured substances in the presence of actively growing fungal mycelium. The immobilized fungal biomass catalyzed the transformation of 1 mM benzene and naphthalene derivatives in liquid cultures yielding stable and non-toxic products with good dyeing properties. The type of fungal strain had a large influence on the absorbance of the coloured products obtained after 48-hour transformation of the selected precursors, and the most effective was Fomes fomentarius (FF25). Whole-cell transformation of AHBS (3-amino-4-hydroxybenzenesulfonic acid) into a phenoxazinone dye was carried out in four different systems: in aqueous media comprising low amounts of carbon and nitrogen source, in buffer, and in distilled water. Conclusions This study demonstrated the ability of four fungal strains belonging to the ecological type of white rot fungi to transform precursors into dyes. This paper highlights the potential of fungal biomass for replacing isolated enzymes as a cheaper industrial-grade biocatalyst for the synthesis of dyes and other commercially important products. The use of immobilized fungal biomass limits free migration of cells and facilitates their reuse in a continuous system for precursor transformation. PMID:20598166

  17. Furry pet allergens, fungal DNA and microbial volatile organic compounds (MVOCs) in the commercial aircraft cabin environment.

    PubMed

    Fu, Xi; Lindgren, Torsten; Guo, Moran; Cai, Gui-Hong; Lundgren, Håkan; Norbäck, Dan

    2013-06-01

    There has been concern about the cabin environment in commercial aircraft. We measured cat, dog and horse allergens and fungal DNA in cabin dust and microbial volatile organic compounds (MVOCs) in cabin air. Samples were collected from two European airline companies, one with cabins having textile seats (TSC) and the other with cabins having leather seats (LSC), 9 airplanes from each company. Dust was vacuumed from seats and floors in the flight deck and different parts of the cabin. Cat (Fel d1), dog (Can f1) and horse allergens (Equ cx) were analyzed by ELISA. Five sequences of fungal DNA were analyzed by quantitative PCR. MVOCs were sampled on charcoal tubes in 42 TSC flights, and 17 compounds were analyzed by gas chromatography mass spectrometry (GC-MS) with selective ion monitoring (SIM). MVOC levels were compared with levels in homes from Nordic countries. The weight of dust was 1.8 times larger in TSC cabins as compared to LSC cabins (p < 0.001). In cabins with textile seats, the geometric mean (GM) concentrations of Fel d1, Can f1 and Equ cx were 5359 ng g(-1), 6067 ng g(-1), and 13?703 ng g(-1) (GM) respectively. Levels of Fel d1, Can f1 and Equ cx were 50 times, 27 times and 75 times higher respectively, in TSC cabins as compared to LSC cabins (p < 0.001). GM levels of Aspergillus/Penicillium DNA, Aspergillus versicolor DNA, Stachybotrys chartarum DNA and Streptomyces DNA were all higher in TSC as compared to LSC (p < 0.05). The sum of MVOCs in cabin air (excluding butanols) was 3192 ng m(-3) (GM), 3.7 times higher than in homes (p < 0.001) and 2-methyl-1-butanol and 3-methyl-1-butanol concentrations were 15-17 times higher as compared to homes (p < 0.001). Concentrations of isobutanol, 1-butanol, dimethyldisulfide, 2-hexanone, 2-heptanone, 3-octanone, isobutyl acetate and ethyl-2-methylbutyrate were lower in cabin air as compared to homes (p < 0.05). In conclusion, textile seats are much more contaminated by pet allergens and fungal DNA than leather seats. The use of seats with smooth surfaces should be encouraged. The MVOC levels differed between cabin air and homes. PMID:23644832

  18. Distribution of Malassezia species on the skin of patients with atopic dermatitis, psoriasis, and healthy volunteers assessed by conventional and molecular identification methods

    PubMed Central

    2014-01-01

    Background The Malassezia yeasts which belong to the physiological microflora of human skin have also been implicated in several dermatological disorders, including pityriasis versicolor (PV), atopic dermatitis (AD), and psoriasis (PS). The Malassezia genus has repeatedly been revised and it now accommodates 14 species, all but one being lipid-dependent species. The traditional, phenotype-based identification schemes of Malassezia species are fraught with interpretative ambiguities and inconsistencies, and are thus increasingly being supplemented or replaced by DNA typing methods. The aim of this study was to explore the species composition of Malassezia microflora on the skin of healthy volunteers and patients with AD and PS. Methods Species characterization was performed by conventional, culture-based methods and subsequently molecular techniques: PCR-RFLP and sequencing of the internal transcribed spacer (ITS) 1/2 regions and the D1/D2 domains of the 26S rRNA gene. The Chi-square test and Fisher’s exact test were used for statistical analysis. Results Malassezia sympodialis was the predominant species, having been cultured from 29 (82.9%) skin samples collected from 17 out of 18 subjects under the study. Whereas AD patients yielded exclusively M. sympodialis isolates, M. furfur isolates were observed only in PS patients. The isolation of M. sympodialis was statistically more frequent among AD patients and healthy volunteers than among PS patients (P

