These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Graphene Sheets Stabilized on Genetically Engineered M13 Viral Templates as Conducting Frameworks for Hybrid Energy-Storage Materials  

E-print Network

Utilization of the material-specific peptide–substrate interactions of M13 virus broadens colloidal stability window of graphene. The homogeneous distribution of graphene is maintained in weak acids and increased ionic ...

Oh, Dahyun

2

Linking Dynamical and Population Genetic Models of Persistent Viral Infection  

E-print Network

This article develops a theoretical framework to link dynamical and population genetic models of persistent viral infection. This linkage is useful because, while the dynamical and population genetic theories have developed ...

Kelly, John K.; Williamson, Scott; Orive, Maria E.; Smith, Marilyn S.; Holt, Robert D.

2003-07-01

3

Viral replication and genetics Nabil A. NIMER  

E-print Network

the enzymes necessary to replicate viral DNA viral RNA. #12;#12;A fundamental difference between the replication of viruses and bacteria; the latter retain their structure and infectivity throughout the growth. #12;General plan of viral replication No single virus is typical of them all. We have chosen a DNA

4

Patterned Assembly of Genetically Modified Viral Nanotemplates via  

E-print Network

Patterned Assembly of Genetically Modified Viral Nanotemplates via Nucleic Acid Hybridization and devices. In this report, cysteine residues were genetically engineered onto the virion surface of tobacco transistors.1,2 In addition, the genetically derived nanostructures of viruses have been exploited

Rubloff, Gary W.

5

Genetic typing of bovine viral diarrhea virus isolates from Argentina  

Microsoft Academic Search

Genetic typing of 29 Bovine Viral Diarrhea Virus (BVDV) isolates from Argentina was carried out by sequencing 245 nucleotides of the RT-PCR products of the 5?-UTR region. Sequence analysis shows that these Argentinean BVDV include types 1 and 2. The majority (26\\/29) of the isolates are type 1, which comprises subtypes 1a and 1b, together with an additional subgroup within

Leandro R Jones; Rubén Zandomeni; E. Laura Weber

2001-01-01

6

Molecular genetic alterations and viral presence in ophthalmic pterygium.  

PubMed

Pterygium is a lesion of the corneoscleral limbus which tends to grow in size, often recurs after surgical excision and is associated with exposure to solar light. Additionally, a family history is frequently reported. Loss of heterozygosity (LOH), increased P53 expression and the presence of oncogenic viruses, such as human papilloma virus (HPV) and herpes simplex virus (HSV), have been detected in pterygia, supporting the possible neoplastic nature of the lesion. Co-infection by HSV and HPV as well as LOH at some loci have also been correlated with clinical features, such as postoperative recurrence and history of conjunctivitis. A possible model of pterygium formation is proposed, in which genetic predisposition, environmental factors and viral infection(s) participate in a multi-step process. Future research may lead to new ways of pterygium treatment such as anti-viral or gene therapy. PMID:10851263

Detorakis, E T; Drakonaki, E E; Spandidos, D A

2000-07-01

7

Analysis of host genetic diversity and viral entry as sources of between-host variation in viral load  

USGS Publications Warehouse

Little is known about the factors that drive the high levels of between-host variation in pathogen burden that are frequently observed in viral infections. Here, two factors thought to impact viral load variability, host genetic diversity and stochastic processes linked with viral entry into the host, were examined. This work was conducted with the aquatic vertebrate virus, Infectious hematopoietic necrosis virus (IHNV), in its natural host, rainbow trout. It was found that in controlled in vivo infections of IHNV, a suggestive trend of reduced between-fish viral load variation was observed in a clonal population of isogenic trout compared to a genetically diverse population of out-bred trout. However, this trend was not statistically significant for any of the four viral genotypes examined, and high levels of fish-to-fish variation persisted even in the isogenic trout population. A decrease in fish-to-fish viral load variation was also observed in virus injection challenges that bypassed the host entry step, compared to fish exposed to the virus through the natural water-borne immersion route of infection. This trend was significant for three of the four virus genotypes examined and suggests host entry may play a role in viral load variability. However, high levels of viral load variation also remained in the injection challenges. Together, these results indicate that although host genetic diversity and viral entry may play some role in between-fish viral load variation, they are not major factors. Other biological and non-biological parameters that may influence viral load variation are discussed.

Wargo, Andrew R.; Kell, Alison M.; Scott, Robert J.; Thorgaard, Gary H.; Kurath, Gael

2012-01-01

8

Analysis of host genetic diversity and viral entry as sources of between-host variation in viral load  

PubMed Central

Little is known about the factors that drive the high levels of between-host variation in pathogen burden that are frequently observed in viral infections. Here, two factors thought to impact viral load variability, host genetic diversity and stochastic processes linked with viral entry into the host, were examined. This work was conducted with the aquatic vertebrate virus, Infectious hematopoietic necrosis virus (IHNV), in its natural host, rainbow trout. It was found that in controlled in vivo infections of IHNV, a suggestive trend of reduced between-fish viral load variation was observed in a clonal population of isogenic trout compared to a genetically diverse population of out-bred trout. However, this trend was not statistically significant for any of the four viral genotypes examined, and high levels of fish-to-fish variation persisted even in the isogenic trout population. A decrease in fish-to-fish viral load variation was also observed in virus injection challenges that bypassed the host entry step, compared to fish exposed to the virus through the natural water-borne immersion route of infection. This trend was significant for three of the four virus genotypes examined and suggests host entry may play a role in viral load variability. However, high levels of viral load variation also remained in the injection challenges. Together, these results indicate that although host genetic diversity and viral entry may play some role in between-fish viral load variation, they are not major factors. Other biological and non-biological parameters that may influence viral load variation are discussed. PMID:22310066

Wargo, Andrew R.; Kell, Alison M.; Scott, Robert J.; Thorgaard, Gary H.; Kurath, Gael

2012-01-01

9

Host genetic susceptibility, dysbiosis and viral triggers in IBD  

PubMed Central

Purpose of Review Inflammatory bowel disease (IBD) is thought to occur in genetically susceptible individuals. However, environmental factors, potentially including shifts in commensal microbiota, are also required to trigger disease. This review discusses some of the recent discoveries in host susceptibility and interaction with the microbial environment, and pinpoints key areas for advancement in our understanding of IBD pathogenesis. Recent findings Meta-analyses of genome wide association studies have uncovered many new exciting genes associated with susceptibility loci. In addition, improved methods to analyze the commensal microbiota path the way to better define dysbiosis and its potential role in disease. Lastly, identification of viral triggers in experimental systems of IBD suggests a potential role in IBD. Summary Understanding the precise microbial and immune triggers of IBD in a genetic context will hopefully lead to a better understanding of the pathogenesis of this disease and the discovery of novel therapeutic approaches including vaccines for specific viruses. PMID:21483258

Sun, Lulu; Nava, Gerardo M.; Stappenbeck, Thaddeus S.

2014-01-01

10

Massively parallel sequencing for monitoring genetic consistency and quality control of live viral vaccines.  

PubMed

Intrinsic genetic instability of RNA viruses may lead to the accumulation of revertants during manufacture of live viral vaccines, requiring rigorous quality control to ensure vaccine safety. Each lot of oral poliovirus vaccine (OPV) is tested for neurovirulence in animals and also for the presence of neurovirulent revertants. Mutant analysis by PCR and restriction enzyme cleavage (MAPREC) is used to measure the frequency of neurovirulent mutations at the 5' untranslated region (UTR) of the viral genome that correlate with the level of neurovirulence determined by the monkey neurovirulence test. However, MAPREC can only monitor mutations at a few genomic loci and miss mutations at other sites that could adversely affect vaccine quality. Here we propose to use massively parallel sequencing (MPS) for sensitive detection and quantification of all mutations in the entire genome of attenuated viruses. Analysis of vaccine samples and reference preparations demonstrated a perfect agreement with MAPREC results. Quantitative MPS analysis of validated reference preparations tested by MAPREC produced identical results, suggesting that the method could take advantage of the existing reference materials and be used as a replacement for the MAPREC procedure in lot release of OPV. Patterns of mutations present at a low level in vaccine preparations were characteristic of seed viruses used for their manufacture and could be used for identification of individual batches. This approach may represent the ultimate tool for monitoring genetic consistency of live viral vaccines. PMID:21041640

Neverov, Alexander; Chumakov, Konstantin

2010-11-16

11

Genetic methods for studying the role of viral oncogenes in the HPV life cycle.  

PubMed

Human papillomaviruses are the causative agents of several cancers, but only a minority of HPV infections progress to malignancy. In order to better understand HPV biology during the normal, differentiation-dependent life cycle, a cell culture model that maintains the complete episomal genome and permits host cell differentiation is critical. Furthermore, the use of cloned DNA as a starting material is important to facilitate genetic analyses. In this chapter, procedures for isolating human keratinocytes, establishing cell lines maintaining HPV16 genomes, and inducing cellular differentiation, which permits analysis of both early and late stages in the viral life cycle, are described. PMID:25348299

Bodily, Jason M

2015-01-01

12

Radiolytic Damage to Genetic Material.  

ERIC Educational Resources Information Center

Describes some basic findings in the radiation chemistry of genetic material derived from studies of model systems. Uses these findings to extrapolate the consequences of radiation damage to DNA within cells. (CS)

Ward, John F.

1981-01-01

13

nature biotechnology volume 27 number 12 december 2009 1163 systems (`refactoring'genomes) or recoding viral genetic information  

E-print Network

into biology or the design of new vectors that can prevent or cure infectious diseases, cure genetic if the natural viral template is not available. It also allows the genetic modification of viral genomes to understand and prevent viral disease Eckard Wimmer1,Steffen Mueller1,Terrence M Tumpey2 & Jef

Cai, Long

14

Emergence of viral hemorrhagic septicemia virus in the North American Great Lakes region is associated with low viral genetic diversity  

USGS Publications Warehouse

Viral hemorrhagic septicemia virus (VHSV) is a fish rhabdovirus that causes disease in a broad range of marine and freshwater hosts. The known geographic range includes the Northern Atlantic and Pacific Oceans, and recently it has invaded the Great Lakes region of North Ame­rica. The goal of this work was to characterize genetic diversity of Great Lakes VHSV isolates at the early stage of this viral emergence by comparing a partial glycoprotein (G) gene sequence (669 nt) of 108 isolates collected from 2003 to 2009 from 31 species and at 37 sites. Phylogenetic analysis showed that all isolates fell into sub-lineage IVb within the major VHSV genetic group IV. Among these 108 isolates, genetic diversity was low, with a maximum of 1.05% within the 669 nt region. There were 11 unique sequences, designated vcG001 to vcG011. Two dominant sequence types, vcG001 and vcG002, accounted for 90% (97 of 108) of the isolates. The vcG001 isolates were most widespread. We saw no apparent association of sequence type with host or year of isolation, but we did note a spatial pattern, in which vcG002 isolates were more prevalent in the easternmost sub-regions, including inland New York state and the St. Lawrence Seaway. Different sequence types were found among isolates from single disease outbreaks, and mixtures of types were evident within 2 isolates from ­individual fish. Overall, the genetic diversity of VHSV in the Great Lakes region was found to be extremely low, consistent with an introduction of a new virus into a geographic region with ­previously naïve host populations.

Thompson, T.M.; Batts, W.N.; Faisal, M.; Bowser, P.; Casey, J.W.; Phillips, K.; Garver, K.A.; Winton, J.; Kurath, G.

2011-01-01

15

Emergence of Viral hemorrhagic septicemia virus in the North American Great Lakes region is associated with low viral genetic diversity.  

PubMed

Viral hemorrhagic septicemia virus (VHSV) is a fish rhabdovirus that causes disease in a broad range of marine and freshwater hosts. The known geographic range includes the Northern Atlantic and Pacific Oceans, and recently it has invaded the Great Lakes region of North America. The goal of this work was to characterize genetic diversity of Great Lakes VHSV isolates at the early stage of this viral emergence by comparing a partial glycoprotein (G) gene sequence (669 nt) of 108 isolates collected from 2003 to 2009 from 31 species and at 37 sites. Phylogenetic analysis showed that all isolates fell into sub-lineage IVb within the major VHSV genetic group IV. Among these 108 isolates, genetic diversity was low, with a maximum of 1.05% within the 669 nt region. There were 11 unique sequences, designated vcG001 to vcG011. Two dominant sequence types, vcG001 and vcG002, accounted for 90% (97 of 108) of the isolates. The vcG001 isolates were most widespread. We saw no apparent association of sequence type with host or year of isolation, but we did note a spatial pattern, in which vcG002 isolates were more prevalent in the easternmost sub-regions, including inland New York state and the St. Lawrence Seaway. Different sequence types were found among isolates from single disease outbreaks, and mixtures of types were evident within 2 isolates from individual fish. Overall, the genetic diversity of VHSV in the Great Lakes region was found to be extremely low, consistent with an introduction of a new virus into a geographic region with previously naive host populations. PMID:21991663

Thompson, Tarin M; Batts, William N; Faisal, Mohamed; Bowser, Paul; Casey, James W; Phillips, Kenneth; Garver, Kyle A; Winton, James; Kurath, Gael

2011-08-29

16

Genetic and antigenic variability in bovine viral diarrhea virus (BVDV) isolates from Belgium  

Microsoft Academic Search

This report describes the genetic and antigenic variability of bovine viral diarrhea virus strains isolated in Belgium. Part of the 5? untranslated region and the 5? end of the gp53 (E2) coding sequence were amplified by PCR and sequenced. Phylogenetic analysis showed that most field isolates segregated into genotypes Ib or II. Only one out of 28 field isolates belonged

B. Couvreur; C. Letellier; A. Collard; P. Quenon; P. Dehan; C. Hamers; P.-P. Pastoret; P. Kerkhofs

2002-01-01

17

Genetic Therapy for Duchenne Muscular Dystrophy: Viral Vectors and Micro-Gene Therapy  

E-print Network

Genetic Therapy for Duchenne Muscular Dystrophy: Viral Vectors and Micro-Gene Therapy Taeyoung Koo, Royal Holloway-University of London, Egham, TW20 0EX What is Duchenne Muscular Dystrophy (DMD)? DMD is Duchenne Muscular Dystrophy (DMD)? DMD is a Neuromuscular disease caused by mutations in the dystrophin

Royal Holloway, University of London

18

Viral Phylodynamics  

PubMed Central

Viral phylodynamics is defined as the study of how epidemiological, immunological, and evolutionary processes act and potentially interact to shape viral phylogenies. Since the coining of the term in 2004, research on viral phylodynamics has focused on transmission dynamics in an effort to shed light on how these dynamics impact viral genetic variation. Transmission dynamics can be considered at the level of cells within an infected host, individual hosts within a population, or entire populations of hosts. Many viruses, especially RNA viruses, rapidly accumulate genetic variation because of short generation times and high mutation rates. Patterns of viral genetic variation are therefore heavily influenced by how quickly transmission occurs and by which entities transmit to one another. Patterns of viral genetic variation will also be affected by selection acting on viral phenotypes. Although viruses can differ with respect to many phenotypes, phylodynamic studies have to date tended to focus on a limited number of viral phenotypes. These include virulence phenotypes, phenotypes associated with viral transmissibility, cell or tissue tropism phenotypes, and antigenic phenotypes that can facilitate escape from host immunity. Due to the impact that transmission dynamics and selection can have on viral genetic variation, viral phylogenies can therefore be used to investigate important epidemiological, immunological, and evolutionary processes, such as epidemic spread [2], spatio-temporal dynamics including metapopulation dynamics [3], zoonotic transmission, tissue tropism [4], and antigenic drift [5]. The quantitative investigation of these processes through the consideration of viral phylogenies is the central aim of viral phylodynamics. PMID:23555203

Volz, Erik M.; Koelle, Katia; Bedford, Trevor

2013-01-01

19

Genetic disruption of KSHV major latent nuclear antigen LANA enhances viral lytic transcriptional program  

SciTech Connect

Following primary infection, KSHV establishes a lifelong persistent latent infection in the host. The mechanism of KSHV latency is not fully understood. The latent nuclear antigen (LANA or LNA) encoded by ORF73 is one of a few viral genes expressed during KSHV latency, and is consistently detected in all KSHV-related malignancies. LANA is essential for KSHV episome persistence, and regulates the expression of viral lytic genes through epigenetic silencing, and inhibition of the expression and transactivation function of the key KSHV lytic replication initiator RTA (ORF50). In this study, we used a genetic approach to examine the role of LANA in regulating KSHV lytic replication program. Deletion of LANA did not affect the expression of its adjacent genes vCyclin (ORF72) and vFLIP (ORF71). In contrast, the expression levels of viral lytic genes including immediate-early gene RTA, early genes MTA (ORF57), vIL-6 (ORF-K2) and ORF59, and late gene ORF-K8.1 were increased before and after viral lytic induction with 12-O-tetradecanoyl-phorbol-13-acetate and sodium butyrate. This enhanced expression of viral lytic genes was also observed following overexpression of RTA with or without simultaneous chemical induction. Consistent with these results, the LANA mutant cells produced more infectious virions than the wild-type virus cells did. Furthermore, genetic repair of the mutant virus reverted the phenotypes to those of wild-type virus. Together, these results have demonstrated that, in the context of viral genome, LANA contributes to KSHV latency by regulating the expression of RTA and its downstream genes.

Li Qiuhua [Tumor Virology Program, Greehey Children's Cancer Research Institute, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Microbiology and Immunology, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Zhou Fuchun; Ye Fengchun [Tumor Virology Program, Greehey Children's Cancer Research Institute, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Pediatrics, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Gao Shoujiang [Tumor Virology Program, Greehey Children's Cancer Research Institute, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Pediatrics, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Microbiology and Immunology, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Medicine, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Molecular Medicine, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Cancer Therapy and Research Center, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, 44 Xiaohongshan, Wuhan (China)], E-mail: gaos@uthscsa.edu

2008-09-30

20

Genetic characterization of a noncytopathic bovine viral diarrhea virus 2b isolated from cattle in China.  

PubMed

In January 2013, several clinical signs of cattle with diarrhea, cough, nasal discharge, and fever were reported in Jilin province, China. One virus named SD1301 was isolated and identified. Complete genome of the virus is 12258nt in length and contains a 5'UTR, one open reading frame encoding a polyprotein of 3,897 amino acids and a 3'UTR. Phylogenetic analysis of 5'UTR, N(pro), E1 and E2 gene demonstrated the virus belonged to BVDV 2b, and genetically related to the BVDV strain Hokudai-Lab/09 from Japan in 2010. This bovine viral diarrhea virus displays a unique genetic signature with 27-nucleotide deletion in the 5'UTR, which is similar to the bovine viral diarrhea virus C413 (AF002227). This was the first confirmed isolation of ncp BVDV2b circulating in bovine herd of China. PMID:24811746

Wang, Wei; Shi, Xinchuan; Chen, Chaoyang; Wu, Hua

2014-10-01

21

Challenges and opportunities in estimating viral genetic diversity from next-generation sequencing data  

PubMed Central

Many viruses, including the clinically relevant RNA viruses HIV (human immunodeficiency virus) and HCV (hepatitis C virus), exist in large populations and display high genetic heterogeneity within and between infected hosts. Assessing intra-patient viral genetic diversity is essential for understanding the evolutionary dynamics of viruses, for designing effective vaccines, and for the success of antiviral therapy. Next-generation sequencing (NGS) technologies allow the rapid and cost-effective acquisition of thousands to millions of short DNA sequences from a single sample. However, this approach entails several challenges in experimental design and computational data analysis. Here, we review the entire process of inferring viral diversity from sample collection to computing measures of genetic diversity. We discuss sample preparation, including reverse transcription and amplification, and the effect of experimental conditions on diversity estimates due to in vitro base substitutions, insertions, deletions, and recombination. The use of different NGS platforms and their sequencing error profiles are compared in the context of various applications of diversity estimation, ranging from the detection of single nucleotide variants (SNVs) to the reconstruction of whole-genome haplotypes. We describe the statistical and computational challenges arising from these technical artifacts, and we review existing approaches, including available software, for their solution. Finally, we discuss open problems, and highlight successful biomedical applications and potential future clinical use of NGS to estimate viral diversity. PMID:22973268

Beerenwinkel, Niko; Günthard, Huldrych F.; Roth, Volker; Metzner, Karin J.

2012-01-01

22

The recombination of genetic material  

SciTech Connect

Genetic recombination is the major mechanism by which new arrangements of genetic elements are produced in all living organisms, from the simplest bacterial viruses to humans. This volume presents an overview of the types of recombination found in prokaryotes and eukaryotes.

Low, K.B.

1988-01-01

23

Genetic diversity and phylogenetic classification of viral hemorrhagic septicemia virus (VHSV).  

PubMed

The present study was undertaken to determine the genetic diversity of viral hemorrhagic septicemia virus (VHSV) and to gain insight into the molecular epidemiology of this fish rhabdovirus. The sequences of the nonstructural (NV) protein and the transmembrane (G) protein of sequential North American and European isolates of VHSV were determined and used to compute phylogenetic trees. According to the percentage of nucleotide or amino acid similarities, North American and European isolates formed 2 clearly distant genetic groups. While North American isolates clustered into a highly homogeneous genetic group, European isolates exhibited a higher genetic variability. Subgrouping based on this variability could be correlated with both the geographic origin and the serological classification. PMID:8581023

Basurco, B; Vende, P; Monnier, A F; Winton, J R; de Kinkelin, P; Benmansour, A

1995-01-01

24

A Yeast-Based Genetic System for Functional Analysis of Viral mRNA Capping Enzymes  

PubMed Central

Virus-encoded mRNA capping enzymes are attractive targets for antiviral therapy, but functional studies have been limited by the lack of genetically tractable in vivo systems that focus exclusively on the RNA-processing activities of the viral proteins. Here we have developed such a system by engineering a viral capping enzyme—vaccinia virus D1(1-545)p, an RNA triphosphatase and RNA guanylyltransferase—to function in the budding yeast Saccharomyces cerevisiae in lieu of the endogenous fungal triphosphatase (Cet1p) and guanylyltransferase (Ceg1p). This was accomplished by fusion of D1(1-545)p to the C-terminal guanylyltransferase domain of mammalian capping enzyme, Mce1(211-597)p, which serves as a vehicle to target the viral capping enzyme to the RNA polymerase II elongation complex. An inactivating mutation (K294A) of the mammalian guanylyltransferase active site in the fusion protein had no impact on genetic complementation of cet1?ceg1? cells, thus proving that (i) the viral guanylyltransferase was active in vivo and (ii) the mammalian domain can serve purely as a chaperone to direct other proteins to the transcription complex. Alanine scanning had identified five amino acids of vaccinia virus capping enzyme—Glu37, Glu39, Arg77, Glu192, and Glu194—that are essential for ? phosphate cleavage in vitro. Here we show that the introduction of mutation E37A, R77A, or E192A into the fusion protein abrogates RNA triphosphatase function in vivo. The essential residues are located within three motifs that define a family of viral and fungal metal-dependent phosphohydrolases with a distinctive capacity to hydrolyze nucleoside triphosphates to nucleoside diphosphates in the presence of manganese or cobalt. The acidic residues Glu37, Glu39, and Glu192 likely comprise the metal-binding site of vaccinia virus triphosphatase, insofar as their replacement by glutamine abolishes the RNA triphosphatase and ATPase activities. PMID:10823853

Ho, C. Kiong; Martins, Alexandra; Shuman, Stewart

2000-01-01

25

Genetics & Genomes The Genetics and Genomes course covers the transmission of the genetic material in humans  

E-print Network

MBIOL 6420 Genetics & Genomes Fall 2013 The Genetics and Genomes course covers the transmission of the genetic material in humans and various model organisms. In previous years, we have found that some students have struggled in this graduate level course in Genetics. This may be because the student did

Feschotte, Cedric

26

Genetics & Genomes The Genetics and Genomes course covers the transmission of the genetic material in  

E-print Network

MBIOL 6420 Genetics & Genomes Fall 2014 The Genetics and Genomes course covers the transmission of the genetic material in humans and various model organisms. In previous years, we have found that some students have struggled in this graduate level course in Genetics. This may be because the student did

Feschotte, Cedric

27

Manipulating Genetic Material in Bacteria  

NASA Technical Reports Server (NTRS)

Lisa Crawford, a graduate research assistant from the University of Toledo, works with Laurel Karr of Marshall Space Flight Center (MSFC) in the molecular biology laboratory. They are donducting genetic manipulation of bacteria and yeast for the production of large amount of desired protein. Photo credit: NASA/Marshall Space Flight Center (MSFC)

1998-01-01

28

A Novel Approach to Identify Candidate Prognostic Factors for Hepatitis C Treatment Response Integrating Clinical and Viral Genetic Data  

PubMed Central

The combined therapy of pegylated interferon (IFN) plus ribavirin (RBV) has been for a long time the standard treatment for patients infected with hepatitis C virus (HCV). In the case of genotype 1, only 38%–48% of patients have a positive response to the combined treatment. In previous studies, viral genetic information has been occasionally included as a predictor. Here, we consider viral genetic variation in addition to 11 clinical and 19 viral populations and evolutionary parameters to identify candidate baseline prognostic factors that could be involved in the treatment outcome. We obtained potential prognostic models for HCV subtypes la and lb in combination as well as separately. We also found that viral genetic information is relevant for the combined treatment assessment of patients, as the potential prognostic model of joint subtypes includes 9 viral-related variables out of 11. Our proposed methodology fully characterizes viral genetic information and finds a combination of positions that modulate inter-patient variability. PMID:25780333

Amadoz, Alicia; González-Candelas, Fernando

2015-01-01

29

Genetic diversity of bovine viral diarrhea viruses in commercial bovine serum batches of Chinese origin.  

PubMed

Bovine viral diarrhea virus (BVDV) is often detected in commercial bovine serum. BVDV genetic diversity was investigated in commercial bovine serum of Chinese origin. Twenty-two batches of bovine serum were obtained from 10 suppliers with different geographic origins in China, and 20 batches of bovine serum were positive by reverse-transcription polymerase chain reaction (RT-PCR) and sequencing. Phylogenetic reconstructions of partial 5'UTR sequences indicated that the samples examined in this work clustered within the BVDV type 1 and BVDV type 2 genotypes. Interestingly, 3 sample sequences clustered into CSFV. These results suggest a high genetic diversity in Chinese BVDV field isolates. This study will benefit epidemiological surveys of BVDV detected in China. PMID:25102030

Zhang, Shu-Qin; Tan, Bin; Guo, Li; Wang, Feng-Xue; Zhu, Hong-Wei; Wen, Yong-Jun; Cheng, Shipeng

2014-10-01

30

Detecting lateral genetic material transfer  

E-print Network

The bioinformatical methods to detect lateral gene transfer events are mainly based on functional coding DNA characteristics. In this paper, we propose the use of DNA traits not depending on protein coding requirements. We introduce several semilocal variables that depend on DNA primary sequence and that reflect thermodynamic as well as physico-chemical magnitudes that are able to tell apart the genome of different organisms. After combining these variables in a neural classificator, we obtain results whose power of resolution go as far as to detect the exchange of genomic material between bacteria that are phylogenetically close.

Calderón, C; Mireles, V; Miramontes, P

2012-01-01

31

Co-existence of genetically and antigenically diverse bovine viral diarrhoea viruses in an endemic situation.  

PubMed

Bovine viral diarrhoea virus (BVDV) is an important cattle pathogen that causes acute or persistent infections. These are associated with immunotolerance to the viral strain persisting in animals that became infected early in their intrauterine development. To this date, the epidemiology of BVD in Switzerland runs virtually undisturbed by control measures such as restrictions on animal traffic or vaccination. Here, we analysed the viral genetics of 169 Swiss isolates and carried out crossed serum neutralisation tests to assess the antigenic spectrum of BVDV strains present in the cattle population. Besides confirming the presence of BVDV type 1 subgroups b, e, h and k, a single "orphan" BVDV-1 virus was detected that does not belong to any known BVDV-1 subgroup. No BVDV type 2 viruses were detected, suggesting that they are rare or not present in the cattle population. Antigenic comparison revealed significant differences between the different subgroups, with anti-1k immune serum having up to tenfold lower neutralising activity against 1b, 1e and 1h subgroup viruses, which however may still suffice to protect 1k-immune animals against superinfection by viruses of those other subgroups. Serum from routinely vaccinated animals revealed generally low titres but good cross-neutralisation. A geographic information system revealed that the viruses of the different subgroups are distributed in an apparently randomised fashion in the cattle population. This geographic distribution pattern may reflect peculiarities of the management practice in the Swiss cattle industry that, especially through annual transhumance of up to 25% of the entire population in the alpine region, tend to optimise the spread of BVDV. PMID:18424020

Bachofen, Claudia; Stalder, Hanspeter; Braun, Ueli; Hilbe, Monika; Ehrensperger, Felix; Peterhans, Ernst

2008-09-18

32

A Natural Genetic Variant of Granzyme B Confers Lethality to a Common Viral Infection  

PubMed Central

Many immune response genes are highly polymorphic, consistent with the selective pressure imposed by pathogens over evolutionary time, and the need to balance infection control with the risk of auto-immunity. Epidemiological and genomic studies have identified many genetic variants that confer susceptibility or resistance to pathogenic micro-organisms. While extensive polymorphism has been reported for the granzyme B (GzmB) gene, its relevance to pathogen immunity is unexplored. Here, we describe the biochemical and cytotoxic functions of a common allele of GzmB (GzmBW) common in wild mouse. While retaining ‘Asp-ase’ activity, GzmBW has substrate preferences that differ considerably from GzmBP, which is common to all inbred strains. In vitro, GzmBW preferentially cleaves recombinant Bid, whereas GzmBP activates pro-caspases directly. Recombinant GzmBW and GzmBP induced equivalent apoptosis of uninfected targets cells when delivered with perforin in vitro. Nonetheless, mice homozygous for GzmBW were unable to control murine cytomegalovirus (MCMV) infection, and succumbed as a result of excessive liver damage. Although similar numbers of anti-viral CD8 T cells were generated in both mouse strains, GzmBW-expressing CD8 T cells isolated from infected mice were unable to kill MCMV-infected targets in vitro. Our results suggest that known virally-encoded inhibitors of the intrinsic (mitochondrial) apoptotic pathway account for the increased susceptibility of GzmBW mice to MCMV. We conclude that different natural variants of GzmB have a profound impact on the immune response to a common and authentic viral pathogen. PMID:25502180

Andoniou, Christopher E.; Sutton, Vivien R.; Wikstrom, Matthew E.; Fleming, Peter; Thia, Kevin Y. T.; Matthews, Antony Y.; Kaiserman, Dion; Schuster, Iona S.; Coudert, Jerome D.; Eldi, Preethi; Chaudhri, Geeta; Karupiah, Gunasegaran; Bird, Phillip I.

2014-01-01

33

Temperature, Viral Genetics, and the Transmission of West Nile Virus by Culex pipiens Mosquitoes  

E-print Network

The distribution and intensity of transmission of vector-borne pathogens can be strongly influenced by the competence of vectors. Vector competence, in turn, can be influenced by temperature and viral genetics. West Nile virus (WNV) was introduced into the United States of America in 1999 and subsequently spread throughout much of the Americas. Previously, we have shown that a novel genotype of WNV, WN02, first detected in 2001, spread across the US and was more efficient than the introduced genotype, NY99, at infecting, disseminating, and being transmitted by Culex mosquitoes. In the current study, we determined the relationship between temperature and time since feeding on the probability of transmitting each genotype of WNV. We found that the advantage of the WN02 genotype increases with the product of time and temperature. Thus, warmer temperatures would have facilitated the invasion of the WN02 genotype. In addition, we found that transmission of WNV accelerated sharply with increasing temperature, T, (best fit by a function of T 4) showing that traditional degree-day models underestimate the impact of temperature on WNV transmission. This laboratory study suggests that both viral evolution and temperature help shape the distribution and intensity of transmission of WNV, and

A. Marm Kilpatrick; Mark A. Meola; Robin M. Moudy; Laura D. Kramer

2008-01-01

34

Temperature, Viral Genetics, and the Transmission of West Nile Virus by Culex pipiens Mosquitoes  

PubMed Central

The distribution and intensity of transmission of vector-borne pathogens can be strongly influenced by the competence of vectors. Vector competence, in turn, can be influenced by temperature and viral genetics. West Nile virus (WNV) was introduced into the United States of America in 1999 and subsequently spread throughout much of the Americas. Previously, we have shown that a novel genotype of WNV, WN02, first detected in 2001, spread across the US and was more efficient than the introduced genotype, NY99, at infecting, disseminating, and being transmitted by Culex mosquitoes. In the current study, we determined the relationship between temperature and time since feeding on the probability of transmitting each genotype of WNV. We found that the advantage of the WN02 genotype increases with the product of time and temperature. Thus, warmer temperatures would have facilitated the invasion of the WN02 genotype. In addition, we found that transmission of WNV accelerated sharply with increasing temperature, T, (best fit by a function of T4) showing that traditional degree-day models underestimate the impact of temperature on WNV transmission. This laboratory study suggests that both viral evolution and temperature help shape the distribution and intensity of transmission of WNV, and provides a model for predicting the impact of temperature and global warming on WNV transmission. PMID:18584026

Kilpatrick, A. Marm; Meola, Mark A.; Moudy, Robin M.; Kramer, Laura D.

2008-01-01

35

Morphology genetic materials templated from natural species.  

PubMed

The structural characteristics of natural species have been optimized by natural selection for millions of years. They offer specific functions much more effectively than artificial approaches. Morphology genetic materials utilize morphologies gleaned from natural selection into their hierarchical structures. The combination of natural morphologies and manually selected functional materials makes these novel materials suitable for many applications. This review focuses on the strategies by which the structures and functions of natural species can be utilized. Specific functions inherited from both the natural microstructures and coupled functional materials are highlighted with regard to various applications, including photonics, light-harvesting, surface-enhanced Raman scattering (SERS), and electrodes for supercapacitors and batteries, as well as environmentally friendly materials. PMID:25331783

Gu, Jiajun; Zhang, Wang; Su, Huilan; Fan, Tongxiang; Zhu, Shenmin; Liu, Qinglei; Zhang, Di

2015-01-21

36

Pathogenesis of Primary Respiratory Disease Induced by Isolates from a New Genetic Cluster of Bovine Viral Diarrhea Virus Type I  

Microsoft Academic Search

The pathogenesis of infection induced by cytopathogenic isolates from the newly identified genetic cluster Id of bovine viral diarrhea virus (BVDV) type I was studied in two experimental infections of previously sero- negative, immunocompetent calves. Experiment 1 focused on the evaluation of clinical patterns, viremia, and serological responses. All infected calves in this experiment developed respiratory symptoms and seroconverted to

C. Baule; G. Kulcsar; K. Belak; M. Albert; C. Mittelholzer; T. Soos; L. Kucsera; S. Belak

2001-01-01

37

Production methods for viral particles.  

PubMed

Viral particles and virus-like particles (VLPs) or capsids are becoming important vehicles and templates in bio-imaging, drug delivery and materials sciences. Viral particles are prepared by infecting the host organism but VLPs are obtained from cells that express a capsid protein. Some VLPs are disassembled and then re-assembled to incorporate a material of interest. Cell-free systems, which are amenable to manipulating the viral assembly process, are also available for producing viral particles. Regardless of the production system employed, the particles are functionalized by genetic and/or chemical engineering. Here, we review various methods for producing and functionalizing viral particles and VLPs, and we discuss the merits of each system. PMID:25488519

Machida, Kodai; Imataka, Hiroaki

2015-04-01

38

Material proximities and hotspots: toward an anthropology of viral hemorrhagic fevers.  

PubMed

This article outlines a research program for an anthropology of viral hemorrhagic fevers (collectively known as VHFs). It begins by reviewing the social science literature on Ebola, Marburg, and Lassa fevers and charting areas for future ethnographic attention. We theoretically elaborate the hotspot as a way of integrating analysis of the two routes of VHF infection: from animal reservoirs to humans and between humans. Drawing together recent anthropological investigations of human-animal entanglements with an ethnographic interest in the social production of space, we seek to enrich conceptualizations of viral movement by elaborating the circumstances through which viruses, humans, objects, and animals come into contact. We suggest that attention to the material proximities-between animals, humans, and objects-that constitute the hotspot opens a frontier site for critical and methodological development in medical anthropology and for future collaborations in VHF management and control. PMID:24752909

Brown, Hannah; Kelly, Ann H

2014-06-01

39

Material Proximities and Hotspots: Toward an Anthropology of Viral Hemorrhagic Fevers  

PubMed Central

This article outlines a research program for an anthropology of viral hemorrhagic fevers (collectively known as VHFs). It begins by reviewing the social science literature on Ebola, Marburg, and Lassa fevers and charting areas for future ethnographic attention. We theoretically elaborate the hotspot as a way of integrating analysis of the two routes of VHF infection: from animal reservoirs to humans and between humans. Drawing together recent anthropological investigations of human–animal entanglements with an ethnographic interest in the social production of space, we seek to enrich conceptualizations of viral movement by elaborating the circumstances through which viruses, humans, objects, and animals come into contact. We suggest that attention to the material proximities—between animals, humans, and objects—that constitute the hotspot opens a frontier site for critical and methodological development in medical anthropology and for future collaborations in VHF management and control. PMID:24752909

Brown, Hannah; Kelly, Ann H

2014-01-01

40

Genetic Imprint of Vaccination on Simian/Human Immunodeficiency Virus Type 1 Transmitted Viral Genomes in Rhesus Macaques  

PubMed Central

Understanding the genetic, antigenic and structural changes that occur during HIV-1 infection in response to pre-existing immunity will facilitate current efforts to develop an HIV-1 vaccine. Much is known about HIV-1 variation at the population level but little with regard to specific changes occurring in the envelope glycoprotein within a host in response to immune pressure elicited by antibodies. The aim of this study was to track and map specific early genetic changes occurring in the viral envelope gene following vaccination using a highly controlled viral challenge setting in the SHIV macaque model. We generated 449 full-length env sequences from vaccinees, and 63 from the virus inoculum. Analysis revealed a different pattern in the distribution and frequency of mutations in the regions of the envelope gene targeted by the vaccine as well as different patterns of diversification between animals in the naïve control group and vaccinees. Given the high stringency of the model it is remarkable that we were able to identify genetic changes associated with the vaccination. This work provides insight into the characterization of breakthrough viral populations in less than fully efficacious vaccines and illustrates the value of HIV-1 Env SHIV challenge model in macaques to unravel the mechanisms driving HIV-1 envelope genetic diversity in the presence of vaccine induced-responses. PMID:23967111

Varela, Mariana; Verschoor, Ernst; Lai, Rachel P. J.; Hughes, Joseph; Mooj, Petra; McKinley, Trevelyan J.; Fitzmaurice, Timothy J.; Landskron, Lisa; Willett, Brian J.; Frost, Simon D. W.; Bogers, Willy M.; Heeney, Jonathan L.

2013-01-01

41

Genetic and antigenic characterization of bovine viral diarrhoea virus type 2 isolated from cattle in India.  

PubMed

Previous studies have shown that bovine viral diarrhoea virus type 1 (BVDV-1) subtype b is predominantly circulating in Indian cattle. During testing for exotic pestiviruses between 2007 and 2010, BVDV-2 was identified by real time RT-PCR in two of 1446 cattle blood samples originating from thirteen states of India. The genetic analysis of the isolated virus in 5' UTR, N(pro), entire structural genes (C, E(rns), E1 and E2), nonstructural genes NS2-3 besides 3' UTR demonstrated that the nucleotide and amino acid sequences showed highest similarity with BVDV-2. The entire 5' and 3' UTR consisted of 387 and 204 nucleotides, respectively, and an eight nucleotide repeat motif was found twice within the variable part of 3' UTR that may be considered as a characteristic of BVDV-2. The phylogenetic analysis revealed that the cattle isolate and earlier reported goat BVDV-2 isolate fall into separate clades within BVDV-2a subtype. Antigenic typing with monoclonal antibodies verified the cattle isolate also as BVDV-2. In addition, cross-neutralization tests using antisera raised against Indian BVDV strains circulating in ruminants (cattle, sheep, goat and yak) displayed significant antigenic differences only between BVDV-1 and BVDV-2 strains. This is the first identification of BVDV-2 in Indian cattle that may have important implications for immunization strategies and molecular epidemiology of BVD. PMID:21112633

Behera, Sthita Pragnya; Mishra, Niranjan; Vilcek, Stefan; Rajukumar, Katherukamem; Nema, Ram Kumar; Prakash, Anil; Kalaiyarasu, S; Dubey, Shiv Chandra

2011-03-01

42

A Genetic Approach to Promoter Recognition during Trans Induction of Viral Gene Expression  

NASA Astrophysics Data System (ADS)

Viral infection of mammalian cells entails the regulated induction of viral gene expression. The induction of many viral genes, including the herpes simplex virus gene encoding thymidine kinase (tk), depends on viral regulatory proteins that act in trans. Because recognition of the tk promoter by cellular transcription factors is well understood, its trans induction by viral regulatory proteins may serve as a useful model for the regulation of eukaryotic gene expression. A comprehensive set of mutations was therefore introduced into the chromosome of herpes simplex virus at the tk promoter to directly analyze the effects of promoter mutations on tk transcription. The promoter domains required for efficient tk expression under conditions of trans induction corresponded to those important for recognition by cellular transcription factors. Thus, trans induction of tk expression may be catalyzed initially by the interaction of viral regulatory proteins with cellular transcription factors.

Coen, Donald M.; Weinheimer, Steven P.; McKnight, Steven L.