  19. Human infections due to Malassezia spp.

    PubMed Central

    Marcon, M J; Powell, D A

    1992-01-01

    The genus Malassezia contains three member species: Malassezia furfur and Malassezia sympodialis, both obligatory lipophilic, skin flora yeasts of humans, and Malassezia pachydermatis, a nonobligatory lipophilic, skin flora yeast of other warm-blooded animals. Several characteristics suggest the basidiomycetous nature of these yeasts, although a perfect stage has not been identified. Classically, these organisms are associated with superficial infections of the skin and associated structures, including pityriasis versicolor and folliculitis. Recently, however, they have been reported as agents of more invasive human diseases including deep-line catheter-associated sepsis. The latter infection occurs in patients, primarily infants, receiving parenteral nutrition (including lipid emulsions) through the catheter. The lipids presumably provide growth factors required for replication of the organisms. It is unclear how deep-line catheters become colonized with Malassezia spp. Skin colonization with M. furfur is common in infants hospitalized in neonatal intensive care units, whereas colonization of newborns hospitalized in well-baby nurseries and of older infants is rarely observed. Catheter colonization, which may occur without overt clinical symptoms, probably occurs secondary to skin colonization, with the organism gaining access either via the catheter insertion site on the skin or through the external catheter hub (connecting port). There is little information on the colonization of hospitalized patients by M. sympodialis or M. pachydermatis. Diagnosis of superficial infections is best made by microscopic examination of skin scrapings following KOH, calcofluor white, or histologic staining. Treatment of these infections involves the use of topical or oral antifungal agents, and it may be prolonged. Diagnosis of Malassezia catheter-associated sepsis requires detection of the organism in whole blood smears or in buffy coat smears of blood drawn through the infected catheter or isolation of the organism from catheter or peripheral blood or the catheter tip. Culture of M. furfur from blood is best achieved with Isolator tubes and plating onto a solid medium supplemented with a lipid source. Appropriate treatment of patients requires removal of the infected catheter with or without temporary stoppage of lipid emulsions; administration of antifungal therapeutic agents does not appear to be necessary. Because many patients who develop Malassezia catheter-associated sepsis have severe underlying illnesses, caution must be exercised in attributing all clinical deterioration to Malassezia infection. Our better understanding of how these organisms cause disease awaits the development of a useful typing scheme for epidemiologic studies and further studies on microbial virulence factors and the role of the immune response in pathogenesis. Images PMID:1576583

  20. Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

    PubMed Central

    Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2?-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  1. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    PubMed

    Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

    2015-01-01

    Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZ?A-LaccGluc-Stop and pGAPZ?A-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and ?-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates that laccases can transform. This contributes to a great gamut of products in diverse settings: industry, clinical and chemical use, and environmental applications. PMID:25611746

  2. Annotated type catalogue of the Chrysididae (Insecta, Hymenoptera) deposited in the collection of Maximilian Spinola (1780–1857), Turin

    PubMed Central

    Rosa, Paolo; Xu, Zai-fu

    2015-01-01

    Abstract A critical and annotated catalogue of the ninety-six type specimens of Chrysididae (Hymenoptera), belonging to sixty-seven species, housed in the insect collection of Maximilian Spinola is given. The neotypes of six species are designated: Chrysis bicolor Lepeletier, 1806; Chrysis comparata Lepeletier, 1806; Chrysis dives Dahlbom, 1854; Chrysis pumila Klug, 1845; Chrysis succincta Linnaeus, 1767; Hedychrum bidentulum Lepeletier, 1806. The lectotypes of twenty-four species are designated: Chrysis aequinoctialis Dahlbom, 1854; Chrysis analis Spinola, 1808; Chrysis assimilis Dahlbom, 1854; Chrysis bihamata Spinola, 1838; Chrysis chilensis Spinola, 1851; Chrysis dichroa Dahlbom, 1854; Chrysis distinguenda Dahlbom, 1854; Chrysis episcopalis Spinola, 1838; Chrysis grohmanni Dahlbom, 1854; Chrysis incrassata Spinola, 1838; Chrysis pallidicornis Spinola, 1838; Chrysis pulchella Spinola, 1808; Chrysis ramburi Dahlbom, 1854; Chrysis refulgens Spinola, 1806; Chrysis splendens Dahlbom, 1854; Chrysis succinctula Dahlbom, 1854; Chrysis versicolor Spinola, 1808; Elampus gayi Spinola, 1851; Hedychrum caerulescens Lepeletier, 1806; Hedychrum chloroideum Dahlbom, 1854; Hedychrum difficile Spinola, 1851; Hedychrum virens Dahlbom, 1854; Holopyga janthina Dahlbom, 1854; Holopyga luzulina Dahlbom, 1854. Previous lectotype designations of five species are set aside: Chrysis bicolor Lepeletier, 1806 (designated by Morgan 1984); Chrysis calimorpha Mocsáry, 1882 (designated by Móczár 1965); Chrysis elegans Lepeletier, 1806 (designated by Bohart (in Kimsey and Bohart 1991)); Hedychrum chloroideum Dahlbom, 1854 (designated by Kimsey 1986); Hedychrum rutilans Dahlbom, 1854 (designated by Morgan 1984). Three new synonymies are proposed: Hedychrum intermedium Dahlbom, 1845, syn. n. of Holopyga fervida (Fabricius, 1781); Chrysis sicula Dahlbom, 1854, syn. n. of Chrysis elegans Lepeletier, 1806; Chrysis succinctula Dahlbom, 1854, syn. n. of Chrysis germari Wesmael, 1839. Chrysis distinguenda Spinola, 1838, and Chrysis coronata Spinola, 1808, are considered nomina dubia. Hedychrum alterum Lepeletier, 1806, and Hedychrum aulicum Spinola, 1843, are considered nomina oblita. Hedychrum rutilans Dahlbom, 1854, and Hedychrum niemelai Linsenmaier, 1959, are retained as nomina protecta. The first available name for Chrysis succinctula sensu Linsenmaier is Chrysis tristicula Linsenmaier, 1959, (stat. n.) The current status and validity of some types in the Spinola collection are discussed. Photographs of fifty-three types are given. PMID:25632245

  3. White-rot fungal response to fresh and photolytically-weathered pyrogenic organic matter

    NASA Astrophysics Data System (ADS)

    Gibson, C. D.; Berry, T. D.; Wang, R.; Bird, J. A.; Filley, T. R.