1986-10-01

43

Ring finger protein 39 genetic variants associate with HIV-1 plasma viral loads and its replication in cell culture  

PubMed Central

Background The human immunodeficiency virus (HIV-1) exploits host proteins to complete its life cycle. Genome-wide siRNA approaches suggested that host proteins affect HIV-1 replication. However, the results barely overlapped. RING finger protein 39 (RNF39) has been identified from genome-wide association studies. However, its function during HIV-1 replication remains unclear. Methods and results We investigated the relationship between common RNF39 genetic variants and HIV-1 viral loads. The effect of RNF39 protein knockdown or overexpression on HIV-1 replication was then investigated in different cell lines. Two genetic variants were associated with HIV-1 viral loads. Patients with the ht1-GG/GG haplotype presented lower RNF39 expression levels and lower HIV-1 viral load. RNF39 knockdown inhibited HIV-1 expression. Conclusions RNF39 protein may be involved in HIV-1 replication as observed in genetic studies on patients with HIV-1 and in in vitro cell cultures. PMID:25126410

2014-01-01

44

[Synthetic biology and rearrangements of microbial genetic material].  

PubMed

As an emerging discipline, synthetic biology has shown great scientific values and application prospects. Although there have been many reviews of various aspects on synthetic biology over the last years, this article, for the first time, attempted to discuss the relationship and difference between microbial genetics and synthetic biology. We summarized the recent development of synthetic biology in rearranging microbial genetic materials, including synthesis, design and reduction of genetic materials, standardization of genetic parts and modularization of genetic circuits. The relationship between synthetic biology and microbial genetic engineering was also discussed in the paper. PMID:21993285

Liang, Quan-Feng; Wang, Qian; Qi, Qing-Sheng

2011-10-01

45

Co-existence of genetically and antigenically diverse bovine viral diarrhoea viruses in an endemic situation  

Microsoft Academic Search

Bovine viral diarrhoea virus (BVDV) is an important cattle pathogen that causes acute or persistent infections. These are associated with immunotolerance to the viral strain persisting in animals that became infected early in their intrauterine development. To this date, the epidemiology of BVD in Switzerland runs virtually undisturbed by control measures such as restrictions on animal traffic or vaccination. Here,

Claudia Bachofen; Hanspeter Stalder; Ueli Braun; Monika Hilbe; Felix Ehrensperger; Ernst Peterhans

2008-01-01

46

Clinical appearance and pathology of cattle persistently infected with bovine viral diarrhoea virus of different genetic subgroups.  

PubMed

Bovine viral diarrhoea (BVD) is an economically important cattle disease with a world-wide distribution that is caused by BVD virus, a pestivirus of the flaviviridae family. BVD viruses are genetically highly variable. They are classified into two genetic species (BVDV-1 and -2) that are further divided into numerous subgroups, particularly for BVDV-1. The complexity of these viruses is also reflected in their interaction with the host animals. Infections are either transient or persistent and can cause a wide spectrum of clinical signs, from no or very mild disease to severe forms, reminiscent of viral haemorrhagic fevers. In this work, we have analysed the clinical signs and the pathology of BVD viral infections in a cattle population where different subgroups of BVDV-1 genotype viruses are endemic. In addition, we have examined potential virulence properties of BVDV-1 subgroups during persistent infection by comparing the viral subgroups present in clinical cases with those detected in persistently infected (PI) animals sampled for epidemiological criteria, irrespective of their health condition. Furthermore, the clinical and postmortem findings were compared with respect to genetic characteristics of the viruses isolated from these animals. Our results indicate that the BVDV positive animals fall roughly into two categories, depending on the primary organ affected and the age, with lung-centred pathology occurring mainly in young animals and mucosal pathology predominantly in older animals. Furthermore, we found a markedly higher proportion of representatives of the BVDV-1e subgroup in stillborn calves and aborted foetuses originating from epidemically unrelated cattle herds, suggesting that BVDV-1e may play a special role in prenatal and perinatal losses. PMID:19819088

Bachofen, Claudia; Braun, Ueli; Hilbe, Monika; Ehrensperger, Felix; Stalder, Hanspeter; Peterhans, Ernst

2010-03-24

47

A Drosophila model for genetic analysis of influenza viral/host interactions.  

PubMed

Influenza viruses impose a constant threat to vertebrates susceptible to this family of viruses. We have developed a new tool to study virus-host interactions that play key roles in viral replication and to help identify novel anti-influenza drug targets. Via the UAS/Gal4 system we ectopically expressed the influenza virus M2 gene in Drosophila melanogaster and generated dose-sensitive phenotypes in the eye and wing. We have confirmed that the M2 proton channel is properly targeted to cell membranes in Drosophila tissues and functions as a proton channel by altering intracellular pH. As part of the efficacy for potential anti-influenza drug screens, we have also demonstrated that the anti-influenza drug amantadine, which targets the M2 proton channel, suppressed the UAS-M2 mutant phenotype when fed to larvae. In a candidate gene screen we identified mutations in components of the vacuolar V1V0 ATPase that modify the UAS-M2 phenotype. Importantly, in this study we demonstrate that Drosophila genetic interactions translate directly to physiological requirements of the influenza A virus for these components in mammalian cells. Overexpressing specific V1 subunits altered the replication capacity of influenza virus in cell culture and suggests that drugs targeting the enzyme complex via these subunits may be useful in anti-influenza drug therapies. Moreover, this study adds credence to the idea of using the M2 "flu fly" to identify new and previously unconsidered cellular genes as potential drug targets and to provide insight into basic mechanisms of influenza virus biology. PMID:21775472

Adamson, Amy L; Chohan, Kultaran; Swenson, Jennifer; LaJeunesse, Dennis

2011-10-01

48

A quantitative high-resolution genetic profile rapidly identifies sequence determinants of hepatitis C viral fitness and drug sensitivity.  

PubMed

Widely used chemical genetic screens have greatly facilitated the identification of many antiviral agents. However, the regions of interaction and inhibitory mechanisms of many therapeutic candidates have yet to be elucidated. Previous chemical screens identified Daclatasvir (BMS-790052) as a potent nonstructural protein 5A (NS5A) inhibitor for Hepatitis C virus (HCV) infection with an unclear inhibitory mechanism. Here we have developed a quantitative high-resolution genetic (qHRG) approach to systematically map the drug-protein interactions between Daclatasvir and NS5A and profile genetic barriers to Daclatasvir resistance. We implemented saturation mutagenesis in combination with next-generation sequencing technology to systematically quantify the effect of every possible amino acid substitution in the drug-targeted region (domain IA of NS5A) on replication fitness and sensitivity to Daclatasvir. This enabled determination of the residues governing drug-protein interactions. The relative fitness and drug sensitivity profiles also provide a comprehensive reference of the genetic barriers for all possible single amino acid changes during viral evolution, which we utilized to predict clinical outcomes using mathematical models. We envision that this high-resolution profiling methodology will be useful for next-generation drug development to select drugs with higher fitness costs to resistance, and also for informing the rational use of drugs based on viral variant spectra from patients. PMID:24722365

Qi, Hangfei; Olson, C Anders; Wu, Nicholas C; Ke, Ruian; Loverdo, Claude; Chu, Virginia; Truong, Shawna; Remenyi, Roland; Chen, Zugen; Du, Yushen; Su, Sheng-Yao; Al-Mawsawi, Laith Q; Wu, Ting-Ting; Chen, Shu-Hua; Lin, Chung-Yen; Zhong, Weidong; Lloyd-Smith, James O; Sun, Ren

2014-04-01

49

Genetic correlates of in vivo viral resistance to indinavir, a human immunodeficiency virus type 1 protease inhibitor.  

PubMed Central

Indinavir (IDV) (also called CRIXIVAN, MK-639, or L-735,524) is a potent and selective inhibitor of the human immunodeficiency virus type 1 (HIV-1) protease. During early clinical trials, in which patients initiated therapy with suboptimal dosages of IDV, we monitored the emergence of viral resistance to the inhibitor by genotypic and phenotypic characterization of primary HIV-1 isolates. Development of resistance coincided with variable patterns of multiple substitutions among at least 11 protease amino acid residues. No single substitution was present in all resistant isolates, indicating that resistance evolves through multiple genetic pathways. Despite this complexity, all of 29 resistant isolates tested exhibited alteration of residues M-46 (to I or L) and/or V-82 (to A, F, or T), suggesting that screening of these residues may be useful in predicting the emergence of resistance. We also extended our previous finding that IDV-resistant viral variants exhibit various patterns of cross-resistance to a diverse panel of HIV-1 protease inhibitors. Finally, we noted an association between the number of protease amino acid substitutions and the observed level of IDV resistance. No single substitution or pair of substitutions tested gave rise to measurable viral resistance to IDV. The evolution of this resistance was found to be cumulative, indicating the need for ongoing viral replication in this process. These observations strongly suggest that therapy should be initiated with the most efficacious regimen available, both to suppress viral spread and to inhibit the replication that is required for the evolution of resistance. PMID:8970946

Condra, J H; Holder, D J; Schleif, W A; Blahy, O M; Danovich, R M; Gabryelski, L J; Graham, D J; Laird, D; Quintero, J C; Rhodes, A; Robbins, H L; Roth, E; Shivaprakash, M; Yang, T; Chodakewitz, J A; Deutsch, P J; Leavitt, R Y; Massari, F E; Mellors, J W; Squires, K E; Steigbigel, R T; Teppler, H; Emini, E A

1996-01-01

50

Genome-Wide Identification of Susceptibility Alleles for Viral Infections through a Population Genetics Approach  

PubMed Central

Viruses have exerted a constant and potent selective pressure on human genes throughout evolution. We utilized the marks left by selection on allele frequency to identify viral infection-associated allelic variants. Virus diversity (the number of different viruses in a geographic region) was used to measure virus-driven selective pressure. Results showed an excess of variants correlated with virus diversity in genes involved in immune response and in the biosynthesis of glycan structures functioning as viral receptors; a significantly higher than expected number of variants was also seen in genes encoding proteins that directly interact with viral components. Genome-wide analyses identified 441 variants significantly associated with virus-diversity; these are more frequently located within gene regions than expected, and they map to 139 human genes. Analysis of functional relationships among genes subjected to virus-driven selective pressure identified a complex network enriched in viral products-interacting proteins. The novel approach to the study of infectious disease epidemiology presented herein may represent an alternative to classic genome-wide association studies and provides a large set of candidate susceptibility variants for viral infections. PMID:20174570

Fumagalli, Matteo; Pozzoli, Uberto; Cagliani, Rachele; Comi, Giacomo P.; Bresolin, Nereo

2010-01-01

51

Genetic diversity and frequency of bovine viral diarrhea virus (BVDV) detected in cattle in Turkey  

Technology Transfer Automated Retrieval System (TEKTRAN)

Rapid detection and culling of persistently infected animals and efficacious vaccination are key factors to control bovine viral diarrhea virus (BVDV) infections in cattle. The aim of this study was to investigate frequency of detection of persistently infected cattle and examine the diversity of bo...

52

Genetics Curriculum Materials for the 21st Century  

ERIC Educational Resources Information Center

The purpose of this project was to provide innovative and cutting edge genetics materials for 14-17 year olds (Year 10-12) in Australian schools, which aimed to engage students and encourage evidence based decision-making. In 2008, an Australian School Innovation in Science, Technology and Mathematics (ASISTM) project called "Genetics Education in…

Dawson, Vaille; Carson, Katherine; Venville, Grady

2010-01-01

53

Phylogenetic analysis of bovine viral diarrhea viruses using five different genetic regions  

Microsoft Academic Search

Phylogenetic analysis of the five different regions (5? non-coding region (5?NCR), Npro, E2, NS3 and NS5B–3?NCR) of 48 Japanese and reported bovine viral diarrhea virus (BVDV) genomes was performed. Japanese BVDVs were segregated into BVDV1 subdivided into six subgroups and BVDV2. One isolate, So CP\\/75, isolated in 1975 and previously proposed as subgroup 1e according to its 5?NCR sequence, was

Makoto Nagai; Michiko Hayashi; Shigeo Sugita; Yoshihiro Sakoda; Masashi Mori; Toshiaki Murakami; Tadashi Ozawa; Naoki Yamada; Hiroomi Akashi

2004-01-01

54

Polymorphic genetic characterization of E2 gene of bovine viral diarrhea virus in China.  

PubMed

Bovine viral diarrhea virus (BVDV) is one of the wide distributed pathogenic viruses of livestock and wild animals worldwide. E2 glycoprotein is a major structural component of the BVDV virion and plays a key role in viral attachment to host cells and inducing immune responses against viral infection. In order to gain detailed information of the E2 coding region of BVDV circulating in China, 46 positive samples were tested by RT-PCR for the E2 coding region. The 1122 nt nucleotide sequences of full-length E2 were harvested and analyzed. The results suggested that full-length E2 was an ideal target for BVDV genotyping and divided the domestic BVDV isolates into 9 subgenotypes, namely BVDV-1a, -1b1, -1c, -1d, -1o, -1m, -1p, -1q and BVDV-2a, showing great diversity. The difference of nonsynonymous and synonymous substitution rates (dN-dS) inferred both positive and purifying selection of the E2. However, combination of positive and purifying selection at different points indicated purifying selection within the complete E2. Protein properties analysis based on glycosylation sites and epitope prediction demonstrated that the biological character of E2 among individual BVDV subgenotype was similar, but may alter due to amino acid changes. For the first time, the comprehensive collection of E2 sequences of Chinese BVDV isolates was elucidated, which would provide information for future vaccine design and BVD control in China. PMID:25465669

Lang, Yifei; Gao, Shandian; Du, Junzheng; Shao, Junjun; Cong, Guozheng; Lin, Tong; Zhao, Furong; Liu, Lihong; Chang, Huiyun

2014-12-01

55

Unit: Genetics, Inspection Set, First Trial Materials.  

ERIC Educational Resources Information Center

Most of the activities suggested in this trial version of the Genetics unit produced by the Australian Science Education Project rely on second-hand data, although one of the introductory activities suggested is based on results of a mouse breeding experiment. The unit is, therefore, expected to be suitable only for students who are capable of…

Australian Science Education Project, Toorak, Victoria.

56

Genetic modification of cancer cells using non-viral, episomal S/MAR vectors for in vivo tumour modelling.  

PubMed

The development of genetically marked animal tumour xenografts is an area of ongoing research to enable easier and more reliable testing of cancer therapies. Genetically marked tumour models have a number of advantages over conventional tumour models, including the easy longitudinal monitoring of therapies and the reduced number of animals needed for trials. Several different methods have been used in previous studies to mark tumours genetically, however all have limitations, such as genotoxicity and other artifacts related to the usage of integrating viral vectors. Recently, we have generated an episomally maintained plasmid DNA (pDNA) expression system based on Scaffold/Matrix Attachment Region (S/MAR), which permits long-term luciferase transgene expression in the mouse liver. Here we describe a further usage of this pDNA vector with the human Ubiquitin C promoter to create stably transfected human hepatoma (Huh7) and human Pancreatic Carcinoma (MIA-PaCa2) cell lines, which were delivered into "immune deficient" mice and monitored longitudinally over time using a bioluminometer. Both cell lines revealed sustained episomal long-term luciferase expression and formation of a tumour showing the pathological characteristics of hepatocellular carcinoma (HCC) and pancreatic carcinoma (PaCa), respectively. This is the first demonstration that a pDNA vector can confer sustained episomal luciferase transgene expression in various mouse tumour models and can thus be readily utilised to follow tumour formation without interfering with the cellular genome. PMID:23110132

Argyros, Orestis; Wong, Suet Ping; Gowers, Kate; Harbottle, Richard Paul

2012-01-01

57

Putting Synthesis into Biology – A Viral View of Genetic Engineering Through de novo Gene and Genome synthesis  

PubMed Central

The rapid improvements in DNA synthesis technology hold the potential to revolutionize biosciences in the near future. Traditional genetic engineering methods are template dependent and make extensive but laborious use of site-directed mutagenesis to explore the impact of small variations on an existing sequence “theme”. De novo gene and genome synthesis frees the investigator from the restrictions of the pre-existing template and allows for the rational design of any conceivable new sequence theme. Viruses, being amongst the simplest replicating entities, have been at the forefront of the advancing biosciences since the dawn of molecular biology. Viral genomes, especially those of RNA viruses, are relatively short, often less than 10,000 bases long, making them amenable to whole genome synthesis with the currently available technology. For this reason viruses are once again poised to lead the way in the budding field of synthetic biology – for better or worse. PMID:19318214

Mueller, Steffen; Coleman, J. Robert; Wimmer, Eckard

2009-01-01

58

Analysis of viral (zucchini yellow mosaic virus) genetic diversity during systemic movement through a Cucurbita pepo vine.  

PubMed

Determining the extent and structure of intra-host genetic diversity and the magnitude and impact of population bottlenecks is central to understanding the mechanisms of viral evolution. To determine the nature of viral evolution following systemic movement through a plant, we performed deep sequencing of 23 leaves that grew sequentially along a single Cucurbita pepo vine that was infected with zucchini yellow mosaic virus (ZYMV), and on a leaf that grew in on a side branch. Strikingly, of 112 genetic (i.e. sub-consensus) variants observed in the data set as a whole, only 22 were found in multiple leaves. Similarly, only three of the 13 variants present in the inoculating population were found in the subsequent leaves on the vine. Hence, it appears that systemic movement is characterized by sequential population bottlenecks, although not sufficient to reduce the population to a single virion as multiple variants were consistently transmitted between leaves. In addition, the number of variants within a leaf increases as a function of distance from the inoculated (source) leaf, suggesting that the circulating sap may serve as a continual source of virus. Notably, multiple mutational variants were observed in the cylindrical inclusion (CI) protein (known to be involved in both cell-to-cell and systemic movement of the virus) that were present in multiple (19/24) leaf samples. These mutations resulted in a conformational change, suggesting that they might confer a selective advantage in systemic movement within the vine. Overall, these data reveal that bottlenecks occur during systemic movement, that variants circulate in the phloem sap throughout the infection process, and that important conformational changes in CI protein may arise during individual infections. PMID:25107623

Dunham, J P; Simmons, H E; Holmes, E C; Stephenson, A G

2014-10-13

59

Viral Replication, Persistence in Water and Genetic Characterization of Two Influenza A Viruses Isolated from Surface Lake Water  

PubMed Central

Water-borne transmission has been suggested as an important transmission mechanism for Influenza A (IA) viruses in wild duck populations; however, relatively few studies have attempted to detect IA viruses from aquatic habitats. Water-isolated viruses have rarely been genetically characterized and evaluation for persistence in water and infectivity in natural hosts has never been documented. In this study, we focused on two IA viruses (H3N8 and H4N6 subtypes) isolated from surface lake water in Minnesota, USA. We investigated the relative prevalence of the two virus subtypes in wild duck populations at the sampling site and their genetic relatedness to IA viruses isolated in wild waterbirds in North America. Viral persistence under different laboratory conditions (temperature and pH) and replication in experimentally infected Mallards (Anas platyrhynchos) were also characterized. Both viruses were the most prevalent subtype one year following their isolation in lake water. The viruses persisted in water for an extended time period at constant temperature (several weeks) but infectivity rapidly reduced under multiple freeze-thaw cycles. Furthermore, the two isolates efficiently replicated in Mallards. The complete genome characterization supported that these isolates originated from genetic reassortments with other IA viruses circulating in wild duck populations during the year of sampling. Based on phylogenetic analyses, we couldn't identify genetically similar viruses in duck populations in the years following their isolation from lake water. Our study supports the role for water-borne transmission for IA viruses but also highlights that additional field and experimental studies are required to support inter-annual persistence in aquatic habitats. PMID:22028909

Lebarbenchon, Camille; Yang, My; Keeler, Shamus P.; Ramakrishnan, Muthannan A.; Brown, Justin D.; Stallknecht, David E.; Sreevatsan, Srinand

2011-01-01

60

Isolation and Genetic Analysis of Bovine Viral Diarrhea Virus from Infected Cattle in Indiana  

PubMed Central

Species and biotype distribution was determined in 44 bovine viral diarrhea virus- (BVDV-) positive samples submitted to the Animal Disease Diagnostic Laboratory (ADDL) in Indiana during 2006–2008. BVDV RNA was detected in the 5?-untranslated region and Npro region using reverse transcriptase PCR followed by sequencing analysis of the PCR product. Additionally, cases were classified into one of six categories according to history and/or lesions: acute symptomatic, hemorrhagic, respiratory distress, reproductive, persistent infection (PI), and mucosal disease (MD). Of 44 BVDV-positive samples, 33 were noncytopathic (ncp), 10 were cytopathic (cp), and one presented both ncp and cp biotypes. Sequencing analysis demonstrated that all samples belonged to BVDV-1a, BVDV-1b, or BVDV-2. The most common isolate was ncp BVDV-1b, (44%) followed by ncp BVDV-2a (24%). Among the six categories, respiratory clinical signs were the most common (36%) followed by PI (25%) and MD (16%). PMID:21647344

Pogranichniy, Roman M.; Schnur, Megan E.; Raizman, Eran A.; Murphy, Duane A.; Negron, Maria; Thacker, H. Leon

2011-01-01

61

Non-viral gene transfection technologies for genetic engineering of stem cells  

Microsoft Academic Search

The recent rapid progress of molecular biology together with the steady progress of genome projects has given us some essential and revolutionary information about DNA and RNA to elucidate various biological phenomena at a genetic level. Under these circumstances, the technology and methodology of gene transfection have become more and more important to enhance the efficacy of gene therapy for

Jun-ichiro Jo; Yasuhiko Tabata

2008-01-01

62

Targeting of Adenovirus via Genetic Modification of the Viral Capsid Combined with a Protein Bridge  

Microsoft Academic Search

A potential barrier to the development of genetically targeted adenovirus (Ad) vectors for cell-specific delivery of gene therapeutics lies in the fact that several types of targeting protein ligands require posttrans- lational modifications, such as the formation of disulfide bonds, which are not available to Ad capsid proteins due to their nuclear localization during assembly of the virion. To overcome

Nikolay Korokhov; Galina Mikheeva; Alexander Krendelshchikov; Natalya Belousova; Vera Simonenko; Valentina Krendelshchikova; Alexander Pereboev; Alexander Kotov; Olga Kotova; Pierre L. Triozzi; Wayne A. Aldrich; Joanne T. Douglas; Kin-Ming Lo; Papia T. Banerjee; Stephen D. Gillies; David T. Curiel; Victor Krasnykh

2003-01-01

63

Persistence of Transmitted HIV-1 Drug Resistance Mutations Associated with Fitness Costs and Viral Genetic Backgrounds  

PubMed Central

Transmission of drug-resistant pathogens presents an almost-universal challenge for fighting infectious diseases. Transmitted drug resistance mutations (TDRM) can persist in the absence of drugs for considerable time. It is generally believed that differential TDRM-persistence is caused, at least partially, by variations in TDRM-fitness-costs. However, in vivo epidemiological evidence for the impact of fitness costs on TDRM-persistence is rare. Here, we studied the persistence of TDRM in HIV-1 using longitudinally-sampled nucleotide sequences from the Swiss-HIV-Cohort-Study (SHCS). All treatment-naïve individuals with TDRM at baseline were included. Persistence of TDRM was quantified via reversion rates (RR) determined with interval-censored survival models. Fitness costs of TDRM were estimated in the genetic background in which they occurred using a previously published and validated machine-learning algorithm (based on in vitro replicative capacities) and were included in the survival models as explanatory variables. In 857 sequential samples from 168 treatment-naïve patients, 17 TDRM were analyzed. RR varied substantially and ranged from 174.0/100-person-years;CI=[51.4, 588.8] (for 184V) to 2.7/100-person-years;[0.7, 10.9] (for 215D). RR increased significantly with fitness cost (increase by 1.6[1.3,2.0] per standard deviation of fitness costs). When subdividing fitness costs into the average fitness cost of a given mutation and the deviation from the average fitness cost of a mutation in a given genetic background, we found that both components were significantly associated with reversion-rates. Our results show that the substantial variations of TDRM persistence in the absence of drugs are associated with fitness-cost differences both among mutations and among different genetic backgrounds for the same mutation. PMID:25798934

Böni, Jürg; Yerly, Sabine; Klimkait, Thomas; Aubert, Vincent; Scherrer, Alexandra U.; Shilaih, Mohaned; Hinkley, Trevor; Petropoulos, Christos; Bonhoeffer, Sebastian

2015-01-01

64

Genetic analysis of vibriosis and viral nervous necrosis resistance in Atlantic cod (Gadus morhua L.) using a cure model.  

PubMed

The aim of this study was to investigate whether observed time-until-death of Atlantic cod (Gadus morhua L.) juveniles in separate challenge tests with Vibrio anguillarum (causes vibriosis) and nodavirus [causes viral nervous necrosis (VNN)] are due to differences in susceptibility (whether at risk or not) or increased endurance (individual hazard, given that the animal is susceptible) using a cure mixture (CURE) model with Gibbs sampling. Observed time-until-death, prepared as sequential binary records, were analyzed with the CURE model and results were compared with cross-sectional threshold (SIMPLE) and an ordinary longitudinal survival score (NAÏVE) model (i.e., assuming that all animals are susceptible). Overall mortality at the end of the test was 86 and 71% for vibriosis and VNN, respectively. But the CURE model estimated 92 and 82% of the population to be susceptible to vibriosis and VNN, respectively. Hence, a substantial fraction among the survivors were considered to be susceptible but with high endurance. The underlying heritability of susceptibility was moderate for vibriosis (0.33) and extremely high for VNN (0.91), somewhat greater compared with classical SIMPLE model (0.19 and 0.76 for vibriosis and VNN, respectively), analyzing end survival as a cross-sectional binary trait. Estimates of the underlying heritability were low for single test-day scores of both endurance (0.02 and 0.15 for vibriosis and VNN, respectively) in the CURE model and for the NAÏVE model (0.02 and 0.18 for vibriosis and VNN, respectively). Based on the CURE model, the genetic correlation between susceptibility and endurance was low to moderately positive and significantly different from unity (P < 0.01) for both vibriosis (0.13) and VNN (0.47). Estimated breeding values from the SIMPLE and NAÏVE models showed moderate to high correlations (0.41 to 0.96) with EBV for susceptibility and endurance in the CURE model. The analyses indicate that susceptibility and endurance are apparently distinct genetic traits. Still, the genetic variation estimated in the SIMPLE and NAÏVE models seems to a large extent to be controlled by susceptibility and an efficient genetic selection for reduced susceptibility to vibriosis and VNN is therefore likely feasible even when using classical (noncure) models. Earlier termination of the challenge test or back truncation of survival data is not recommended as this likely shifts the focus of selection towards endurance rather than susceptibility. PMID:23736060

Bangera, R; Ødegård, J; Nielsen, H M; Gjøen, H M; Mortensen, A

2013-08-01

65

Label-Free Electrochemical Diagnosis of Viral Antigens with Genetically Engineered Fusion Protein  

PubMed Central

We have developed a simple electrochemical biosensing strategy for the label-free diagnosis of hepatitis B virus (HBV) on a gold electrode surface. Gold-binding polypeptide (GBP) fused with single-chain antibody (ScFv) against HBV surface antigen (HBsAg), in forms of genetically engineered protein, was utilized. This GBP-ScFv fusion protein can directly bind onto the gold substrate with the strong binding affinity between the GBP and the gold surface, while the recognition site orients toward the sample for target binding at the same time. Furthermore, this one-step immobilization strategy greatly simplifies a fabrication process without any chemical modification as well as maintaining activity of biological recognition elements. This system allows specific immobilization of proteins and sensitive detection of targets, which were verified by surface plasmon resonance analysis and successfully applied to electrochemical cyclic voltammetry and impedance spectroscopy upto 0.14 ng/mL HBsAg. PMID:23112590

Heo, Nam Su; Zheng, Shun; Yang, MinHo; Lee, Seok Jae; Lee, Sang Yup; Kim, Hwa-Jung; Park, Jung Youn; Lee, Chang-Soo; Park, Tae Jung

2012-01-01

66

Deep sequencing identifies two genotypes and high viral genetic diversity of human pegivirus (GB virus C) in rural Ugandan patients  

PubMed Central

Human pegivirus (HPgV), formerly ‘GB virus C’ or ‘hepatitis G virus’, is a member of the genus Flavivirus (Flaviviridae) that has garnered significant attention due to its inhibition of HIV, including slowing disease progression and prolonging survival in HIV-infected patients. Currently, there are six proposed HPgV genotypes that have roughly distinct geographical distributions. Genotypes 2 and 3 are the most comprehensively characterized, whereas those genotypes occurring on the African continent, where HPgV prevalence is highest, are less well studied. Using deep sequencing methods, we identified complete coding HPgV sequences in four of 28 patients (14.3?%) in rural Uganda, east Africa. One of these sequences corresponds to genotype 1 and is the first complete genome of this genotype from east Africa. The remaining three sequences correspond to genotype 5, a genotype that was previously considered exclusively South African. All four positive samples were collected within a geographical area of less than 25 km2, showing that multiple HPgV genotypes co-circulate in this area. Analysis of intra-host viral genetic diversity revealed that total single-nucleotide polymorphism frequency was approximately tenfold lower in HPgV than in hepatitis C virus. Finally, one patient was co-infected with HPgV and HIV, which, in combination with the high prevalence of HIV, suggests that this region would be a useful locale to study the interactions and co-evolution of these viruses. PMID:24077364

Ghai, Ria R.; Sibley, Samuel D.; Lauck, Michael; Dinis, Jorge M.; Bailey, Adam L.; Chapman, Colin A.; Omeja, Patrick; Friedrich, Thomas C.; O’Connor, David H.

2013-01-01

67

Haploid Genetic Screens Identify an Essential Role for PLP2 in the Downregulation of Novel Plasma Membrane Targets by Viral E3 Ubiquitin Ligases  

PubMed Central

The Kaposi's sarcoma-associated herpesvirus gene products K3 and K5 are viral ubiquitin E3 ligases which downregulate MHC-I and additional cell surface immunoreceptors. To identify novel cellular genes required for K5 function we performed a forward genetic screen in near-haploid human KBM7 cells. The screen identified proteolipid protein 2 (PLP2), a MARVEL domain protein of unknown function, as essential for K5 activity. Genetic loss of PLP2 traps the viral ligase in the endoplasmic reticulum, where it is unable to ubiquitinate and degrade its substrates. Subsequent analysis of the plasma membrane proteome of K5-expressing KBM7 cells in the presence and absence of PLP2 revealed a wide range of novel K5 targets, all of which required PLP2 for their K5-mediated downregulation. This work ascribes a critical function to PLP2 for viral ligase activity and underlines the power of non-lethal haploid genetic screens in human cells to identify the genes involved in pathogen manipulation of the host immune system. PMID:24278019

Timms, Richard T.; Duncan, Lidia M.; Tchasovnikarova, Iva A.; Antrobus, Robin; Smith, Duncan L.; Dougan, Gordon; Weekes, Michael P.; Lehner, Paul J.

2013-01-01

68

Hazards of Transgenic Plants Containing the Cauliflower Mosaic Viral Promoter Hazards of CaMV Promoter Horizontal Gene Transfer- The Hidden Hazards of Genetic Engineering  

E-print Network

Transgenic pollen and baby bees Horizontal gene transfer may spread transgenes to the entire biosphere Genetic engineering is unregulated horizontal gene transfer Artificial vectors enhance horizontal gene transfer What are the hazards of horizontal gene transfer? Potential hazards of horizontal gene transfer from genetic engineering Transgenic DNA may be more likely to transfer horizontally than non-transgenic DNA Reasons to suspect that transgenic DNA may be more likely to spread horizontally than non-transgenic DNA Additional hazards from viral promoters Evidence for horizontal transfer of transgenic DNA Conclusion

Mae-wan Ho

2000-01-01

69

Genetic characterization of bovine viral diarrhoea (BVD) viruses: confirmation of the presence of BVD genotype 2 in Africa.  

PubMed

Bovine viral diarrhoea virus (BVDV) has emerged as one of the economically important pathogens in cattle populations, with a worldwide distribution and causing a complex of disease syndromes. Two genotypes, BVDV 1 and 2, exist and are discriminated on the basis of the sequence of the 5' non-coding region (5' NCR) using real-time PCR. Real-time PCR is more sensitive, specific, and less time-consuming than conventional PCR, and it has less risk of cross-contamination of samples. Limited information exists on BVDV genetic subtypes in South Africa. The aim of this study was to determine the genotypes of BVDV currently circulating in South African feedlots. A total of 279 specimens (219 tissue samples, 59 trans-tracheal aspirates and 1 blood sample) were collected from dead and living cattle with lesions or clinical signs compatible with BVDV infection. Pooled homogenates from the same animals were prepared, and total RNA was extracted. A screening test was performed on the pooled samples, and positive pools were investigated individually. A Cador BVDV Type 1/2 RT-PCR Kit (QIAGEN, Hilden, Germany) was used for the real-time PCR assay on a LightCycler(®) V2.0 real-time PCR machine (Roche Diagnostics, Mannheim, Germany). The results were read at 530 and 640 nm for BVDV 1 and 2, respectively. Bovine viral diarrhoea virus was detected in a total of 103 samples that included 91 tissue samples, 1 blood sample and 11 trans-tracheal aspirates. Eighty-five (82.5 %) of the strains were genotype 1 and 18 (17.5 %) were genotype 2. Comparing the sequencing data, genotypes 1 and 2 from the field strains did not cluster with vaccine strains currently used in feedlots in South Africa. The present study revealed the presence of BVDV genotype 2 in cattle in South Africa based on the high sequence similarity between genotype 2 field strains and strain 890 from North America. The presence of genotype 2 viruses that phylogenetically belong to different clusters and coexist in feedlots is consistent with the possibility of multiple virus introductions. These results represent the first documented evidence for the presence of BVDV genotype 2 in African cattle. PMID:23011308

Ularamu, H G; Sibeko, K P; Bosman, A B; Venter, E H; van Vuuren, M

2013-01-01

70

Rotavirus seasonality in urban sewage from Argentina: Effect of meteorological variables on the viral load and the genetic diversity.  

PubMed

In Argentina, the rotavirus disease exhibits seasonal variations, being most prevalent in the fall and winter months. To deepen the understanding of rotavirus seasonality in our community, the influence of meteorological factors on the rotavirus load and the genetic diversity in urban raw sewage from Córdoba city, Argentina were evaluated. Wastewater samples were collected monthly during a three-year study period and viral particles were concentrated by polyethylene glycol precipitation. RT-nested PCR was applied for rotavirus detection, and VP7/VP4 characterization and real-time PCR for rotavirus quantification. Both molecular techniques showed relatively similar sensitivity rates and revealed rotavirus presence in urban wastewater in cold and warm seasons, indicating its circulation in the local community all year round. However, a slight trend for rotavirus circulation was noted by real-time PCR in the fall and winter seasons, showing a significantly higher peak of rotavirus concentration at mean temperatures lower than 18°C and also higher, although not statistically different during drier weather. VP7 and VP4 gene characterization showed that G1 and P[8] genotypes were dominant, and temporal variations in genotype distribution were not observed. Rotavirus spread is complex and our results point out that weather factors alone cannot explain the seasonal quantitative pattern of the rotavirus disease. Therefore, alternative transmission routes, changes in human behavior and susceptibility, and the stability and survivability of the virus might all together contribute to the seasonality of rotavirus. The results obtained here provide evidence regarding the dynamics of rotavirus circulation and maintenance in Argentina. PMID:25777068

Barril, P A; Fumian, T M; Prez, V E; Gil, P I; Martínez, L C; Giordano, M O; Masachessi, G; Isa, M B; Ferreyra, L J; Ré, V E; Miagostovich, M; Pavan, J V; Nates, S V

2015-04-01

71

Generation of pluripotent stem cells without the use of genetic material.  

PubMed

Induced pluripotent stem cells (iPSCs) provide a platform to obtain patient-specific cells for use as a cell source in regenerative medicine. Although iPSCs do not have the ethical concerns of embryonic stem cells, iPSCs have not been widely used in clinical applications, as they are generated by gene transduction. Recently, iPSCs have been generated without the use of genetic material. For example, protein-induced PSCs and chemically induced PSCs have been generated by the use of small and large (protein) molecules. Several epigenetic characteristics are important for cell differentiation; therefore, several small-molecule inhibitors of epigenetic-modifying enzymes, such as DNA methyltransferases, histone deacetylases, histone methyltransferases, and histone demethylases, are potential candidates for the reprogramming of somatic cells into iPSCs. In this review, we discuss what types of small chemical or large (protein) molecules could be used to replace the viral transduction of genes and/or genetic reprogramming to obtain human iPSCs. PMID:25365202

Higuchi, Akon; Ling, Qing-Dong; Kumar, S Suresh; Munusamy, Murugan A; Alarfaj, Abdullah A; Chang, Yung; Kao, Shih-Hsuan; Lin, Ke-Chen; Wang, Han-Chow; Umezawa, Akihiro

2015-01-01

72

Genetic polymorphism of the human organic solute carrier protein 1 (hOSCP1) gene in Japanese patients with non-viral liver carcinoma  

PubMed Central

Human organic solute carrier protein 1 (hOSCP1) is a Na+-independent multispecific organic solute transporter. To date, several studies have revealed that gene mutations of the transporters are likely to be associated with some diseases; however, there are no data concerning the genetic polymorphism of the hOSCP1 gene in Japanese patients with non-viral liver carcinoma (LC). In the present study, we isolated genomic DNA from a normal portion of LC, and analyzed 41 single nucleotide polymorphisms (SNPs) chosen from a database of SNPs (dbSNPs). We found genotype frequencies for 2 non-synonymous SNPs [rs34409118 (Thr131 ? Ala) and rs1416840 (Ile219 ? Thr)] and 1 synonymous SNP [rs16822954 (Ser193 ? Ser)] to be statistically significant when compared with dbSNPs. No statistical significance was observed in rs2275477 (Gly307 ? Arg) in the hOSCP1 gene. With respect to the allele frequency, we also observed rs34409118 to be statistically significant. Interestingly, we found that non-viral LC patients do not carry heterozygous mutations in rs1416840 (A/G) and rs16822954 (A/G), suggesting that a non-carrier of heterozygous mutations in these two SNPs might be a biomarker for susceptibility for non-viral LC in Japanese. Further analyses of patients with hOSCP1 variants may elucidate the relationship between the hOSCP1 gene and susceptibility of non-viral LC in Japanese patients. PMID:25606452

Toda, Mayumi; Kobayashi, Yasuna; Koizumi, Tomotake; Saito, Koji; Ohbayashi, Masayuki; Kohyama, Noriko; Aoki, Takeshi; Murakami, Masahiko; Yasuhara, Hajime; Yamamoto, Toshinori

2014-01-01

73

Genetic polymorphism of the human organic solute carrier protein 1 (hOSCP1) gene in Japanese patients with non-viral liver carcinoma.  

PubMed

Human organic solute carrier protein 1 (hOSCP1) is a Na(+)-independent multispecific organic solute transporter. To date, several studies have revealed that gene mutations of the transporters are likely to be associated with some diseases; however, there are no data concerning the genetic polymorphism of the hOSCP1 gene in Japanese patients with non-viral liver carcinoma (LC). In the present study, we isolated genomic DNA from a normal portion of LC, and analyzed 41 single nucleotide polymorphisms (SNPs) chosen from a database of SNPs (dbSNPs). We found genotype frequencies for 2 non-synonymous SNPs [rs34409118 (Thr(131) ? Ala) and rs1416840 (Ile(219) ? Thr)] and 1 synonymous SNP [rs16822954 (Ser(193) ? Ser)] to be statistically significant when compared with dbSNPs. No statistical significance was observed in rs2275477 (Gly(307) ? Arg) in the hOSCP1 gene. With respect to the allele frequency, we also observed rs34409118 to be statistically significant. Interestingly, we found that non-viral LC patients do not carry heterozygous mutations in rs1416840 (A/G) and rs16822954 (A/G), suggesting that a non-carrier of heterozygous mutations in these two SNPs might be a biomarker for susceptibility for non-viral LC in Japanese. Further analyses of patients with hOSCP1 variants may elucidate the relationship between the hOSCP1 gene and susceptibility of non-viral LC in Japanese patients. PMID:25606452

Toda, Mayumi; Kobayashi, Yasuna; Koizumi, Tomotake; Saito, Koji; Ohbayashi, Masayuki; Kohyama, Noriko; Aoki, Takeshi; Murakami, Masahiko; Yasuhara, Hajime; Yamamoto, Toshinori

2014-12-01

74

A reverse genetics system for the Great Lakes strain of viral hemorrhagic septicemia virus: the NV gene is required for pathogenicity.  

PubMed

Viral hemorrhagic septicemia virus (VHSV), belonging to the genus Novirhabdovirus in the family of Rhabdoviridae, causes a highly contagious disease of fresh and saltwater fish worldwide. Recently, a novel genotype of VHSV, designated IVb, has invaded the Great Lakes in North America, causing large-scale epidemics in wild fish. An efficient reverse genetics system was developed to generate a recombinant VHSV of genotype IVb from cloned cDNA. The recombinant VHSV (rVHSV) was comparable to the parental wild-type strain both in vitro and in vivo, causing high mortality in yellow perch (Perca flavescens). A modified recombinant VHSV was generated in which the NV gene was substituted with an enhanced green fluorescent protein gene (rVHSV-?NV-EGFP), and another recombinant was made by inserting the EGFP gene into the full-length viral clone between the P and M genes (rVHSV-EGFP). The in vitro replication kinetics of rVHSV-EGFP was similar to rVHSV; however, the rVHSV-?NV-EGFP grew 2 logs lower. In yellow perch challenges, wtVHSV and rVHSV induced 82-100% cumulative per cent mortality (CPM), respectively, whereas rVHSV-EGFP produced 62% CPM and rVHSV-?NV-EGFP caused only 15% CPM. No reversion of mutation was detected in the recovered viruses and the recombinant viruses stably maintained the foreign gene after several passages. These results indicate that the NV gene of VHSV is not essential for viral replication in vitro and in vivo, but it plays an important role in viral replication efficiency and pathogenicity. This system will facilitate studies of VHSV replication, virulence, and production of viral vectored vaccines. PMID:20936318

Ammayappan, Arun; Kurath, Gael; Thompson, Tarin M; Vakharia, Vikram N

2011-08-01

75

A reverse genetics system for the Great Lakes strain of viral hemorrhagic septicemia virus: the NV gene is required for pathogenicity  

USGS Publications Warehouse

Viral hemorrhagic septicemia virus (VHSV), belonging to the genus Novirhabdovirus in the family of Rhabdoviridae, causes a highly contagious disease of fresh and saltwater fish worldwide. Recently, a novel genotype of VHSV, designated IVb, has invaded the Great Lakes in North America, causing large-scale epidemics in wild fish. An efficient reverse genetics system was developed to generate a recombinant VHSV of genotype IVb from cloned cDNA. The recombinant VHSV (rVHSV) was comparable to the parental wild-type strain both in vitro and in vivo, causing high mortality in yellow perch (Perca flavescens). A modified recombinant VHSV was generated in which the NV gene was substituted with an enhanced green fluorescent protein gene (rVHSV-?NV-EGFP), and another recombinant was made by inserting the EGFP gene into the full-length viral clone between the P and M genes (rVHSV-EGFP). The in vitro replication kinetics of rVHSV-EGFP was similar to rVHSV; however, the rVHSV-?NV-EGFP grew 2 logs lower. In yellow perch challenges, wtVHSV and rVHSV induced 82-100% cumulative per cent mortality (CPM), respectively, whereas rVHSV-EGFP produced 62% CPM and rVHSV-?NV-EGFP caused only 15% CPM. No reversion of mutation was detected in the recovered viruses and the recombinant viruses stably maintained the foreign gene after several passages. These results indicate that the NV gene of VHSV is not essential for viral replication in vitro and in vivo, but it plays an important role in viral replication efficiency and pathogenicity. This system will facilitate studies of VHSV replication, virulence, and production of viral vectored vaccines.

Ammayappan, Arun; Kurath, Gael; Thompson, Tarin M.; Vakharia, Vikram N.

2011-01-01

76

Comparative evaluation of the performance of the Abbott RealTime HIV-1 assay for measurement of HIV-1 plasma viral load on genetically diverse samples from Greece  

PubMed Central

Background HIV-1 is characterized by increased genetic heterogeneity which tends to hinder the reliability of detection and accuracy of HIV-1 RNA quantitation assays. Methods In this study, the Abbott RealTime HIV-1 (Abbott RealTime) assay was compared to the Roche Cobas TaqMan HIV-1 (Cobas TaqMan) and the Siemens Versant HIV-1 RNA 3.0 (bDNA 3.0) assays, using clinical samples of various viral load levels and subtypes from Greece, where the recent epidemiology of HIV-1 infection has been characterized by increasing genetic diversity and a marked increase in subtype A genetic strains among newly diagnosed infections. Results A high correlation was observed between the quantitative results obtained by the Abbott RealTime and the Cobas TaqMan assays. Viral load values quantified by the Abbott RealTime were on average lower than those obtained by the Cobas TaqMan, with a mean (SD) difference of -0.206 (0.298) log10 copies/ml. The mean differences according to HIV-1 subtypes between the two techniques for samples of subtype A, B, and non-A/non-B were 0.089, -0.262, and -0.298 log10 copies/ml, respectively. Overall, differences were less than 0.5 log10 for 85% of the samples, and >1 log10 in only one subtype B sample. Similarly, Abbott RealTime and bDNA 3.0 assays yielded a very good correlation of quantitative results, whereas viral load values assessed by the Abbott RealTime were on average higher (mean (SD) difference: 0.160 (0.287) log10 copies/ml). The mean differences according to HIV-1 subtypes between the two techniques for subtype A, B and non-A/non-B samples were 0.438, 0.105 and 0.191 log10 copies/ml, respectively. Overall, the majority of samples (86%) differed by less than 0.5 log10, while none of the samples showed a deviation of more than 1.0 log10. Conclusions In an area of changing HIV-1 subtype pattern, the Abbott RealTime assay showed a high correlation and good agreement of results when compared both to the Cobas TaqMan and bDNA 3.0 assays, for all HIV-1 subtypes tested. All three assays could determine viral load from samples of different HIV-1 subtypes adequately. However, assay variation should be taken into account when viral load monitoring of the same individual is assessed by different systems. PMID:21219667

2011-01-01

77

Appropriate use of genetic manipulation for the development of restoration plant materials  

Technology Transfer Automated Retrieval System (TEKTRAN)

The diversity of restoration plant material development approaches reflect a variety of philosophies that represent what should and can be accomplished by restoration. The "natural" approach emphasizes emulation of putative naturally occurring patterns of genetic variation. The "genetically manipu...

78

A screen for genetic suppressor elements of hepatitis C virus identifies a supercharged protein inhibitor of viral replication  

E-print Network

a cloning site for the insertion and expression of the cDNA of interest. cDNA inserts are expressed from the viral LTR. We chose the pV1 for library expression because viral particles can be repackaged from pV1-transduced cells when these cells...-to-mass (kDa) ratio of 1.5. We show that B1 expression specifically inhibits HCV replication. In addition, five highly positively charged B1 fragments produced from progressive truncation at the C-terminus all retain the ability to inhibit HCV, suggesting...

Simeon, Rudo L.; Chen, Zhilei

2013-12-31

79

A novel oncolytic viral therapy and imaging technique for gastric cancer using a genetically engineered vaccinia virus carrying the human sodium iodide symporter  

PubMed Central

Background Gastric cancers have poor overall survival despite recent advancements in early detection methods, endoscopic resection techniques, and chemotherapy treatments. Vaccinia viral therapy has had promising therapeutic potential for various cancers and has a great safety profile. We investigated the therapeutic efficacy of a novel genetically-engineered vaccinia virus carrying the human sodium iodide symporter (hNIS) gene, GLV-1 h153, on gastric cancers and its potential utility for imaging with 99mTc pertechnetate scintigraphy and 124I positron emission tomography (PET). Methods GLV-1 h153 was tested against five human gastric cancer cell lines using cytotoxicity and standard viral plaque assays. In vivo, subcutaneous flank tumors were generated in nude mice with human gastric cancer cells, MKN-74. Tumors were subsequently injected with either GLV-1 h153 or PBS and followed for tumor growth. 99mTc pertechnetate scintigraphy and 124I microPET imaging were performed. Results GFP expression, a surrogate for viral infectivity, confirmed viral infection by 24 hours. At a multiplicity of infection (MOI) of 1, GLV-1 h153 achieved?>?90% cytotoxicity in MNK-74, OCUM-2MD3, and AGS over 9 days, and >70% cytotoxicity in MNK- 45 and TMK-1. In vivo, GLV-1 h153 was effective in treating xenografts (p?

2014-01-01

80

[Genetic variability of hepatitis C virus in the health area of Elche (Spain). Correlation between core antigen and viral load].  

PubMed

We investigated the prevalence of the various genotypes of hepatitis C virus (HCV) in 281 patients evaluated between March, 2000 and March, 2002 in the health area of Elche. Of these patients, 55 were coinfected with human immunodeficiency virus (HIV). The genotype was related to viral load and the co-existence of HIV infection. Likewise, the relationship between these parameters and the presence of the HCV core antigen was established. The results indicate that genotype 1b was the most prevalent (38.4%) followed by genotype 3a (23.1%). Patients coinfected with HIV presented fewer infections due to group 1 genotypes (p < 0.05).Patients with HIV presented a greater viral load in all the genotypes, with genotype 3 presenting a high viral load. Detection of the HCV core antigen showed a close correlation with viral load determinations. Although not yet sufficiently assessed, determination of the HCV core antigen constitutes a simple technique that could eventually contribute to improving the management of patients with chronic HCV hepatitis. PMID:12887853

Rodríguez, J C; García, J; Moya, I; Ayelo, A; Vázquez, N; Sillero, C; Royo, G

2003-01-01

81

Genetic heterogeneity within the coding regions of E2 and NS3 in strains of bovine viral diarrhea virus  

Microsoft Academic Search

We have amplified and sequenced parts of the genomes of eleven laboratory strains of bovine viral diarrhea (BVD) virus originating from North America, New Zealand and Europe. The cumulative nucleotide (nt) sequence heterogeneity of the amplified fragments located in the analysed region of the gene encoding the nonstructural protein NS3 (P80) was 24% as compared to 47% for E2 (Gp53).

Christian Hertig; Hanspeter Stalder; Ernst Peterhans

1995-01-01

82

Towards XNA nanotechnology: new materials from synthetic genetic polymers  

PubMed Central

Nucleic acids display remarkable properties beyond information storage and propagation. The well-understood base pairing rules have enabled nucleic acids to be assembled into nanostructures of ever increasing complexity. Although nanostructures can be constructed using other building blocks, including peptides and lipids, it is the capacity to evolve that sets nucleic acids apart from all other nanoscale building materials. Nonetheless, the poor chemical and biological stability of DNA and RNA constrain their applications. Recent advances in nucleic acid chemistry and polymerase engineering enable the synthesis, replication, and evolution of a range of synthetic genetic polymers (XNAs) with improved chemical and biological stability. We discuss the impact of this technology on the generation of XNA ligands, enzymes, and nanostructures with tailor-made chemistry. PMID:24745974

Pinheiro, Vitor B.; Holliger, Philipp

2014-01-01

83

Baculovirus expression system and method for high throughput expression of genetic material  

DOEpatents

The present invention provides novel recombinant baculovirus expression systems for expressing foreign genetic material in a host cell. Such expression systems are readily adapted to an automated method for expression foreign genetic material in a high throughput manner. In other aspects, the present invention features a novel automated method for determining the function of foreign genetic material by transfecting the same into a host by way of the recombinant baculovirus expression systems according to the present invention.

Clark, Robin (Benecia, CA); Davies, Anthony (Mill Valley, CA)

2001-01-01

84

Extended Genetic Diversity of Bovine Viral Diarrhea Virus and Frequency of Genotypes and Subtypes in Cattle in Italy between 1995 and 2013  

PubMed Central

Genetic typing of bovine viral diarrhea virus (BVDV) has distinguished BVDV-1 and BVDV-2 species and an emerging putative third species (HoBi-like virus), recently detected in southern Italy, signaling the occurrence of natural infection in Europe. Recognizing the need to update the data on BVDV genetic variability in Italy for mounting local and European alerts, a wide collection of 5? UTR sequences (n = 371) was selected to identify the frequency of genotypes and subtypes at the herd level. BVDV-1 had the highest frequency, followed by sporadic BVDV-2. No novel HoBi-like viruses were identified. Four distribution patterns of BVDV-1 subtypes were observed: highly prevalent subtypes with a wide temporal-spatial distribution (1b and 1e), low prevalent subtypes with a widespread geographic distribution (1a, 1d, 1g, 1h, and 1k) or a restricted geographic distribution (1f), and sporadic subtypes detected only in single herds (1c, 1j, and 1l). BVDV-1c, k, and l are reported for the first time in Italy. A unique genetic variant was detected in the majority of herds, but cocirculation of genetic variants was also observed. Northern Italy ranked first for BVDV introduction, prevalence, and dispersion. Nevertheless, the presence of sporadic variants in other restricted areas suggests the risk of different routes of BVDV introduction. PMID:25045658

Lauzi, Stefania; Ebranati, Erika; Giammarioli, Monica; Cannella, Vincenza; Masoero, Loretta; Canelli, Elena; Guercio, Annalisa; Caruso, Claudio; Ciccozzi, Massimo; De Mia, Gian Mario; Acutis, Pier Luigi; Zehender, Gianguglielmo

2014-01-01

85

Raw Sewage Harbors Diverse Viral Populations  

PubMed Central

ABSTRACT At this time, about 3,000 different viruses are recognized, but metagenomic studies suggest that these viruses are a small fraction of the viruses that exist in nature. We have explored viral diversity by deep sequencing nucleic acids obtained from virion populations enriched from raw sewage. We identified 234 known viruses, including 17 that infect humans. Plant, insect, and algal viruses as well as bacteriophages were also present. These viruses represented 26 taxonomic families and included viruses with single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), positive-sense ssRNA [ssRNA(+)], and dsRNA genomes. Novel viruses that could be placed in specific taxa represented 51 different families, making untreated wastewater the most diverse viral metagenome (genetic material recovered directly from environmental samples) examined thus far. However, the vast majority of sequence reads bore little or no sequence relation to known viruses and thus could not be placed into specific taxa. These results show that the vast majority of the viruses on Earth have not yet been characterized. Untreated wastewater provides a rich matrix for identifying novel viruses and for studying virus diversity. Importance At this time, virology is focused on the study of a relatively small number of viral species. Specific viruses are studied either because they are easily propagated in the laboratory or because they are associated with disease. The lack of knowledge of the size and characteristics of the viral universe and the diversity of viral genomes is a roadblock to understanding important issues, such as the origin of emerging pathogens and the extent of gene exchange among viruses. Untreated wastewater is an ideal system for assessing viral diversity because virion populations from large numbers of individuals are deposited and because raw sewage itself provides a rich environment for the growth of diverse host species and thus their viruses. These studies suggest that the viral universe is far more vast and diverse than previously suspected. PMID:21972239

Cantalupo, Paul G.; Calgua, Byron; Zhao, Guoyan; Hundesa, Ayalkibet; Wier, Adam D.; Katz, Josh P.; Grabe, Michael; Hendrix, Roger W.; Girones, Rosina; Wang, David; Pipas, James M.

2011-01-01

86

Polyandry in grain beetles, Tenebrio molitor, leads to greater reproductive success: material or genetic benefits?  

Microsoft Academic Search

Females that mate with more than one male may derive both material and genetic benefits, and differentiating between the two benefits is often difficult. We tested for both material and genetic effects associated with multiple mating in the highly promiscuous yellow mealworm beetle, Tenebrio molitor. Females that mated four times to the same male laid more eggs and produced more

Bradley D. Worden; Patricia G. Parker

2001-01-01

87

Unifying Viral Genetics and Human Transportation Data to Predict the Global Transmission Dynamics of Human Influenza H3N2  

PubMed Central

Information on global human movement patterns is central to spatial epidemiological models used to predict the behavior of influenza and other infectious diseases. Yet it remains difficult to test which modes of dispersal drive pathogen spread at various geographic scales using standard epidemiological data alone. Evolutionary analyses of pathogen genome sequences increasingly provide insights into the spatial dynamics of influenza viruses, but to date they have largely neglected the wealth of information on human mobility, mainly because no statistical framework exists within which viral gene sequences and empirical data on host movement can be combined. Here, we address this problem by applying a phylogeographic approach to elucidate the global spread of human influenza subtype H3N2 and assess its ability to predict the spatial spread of human influenza A viruses worldwide. Using a framework that estimates the migration history of human influenza while simultaneously testing and quantifying a range of potential predictive variables of spatial spread, we show that the global dynamics of influenza H3N2 are driven by air passenger flows, whereas at more local scales spread is also determined by processes that correlate with geographic distance. Our analyses further confirm a central role for mainland China and Southeast Asia in maintaining a source population for global influenza diversity. By comparing model output with the known pandemic expansion of H1N1 during 2009, we demonstrate that predictions of influenza spatial spread are most accurate when data on human mobility and viral evolution are integrated. In conclusion, the global dynamics of influenza viruses are best explained by combining human mobility data with the spatial information inherent in sampled viral genomes. The integrated approach introduced here offers great potential for epidemiological surveillance through phylogeographic reconstructions and for improving predictive models of disease control. PMID:24586153

Lemey, Philippe; Rambaut, Andrew; Bedford, Trevor; Faria, Nuno; Bielejec, Filip; Baele, Guy; Russell, Colin A.; Smith, Derek J.; Pybus, Oliver G.; Brockmann, Dirk; Suchard, Marc A.

2014-01-01

88

Impact of the HIV-1 env Genetic Context outside HR1–HR2 on Resistance to the Fusion Inhibitor Enfuvirtide and Viral Infectivity in Clinical Isolates  

PubMed Central

Resistance mutations to the HIV-1 fusion inhibitor enfuvirtide emerge mainly within the drug's target region, HR1, and compensatory mutations have been described within HR2. The surrounding envelope (env) genetic context might also contribute to resistance, although to what extent and through which determinants remains elusive. To quantify the direct role of the env context in resistance to enfuvirtide and in viral infectivity, we compared enfuvirtide susceptibility and infectivity of recombinant viral pairs harboring the HR1–HR2 region or the full Env ectodomain of longitudinal env clones from 5 heavily treated patients failing enfuvirtide therapy. Prior to enfuvirtide treatment onset, no env carried known resistance mutations and full Env viruses were on average less susceptible than HR1–HR2 recombinants. All escape clones carried at least one of G36D, V38A, N42D and/or N43D/S in HR1, and accordingly, resistance increased 11- to 2800-fold relative to baseline. Resistance of full Env recombinant viruses was similar to resistance of their HR1–HR2 counterpart, indicating that HR1 and HR2 are the main contributors to resistance. Strictly X4 viruses were more resistant than strictly R5 viruses, while dual-tropic Envs featured similar resistance levels irrespective of the coreceptor expressed by the cell line used. Full Env recombinants from all patients gained infectivity under prolonged drug pressure; for HR1–HR2 viruses, infectivity remained steady for 3/5 patients, while for 2/5 patients, gains in infectivity paralleled those of the corresponding full Env recombinants, indicating that the env genetic context accounts mainly for infectivity adjustments. Phylogenetic analyses revealed that quasispecies selection is a step-wise process where selection of enfuvirtide resistance is a dominant factor early during therapy, while increased infectivity is the prominent driver under prolonged therapy. PMID:21760896

Baatz, Franky; Nijhuis, Monique; Lemaire, Morgane; Riedijk, Martiene; Wensing, Annemarie M. J.; Servais, Jean-Yves; van Ham, Petra M.; Hoepelman, Andy I. M.; Koopmans, Peter P.; Sprenger, Herman G.; Devaux, Carole; Schmit, Jean-Claude; Perez Bercoff, Danielle

2011-01-01

89

Impact of the HIV-1 env genetic context outside HR1-HR2 on resistance to the fusion inhibitor enfuvirtide and viral infectivity in clinical isolates.  

PubMed

Resistance mutations to the HIV-1 fusion inhibitor enfuvirtide emerge mainly within the drug's target region, HR1, and compensatory mutations have been described within HR2. The surrounding envelope (env) genetic context might also contribute to resistance, although to what extent and through which determinants remains elusive. To quantify the direct role of the env context in resistance to enfuvirtide and in viral infectivity, we compared enfuvirtide susceptibility and infectivity of recombinant viral pairs harboring the HR1-HR2 region or the full Env ectodomain of longitudinal env clones from 5 heavily treated patients failing enfuvirtide therapy. Prior to enfuvirtide treatment onset, no env carried known resistance mutations and full Env viruses were on average less susceptible than HR1-HR2 recombinants. All escape clones carried at least one of G36D, V38A, N42D and/or N43D/S in HR1, and accordingly, resistance increased 11- to 2800-fold relative to baseline. Resistance of full Env recombinant viruses was similar to resistance of their HR1-HR2 counterpart, indicating that HR1 and HR2 are the main contributors to resistance. Strictly X4 viruses were more resistant than strictly R5 viruses, while dual-tropic Envs featured similar resistance levels irrespective of the coreceptor expressed by the cell line used. Full Env recombinants from all patients gained infectivity under prolonged drug pressure; for HR1-HR2 viruses, infectivity remained steady for 3/5 patients, while for 2/5 patients, gains in infectivity paralleled those of the corresponding full Env recombinants, indicating that the env genetic context accounts mainly for infectivity adjustments. Phylogenetic analyses revealed that quasispecies selection is a step-wise process where selection of enfuvirtide resistance is a dominant factor early during therapy, while increased infectivity is the prominent driver under prolonged therapy. PMID:21760896

Baatz, Franky; Nijhuis, Monique; Lemaire, Morgane; Riedijk, Martiene; Wensing, Annemarie M J; Servais, Jean-Yves; van Ham, Petra M; Hoepelman, Andy I M; Koopmans, Peter P; Sprenger, Herman G; Devaux, Carole; Schmit, Jean-Claude; Perez Bercoff, Danielle

2011-01-01

90

IN VIVO STUDIES ON POSSIBLE HEALTH CONSEQUENCES OF GENETICALLY MODIFIED FOOD AND FEED—WITH PARTICULAR REGARD TO INGREDIENTS CONSISTING OF GENETICALLY MODIFIED PLANT MATERIALS  

Microsoft Academic Search

This synopsis reviews published in vivo studies on possible health consequences of genetically modified food and feed where the ingredients in question have consisted of genetically modified plant materials. The following, however, have not been taken into consideration: -ingredients consisting of genetically modified microorganisms or parts of animals\\/fish -ingredients produced by\\/from genetically modified organisms but without any DNA present -studies

IAN F. PRYME; ROLF LEMBCKE

91

Emerging viral diseases of tomato crops.  

PubMed

Viral diseases are an important limiting factor in many crop production systems. Because antiviral products are not available, control strategies rely on genetic resistance or hygienic measures to prevent viral diseases, or on eradication of diseased crops to control such diseases. Increasing international travel and trade of plant materials enhances the risk of introducing new viruses and their vectors into production systems. In addition, changing climate conditions can contribute to a successful spread of newly introduced viruses or their vectors and establishment of these organisms in areas that were previously unfavorable. Tomato is economically the most important vegetable crop worldwide and many viruses infecting tomato have been described, while new viral diseases keep emerging. Pepino mosaic virus is a rapidly emerging virus which has established itself as one of the most important viral diseases in tomato production worldwide over recent years. Begomovirus species and other whitefly-transmitted viruses are invading into new areas, and several recently described new viruses such as Tomato torrado virus and new Tospovirus species are rapidly spreading over large geographic areas. In this article, emerging viruses of tomato crops are discussed. PMID:20367462

Hanssen, Inge M; Lapidot, Moshe; Thomma, Bart P H J

2010-05-01

92

Viral Infections  

MedlinePLUS

... much smaller than bacteria. Viruses cause familiar infectious diseases such as the common cold, flu and warts. ... can help prevent you from getting many viral diseases. NIH: National Institute of Allergy and Infectious Diseases

93

Viral pneumonia  

MedlinePLUS

More serious infections can result in respiratory failure, liver failure, and heart failure. Sometimes, bacterial infections occur during or just after viral pneumonia, which may lead to more serious forms ...

94

Viral Gastroenteritis  

MedlinePLUS

... and hospitalization. Untreated severe dehydration can cause serious health problems such as organ damage, shock, or coma—a sleeplike state in which a person is not conscious. [ Top ] What causes viral gastroenteritis? Four types of ...

95

Viral Meningitis  

MedlinePLUS

... Non-infectious Meningitis Resources for Healthcare Professionals Related Links Vaccine Schedules Preteen & Teen Vaccines Meningococcal Disease Viral ... lymphocytic choriomeningitis virus . Â Top of Page Related Links Mumps MMR Vaccine Chickenpox Chickenpox Vaccine Enteroviruses Arboviruses ...

96

Prevalence Study and Genetic Typing of Bovine Viral Diarrhea Virus (BVDV) in Four Bovine Species in China.  

PubMed

To determine the nationwide status of persistent BVDV infection in different bovine species in China and compare different test methods, a total of 1379 serum samples from clinical healthy dairy cattle, beef cattle, yaks (Bos grunniens), and water buffalo (Bubalus bubalis) were collected in eight provinces of China from 2010 to 2013. The samples were analyzed using commercial antibody (Ab) and antigen (Ag) detection kits, and RT-PCR based on the 5'-UTR and Npro gene sequencing. Results showed that the overall positive rates for BVDV Ab, Ag and RT-PCR detection were 58.09% (801/1379), 1.39% (14/1010), and 22.64% (146/645), respectively, while the individual positive rates varied among regions, species, and farms. The average Ab-positive rates for dairy cattle, beef cattle, yaks, and water buffalo were 89.49% (298/333), 63.27% (248/392), 45.38% (236/520), and 14.18% (19/134), respectively, while the Ag-positive rates were 0.00% (0/116), 0.77% (3/392), 0.82% (3/368), and 5.97% (8/134), respectively, and the nucleic acid-positive rates detected by RT-PCR were 32.06% (42/131), 13.00% (26/200), 28.89% (52/180), and 19.40% (26/134), respectively. In addition, the RT-PCR products were sequenced and 124 5'-UTR sequences were obtained. Phylogenetic analysis of the 5'-UTR sequences indicated that all of the 124 BVDV-positive samples were BVDV-1 and subtyped into either BVDV-1b (33.06%), BVDV-1m (49.19%), or a new cluster, designated as BVDV-1u (17.74%). Phylogenetic analysis based on Npro sequences confirmed this novel subtype. In conclusion, this study revealed the prevalence of BVDV-1 in bovine species in China and the dominant subtypes. The high proportion of bovines with detectable viral nucleic acids in the sera, even in the presence of high Ab levels, revealed a serious threat to bovine health. PMID:25849315

Deng, Mingliang; Ji, Sukun; Fei, Wentao; Raza, Sohail; He, Chenfei; Chen, Yingyu; Chen, Huanchun; Guo, Aizhen

2015-01-01

97

Prevalence Study and Genetic Typing of Bovine Viral Diarrhea Virus (BVDV) in Four Bovine Species in China  

PubMed Central

To determine the nationwide status of persistent BVDV infection in different bovine species in China and compare different test methods, a total of 1379 serum samples from clinical healthy dairy cattle, beef cattle, yaks (Bos grunniens), and water buffalo (Bubalus bubalis) were collected in eight provinces of China from 2010 to 2013. The samples were analyzed using commercial antibody (Ab) and antigen (Ag) detection kits, and RT-PCR based on the 5’-UTR and Npro gene sequencing. Results showed that the overall positive rates for BVDV Ab, Ag and RT-PCR detection were 58.09% (801/1379), 1.39% (14/1010), and 22.64% (146/645), respectively, while the individual positive rates varied among regions, species, and farms. The average Ab-positive rates for dairy cattle, beef cattle, yaks, and water buffalo were 89.49% (298/333), 63.27% (248/392), 45.38% (236/520), and 14.18% (19/134), respectively, while the Ag-positive rates were 0.00% (0/116), 0.77% (3/392), 0.82% (3/368), and 5.97% (8/134), respectively, and the nucleic acid-positive rates detected by RT-PCR were 32.06% (42/131), 13.00% (26/200), 28.89% (52/180), and 19.40% (26/134), respectively. In addition, the RT-PCR products were sequenced and 124 5’-UTR sequences were obtained. Phylogenetic analysis of the 5’-UTR sequences indicated that all of the 124 BVDV-positive samples were BVDV-1 and subtyped into either BVDV-1b (33.06%), BVDV-1m (49.19%), or a new cluster, designated as BVDV-1u (17.74%). Phylogenetic analysis based on Npro sequences confirmed this novel subtype. In conclusion, this study revealed the prevalence of BVDV-1 in bovine species in China and the dominant subtypes. The high proportion of bovines with detectable viral nucleic acids in the sera, even in the presence of high Ab levels, revealed a serious threat to bovine health. PMID:25849315

Deng, Mingliang; Ji, Sukun; Fei, Wentao; Raza, Sohail; He, Chenfei; Chen, Yingyu; Chen, Huanchun; Guo, Aizhen

2015-01-01

98

Ovine Reference Materials and Assays for Prion Genetic Testing  

Technology Transfer Automated Retrieval System (TEKTRAN)

Background: Genetic predisposition to scrapie in sheep is associated with variation in the peptide sequence of the ovine prion protein encoded by Prnp. Codon variants implicated in scrapie susceptibility or disease progression include those at amino acid positions 112, 136, 141, 154, and 171. Nin...

99

The introduction of fox rabies into Italy (2008-2011) was due to two viral genetic groups with distinct phylogeographic patterns.  

PubMed

Fox rabies re-emerged in north-eastern Italy at the end of 2008 and circulated until early 2011. As with previous rabies epidemics, the Italian cases were linked to the epidemiological situation in adjacent regions. To obtain a comprehensive picture of the dynamics of the recent Italian epidemic, we performed a detailed evolutionary analysis of RABVs circulating in north-eastern Italy. Sequences were obtained for the hyper-variable region of the nucleoprotein gene, the complete glycoprotein gene, and the intergenic region G-L from 113 selected fox rabies cases. We identified two viral genetic groups, here referred to as Italy-1 and Italy-2. Phylogenetic and phylogeographic analyses revealed that both groups had been circulating in the Western Balkans and Slovenia in previous years and were only later introduced into Italy (into the Friuli Venezia Giulia region-FVG), occupying different areas of the Italian territories. Notably, viruses belonging to the Italy-1 group remained confined to the region of introduction and their spread was minimised by the implementation of oral fox vaccination campaigns. In contrast, Italy-2 viruses spread westward over a territory of 100 km from their first identification in FVG, likely crossing the northern territories where surveillance was inadequate. A genetic sub-group (Italy-2A), characterised by a unique amino acid mutation (D106A) in the N gene, was also observed to occupy a distinct geographic cluster. This molecular epidemiological analysis of the 2008-2011 fox rabies epidemic will contribute to future control programmes both at national and regional levels. In particular, our findings highlight the weaknesses of the national surveillance strategy in the period preceding rabies re-emergence, and of control plans implemented immediately after rabies notification, and underline the need of a coordinated approach at the regional level for both the surveillance and control of wildlife rabies. PMID:23603764

Fusaro, Alice; Monne, Isabella; Salomoni, Angela; Angot, Angélique; Trolese, Matteo; Ferrè, Nicola; Mutinelli, Franco; Holmes, Edward C; Capua, Ilaria; Lemey, Philippe; Cattoli, Giovanni; De Benedictis, Paola

2013-07-01

100

Viral vectors for gene delivery and gene therapy within the endocrine system  

Microsoft Academic Search

The transfer of genetic material into endocrine cells and tissues, both in vitro and in vivo, has been identified as critical for the study of endocrine mechanisms and the future treat- ment of endocrine disorders. Classical methods of gene transfer, such as transfection, are inefficient and limited mainly to delivery into actively proliferating cells in vitro. The development of viral

D Stone; A David; F Bolognani; P R Lowenstein; M G Castro

2000-01-01

101

Drug Resistance in Acute Viral Infections: Rhinovirus as a Alun L. Lloyd and Dominik Wodarz  

E-print Network

. For instance, in the case of HIV, the reverse transcription of viral RNA to DNA during the virus's replication of the virus that are less sensitive to the action of the drug have a considerable replicative advantage over of bacteria, genetic material can be acquired from other bacteria

Lloyd, Alun

102

Viral-templated Palladium Nanocatalysts  

NASA Astrophysics Data System (ADS)

Despite recent progress on nanocatalysis, there exist several critical challenges in simple and readily controllable nanocatalyst synthesis including the unpredictable particle growth, deactivation of catalytic activity, cumbersome catalyst recovery and lack of in-situ reaction monitoring. In this dissertation, two novel approaches are presented for the fabrication of viral-templated palladium (Pd) nanocatalysts, and their catalytic activities for dichromate reduction reaction and Suzuki Coupling reaction were thoroughly studied. In the first approach, viral template based bottom-up assembly is employed for the Pd nanocatalyst synthesis in a chip-based format. Specifically, genetically displayed cysteine residues on each coat protein of Tobacco Mosaic Virus (TMV) templates provide precisely spaced thiol functionalities for readily controllable surface assembly and enhanced formation of catalytically active Pd nanoparticles. Catalysts with the chip-based format allow for simple separation and in-situ monitoring of the reaction extent. Thorough examination of synthesis-structure-activity relationship of Pd nanoparticles formed on surface-assembled viral templates shows that Pd nanoparticle size, catalyst loading density and catalytic activity of viral-templated Pd nanocatalysts can be readily controlled simply by tuning the synthesis conditions. The viral-templated Pd nanocatalysts with optimized synthesis conditions are shown to have higher catalytic activity per unit Pd mass than the commercial Pd/C catalysts. Furthermore, tunable and selective surface assembly of TMV biotemplates is exploited to control the loading density and location of Pd nanocatalysts on solid substrates via preferential electroless deposition. In addition, the catalytic activities of surface-assembled TMV-templated Pd nanocatalysts were also investigated for the ligand-free Suzuki Coupling reaction under mild reaction conditions. The chip-based format enables simple catalyst separation and reuse as well as facile product recovery. Reaction condition studies show that the solvent ratio played an important role in the selectivity of the Suzuki reaction, and that a higher water/acetonitrile ratio significantly facilitated the cross-coupling pathway. Meanwhile, in-depth characterizations including Atomic Force Microscopy (AFM), Grazing Incidence Small Angle X-ray Scattering (GISAXS), Inductively Coupled Plasma Optical Emission Spectrometry (ICP-OES) and X-ray Photoelectron Spectroscopy (XPS) were carried out for these chip-based viral-templated Pd nanocatalysts. In the second approach, catalytically active TMV-templated Pd nanoparticles are encapsulated in readily exploited polymeric microparticle formats. Specifically, small (1˜2 nm), uniform and highly crystalline palladium (Pd) nanoparticles are spontaneously formed along (TMV) biotemplates without external reducing agents. The as-prepared Pd-TMV complexes are integrated into the hybrid poly(ethylene glycol)(PEG)-based microparticles via replica molding (RM) technique in a simple, robust and highly reproducible manner. The Pd-TMV complex structure was characterized by Transmission Electron Microscopy (TEM). The hybrid Pd-TMV-PEG microparticles are examined to have high catalytic activity, recyclability and stability through dichromate reduction. Combined these findings represent a significant step toward simple, robust, scalable synthesis and fabrication of efficient biotemplate-supported Pd nanocatalysts in readily deployable polymeric formats with high capacity in a well-controlled manner. These two simple, robust and readily controllable approaches for the fabrication of viral-templated Pd nanocatalysts, in both chip-based and hydrogel-encapsulated formats, can be readily extended to a variety of other nano-bio hybrid material synthesis in other catalytic reaction systems.

Yang, Cuixian

103

Viral hepatocarcinogenesis  

PubMed Central

Hepatocellular carcinoma (HCC) is the fifth most common cancer and the third leading cause of cancer death worldwide. Despite recent advances in the diagnosis and treatment of HCC, its prognosis remains dismal. Infection with hepatitis B virus (HBV) and hepatitis C virus (HCV) are the major risk factors for HCC. Although both are hepatotropic viral infections, there are important differences between the oncogenic mechanisms of these two viruses. In addition to the oncogenic potential of its viral proteins, HBV, as a DNA virus, can integrate into host DNA and directly transform hepatocytes. In contrast, HCV, an RNA virus, is unable to integrate into the host genome, and viral protein expression has a more critical function in hepatocarcinogenesis. Both HBV and HCV proteins have been implicated in disrupting cellular signal transduction pathways that lead to unchecked cell growth. Most HCC develops in the cirrhotic liver, but the linkage between cirrhosis and HCC is likely multifactorial. In this review, we summarize current knowledge regarding the pathogenetic mechanisms of viral HCC. PMID:20228847

Tsai, W-L; Chung, RT

2011-01-01

104

Optimal placement of active material actuators using genetic algorithm  

NASA Astrophysics Data System (ADS)

Actuators based on smart materials generally exhibit a tradeoff between force and stroke. Researchers have surrounded piezoelectric materials (PZT"s) with complaint structures to magnify either their geometric or mechanical advantage. Most of these designs are literally built around a particular piezoelectric device, so the design space consists of only the compliant mechanism. Materials scientists researchers have demonstrated the ability to pole a PZT in an arbitrary direction, and some engineers have taken advantage of this to build "shear mode" actuators. The goal of this work is to determine if the performance of compliant mechanisms improves by the inclusion of the piezoelectric polarization as a design variable. The polarization vector is varied via transformation matrixes, and the compliant actuator is modeled using the SIMP (Solid Isotropic Material with Penalization) or "power-law method." The concept of mutual potential energy is used to form an objective function to measure the piezoelectric actuator"s performance. The optimal topology of the compliant mechanism and orientation of the polarization method are determined using a sequential linear programming algorithm. This paper presents a demonstration problem that shows small changes in the polarization vector have a marginal effect on the optimum topology of the mechanism, but improves actuation.

Johnson, Terrence; Frecker, Mary I.

2004-07-01

105

The contribution of viral genotype to plasma viral set-point in HIV infection.  

PubMed

Disease progression in HIV-infected individuals varies greatly, and while the environmental and host factors influencing this variation have been widely investigated, the viral contribution to variation in set-point viral load, a predictor of disease progression, is less clear. Previous studies, using transmission-pairs and analysis of phylogenetic signal in small numbers of individuals, have produced a wide range of viral genetic effect estimates. Here we present a novel application of a population-scale method based in quantitative genetics to estimate the viral genetic effect on set-point viral load in the UK subtype B HIV-1 epidemic, based on a very large data set. Analyzing the initial viral load and associated pol sequence, both taken before anti-retroviral therapy, of 8,483 patients, we estimate the proportion of variance in viral load explained by viral genetic effects to be 5.7% (CI 2.8-8.6%). We also estimated the change in viral load over time due to selection on the virus and environmental effects to be a decline of 0.05 log10 copies/mL/year, in contrast to recent studies which suggested a reported small increase in viral load over the last 20 years might be due to evolutionary changes in the virus. Our results suggest that in the UK epidemic, subtype B has a small but significant viral genetic effect on viral load. By allowing the analysis of large sample sizes, we expect our approach to be applicable to the estimation of the genetic contribution to traits in many organisms. PMID:24789308

Hodcroft, Emma; Hadfield, Jarrod D; Fearnhill, Esther; Phillips, Andrew; Dunn, David; O'Shea, Siobhan; Pillay, Deenan; Leigh Brown, Andrew J

2014-05-01

106

The Contribution of Viral Genotype to Plasma Viral Set-Point in HIV Infection  

PubMed Central

Disease progression in HIV-infected individuals varies greatly, and while the environmental and host factors influencing this variation have been widely investigated, the viral contribution to variation in set-point viral load, a predictor of disease progression, is less clear. Previous studies, using transmission-pairs and analysis of phylogenetic signal in small numbers of individuals, have produced a wide range of viral genetic effect estimates. Here we present a novel application of a population-scale method based in quantitative genetics to estimate the viral genetic effect on set-point viral load in the UK subtype B HIV-1 epidemic, based on a very large data set. Analyzing the initial viral load and associated pol sequence, both taken before anti-retroviral therapy, of 8,483 patients, we estimate the proportion of variance in viral load explained by viral genetic effects to be 5.7% (CI 2.8–8.6%). We also estimated the change in viral load over time due to selection on the virus and environmental effects to be a decline of 0.05 log10 copies/mL/year, in contrast to recent studies which suggested a reported small increase in viral load over the last 20 years might be due to evolutionary changes in the virus. Our results suggest that in the UK epidemic, subtype B has a small but significant viral genetic effect on viral load. By allowing the analysis of large sample sizes, we expect our approach to be applicable to the estimation of the genetic contribution to traits in many organisms. PMID:24789308

Hodcroft, Emma; Hadfield, Jarrod D.; Fearnhill, Esther; Phillips, Andrew; Dunn, David; O'Shea, Siobhan; Pillay, Deenan; Leigh Brown, Andrew J.

2014-01-01

107

Viral Infections  

Microsoft Academic Search

Although influenza remains indisputably the most significant viral pathogen in adults, other viruses such as respiratory syncytial\\u000a virus, parainfluenza viruses, and human metapneumovirus are now recognized as significant pathogens in older populations.\\u000a \\u000a Oseltamivir and zanamivir are antiviral agents that are effective for the treatment and prophylaxis of influenza A and B.\\u000a For treatment and for optimal effect, therapy should be

Coley B. Duncan; Ann R. Falsey

108

Seeds of Dissension A Case Study in Patenting Genetic Material  

NSDL National Science Digital Library

A possible act of industrial espionage is the backdrop for this case study, which introduces students to analytical techniques routinely used in most areas of biotechnology, including forensic science and paternity suits. In this fictional case, "Roger Wezel," formerly employed at ExOil developing soybean seeds high in oleic acid, now works at a competing company, SeedGene Inc., after befing fired by ExOil over a dispute with his boss. ExOil has just discovered that Roger is at SeedGene, and also that SeedGene is now advertising high-oil soybean seeds. ExOil suspects that Roger stole their seeds and gave them to SeedGene to produce their own high oleic acid variety. ExOil wants to test some of the seeds from their competitor to see if they are the same strain in order to support their accusation that SeedGene is violating their patent. The case is designed for use with advanced biology students or introductory genetics students.

Elaine M. Schamber

2003-01-01

109

Microfluidic Fabrication of Hydrogel Microparticles Containing Functionalized Viral Nanotemplates  

E-print Network

We demonstrate rapid microfluidic fabrication of hybrid microparticles composed of functionalized viral nanotemplates directly embedded in polymeric hydrogels. Specifically, genetically modified tobacco mosaic virus (TMV) ...

Lewis, Christina L.

110

Huntsman Cancer Institute scientists discover new method to identify cancer-causing rearrangements of genetic material  

Cancer.gov

Researchers from Huntsman Cancer Institute at the University of Utah report they have discovered a method to identify cancer-causing rearrangements of genetic material called chromosomal translocations quickly, accurately, and inexpensively. A description of the method and the research results appear online in this month's issue of the EMBO Molecular Medicine journal.

111

A hybrid genetic algorithm approach to calculating chemical equilibrium and detonation parameters in condensed energetic materials  

Microsoft Academic Search

We discuss the implementation of genetic algorithms for modelling chemical equilibrium and detonation parameters at the Chapman–Jouguet (CJ) state. This strategy has the advantage that no initial estimate of the equilibrium product distribution needs to be made. It is also an efficient method for finding the global minimum, since for highly non-ideal condensed energetic materials, the calculation of the chemical

A. Zayer; U. Riedel; J. Warnatz

2006-01-01

112

Viral epigenetics.  