    2013-12-01

    Pyrogenic organic matter (PyOM or biochar) is the product of the incomplete combustion of biomass. A better understanding of the microbial-mediated degradation of PyOM is critical to assess its role in soil C sequestration and to serve as an agricultural amendment. Recent studies have shown that PyOM additions can prime native soil C but results have been inconsistent, with studies reporting no effect, an increase, or decrease in C mineralization. This study investigated the ability of saprotrophic white-rot fungus, Trametes versicolor, to decompose an unaltered 'fresh' PyOM and a photo-oxidized PyOM. In addition, we measured PyOM-induced priming effects on the mineralization of malt extract agar media (MEA). Enriched (13C) Pinus banksiana-derived PyOM, produced at 450oC under N2, was added fresh and after 4 weeks exposure to 254 nm light to MEA. Vials containing the various types of media were then monitored for CO2 evolution and oxidative enzyme activity. We found that MEA C respired was stimulated (positive priming) by photolyzed PyOM and was inhibited with fresh PyOM addition (negative priming) relative to controls. Vetryl alcohol addition, a laccase production stimulant, resulted in less activity in the presence of PyOM compared with a control, indicating PyOM may disrupt enzyme induction processes. Loss of PyOM-13CO2 was 0.2% (× 0.001) for fresh PyOM and 1.2% (×0.001) for photolyzed PyOM C during 10 weeks averaged across media treatments. While MEA C mineralization decreased after fresh PyOM addition, both oxidative (laccase and manganese peroxidase) and hydrolytic (? glucosidase) enzyme production increased with fresh PyOM in the absence of veratryl alcohol. However, there was a decrease in its presence. These results suggest that the physiological response of this common wood decay fungus to PyOM is complex and responsive to enzymatic triggers but that PyOM itself can act to promote or suppress overall litter or soil decay by fungi.

  4. Leaf hydraulic conductance, measured in situ, declines and recovers daily: leaf hydraulics, water potential and stomatal conductance in four temperate and three tropical tree species.

    PubMed

    Johnson, D M; Woodruff, D R; McCulloh, K A; Meinzer, F C

    2009-07-01

    Adequate leaf hydraulic conductance (Kleaf) is critical for preventing transpiration-induced desiccation and subsequent stomatal closure that would restrict carbon gain. A few studies have reported midday depression of Kleaf (or petiole conductivity) and its subsequent recovery in situ, but the extent to which this phenomenon is universal is not known. The objectives of this study were to measure Kleaf, using a rehydration kinetics method, (1) in the laboratory (under controlled conditions) across a range of water potentials to construct vulnerability curves (VC) and (2) over the course of the day in the field along with leaf water potential and stomatal conductance (gs). Two broadleaf (one evergreen, Arbutus menziesii Pursh., and one deciduous, Quercus garryana Dougl.) and two coniferous species (Pinus ponderosa Dougl. and Pseudotsuga menziesii [Mirbel]) were chosen as representative of different plant types. In addition, Kleaf in the laboratory and leaf water potential in the field were measured for three tropical evergreen species (Protium panamense (Rose), Tachigalia versicolor Standley and L.O. Williams and Vochysia ferruginea Mart) to predict their daily changes in field Kleaf in situ. It was hypothesized that in the field, leaves would close their stomata at water potential thresholds at which Kleaf begins to decline sharply in laboratory-generated VC, thus preventing substantial losses of Kleaf. The temperate species showed a 15-66% decline in Kleaf by midday, before stomatal closure. Although there were substantial midday declines in Kleaf, recovery was nearly complete by late afternoon. Stomatal conductance began to decrease in Pseudotsuga, Pinus and Quercus once Kleaf began to decline; however, there was no detectable reduction in gs in Arbutus. Predicted Kleaf in the tropical species, based on laboratory-generated VC, decreased by 74% of maximum Kleaf in Tachigalia, but only 22-32% in Vochysia and Protium. The results presented here, from the previous work of the authors and from other published studies, were consistent with two different strategies regarding daily maintenance of Kleaf: (1) substantial loss and subsequent recovery or (2) a more conservative strategy of loss avoidance. PMID:19429900

  5. A Proposed Activity for a Meaningful Learning about the Moon Phases. (Breton Title: Uma Proposta de Atividade Para a Aprendizagem Significativa sobre as Fases da Lua.) Una Actividad Propuesta Para EL Aprendizaje Significativo Acerca de Las Fases de la Luna

    NASA Astrophysics Data System (ADS)

    Martins, Bruno Andrade; Langhi, Rodolfo

    2012-12-01

    This paper presents one of the concepts of Astronomy and its consequent failure in teaching this topic in high school, even when the official documents point out the necessity of Astronomy teaching at this school level. Among the spontaneous conceptions in Astronomy that high school students carry with them, even after the end of the school, we emphasized in this research the Moon phases. The development of different strategies in relation to traditional methods, aimed to teaching-learning process on this topic was considered in this study. These strategies were devised based on the reference frame of the Meaningful Learning, as elaborated by Ausubel. The proposals presented here include the active participation of students in experimental activities and other didactic activities, for their continuous evaluation during the process. These activities finished with a Comics elaboration about the Moon phases. Therefore, the objective of this paper is to present a proposal for differentiated teaching activity about Moon phases supported by the theoretical principles of Meaningful Learning at Physics classes. Este texto foca um dos conteúdos de Astronomia e a consequente falha no ensino deste tema no ensino médio, apesar de os documentos oficiais apresentarem a necessidade de se trabalhar a Astronomia neste nível de ensino. Dentre as concepções alternativas em Astronomia que os alunos do ensino médio carregam consigo, mesmo após o término dos estudos, destacamos, nesta pesquisa, o fenômeno das fases da Lua. O desenvolvimento de estratégias diferenciadas em relação ao ensino tradicional, visando o processo de ensino-aprendizagem sobre este tema, foi contemplado neste trabalho como um dos resultados obtidos sob a luz dos referenciais da aprendizagem significativa, fundamentados em Ausubel. Segundo a proposta aqui apresentada, a participação ativa dos alunos na execução de uma atividade experimental e outras atividades didáticas, que visam sua contínua avaliação durante o processo, culmina com a elaboração de uma história em quadrinhos envolvendo as fases da Lua. Portanto, o objetivo deste trabalho é apresentar uma proposta de atividade didática diferenciada sustentada pelos princípios teóricos da aprendizagem significativa aplicada ao ensino das fases da Lua durante as aulas de Física no ensino médio. En este trabajo se presenta uno de los contenidos de la Astronomía y el evidente fracaso en la enseñanza del tema en la escuela secundaria, a pesar del hecho que los documentos oficiales apuntan para la necesidad de trabajar contenidos de Astronomía en este nivel. Entre los conceptos alternativos en Astronomía que los alumnos secundarios llevan consigo, aún después de terminados los estudios, destacamos aquí el fenómeno de las fases de la Luna. El desarrollo de diferentes estrategias en relación con los métodos tradicionales, dirigidas al proceso de enseñanza-aprendizaje en este tema fue considerado en este trabajo como uno de los resultados obtenidos a la luz de los referenciales del aprendizaje significativo, tal como fueron fundamentados por Ausubel. Según la propuesta que aquí se presenta, la participación activa de los estudiantes en la ejecución de una actividad experimental y otras actividades educativas destinadas a la evaluación continua durante el proceso culminó en la elaboración de una historieta respecto de las fases de la Luna. Por lo tanto, el objetivo de este trabajo es presentar una propuesta de actividad de enseñanza diferenciada con el apoyo de los principios teóricos del aprendizaje significativo aplicado a la enseñanza de las fases de la luna durante las clases de física del ciclo secundario.

  6. The Teaching of Astronomy in Uruguay. (Spanish Title: La Enseñanza de la Astronomía en Uruguay.) O Ensino da Astronomia no Uruguai

    NASA Astrophysics Data System (ADS)

    Pintos Ganón, Reina; Fernández, Julio Angel

    2008-07-01

    We present in this work the development of astronomy in Uruguay since the colony times up to the present, stressing in particular those aspects related to the formal as well as informal teaching of astronomy. The first antecedents of astronomical studies in our country go back to the beginnings of the XVIIIth century related to the scientific expeditions from Europe coming to our shores. The teaching of astronomy was generalized at the high school level as soon as the end of the XIXth century, while itsintroduction at the university level happened much later, around the middle of the last century. We analyze the current situation of this subject, its problems, and some measures to strengthen its development. Se presenta en este trabajo el desarrollo de la astronomía en el Uruguay desde la época colonial hasta el presente, destacando en particular los aspectos vinculados a su enseñanza tanto formal como informal. Los primeros antecedentes de estudios astronómicos datan de la época colonial relacionados con las expediciones científicas del Viejo Mundo que llegaban a nuestras costas. La enseñanza de la Astronomía se generalizó en el ámbito de los estudios secundarios ya a fines del siglo XIX, mientras que en la Universidad su arribo fue mucho más tardío, a mediados del siglo pasado. Se analiza la situación actual de esta disciplina, sus problemas, y algunas medidas para fortalecer su desarrollo. Apresentamos, neste trabalho, o desenvolvimento da Astronomia no Uruguai desde a época colonial até o presente, destacando em particular os aspectos vinculados ao seu ensino tanto formal quanto informal. Os primeiros antecedentes de estudos astronômicos em nosso país datam da época colonial relacionados com as expedições científicas do Velho Mundo que chegavam às nossas costas. O ensino da Astronomia se generalizou no âmbito dos estudos secundários já no final do século XIX, enquanto que sua introdução na universidade foi muito mais tardia, em meados do século passado. Se analisa a situação atual dessa disciplina, seus problemas, e algumas medidas para fortalecer seu desenvolvimento.

  7. Contaminant Interactions and Biological Effects of Single-walled Carbon Nanotubes in a Benthic Estuarine System

    NASA Astrophysics Data System (ADS)

    Parks, Ashley Nicole

    The fate, bioavailability, bioaccumulation and toxicity of single-walled carbon nanotubes (SWNT) have not been extensively studied to date. Pristine SWNT are highly hydrophobic and have been shown to strongly associate with natural particulate matter in aquatic environments. In light of this, I have focused my research to examine the influence of sediment and food exposure routes on bioavailability, bioaccumulation, and toxicity of structurally diverse SWNT in several ecologically-important marine invertebrate species. No significant mortality was observed in any organism at concentrations up to 1000 mg/kg. Evidence of biouptake after ingestion was observed for pristine semiconducting SWNT using NIRF spectroscopy and for oxidized 14C-SWNT using liquid scintillation counting. After a 24 hour depuration period, the pristine semiconducting SWNT were eliminated from organisms to below the method detection limit (5 microg/mL), and the 14C-SWNT body burden was decreased by an order of magnitude to a bioaccumulation factor (BAF) of <0.01. Neither pristine SWNT nor oxidized 14C-SWNT caused environmentally relevant toxicity or bioaccumulation in benthic invertebrates. Overall, the SWNT were not bioavailable and appear to associate with the sediment. In addition to investigating the toxicity and bioaccumulation of SWNT as an independent toxicant, it is important to consider how they will interact with other contaminants in the environment (i.e., increase or decrease toxicity and bioaccumulation of co-contaminants, alter the environmental transport of co-contaminants, induce degradation of co-contaminants, etc.). I wanted to investigate the effects of SWNT on a complex mixture of contaminants already present in a natural system. New Bedford Harbor (NBH) sediment, which is contaminated with polychlorinated biphenyls (PCBs), was amended with pristine SWNT to determine if the presence of SWNT would mitigate the toxicity and bioaccumulation of the PCBs in deposit-feeding invertebrates. A dilution series of the NBH sediment was created using uncontaminated Long Island Sound (LIS) sediment to test 25% NBH sediment, 50% NBH sediment, 75% NBH sediment, and 100% NBH sediment. The results of this work showed increased organism survival and decreased bioaccumulation of PCBs in treatments amended with SWNT, with the greatest reduction observed in the 25% NBH sediment treatment group amended with 10 mg SWNT/g dry sediment. Polyethylene (PE) passive samplers indicated a reduction of interstitial water (ITW) PCB concentration of greater than 90% in the 25% NBH sediment + 10 mg SWNT/g dry sediment amendment. The ITW concentration was reduced because PCBs were not desorbing from the SWNT. Lower bioavailability leads to reduced potential for toxic effects, supporting the observation of increased survival and decreased bioaccumulation. Once in the sediment, not only are SWNT not bioavailable, they act as a highly sorptive phase, such as black carbon (BC), into which hydrophobic organic contaminants (HOCs), such as PCBS and polycyclic aromatic hydrocarbons (PAHs), can partition, thereby reducing the toxicity and bioavailability of co-occurring HOCs. To more fully understand the impact of SWNT in this environment, their biodegradability also needs to be investigated. Biodegradation of SWNT could lead to release and/or transformation of sorbed HOCs as well as a change in the inherent transport, toxicity, and bioaccumulation of SWNT in the estuarine environment. Because the persistence of SWNT will be a primary determinant of the fate of these materials in the environment, I conducted experiments to determine if the fungus Trametes versicolor, the natural bacterial communities present in NBH sediment, and municipal wastewater treatment plant sludge could degrade or mineralize oxidized 14C-SWNT. Over a six month time period, no significant degradation or mineralization was observed. In all treatments, approximately 99% of the 14C-SWNT remained associated with the solid phase, with only approximately 0.8% of added 14C present as dissolved species and o