PubMed

DNA tumor viruses including members of the polyomavirus, adenovirus, papillomavirus, and herpes virus families are presently the subject of intense interest with respect to the role that epigenetics plays in control of the virus life cycle and the transformation of a normal cell to a cancer cell. To date, these studies have primarily focused on the role of histone modification, nucleosome location, and DNA methylation in regulating the biological consequences of infection. Using a wide variety of strategies and techniques ranging from simple ChIP to ChIP-chip and ChIP-seq to identify histone modifications, nuclease digestion to genome wide next generation sequencing to identify nucleosome location, and bisulfite treatment to MeDIP to identify DNA methylation sites, the epigenetic regulation of these viruses is slowly becoming better understood. While the viruses may differ in significant ways from each other and cellular chromatin, the role of epigenetics appears to be relatively similar. Within the viral genome nucleosomes are organized for the expression of appropriate genes with relevant histone modifications particularly histone acetylation. DNA methylation occurs as part of the typical gene silencing during latent infection by herpesviruses. In the simple tumor viruses like the polyomaviruses, adenoviruses, and papillomaviruses, transformation of the cell occurs via integration of the virus genome such that the virus's normal regulation is disrupted. This results in the unregulated expression of critical viral genes capable of redirecting cellular gene expression. The redirected cellular expression is a consequence of either indirect epigenetic regulation where cellular signaling or transcriptional dysregulation occurs or direct epigenetic regulation where epigenetic cofactors such as histone deacetylases are targeted. In the more complex herpersviruses transformation is a consequence of the expression of the viral latency proteins and RNAs which again can have either a direct or indirect effect on epigenetic regulation of cellular expression. Nevertheless, many questions still remain with respect to the specific mechanisms underlying epigenetic regulation of the viruses and transformation. PMID:25421681

Milavetz, Barry I; Balakrishnan, Lata

2015-01-01

113

Viral Hijackers  

NSDL National Science Digital Library

Students learn how viruses invade host cells and hijack the hosts' cell-reproduction mechanisms in order to make new viruses, which can in turn attack additional host cells. Students also learn how the immune system responds to a viral invasion, eventually defeating the viruses—if all goes well. Finally, they consider the special case of HIV, in which the virus' host cell is a key component of the immune system itself, severely crippling it and ultimately leading to AIDS. The associated activity sets the stage for this lesson with a dramatic simulation that allows students to see for themselves how quickly a virus can spread through a population, and then challenges students to determine who the initial bearers of the virus were.

2014-09-18

114

Synthesis of minus-strand copies of a viral transgene during viral infections of transgenic plants  

Technology Transfer Automated Retrieval System (TEKTRAN)

Plants can be genetically engineered to express viral sequences, often resulting in resistance to the virus from which the sequence was derived. The generally accepted mechanism for this pathogen induced resistance is gene silencing. Previous work has demonstrated that viral transgenes can be incorp...

115

Genetics  

MedlinePLUS

... Inheritance; Heterozygous; Inheritance patterns; Heredity and disease; Heritable; Genetic markers ... The chromosomes are made up of strands of genetic information called DNA. Each chromosome contains sections of ...

116

Genetic heterogeneity in psoriasis vulgaris based on linkage analyses of a large family material  

SciTech Connect

Information on psoriasis among parents and siblings in 14,008 families has been collected. On the basis of this material, evidence for monogenetic autosomal recessive inheritance of psoriasis has recently been presented. Indications from more than one type of non-pustular psoriasis has been obtained from the population genetic data. Molecular genetic linkage analysis of psoriasis to a number of polymorphic genetic markers for a large number of families has been made. It is apparent that there is genetic heterogeneity in a psoriasis population with regard to psoriasis genes. Using the computer program Linkage 5.0 and a formula for heterogeneity, a lodscore over 3.0 for one locus has been obtained. This locus has further been confirmed by several other markers in the vicinity. The locus found is linked to slightly over half of the families, indicating that there are more genetically independent types of psoriasis. The age at onset of those families that are apparently linked to this locus have a slightly higher age at onset than those not linked to that locus but with a considerable overlap. In spite of close coverage of the whole chromosomes number 6 and 17, no linkage has been found in this regions. This indicates that neither the HLA region nor the region earlier found to be involved in one family with psoriasis are primarily involved in our families.

Wahlstroem, J.; Swanbeck, G.; Inerot, A. [ Univ. of Goeteborg (Sweden)] [and others

1994-09-01

117

Peptide nucleic acid (PNA): A model structure for the primordial genetic material?  

Microsoft Academic Search

It is proposed that the primordial genetic material could have been peptide nucleic aicds,i.e., DNA analogues having a peptide backbone. PNA momomers based on the amino acid, a, ?-diaminobutyric acid or ornithine are suggested as compounds that could have been formed in the prebiotic soup. Finally, the possibility of a PNA\\/RNA world is presented, in which PNA constitutes the stable

Peter Egil Nielsen

1993-01-01

118

Endogenous Viral Elements in Animal Genomes  

PubMed Central

Integration into the nuclear genome of germ line cells can lead to vertical inheritance of retroviral genes as host alleles. For other viruses, germ line integration has only rarely been documented. Nonetheless, we identified endogenous viral elements (EVEs) derived from ten non-retroviral families by systematic in silico screening of animal genomes, including the first endogenous representatives of double-stranded RNA, reverse-transcribing DNA, and segmented RNA viruses, and the first endogenous DNA viruses in mammalian genomes. Phylogenetic and genomic analysis of EVEs across multiple host species revealed novel information about the origin and evolution of diverse virus groups. Furthermore, several of the elements identified here encode intact open reading frames or are expressed as mRNA. For one element in the primate lineage, we provide statistically robust evidence for exaptation. Our findings establish that genetic material derived from all known viral genome types and replication strategies can enter the animal germ line, greatly broadening the scope of paleovirological studies and indicating a more significant evolutionary role for gene flow from virus to animal genomes than has previously been recognized. PMID:21124940

Katzourakis, Aris; Gifford, Robert J.

2010-01-01

119

The Application of a Genetic Algorithm to Estimate Material Properties for Fire Modeling from Bench-Scale Fire Test Data   

E-print Network

A methodology based on an automated optimization technique that uses a genetic algorithm (GA) is developed to estimate the material properties needed for CFD-based fire growth modeling from bench-scale fire test data. ...

Lautenberger, Chris; Rein, Guillermo; Fernandez-Pello, Carlos

120

Genetic characterization of hepatitis B virus in peripheral blood leukocytes: evidence for selection and compartmentalization of viral variants with the immune escape G145R mutation.  

PubMed

The compartmentalization of viral variants in distinct host tissues is a frequent event in many viral infections. Although hepatitis B virus (HBV) classically is considered hepatotropic, it has strong lymphotropic properties as well. However, unlike other viruses, molecular evolutionary studies to characterize HBV variants in compartments other than hepatocytes or sera have not been performed. The present work attempted to characterize HBV sequences from the peripheral blood leukocytes (PBL) of a large set of subjects, using advanced molecular biology and computational methods. The results of this study revealed the exclusive compartmentalization of HBV subgenotype Ae/A2-specific sequences with a potent immune escape G145R mutation in the PBL of the majority of the subjects. Interestingly, entirely different HBV genotypes/subgenotypes (C, D, or Aa/A1) were found to predominate in the sera of the same study populations. These results suggest that subgenotype Ae/A2 is selectively archived in the PBL, and the high prevalence of G145R indicates high immune pressure and high evolutionary rates of HBV DNA in the PBL. The results are analogous to available literature on the compartmentalization of other viruses. The present work thus provides evidence in favor of the compartment-specific abundance, evolution, and emergence of the potent immune escape mutant. These findings have important implications in the field of HBV molecular epidemiology, transmission, transfusion medicine, organ transplantation, and vaccination strategies. PMID:19420079

Datta, Sibnarayan; Panigrahi, Rajesh; Biswas, Avik; Chandra, Partha K; Banerjee, Arup; Mahapatra, Pradip K; Panda, Chinmoy K; Chakrabarti, Shekhar; Bhattacharya, Sujit K; Biswas, Kuntal; Chakravarty, Runu

2009-10-01

121

Genetic change in the open reading frame of bovine viral diarrhea virus is introduced more rapidly during the establishment of a single persistent infection than from multiple acute infections.  

PubMed

Bovine viral diarrhea viruses (BVDV) are ubiquitous viral pathogens of cattle with a high degree of sequence diversity amongst strains circulating in livestock herds. The driving force behind change in sequence is not well established but the inaccurate replication of the genomic RNA by a viral RNA polymerase without proof-reading capabilities as well as immune pressure on immunodominant proteins are thought to play major roles. Additionally, it is not clear when the majority of changes are introduced, whether during acute infections with exposure to innate and adaptive immune responses or in establishment of persistent infections (PI) in utero. To examine which generates greater sequence diversity, two groups of viruses were compared. The first was six isolates of a single strain of BVDV-2 that were isolated over greater than a year's time. These viruses caused a series of severe acute (SA) BVD outbreaks over a large geographic area. Changes in nucleotide sequence were determined by comparison of the sequence of each strain to the six virus consensus sequence. The second group was composed of six BVDV strains isolated from PI calves whose dams were exposed to PI cattle. Changes were identified by comparison of the sequence of the progenitor PI virus to that of the progeny viruses from the single in vivo 'passage'. The open reading frames (ORF) of the six SA isolates were >99% identical at the nucleotide level with 30% of the changes being nonsynonymous changes. The amount of genetic change increased with time and distance from the original outbreak. Similarly, the PI viruses isolated from single passage PI calves had >99% identity with the progenitor virus. The number of nucleotide changes in these viruses was equal to or greater than that observed in the SA viruses. The majority of the nonsynonymous changes were found in the structural proteins, with 65% of these occurring in the immunodominant E2 protein. Antigenic mapping studies using a monoclonal antibody panel specific for the BVDV E2 protein showed no antigenic differences amongst the six SA viruses, nor between the progenitor and progeny type 1a and type 2 persistent viruses. However, antigenic differences were observed in the two type 1b progeny viruses that possessed the greatest number of amino acid changes. Two antibodies were found to have altered staining patterns. These results suggest that the establishment of a single persistent infection results in more rapid generation of genetic diversity in BVDV strains than a series of acute infections and may contribute to antigenic change in the absence of an immune response. PMID:21470568

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2011-06-01

122

Nest materials as a source of genetic data for avian ecological studies  

USGS Publications Warehouse

We examined the utility of feathers and egg shell membranes, deposited in the nests of Spectacled Eiders (Somateria fischeri), as a source of DNA for genetic studies at both the population and individual level. The potential for feather DNA contamination as a result of female behavioral interactions (e.g. nest parasitism), reuse of nest sites from previous years, or other unknown occurrences was acknowledged and specifically tested. DNA was successfully extracted from both feathers and egg shell membranes and waterfowl microsatellite loci were used to construct individual genotypes. We found no difference in the genotypes obtained from nest feathers or blood of the incubating female. Detection of nest feather contamination was possible with as little as one feather when samples from multiple females were intentionally mixed. Triplicate DNA extractions from 33 nests provided a means of detecting contamination in 3 nests. Egg membranes proved a viable source of offspring DNA and can contribute valuable data to investigations of parentage when assayed jointly with maternal feather DNA. Nest materials provide an efficient, non-invasive method of genetic sampling that can be readily incorporated into field research. However, the natural history traits and mating strategies of a species must be considered during sample collection to identify the possible sources of nest materials (e.g., paternal, maternal, parasite, etc.). Specific experiments should also be designed to test sampling assumptions.

Pearce, J.M.; Fields, R.L.; Scribner, K.T.

1997-01-01

123

Comparing viral metagenomics methods using a highly multiplexed human viral pathogens reagent.  

PubMed

Unbiased metagenomic sequencing holds significant potential as a diagnostic tool for the simultaneous detection of any previously genetically described viral nucleic acids in clinical samples. Viral genome sequences can also inform on likely phenotypes including drug susceptibility or neutralization serotypes. In this study, different variables of the laboratory methods often used to generate viral metagenomics libraries were compared for their abilities to detect multiple viruses and generate full genome coverage. A biological reagent consisting of 25 different human RNA and DNA viral pathogens was used to estimate the effect of filtration and nuclease digestion, DNA/RNA extraction methods, pre-amplification and the use of different library preparation kits on the detection of viral nucleic acids. Filtration and nuclease treatment led to slight decreases in the percentage of viral sequence reads and number of viruses detected. For nucleic acid extractions silica spin columns improved viral sequence recovery relative to magnetic beads and Trizol extraction. Pre-amplification using random RT-PCR while generating more viral sequence reads resulted in detection of fewer viruses, more overlapping sequences, and lower genome coverage. The ScriptSeq library preparation method retrieved more viruses and a greater fraction of their genomes than the TruSeq and Nextera methods. Viral metagenomics sequencing was able to simultaneously detect up to 22 different viruses in the biological reagent analyzed including all those detected by qPCR. Further optimization will be required for the detection of viruses in biologically more complex samples such as tissues, blood, or feces. PMID:25497414

Li, Linlin; Deng, Xutao; Mee, Edward T; Collot-Teixeira, Sophie; Anderson, Rob; Schepelmann, Silke; Minor, Philip D; Delwart, Eric

2015-03-01

124

Maintenance of picobirnavirus (PBV) infection in an adult orangutan (Pongo pygmaeus) and genetic diversity of excreted viral strains during a three-year period.  

PubMed

The present work provide data about the maintenance of picobirnavirus (PBV) infection during adulthood in a mammalian host. For this purpose PBV infection was studied in an adult orangutan (Pongo pygmaeus) by PAGE/SS, RT-PCR and nucleotide sequencing. PBV infection in the animal was asymptomatic and was characterized by interspaced silent and high/ low active viral excretion periods. The PBV strains excreted by the studied individual were identified as genogroup I and revealed a nucleotide identity among them of 64-81%. The results obtained allowed to arrive to a deeper understanding of the natural history of PBV infection, which seems to be characterized by new-born, juvenile and adult asymptomatic hosts which persistently excrete closely related strains in their feces. Consequently, picobirnaviruses could be considered frequent inhabitants of the gastrointestinal tract, leaving the question open about the molecular mechanisms governing persistent and asymptomatic coexistence within the host and the potential host suitability to maintain this relationship. PMID:25435283

Masachessi, Gisela; Ganesh, Balasubramanian; Martinez, Laura C; Giordano, Miguel O; Barril, Patricia A; Isa, Maria B; Paván, Giorgio V; Mateos, Carlos A; Nates, Silvia V

2015-01-01

125

Genetics  

Microsoft Academic Search

The author draws on modern research to introduce genetics in a molecular and cellular context. This work covers the structure of DNA and the gene and gene expression, replication, mutation, and recombination, looks at the gene in the context of the cell and organism, describes the elements of genetic analysis and the basic principles of inheritance, and examines classic experiments

1990-01-01

126

Detecting un-authorized genetically modified organisms (GMOs) and derived materials.  

PubMed

Genetically modified plants, in the following referred to as genetically modified organisms or GMOs, have been commercially grown for almost two decades. In 2010 approximately 10% of the total global crop acreage was planted with GMOs (James, 2011). More than 30 countries have been growing commercial GMOs, and many more have performed field trials. Although the majority of commercial GMOs both in terms of acreage and specific events belong to the four species: soybean, maize, cotton and rapeseed, there are another 20+ species where GMOs are commercialized or in the pipeline for commercialization. The number of GMOs cultivated in field trials or for commercial production has constantly increased during this time period. So have the number of species, the number of countries involved, the diversity of novel (added) genetic elements and the global trade. All of these factors contribute to the increasing complexity of detecting and correctly identifying GMO derived material. Many jurisdictions, including the European Union (EU), legally distinguish between authorized (and therefore legal) and un-authorized (and therefore illegal) GMOs. Information about the developments, field trials, authorizations, cultivation, trade and observations made in the official GMO control laboratories in different countries around the world is often limited, despite several attempts such as the OECD BioTrack for voluntary dissemination of data. This lack of information inevitably makes it challenging to detect and identify GMOs, especially the un-authorized GMOs. The present paper reviews the state of the art technologies and approaches in light of coverage, practicability, sensitivity and limitations. Emphasis is put on exemplifying practical detection of un-authorized GMOs. Although this paper has a European (EU) bias when examples are given, the contents have global relevance. PMID:22333321

Holst-Jensen, Arne; Bertheau, Yves; de Loose, Marc; Grohmann, Lutz; Hamels, Sandrine; Hougs, Lotte; Morisset, Dany; Pecoraro, Sven; Pla, Maria; Van den Bulcke, Marc; Wulff, Doerte

2012-01-01

127

A Novel, Real-Valued Genetic Algorithm for Optimizing Radar Absorbing Materials  

NASA Technical Reports Server (NTRS)

A novel, real-valued Genetic Algorithm (GA) was designed and implemented to minimize the reflectivity and/or transmissivity of an arbitrary number of homogeneous, lossy dielectric or magnetic layers of arbitrary thickness positioned at either the center of an infinitely long rectangular waveguide, or adjacent to the perfectly conducting backplate of a semi-infinite, shorted-out rectangular waveguide. Evolutionary processes extract the optimal physioelectric constants falling within specified constraints which minimize reflection and/or transmission over the frequency band of interest. This GA extracted the unphysical dielectric and magnetic constants of three layers of fictitious material placed adjacent to the conducting backplate of a shorted-out waveguide such that the reflectivity of the configuration was 55 dB or less over the entire X-band. Examples of the optimization of realistic multi-layer absorbers are also presented. Although typical Genetic Algorithms require populations of many thousands in order to function properly and obtain correct results, verified correct results were obtained for all test cases using this GA with a population of only four.

Hall, John Michael

2004-01-01

128

Barriers to non-viral vector-mediated gene delivery in the nervous system.  

PubMed

Efficient methods for cell line transfection are well described, but, for primary neurons, a high-yield method different from those relying on viral vectors is lacking. Viral transfection has several drawbacks, such as the complexity of vector preparation, safety concerns, and the generation of immune and inflammatory responses when used in vivo. However, one of the main problems for the use of non-viral gene vectors for neuronal transfection is their low efficiency when compared with viral vectors. Transgene expression, or siRNA delivery mediated by non-viral vectors, is the result of multiple processes related to cellular membrane crossing, intracellular traffic, and/or nuclear delivery of the genetic material cargo. This review will deal with the barriers that different nanoparticles (cationic lipids, polyethyleneimine, dendrimers and carbon nanotubes) must overcome to efficiently deliver their cargo to central nervous system cells, including internalization into the neurons, interaction with intracellular organelles such as lysosomes, and transport across the nuclear membrane of the neuron in the case of DNA transfection. Furthermore, when used in vivo, the nanoparticles should efficiently cross the blood-brain barrier to reach the target cells in the brain. PMID:21225319

Pérez-Martínez, Francisco C; Guerra, Javier; Posadas, Inmaculada; Ceña, Valentín

2011-08-01

129

Viral nanoparticles as macromolecular devices for new therapeutic and pharmaceutical approaches  

PubMed Central

Viral nanoparticles are molecular cages derived from the assembly of viral structural proteins. They bear several peculiar features as proper dimensions for nanoscale applications, size homogeneity, an intrinsic robustness, a large surface area to mass ratio and a defined, repetitive and symmetric macromolecular organization. A number of expression strategies, using various biological systems, efficiently enable the production of significant quantities of viral nanoparticles, which can be easily purified. Genetic engineering and in vitro chemical modification consent to manipulate of the outer and inner surface of these nanocages, allowing specific changes of the original physico-chemical and biological properties. Moreover, several studies have focused on the in vitro disassembly/reassembly and gating of viral nanoparticles, with the aim of encapsulating exogenous molecules inside and therefore improving their potential as containment delivery devices. These technological progresses have led research to a growing variety of applications in different fields such as biomedicine, pharmacology, separation science, catalytic chemistry, crop pest control and material science. In this review we will focus on the strategies used to modify the characteristics of viral nanoparticles and on their use in biomedicine and pharmacology. PMID:21383892

Grasso, Simone; Santi, Luca

2010-01-01

130

Development of genomic DNA reference materials for genetic testing of disorders common in people of ashkenazi jewish descent.  

PubMed

Many recessive genetic disorders are found at a higher incidence in people of Ashkenazi Jewish (AJ) descent than in the general population. The American College of Medical Genetics and the American College of Obstetricians and Gynecologists have recommended that individuals of AJ descent undergo carrier screening for Tay Sachs disease, Canavan disease, familial dysautonomia, mucolipidosis IV, Niemann-Pick disease type A, Fanconi anemia type C, Bloom syndrome, and Gaucher disease. Although these recommendations have led to increased test volumes and number of laboratories offering AJ screening, well-characterized genomic reference materials are not publicly available. The Centers for Disease Control and Prevention-based Genetic Testing Reference Materials Coordination Program, in collaboration with members of the genetic testing community and Coriell Cell Repositories, have developed a panel of characterized genomic reference materials for AJ genetic testing. DNA from 31 cell lines, representing many of the common alleles for Tay Sachs disease, Canavan disease, familial dysautonomia, mucolipidosis IV, Niemann-Pick disease type A, Fanconi anemia type C, Bloom syndrome, Gaucher disease, and glycogen storage disease, was prepared by the Repository and tested in six clinical laboratories using three different PCR-based assay platforms. A total of 33 disease alleles was assayed and 25 different alleles were identified. These characterized materials are publicly available from Coriell and may be used for quality control, proficiency testing, test development, and research. PMID:19815695

Kalman, Lisa; Wilson, Jean Amos; Buller, Arlene; Dixon, John; Edelmann, Lisa; Geller, Louis; Highsmith, William Edward; Holtegaard, Leonard; Kornreich, Ruth; Rohlfs, Elizabeth M; Payeur, Toby L; Sellers, Tina; Toji, Lorraine; Muralidharan, Kasinathan

2009-11-01

131

Genetic change in the open reading frame of bovine viral diarrhea virus is introduced more rapidly during the establishment of a single persistent infection than from multiple acute infections  

Microsoft Academic Search

Bovine viral diarrhea viruses (BVDV) are ubiquitous viral pathogens of cattle with a high degree of sequence diversity amongst strains circulating in livestock herds. The driving force behind change in sequence is not well established but the inaccurate replication of the genomic RNA by a viral RNA polymerase without proof-reading capabilities as well as immune pressure on immunodominant proteins are

John D. Neill; Benjamin W. Newcomer; Shonda D. Marley; Julia F. Ridpath; M. Daniel Givens

2011-01-01

132

Genetic change in the open reading frame of bovine viral diarrhea virus is introduced more rapidly during the establishment of a single persistent infection than by multiple acute infections  

Technology Transfer Automated Retrieval System (TEKTRAN)

Bovine viral diarrhea viruses (BVDV) are ubiquitous viral pathogens of cattle. There is a high degree of sequence diversity between strains circulating in livestock herds. The driving force behind change in sequence is not known but the inaccurate replication of the genomic RNA by a viral RNA polyme...

133

Development of multiplex rt-PCR for simultaneous detection of garlic viruses and the incidence of garlic viral disease in garlic genetic resources.  

PubMed

Garlic generally becomes coinfected with several types of viruses belonging to the Potyvirus, Carlavirus, and Allexivirus genera. These viruses produce characteristically similar symptoms, they cannot be easily identified by electron microscopy (EM) or immunological detection methods, and they are currently widespread around the world, thereby affecting crop yields and crop quality adversely. For the early and reliable detection of garlic viruses, virus-specific sets of primers, including species-specific and genus-specific primers were designed. To effectively detect the twelve different types of garlic viruses, primer mixtures were tested and divided into two independent sets for multiplex polymerase chain reaction (PCR). The multiplex PCR assays were able to detect specific targets up to the similar dilution series with monoplex reverse transcription (RT)-PCR. Seventy-two field samples collected by the Gyeongbuk Agricultural Technology Administration were analyzed by multiplex RT-PCR. All seventy two samples were infected with at least one virus, and the coinfection rate was 78%. We conclude that the simultaneous detection system developed in this study can effectively detect and differentiate mixed viral infections in garlic. PMID:25774116

Nam, Moon; Lee, Yeong-Hoon; Park, Chung Youl; Lee, Min-A; Bae, Yang-Soo; Lim, Seungmo; Lee, Joong Hwan; Moon, Jae Sun; Lee, Su-Heon

2015-03-01

134

The genetic drift of human papillomavirus type 16 is a means of reconstructing prehistoric viral spread and the movement of ancient human populations.  

PubMed Central

We have investigated the diversity of a hypervariable segment of the human papillomavirus type 16 (HPV-16) genome among 301 virus isolates that were collected from 25 different ethnic groups and geographic locations. Altogether, we distinguished 48 different variants that had diversified from one another along five phylogenetic branches. Variants from two of these branches were nearly completely confined to Africa. Variants from a third branch were the only variants identified in Europeans but occurred at lower frequency in all other ethnic groups. A fourth branch was specific for Japanese and Chinese isolates. A small fraction of all isolates from Asia and from indigenous as well as immigrant populations in the Americas formed a fifth branch. Important patterns of HPV-16 phylogeny suggested coevolution of the virus with people of the three major human races, namely, Africans, Caucasians, and East Asians. But several minor patterns are indicative of smaller bottlenecks of viral evolution and spread, which may correlate with the migration of ethnic groups in prehistoric times. The colonization of the Americas by Europeans and Africans is reflected in the composition of their HPV-16 variants. We discuss arguments that today's HPV-16 genomes represent a degree of diversity that evolved over a large time span, probably exceeding 200,000 years, from a precursor genome that may have originated in Africa. The identification of molecular variants is a powerful epidemiological and phylogenetic tool for revealing the ancient spread of papillomaviruses, whose trace through the world has not yet been completely lost. PMID:8411343

Ho, L; Chan, S Y; Burk, R D; Das, B C; Fujinaga, K; Icenogle, J P; Kahn, T; Kiviat, N; Lancaster, W; Mavromara-Nazos, P

1993-01-01

135

Development of Multiplex RT-PCR for Simultaneous Detection of Garlic Viruses and the Incidence of Garlic Viral Disease in Garlic Genetic Resources  

PubMed Central

Garlic generally becomes coinfected with several types of viruses belonging to the Potyvirus, Carlavirus, and Allexivirus genera. These viruses produce characteristically similar symptoms, they cannot be easily identified by electron microscopy (EM) or immunological detection methods, and they are currently widespread around the world, thereby affecting crop yields and crop quality adversely. For the early and reliable detection of garlic viruses, virus-specific sets of primers, including species-specific and genus-specific primers were designed. To effectively detect the twelve different types of garlic viruses, primer mixtures were tested and divided into two independent sets for multiplex polymerase chain reaction (PCR). The multiplex PCR assays were able to detect specific targets up to the similar dilution series with monoplex reverse transcription (RT)-PCR. Seventy-two field samples collected by the Gyeongbuk Agricultural Technology Administration were analyzed by multiplex RT-PCR. All seventy two samples were infected with at least one virus, and the coinfection rate was 78%. We conclude that the simultaneous detection system developed in this study can effectively detect and differentiate mixed viral infections in garlic.

Nam, Moon; Lee, Yeong-Hoon; Park, Chung Youl; Lee, Min-A; Bae, Yang-Soo; Lim, Seungmo; Lee, Joong Hwan; Moon, Jae Sun; Lee, Su-Heon

2015-01-01

136

Genetics  

NSDL National Science Digital Library

This activity helps students to understand basic principles of genetics, including relationships of genotype to phenotype, concepts of recessive and dominant alleles, and how understanding meiosis and fertilization provides the basis for understanding inheritance, as summarized in Punnett squares. The Student Handout includes an analysis of the inheritance of albinism that teaches all of these concepts, a Coin Toss Genetics activity that helps students understand the probabilistic nature of Punnett square predictions, and an analysis of the inheritance of sickle cell anemia that reinforces the basic concepts and introduces some of the complexities of genetics. The Genetics Supplement includes two additional activities, an analysis of student data on the sex makeup of sibships and pedigree analyses of recessive and dominant alleles with challenge questions that introduce the role of mutations and an evaluation of Punnett squares and pedigrees as models of inheritance.

Jennifer Doherty

137

Genetics  

NSDL National Science Digital Library

What affects how physical characteristics are transmitted from parent to offspring? This is a question that can be answered at many levels. Molecular biologists examine the pattern of nucleotides in deoxyribonucleic acid (DNA) and the effect of mutations on the proteins produced. Classical geneticists explore the patterns by which traits are transmitted through families. Medical geneticists attempt to describe and develop treatments for diseases that have a genetic component. Genetic engineers analyze how traits can be altered in organisms through modern technology. These are only a few of the strategies that scientists employ to explain the nature of heredity. Explore historical perspectives on the study of genetics and investigate how cutting-edge technology is being used to expand our understanding of heredity.

National Science Teachers Association (NSTA)

2005-04-01

138

Systemic Agrobacterium tumefaciens–mediated transfection of viral replicons for efficient transient expression in plants  

Microsoft Academic Search

Plant biotechnology relies on two approaches for delivery and expression of heterologous genes in plants: stable genetic transformation and transient expression using viral vectors. Although much faster, the transient route is limited by low infectivity of viral vectors carrying average-sized or large genes. We have developed constructs for the efficient delivery of RNA viral vectors as DNA precursors and show

Sylvestre Marillonnet; Carola Thoeringer; Romy Kandzia; Victor Klimyuk; Yuri Gleba

2005-01-01

139

Fulminant viral hepatitis.  

PubMed

Acute liver failure (ALF) is a condition wherein the previously healthy liver rapidly deteriorates, resulting in jaundice, encephalopathy, and coagulopathy. There are approximately 2000 cases per year of ALF in the United States. Viral causes (fulminant viral hepatitis [FVH]) are the predominant cause of ALF in developing countries. Given the ease of spread of viral hepatitis and the high morbidity and mortality associated with ALF, a systematic approach to the diagnosis and treatment of FVH is required. In this review, the authors describe the viral causes of ALF and review the intensive care unit management of patients with FVH. PMID:23830658

Jayakumar, Saumya; Chowdhury, Raiyan; Ye, Carrie; Karvellas, Constantine J

2013-07-01

140

Correlates of viral richness in bats (order Chiroptera).  

PubMed

Historic and contemporary host ecology and evolutionary dynamics have profound impacts on viral diversity, virulence, and associated disease emergence. Bats have been recognized as reservoirs for several emerging viral pathogens, and are unique among mammals in their vagility, potential for long-distance dispersal, and often very large, colonial populations. We investigate the relative influences of host ecology and population genetic structure for predictions of viral richness in relevant reservoir species. We test the hypothesis that host geographic range area, distribution, population genetic structure, migratory behavior, International Union for Conservation of Nature and Natural Resources (IUCN) threat status, body mass, and colony size, are associated with known viral richness in bats. We analyze host traits and viral richness in a generalized linear regression model framework, and include a correction for sampling effort and phylogeny. We find evidence that sampling effort, IUCN status, and population genetic structure correlate with observed viral species richness in bats, and that these associations are independent of phylogeny. This study is an important first step in understanding the mechanisms that promote viral richness in reservoir species, and may aid in predicting the emergence of viral zoonoses from bats. PMID:20049506

Turmelle, Amy S; Olival, Kevin J

2009-12-01

141

Direct observations of DNA provides new insights into how genetic material is copied and repaired News-Medical.Net  

E-print Network

News-Medical.Net · Home Page Direct observations of DNA provides new insights into how genetic material is copied and repaired Medical Research News Published: Thursday, 21-Sep-2006 Printer Friendly Email and repaired. "We can monitor the process directly, and that gives us a different perspective," said Roberto

Kowalczykowski, Stephen C.

142

Engineering Biomaterial Systems to Enhance Viral Vector Gene Delivery  

Microsoft Academic Search

Integrating viral gene delivery with engineered biomaterials is a promising strategy to overcome a number of challenges associated with virus-mediated gene delivery, including inefficient delivery to specific cell types, limited tropism, spread of vectors to distant sites, and immune responses. Viral vectors can be combined with biomaterials either through encapsulation within the material or immobilization onto a material surface. Subsequent

Jae-Hyung Jang; David V Schaffer; Lonnie D Shea

2011-01-01

143

Genetics  

Technology Transfer Automated Retrieval System (TEKTRAN)

The genus Capsicum represents one of several well characterized Solanaceous genera. A wealth of classical and molecular genetics research is available for the genus. Information gleaned from its cultivated relatives, tomato and potato, provide further insight for basic and applied studies. Early ...

144

Genetics  

Technology Transfer Automated Retrieval System (TEKTRAN)

Maintaining genetic variation in wild populations of Arctic organisms is fundamental to the long-term persistence of high latitude biodiversity. Variability is important because it provides options for species to respond to changing environmental conditions and novel challenges such as emerging path...

145

[Cell analogs of viral proteins].  

PubMed

Horizontal transfer of genes between viruses and their hosts played an important role in the evolution of various eukaryotes including contemporary mammals as well as the pathogens themselves. Elements of viruses of various types can be found in the genome of animals. Endogenous retroviral elements composing up to 8% of human genome length not only determine its high flexibility and rapid adaptation potential. Many of virus genes such as Fv1, Lv1, Lv2 being analogues of capsid and other proteins determine effective suppression of viral replication after cell penetration by the causative agent. Introduction of these elements into genome of a wide variety of animals from fish to primates could have taken place against the background of global natural cataclysms of viral origin. Integration of retrovirus genes coding surface glycoproteins with immunosuppressing domains into genetic apparatus of animals served as an impetus to the development of viviparity and spread ofplacental mammals. Their cell analogs syncytins perform a dual function: take direct part in the formation of syncytiotrophoblast layer of placenta and ensure tolerance of immune system of mother to embryo. The acquisition of cell genes by viruses also played an important role in their evolution: various interleukins and other modulators of immune response introduced into viral genome from cell genetic apparatus became one of the most important factors of pathogenicity of a wide variety of causative agents including poxviruses, cytomegalovirus, Epstein-Barr virus and many others. Evolutionary pathways of the virus and host are thus inseparable from each other, and character of one of these directions is largely dictated by the vector of another. PMID:25051706

Blinov, V M; Ga?sler, V; Krasnov, G S; Shargunov, A V; Shurdov, M A; Zverev, V V

2014-01-01

146

Broad-Spectrum Drugs Against Viral Agents  

PubMed Central

Development of antivirals has focused primarily on vaccines and on treatments for specific viral agents. Although effective, these approaches may be limited in situations where the etiologic agent is unknown or when the target virus has undergone mutation, recombination or reassortment. Augmentation of the innate immune response may be an effective alternative for disease amelioration. Nonspecific, broad-spectrum immune responses can be induced by double-stranded (ds)RNAs such as poly (ICLC), or oligonucleotides (ODNs) containing unmethylated deocycytidyl-deoxyguanosinyl (CpG) motifs. These may offer protection against various bacterial and viral pathogens regardless of their genetic makeup, zoonotic origin or drug resistance. PMID:19325820

Christopher, Mary E.; Wong, Jonathan P.

2008-01-01

147

Abstract--Genetic diversity in plant materials used for reveg-etation of disturbed sites is important to allow natural selection  

E-print Network

267 Abstract--Genetic diversity in plant materials used for reveg- etation of disturbed sites for uniform products to deter the use of diverse material, as is the case with culti- vated plants in a variety of environments. Genetically diverse seed sources can be self-adapting, where those plants most

148

Development of a Genomic DNA Reference Material Panel for Rett Syndrome (MECP2-Related Disorders) Genetic Testing  

PubMed Central

Rett syndrome is a dominant X-linked disorder caused by point mutations (approximately 80%) or by deletions or insertions (approximately 15% to 18%) in the MECP2 gene. It is most common in females but lethal in males, with a distinctly different phenotype. Rett syndrome patients have severe neurological and behavioral problems. Clinical genetic testing laboratories commonly use characterized genomic DNA reference materials to assure the quality of the testing process; however, none are commercially available for MECP2 genetic testing. The Centers for Disease Control and Prevention’s Genetic Testing Reference Material Coordination Program, in collaboration with the genetic testing community and the Coriell Cell Repositories, established 27 new cell lines and characterized the MECP2 mutations in these and in 8 previously available cell lines. DNA samples from the 35 cell lines were tested by eight clinical genetic testing laboratories using DNA sequence analysis and methods to assess copy number (multiplex ligation-dependent probe amplification, semiquantitative PCR, or array-based comparative genomic hybridization). The eight common point mutations known to cause approximately 60% of Rett syndrome cases were identified, as were other MECP2 variants, including deletions, duplications, and frame shift and splice-site mutations. Two of the 35 samples were from males with MECP2 duplications. These MECP2 and other characterized genomic DNA samples are publicly available from the NIGMS Repository at the Coriell Cell Repositories. PMID:24508304

Kalman, Lisa V.; Tarleton, Jack C.; Percy, Alan K.; Aradhya, Swaroop; Bale, Sherri; Barker, Shannon D.; Bayrak-Toydemir, Pinar; Bridges, Christina; Buller-Burckle, Arlene M.; Das, Soma; Iyer, Ramaswamy K.; Vo, Timothy D.; Zvereff, Val V.; Toji, Lorraine H.

2015-01-01

149

MILESTONES LEADING TO THE GENETIC ENGINEERING OF BACULOVIRUSES AS EXPRESSION  

E-print Network

MILESTONES LEADING TO THE GENETIC ENGINEERING OF BACULOVIRUSES AS EXPRESSION VECTOR SYSTEMS and Infection VI. Genetically Engineered Viral Pesticides A. Development of Genetically Engineered Baculovirus, therapeutics, and diagnostics. The genetic engineering of the baculovirus polyhedrin gene promoter

Summers, Max D.

150

Viral Disease Networks?  

NASA Astrophysics Data System (ADS)

Viral infections induce multiple perturbations that spread along the links of the biological networks of the host cells. Understanding the impact of these cascading perturbations requires an exhaustive knowledge of the cellular machinery as well as a systems biology approach that reveals how individual components of the cellular system function together. Here we describe an integrative method that provides a new approach to studying virus-human interactions and its correlations with diseases. Our method involves the combined utilization of protein - protein interactions, protein -- DNA interactions, metabolomics and gene - disease associations to build a ``viraldiseasome''. By solely using high-throughput data, we map well-known viral associated diseases and predict new candidate viral diseases. We use microarray data of virus-infected tissues and patient medical history data to further test the implications of the viral diseasome. We apply this method to Epstein-Barr virus and Human Papillomavirus and shed light into molecular development of viral diseases and disease pathways.

Gulbahce, Natali; Yan, Han; Vidal, Marc; Barabasi, Albert-Laszlo

2010-03-01

151

RNA genetics  

SciTech Connect

This book contains the proceedings on RNA genetics: RNA-directed virus replication Volume 1. Topics covered include: Replication of the poliovirus genome; Influenza viral RNA transcription and replication; and Relication of the reoviridal: Information derived from gene cloning and expression.

Domingo, E. (Instituto de Biologia Molecular, Facultad de Ciencias, Universidad Autonoma de Madrid, Canto Blanco, Madrid (ES)); Holland, J.J. (California Univ., San Diego, La Jolla, CA (USA). Dept. of Biology); Ahlquist, P. (Wisconsin Univ., Madison, WI (USA). Dept. of Plant Pathology)

1988-01-01

152

Viruses That Cross Borders: Factors Responsible for Global Dissemination of Viral Infections  

Microsoft Academic Search

Objective: Pandemic viral infections as emerging infectious diseases are of a great global concern. However, for some viruses, particular strains are endemic to specific areas and can be genetically distinguished from strains in other regions. In contrast, for some other viruses, genetically similar strains can spread and circulate all over the world. This study addresses global dissemination of various viral

Yuki Furuse; Akira Suzuki; Taro Kamigaki; Emmanuel Abraham Mpolya; Irona Khandaker; Hitoshi Oshitani

2011-01-01

153

Best Pract Res Clin Gastroenterol . Author manuscript Diagnosis and management of chronic viral hepatitis: antigens, antibodies  

E-print Network

of chronic viral hepatitis: antigens, antibodies and viral genomes St phane Chevaliezé 1 2 , Jean ; Hepatitis B Antibodies ; blood ; Hepatitis B Antigens ; blood ; Hepatitis B virus ; genetics ; Hepatitis B, Chronic ; blood ; diagnosis ; drug therapy ; genetics ; Hepatitis C Antibodies ; blood ; Hepatitis C

Paris-Sud XI, Université de

154

Impacts of human leukocyte antigen DQ genetic polymorphisms and their interactions with hepatitis B virus mutations on the risks of viral persistence, liver cirrhosis, and hepatocellular carcinoma.  

PubMed

Human leukocyte antigen (HLA)-DQ genetic polymorphisms have been associated with chronic hepatitis B virus (HBV) outcomes. We aimed to determine impacts of HLA-DQ polymorphisms and their interactions with HBV mutations on the risks of liver cirrhosis (LC) and hepatocellular carcinoma (HCC). rs2856718 (A>G) and rs9275319 (A>G) were genotyped in 1342 healthy controls, 327 HBV surface antigen (HBsAg) seroclearance subjects, 611 asymptomatic HBsAg carriers (ASCs), 1144 chronic hepatitis B (CHB) patients, 734 LC patients, and 1531 HCC patients using quantitative PCR. HBV mutations were detected by direct sequencing. Logistic regression analyses were utilized to assess the factors and/or multiplicative interactions significantly associated with liver diseases. rs9275319 variant genotypes were inversely associated with HBV persistence compared to HBV natural clearance subjects. rs2856718 variant genotypes significantly increased LC risk compared to ASCs plus CHB patients (GG vs. AA: odds ratio [OR], 1.52, 95% confidence interval [CI], 1.17-1.97 and AG+GG vs. AA: OR, 1.27; 95% CI, 1.04-1.54) and decreased HCC risk compared to HCC-free HBV-infected subjects (AG vs. AA: OR, 0.76; 95% CI, 0.65-0.89 and AG+GG vs. AA: OR, 0.78, 95% CI, 0.68-0.90). rs2856718 variant genotypes were significantly associated with an increased frequency of HBV A1726C mutation, a LC-risk, HCC-protective mutation, in genotype C. A rs9275319 variant genotype (GG) was significantly associated with an increased frequency of preS1 start codon mutation, an HCC-risk mutation, in genotype C. The interaction of rs2856718 AG+GG genotype with T1753V, a HCC-risk mutation, significantly reduced LC risk, with an OR of 0.26 (95% CI, 0.09-0.78); whereas the interaction of rs2856718 AG genotype with C1673T, a LC-risk mutation, significantly increased HCC risk, with an OR of 2.80 (95% CI, 1.02-7.66) in genotype C HBV-infected subjects. Conclusively, the HLA-DQ polymorphisms affect the risks of LC and HCC differently in chronic HBV-infected subjects, possibly via interacting with the HBV mutations. PMID:25281206

Ji, Xiaowei; Zhang, Qi; Li, Bin; Du, Yan; Yin, Jianhua; Liu, Wenbin; Zhang, Hongwei; Cao, Guangwen

2014-12-01

155

HUMAN VIRAL ONCOGENESIS: A CANCER HALLMARKS ANALYSIS  

PubMed Central

Approximately twelve percent of all human cancers are caused by oncoviruses. Human viral oncogenesis is complex and only a small percentage of the infected individuals develop cancer and often many years to decades after initial infection. This reflects the multistep nature of viral oncogenesis, host genetic variability and the fact that viruses contribute to only a portion of the oncogenic events. In this review, the Hallmarks of Cancer framework of Hanahan & Weinberg (2000 and 2011) is used to dissect the viral, host and environmental co-factors that contribute to the biology of multistep oncogenesis mediated by established human oncoviruses. The viruses discussed include Epstein Barr Virus (EBV), high-risk Human Papillomaviruses (HPV16/18), Hepatitis B and C viruses (HBV, HCV respectively), Human T-cell lymphotropic virus-1 (HTLV-1) and Kaposi’s sarcoma herpesvirus (KSHV). PMID:24629334

Mesri, Enrique A.; Feitelson, Mark; Munger, Karl

2014-01-01

156

Patenting of human genetic material v. bioethics: revisiting the case of John Moore v. Regents of the University of California.  