  8. Partitioned Bayesian analyses, dispersal-vicariance analysis, and the biogeography of Chinese toad-headed lizards (Agamidae: Phrynocephalus): a re-evaluation.

    PubMed

    Guo, Xianguang; Wang, Yuezhao

    2007-11-01

    The toad-headed lizards of genus Phrynocephalus are distributed from northwestern China to Turkey and are one of the major components of the central Asian desert fauna. To date, published morphological and molecular phylogenetic hypotheses of Phrynocephalus are only partially congruent, and the relationships within the genus are still far from clear. We re-analyzed published mitochondrial gene sequence data (12S, 16S, cyt b, ND4-tRNA(Leu)) by employing partition-specific modeling in a combined DNA analysis to clarify existing gaps in the phylogeny of Chinese Phrynocephalus. Using this phylogenetic framework, we inferred the genus' historical biogeography by using weighted ancestral-area analysis and dispersal-vicariance analysis in combination with a Bayesian relaxed molecular-clock approach and paleogeographical data. The partitioned Bayesian analyses support the monophyly of Phrynocephalus and its sister-group relationship with Laudakia. An earlier finding demonstrating the monophyly of the viviparous group is corroborated. However, our hypothesis of internal relationships of the oviparous group differs from a previous hypothesis as our results do not support monophyly of the oviparous taxa. Instead, the viviparous taxa form a clade with many oviparous taxa exclusive of P. helioscopus and P. mystaceus. Our results also suggest that: (1) P. putjatia is a valid species, comprising populations from Guide, Qinghai Province and Tianzhu, Gansu Province; (2) P. hongyuanensis is not a valid species, synonymized instead with P. vlangalii; (3) P. zetangensis is not a valid species and should be included in P. theobaldi; (4) the population occurring in Kuytun, Xinjiang Uygur Autonomous Region is recognized as P. guttatus instead of P. versicolor; and (5) the Lanzhou population of P. frontalis is part of P. przewalskii. Congruent with previous hypotheses, the uplift of the Tibetan Plateau played a fundamental role in the diversification of Phrynocephalus. An evolutionary scenario combining aspects of vicariance and dispersal is necessary to explain the distribution of Phrynocephalus. Bayesian divergence-time estimation suggests that Phrynocephalus originated at the Middle-Late Miocene boundary (15.16-10.4 Ma), and diversified from Late Miocene to Pleistocene from a center of origin in Central Asia, Tarim Basin, and Junggar Basin temperate desert, followed by several rapid speciation events in a relatively short time. The proposed biogeographic scenarios also indicate that the Tarim Basin desert may be the secondary diversification center, followed by Junggar Basin temperate desert and Alashan Plateau temperate desert. In the viviparous group, the allopatric speciation of P. theobaldi and P. vlangalii may have been caused by the uplifting of Tanggula Mountain Ranges. In addition, the results of this study make an important contribution to understanding the uplift of the Tibetan Plateau and Tian Shan Mountains and the biogeography of the entire region. PMID:17689269

  9. Phylogeny and revision of Messatoporus Cushman (Hymenoptera, Ichneumonidae, Cryptinae), with descriptions of sixty five new species.

    PubMed

    Santos, Bernardo F; Aguiar, Alexandre P

    2013-01-01

    The large New World genus Messatoporus Cushman is diagnosed, redefined, described, and its species revised. A total of 89 valid species are recognized, of which 65 are described as new. All previously known species are redescribed and illustrated. The following synonyms are proposed: M. jocosus (Provancher) and M. rufiventris Cushman under M. discoidalis (Cresson), syn. nov. and M. tricolor (Szépligeti) under M. variegatus (Szépligeti) syn. nov. The following new species are proposed: M. advenus, M. albiaterartus, M. allomeros, M. amarelus, M. amazonensis, M. amplithorax, M. andinus, M. anepomius, M. apiopharkis, M. argentinus, M. atlanticus, M. atrifoveus, M. aurantius, M. badius, M. basiflavus, M. bennetii, M. bicolor, M. bimaculatus, M. campanulatus, M. caxiuanensis, M. citreocephalus, M. complexifemur, M. concavivenus, M. convexus, M. copiosus, M. depressifrons, M. dialeipsis, M. dissidens, M. dominicanus, M. elektor, M. ellipsicavus, M. euryoikos, M. igneus, M. interceptus, M. keraiopetalus, M. laevilatus, M. latissulcus, M. longicaudis, M. longitergus, M. lordos, M. lunatus, M. maculiscus, M. matucanus, M. nigriangulatus, M. nigriscapus, M. nigriscutus, M. occidentalis, M. opacus, M. orientalis, M. paeneater, M. pallidus, M. paradoxus, M. paralissonotus, M. pleuriflavus, M. semialbiventris, M. semiaurantigaster, M. subalaris, M. tenuiorbis, M. tenuissimus, M. teutonicus, M. titans, M. unidentatus, M. unimaculatus, M. versicolor and M. xanthogaster spp. nov. As well, a lectotype is designated for M. townesi Alayo and Tzankov, and Messatoporus nigrispina (Cameron) is transferred to Prosthoporus Porter, comb. nov.. A key to species based on both sexes is also presented, and new distribution records and distribution maps are provided. The validity and relationships of the genus are investigated cladistically using 162 morphological characters for 27 species of Messatoporus and 105 outgroup taxa. Tree search was conducted using TNT under implied weighting, with values of 1–6 for the concavity constant (K). All analyses recovered Messatoporus as a monophyletic group, supported by 7–11 synapomorphies. The results also support the monophyly of the six studied genera of Osprynchotina, in a clade including also Dotocryptus Brèthes. Messatoporus is diagnosed by the combination of the following features: apicolateral corners of clypeus projected; mandible long and tapered, ventral tooth much shorter than dorsal one or indistinct; transverse sulcus at base of propodeum long and shallow; anterior margin of propodeum concave; posterior area of propodeum almost always transversely wrinkled; first metasomal spiracle placed approximately on midlength; median dorsal carina of first metasomal segment absent; ovipositor basally cylindrical, apically depressed, with ventral valve enclosing completely dorsal valve as a sheath. A second analysis including all species of the genus was performed to evaluate the phylogeny at the genus level. The character set for that analysis included 104 characters considered of phylogenetic importance within the genus, and used the same tree searching protocol as the first one. A distinct and gradual transition is detected, from species more similar to the remaining Osprynchotina to a significantly different morphotype with several convergences with the Gabuniina. These convergences are interpreted as adaptations to host location and substrate perforation, and may be related to use of more deeply concealed hosts. PMID:25325091