PubMed

Moore v. Regents of the University of California was one of the first cases internationally that dealt with the patenting of human genetic material. The case is closely related to the development of medicine and of biotechnology applied to medicine. These developments require the utilisation of human body parts, both for experiments and for transplant, and present certain major medico-legal problems. However, the case did not produce conclusive decisions on the various key legal issues that it raised involved in biomedical research and the patenting of human genetic material. This article re-examines the case from an Indian and an international perspective. After a brief introduction in Part I, Part II of the article describes existing laws in various countries with respect to the patenting of human genetic material. Part III discusses legal regimes applicable in the context of biological materials. Part IV elaborates on the importance of the doctrine of informed consent in the context of biomedical research on human subjects. Part V discusses the significance of bioethics in research and the patenting of biotechnology, according to international law. Part VI concludes the article with an assertion of the urgent need for legislation in this area. PMID:20432879

Narayanan, Nithya

2010-01-01

157

Genetics  

NSDL National Science Digital Library

Genetics is the branch of biology that studies the ways in which hereditary information is passed on from the parents to their offspring. As we study this unit, I will be asking you to visit the following websites to emphasize concepts brought up during class. DNA Structure and Replication Build a DNA molecule Use this website to practice matching up complementary nucleotides in the DNA molecule. How DNA Replicates Take a look at this short video clip that demonstrates how the DNA molecule replicates. A Science Odyssey :You Try It: DNA Workshop When you get to this website, click on \\"Go directly to the DNA Workshop\\". Click on DNA replication on the left ...

Miss Goodfellow

2007-10-23

158

Genetics  

NSDL National Science Digital Library

This online tutorial from the TheTech Museum of Innovation focuses on genetics. The interactive topics will initially introduce the user to the DNA, chromosomes, and the make up of human genes. Further topics will examine forensic science, the history of forensics, fingerprinting, and cloning background research and community response to cloning. Finally, the resource provides connections to gallery exhibits, science labs, and a design challenge that engages the learner to write a persuasive letter to a group or organization responsible for cloning or DNA decision making. Copyright 2005 International Technology Education Association

The Tech Museum of Innovation

2004-01-01

159

The Fecal Viral Flora of Wild Rodents  

PubMed Central

The frequent interactions of rodents with humans make them a common source of zoonotic infections. To obtain an initial unbiased measure of the viral diversity in the enteric tract of wild rodents we sequenced partially purified, randomly amplified viral RNA and DNA in the feces of 105 wild rodents (mouse, vole, and rat) collected in California and Virginia. We identified in decreasing frequency sequences related to the mammalian viruses families Circoviridae, Picobirnaviridae, Picornaviridae, Astroviridae, Parvoviridae, Papillomaviridae, Adenoviridae, and Coronaviridae. Seventeen small circular DNA genomes containing one or two replicase genes distantly related to the Circoviridae representing several potentially new viral families were characterized. In the Picornaviridae family two new candidate genera as well as a close genetic relative of the human pathogen Aichi virus were characterized. Fragments of the first mouse sapelovirus and picobirnaviruses were identified and the first murine astrovirus genome was characterized. A mouse papillomavirus genome and fragments of a novel adenovirus and adenovirus-associated virus were also sequenced. The next largest fraction of the rodent fecal virome was related to insect viruses of the Densoviridae, Iridoviridae, Polydnaviridae, Dicistroviriade, Bromoviridae, and Virgaviridae families followed by plant virus-related sequences in the Nanoviridae, Geminiviridae, Phycodnaviridae, Secoviridae, Partitiviridae, Tymoviridae, Alphaflexiviridae, and Tombusviridae families reflecting the largely insect and plant rodent diet. Phylogenetic analyses of full and partial viral genomes therefore revealed many previously unreported viral species, genera, and families. The close genetic similarities noted between some rodent and human viruses might reflect past zoonoses. This study increases our understanding of the viral diversity in wild rodents and highlights the large number of still uncharacterized viruses in mammals. PMID:21909269

Phan, Tung G.; Kapusinszky, Beatrix; Wang, Chunlin; Rose, Robert K.; Lipton, Howard L.; Delwart, Eric L.

2011-01-01

160

Viruses and viral proteins  

PubMed Central

For more than 30 years X-ray crystallography has been by far the most powerful approach for determining the structures of viruses and viral proteins at atomic resolution. The information provided by these structures, which covers many important aspects of the viral life cycle such as cell-receptor recognition, viral entry, nucleic acid transfer and genome replication, has extensively enriched our vision of the virus world. Many of the structures available correspond to potential targets for antiviral drugs against important human pathogens. This article provides an overview of the current knowledge of different structural aspects of the above-mentioned processes. PMID:25485129

Verdaguer, Nuria; Ferrero, Diego; Murthy, Mathur R. N.

2014-01-01

161

Determination of the chondrogenic differentiation processes in human bone marrow-derived mesenchymal stem cells genetically modified to overexpress transforming growth factor-? via recombinant adeno-associated viral vectors.  

PubMed

Genetic modification of bone marrow-derived mesenchymal stem cells (MSCs) for use in transplantation settings may be a valuable strategy to enhance the repair processes in articular cartilage defects. Here, we evaluated the potential of overexpressing the transforming growth factor (TGF)-? via recombinant adeno-associated viral (rAAV) vector-mediated gene transfer to promote the chondrogenic differentiation of human MSCs (hMSCs). A human TGF-? sequence was delivered to undifferentiated and chondrogenically induced primary hMSCs, using rAAV vectors to test the efficacy and duration of transgene expression and its effects on the chondrogenic, osteogenic, and adipogenic differentiation patterns of the cells compared with control (lacZ) treatment after 21 days in vitro. Significant, durable TGF-? expression was noted both in undifferentiated and chondrogenically induced hMSCs transduced with the candidate rAAV-hTGF-? vector for up to 21 days compared with rAAV-lacZ treatment, allowing for increased proliferative, metabolic, and chondrogenic activities via stimulation of the critical SOX9 (SRY [sex-determining region Y]-related HMG [high-mobility group] box 9) chondrogenic pathway. Overexpression of TGF-? under the conditions applied here also activated the hypertrophic and osteogenic differentiation processes in the treated cells. Such effects were noted in association with enhanced levels of ?-catenin and Indian hedgehog and decreased parathyroid hormone-related protein expression. The current findings show that rAAV vectors provide advantageous vehicles for gene- and stem cell-based approaches to treat articular cartilage defects, requiring tight regulation of TGF-? expression to avoid hypertrophy as candidate treatment for future applications in clinically relevant animal models in vivo. PMID:25333854

Frisch, Janina; Venkatesan, Jagadeesh Kumar; Rey-Rico, Ana; Schmitt, Gertrud; Madry, Henning; Cucchiarini, Magali

2014-12-01

162

THz absorption signature detection of genetic material of E. coli and B. subtilis  

NASA Astrophysics Data System (ADS)

The development of efficient biological agent detection techniques requires in-depth understanding of THz absorption spectral features of different cell components. Chromosomal DNA, RNAs, proteins, bacterial cell wall, proteinaceous coat might be essential for bacterial cells and spores THz signature. As a first step, the DNA's contribution into entire cell THz spectra was analyzed. The experimental study of cells and DNAs of E. coli and cells/spores and DNA of Bacillus subtilis was conducted. Samples were prepared in the form of water solutions (suspension) with the concentrations in the range 0.01-1 mg/ml. The measurable difference in the THz transmission spectra of E. coli and Bacillus subtilis DNAs was observed. The correlation between chromosomal DNA signature and a corresponding entire spore/cell signature was observed. This correlation was especially pronounced for spores of Bacillus subtilis and their DNA. These experimental results justify our approach to develop a model for THz signatures of biological simulants and agents. In parallel with the experimental study, for the first time, the computer modeling and simulation of chromosome DNAs of E. coli and Bacillus subtilis was performed and their THz signatures were calculated. The DNA structures were optimized using the Amber software package. Also, we developed the initial model of the DNA fragment poly(dAT)-poly(dTA) solvated in water to be used in the simulations of genetic material (DNA and RNA) of spores and cells. Molecular dynamical simulations were conducted using explicit solvent (3-point TIP3P water) and implicit solvent (generalized Born) models. The calculated THz signatures of E. coli and Bacillus subtilis DNAs and poly(dAT)-poly(dTA) reproduce many features of our measured spectra. The results of this study demonstrate that THz Fourier transform infrared spectroscopy is a promising tool in generating spectral data for complex biological objects such as bacterial cells and spores.

Bykhovski, Alexei; Li, Xiaowei; Globus, Tatiana; Khromova, Tatyana; Gelmont, Boris; Woolard, Dwight; Samuels, Alan C.; Jensen, James O.

2005-11-01

163

Evaluation of terrestrial microcosms for detection, fate, and survival analysis of genetically engineered microorganisms and their recombinant genetic material  

SciTech Connect

The research included in this document represents the current scientific information available regarding the applicability of terrestrial microcosms and related methodologies for evaluating detection methods and the fate and survival of microorganisms in the environment. The three terrestrial microcosms described in this document were used to evaluate the survival and fate of recombinant bacteria in soils and in association with plant surfaces and insects and their transport through soil with percolating water and root systems, and to test new methods and procedures to improve detection and enumeration of bacteria in soil. Simple (potting soil composed of peat mix and perlite, lacking environmental control and monitoring) and complex microcosms (agricultural soil with partial control and monitoring of environmental conditions) were demonstrated to be useful tools for preliminary assessments of microbial viability in terrestrial ecosystems. These studies evaluated the survival patterns of Enterobacter cloacae (pBR322) in soil and on plant surfaces and the ingestion of this same microorganism by cutworms and survival in the foregut and frass. The Versacore microcosm design was used to monitor the fate and competitiveness of genetically engineered bacteria in soil. Both selective media and gene probes were used successfully to follow the fate of two recombinant Pseudomonas sp. introduced into Versacore microcosms. Intact soil-core microcosms were employed to evaluate the fate and transport of genetically altered Azospirillum sp. and Pseudomonas sp. in soil and the plant rhizosphere. The usefulness of these various microcosms as a tool for risk assessment is underscored by the ease in obtaining soil from a proposed field release site to evaluate subsequent GEM fate and survival.

Fredrickson, J.K.; Seidler, R.J.

1989-02-01

164

Generation of Reference Material by the Use of Multiple Displacement Amplification (MDA) for the Detection of Genetically Modified Organisms (GMOs)  

Microsoft Academic Search

The identification of genetically modified (GM) organisms (GMOs) in unknown samples by polymerase chain reaction (PCR) requires\\u000a the use of a positive control sample, containing the target sequence derived from the respective GMO. For this purpose, either\\u000a DNA extracted from suitable reference material or plasmids bearing the sequence are used. In the case of isolated genomic\\u000a DNA, the preparation is

Lillian Roth; Jutta Zagon; Ines Laube; Arne Holst-Jensen; Hermann Broll

2008-01-01

165

HIV Viral Load  

MedlinePLUS

... that an HIV viral load test detects HIV RNA. What is an HIV DNA test? The HIV ... HIV-1-Infected Adults and Adolescents, Plasma HIV RNA Testing. AIDSinfo On-line information]. Available online through ...

166

Viral infections during pregnancy.  

PubMed

Viral infections during pregnancy have long been considered benign conditions with a few notable exceptions, such as herpes virus. The recent Ebola outbreak and other viral epidemics and pandemics show how pregnant women suffer worse outcomes (such as preterm labor and adverse fetal outcomes) than the general population and non-pregnant women. New knowledge about the ways the maternal-fetal interface and placenta interact with the maternal immune system may explain these findings. Once thought to be 'immunosuppressed', the pregnant woman actually undergoes an immunological transformation, where the immune system is necessary to promote and support the pregnancy and growing fetus. When this protection is breached, as in a viral infection, this security is weakened and infection with other microorganisms can then propagate and lead to outcomes, such as preterm labor. In this manuscript, we review the major viral infections relevant to pregnancy and offer potential mechanisms for the associated adverse pregnancy outcomes. PMID:25582523

Silasi, Michelle; Cardenas, Ingrid; Kwon, Ja-Young; Racicot, Karen; Aldo, Paula; Mor, Gil

2015-03-01

167

Viral membrane fusion  

Microsoft Academic Search

Infection by viruses having lipid-bilayer envelopes proceeds through fusion of the viral membrane with a membrane of the target cell. Viral 'fusion proteins' facilitate this process. They vary greatly in structure, but all seem to have a common mechanism of action, in which a ligand-triggered, large-scale conformational change in the fusion protein is coupled to apposition and merger of the

Stephen C Harrison

2008-01-01

168

Optimal viral production  

Microsoft Academic Search

Viruses reproduce by multiplying within host cells. The reproductive fitness of a virus is proportional to the number of offspring\\u000a it can produce during the lifetime of the cell it infects. If viral production rates are independent of cell death rate, then\\u000a one expects natural selection will favor viruses that maximize their production rates. However, if increases in the viral

Daniel Coombs; Michael A. Gilchrist; Jerome Percus; Alan S. Perelson

2003-01-01

169

Viral suppressors of RNA-based viral immunity: Host targets  

PubMed Central

Discovery of diverse plant and animal viral proteins as suppressors of RNA silencing has provided strong support for an RNA-based viral immunity (RVI), which is now known to specifically destroy viral RNAs by RNA interference in fungi, plants and invertebrates. Here we review several recent studies that have revealed new mechanistic insights into plant and insect viral suppressors of RVI or suggested a role for RNA silencing suppression during mammalian viral infection. PMID:20638637

Wu, Qingfa; Wang, Xianbing

2010-01-01

170

NCBI Viral Genomes Resource  

PubMed Central

Recent technological innovations have ignited an explosion in virus genome sequencing that promises to fundamentally alter our understanding of viral biology and profoundly impact public health policy. Yet, any potential benefits from the billowing cloud of next generation sequence data hinge upon well implemented reference resources that facilitate the identification of sequences, aid in the assembly of sequence reads and provide reference annotation sources. The NCBI Viral Genomes Resource is a reference resource designed to bring order to this sequence shockwave and improve usability of viral sequence data. The resource can be accessed at http://www.ncbi.nlm.nih.gov/genome/viruses/ and catalogs all publicly available virus genome sequences and curates reference genome sequences. As the number of genome sequences has grown, so too have the difficulties in annotating and maintaining reference sequences. The rapid expansion of the viral sequence universe has forced a recalibration of the data model to better provide extant sequence representation and enhanced reference sequence products to serve the needs of the various viral communities. This, in turn, has placed increased emphasis on leveraging the knowledge of individual scientific communities to identify important viral sequences and develop well annotated reference virus genome sets. PMID:25428358

Brister, J. Rodney; Ako-adjei, Danso; Bao, Yiming; Blinkova, Olga

2015-01-01

171

NCBI viral genomes resource.  

PubMed

Recent technological innovations have ignited an explosion in virus genome sequencing that promises to fundamentally alter our understanding of viral biology and profoundly impact public health policy. Yet, any potential benefits from the billowing cloud of next generation sequence data hinge upon well implemented reference resources that facilitate the identification of sequences, aid in the assembly of sequence reads and provide reference annotation sources. The NCBI Viral Genomes Resource is a reference resource designed to bring order to this sequence shockwave and improve usability of viral sequence data. The resource can be accessed at http://www.ncbi.nlm.nih.gov/genome/viruses/ and catalogs all publicly available virus genome sequences and curates reference genome sequences. As the number of genome sequences has grown, so too have the difficulties in annotating and maintaining reference sequences. The rapid expansion of the viral sequence universe has forced a recalibration of the data model to better provide extant sequence representation and enhanced reference sequence products to serve the needs of the various viral communities. This, in turn, has placed increased emphasis on leveraging the knowledge of individual scientific communities to identify important viral sequences and develop well annotated reference virus genome sets. PMID:25428358

Brister, J Rodney; Ako-Adjei, Danso; Bao, Yiming; Blinkova, Olga

2015-01-01

172

Microvesicles and Viral Infection?  

PubMed Central

Cells secrete various membrane-enclosed microvesicles from their cell surface (shedding microvesicles) and from internal, endosome-derived membranes (exosomes). Intriguingly, these vesicles have many characteristics in common with enveloped viruses, including biophysical properties, biogenesis, and uptake by cells. Recent discoveries describing the microvesicle-mediated intercellular transfer of functional cellular proteins, RNAs, and mRNAs have revealed additional similarities between viruses and cellular microvesicles. Apparent differences include the complexity of viral entry, temporally regulated viral expression, and self-replication proceeding to infection of new cells. Interestingly, many virally infected cells secrete microvesicles that differ in content from their virion counterparts but may contain various viral proteins and RNAs. For the most part, these particles have not been analyzed for their content or functions during viral infection. However, early studies of microvesicles (L-particles) secreted from herpes simplex virus-infected cells provided the first evidence of microvesicle-mediated intercellular communication. In the case of Epstein-Barr virus, recent evidence suggests that this tumorigenic herpesvirus also utilizes exosomes as a mechanism of cell-to-cell communication through the transfer of signaling competent proteins and functional microRNAs to uninfected cells. This review focuses on aspects of the biology of microvesicles with an emphasis on their potential contributions to viral infection and pathogenesis. PMID:21976651

Meckes, David G.; Raab-Traub, Nancy

2011-01-01

173

Coordinated Function of Cellular DEAD-Box Helicases in Suppression of Viral RNA Recombination and Maintenance of Viral Genome Integrity  

PubMed Central

The intricate interactions between viruses and hosts include an evolutionary arms race and adaptation that is facilitated by the ability of RNA viruses to evolve rapidly due to high frequency mutations and genetic RNA recombination. In this paper, we show evidence that the co-opted cellular DDX3-like Ded1 DEAD-box helicase suppresses tombusviral RNA recombination in yeast model host, and the orthologous RH20 helicase functions in a similar way in plants. In vitro replication and recombination assays confirm the direct role of the ATPase function of Ded1p in suppression of viral recombination. We also present data supporting a role for Ded1 in facilitating the switch from minus- to plus-strand synthesis. Interestingly, another co-opted cellular helicase, the eIF4AIII-like AtRH2, enhances TBSV recombination in the absence of Ded1/RH20, suggesting that the coordinated actions of these helicases control viral RNA recombination events. Altogether, these helicases are the first co-opted cellular factors in the viral replicase complex that directly affect viral RNA recombination. Ded1 helicase seems to be a key factor maintaining viral genome integrity by promoting the replication of viral RNAs with correct termini, but inhibiting the replication of defective RNAs lacking correct 5’ end sequences. Altogether, a co-opted cellular DEAD-box helicase facilitates the maintenance of full-length viral genome and suppresses viral recombination, thus limiting the appearance of defective viral RNAs during replication. PMID:25693185

Chuang, Chingkai; Prasanth, K. Reddisiva; Nagy, Peter D.

2015-01-01

174

Viral metagenomic analysis of feces of wild small carnivores  

PubMed Central

Background Recent studies have clearly demonstrated the enormous virus diversity that exists among wild animals. This exemplifies the required expansion of our knowledge of the virus diversity present in wildlife, as well as the potential transmission of these viruses to domestic animals or humans. Methods In the present study we evaluated the viral diversity of fecal samples (n?=?42) collected from 10 different species of wild small carnivores inhabiting the northern part of Spain using random PCR in combination with next-generation sequencing. Samples were collected from American mink (Neovison vison), European mink (Mustela lutreola), European polecat (Mustela putorius), European pine marten (Martes martes), stone marten (Martes foina), Eurasian otter (Lutra lutra) and Eurasian badger (Meles meles) of the family of Mustelidae; common genet (Genetta genetta) of the family of Viverridae; red fox (Vulpes vulpes) of the family of Canidae and European wild cat (Felis silvestris) of the family of Felidae. Results A number of sequences of possible novel viruses or virus variants were detected, including a theilovirus, phleboviruses, an amdovirus, a kobuvirus and picobirnaviruses. Conclusions Using random PCR in combination with next generation sequencing, sequences of various novel viruses or virus variants were detected in fecal samples collected from Spanish carnivores. Detected novel viruses highlight the viral diversity that is present in fecal material of wild carnivores. PMID:24886057

2014-01-01

175

ReVOLT: radiation-enhanced viral oncolytic therapy  

SciTech Connect

Viral oncolytic therapy has been pursued with renewed interest as the molecular basis of carcinogenesis and viral replication has been elucidated. Genetically engineered, attenuated viruses have been rationally constructed to achieve a therapeutic index in tumor cells compared with surrounding normal tissue. Many of these attenuated mutant viruses have entered clinical trials. Here we review the preclinical literature demonstrating the interaction of oncolytic viruses with ionizing radiation and provides a basis for future clinical trials.

Advani, Sunil J. [Department of Radiation and Cellular Oncology, University of Chicago, Chicago, IL (United States); Mezhir, James J. [Department of Surgery, University of Chicago, Chicago, IL (United States); Roizman, Bernard [Marjorie B. Kovler Viral Oncology Laboratories, University of Chicago, Chicago, IL (United States); Weichselbaum, Ralph R. [Department of Radiation and Cellular Oncology, University of Chicago, Chicago, IL (United States)]. E-mail: rrw@rover.uchicago.edu

2006-11-01

176

Modeling Viral Capsid Assembly  

PubMed Central

I present a review of the theoretical and computational methodologies that have been used to model the assembly of viral capsids. I discuss the capabilities and limitations of approaches ranging from equilibrium continuum theories to molecular dynamics simulations, and I give an overview of some of the important conclusions about virus assembly that have resulted from these modeling efforts. Topics include the assembly of empty viral shells, assembly around single-stranded nucleic acids to form viral particles, and assembly around synthetic polymers or charged nanoparticles for nanotechnology or biomedical applications. I present some examples in which modeling efforts have promoted experimental breakthroughs, as well as directions in which the connection between modeling and experiment can be strengthened. PMID:25663722

2014-01-01

177

Optimal viral production.  

PubMed

Viruses reproduce by multiplying within host cells. The reproductive fitness of a virus is proportional to the number of offspring it can produce during the lifetime of the cell it infects. If viral production rates are independent of cell death rate, then one expects natural selection will favor viruses that maximize their production rates. However, if increases in the viral production rate lead to an increase in the cell death rate, then the viral production rate that maximizes fitness may be less than the maximum. Here we pose the question of how fast should a virus replicate in order to maximize the number of progeny virions that it produces. We present a general mathematical framework for studying problems of this type, which may be adapted to many host-parasite systems, and use it to examine the optimal virus production scheduling problem from the perspective of the virus. PMID:14607286

Coombs, Daniel; Gilchrist, Michael A; Percus, Jerome; Perelson, Alan S

2003-11-01

178

Viral encephalitis and epilepsy.  

PubMed

Viral encephalitis presents with seizures not only in the acute stage but also increases the risk of late unprovoked seizures and epilepsy. Acute symptomatic and late unprovoked seizures in different viral encephalitides are reviewed here. Among the sporadic viral encephalitides, Herpes simplex encephalitis (HSE) is perhaps most frequently associated with epilepsy, which may often be severe. Seizures may be the presenting feature in 50% patients with HSE because of involvement of the highly epileptogenic frontotemporal cortex. The occurrence of seizures in HSE is associated with poor prognosis. In addition, chronic and relapsing forms of HSE have been described and these may be associated with antiepileptic drug-resistant seizures. Among the epidemic (usually due to flaviviruses) viral encephalitides, Japanese encephalitis (JE) is most common and is associated with acute symptomatic seizures, especially in children. The reported frequency of acute symptomatic seizures in JE is 7-46%. Encephalitis due to other flaviviruses such as equine, St. Louis, and West Nile viruses may also manifest with acute symptomatic seizures. In Nipah virus encephalitis, seizures are more common in relapsed and late-onset encephalitis in comparison to acute encephalitis (4% vs. 1.8%). Other viruses like measles, varicella, mumps, influenza, and entero-viruses may cause seizures depending on the area of brain involved. There is no comprehensive data regarding late unprovoked seizures in different viral encephalitides. Prospective studies are required to document the risk of late unprovoked seizures and epilepsy following viral encephalitis due to different viruses as well as to determine the clinical characteristics, course, and outcome of post-encephalitic epilepsy. PMID:18754956

Misra, Usha Kant; Tan, Chong Tin; Kalita, Jayantee

2008-08-01

179

pelo is required for high efficiency viral replication.  

PubMed

Viruses hijack host factors for their high speed protein synthesis, but information about these factors is largely unknown. In searching for genes that are involved in viral replication, we carried out a forward genetic screen for Drosophila mutants that are more resistant or sensitive to Drosophila C virus (DCV) infection-caused death, and found a virus-resistant line in which the expression of pelo gene was deficient. Our mechanistic studies excluded the viral resistance of pelo deficient flies resulting from the known Drosophila anti-viral pathways, and revealed that pelo deficiency limits the high level synthesis of the DCV capsid proteins but has no or very little effect on the expression of some other viral proteins, bulk cellular proteins, and transfected exogenous genes. The restriction of replication of other types of viruses in pelo deficient flies was also observed, suggesting pelo is required for high level production of capsids of all kinds of viruses. We show that both pelo deficiency and high level DCV protein synthesis increase aberrant 80S ribosomes, and propose that the preferential requirement of pelo for high level synthesis of viral capsids is at least partly due to the role of pelo in dissociation of stalled 80S ribosomes and clearance of aberrant viral RNA and proteins. Our data demonstrated that pelo is a host factor that is required for high efficiency translation of viral capsids and targeting pelo could be a strategy for general inhibition of viral infection. PMID:24722736

Wu, Xiurong; He, Wan-Ting; Tian, Shuye; Meng, Dan; Li, Yuanyue; Chen, Wanze; Li, Lisheng; Tian, Lili; Zhong, Chuan-Qi; Han, Felicia; Chen, Jianming; Han, Jiahuai

2014-04-01

180

Failure of Viral Shells  

NASA Astrophysics Data System (ADS)

We report a combined theoretical and experimental study of the structural failure of viral shells under mechanical stress. We find that discontinuities in the force-indentation curve associated with failure should appear when the so-called Föppl von Kármán (FvK) number exceeds a critical value. A nanoindentation study of a viral shell subject to a soft-mode instability, where the stiffness of the shell decreases with increasing pH, confirms the predicted onset of failure as a function of the FvK number.

Klug, William S.; Bruinsma, Robijn F.; Michel, Jean-Philippe; Knobler, Charles M.; Ivanovska, Irena L.; Schmidt, Christoph F.; Wuite, Gijs J. L.

2006-12-01

181

DNA as Genetic Material: Revisiting Classic Experiments through a Simple, Practical Class  

ERIC Educational Resources Information Center

In 1928, Frederick Griffith demonstrated a transmission process of genetic information by transforming "Pneumococcus". In 1944, Avery et al. demonstrated that Griffith's transforming principle was DNA. We revisited these classic experiments in a practical class for undergraduate students. Both experiments were reproduced in simple, adapted forms.…

Malago, Wilson, Jr.; Soares-Costa, Andrea; Henrique-Silva, Flavio

2009-01-01

182

Controlling viral capsid assembly with templating  

NASA Astrophysics Data System (ADS)

We develop coarse-grained models that describe the dynamic encapsidation of functionalized nanoparticles by viral capsid proteins. We find that some forms of cooperative interactions between protein subunits and nanoparticles can dramatically enhance rates and robustness of assembly, as compared to the spontaneous assembly of subunits into empty capsids. For large core-subunit interactions, subunits adsorb onto core surfaces en masse in a disordered manner, and then undergo a cooperative rearrangement into an ordered capsid structure. These assembly pathways are unlike any identified for empty capsid formation. Our models can be directly applied to recent experiments in which viral capsid proteins assemble around functionalized inorganic nanoparticles [Sun , Proc. Natl. Acad. Sci. U.S.A. 104, 1354 (2007)]. In addition, we discuss broader implications for understanding the dynamic encapsidation of single-stranded genomic molecules during viral replication and for developing multicomponent nanostructured materials.

Hagan, Michael F.

2008-05-01

183

Viral surveillance and subclinical viral infection in pediatric kidney transplantation.  

PubMed

The more potent immunosuppressive therapy that has successfully reduced the incidence of acute rejection and improved graft outcomes has also resulted in a higher incidence of viral complications. Sensitive molecular methods now allow for the detection of subclinical viral infection, which is increasingly recognized due to the adoption of routine post-transplant viral surveillance protocols. The goal of viral surveillance is the detection of subclinical viral infection that triggers an intervention; one that either prevents progression to viral disease or leads to early diagnosis of viral disease, which is associated with improved outcomes. Knowledge of the epidemiology and natural history of subclinical viral infection and viral disease, as well as patient-specific risk factors, is required to establish the optimal surveillance schedule which achieves the goal of early diagnosis. Evidence that detection of subclinical viral infection can impact viral disease is variable depending on the virus. This review will summarize the current data on the role of viral surveillance for BK virus (BKV), cytomegalovirus (CMV), and the Epstein-Barr virus (EBV) in the pediatric kidney transplant population. PMID:25125226

Smith, Jodi M; Dharnidharka, Vikas R

2015-05-01

184

Viral-Associated Trichodysplasia  

PubMed Central

Background Viral-associated trichodysplasia of immunosuppression is a rare cutaneous eruption that is characterized by follicularly based shiny papules and alopecia with characteristic histopathologic findings of abnormally anagen follicules with excessive inner root sheath differentiation. Prior reports have described the histopathologic characteristics on vertical sections; however, to our knowledge, immunohistochemical analysis of polyomavirus proteins has not been previously performed. Observations We discuss the thorough diagnostic evaluation and therapy of an unusual case of viral-associated trichodysplasia due to a newly described human polyomavirus that occurred in a patient with post-treatment chronic lymphocytic leukemia and an abnormal white blood cell count. Unique to our study is the immunohistochemical staining for the polyomavirus middle T antigen, which demonstrated positive staining of cellular inclusions within keratinocytes that compose the inner root sheath. Further evaluation with scanning electron microscopy and polymerase chain reaction analysis of viral DNA confirmed the presence of the virus. Treatment with topical cidofovir resulted in dramatic clinical improvement and hair regrowth. Conclusions Several tools, including immunohistochemical staining for the polyomavirus middle T antigen, can be used to identify the pathogenic virus associated with viral-associated trichodysplasia. This case highlights the utility of multiple diagnostic modalities and a robust response to a topical therapeutic agent, cidofovir. PMID:22351821

Wanat, Karolyn A.; Holler, Phillip D.; Dentchev, Tzvete; Simbiri, Kenneth; Robertson, Erle; Seykora, John T.; Rosenbach, Misha

2012-01-01

185

BIOMARKERS OF VIRAL EXPOSURE  

EPA Science Inventory

Viral and protozoan pathogens associated with raw sludge can cause encephalitis, gastroenteritis, hepatitis, myocarditis, and a number of other diseases. Raw sludge that has been treated to reduce these pathogens can be used for land application according to the regulations spec...

186

Viral Space Situational Awareness  

NASA Astrophysics Data System (ADS)

Viral SSA takes advantage of the amateur astronomy community to provide an extremely low-cost and geographically-diverse network of optical SSA sites. In the spirit of programs such as DARPA's Grand Challenge and the National Weather Service's program of providing amateur meteorologists with weather stations linked to a central professional meteorological facility, we form a cooperative bond with a willing community of technically-minded individuals. We term this program "viral" because we will qualify an initial set of astronomers for SSA operation and then use word of mouth in the astronomy community, as well as an outreach program, to pull in new observers. The use of modern remote controlled telescopes allows the incorporation of certified amateur, university, and commercial telescope systems. The availability of the local Viral SSA member for troubleshooting eliminates most significant costs of operating a large network. In this talk, we discuss the key concepts of Viral SSA and the route to a network of 100+ sites in a three year or less timeframe.

Gleckler, A.; Butterfield, M. C.

2012-09-01

187

Viral myelitis: an update.  

PubMed

Viral infections of the central nervous system are uncommon but are important in the differential diagnosis of acute myelopathy. Acute viral myelitis can present as acute flaccid paralysis (poliomyelitis) or neurologic dysfunction due to involvement of the white matter. The latter usually affects only part of the transverse expanse of the spinal cord and manifests as asymmetric motor and sensory symptoms. When both halves of the spinal cord are affected, the entity is referred to as acute transverse myelitis and patients exhibit uniformly symmetric weakness, sensory loss, and urinary bladder involvement. Acute flaccid paralysis is due to cytolytic infection of anterior horn cells. When the involvement is mainly white matter, virus-specific and autoimmune host cellular immune responses are believed to contribute to spinal cord damage. Acute flaccid paralysis is caused by polioviruses-1, -2, and -3; coxsackieviruses A and B; enterovirus-71; and flaviviruses, including West Nile virus. Involvement of spinal cord white matter may be associated with infection by many different viruses; however, in most cases a specific viral cause is never determined. Chronic myelitis may be due to either direct infection of the spinal cord by human T-cell lymphotrophic virus-1 (HTLV-1), or a metabolic disturbance due to HIV-1 infection in AIDS patients; no other human virus is known to chronically infect the spinal cord without involvement of the brain. The principal treatment is antiviral drugs immediately upon virus isolation or the identification of a viral sequence by PCR and, when indicated, high doses of methylprednisolone. PMID:17074281

Kincaid, Octavia; Lipton, Howard L

2006-11-01

188

Bovine viral diarrhea viruses  

Technology Transfer Automated Retrieval System (TEKTRAN)

Infections with bovine viral diarrhea viruses (BVDV) result in significant economic losses for beef and dairy producers worldwide. BVDV is actually an umbrella term for two species of viruses, BVDV1 and BVDV2, within the Pestivirus genus of the Flavivirus family. While denoted as a bovine pathogen...

189

Leafhopper viral pathogens  

Technology Transfer Automated Retrieval System (TEKTRAN)

Four newly discovered viral pathogens in leafhopper vectors of Pierce’s disease of grapes, have been shown to replicate in sharpshooter leafhoppers; the glassy-winged sharpshooter, GWSS, Homalodisca vitripennis, and Oncometopia nigricans (Hemiptera: Cicadellidae). The viruses were classified as memb...

190

Formation of ceramophilic chitin and biohybrid materials enabled by a genetically engineered bifunctional protein.  

PubMed

A bifunctional protein composed of a highly negatively charged oyster shell protein and a chitin-binding domain enabled the formation of biohybrid materials through non-covalent surface modification of chitin nanofibres. The results demonstrate that specific biomolecular interactions offer a route for the formation of biosynthetic materials. PMID:24871427

Malho, Jani-Markus; Heinonen, Hanna; Kontro, Inkeri; Mushi, Ngesa E; Serimaa, Ritva; Hentze, Hans-Peter; Linder, Markus B; Szilvay, Géza R

2014-07-14

191

Bovine viral diarrhea virus induced apoptosis correlates with increased intracellular viral RNA accumulation  

Microsoft Academic Search

Non-cytopathic (NCP) and cytopathic (CP) parent–daughter pairs are often isolated from cattle with bovine viral diarrhea virus (BVDV) induced mucosal disease. Alignment of these pair genomes revealed that genetic changes in CP BVDV involve the NS2-3 coding region and correlate with expression of NS3. However, additional mutations are present elsewhere in the genomes of these natural pairs, precluding unambiguous mapping

Ventzislav B Vassilev; Ruben O Donis

2000-01-01

192

Neural Networks and Genetic Algorithms in Materials Science and Engineering, 2006 January 1113, 2006, Tata McGrawHill Publishing Company Ltd., India  

E-print Network

Neural Networks and Genetic Algorithms in Materials Science and Engineering, 2006 January 11, Shibpur, Howrah, India Neural Networks in Materials Science: The Importance of Uncertainty H. K. D. H rela- tionships and structure within vast arrays of ill­understood data. The neural network method

Cambridge, University of

193

Optogenetic Control of Cardiomyocytes via Viral Delivery  

PubMed Central

Optogenetics is an emerging technology for the manipulation and control of excitable tissues, such as the brain and heart. As this technique requires the genetic modification of cells in order to inscribe light sensitivity, for cardiac applications, here we describe the process through which neonatal rat ventricular myocytes are virally infected in vitro with channelrhodopsin-2 (ChR2). We also describe in detail the procedure for quantitatively determining the optimal viral dosage, including instructions for patterning gene expression in multicellular cardiomyocyte preparations (cardiac syncytia) to simulate potential in vivo transgene distributions. Finally, we address optical actuation of ChR2-transduced cells and means to measure their functional response to light. PMID:25070340

Ambrosi, Christina M.; Entcheva, Emilia

2014-01-01

194

Genetic Disorders  

MedlinePLUS

... is a small piece of hereditary material called DNA that controls some aspect of a person’s physical ... who have an increased risk of a disease. DNA: The genetic material that is passed down from ...

195

Viral Membrane Scission  

PubMed Central

Virus budding is a complex, multistep process in which viral proteins make specific alterations in membrane curvature. Many different viral proteins can deform the membrane and form a budding virion, but very few can mediate membrane scission to complete the budding process. As a result, enveloped viruses have developed numerous ways of facilitating membrane scission, including hijacking host cellular scission machinery and expressing their own scission proteins. These proteins mediate scission in very different ways, though the biophysical mechanics underlying their actions may be similar. In this review, we explore the mechanisms of membrane scission and the ways in which enveloped viruses use these systems to mediate the release of budding virions. PMID:24099087

Rossman, Jeremy S.; Lamb, Robert A.

2014-01-01

196

Viral haemorrhagic fever.  

PubMed

Viral haemorrhagic fevers (VHF) are a range of viral infections with potential to cause life-threatening illness in humans. Apart from Crimean-Congo haemorrhagic fever (CCHF), they are largely confined to Africa, distribution being dependent on the ecology of reservoir hosts. At present, the largest ever epidemic of Ebola virus disease (EVD or Ebola) is occurring in West Africa, raising the possibility that cases could be imported into non-endemic countries. Diagnosis and management is challenging due to the non-specificity of early symptoms, limited laboratory facilities in endemic areas, severity of disease, lack of effective therapy, strict infection control requirements and propensity to cause epidemics with secondary cases in healthcare workers. PMID:25650201

Fhogartaigh, Caoimhe Nic; Aarons, Emma

2015-02-01

197

Reverse Genetic Generation of Recombinant Zaire Ebola Viruses Containing Disrupted IRF-3 Inhibitory Domains Results in Attenuated Virus Growth In Vitro and Higher Levels of IRF-3 Activation without Inhibiting Viral Transcription or Replication  

Microsoft Academic Search

The VP35 protein of Zaire Ebola virus is an essential component of the viral RNA polymerase complex and also functions to antagonize the cellular type I interferon (IFN) response by blocking activation of the transcription factor IRF-3. We previously mapped the IRF-3 inhibitory domain within the C terminus of VP35. In the present study, we show that mutations that disrupt

Amy L. Hartman; Jason E. Dover; Jonathan S. Towner; Stuart T. Nichol

2006-01-01

198

Viral RNA extraction for in-the-field analysis  

PubMed Central

Retroviruses encode their genetic information with RNA molecules, and have a high genomic recombination rate which allows them to mutate more rapidly, thereby posting a higher risk to humans. One important way to help combat a pandemic of viral infectious diseases is early detection before large scale outbreaks occur. The polymerase chain reaction (PCR) and reverse transcription-PCR (RT-PCR) have been used to identify precisely different strains of some very closely related pathogens. However, isolation and detection of viral RNA in the field are difficult due to the unstable nature of viral RNA molecules. Consequently, performing in-the-field nucleic acid analysis to monitor the spread of viruses is financially and technologically challenging in remote and underdeveloped regions that are high-risk areas for outbreaks. A simplified rapid viral RNA extraction method is reported to meet the requirements for in-the-field viral RNA extraction and detection. The ability of this device to perform viral RNA extraction with subsequent RT-PCR detection of retrovirus is demonstrated. This inexpensive device has the potential to be distributed on a large scale to underdeveloped regions for early detection of retrovirus, with the possibility of reducing viral pandemic events. PMID:17548117

Zhong, Jiang F.; Weiner, Leslie P.; Burke, Kathy; Taylor, Clive R.

2012-01-01

199

Quantitative analysis of non-viral gene therapy in primary liver culture systems  

E-print Network

Gene therapy has the potential to cure thousands of diseases caused by genetic abnormalities, provide novel combination therapies for cancers and viral infections, and offer a new and effective platform for next generation ...

Tedford, Nathan C

2007-01-01

200

Genetics Home Reference: Sjögren syndrome  

MedlinePLUS

... condition may be triggered by something in the environment. In particular, viral or bacterial infections, which activate the immune system, may have the potential to encourage the development of Sjögren syndrome in susceptible individuals. The genetic ...