  10. Moléculas orgánicas no-rígidas

    NASA Astrophysics Data System (ADS)

    Senent Díez, M. L.

    Se destaca la importancia del estudio espectroscópico ab initio de una serie de moléculas no-rígidas detectadas en el medio interestelar (acetona, dimetil-eter, etanol, metanol, metilamina, ldots), así como los últimos avances del desarrollo de la metodología para el tratamiento teórico de estas especies. Se describe, a modo de ejemplo, el análisis del espectro roto-torsional de la molécula de glicoaldehido que ha sido recientemente detectada en el centro Galáctico Sagitario B2 (N) [1]. Esta especie presenta dos movimientos de gran amplitud que interaccionan, descansan en el Infrarrojo Lejano y le confiere propiedades no-rígidas. La molécula puede existir en posiciones cis y trans y presenta cinco confórmeros estables, tres de simetría Cs (I, II y IV) y un doble mínimo trans de simetría C1 (III) . La conformación favorita, I, presenta simetría Cs y se estabiliza por la formación de un puente de hidrógeno entre los grupos OH y C=O. Los mínimos secundarios II, III, y IV se han determinado a 1278.2 cm-1 (trans, Cs), 1298.8 cm-1 (trans, C1) y 1865.2 cm-1 (cis, Cs) con cálculos MP4/cc-pVQZ que incluyen sustituciones triples. Para determinar que vibraciones interaccionan con las torsiones, se ha realizado un análisis armónico en los mínimos. Las frecuencias fundamentales armónicas correspondientes al mínimo I se han calculado en 213.4 cm-1 (torsión C-C) y 425.7 cm-1 (torsión OH). Es de esperar que tan sólo dos vibraciones, la flexión del grupo C-C-O y el aleteo del hidrógeno del grupo aldehídico puedan desplazar el espectro torsional de la molécula aislada. Para determinar el espectro torsional, se ha determinado la superficie de potencial en dos dimensiones mediante el cálculo ab initio de las geometrías y energías de 74 conformaciones seleccionadas. Estas últimas se han ajustado a un doble serie de Fourier. A partir de la PES y de los parámetros cinéticos del Hamiltoniano vibracional se han obtenido frecuencias e intensidades. Las frecuencias fundamentales se han calculado en 208.0 cm-1 (torsión C-C) y 349.9 cm-1 (torsión OH). Se discute el método de cálculo que se ha empleado para la clasificación de los niveles. Los niveles rotacionales se han determinado empleando el método desarrollado para el estudio del ácido acético [2]. Se emplean la base de funciones rotacionales de [3]. A partir de los niveles se han determinado las constantes rotacionales y las constantes de distorsión centrífuga que se comparan con las experimentales de Herbst et al [3].

  11. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

  12. Astronomy, Art and Mythology in a Public Elementary School in Itaocara/rj. (Spanish Title: Astronomía, Arte y Mitologia en el Ensino Fundamental en Una Escuela de la Red Estatal en ITAOCARA/RJ.) Astronomia, Arte e Mitologia no Ensino Fundamental em Escola da Rede Estadual em ITAOCARA/RJ

    NASA Astrophysics Data System (ADS)