201

Review article Pseudorabies virus infections in pigs. Role of viral  

E-print Network

Review article Pseudorabies virus infections in pigs. Role of viral proteins in virulence on the biological functions of pseudorabies virus (PRV) proteins. It focuses on the role of PRV proteins the spread of genetically engineered vaccine strains within pigs or between pigs. pseudorabies virus protein

Paris-Sud XI, Université de

202

Selling Genes, Selling Gender: Egg Agencies, Sperm Banks, and the Medical Market in Genetic Material  

Microsoft Academic Search

Eggs and sperm are parallel bodily goods in that each contributes half of the reproductive material needed to create life. Yet these cells are produced by differently sexed bodies, allowing for a comparative analysis of how the social process of bodily commodification varies based on sex and gender. Drawing on interview and observational data from two egg agencies and two

Rene Almeling

2007-01-01

203

Engineering Biomaterial Systems to Enhance Viral Vector Gene Delivery  

PubMed Central

Integrating viral gene delivery with engineered biomaterials is a promising strategy to overcome a number of challenges associated with virus-mediated gene delivery, including inefficient delivery to specific cell types, limited tropism, spread of vectors to distant sites, and immune responses. Viral vectors can be combined with biomaterials either through encapsulation within the material or immobilization onto a material surface. Subsequent biomaterial-based delivery can increase the vector's residence time within the target site, thereby potentially providing localized delivery, enhancing transduction, and extending the duration of gene expression. Alternatively, physical or chemical modification of viral vectors with biomaterials can be employed to modulate the tropism of viruses or reduce inflammatory and immune responses, both of which may benefit transduction. This review describes strategies to promote viral gene delivery technologies using biomaterials, potentially providing opportunities for numerous applications of gene therapy to inherited or acquired disorders, infectious disease, and regenerative medicine. PMID:21629221

Jang, Jae-Hyung; Schaffer, David V; Shea, Lonnie D

2011-01-01

204

Viral quasispecies assembly via maximal clique enumeration.  

PubMed

Virus populations can display high genetic diversity within individual hosts. The intra-host collection of viral haplotypes, called viral quasispecies, is an important determinant of virulence, pathogenesis, and treatment outcome. We present HaploClique, a computational approach to reconstruct the structure of a viral quasispecies from next-generation sequencing data as obtained from bulk sequencing of mixed virus samples. We develop a statistical model for paired-end reads accounting for mutations, insertions, and deletions. Using an iterative maximal clique enumeration approach, read pairs are assembled into haplotypes of increasing length, eventually enabling global haplotype assembly. The performance of our quasispecies assembly method is assessed on simulated data for varying population characteristics and sequencing technology parameters. Owing to its paired-end handling, HaploClique compares favorably to state-of-the-art haplotype inference methods. It can reconstruct error-free full-length haplotypes from low coverage samples and detect large insertions and deletions at low frequencies. We applied HaploClique to sequencing data derived from a clinical hepatitis C virus population of an infected patient and discovered a novel deletion of length 357±167 bp that was validated by two independent long-read sequencing experiments. HaploClique is available at https://github.com/armintoepfer/haploclique. A summary of this paper appears in the proceedings of the RECOMB 2014 conference, April 2-5. PMID:24675810

Töpfer, Armin; Marschall, Tobias; Bull, Rowena A; Luciani, Fabio; Schönhuth, Alexander; Beerenwinkel, Niko

2014-03-01

205

Oocyte destruction is activated during viral infection.  

PubMed

Viral infection has been associated with a starvation-like state in Drosophila melanogaster. Because starvation and inhibiting TOR kinase activity in vivo result in blocked oocyte production, we hypothesized that viral infection would also result in compromised oogenesis. Wild-type flies were injected with flock house virus (FHV) and survival and embryo production were monitored. Infected flies had a dose-responsive loss of fecundity that corresponded to a global reduction in Akt/TOR signaling. Highly penetrant egg chamber destruction mid-way through oogenesis was noted and FHV coat protein was detected within developing egg chambers. As seen with in vivo TOR inhibition, oogenesis was partially rescued in loss of function discs large and merlin mutants. As expected, mutants in genes known to be involved in virus internalization and trafficking [Clathrin heavy chain (chc) and synaptotagmin] survive longer during infection. However, oogenesis was rescued only in chc mutants. This suggests that viral response mechanisms that control fly survival and egg chamber survival are separable. The genetic and signaling requirements for oocyte destruction delineated here represent a novel host-virus interaction with implications for the control of both fly and virus populations. PMID:22173880

Thomson, Travis C; Schneemann, Anette; Johnson, Joshua

2012-06-01

206

Broad Surveys of DNA Viral Diversity Obtained through Viral Metagenomics of Mosquitoes  

PubMed Central

Viruses are the most abundant and diverse genetic entities on Earth; however, broad surveys of viral diversity are hindered by the lack of a universal assay for viruses and the inability to sample a sufficient number of individual hosts. This study utilized vector-enabled metagenomics (VEM) to provide a snapshot of the diversity of DNA viruses present in three mosquito samples from San Diego, California. The majority of the sequences were novel, suggesting that the viral community in mosquitoes, as well as the animal and plant hosts they feed on, is highly diverse and largely uncharacterized. Each mosquito sample contained a distinct viral community. The mosquito viromes contained sequences related to a broad range of animal, plant, insect and bacterial viruses. Animal viruses identified included anelloviruses, circoviruses, herpesviruses, poxviruses, and papillomaviruses, which mosquitoes may have obtained from vertebrate hosts during blood feeding. Notably, sequences related to human papillomaviruses were identified in one of the mosquito samples. Sequences similar to plant viruses were identified in all mosquito viromes, which were potentially acquired through feeding on plant nectar. Numerous bacteriophages and insect viruses were also detected, including a novel densovirus likely infecting Culex erythrothorax. Through sampling insect vectors, VEM enables broad survey of viral diversity and has significantly increased our knowledge of the DNA viruses present in mosquitoes. PMID:21674005

Ng, Terry Fei Fan; Willner, Dana L.; Lim, Yan Wei; Schmieder, Robert; Chau, Betty; Nilsson, Christina; Anthony, Simon; Ruan, Yijun; Rohwer, Forest; Breitbart, Mya

2011-01-01

207

Viral surveillance and discovery  

PubMed Central

The field of virus discovery has burgeoned with the advent of high throughput sequencing platforms and bioinformatics programs that enable rapid identification and molecular characterization of known and novel agents, investments in global microbial surveillance that include wildlife and domestic animals as well as humans, and recognition that viruses may be implicated in chronic as well as acute diseases. Here we review methods for viral surveillance and discovery, strategies and pitfalls in linking discoveries to disease, and identify opportunities for improvements in sequencing instrumentation and analysis, the use of social media and medical informatics that will further advance clinical medicine and public health. PMID:23602435

Lipkin, Walter Ian; Firth, Cadhla

2014-01-01

208

Equine viral arteritis.  

PubMed

Equine arteritis virus (EAV), the causative agent of equine viral arteritis (EVA), is a respiratory and reproductive disease that occurs throughout the world. EAV infection is highly species-specific and exclusively limited to members of the family Equidae, which includes horses, donkeys, mules, and zebras. EVA is an economically important disease and outbreaks could cause significant losses to the equine industry. The primary objective of this article is to summarize current understanding of EVA, specifically the disease, pathogenesis, epidemiology, host immune response, vaccination and treatment strategies, prevention and control measures, and future directions. PMID:25441113

Balasuriya, Udeni B R

2014-12-01

209

Hybrid viral vectors for vaccine and antibody production in plants.  

PubMed

Plants have a demonstrated potential for large-scale, rapid production of recombinant proteins for diverse product applications, including subunit vaccines and monoclonal antibodies. In this field, the accent has recently shifted from the engineering of "edible" vaccines based on stable expression of target protein in transgenic or transplastomic plants to the development of purified formulated vaccines that are delivered via injection. The injectable vaccines are commonly produced using transient expression of target gene delivered into genetically unmodified plant host via viral or bacterial vectors. Most viral vectors are based on plant RNA viruses, where nonessential sequences are replaced with the gene of interest. Utilization of viral hybrids that consist of genes and regulatory elements of different virus species, or transcomplementation systems (vector/transgene) had a substantial impact on the level of target protein expression. Development and introduction of agroviral hybrid vectors that combine genetic elements of bacterial binary plasmids and plant viral vectors, and agroinfiltration as a tool of the vector delivery have resulted in significant progress in large-scale production of recombinant vaccines and monoclonal antibodies in plants. This article presents an overview of plant hybrid viral vector expression systems developed so far. PMID:23394571

Yusibov, Vidadi; Streatfield, Stephen J; Kushnir, Natasha; Roy, Gourgopal; Padmanaban, Annamalai

2013-01-01

210

STAT2 deficiency and susceptibility to viral illness in humans  

PubMed Central

Severe infectious disease in children may be a manifestation of primary immunodeficiency. These genetic disorders represent important experiments of nature with the capacity to elucidate nonredundant mechanisms of human immunity. We hypothesized that a primary defect of innate antiviral immunity was responsible for unusually severe viral illness in two siblings; the proband developed disseminated vaccine strain measles following routine immunization, whereas an infant brother died after a 2-d febrile illness from an unknown viral infection. Patient fibroblasts were indeed abnormally permissive for viral replication in vitro, associated with profound failure of type I IFN signaling and absence of STAT2 protein. Sequencing of genomic DNA and RNA revealed a homozygous mutation in intron 4 of STAT2 that prevented correct splicing in patient cells. Subsequently, other family members were identified with the same genetic lesion. Despite documented infection by known viral pathogens, some of which have been more severe than normal, surviving STAT2-deficient individuals have remained generally healthy, with no obvious defects in their adaptive immunity or developmental abnormalities. These findings imply that type I IFN signaling [through interferon-stimulated gene factor 3 (ISGF3)] is surprisingly not essential for host defense against the majority of common childhood viral infections. PMID:23391734

Hambleton, Sophie; Goodbourn, Stephen; Young, Dan F.; Dickinson, Paul; Mohamad, Siti M. B.; Valappil, Manoj; McGovern, Naomi; Cant, Andrew J.; Hackett, Scott J.; Ghazal, Peter; Morgan, Neil V.; Randall, Richard E.

2013-01-01

211

Human viral gastroenteritis.  

PubMed Central

During the last 15 years, several different groups of fastidious viruses that are responsible for a large proportion of acute viral gastroenteritis cases have been discovered by the electron microscopic examination of stool specimens. This disease is one of the most prevalent and serious clinical syndromes seen around the world, especially in children. Rotaviruses, in the family Reoviridae, and fastidious fecal adenoviruses account for much of the viral gastroenteritis in infants and young children, whereas the small caliciviruses and unclassified astroviruses, and possibly enteric coronaviruses, are responsible for significantly fewer cases overall. In addition to electron microscopy, enzyme immunoassays and other rapid antigen detection systems have been developed to detect rotaviruses and fastidious fecal adenoviruses in the stool specimens of both nonhospitalized patients and those hospitalized for dehydration and electrolyte imbalance. Experimental rotavirus vaccines have also been developed, due to the prevalence and seriousness of rotavirus infection. The small, unclassified Norwalk virus and morphologically similar viruses are responsible for large and small outbreaks of acute gastroenteritis in older children, adolescents, and adults. Hospitalization of older patients infected with these viruses is usually not required, and their laboratory diagnoses have been limited primarily to research laboratories. Images PMID:2644024

Christensen, M L

1989-01-01

212

An empirical survey on biobanking of human genetic material and data in six EU countries.  

PubMed

Biobanks correspond to different situations: research and technological development, medical diagnosis or therapeutic activities. Their status is not clearly defined. We aimed to investigate human biobanking in Europe, particularly in relation to organisational, economic and ethical issues in various national contexts. Data from a survey in six EU countries (France, Germany, the Netherlands, Portugal, Spain and the UK) were collected as part of a European Research Project examining human and non-human biobanking (EUROGENBANK, coordinated by Professor JC Galloux). A total of 147 institutions concerned with biobanking of human samples and data were investigated by questionnaires and interviews. Most institutions surveyed belong to the public or private non-profit-making sectors, which have a key role in biobanking. This activity is increasing in all countries because few samples are discarded and genetic research is proliferating. Collections vary in size, many being small and only a few very large. Their purpose is often research, or research and healthcare, mostly in the context of disease studies. A specific budget is very rarely allocated to biobanking and costs are not often evaluated. Samples are usually provided free of charge and gifts and exchanges are the common rule. Good practice guidelines are generally followed and quality controls are performed but quality procedures are not always clearly explained. Associated data are usually computerised (identified or identifiable samples). Biobankers generally favour centralisation of data rather than of samples. Legal and ethical harmonisation within Europe is considered likely to facilitate international collaboration. We propose a series of recommendations and suggestions arising from the EUROGENBANK project. PMID:12774042

Hirtzlin, Isabelle; Dubreuil, Christine; Préaubert, Nathalie; Duchier, Jenny; Jansen, Brigitte; Simon, Jürgen; Lobato De Faria, Paula; Perez-Lezaun, Anna; Visser, Bert; Williams, Garrath D; Cambon-Thomsen, Anne

2003-06-01

213

Axonal Pathology and Demyelination in Viral Models of Multiple Sclerosis  

PubMed Central

Multiple sclerosis (MS) is an immune-mediated inflammatory demyelinating disease of the central nervous system (CNS). Monozygotic twin studies suggest that while there is a genetic contribution, genetics alone cannot be the sole determining factor in the development of MS. As the rates of MS are increasing, particularly among women, environmental factors such as viral infections are coming to the foreground as potential agents in triggering disease in genetically susceptible individuals. This review highlights pathological aspects related to two pre-clinical viral models for MS; data are consistent between these two models as experimental infection of susceptible mice can induce axonal degeneration associated with demyelination. These data are consistent with observations in MS that axonal damage or Wallerian degeneration is occurring within the CNS contributing to the disability and disease severity. Such early damage, where axonal damage is primary to secondary demyelination, could set the stage for more extensive immune mediated demyelination arising later. PMID:25091490

Libbey, Jane E.; Lane, Thomas E.; Fujinami, Robert S.

2015-01-01

214

Viral vectors: a look back and ahead on gene transfer technology.  

PubMed

No matter what their origin, strain and family, viruses have evolved exquisite strategies to reach and penetrate specific target cells where they hijack the cellular machinery to express viral genes and produce progeny particles. The ability to deliver and express genetic information to cells is the basis for exploiting viruses as "Trojan horses" to genetically modify the natural cell target or, upon manipulation of the viral receptor to retarget the virus, to genetically engineer different cell types. This process, known as transduction, is accomplished using viral vectors derived from parental wild type viruses whose viral genes, essential for replication and virulence, have been replaced with the heterologous gene(s) required for cell manipulation. Rearrangement of the viral genome to impede replication or generation of infectious virions but maintaining the ability to deliver nucleic acids has been the object of intense research since the early 1980s. Technological advances and the ever-growing knowledge of molecular virology and virus-host cell relationships have constantly improved the safety profile of viral vectors that are now used in vitro and in vivo to study cellular gene function, correct genetic defects (gene therapy), express therapeutic proteins, vaccinate against infectious agents and tumors, produce experimental animal models, and for other purposes. This review illustrates the strategies used to generate some of the most used viral vectors, and their advantages, limitations and principal applications. PMID:23435812

Vannucci, Laura; Lai, Michele; Chiuppesi, Flavia; Ceccherini-Nelli, Luca; Pistello, Mauro

2013-01-01

215

Evaluation and molecular characterization of human adenovirus in drinking water supplies: viral integrity and viability assays  

PubMed Central

Background Human adenoviruses (HAdVs) are the second-leading cause of childhood gastroenteritis worldwide. This virus is commonly found in environmental waters and is very resistant to water disinfection and environmental stressors, especially UV light inactivation. Molecular techniques, such as PCR-based methods (Polymerase Chain Reaction), are commonly used to detect and identify viral contamination in water, although PCR alone does not allow the discrimination between infectious and non-infectious viral particles. A combination of cell culture and PCR has allowed detection of infectious viruses that grow slowly or fail to produce cytopathic effects (CPE) in cell culture. This study aimed to assess the integrity and viability of human adenovirus (HAdV) in environmental water and evaluate circulating strains by molecular characterization in three sites of the water supply in Florianópolis, Santa Catarina Island, Brazil: Peri Lagoon water, spring source water, and water from the public water supply system. Methods Water samples were collected, concentrated and HAdV quantified by real-time PCR. Viral integrity was evaluated by enzymatic assay (DNase I) and infectivity by plaque assay (PA) and integrated cell culture using transcribed mRNA (ICC-RT-qPCR). Samples containing particles of infectious HAdV were selected for sequencing and molecular characterization. Results The analyzed sites contained 83, 66 and 58% undamaged HAdV particles (defined as those in which the genetic material is protected by the viral capsid) at Peri Lagoon, spring source water and public supply system water, respectively. Of these, 66% of the particles (by PA) and 75% (by ICC-RT-qPCR) HAdV were shown to be infectious, due to being undamaged in Peri Lagoon, 33% (by PA) and 58% (by ICC-RT-qPCR) in spring source water and 8% (by PA) and 25% (by ICC-RT-qPCR) in the public water supply system. ICC-RT-qPCR, a very sensitive and rapid technique, was able to detect as low as 1?×?102 HAdV genome copies per milliliter of infectious viral particles in the environmental water samples. The molecular characterization studies indicated that HAdV-2 was the prevalent serotype. Conclusions These results indicate a lack of proper public health measures. We suggest that HAdV can be efficiently used as a marker of environmental and drinking water contamination and ICC-RT-qPCR demonstrated greater sensitivity and speed of detection of infectious viral particles compared to PA. PMID:23714224

2013-01-01

216

Generating Information-Rich High-Throughput Experimental Materials Genomes using Functional Clustering via Multitree Genetic Programming and Information Theory.  

PubMed

High-throughput experimental methodologies are capable of synthesizing, screening and characterizing vast arrays of combinatorial material libraries at a very rapid rate. These methodologies strategically employ tiered screening wherein the number of compositions screened decreases as the complexity, and very often the scientific information obtained from a screening experiment, increases. The algorithm used for down-selection of samples from higher throughput screening experiment to a lower throughput screening experiment is vital in achieving information-rich experimental materials genomes. The fundamental science of material discovery lies in the establishment of composition-structure-property relationships, motivating the development of advanced down-selection algorithms which consider the information value of the selected compositions, as opposed to simply selecting the best performing compositions from a high throughput experiment. Identification of property fields (composition regions with distinct composition-property relationships) in high throughput data enables down-selection algorithms to employ advanced selection strategies, such as the selection of representative compositions from each field or selection of compositions that span the composition space of the highest performing field. Such strategies would greatly enhance the generation of data-driven discoveries. We introduce an informatics-based clustering of composition-property functional relationships using a combination of information theory and multitree genetic programming concepts for identification of property fields in a composition library. We demonstrate our approach using a complex synthetic composition-property map for a 5 at. % step ternary library consisting of four distinct property fields and finally explore the application of this methodology for capturing relationships between composition and catalytic activity for the oxygen evolution reaction for 5429 catalyst compositions in a (Ni-Fe-Co-Ce)Ox library. PMID:25706328

Suram, Santosh K; Haber, Joel A; Jin, Jian; Gregoire, John M

2015-04-13

217

Viral hepatitis in India.  

PubMed

Viral hepatitis is a major public health problem in India, which is hyperendemic for HAV and HEV. Seroprevalence studies reveal that 90%-100% of the population acquires anti-HAV antibody and becomes immune by adolescence. Many epidemics of HEV have been reported from India. HAV related liver disease is uncommon in India and occurs mainly in children. HEV is also the major cause of sporadic adult acute viral hepatitis and ALF. Pregnant women and patients with CLD constitute the high risk groups to contract HEV infection, and HEV-induced mortality among them is substantial, which underlines the need for preventive measures for such groups. Children with HAV and HEV coinfection are prone to develop ALF. India has intermediate HBV endemicity, with a carrier frequency of 2%-4%. HBV is the major cause of CLD and HCC. Chronic HBV infection in India is acquired in childhood, presumably before 5 years of age, through horizontal transmission. Vertical transmission of HBV in India is considered to be infrequent. Inclusion of HBV vaccination in the expanded programme of immunization is essential to reduce the HBV carrier frequency and disease burden. HBV genotypes A and D are prevalent in India, which are similar to the HBV genotypes in the West. HCV infection in India has a population prevalence of around 1%, and occurs predominantly through transfusion and the use of unsterile glass syringes. HCV genotypes 3 and 2 are prevalent in 60%-80% of the population and they respond well to a combination of interferon and ribavirin. About 10%-15% of CLD and HCC are associated with HCV infection in India. HCV infection is also a major cause of post-transfusion hepatitis. HDV infection is infrequent in India and is present about 5%-10% of patients with HBV-related liver disease. HCC appears to be less common in India than would be expected from the prevalence rates of HBV and HCV. The high disease burden of viral hepatitis and related CLD in India, calls for the setting up of a hepatitis registry and formulation of government-supported prevention and control strategies. PMID:17100109

Acharya, S K; Madan, Kaushal; Dattagupta, S; Panda, S K

2006-01-01

218

Viral vectors: from virology to transgene expression  

PubMed Central

In the late 1970s, it was predicted that gene therapy would be applied to humans within a decade. However, despite some success, gene therapy has still not become a routine practise in medicine. In this review, we will examine the problems, both experimental and clinical, associated with the use of viral material for transgenic insertion. We shall also discuss the development of viral vectors involving the most important vector types derived from retroviruses, adenoviruses, herpes simplex viruses and adeno-associated viruses. This article is part of a themed section on Vector Design and Drug Delivery. For a list of all articles in this section see the end of this paper, or visit: http://www3.interscience.wiley.com/journal/121548564/issueyear?year=2009 PMID:18776913

Bouard, D; Alazard-Dany, N; Cosset, F-L

2009-01-01

219

The Impact of Viral Genotype on Pathogenesis and Disease Severity: Respiratory Syncytial Virus and Human Rhinoviruses  

PubMed Central

Respiratory syncytial virus (RSV) is the leading cause of lower respiratory tract infection (LRI) and viral death in infants. RSV disease in infants is characterized by epithelial desquamation, neutrophilic bronchiolitis and pneumonia, and obstructive pulmonary mucus. Human rhinoviruses (HRV) are by far the most common cause of symptomatic upper respiratory tract infection (URI) in people and are more recently appreciated as a significant cause of LRI. RSV and HRV are also implicated in asthma pathogenesis. Within both RSV and HRV, viral genetic differences play a role in disease severity and/or prevalence in patient populations, and viral genetic differences affect pathogenesis. Here, we review data on how viral genetic differences impact disease using RSV and HRV as examples, including effects on the host immune response. Virus genotype-phenotype relationships can be exploited in the laboratory to gain insight into mechanisms by which respiratory viruses modulate host immune responses and cause disease. PMID:24455766

Moore, Martin L.; Stokes, Kate L.; Hartert, Tina V.

2013-01-01

220

Cytokine determinants of viral tropism  

Microsoft Academic Search

The specificity of a given virus for a cell type, tissue or species — collectively known as viral tropism — is an important factor in determining the outcome of viral infection in any particular host. Owing to the increased prevalence of zoonotic infections and the threat of emerging and re-emerging pathogens, gaining a better understanding of the factors that determine

Mohamed R. Mohamed; Masmudur M. Rahman; Eric Bartee; Grant McFadden

2009-01-01

221

Viral Quasispecies Evolution  

PubMed Central

Summary: Evolution of RNA viruses occurs through disequilibria of collections of closely related mutant spectra or mutant clouds termed viral quasispecies. Here we review the origin of the quasispecies concept and some biological implications of quasispecies dynamics. Two main aspects are addressed: (i) mutant clouds as reservoirs of phenotypic variants for virus adaptability and (ii) the internal interactions that are established within mutant spectra that render a virus ensemble the unit of selection. The understanding of viruses as quasispecies has led to new antiviral designs, such as lethal mutagenesis, whose aim is to drive viruses toward low fitness values with limited chances of fitness recovery. The impact of quasispecies for three salient human pathogens, human immunodeficiency virus and the hepatitis B and C viruses, is reviewed, with emphasis on antiviral treatment strategies. Finally, extensions of quasispecies to nonviral systems are briefly mentioned to emphasize the broad applicability of quasispecies theory. PMID:22688811

Sheldon, Julie; Perales, Celia

2012-01-01

222

Dengue viral infections  

PubMed Central

Dengue viral infections are one of the most important mosquito borne diseases in the world. They may be asymptomatic or may give rise to undifferentiated fever, dengue fever, dengue haemorrhagic fever (DHF), or dengue shock syndrome. Annually, 100 million cases of dengue fever and half a million cases of DHF occur worldwide. Ninety percent of DHF subjects are children less than 15 years of age. At present, dengue is endemic in 112 countries in the world. No vaccine is available for preventing this disease. Early recognition and prompt initiation of appropriate treatment are vital if disease related morbidity and mortality are to be limited. This review outlines aspects of the epidemiology of dengue infections, the dengue virus and its mosquito vector, clinical features and pathogenesis of dengue infections, and the management and control of these infections. PMID:15466994

Malavige, G; Fernando, S; Fernando, D; Seneviratne, S

2004-01-01

223

Genetics of the Steller's Sea Cow (Hydrodamalis gigas): A Study of Ancient Bone Material  

NASA Astrophysics Data System (ADS)

Georg Wilhelm Steller was born 100 years before Darwin in 1709 and he was part of a vast exploration fifty years before Lewis and Clark explored America. Steller was important to the study of marine mammals because he was the only naturalist to see and describe the great northern sea cow ( Hydrodamalis gigas). Knowledge of an extinct population can be used to aid the conservation of a current population. Extraction of DNA from this extinct animal was performed in order to determine the population structure of the Steller's sea cow. A test was also developed that can definitively state whether or not a random bone sample came from H. gigas. This test could be used by the Fish and Wildlife Service (FWS) and the National Oceanic and Atmospheric Administration (NOAA) to examine material distributed in the North Pacific to determine whether samples are legally traded extinct Steller's sea cow or illegally traded extant marine mammal species protected under the Marine Mammal Protection Act (MMPA).

Crerar, Lorelei D.

224

Genetic Resources  

Microsoft Academic Search

\\u000a Plant genetic resources (PGR) for food and agriculture consist of the diversity of genetic material contained in traditional\\u000a varieties and modern cultivars grown by farmers as well as crop wild relatives and other wild plant species that can be used\\u000a for food, feed for domestic animals, fiber, clothing, shelter, wood, timber, energy, etc. (FAO 1997). Fodder crop genetic\\u000a resources broaden

Beat Boller; Stephanie L. Greene

225

Intrapatient Diversity and Its Correlation with Viral Setpoint in Human Immunodeficiency Virus Type 1 CRF02_A\\/G-IbNG Infection  

Microsoft Academic Search

The human immunodeficiency virus type 1 (HIV-1) viral setpoint during the disease-free interval has been strongly associated with future risk of disease progression. An awareness of the correlation between viral setpoint and HIV-1 genetic evolution over time is important in the understanding of viral dynamics and infection. We examined genetic diversity in HIV-1 CRF02_A\\/G-IbNG-infected seroincident women in Dakar, Senegal; determined

Indu Mani; Peter Gilbert; Jean-Louis Sankale; Geoffrey Eisen; Souleymane Mboup; Phyllis J. Kanki

2002-01-01

226

Influence of amount of starting material for DNA extraction on detection of low-level presence of genetically engineered traits.  

PubMed

Two laboratories independently examined how the amount of starting material influences DNA extraction efficiency and, ultimately, the detection of low-level presence of genetically engineered (GE) traits in commercialized grains. GE traits from one maize, two canola, and two soybean samples were used as prototypical models in the study design as well as two commonly used DNA extraction methods, a small scale (0.1 and 0.2 g samples) and a large scale (1.0 and 2.0 g samples). The DNA samples were fortified (spiked) at 0.1 and 0.01% (w/w) levels. The amount of DNA recovery varied between the two laboratories, although a sufficient amount of DNA was obtained to perform replicate PCR analysis by both laboratories. Reliable detection of all five events was achieved by both laboratories at 0.1% level using either small-scale or large-scale DNA extractions. Reliable detection of the GE events was achieved at 0.01% level for soybean and canola but not for maize. Variability was observed among the two laboratories in terms of the Ct values generated. There was no difference between small-scale and large-scale DNA extraction methods for qualitative PCR detections of all five GE events. PMID:24745691

Demeke, Tigst; Phan, Anh; Ratnayaka, Indira; Holigroski, Michelle; Jenkins, G Ronald

2014-05-14

227

Viral infections in pregnancy.  

PubMed

Viral infections are a common complication of pregnancy and in some cases, can have profound effects for the unborn fetus. The human herpesvirus family is composed of large, enveloped DNA viruses that have close structural similarity. The family includes the herpes simplex viruses types 1 and 2, varicella zoster virus, Epstein Barr virus, cytomegalovirus (CMV), and human herpes viruses types 6, 7 and 8. These viruses all share the ability to establish latency and reactivate at a later time. Structural fetal abnormalities can result from intrauterine infection and transmission of the infection during the pregnancy or at the time of delivery can result in important neonatal disease. Human parvovirus B19 is a DNA virus with strong tropism for erythroid precursors and infection during pregnancy can result in fetal hydrops and stillbirth. The causative agents of hepatitis are hepatotropic viruses termed hepatitis A, B, C, D (deltavirus) and E. All except hepatitis B virus are RNA viruses. Vertical transmission of maternal infection with hepatitis B and C can result in significant long term sequelae. PMID:17505458

Haun, L; Kwan, N; Hollier, L M

2007-04-01

228

Genetic variability and evolutionary dynamics of viruses of the family Closteroviridae  

PubMed Central

RNA viruses have a great potential for genetic variation, rapid evolution and adaptation. Characterization of the genetic variation of viral populations provides relevant information on the processes involved in virus evolution and epidemiology and it is crucial for designing reliable diagnostic tools and developing efficient and durable disease control strategies. Here we performed an updated analysis of sequences available in Genbank and reviewed present knowledge on the genetic variability and evolutionary processes of viruses of the family Closteroviridae. Several factors have shaped the genetic structure and diversity of closteroviruses. (I) A strong negative selection seems to be responsible for the high genetic stability in space and time for some viruses. (2) Long distance migration, probably by human transport of infected propagative plant material, have caused that genetically similar virus isolates are found in distant geographical regions. (3) Recombination between divergent sequence variants have generated new genotypes and plays an important role for the evolution of some viruses of the family Closteroviridae. (4) Interaction between virus strains or between different viruses in mixed infections may alter accumulation of certain strains. (5) Host change or virus transmission by insect vectors induced changes in the viral population structure due to positive selection of sequence variants with higher fitness for host-virus or vector-virus interaction (adaptation) or by genetic drift due to random selection of sequence variants during the population bottleneck associated to the transmission process. PMID:23805130

Rubio, Luis; Guerri, José; Moreno, Pedro

2013-01-01

229

Autologous Antibody Capture to Enrich Immunogenic Viruses for Viral Discovery  

PubMed Central

Discovery of new viruses has been boosted by novel deep sequencing technologies. Currently, many viruses can be identified by sequencing without knowledge of the pathogenicity of the virus. However, attributing the presence of a virus in patient material to a disease in the patient can be a challenge. One approach to meet this challenge is identification of viral sequences based on enrichment by autologous patient antibody capture. This method facilitates identification of viruses that have provoked an immune response within the patient and may increase the sensitivity of the current virus discovery techniques. To demonstrate the utility of this method, virus discovery deep sequencing (VIDISCA-454) was performed on clinical samples from 19 patients: 13 with a known respiratory viral infection and 6 with a known gastrointestinal viral infection. Patient sera was collected from one to several months after the acute infection phase. Input and antibody capture material was sequenced and enrichment was assessed. In 18 of the 19 patients, viral reads from immunogenic viruses were enriched by antibody capture (ranging between 1.5x to 343x in respiratory material, and 1.4x to 53x in stool). Enriched reads were also determined in an identity independent manner by using a novel algorithm Xcompare. In 16 of the 19 patients, 21% to 100% of the enriched reads were derived from infecting viruses. In conclusion, the technique provides a novel approach to specifically identify immunogenic viral sequences among the bulk of sequences which are usually encountered during virus discovery metagenomics. PMID:24223808

Deijs, Martin; Jonkers, Jiri; Verhoeven, Joost T. P.; Ieven, Margareta; Goossens, Herman; de Jong, Menno D.; Berkhout, Ben; Loens, Katherine; Kellam, Paul; Bakker, Margreet; Canuti, Marta; Cotten, Matthew; van der Hoek, Lia

2013-01-01

230

A Drosophila Toolkit for the Visualization and Quantification of Viral Replication Launched from Transgenic Genomes  

PubMed Central

Arthropod RNA viruses pose a serious threat to human health, yet many aspects of their replication cycle remain incompletely understood. Here we describe a versatile Drosophila toolkit of transgenic, self-replicating genomes (‘replicons’) from Sindbis virus that allow rapid visualization and quantification of viral replication in vivo. We generated replicons expressing Luciferase for the quantification of viral replication, serving as useful new tools for large-scale genetic screens for identifying cellular pathways that influence viral replication. We also present a new binary system in which replication-deficient viral genomes can be activated ‘in trans’, through co-expression of an intact replicon contributing an RNA-dependent RNA polymerase. The utility of this toolkit for studying virus biology is demonstrated by the observation of stochastic exclusion between replicons expressing different fluorescent proteins, when co-expressed under control of the same cellular promoter. This process is analogous to ‘superinfection exclusion’ between virus particles in cell culture, a process that is incompletely understood. We show that viral polymerases strongly prefer to replicate the genome that encoded them, and that almost invariably only a single virus genome is stochastically chosen for replication in each cell. Our in vivo system now makes this process amenable to detailed genetic dissection. Thus, this toolkit allows the cell-type specific, quantitative study of viral replication in a genetic model organism, opening new avenues for molecular, genetic and pharmacological dissection of virus biology and tool development. PMID:25386852

Wernet, Mathias F.; Klovstad, Martha; Clandinin, Thomas R.

2014-01-01

231

Authentic and Chimeric Full-Length Genomic cDNA Clones of Bovine Viral Diarrhea Virus That Yield Infectious Transcripts  

Microsoft Academic Search

Bovine viral diarrhea virus (BVDV) is the most insidious and devastating viral pathogen of cattle in the United States. Disease control approaches must be based on detailed knowledge of virus biology. To develop reverse-genetic systems to study the molecular biology of the virus, wefirst constructed a plasmid containing the entire genome of BVDV cloned as cDNA. Subsequently, we showed that

VENTZISLAV B. VASSILEV; MARC S. COLLETT; ANDRUBEN O. DONIS

1997-01-01

232

High efficiency non-viral transfection of retinal and iris pigment epithelial cells with pigment epithelium-derived factor  

Microsoft Academic Search

Transplantation of pigment epithelial cells in patients with age-related macular degeneration and Parkinson's disease has the potential to improve functional rehabilitation. Genetic modification of cells before transplantation may allow the delivery of neuroprotective factors to achieve functional improvement. As transplantation of cells modified using viral vectors is complicated by the possible dissemination of viral particles and severe immune reactions, we

G Thumann; M Stöcker; C Maltusch; A K Salz; S Barth; P Walter; S Johnen

2010-01-01

233

Statistical Mechanics of Viral Entry  

NASA Astrophysics Data System (ADS)

Viruses that have lipid-membrane envelopes infect cells by fusing with the cell membrane to release viral genes. Membrane fusion is known to be hindered by high kinetic barriers associated with drastic structural rearrangements—yet viral infection, which occurs by fusion, proceeds on remarkably short time scales. Here, we present a quantitative framework that captures the principles behind the invasion strategy shared by all enveloped viruses. The key to this strategy—ligand-triggered conformational changes in the viral proteins that pull the membranes together—is treated as a set of concurrent, bias field-induced activated rate processes. The framework results in analytical solutions for experimentally measurable characteristics of virus-cell fusion and enables us to express the efficiency of the viral strategy in quantitative terms. The predictive value of the theory is validated through simulations and illustrated through recent experimental data on influenza virus infection.

Zhang, Yaojun; Dudko, Olga K.

2015-01-01

234

Aseptic Meningitis and Viral Myelitis  

PubMed Central

SYNOPSIS Meningitis and myelitis represent common and very infrequent viral infections of the central nervous system (CNS), respectively. Indeed, the number of cases of viral meningitis that occurs annually exceeds the total number of meningitis cases caused by all other etiologies combined. Focal CNS infections, on the other hand, such as occur in the spinal cord with viral myelitis, are much less common and may be confused with non-infectious disorders that cause acute flaccid paralysis (AFP). This chapter will review some of the important clinical features, epidemiology, diagnostic approaches, and management strategies for patients with aseptic meningitis and viral myelitis. Particular focus will be placed on the diseases caused by enteroviruses (EVs), which as a group account for the vast majority of all aseptic meningitis cases as well as many focal infections of the spinal cord. PMID:18657719

Irani, David N.

2008-01-01

235

Update on selected viral exanthems.  

PubMed

Viral exanthems are common in childhood and account for a large number of patient visits to pediatric or family medicine clinics. Most exanthems are virtually harmless to the healthy child, but others can be signs of more significant systemic disease. Some exanthems that are benign or self-limited in the healthy child may propose significant risk to pregnant or immunocompromised individuals. Therefore, recognition of exanthems, which may be associated with certain viral illnesses, is important for the primary care provider. For example, prompt recognition of a viral exanthem caused by parvovirus may allow a pregnant female from exposing her fetus to a potentially fatal infection, or, if the exposure has already occurred, may indicate the need for appropriate fetal monitoring. In this manuscript, we review the recent literature pertaining to four characteristic exanthems that are thought to be viral in nature: papular purpuric gloves and socks syndrome; pityriasis rosea; unilateral lateral thoracic exanthem; and Gianotti-Crosti syndrome. PMID:10943817

Nelson, J S; Stone, M S

2000-08-01

236

Cytokine determinants of viral tropism  

PubMed Central

The specificity of a given virus for a ceil type, tissue or species — collectively known as viral tropism — is an important factor in determining the outcome of viral infection in any particular host. Owing to the increased prevalence of zoonotic infections and the threat of emerging and re-emerging pathogens, gaining a better understanding of the factors that determine viral tropism has become particularly important. In this Review, we summarize our current understanding of the central role of antiviral and pro-inflammatory cytokines, particularly the interferons and tumour necrosis factor, in dictating viral tropism and how these cytokine pathways can be exploited therapeutically for cancer treatment and to better counter future threats from emerging zoonotic pathogens. PMID:19696766

McFadden, Grant; Mohamed, Mohamed R.; Rahman, Masmudur M.; Bartee, Eric

2015-01-01

237

Nonlytic viral spread enhanced by autophagy components  

PubMed Central

The cell-to-cell spread of cytoplasmic constituents such as nonenveloped viruses and aggregated proteins is usually thought to require cell lysis. However, mechanisms of unconventional secretion have been described that bypass the secretory pathway for the extracellular delivery of cytoplasmic molecules. Components of the autophagy pathway, an intracellular recycling process, have been shown to play a role in the unconventional secretion of cytoplasmic signaling proteins. Poliovirus is a lytic virus, although a few examples of apparently nonlytic spread have been documented. Real demonstration of nonlytic spread for poliovirus or any other cytoplasmic constituent thought to exit cells via unconventional secretion requires demonstration that a small amount of cell lysis in the cellular population is not responsible for the release of cytosolic material. Here, we use quantitative time-lapse microscopy to show the spread of infectious cytoplasmic material between cells in the absence of lysis. siRNA-mediated depletion of autophagy protein LC3 reduced nonlytic intercellular viral transfer. Conversely, pharmacological stimulation of the autophagy pathway caused more rapid viral spread in tissue culture and greater pathogenicity in mice. Thus, the unconventional secretion of infectious material in the absence of cell lysis is enabled by components of the autophagy pathway. It is likely that other nonenveloped viruses also use this pathway for nonlytic intercellular spread to affect pathogenesis in infected hosts. PMID:25157142

Bird, Sara Whitney; Maynard, Nathaniel D.; Covert, Markus W.; Kirkegaard, Karla

2014-01-01

238

[Acute viral hepatitis during pregnancy].  

PubMed

Acute hepatitis has a very low incidence disease during pregnancy. However, it may be an important cause of jaundice during gestation which in cases of viral etiology can have a very high morbidity and mortality risk to the mother and the fetus. The purpose of this review is to update the available knowledge regarding viral hepatitis during pregnancy including description of the main etiologies, transmission route, maternal-fetal risk and possible management. PMID:21279287

Valdés R, Enrique; Sepúlveda M, Alvaro; Candia P, Paula; Lattes A, Karina

2010-12-01

239

Viral RNAs Are Unusually Compact  

PubMed Central

A majority of viruses are composed of long single-stranded genomic RNA molecules encapsulated by protein shells with diameters of just a few tens of nanometers. We examine the extent to which these viral RNAs have evolved to be physically compact molecules to facilitate encapsulation. Measurements of equal-length viral, non-viral, coding and non-coding RNAs show viral RNAs to have among the smallest sizes in solution, i.e., the highest gel-electrophoretic mobilities and the smallest hydrodynamic radii. Using graph-theoretical analyses we demonstrate that their sizes correlate with the compactness of branching patterns in predicted secondary structure ensembles. The density of branching is determined by the number and relative positions of 3-helix junctions, and is highly sensitive to the presence of rare higher-order junctions with 4 or more helices. Compact branching arises from a preponderance of base pairing between nucleotides close to each other in the primary sequence. The density of branching represents a degree of freedom optimized by viral RNA genomes in response to the evolutionary pressure to be packaged reliably. Several families of viruses are analyzed to delineate the effects of capsid geometry, size and charge stabilization on the selective pressure for RNA compactness. Compact branching has important implications for RNA folding and viral assembly. PMID:25188030

Gopal, Ajaykumar; Egecioglu, Defne E.; Yoffe, Aron M.; Ben-Shaul, Avinoam; Rao, Ayala L. N.; Knobler, Charles M.; Gelbart, William M.

2014-01-01

240

Detection of viral hemorrhagic septicemia virus  

USGS Publications Warehouse

Viral hemorrhagic septicemia virus (VHSV) is considered to be one of the most important viral pathogens of finfish and is listed as reportable by many nations and international organizations (Office International des Epizooties 2006). Prior to 1988, VHSV was thought to be limited to Europe (Wolf 1988; Smail 1999). Subsequently, it was shown that the virus is endemic among many marine and anadromous fish species in both the Pacific and Atlantic Oceans (Meyers and Winton 1995; Skall et al. 2005). Genetic analysis reveals that isolates of VHSV can be divided into four genotypes that generally correlate with geographic location with the North American isolates generally falling into VHSV Genotype IV (Snow et al. 2004). In 2005-2006, reports from the Great Lakes region indicated that wild fish had experienced disease or, in some cases, very large die-offs from VHSV (Elsayed et al. 2006, Lumsden et al. 2007). The new strain from the Great Lakes, now identified as VHSV Genotype IVb, appears most closely related to isolates of VHSV from mortalities that occurred during 2000-2004 in rivers and near-shore areas of New Brunswick and Nova Scotia, Canada (Gagne et al. 2007). The type IVb isolate found in the Great Lakes region is the only strain outside of Europe that has been associated with significant mortality in freshwater species.

Winton, James; Kurath, Gael; Batts, William

2007-01-01

241

Glycosylation, hypogammaglobulinemia, and resistance to viral infections.  

PubMed

Genetic defects in MOGS, the gene encoding mannosyl-oligosaccharide glucosidase (the first enzyme in the processing pathway of N-linked oligosaccharide), cause the rare congenital disorder of glycosylation type IIb (CDG-IIb), also known as MOGS-CDG. MOGS is expressed in the endoplasmic reticulum and is involved in the trimming of N-glycans. We evaluated two siblings with CDG-IIb who presented with multiple neurologic complications and a paradoxical immunologic phenotype characterized by severe hypogammaglobulinemia but limited clinical evidence of an infectious diathesis. A shortened immunoglobulin half-life was determined to be the mechanism underlying the hypogammaglobulinemia. Impaired viral replication and cellular entry may explain a decreased susceptibility to infections. PMID:24716661

Sadat, Mohammed A; Moir, Susan; Chun, Tae-Wook; Lusso, Paolo; Kaplan, Gerardo; Wolfe, Lynne; Memoli, Matthew J; He, Miao; Vega, Hugo; Kim, Leo J Y; Huang, Yan; Hussein, Nadia; Nievas, Elma; Mitchell, Raquel; Garofalo, Mary; Louie, Aaron; Ireland, Derek C; Grunes, Claire; Cimbro, Raffaello; Patel, Vyomesh; Holzapfel, Genevieve; Salahuddin, Daniel; Bristol, Tyler; Adams, David; Marciano, Beatriz E; Hegde, Madhuri; Li, Yuxing; Calvo, Katherine R; Stoddard, Jennifer; Justement, J Shawn; Jacques, Jerome; Long Priel, Debra A; Murray, Danielle; Sun, Peter; Kuhns, Douglas B; Boerkoel, Cornelius F; Chiorini, John A; Di Pasquale, Giovanni; Verthelyi, Daniela; Rosenzweig, Sergio D

2014-04-24

242

Identification of viral mutants by mass spectrometry  

PubMed Central

A method to identify mutations of virus proteins by using protein mass mapping is described. Comparative mass mapping was applied to a structural protein of the human rhinovirus Cys1199 ? Tyr mutant and to genetically engineered mutants of tobacco mosaic virus. The information generated from this approach can rapidly identify the peptide or protein containing the mutation and, in cases when nucleic acid sequencing is required, significantly narrows the region of the genome that must be sequenced. High-resolution matrix-assisted laser desorption/ionization (MALDI) mass spectrometry and tandem mass spectrometry were used to identify amino acid substitutions. This method provides valuable information for those analyzing viral variants and, in some cases, offers a rapid and accurate alternative to nucleotide sequencing. PMID:9671723

Lewis, J. Kathleen; Bendahmane, Mohammed; Smith, Thomas J.; Beachy, Roger N.; Siuzdak, Gary

1998-01-01

243

Glycosylation, Hypogammaglobulinemia, and Resistance to Viral Infections  

PubMed Central

Summary Genetic defects in MOGS, the gene encoding mannosyl-oligosaccharide glucosidase (the first enzyme in the processing pathway of N-linked oligosaccharide), cause the rare congenital disorder of glycosylation type IIb (CDG-IIb), also known as MOGS-CDG. MOGS is expressed in the endoplasmic reticulum and is involved in the trimming of N-glycans. We evaluated two siblings with CDG-IIb who presented with multiple neurologic complications and a paradoxical immunologic phenotype characterized by severe hypogammaglobulinemia but limited clinical evidence of an infectious diathesis. A shortened immunoglobulin half-life was determined to be the mechanism underlying the hypogammaglobulinemia. Impaired viral replication and cellular entry may explain a decreased susceptibility to infections. PMID:24716661

Chun, Tae-Wook; Lusso, Paolo; Kaplan, Gerardo; Wolfe, Lynne; Memoli, Matthew J.; He, Miao; Vega, Hugo; Kim, Leo J.Y.; Huang, Yan; Hussein, Nadia; Nievas, Elma; Mitchell, Raquel; Garofalo, Mary; Louie, Aaron; Ireland, Derek C.; Grunes, Claire; Cimbro, Raffaello; Patel, Vyomesh; Holzapfel, Genevieve; Salahuddin, Daniel; Bristol, Tyler; Adams, David; Marciano, Beatriz E.; Hegde, Madhuri; Li, Yuxing; Calvo, Katherine R.; Stoddard, Jennifer; Justement, J. Shawn; Jacques, Jerome; Priel, Debra A. Long; Murray, Danielle; Sun, Peter; Kuhns, Douglas B.; Boerkoel, Cornelius F.; Chiorini, John A.; Di Pasquale, Giovanni; Verthelyi, Daniela; Rosenzweig, Sergio D.

2014-01-01

244

A methodology for exploiting the tolerance for imprecision in genetic fuzzy systems and its application to characterization of rotor blade leading edge materials  

NASA Astrophysics Data System (ADS)

A methodology for obtaining fuzzy rule-based models from uncertain data is proposed. The granularity of the linguistic discretization is decided with the help of a new estimation of the mutual information between ill-known random variables, and a combination of boosting and genetic algorithms is used for discovering new rules. This methodology has been applied to predict whether the coating of an helicopter rotor blade is adequate, considering the shear adhesion strength of ice to different materials. The discovered knowledge is intended to increase the level of post-processing interpretation accuracy of experimental data obtained during the evaluation of ice-phobic materials for rotorcraft applications.

Sánchez, Luciano; Couso, Inés; Palacios, Ana M.; Palacios, José L.

2013-05-01

245

Illinois Birth to Three Clearinghouse Bibliography Series: "Materials on Home Care" (#18); "Material on Hearing-Impairment and Deafness in the Clearinghouse" (#19); "Audiovisual Materials in the Clearinghouse Collection" (#20); "Materials on Medical Genetics in the Clearinghouse" (#21).  

ERIC Educational Resources Information Center

Four topical bibliographies list materials held by the Illinois Birth to Three Clearinghouse which collects information of interest to parents, professionals, and policymakers on health, education, and development in infancy and early childhood. Bibliography number 18, "Materials on Home Care," contains 52 entries for books and journal articles…

Illinois Public Health Association, Springfield.

246

Identification of Bovine Viral Diarrhea Virus type 2 in Korean native goat ( Capra hircus)  

Microsoft Academic Search

In the genus Pestivirus, four genetically distinct viral species are currently recognized: bovine viral diarrhea viruses type 1 and 2 (BVDV-1, BVDV-2), classical swine fever virus (CSFV) and border disease virus (BDV). BVDV-1 and BDV infections have been described in goat species. Since 1998, border disease (BD) like symptoms in goats have been reported repeatedly in two southern-most provinces of

In-Joong Kim; Bang-Hun Hyun; Jin-Ho Shin; Kyoung-Ki Lee; Kyung-Woo Lee; Kyoung-Oh Cho; Mun-Il Kang

2006-01-01

247

RNA Virus Reverse Genetics and Vaccine Design  

PubMed Central

RNA viruses are capable of rapid spread and severe or potentially lethal disease in both animals and humans. The development of reverse genetics systems for manipulation and study of RNA virus genomes has provided platforms for designing and optimizing viral mutants for vaccine development. Here, we review the impact of RNA virus reverse genetics systems on past and current efforts to design effective and safe viral therapeutics and vaccines. PMID:24967693

Stobart, Christopher C.; Moore, Martin L.

2014-01-01

248

Cutaneous manifestations of viral hepatitis.  

PubMed

There are several extrahepatic cutaneous manifestations associated with hepatitis B and hepatitis C virus infection. Serum sickness and polyarteritis nodosa are predominantly associated with hepatitis B infection, whereas mixed cryoglobulinemia associated vasculitis and porphyria cutanea tarda are more frequently seen in hepatitis C infection. The clinico-pathogenic associations of these skin conditions are not completely defined but appear to involve activation of the host immune system including the complement system. Management of the aforementioned cutaneous manifestations of viral hepatitis is often similar to that done in cases without viral hepatitis, with control of immune activation being a key strategy. In cases associated with hepatitis B and C, control of viral replication with specific antiviral therapy is also important and associated with improvement in most of the associated clinical manifestations. PMID:25809574

Akhter, Ahmed; Said, Adnan

2015-02-01

249

Topology of viral evolution  

PubMed Central

The tree structure is currently the accepted paradigm to represent evolutionary relationships between organisms, species or other taxa. However, horizontal, or reticulate, genomic exchanges are pervasive in nature and confound characterization of phylogenetic trees. Drawing from algebraic topology, we present a unique evolutionary framework that comprehensively captures both clonal and reticulate evolution. We show that whereas clonal evolution can be summarized as a tree, reticulate evolution exhibits nontrivial topology of dimension greater than zero. Our method effectively characterizes clonal evolution, reassortment, and recombination in RNA viruses. Beyond detecting reticulate evolution, we succinctly recapitulate the history of complex genetic exchanges involving more than two parental strains, such as the triple reassortment of H7N9 avian influenza and the formation of circulating HIV-1 recombinants. In addition, we identify recurrent, large-scale patterns of reticulate evolution, including frequent PB2-PB1-PA-NP cosegregation during avian influenza reassortment. Finally, we bound the rate of reticulate events (i.e., 20 reassortments per year in avian influenza). Our method provides an evolutionary perspective that not only captures reticulate events precluding phylogeny, but also indicates the evolutionary scales where phylogenetic inference could be accurate. PMID:24170857

Chan, Joseph Minhow; Carlsson, Gunnar; Rabadan, Raul

2013-01-01

250

Topology of viral evolution.  

PubMed

The tree structure is currently the accepted paradigm to represent evolutionary relationships between organisms, species or other taxa. However, horizontal, or reticulate, genomic exchanges are pervasive in nature and confound characterization of phylogenetic trees. Drawing from algebraic topology, we present a unique evolutionary framework that comprehensively captures both clonal and reticulate evolution. We show that whereas clonal evolution can be summarized as a tree, reticulate evolution exhibits nontrivial topology of dimension greater than zero. Our method effectively characterizes clonal evolution, reassortment, and recombination in RNA viruses. Beyond detecting reticulate evolution, we succinctly recapitulate the history of complex genetic exchanges involving more than two parental strains, such as the triple reassortment of H7N9 avian influenza and the formation of circulating HIV-1 recombinants. In addition, we identify recurrent, large-scale patterns of reticulate evolution, including frequent PB2-PB1-PA-NP cosegregation during avian influenza reassortment. Finally, we bound the rate of reticulate events (i.e., 20 reassortments per year in avian influenza). Our method provides an evolutionary perspective that not only captures reticulate events precluding phylogeny, but also indicates the evolutionary scales where phylogenetic inference could be accurate. PMID:24170857

Chan, Joseph Minhow; Carlsson, Gunnar; Rabadan, Raul

2013-11-12

251

Viral metagenomics analysis of planktonic viruses in East Lake, Wuhan, China.  

PubMed

East Lake (Lake Donghu), located in Wuhan, China, is a typical city freshwater lake that has been experiencing eutrophic conditions and algal blooming during recent years. Marine and fresh water are considered to contain a large number of viruses. However, little is known about their genetic diversity because of the limited techniques for culturing viruses. In this study, we conducted a viral metagenomic analysis using a high-throughput sequencing technique with samples collected from East Lake in Spring, Summer, Autumn, and Winter. The libraries from four samples each generated 234,669, 71,837, 12,820, and 34,236 contigs (> 90 bp each), respectively. The genetic structure of the viral community revealed a high genetic diversity covering 23 viral families, with the majority of contigs homologous to DNA viruses, including members of Myoviridae, Podoviridae, Siphoviridae, Phycodnaviridae, and Microviridae, which infect bacteria or algae, and members of Circoviridae, which infect invertebrates and vertebrates. The highest viral genetic diversity occurred in samples collected in August, then December and June, and the least diversity in March. Most contigs have low-sequence identities with known viruses. PCR detection targeting the conserved sequences of genes (g20, psbA, psbD, and DNApol) of cyanophages further confirmed that there are novel cyanophages in the East Lake. Our viral metagenomic data provide the first preliminary understanding of the virome in one freshwater lake in China and would be helpful for novel virus discovery and the control of algal blooming in the future. PMID:24132758

Ge, Xingyi; Wu, Yongquan; Wang, Meiniang; Wang, Jun; Wu, Lijun; Yang, Xinglou; Zhang, Yuji; Shi, Zhengli

2013-10-01

252

A practical approach to a viral detection pipeline using existing viral and non-viral sequence resources.  

PubMed

For public health safety, vaccines and other pharmaceutical products as well as the raw materials used in their manufacture need to be tested for adventitious virus contamination. The current standard of practice is to develop culture-based or polymerase chain reaction assays for the types of viruses one might expect based upon the source of reagents used. High-throughput sequencing technology is well-suited for building an unbiased strategy for the purpose of adventitious virus detection. We have developed an approach to automate curation of publically available nucleotide sequences, and have practically balanced the desire to capture all viral diversity while simultaneously reducing the use of partial viral sequences that represent the largest source of false positive results. In addition, we describe an effective workflow for virus detection that can process sequence data from all currently available High-throughput sequencing technologies and produce a report that summarizes the weight of sequence data in support of each detected virus. PMID:25475634

Bekkari, Kavitha; Shpungin, Joseph; Thompson, John Ryan

2014-01-01

253

Viral infections and the development of asthma in children  

PubMed Central

Viral aetiology, host susceptibility (in particular allergic predisposition and sensitization), and illness severity, timing and frequency all appear to contribute as synergistic factors to the risk of developing asthma. Experimental models have shown both innate and adaptive immune responses contribute to this risk with lung inflammatory cells showing marked differences in phenotype and function in young compared with older animals, and these differences are further enhanced following virus infection. Findings to date strongly suggest that the impact of infant and preschool viral infections on the maturing immune system and developing lung that subsequently result in an asthma phenotype occur during a critical susceptibility period, and in a genetically susceptible host. There are currently no therapeutic strategies that allow primary or secondary prevention of asthma following early life viral respiratory infections in high-risk children, thus a focus on understanding the mechanisms of progression from viral wheezing in infants and preschool children to asthma development are urgently needed. This review summarizes the data reporting the role of the two most common viruses, that is, respiratory syncytial virus and human rhinovirus, that result in asthma development, comparing risk factors for disease progression, and providing insight into strategies that might be adopted to prevent asthma development. PMID:25165549

2013-01-01

254

Viral infections and the development of asthma in children.  

PubMed

Viral aetiology, host susceptibility (in particular allergic predisposition and sensitization), and illness severity, timing and frequency all appear to contribute as synergistic factors to the risk of developing asthma. Experimental models have shown both innate and adaptive immune responses contribute to this risk with lung inflammatory cells showing marked differences in phenotype and function in young compared with older animals, and these differences are further enhanced following virus infection. Findings to date strongly suggest that the impact of infant and preschool viral infections on the maturing immune system and developing lung that subsequently result in an asthma phenotype occur during a critical susceptibility period, and in a genetically susceptible host. There are currently no therapeutic strategies that allow primary or secondary prevention of asthma following early life viral respiratory infections in high-risk children, thus a focus on understanding the mechanisms of progression from viral wheezing in infants and preschool children to asthma development are urgently needed. This review summarizes the data reporting the role of the two most common viruses, that is, respiratory syncytial virus and human rhinovirus, that result in asthma development, comparing risk factors for disease progression, and providing insight into strategies that might be adopted to prevent asthma development. PMID:25165549

Saglani, Sejal

2013-08-01

255

Chapter VIII. Contributions of propagation techniques and genetic modification to breeding - genetic engineering for disease resistance  

Technology Transfer Automated Retrieval System (TEKTRAN)

Genetic engineering offers an opportunity to develop flower bulb crops with resistance to fungal, viral, and bacterial pathogens. Several of the flower bulb crops, Lilium spp., Gladiolus, Zantedeschia, Muscari, Hyacinthus, Narcissus, Ornithogalum, Iris, and Alstroemeria, have been transformed with t...

256

GENETIC ENGINEERING PRODUCER FACT SHEET 2 Methods to Maintain Genetic  

E-print Network

GENETIC ENGINEERING PRODUCER FACT SHEET 2 Methods to Maintain Genetic Purity of Seed Stocks KENT J yield. Seeds carry the genetic traits incorporated by years of breeding and selection to create quality. The genetic purity of seeds (i.e., the percentage of contamination by seeds or genetic material

Bradford, Kent

257

Nosocomial Spread of Viral Disease  

PubMed Central

Viruses are important causes of nosocomial infection, but the fact that hospital outbreaks often result from introduction(s) from community-based epidemics, together with the need to initiate specific laboratory testing, means that there are usually insufficient data to allow the monitoring of trends in incidences. The most important defenses against nosocomial transmission of viruses are detailed and continuing education of staff and strict adherence to infection control policies. Protocols must be available to assist in the management of patients with suspected or confirmed viral infection in the health care setting. In this review, we present details on general measures to prevent the spread of viral infection in hospitals and other health care environments. These include principles of accommodation of infected patients and approaches to good hygiene and patient management. They provide detail on individual viral diseases accompanied in each case with specific information on control of the infection and, where appropriate, details of preventive and therapeutic measures. The important areas of nosocomial infection due to blood-borne viruses have been extensively reviewed previously and are summarized here briefly, with citation of selected review articles. Human prion diseases, which present management problems very different from those of viral infection, are not included. PMID:11432812

Aitken, Celia; Jeffries, Donald J.

2001-01-01

258

Viral Subversion of Nucleocytoplasmic Trafficking  

PubMed Central

Trafficking of proteins and RNA into and out of the nucleus occurs through the nuclear pore complex (NPC). Due to its critical function in many cellular processes, the NPC and transport factors are common targets of several viruses that disrupt key constituents of the machinery to facilitate viral replication. Many viruses such as poliovirus and severe acute respiratory syndrome (SARS) virus inhibit protein import into the nucleus, while viruses such as influenza A virus target and disrupt host mRNA nuclear export. Current evidence indicates that these viruses may employ such strategies to avert the host immune response. Conversely, many viruses co-opt nucleocytoplasmic trafficking to facilitate transport of viral RNAs. Since viral proteins interact with key regulators of the host nuclear transport machinery, viruses have served as invaluable tools of discovery that led to the identification of novel constituents of nuclear transport pathways. In addition, this review explores the importance of nucleocytoplasmic trafficking to viral pathogenesis as these studies revealed new antiviral therapeutic strategies and exposed previously unknown cellular mechanisms. Further understanding of nuclear transport pathways will determine whether such therapeutics will be useful treatments for important human pathogens. PMID:24289861

Yarbrough, Melanie L.; Mata, Miguel A.; Sakthivel, Ramanavelan; Fontoura, Beatriz M. A.

2014-01-01

259

Asian citrus psyllid viral pathogen  

Technology Transfer Automated Retrieval System (TEKTRAN)

A newly discovered viral pathogen of Asian citrus psyllid, AsCP, Diaphorina citri, Kuwayama (Psyllidae: Hemiptera) was classified as a Reoviridae. This virus may serve as a biological control agent for AsCP. The AsCP is an efficient vector of the plant-infecting bacterium (Candidatus Liberibacter as...

260

The Paradigm of Viral Communication.  

ERIC Educational Resources Information Center

Introduces the concepts of idea viruses and viral communication, a technology-based communication that spreads ideas quickly. Explains its applicability in the area of direct marketing and discusses a technology platform that provides the opportunity of sending a message to a large number of people and emotional or pecuniary incentives to…

Welker, Carl B.

2002-01-01

261

VIRAL EVOLUTION Genomic surveillance elucidates  

E-print Network

VIRAL EVOLUTION Genomic surveillance elucidates Ebola virus origin and transmission during the 2014,12,13 § Robert F. Garry,8 § S. Humarr Khan,3 § Pardis C. Sabeti1,2 § In its largest outbreak, Ebola virus disease is spreading through Guinea, Liberia, Sierra Leone, and Nigeria. We sequenced 99 Ebola virus genomes from 78

Napp, Nils

262

An atomistic approach to viral mechanical oscillations  

NASA Astrophysics Data System (ADS)

Viruses are the simplest ``life'' form. These parasites reproduce by borrowing the machinery of their host cell. Many are pathogenic to plants, animals, and humans. Viruses possess an outer protein coat (capsid) that protects its genomic material that resides inside. We have developed a theoretical technique to model the very low frequency mechanical modes of the viral capsid with atomic resolution. The method uses empirical force fields and a mathematical framework borrowed from electronic structure theory for finding low energy states. The low frequency modes can be ``pinged'' with an ultra-short laser pulse and the aim of the light/vibrational coupling is to interfere with the viral life cycle. The theoretical work here is motivated by the recent work of Tsen et al. [2] who have used ultra-short pulsed laser scattering to inactivate viruses. The methodology can be applied to many systems, and the coupled mechanical oscillations of other floppy biomolecules such as a complete ATP binding cassette (ABC transporter) will also be discussed. Co-authors of this work are Dr. Eric Dykeman, Prof. K.-T. Tsen and Daryn Benson. [4pt] [1] E.C. Dykeman et al., Phys. Rev. Lett., 100, 028101 (2008). [0pt] [2] K-T. Tsen et al., J. of Physics -- Cond. Mat. 19, 472201 (2007).

Sankey, Otto F.

2009-03-01

263

Crop Registration: The Pathway to Public Access of Plant Genetic Materials to Build Crops for the Future  

Technology Transfer Automated Retrieval System (TEKTRAN)

Starting as Crop Science Registrations in the American Journal of the Society of Agronomy in 1926, and continuing 80+ years later in the Journal of Plant Registrations, 11,241 plant cultivars, germplasm, parental lines, genetic stocks and mapping populations have been registered as of December 31, 2...

264

Xenografting of sheep testis tissue and isolated cells as a model for preservation of genetic material from endangered ungulates  

Microsoft Academic Search

Recoveryof germ cells could be an option for preservation of the genetic pool of endangered animals. In immature males, xenografting of testis tissue provides the opportunity to recover sperm from these animals. In adult animals, xenografting has been less successful, but de novo morphogenesis offunctional testis tissue from dissociated testis cells could be an alternative. To assess the potential use

Lucia Arregui; Rahul Rathi; Susan O Megee; Ali Honaramooz; Montserrat Gomendio; Eduardo R S Roldan; Ina Dobrinski

2008-01-01

265

Genetics of hepatobiliary carcinogenesis.  

PubMed

Hepatocellular carcinoma (HCC) and cholangiocarcinoma (CC) are two leading causes of cancer death in the world. Liver carcinogenesis is driven by genetic alterations in combination with viral and environmental factors. ?-catenin and P53 mutations represent the two main genetic alterations described in HCC, and P53 and KRAS mutations in CC, but rare genetic alterations could be particularly valuable if they constitute drug-able targets (such as PIK3CA or EGFR mutations). Recent progress using global genomic analysis has highlighted the marked genetic heterogeneity of this disease and this approach has also been used to assess prognosis or refine the diagnosis. The validation of sorafenib as the first targeted therapy useful in HCC has opened up new prospects for biotherapy in this cancer. In the future, mapping of genetic alterations will be essential to adapt treatment to HCC and CC biology. PMID:21538283

Nault, Jean-Charles; Zucman-Rossi, Jessica

2011-05-01

266

Neuropathogenic SIVsmmFGb genetic diversity and selection-induced tissue-specific compartmentalization during chronic infection and temporal evolution of viral genes in lymphoid tissues and regions of the central nervous system.  

PubMed

SIVsmmFGb is a lentivirus swarm that induces neuropathology in over 90% of infected pigtailed macaques and reliably models central nervous system HIV infection in people. We have previously studied SIVsmmFGb genetic diversity and compartmentalization during acute infection, but little is understood about diversity and intertissue compartmentalization during chronic infection. Tissue-specific pressure appeared to affect the diversity of Nef sequences between tissues, but changes to the Env V1 region and Int diversity were similar across all tissues. At 2 months postinfection, compartmentalization of the SIVsmmFGb env V1 region, nef, and int was noted between different brain regions and between brain regions and lymph nodes. Convergent evolution of the nef and env V1 region, and divergent evolution of int, was noted between compartments and all genes demonstrated intratissue temporal segregation. For the env V1 region and nef, temporal segregation was stronger in the brain regions than the periphery, but little difference between tissues was noted for int. Positive selection of the env V1 region appeared in most tissues at 2 months postinfection, whereas nef and int faced negative selection in all tissues. Positive selection of the env V1 region sequences increased in some brain regions over time. SIVsmmFGb nef and int sequences each saw increased negative selection in brain regions, and one lymph node, over the course of infection. Functional differences between tissue compartments decreased over time for int and env V1 region sequences, but increased for nef sequences. PMID:20518690

Reeve, Aaron B; Pearce, Nicholas C; Patel, Kalpana; Augustus, Katherine V; Novembre, Francis J

2010-06-01

267

Materials  

NASA Technical Reports Server (NTRS)

NASA Langley Research Center has successfully developed an electron beam freeform fabrication (EBF3) process, a rapid metal deposition process that works efficiently with a variety of weldable alloys. The EBF3 process can be used to build a complex, unitized part in a layer-additive fashion, although the more immediate payoff is for use as a manufacturing process for adding details to components fabricated from simplified castings and forgings or plate products. The EBF3 process produces structural metallic parts with strengths comparable to that of wrought product forms and has been demonstrated on aluminum, titanium, and nickel-based alloys to date. The EBF3 process introduces metal wire feedstock into a molten pool that is created and sustained using a focused electron beam in a vacuum environment. Operation in a vacuum ensures a clean process environment and eliminates the need for a consumable shield gas. Advanced metal manufacturing methods such as EBF3 are being explored for fabrication and repair of aerospace structures, offering potential for improvements in cost, weight, and performance to enhance mission success for aircraft, launch vehicles, and spacecraft. Near-term applications of the EBF3 process are most likely to be implemented for cost reduction and lead time reduction through addition of details onto simplified preforms (casting or forging). This is particularly attractive for components with protruding details that would require a significantly large volume of material to be machined away from an oversized forging, offering significant reductions to the buy-to-fly ratio. Future far-term applications promise improved structural efficiency through reduced weight and improved performance by exploiting the layer-additive nature of the EBF3 process to fabricate tailored unitized structures with functionally graded microstructures and compositions.

Glaessgen, Edward H.; Schoeppner, Gregory A.

2006-01-01

268

The Dynamics of Viral Marketing JURE LESKOVEC  

E-print Network

- ing such as TV or newspaper ads, marketers have turned to alternate strategies, including viral that "there needs to be a greater understanding of the contexts in which viral marketing strategy works and The Dynamics of Viral Marketing JURE LESKOVEC Carnegie Mellon University LADA A. ADAMIC University

Pratt, Vaughan

269

Viral Video Style: A Closer Look at Viral Videos on YouTube  

E-print Network

Viral Video Style: A Closer Look at Viral Videos on YouTube Lu Jiang, Yajie Miao, Yi Yang Introduction CMU Viral Video Dataset Statistical Characteristics Peak Day Prediction Conclusions #12;Outline Introduction CMU Viral Video Dataset Statistical Characteristics Peak Day Prediction

Shamos, Michael I.

270

Microfluidic Fabrication of Hydrogel Microparticles Containing Functionalized Viral Nanotemplates  

PubMed Central

We demonstrate rapid microfluidic fabrication of hybrid microparticles composed of functionalized viral nanotemplates directly embedded in polymeric hydrogels. Specifically, genetically modified tobacco mosaic virus (TMV) templates were covalently labeled with fluorescent markers or metalized with palladium (Pd) nanoparticles (Pd-TMV), then suspended in a poly(ethylene glycol)-based solution. Upon formation in a flow-focusing device, droplets were photopolymerized with UV light to form microparticles. Fluorescence and confocal microscopy images of microparticles containing fluorescently labeled TMV show uniform distribution of TMV nanotemplates throughout the microparticles. Catalytic activity, via the dichromate reduction reaction, is also demonstrated with microparticles containing Pd-TMV complexes. Additionally, Janus microparticles were fabricated containing viruses embedded in one side and magnetic nanoparticles in the other, that enabled simple separation from bulk solution. These results represent a facile route to directly harness the advantages of viral nanotemplates into a readily usable and stable 3D assembled format. PMID:20695589

Lewis, Christina L.; Lin, Yan; Yang, Cuixian; Manocchi, Amy K.; Yuet, Kai P.; Doyle, Patrick S.; Yi, Hyunmin

2010-01-01

271

HIV1 subtype and viral tropism determination for evaluating antiretroviral therapy options: an analysis of archived Kenyan blood samples  

Microsoft Academic Search

BACKGROUND: Infection with HIV-1 is characterized by genetic diversity such that specific viral subtypes are predominant in specific geographical areas. The genetic variation in HIV-1 pol and env genes is responsible for rapid development of resistance to current drugs. This variation has influenced disease progression among the infected and necessitated the search for alternative drugs with novel targets. Though successfully

Raphael W Lihana; Samoel A Khamadi; Raphael M Lwembe; Joyceline G Kinyua; Joseph K Muriuki; Nancy J Lagat; Fredrick A Okoth; Ernest P Makokha; Elijah M Songok

2009-01-01

272

Concepts of genetics: II edition  

SciTech Connect

This book provides an introduction to the molecule, and progresses logically through cellular genetics and the genetics of organisms to the larger picture of population genetics. The Second Edition features new chapters on quantitative inheritance and recombinant DNA, a new appendix with a human gene map and coverage of gene disorders, expanded coverage of bacterial and viral genetics, and consolidated coverage of sex linkage, sex determination, sex chromosome abberations, and sex differentiation. Dozens of new figures are added in this edition. All diagrams, photographs, and tables work hand-in-hand with the text to explain important concepts. Practical exercises with answers at the back of the text provide immediate feedback.

Klug, W.S.; Cummings, M.R.

1986-01-01

273

A Protective Role for ELR+ Chemokines during Acute Viral Encephalomyelitis  

PubMed Central

The functional role of ELR-positive CXC chemokines in host defense during acute viral-induced encephalomyelitis was determined. Inoculation of the neurotropic JHM strain of mouse hepatitis virus (JHMV) into the central nervous system (CNS) of mice resulted in the rapid mobilization of PMNs expressing the chemokine receptor CXCR2 into the blood. Migration of PMNs to the CNS coincided with increased expression of transcripts specific for the CXCR2 ELR-positive chemokine ligands CXCL1, CXCL2, and CXCL5 within the brain. Treatment of JHMV-infected mice with anti-CXCR2 blocking antibody reduced PMN trafficking into the CNS by >95%, dampened MMP-9 activity, and abrogated blood-brain-barrier (BBB) breakdown. Correspondingly, CXCR2 neutralization resulted in diminished infiltration of virus-specific T cells, an inability to control viral replication within the brain, and 100% mortality. Blocking CXCR2 signaling did not impair the generation of virus-specific T cells, indicating that CXCR2 is not required to tailor anti-JHMV T cell responses. Evaluation of mice in which CXCR2 is genetically silenced (CXCR2?/? mice) confirmed that PMNs neither expressed CXCR2 nor migrated in response to ligands CXCL1, CXCL2, or CXCL5 in an in vitro chemotaxis assay. Moreover, JHMV infection of CXCR2?/? mice resulted in an approximate 60% reduction of PMN migration into the CNS, yet these mice survived infection and controlled viral replication within the brain. Treatment of JHMV-infected CXCR2?/? mice with anti-CXCR2 antibody did not modulate PMN migration nor alter viral clearance or mortality, indicating the existence of compensatory mechanisms that facilitate sufficient migration of PMNs into the CNS in the absence of CXCR2. Collectively, these findings highlight a previously unappreciated role for ELR-positive chemokines in enhancing host defense during acute viral infections of the CNS. PMID:19893623

Hosking, Martin P.; Liu, Liping; Ransohoff, Richard M.; Lane, Thomas E.

2009-01-01

274

Influence of host resistance on viral adaptation: hepatitis C virus as a case study  

PubMed Central

Genetic and cellular studies have shown that the host’s innate and adaptive immune responses are an important correlate of viral infection outcome. The features of the host’s immune response (host resistance) reflect the coevolution between hosts and pathogens that has occurred over millennia, and that has also resulted in a number of strategies developed by viruses to improve fitness and survival within the host (viral adaptation). In this review, we discuss viral adaptation to host immune pressure via protein–protein interactions and sequence-specific mutations. Specifically, we will present the “state of play” on viral escape mutations to host T-cell responses in the context of the hepatitis C virus, and their influence on infection outcome.

Plauzolles, Anne; Lucas, Michaela; Gaudieri, Silvana

2015-01-01

275

Portal Vein Delivery of Viral Vectors for Gene Therapy for Hemophilia  

PubMed Central

The liver is a very complex organ with a large variety of functions, making it an attractive organ for gene replacement therapy. Many genetic disorders can be corrected by delivering gene products directly into the liver using viral vectors. In this chapter, we will describe gene delivery via portal vein administration in mice and dogs to correct the blood coagulation disorder hemophilia B. Although there are multiple delivery routes for both viral and non-viral vectors in animals, portal vein administration delivers vectors directly and efficiently into the liver. Complete correction of murine hemophilia B and multi-year near-correction of canine hemophilia B have been achieved following portal vein delivery of adeno-associated viral (AAV) vectors expressing factor IX from hepatocyte-specific promoters. Peripheral vein injection can lead to increased vector dissemination to off-target organ such as the lung and spleen. Below, we will describe portal vein injection delivery route via laparotomy. PMID:24557919

Sherman, Alexandra; Schlachterman, Alexander; Cooper, Mario; Merricks, Elizabeth P.; Raymer, Robin A.; Bellinger, Dwight A.; Herzog, Roland W.; Nichols, Timothy C.

2014-01-01

276

Histone deacetylases in viral infections  

Microsoft Academic Search

Chromatin remodeling and gene expression are regulated by histone deacetylases (HDACs) that condense the chromatin structure\\u000a by deacetylating histones. HDACs comprise a group of enzymes that are responsible for the regulation of both cellular and\\u000a viral genes at the transcriptional level. In mammals, a total of 18 HDACs have been identified and grouped into four classes,\\u000a i.e., class I (HDACs

Georges Herbein; Daniel Wendling

2010-01-01

277

Mutagenesis of the murine hepatitis virus nsp1-coding region identifies residues important for protein processing, viral RNA synthesis, and viral replication.  

PubMed

Despite ongoing research investigating mechanisms of coronavirus replication, functions of many viral nonstructural proteins (nsps) remain unknown. In the current study, a reverse genetic approach was used to define the role of the 28-kDa amino-terminal product (nsp1) of the gene 1 polyprotein during replication of the coronavirus murine hepatitis virus (MHV) in cell culture. To determine whether nsp1 is required for MHV replication and to identify residues critical for protein function, mutant viruses that contained deletions or point mutations within the nsp1-coding region were generated and assayed for defects in viral replication, viral protein expression, protein localization, and RNA synthesis. The results demonstrated that the carboxy-terminal half of nsp1 (residues K(124) through L(241)) was dispensable for virus replication in culture but was required for efficient proteolytic cleavage of nsp1 from the gene 1 polyprotein and for optimal viral replication. Furthermore, whereas deletion of nsp1 residues amino-terminal to K(124) failed to produce infectious virus, point mutagenesis of the nsp1 amino-terminus allowed recovery of several mutants with altered replication and RNA synthesis. This study identifies nsp1 residues important for protein processing, viral RNA synthesis, and viral replication. PMID:16051301

Brockway, Sarah M; Denison, Mark R

2005-09-30

278

Genetic Engineering: The Modification of Man  

ERIC Educational Resources Information Center

Describes somatic and genetic manipulations of individual genotypes, using diabetes control as an example of the first mode that is potentially realizable be derepression or viral transduction of genes. Advocates the use of genetic engineering of the second mode to remove man from his biological limitations, but offers maxims to ensure the…

Sinsheimer, Robert L.

1970-01-01

279

Gene therapy in dentistry: tool of genetic engineering. Revisited.  

PubMed

Advances in biotechnology have brought gene therapy to the forefront of medical research. The concept of transferring genes to tissues for clinical applications has been discussed nearly half a century, but the ability to manipulate genetic material via recombinant DNA technology has brought this goal to reality. The feasibility of gene transfer was first demonstrated using tumour viruses. This led to development of viral and nonviral methods for the genetic modification of somatic cells. Applications of gene therapy to dental and oral problems illustrate the potential impact of this technology on dentistry. Preclinical trial results regarding the same have been very promising. In this review we will discuss methods, vectors involved, clinical implication in dentistry and scientific issues associated with gene therapy. PMID:25540850

Gupta, Khushboo; Singh, Saurabh; Garg, Kavita Nitish

2015-03-01

280

The Bipartite Geminivirus Coat Protein Aids BR1 Function in Viral Movement by Affecting the Accumulation of Viral Single-Stranded DNA  

PubMed Central

The movement of bipartite geminiviruses such as squash leaf curl virus (SqLCV) requires the cooperative interaction of two essential virus-encoded movement proteins, BR1 and BL1. While the viral coat protein AR1 is not essential for systemic infection, genetic studies demonstrate that its presence masks the defective phenotype of certain BR1 missense mutants, thus suggesting that coat protein does interact with the viral movement pathway. To further examine the mechanism of this interaction, we have constructed alanine-scanning mutants of AR1 and studied them for the ability to mask the infectivity defects of appropriate BR1 mutants, for the ability to target to the nucleus and to bind viral single-stranded DNA (ssDNA) and multimerize, and for effects on the accumulation of replicated viral ssDNA. We identified a specific region of AR1 required for masking of appropriate BR1 mutants and showed that this same region of AR1 was also important for ssDNA binding and the accumulation of viral replicated ssDNA. This region of AR1 also overlapped that involved in multimerization of the coat protein. We also found that the accumulation in protoplasts of single-stranded forms of a recombinant plasmid that included the SqLCV replication origin but was too large to be encapsidated was dependent on the presence of AR1 but did not appear to require encapsidation. These findings extend our model for SqLCV movement, demonstrating that coat protein affects viral movement through its ability to induce the accumulation of replicated viral ssDNA genomes. They further suggested that encapsidation was not required for the AR1-dependent accumulation of viral ssDNA. PMID:9765472

Qin, Shenwei; Ward, Brian M.; Lazarowitz, Sondra G.

1998-01-01

281

Persistently infected cattle stabilise bovine viral diarrhea virus leading to herd specific strains  

Microsoft Academic Search

Animals persistently infected with BVDV are important in the epizootiology of the Bovine Viral Diarrhea (BVD) because they are a permanent source of contamination within a herd. These animals produce large quantities of virus and have, therefore, been proposed as responsible for generating antigenic variability. However, limited studies have failed to detect antigenic or genetic changes in viruses isolated at

C Hamers; C Lecomte; G Kulcsar; M Lambot; P.-P Pastoret

1998-01-01

282

VIRAL RESCUE FROM AN INFECTIOUS CLONE OF A MESOGENIC NEWCASTLE DISEASE VIRUS  

Technology Transfer Automated Retrieval System (TEKTRAN)

Reverse genetics is a powerful tool for the study of viral pathogenesis of negative stranded RNA viruses through the manipulation of genes associated with interactions of the pathogen with the host. The present work describes the generation of an infectious clone of the Newcastle disease virus Anhin...

283

Reassortant influenza A viruses in wild duck populations: effects on viral shedding and persistence in water  

PubMed Central

Wild ducks of the genus Anas represent the natural hosts for a large genetic diversity of influenza A viruses. In these hosts, co-infections with different virus genotypes are frequent and result in high rates of genetic reassortment. Recent genomic data have provided information regarding the pattern and frequency of these reassortant viruses in duck populations; however, potential consequences on viral shedding and maintenance in the environment have not been investigated. On the basis of full-genome sequencing, we identified five virus genotypes, in a wild duck population in northwestern Minnesota (USA), that naturally arose from genetic reassortments. We investigated the effects of influenza A virus genotype on the viral shedding pattern in Mallards (Anas platyrhynchos) and the duration of infectivity in water, under different temperature regimens. Overall, we found that variation in the viral genome composition of these isolates had limited effects on duration, extent and pattern of viral shedding, as well as on the reduction of infectivity in water over time. These results support that, in wild ducks, functionally equivalent gene segments could be maintained in virus populations with no fitness costs when genetic reassortments occur. PMID:22859590

Lebarbenchon, Camille; Sreevatsan, Srinand; Lefèvre, Thierry; Yang, My; Ramakrishnan, Muthannan A.; Brown, Justin D.; Stallknecht, David E.

2012-01-01

284

Environmental factors impacting response to bovine viral diarrhea vaccines in Angus calves  

Technology Transfer Automated Retrieval System (TEKTRAN)

The objective of this study was to evaluate the impact of environmental factors on the serological response to commercial bovine viral diarrhea type 2 (BVDV2) vaccinations in Angus cattle for inclusion as fixed effects into subsequent genetic evaluations for response to vaccination. Age of calf was...