    Oliveira Bernardes, Adriana; Ramos dos Santos, Arleidimar

    2008-12-01

    Volunteer advisors at Itaocara Astronomy Club Marcos Pontes(CAIMP), in their majority high school students, introduced students at Teotônio Brandão Vilela Elementary School to basic concepts in Astronomy, Physics, and Mythology. Computer Science, Arts, puppetry, and educational videos were used to stimulate students to share their feelings and test their knowledge of the concepts presented. The work done by the volunteers helped boost the student's self-esteem and improved their oral skills by applying their knowledge of Physics and Astronomy in Lab experiments. The main goals of the CAIMP are the possibility of including astronomy in Elementary school curricula and developing an interdisciplinary work involving Astronomy, Arts, and Mythology. Through tests and reports, the students who participated in the Brazilian Astronomy Olympics, showed an increase in their knowldge of the sujects presented during the volunteer work. Durante el curso de un trabajo voluntario con estudiantes de nivel primario (1 º a 4 º grado), los guías de Astronomía miembros del CAIMP (Club de Astronomía de Itaocara "Marcos Puentes"), en su mayoría estudiantes secundarios, desarrollaron un trabajo de introducción a las Ciencias y Astronomía con alumnos del colegio estatal Teotônio Vilela Brandão. A través de talleres de informática, artes, videos educativos y teatro de títeres, los estudiantes pudieron expresar sus conocimientos y emociones frente a las leyendas mitológicas con las que se inició el trabajo de introducción. La labor desarrollada por los guías con los alumnos promovió la integración entre las aulas del colegio haciéndolos participar en actividades con el fin de estimular su expresión verbal y aumentar su autoestima. Trabajando diversas formas de expresión, los alumnos pudieron realizar experimentos y conocer algunos conceptos de Física y Astronomía al mismo tiempo que adquirían autonomía para la libre expresión de sus sentimientos y de los conocimientos recibidos. El trabajo en sí ha mostrado además de la posibilidad de la inclusión de la Astronomía en la Educación Primaria, la posibilidad de un trabajo interdisciplinario en los niveles iniciales incluyendo Astronomía, Arte y Mitología. Los resultados presentados por los estudiantes en las Olimpiadas promovidas en la escuela y por la OBA (Olimpiada Brasilera de Astronomía) permitieron verificar un creciente aprendizaje y estimulo hacia las materias científicas, comprobados por la apropiada expresión de los conceptos adquiridos de astronomía y presentados en evaluaciones o en informes obtenidos de ellos mismos, sus familias y profesores. Desenvolvendo um trabalho voluntário junto aos alunos do ensino fundamental no 1º ciclo (1ª a 4ª série), os monitores de Astronomia membros do CAIMP (Clube de Astronomia de Itaocara Marcos Pontes), que eram em sua maioria alunos do ensino médio, desenvolveram um trabalho de aproximação entre os alunos do Colégio Estadual Teotônio Brandão Vilela e os temas envolvendo Ciências e Astronomia. Através de oficinas de informática, artes, vídeos educativos e teatros de fantoches, os alunos puderam expressar seus conhecimentos e emoções diante das lendas mitológicas com as quais começaram a ter contato. O trabalho desenvolvido pelos monitores junto aos alunos proporcionou a integração entre as turmas do colégio e os levou a participação em atividades de maneira a estimular sua oralidade e aumentar sua auto-estima. Trabalhando várias formas de expressões, os alunos puderam realizar seus experimentos e conhecer alguns conceitos de Física e Astronomia, enquanto adquiriam autonomia para se expressarem de acordo com seus sentimentos e conhecimentos adquiridos. O trabalho em si mostrou além da possibilidade de inserção de Astronomia no Ensino Fundamental, a possibilidade de realização de um trabalho interdisciplinar nas séries iniciais envolvendo Astronomia, Arte e Mitologia. Os resultados apresentados pelos alunos nas Olimpíadas promovidas na escola e pela OBA (Olimpíada Brasileir

  13. Sky Observation with the Use of the Software Stellarium for Teaching Astronomy in Classes of Youth and Adult Education. (Spanish Title: Observación del Cielo con la Utilización del Software Stellarium en Las Clases de Educación de Jóvenes y Adultos.) Observação do Céu Aliada À Utilização do Software Stellarium no Ensino de Astronomia em Turmas de Educação de Jovens e Adultos (EJA)

    NASA Astrophysics Data System (ADS)

    Oliveira Bernardes, Adriana

    2010-12-01

    The aim of this paper is to present a project developed through a partnership between the Astronomy Club of Itaocara Marcos Pontes (CAIMP) and Jaime de Souza Queiroz College, both located in the town of Itaocara, in the Northwest Fluminense, to disseminate Astronomy in adult education (Education for Youth and Adult). Given the interdisciplinary nature of Astronomy, we have developed this work to motivate the learning of this science by students in adult education, who attend the subjects Chemistry, Physics and Biology. Initially, we conducted a research in the school to assess the prior knowledge of Astronomy class of adult education, noting that there is little knowledge of basic concepts of the discipline. With these data, we were able to elaborate several activities that would enable a greater involvement of students with this science, performing in the school a work of improvement of scientific literacy, whose activities will be presented in this article. El objetivo de este artículo es presentar los resultados de un proyecto realizado por el Club de Astronomía de Itaocara "Marcos Pontes" (CAIMP), conjuntamente con el Colegio Estatal" Jaime de Souza Queiroz", ambos de la ciudad de Itaocara (Noroeste Fluminense - RJ, Brasil), para la difusión de la Astronomía entre los estudiantes, tanto adultos como adolescentes. Teniendo en cuenta la naturaleza interdisciplinaria de la Astronomía, se determinó motivar el estudio de esta ciencia en los estudiantes adultos de nivel secundario matriculados en las asignaturas de Química, Física y Biología. Como primer paso, se investigó el grado de conocimiento sobre astronomía del estudiante. Este estudio inicial mostró niveles de conocimiento muy bajos de los conceptos básicos de esta ciencia, muchos de los cuales deberían haber sido asimilados dentro del plan curricular del curso de Física. Este estudio previo permitió determinar las actividades adecuadas para promover un mayor envolvimiento de los estudiantes en las ciencias, o sea, elaborar y desarrollar un plan de alfabetización científica. Se describe en detalle este plan, las actividades realizadas y los resultados obtenidos hasta el presente. O objetivo do presente artigo é apresentar um projeto desenvolvido através de parceria entre o Clube de Astronomia de Itaocara Marcos Pontes (CAIMP) e o Colégio Estadual Jaime Queiroz de Souza, ambos localizados na cidade de Itaocara, no Noroeste Fluminense, no sentido de divulgar junto às turmas de EJA (Ensino de Jovens e Adultos) a disciplina Astronomia. Conhecendo o caráter interdisciplinar da Astronomia, desenvolvemos este trabalho para motivar o aprendizado de Ciências junto a alunos de EJA do Ensino Médio que cursam as disciplinas Química, Física e Biologia. Inicialmente, realizamos na escola pesquisa sobre o conhecimento prévio de Astronomia da turma de EJA, observando que é escasso o conhecimento de conceitos básicos do tema, muitos dos quais deveriam ser assimilados através do conteúdo da disciplina Física. Com esses dados, foi possível elaborar várias atividades que possibilitassem um maior envolvimento dos estudantes com a Ciência, realizando dentro da escola um trabalho de alfabetização científica, cujas atividades serão apresentadas neste artigo.

  14. Understanding differences in access and use of healthcare between international immigrants to Chile and the Chilean-born: a repeated cross-sectional population-based study in Chile

    PubMed Central

    2012-01-01

    Introduction International evidence indicates consistently lower rates of access and use of healthcare by international immigrants. Factors associated with this phenomenon vary significantly depending on the context. Some research into the health of immigrants has been conducted in Latin America, mostly from a qualitative perspective. This population-based study is the first quantitative study to explore healthcare provision entitlement and use of healthcare services by immigrants in Chile and compare them to the Chilean-born. Methods Data come from the nationally representative CASEN (Socioeconomic characterization of the population in Chile) surveys, conducted in 2006 and 2009. Self-reported immigrants were compared to the Chilean-born, by demographic characteristics (age, sex, urban/rural, household composition, ethnicity), socioeconomic status (SES: education, household income, contractual status), healthcare provision entitlement (public, private, other, none), and use of primary services. Weighted descriptive, stratified and adjusted regression models were used to analyse factors associated with access to and use of healthcare. Results There was an increase in self-reported immigrant status and in household income inequality among immigrants between 2006 and 2009. Over time there was a decrease in the rate of immigrants reporting no healthcare provision and an increase in reporting of private healthcare provision entitlement. Compared to the Chilean-born, immigrants reported higher rates of use of antenatal and gynaecological care, lower use of well-baby care, and no difference in the use of Pap smears or the number of attentions received in the last three months. Immigrants in the bottom income quintile were four times more likely to report no healthcare provision than their equivalent Chilean-born group (with different health needs, i.e. vertical inequity). Disabled immigrants were more likely to have no healthcare provision compared to the disabled Chilean-born (with similar health needs, i.e. horizontal inequity). Factors associated with immigrants’ access to, and use of, healthcare were sex, urban/rural status, education and country of origin. Conclusion There were significant associations between SES, and access to and use of healthcare among immigrants in Chile and a higher prevalence of no health care provision entitlement among poor and disabled immigrants compared to the Chilean-born. Changing associations between access and use of healthcare and SES among immigrants in Chile over time may reflect changes in their socio-demographic composition or in the survey methodology between 2006 and 2009. Resumen Introducción La evidencia internacional indica menor acceso y uso de servicios de salud por parte de inmigrantes, pero sus factores desencadenantes varían significativamente dependiendo del contexto. Algunas investigaciones se han desarrollado en este tema en América Latina, desde una perspectiva cualitativa. Este estudio cuantitativo exploró el auto-reporte de acceso y uso de servicios de salud de inmigrantes en Chile y los comparó con la población chilena. Métodos Análisis secundario de datos de encuesta nacional CASEN 2006 y 2009. Inmigrantes fueron comparados con chilenos en características demográficas (edad, sexo, urbano/rural, composición del hogar, etnia), estatus socioeconómico (educación, ingreso, situación contractual), tipo de previsión (pública, privada, otra, ninguna), y uso de varios servicios de atención primaria. Análisis descriptivo, estratificado, y modelos de regresión ponderados para entender factores asociados al acceso y uso de servicios de salud en STATA 11.0. Resultados Se observó un aumento de reporte de inmigrantes y de la desigualdad en el ingreso de inmigrantes entre 2006 y 2009. Hubo una disminución en la tasa de inmigrantes sin previsión y un aumento en el acceso al sistema privado. Los inmigrantes usaron más frecuentemente la atención prenatal y ginec

  15. Reviving Erathostenes. (Breton Title: Revivendo Eratóstenes.) Reviviendo a Eratóstenes.

    NASA Astrophysics Data System (ADS)

    Pereira, Paulo Cesar R.

    2006-12-01

    As part of the commemorations of the International Year of the Physics and having as its main objective to introduce students to the scientific method, the Rio de Janeiro Planetarium Foundation, in partnership with many institutions of Brazil and Europe, coordinated the activity "Reviving Eratosthenes" whose objective was the determination of the Earth's circumference. We used the famous procedure adopted by Eratosthenes more than 2000 years ago, with some adaptations. This work considers and analyzes the method used by us, aiming the application in schools. The use of places in different meridians allows a better understanding of the abstract concepts such as geographic coordinate and time zones. We obtained reasonably precise results, which improve for pairs of distant cities. Finally, one of the most important conclusions achieved by the students involved is the importance of the cooperation (international in this case) to solve problems. Fazendo parte das comemorações do Ano Internacional da Física e tendo como principal objetivo introduzir estudantes do ensino médio ao método científico, a Fundação Planetário da Cidade do Rio de Janeiro, em parceria com diversas instituições do Brasil e da Europa, coordenou a atividade "Revivendo Eratóstenes" cujo objetivo foi a determinação da circunferência da Terra. Para isso, utilizou-se um procedimento semelhante ao empregado pelo sábio Eratóstenes há mais de 2.000 anos, com algumas adaptações. Este trabalho propõe e analisa o método que empregamos, visando a aplicação em escolas. A possibilidade de se trabalhar com locais em diferentes meridianos permite uma melhor compreensão dos conceitos mas abstratos, como coordenadas e fusos horários. A precisão dos resultados é bastante razoável, melhorando para cidades bem afastadas. Finalmente, uma das conclusões mais importantes é a percepção, por parte dos estudantes, da importância da colaboração (neste caso, internacional) para resolver problemas. Como parte de las conmemoraciones del Año Internacional de la Física y con el objetivo principal de introducir a los estudiantes secundarios al método científico, la Fundación Planetario Rio de Janeiro, en conjunto con diversas instituciones de Brasil y de Europa, coordinó la actividad denominada "Reviviendo a Eratóstenes" cuyo objetivo consistió en la determinación de la cincunferencia de la Tierra. Para esto se utilizó un procedimiento semejante al empleado por Eratóstenes hace más de 2.000 años, con algunas adaptaciones. Este trabajo expone y analiza el método empleado, con la intención de aplicarlo en las escuelas. La posibilidad de trabajar en lugares situados en diferentes meridianos permite una mejor comprensión de los conceptos más abstractos, tales como coordenadas y husos horarios. La precisión de los resultados resultó razonable, mejorando para aquellas ciudades mas apartadas. Finalmente, una de las conclusiones más importantes es la de la percepción, por parte de los estudiantes, de la importancia de la colaboración (en este caso internacional) para resolver problemas.