285

Distinct Viral Populations Differentiate and Evolve Independently in a Single Perennial Host Plant  

Microsoft Academic Search

The complex structure of virus populations has been the object of intensive study in bacteria, animals, and plants for over a decade. While it is clear that tremendous genetic diversity is rapidly generated during viral replication, the distribution of this diversity within a single host remains an obscure area in this field of science. Among animal viruses, only Human immunodeficiency

Chiraz Jridi; Jean-Francois Martin; Veronique Marie-Jeanne; Gerard Labonne; Stephane Blanc

2006-01-01

286

Environmental factors impacting response to bovine viral diarrhea vaccines in Angus calves  

Technology Transfer Automated Retrieval System (TEKTRAN)

The objective of this study was to evaluate the impact of environmental factors on the serological response to commercial bovine viral diarrhea type 2 (BVDV2) vaccinations in Angus cattle for inclusion as fixed effects into subsequent genetic evaluations for response to vaccination. This study util...

287

Reverse genetics for mammalian reovirus  

Microsoft Academic Search

Mammalian orthoreoviruses (reoviruses) are highly tractable models for studies of viral replication and pathogenesis. The versatility of reovirus as an experimental model has been enhanced by development of a plasmid-based reverse genetics system. Infectious reovirus can be recovered from cells transfected with plasmids encoding cDNAs of each reovirus gene segment using a strategy that does not require helper virus and

Karl W. Boehme; Mine´ Ikizler; Takeshi Kobayashi; Terence S. Dermody

2011-01-01

288

Viral and cellular microRNAs as determinants of viral pathogenesis and immunity  

PubMed Central

Summary MicroRNAs have recently emerged as key post-transcriptional regulators of gene expression in multicellular eukaryotes. It is increasingly clear that microRNAs of both viral and cellular origin can positively or negatively influence viral replication. Viral microRNAs can directly alter host physiology, including components of the immune system, and host microRNAs can directly alter the virus life cycle. Here, we discuss what is known about how viral and cellular microRNAs influence viral replication and pathogenic potential through their regulation of viral mRNAs or by reshaping cellular gene expression. PMID:18541214

Gottwein, Eva; Cullen, Bryan R.

2011-01-01

289

Cementing proteins provide extra mechanical stabilization to viral cages  

NASA Astrophysics Data System (ADS)

The study of virus shell stability is key not only for gaining insights into viral biological cycles but also for using viral capsids in materials science. The strength of viral particles depends profoundly on their structural changes occurring during maturation, whose final step often requires the specific binding of ‘decoration’ proteins (such as gpD in bacteriophage lambda) to the viral shell. Here we characterize the mechanical stability of gpD-free and gpD-decorated bacteriophage lambda capsids. The incorporation of gpD into the lambda shell imparts a major mechanical reinforcement that resists punctual deformations. We further interrogate lambda particle stability with molecular fatigue experiments that resemble the sub-lethal Brownian collisions of virus shells with macromolecules in crowded environments. Decorated particles are especially robust against collisions of a few kBT (where kB is the Boltzmann’s constant and T is the temperature ~300?K), which approximate those anticipated from molecular insults in the environment.

Hernando-Pérez, M.; Lambert, S.; Nakatani-Webster, E.; Catalano, C. E.; de Pablo, P. J.

2014-07-01

290

Drug Sanctuaries, Low Steady State Viral Loads and Viral Blips.  

SciTech Connect

Patients on HAART for long periods of time obtain viral loads (VLs) below 50 copies/ml. Ultrasensitive VL assays show that some of these patients obtain a low steady state VL, while others continue to exhibit VL declines to below 5 copies/ml. Low steady states can be explained by two-compartment models that incorporate a drug sanctuary. Interestingly, when patients exhibit continued declines below 50 copies/ml the rate of decline has a half-life of {approx} 6 months, consistent with some estimates of the rate of latent cell decline. Some patients, despite having sustained undetectable VLs show periods of transient viremia (blips). I will present some statistical characterization of the blips observed in a set of 123 patients, suggesting that blips are generated largely by random processes, that blips tend to correspond to periods of a few weeks in which VLs are elevated, and that VL decay from the peak of a blip may have two-phases. Using new results suggesting that the viral burst size, N {approx} 5 x 10{sup 4}, we estimate the number of cells needed to produce a blip.

Perelson, Alan S.,; Callaway, D. (Duncan); Pomerantz, R. J. (Roger J.); Chen, H. Y.; Markowitz, M.; Ho, David D.; Di Mascio, M. (Michele)

2002-01-01

291

Estimating viral titres in solutions with low viral loads.  

PubMed

An important consideration in the manufacture of products derived from animal or human sources is the virus reduction capacity of the manufacturing process as estimated using validated bench-scale models of relevant manufacturing steps. In these studies, manufacturing process intermediates are spiked with virus and processed using the bench-scale model and the resulting viral titres of input and output samples are typically determined using cell-based infectivity assays. In these assays, the Spearman-Kärber (SK) method is commonly used to estimate titres when there is one or more positive observation (i.e., the presence of any viral cytopathic effect). The SK method is most accurate when the proportion of positive observations ranges from <0.1 to >0.9 across dilutions but can be biased otherwise. Maximum likelihood (ML) based on a single-hit Poisson model is an alternative widely used estimation method. We compared SK with ML and found the methods to have similar properties except for situations in which the concentration of virus is low but measurable. In this case, the SK method produces upwardly biased estimates of titres. Based on our results, we recommend the use of either ML or SK at most virus concentrations; however, at low virus concentrations ML is preferred. PMID:21783380

Brownie, C; Statt, J; Bauman, P; Buczynski, G; Skjolaas, K; Lee, D; Hotta, J; Roth, N J

2011-07-01

292

Introductory molecular genetics  

SciTech Connect

This book begins with an overview of the current principles of genetics and molecular genetics. Over this foundation, it adds detailed and specialized information: a description of the translation, transcription, expression and regulation of DNA and RNA; a description of the manipulation of genetic material via promoters, enhancers, and gene splicing; and a description of cloning techniques, especially those for blood group genes. The last chapter looks to the impact of molecular genetics on transfusion medicine.

Edwards-Moulds, J.

1986-01-01

293

Physical status of the E2 human papilloma virus 16 viral gene in cervical preneoplastic and neoplastic lesions  

Microsoft Academic Search

Background: Integration of human papilloma virus (HPV) 16 DNA is considered an important genetic change in cervical lesion progression towards ICC. The viral E2 gene is often disrupted by this process, releasing suppression of viral E6\\/E7 oncogenes, a key factor for oncogenic progression. Objectives: To evaluate the physical status of HPV 16 E2 gene in cervical preneoplastic and neoplastic lesions

S. A Tonon; M. A Picconi; P. D Bos; J. B Zinovich; J Galuppo; L. V Alonio; A. R Teyssie

2001-01-01

294

Unique viral capsid assembly protein gene ( g20 ) of cyanophages in the floodwater of a Japanese paddy field  

Microsoft Academic Search

In order to evaluate the genetic diversity of cyanophage communities of rice fields, viral capsid assembly protein gene (g20) was amplified with primers CPS1 and CPS8. The DNA was extracted three times from viral concentrates obtained from floodwater\\u000a samples collected in each of four different plots (no fertilizer; P and K chemical fertilizers; N, P, and K chemical fertilizers;\\u000a and

Guanghua Wang; Jun Murase; Susumu Asakawa; Makoto Kimura

2010-01-01

295

Genetic Engineering  

NSDL National Science Digital Library

The Discovery Education website serves as a repository of instructional materials for educators seeking to help their charges learn about everything from the solar system to genetically modified organisms. This particular lesson plan deals with the science and technology of genetic engineering and it is intended to be used by advanced high school and community college students. Users will appreciate the fact that the entire plan is well-organized and divided into 12 sections including Objectives, Discussion Questions, and Procedures. The Discussion Questions are thoughtful and well-articulated and one can imagine that each query might generate more than a bit of meditation and close consideration.

Morrissette-Johnson, Winona

296

Massive activation of archaeal defense genes during viral infection.  

PubMed

Archaeal viruses display unusually high genetic and morphological diversity. Studies of these viruses proved to be instrumental for the expansion of knowledge on viral diversity and evolution. The Sulfolobus islandicus rod-shaped virus 2 (SIRV2) is a model to study virus-host interactions in Archaea. It is a lytic virus that exploits a unique egress mechanism based on the formation of remarkable pyramidal structures on the host cell envelope. Using whole-transcriptome sequencing, we present here a global map defining host and viral gene expression during the infection cycle of SIRV2 in its hyperthermophilic host S. islandicus LAL14/1. This information was used, in combination with a yeast two-hybrid analysis of SIRV2 protein interactions, to advance current understanding of viral gene functions. As a consequence of SIRV2 infection, transcription of more than one-third of S. islandicus genes was differentially regulated. While expression of genes involved in cell division decreased, those genes playing a role in antiviral defense were activated on a large scale. Expression of genes belonging to toxin-antitoxin and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems was specifically pronounced. The observed different degree of activation of various CRISPR-Cas systems highlights the specialized functions they perform. The information on individual gene expression and activation of antiviral defense systems is expected to aid future studies aimed at detailed understanding of the functions and interplay of these systems in vivo. PMID:23698312

Quax, Tessa E F; Voet, Marleen; Sismeiro, Odile; Dillies, Marie-Agnes; Jagla, Bernd; Coppée, Jean-Yves; Sezonov, Guennadi; Forterre, Patrick; van der Oost, John; Lavigne, Rob; Prangishvili, David

2013-08-01

297

Understanding Viral Transmission Behavior via Protein Intrinsic Disorder Prediction: Coronaviruses  

PubMed Central

Besides being a common threat to farm animals and poultry, coronavirus (CoV) was responsible for the human severe acute respiratory syndrome (SARS) epidemic in 2002–4. However, many aspects of CoV behavior, including modes of its transmission, are yet to be fully understood. We show that the amount and the peculiarities of distribution of the protein intrinsic disorder in the viral shell can be used for the efficient analysis of the behavior and transmission modes of CoV. The proposed model allows categorization of the various CoVs by the peculiarities of disorder distribution in their membrane (M) and nucleocapsid (N). This categorization enables quick identification of viruses with similar behaviors in transmission, regardless of genetic proximity. Based on this analysis, an empirical model for predicting the viral transmission behavior is developed. This model is able to explain some behavioral aspects of important coronaviruses that previously were not fully understood. The new predictor can be a useful tool for better epidemiological, clinical, and structural understanding of behavior of both newly emerging viruses and viruses that have been known for a long time. A potentially new vaccine strategy could involve searches for viral strains that are characterized by the evolutionary misfit between the peculiarities of the disorder distribution in their shells and their behavior. PMID:23097708

Goh, Gerard Kian-Meng; Dunker, A. Keith; Uversky, Vladimir N.

2012-01-01

298

Retroviral Vectors for Analysis of Viral Mutagenesis and Recombination  

PubMed Central

Retrovirus population diversity within infected hosts is commonly high due in part to elevated rates of replication, mutation, and recombination. This high genetic diversity often complicates the development of effective diagnostics, vaccines, and antiviral drugs. This review highlights the diverse vectors and approaches that have been used to examine mutation and recombination in retroviruses. Retroviral vectors for these purposes can broadly be divided into two categories: those that utilize reporter genes as mutation or recombination targets and those that utilize viral genes as targets of mutation or recombination. Reporter gene vectors greatly facilitate the detection, quantification, and characterization of mutants and/or recombinants, but may not fully recapitulate the patterns of mutagenesis or recombination observed in native viral gene sequences. In contrast, the detection of mutations or recombination events directly in viral genes is more biologically relevant but also typically more challenging and inefficient. We will highlight the advantages and disadvantages of the various vectors and approaches used as well as propose ways in which they could be improved. PMID:25254386

Rawson, Jonathan M.O.; Mansky, Louis M.

2014-01-01

299

Bermuda Triangle for the liver: alcohol, obesity, and viral hepatitis.  

PubMed

Despite major progress in understanding and managing liver disease in the past 30 years, it is now among the top 10 most common causes of death globally. Several risk factors, such as genetics, diabetes, obesity, excessive alcohol consumption, viral infection, gender, immune dysfunction, and medications, acting individually or in concert, are known to precipitate liver damage. Viral hepatitis, excessive alcohol consumption, and obesity are the major factors causing liver injury. Estimated numbers of hepatitis B virus (HBV) and hepatitis C virus (HCV)-infected subjects worldwide are staggering (370 and 175 million, respectively), and of the 40 million known human immunodeficiency virus positive subjects, 4 and 5 million are coinfected with HBV and HCV, respectively. Alcohol and HCV are the leading causes of end-stage liver disease worldwide and the most common indication for liver transplantation in the United States and Europe. In addition, the global obesity epidemic that affects up to 40 million Americans, and 396 million worldwide, is accompanied by an alarming incidence of end-stage liver disease, a condition exacerbated by alcohol. This article focuses on the interactions between alcohol, viral hepatitis, and obesity (euphemistically described here as the Bermuda Triangle of liver disease), and discusses common mechanisms and synergy. PMID:23855291

Zakhari, Samir

2013-08-01

300

Viral diseases of marine invertebrates  

NASA Astrophysics Data System (ADS)

Approximately 40 viruses are known from marine sponges; turbellarian and monogenetic flatworms; cephalopod, bivalve, and gastropod mollusks; nereid polychaetes; and isopod and decapod crustaceans. Most of the viruses can be tentatively assigned to the Herpesviridae, Baculoviridae, Iridoviridae, Adenoviridae, Papovaviridae, Reoviridae, “Birnaviridae”, Bunyaviridae, Rhabdoviridae, and Picornaviridae. Viruslike particles found in oysters might be representatives of the Togaviridae and Retroviridae. Enveloped single-stranded RNA viruses from crustaceans have developmental and morphological characteristics intermediate between families, and some show evidence of relationships to the Paramyxoviridae as well as the Bunyaviridae or Rhabdoviridae. Certain small viruses of shrimp cannot be assigned, even tentatively, to a particular family. Some viruses cause disease in wild and captive hosts, others are associated with disease states but may not be primary instigators, and many occur in apparently normal animals. The frequency of viral disease in natural populations of marine invertebrates is unknown. Several viruses that cause disease in captive animals, with or without experimental intervention, have also been found in diseased wild hosts, including herpeslike viruses of crabs and oysters, iridovirus of octopus, and reolike and bunyalike viruses of crabs. Iridolike viruses have been implicated in massive mortalities of cultured oysters. Baculoviruses, and IHHN virus, which is of uncertain affinities, cause economically damaging diseases in cultured penaeid shrimp. Double or multiple viral infection is common in crabs. For example, a reolike virus and associated rhabdolike virus act synergistically to cause paralytic and fatal disease in Callinectes sapidus. Information on host range, most susceptible stage, and viral latency is available only for viruses of shrimp. One baculovirus attacks five species of New World penaeid shrimp. IHHN virus infects three species of Penaeus and causes catastrophic mortalities in P. stylirostris, but usually exhibits only inapparent infection in P. vannamei. Some shrimp viruses apparently are latent in larvae, causing disease only when shrimp have reached the postlarval or juvenile stages. Others are equally or more pathogenic in larvae. Studies of shrimp viruses and iridovirus-associated disease in cultured oysters point up the need for rapid and accurate diagnostic methods. Until appropriate cell cultures from marine invertebrates are devised, the viral identifications necessary for understanding of epizootiology, rapid containment of epizootics in cultured animals, and decisions regarding introductions of exotic species will be difficult or impossible.

Johnson, P. T.

1984-03-01

301

Live Cell Imaging of Viral Entry  

PubMed Central

Viral entry encompasses the initial steps of infection starting from virion host cell attachment to viral genome release. Given the dynamic interactions between the virus and the host, many questions related to viral entry can be directly addressed by live cell imaging. Recent advances in fluorescent labeling of viral and cellular components, fluorescence microscopy with high sensitivity and spatiotemporal resolution, and image analysis enabled studies of a broad spectrum across many viral entry steps, including virus-receptor interactions, internalization, intracellular transport, genomic release, nuclear transport, and cell-to-cell transmission. Collectively, these live cell imaging studies have not only enriched our understandings of the viral entry mechanisms, but also provided novel insights into basic cellular biology processes. PMID:23395264

Sun, Eileen; He, Jiang; Zhuang, Xiaowei

2013-01-01

302

V.: A genetic engineering approach to genetic algorithms  

E-print Network

We present an extension to the standard genetic algorithm (GA), which is based on concepts of genetic engineering. The motivation is to discover useful and harmful genetic materials and then execute an evolutionary process in such a way that the population becomes increasingly composed of useful genetic material and increasingly free of the harmful genetic material. Compared to the standard GA, it provides some computational advantages as well as a tool for automatic generation of hierarchical genetic representations specifically tailored to suit certain classes of problems.

John S. Gero; Vladimir Kazakov

303

Assessing the biocompatibility of degradable metallic materials: State-of-the-art and focus on the potential of genetic regulation  

Microsoft Academic Search

For decades, the design, development and use of metallic biomaterials has focused on the corrosion resistance of these materials once implanted in the human body. Recently, degradable metallic biomaterials (DMMs) have been proposed for some specific applications, including paediatric, orthopaedic and cardiovascular applications. DMMs are expected to disappear via corrosion after providing structural support for a certain period of time

Agung Purnama; Hendra Hermawan; Jacques Couet; Diego Mantovani

2010-01-01

304

Infection Strategies of Bacterial and Viral Pathogens through Pathogen–Human Protein–Protein Interactions  

PubMed Central

Since ancient times, even in today’s modern world, infectious diseases cause lots of people to die. Infectious organisms, pathogens, cause diseases by physical interactions with human proteins. A thorough analysis of these interspecies interactions is required to provide insights about infection strategies of pathogens. Here we analyzed the most comprehensive available pathogen–human protein interaction data including 23,435 interactions, targeting 5,210 human proteins. The data were obtained from the newly developed pathogen–host interaction search tool, PHISTO. This is the first comprehensive attempt to get a comparison between bacterial and viral infections. We investigated human proteins that are targeted by bacteria and viruses to provide an overview of common and special infection strategies used by these pathogen types. We observed that in the human protein interaction network the proteins targeted by pathogens have higher connectivity and betweenness centrality values than those proteins not interacting with pathogens. The preference of interacting with hub and bottleneck proteins is found to be a common infection strategy of all types of pathogens to manipulate essential mechanisms in human. Compared to bacteria, viruses tend to interact with human proteins of much higher connectivity and centrality values in the human network. Gene Ontology enrichment analysis of the human proteins targeted by pathogens indicates crucial clues about the infection mechanisms of bacteria and viruses. As the main infection strategy, bacteria interact with human proteins that function in immune response to disrupt human defense mechanisms. Indispensable viral strategy, on the other hand, is the manipulation of human cellular processes in order to use that transcriptional machinery for their own genetic material transcription. A novel observation about pathogen–human systems is that the human proteins targeted by both pathogens are enriched in the regulation of metabolic processes. PMID:22347880

Durmu? Tekir, Saliha; Çakir, Tunahan; Ülgen, Kutlu Ö

2012-01-01

305

Characterization of bovine viral diarrhea viruses  

Microsoft Academic Search

Summary Concentrated preparations of bovine viral diarrhea (BVD) virus were partially purified by agar gel column filtration so that many particles of sub-viral size consisting of cell debris and serum were removed. This purification step is an important one in “cleaning-up” viral preparations for electron microscopic observation. Passage of BVD virus through a column of 1.5% agar beads, calibrated with

A. L. Fernelius; L. F. Velicer

1968-01-01

306

Viral Advertising: Definitional Review and Synthesis  

Microsoft Academic Search

The objectives of this article are threefold. First, it provides an overview of the past published social media research focusing on different aspects of the viral communication, variously termed “electronic word-of-mouth,” “word-of-mouse,” “viral marketing,” and “buzz.” Second, it clarifies and analyzes the concept of viral advertising in social media. Third, it provides a definition to reduce the prevailing ambiguities in

Maria Petrescu; Pradeep Korgaonkar

2011-01-01

307

A Phalaenopsis variety with floral organs showing C class homeotic transformation and its revertant may enable Phalaenopsis as a potential molecular genetic material.  

PubMed

The Orchidaceae is one of the most famous garden plants, and improvement of the orchid is very important in horticulture field. However, molecular information is largely unknown. We found a Phalaenopsis variety harboring floral organs showing C class homeotic change. Column is composed of the anthers with the receptive stigmatic surface just underneath them in wild type. However the C class variety produced column with sepal or petal like structure at the abaxial side. This is the typical abnormality as C class mutants in plants. Further, wild type looking revertant was found from the meristem tissue cultured population. This result strongly indicates the existence of active transposable element in Phalaenopsis genome. This transposon may enable Phalaenopsis as a good material for molecular genetic analysis in Orchidaceae. PMID:21670548

Ejima, Chika; Kobayashi, Yuuki; Honda, Hiroaki; Shimizu, Noriko; Kiyohara, Shunsuke; Hamasaki, Ryota; Sawa, Shinichiro

2011-01-01

308

Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior  

USGS Publications Warehouse

Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

2011-01-01

309

Deletion of the S component inverted repeat sequence c ? and the nonessential genes U s 1 through U s 5 from the herpes simplex virus type 1 genome substantially impairs productive viral infection in cell culture and pathogenesis in the rat central nervous system  

Microsoft Academic Search

A distinctive feature of the genetic make-up of herpes simplex virus type 1 (HSV-1), a human neurotropic virus, is that approximately half of the 81 known viral genes are not absolutely required for productive infection in Vero cells, and most can be individually deleted without substantially impairing viral replication in cell culture. If large blocks of contiguous viral genes could

Siyamak Rasty; P Luigi Poliani; David J Fink; Joseph C Glorioso

1997-01-01

310

Sequencing Needs for Viral Diagnostics  

SciTech Connect

We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''near neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.

Gardner, S N; Lam, M; Mulakken, N J; Torres, C L; Smith, J R; Slezak, T

2004-01-26

311

Reconstruction of viral population structure from next-generation sequencing data using multicommodity flows  

PubMed Central

Background Highly mutable RNA viruses exist in infected hosts as heterogeneous populations of genetically close variants known as quasispecies. Next-generation sequencing (NGS) allows for analysing a large number of viral sequences from infected patients, presenting a novel opportunity for studying the structure of a viral population and understanding virus evolution, drug resistance and immune escape. Accurate reconstruction of genetic composition of intra-host viral populations involves assembling the NGS short reads into whole-genome sequences and estimating frequencies of individual viral variants. Although a few approaches were developed for this task, accurate reconstruction of quasispecies populations remains greatly unresolved. Results Two new methods, AmpMCF and ShotMCF, for reconstruction of the whole-genome intra-host viral variants and estimation of their frequencies were developed, based on Multicommodity Flows (MCFs). AmpMCF was designed for NGS reads obtained from individual PCR amplicons and ShotMCF for NGS shotgun reads. While AmpMCF, based on covering formulation, identifies a minimal set of quasispecies explaining all observed reads, ShotMCS, based on packing formulation, engages the maximal number of reads to generate the most probable set of quasispecies. Both methods were evaluated on simulated data in comparison to Maximum Bandwidth and ViSpA, previously developed state-of-the-art algorithms for estimating quasispecies spectra from the NGS amplicon and shotgun reads, respectively. Both algorithms were accurate in estimation of quasispecies frequencies, especially from large datasets. Conclusions The problem of viral population reconstruction from amplicon or shotgun NGS reads was solved using the MCF formulation. The two methods, ShotMCF and AmpMCF, developed here afford accurate reconstruction of the structure of intra-host viral population from NGS reads. The implementations of the algorithms are available at http://alan.cs.gsu.edu/vira.html (AmpMCF) and http://alan.cs.gsu.edu/NGS/?q=content/shotmcf (ShotMCF). PMID:23902469

2013-01-01

312

Xenografting of sheep testis tissue and isolated cells as a model for preservation of genetic material from endangered ungulates.  

PubMed

Recovery of germ cells could be an option for preservation of the genetic pool of endangered animals. In immature males, xenografting of testis tissue provides the opportunity to recover sperm from these animals. In adult animals, xenografting has been less successful, but de novo morphogenesis of functional testis tissue from dissociated testis cells could be an alternative. To assess the potential use of these techniques in endangered bovid species, the domestic sheep was used as a model. Testes from 2-week-old lambs were grafted as tissue fragments or cell suspensions into nude mice. Grafts were recovered at 4, 8, 12 and 16 weeks post grafting. For isolated cells, two additional time points at 35 and 40 weeks after grafting were added. In addition, to analyse the possible effect of social stress among mice within a group on the development of the grafts, testis tissue grafts were recovered 13 weeks post grafting from mice housed individually and in groups. Complete spermatogenesis occurred in sheep testis xenografts at 12 weeks, similar to the situation in situ. Isolated sheep testis cells were able to reorganize and form functional testicular tissue de novo. Housing mice individually or in groups did not have any effect on the development of xenografts. Xenografting of testis tissue might be useful to obtain sperm from immature endangered ungulates that die prematurely. Testis tissue de novo morphogenesis from isolated cells could open interesting options to recover germ cells from mature males with impaired spermatogenesis. PMID:18390693

Arregui, Lucía; Rathi, Rahul; Megee, Susan O; Honaramooz, Ali; Gomendio, Montserrat; Roldan, Eduardo R S; Dobrinski, Ina

2008-07-01

313

Collaboration at the Nanoscale: Exploring Viral Genetics with Electron Microscopy  

ERIC Educational Resources Information Center

The Maine Science Corps is a project sponsored by the National Science Foundation's (NSF) Graduate Teaching Fellows in K-12 Education (GK-12 ) program. Through this program, the University of Southern Maine's (USM) virology and transmission electron microscopy (TEM) research group provides high school teachers and students in rural areas with…

Duboise, S. Monroe; Moulton, Karen D.; Jamison, Jennifer L.

2009-01-01

314

Natural killer cells act as rheostats modulating anti-viral T cells  

PubMed Central

Anti-viral T cells are thought to regulate whether hepatitis C virus (HCV) and HIV infections result in viral control, asymptomatic persistence, or severe disease, though the reasons for these different outcomes remain unclear. Recent genetic evidence, however, has indicated a correlation between certain natural killer (NK) cell receptors and progression of both HIV and HCV infection1–3, implying that NK cells are playing a role in these T cell-associated diseases. While direct NK cell-mediated lysis of virus-infected cells may contribute to anti-viral defense during some virus infections, especially murine cytomegalovirus (MCMV) infections in mice and perhaps HIV in humans4–5, NK cells have also been suspected as having immunoregulatory functions. For instance, NK cells may indirectly regulate T cell responses by lysing MCMV-infected antigen-presenting cells6–7. In contrast to MCMV, lymphocytic choromeningitis virus (LCMV) infection in mice seems resistant to any direct anti-viral effects of NK cells5,8. Here the roles of NK cells in regulating T cell-dependent viral persistence and immunopathology were examined in mice infected with LCMV, an established model for HIV and HCV infections in humans. We describe a three-way interaction, whereby activated NK cells cytolytically eliminate activated CD4 T cells that affect CD8 T-cell function and exhaustion. At high virus dose NK cells prevented fatal pathology while enabling T-cell exhaustion and viral persistence, but at a medium dose NK cells paradoxically facilitated lethal T cell-mediated pathology. Thus, NK cells can act as rheostats, regulating CD4 T cell-mediated support for the anti-viral CD8 T cells that control viral pathogenesis and persistence. PMID:22101430

Waggoner, Stephen N.; Cornberg, Markus; Selin, Liisa K.; Welsh, Raymond M.

2012-01-01

315

Molecular biology of bovine viral diarrhea virus  

Technology Transfer Automated Retrieval System (TEKTRAN)

Bovine viral diarrhea viruses (BVDV) are arguably the most important viral pathogen of ruminants worldwide and can cause severe economic loss. Clinical symptoms of the disease caused by BVDV range from subclinical to severe acute hemorrhagic syndrome, with the severity of disease being strain depend...

316

Viral diagnosis by antigen detection techniques  

Microsoft Academic Search

Background: Diagnosis of viral infections can be obtained in the early stages of a disease by detection of viral antigens directly in the clinical specimen. This has become an important tool for rapid virus diagnosis.Methods: Antigens produced during virus infections can be detected either in cells collected from the site of infection by immunohistological investigation or in secretions and blood

Monica Grandien

1996-01-01

317

Choosing a Viral Vector System Janet Douglas  

E-print Network

#12;Retroviral vector design Delete packaging signal Maintain packaging signal #12;The Problem viral vectors are "designed" to infect all cell types...tropism of virus = tropism of vector · Some for AAV (small packaging size) #12;#12;Recombinant Viral Vector Systems · Vector has characteristics

Chapman, Michael S.

318

Viral Ancestors of Antiviral Systems  

PubMed Central

All life must survive their corresponding viruses. Thus antiviral systems are essential in all living organisms. Remnants of virus derived information are also found in all life forms but have historically been considered mostly as junk DNA. However, such virus derived information can strongly affect host susceptibility to viruses. In this review, I evaluate the role viruses have had in the origin and evolution of host antiviral systems. From Archaea through bacteria and from simple to complex eukaryotes I trace the viral components that became essential elements of antiviral immunity. I conclude with a reexamination of the ‘Big Bang’ theory for the emergence of the adaptive immune system in vertebrates by horizontal transfer and note how viruses could have and did provide crucial and coordinated features. PMID:22069523

Villarreal, Luis P.

2011-01-01

319

Viral ancestors of antiviral systems.  

PubMed

All life must survive their corresponding viruses. Thus antiviral systems are essential in all living organisms. Remnants of virus derived information are also found in all life forms but have historically been considered mostly as junk DNA. However, such virus derived information can strongly affect host susceptibility to viruses. In this review, I evaluate the role viruses have had in the origin and evolution of host antiviral systems. From Archaea through bacteria and from simple to complex eukaryotes I trace the viral components that became essential elements of antiviral immunity. I conclude with a reexamination of the 'Big Bang' theory for the emergence of the adaptive immune system in vertebrates by horizontal transfer and note how viruses could have and did provide crucial and coordinated features. PMID:22069523

Villarreal, Luis P

2011-10-01

320

Genetics of Cerebral Vasospasm  

PubMed Central

Cerebral vasospasm (CV) is a major source of morbidity and mortality in aneurysmal subarachnoid hemorrhage (aSAH). It is thought that an inflammatory cascade initiated by extravasated blood products precipitates CV, disrupting vascular smooth muscle cell function of major cerebral arteries, leading to vasoconstriction. Mechanisms of CV and modes of therapy are an active area of research. Understanding the genetic basis of CV holds promise for the recognition and treatment for this devastating neurovascular event. In our review, we summarize the most recent research involving key areas within the genetics and vasospasm discussion: (1) Prognostic role of genetics—risk stratification based on gene sequencing, biomarkers, and polymorphisms; (2) Signaling pathways—pinpointing key inflammatory molecules responsible for downstream cellular signaling and altering these mediators to provide therapeutic benefit; and (3) Gene therapy and gene delivery—using viral vectors or novel protein delivery methods to overexpress protective genes in the vasospasm cascade. PMID:23691311

Ladner, Travis R.; Zuckerman, Scott L.; Mocco, J

2013-01-01

321

The genome of orf virus: Restriction endonuclease analysis of viral DNA isolated from lesions of orf in sheep  

Microsoft Academic Search

Summary The purification of orf virus directly from scab material from clinical cases of orf in sheep and restriction endonuclease analysis of the viral DNA is described. Between 7×109 and 1.6×1011 virus particles, and 0.7 to 22.8 µg of viral DNA could be recovered from lg of scab material. Considerable heterogeneity was observed between different field isolates when restriction endonuclease

A. J. Robinson; G. Ellis; T. Balassu

1982-01-01

322

Selected Readings in Genetic Engineering  

ERIC Educational Resources Information Center

Describes different sources of readings for understanding issues and concepts of genetic engineering. Broad categories of reading materials are: concerns about genetic engineering; its background; procedures; and social, ethical and legal issues. References are listed. (PS)

Mertens, Thomas R.; Robinson, Sandra K.

1973-01-01

323

Impact of Tat Genetic Variation on HIV-1 Disease  

PubMed Central

The human immunodeficiency virus type 1 (HIV-1) promoter or long-terminal repeat (LTR) regulates viral gene expression by interacting with multiple viral and host factors. The viral transactivator protein Tat plays an important role in transcriptional activation of HIV-1 gene expression. Functional domains of Tat and its interaction with transactivation response element RNA and cellular transcription factors have been examined. Genetic variation within tat of different HIV-1 subtypes has been shown to affect the interaction of the viral transactivator with cellular and/or viral proteins, influencing the overall level of transcriptional activation as well as its action as a neurotoxic protein. Consequently, the genetic variability within tat may impact the molecular architecture of functional domains of the Tat protein that may impact HIV pathogenesis and disease. Tat as a therapeutic target for anti-HIV drugs has also been discussed. PMID:22899925

Li, Luna; Dahiya, Satinder; Kortagere, Sandhya; Aiamkitsumrit, Benjamas; Cunningham, David; Pirrone, Vanessa; Nonnemacher, Michael R.; Wigdahl, Brian

2012-01-01

324

Good manufacturing practice and viral safety.  

PubMed

The concept of virus inactivation during the manufacture of blood products raises questions about possible recontamination of the product by the environment. A strict regime of good manufacturing practice (GMP) is mandatory. The guidelines originally issued by the World Health Organization (WHO), and now law in most countries, are an excellent basis for the operation of a production plant. The following elements of GMP require special concern: (i) All functions shall be defined in a clear organization chart. (ii) Personnel shall be appropriately trained for the job and to perfect hygiene. (iii) Buildings and facilities, as well as supply systems, shall exclude the possibility of recontamination of already virus-inactivated materials. (iv) Equipment shall be easy to clean and fully sterilizable. (v) Production shall follow appropriate written procedures. (vi) The Quality Control Organization shall monitor the process by in-process controls and review the records for possible deviations. All GMP issues are coordinated by a Quality Assurance Organization that also reviews the overall performance of the operation. The maintenance of viral safety of the products basically depends upon the full commitment of all bodies involved to proper and non-negotiable GMP. PMID:7495961

Kerner, B

1995-07-01

325

Finding and identifying the viral needle in the metagenomic haystack: trends and challenges  

PubMed Central

Collectively, viruses have the greatest genetic diversity on Earth, occupy extremely varied niches and are likely able to infect all living organisms. Viral infections are an important issue for human health and cause considerable economic losses when agriculturally important crops or husbandry animals are infected. The advent of metagenomics has provided a precious tool to study viruses by sampling them in natural environments and identifying the genomic composition of a sample. However, reaching a clear recognition and taxonomic assignment of the identified viruses has been hampered by the computational difficulty of these problems. In this perspective paper we examine the trends in current research for the identification of viral sequences in a metagenomic sample, pinpoint the intrinsic computational difficulties for the identification of novel viral sequences within metagenomic samples, and suggest possible avenues to overcome them. PMID:25610431

Soueidan, Hayssam; Schmitt, Louise-Amélie; Candresse, Thierry; Nikolski, Macha

2015-01-01

326

BOVINE VIRAL DIARRHEA VIRUS PERSISTENTLY INFECTED AND ACUTELY INFECTED CALVES: ASSAYS FOR VIRAL INFECTIVITY, POLYMERASE CHAIN REACTION ANALYSIS, AND ANTIGEN DETECTION  

Technology Transfer Automated Retrieval System (TEKTRAN)

There are numerous assays for bovine viral diarrhea virus (BVDV) detecting infectious virus, nucleic material, and antigen. Persistently infected (PI) and acutely/transiently infected calves with BVDV represent two different manifestations. Diagnostic test results impact on differentiation of PI o...

327

Dynamic models of viral replication and latency  

PubMed Central

Purpose of review HIV targets primary CD4+ T cells. The virus depends on the physiological state of its target cells for efficient replication, and, in turn, viral infection perturbs the cellular state significantly. Identifying the virus–host interactions that drive these dynamic changes is important for a better understanding of viral pathogenesis and persistence. The present review focuses on experimental and computational approaches to study the dynamics of viral replication and latency. Recent findings It was recently shown that only a fraction of the inducible latently infected reservoirs are successfully induced upon stimulation in ex-vivo models while additional rounds of stimulation make allowance for reactivation of more latently infected cells. This highlights the potential role of treatment duration and timing as important factors for successful reactivation of latently infected cells. The dynamics of HIV productive infection and latency have been investigated using transcriptome and proteome data. The cellular activation state has shown to be a major determinant of viral reactivation success. Mathematical models of latency have been used to explore the dynamics of the latent viral reservoir decay. Summary Timing is an important component of biological interactions. Temporal analyses covering aspects of viral life cycle are essential for gathering a comprehensive picture of HIV interaction with the host cell and untangling the complexity of latency. Understanding the dynamic changes tipping the balance between success and failure of HIV particle production might be key to eradicate the viral reservoir. PMID:25565177

Mohammadi, Pejman; Ciuffi, Angela; Beerenwinkel, Niko

2015-01-01

328

Assembly of viral genomes from metagenomes  

PubMed Central

Viral infections remain a serious global health issue. Metagenomic approaches are increasingly used in the detection of novel viral pathogens but also to generate complete genomes of uncultivated viruses. In silico identification of complete viral genomes from sequence data would allow rapid phylogenetic characterization of these new viruses. Often, however, complete viral genomes are not recovered, but rather several distinct contigs derived from a single entity are, some of which have no sequence homology to any known proteins. De novo assembly of single viruses from a metagenome is challenging, not only because of the lack of a reference genome, but also because of intrapopulation variation and uneven or insufficient coverage. Here we explored different assembly algorithms, remote homology searches, genome-specific sequence motifs, k-mer frequency ranking, and coverage profile binning to detect and obtain viral target genomes from metagenomes. All methods were tested on 454-generated sequencing datasets containing three recently described RNA viruses with a relatively large genome which were divergent to previously known viruses from the viral families Rhabdoviridae and Coronaviridae. Depending on specific characteristics of the target virus and the metagenomic community, different assembly and in silico gap closure strategies were successful in obtaining near complete viral genomes. PMID:25566226

Smits, Saskia L.; Bodewes, Rogier; Ruiz-Gonzalez, Aritz; Baumgärtner, Wolfgang; Koopmans, Marion P.; Osterhaus, Albert D. M. E.; Schürch, Anita C.

2014-01-01

329

Identification of novel viral receptors with cell line expressing viral receptor-binding protein  

PubMed Central

The viral cell receptors and infection can be blocked by the expression of the viral receptor-binding protein. Thus, the viral cell receptor is an attractive target for anti-viral strategies, and the identification of viral cell receptor is critical for better understanding and controlling viral disease. As a model system for viral entry and anti-retroviral approaches, avian sarcoma/leukosis virus (ASLV, including the A-J ten subgroups) has been studied intensively and many milestone discoveries have been achieved based on work with ASLV. Here, we used a DF1 cell line expressed viral receptor-binding protein to efficiently identify chicken Annexin A2 (chANXA2) as a novel receptor for retrovirus ALV-J (avian leukosis virus subgroup J). Our data demonstrate that antibodies or siRNA to chANXA2 significantly inhibited ALV-J infection and replication, and over-expression of chANXA2 permitted the entry of ALV-J into its non-permissible cells. Our findings have not only identified chANXA2 as a novel biomarker for anti-ALV-J, but also demonstrated that cell lines with the expression of viral receptor-binding protein could be as efficient tools for isolating functional receptors to identify novel anti-viral targets. PMID:25604889

Mei, Mei; Ye, Jianqiang; Qin, Aijian; Wang, Lin; Hu, Xuming; Qian, Kun; Shao, Hongxia

2015-01-01

330

The morphological, material-level, and ash properties of turkey femurs from 3 different genetic strains during production.  

PubMed

Femoral fractures are observed in selective-bred commercial turkeys; however, the etiology of such fractures is unknown. The current study investigated the whole bone morphological, material-level mechanical, and bone ash properties to determine the effect of selective breeding on bone strength. Femora from 3 divergent strains of turkeys, a commercial line, a different selectively bred heavy line (F-line), and a lighter age or weight matched random-bred line (RBC2/R-EQ, respectively), were compared. Bone geometric properties were measured with micro-CT and bone mechanical properties were measured using 3-point bending tests. Whole bone ash quantities were also recorded. Statistics were run using a general linear model multivariate ANOVA (GLM ANOVA). Results showed that at similar ages, the faster growing birds (commercial and F-line) had femurs twice the size of the RBC2 line as measured by cross-sectional area as early as 8 wk into the study. The femurs of the commercial and F-lines also exhibited as much as 20% greater mechanical strength than femurs from the RBC2 line at 16 and 20 wk of age as measured by properties such as elastic modulus and ultimate tensile strength. However, at similar BW, the slower growing R-EQ line had higher mechanical properties than the other lines, with the elastic modulus being 40% greater and the ultimate tensile strength being 37% greater at weights equivalent to those of the commercial and F-lines at 12 wk of age. Moreover, it was observed that the morphological properties (i.e., cross-sectional area, moments of inertia) are largely governed by BW, as there is little difference in the amount gained per week of age across the different lines. Conversely, the mechanical properties, as well as the related ash content, appear to be governed at least in part by time. Therefore, whereas modulation of bone geometry is the key responder for changes in BW, sufficient time for matrix mineralization or maturation or both to occur is also essential for mechanical competence of bone. PMID:23091126

Zhong, Z; Muckley, M; Agcaoglu, S; Grisham, M E; Zhao, H; Orth, M; Lilburn, M S; Akkus, O; Karcher, D M

2012-11-01

331

Evaluation of the metabolic fate of munitions material (TNT & RDX) in plant systems and initial assessment of material interaction with plant genetic material (DNA). Initial assessment of plant DNA adducts as biomarkers  

SciTech Connect

Genetic damage to deoxyribonucleic acid (DNA) has long been suspected of being a fundamental event leading to cancer. A variety of causal factors can result in DNA damage including photodimerization of base pairs, ionizing radiation, specific reaction of DNA with environmental pollutants, and nonspecific oxidative damage caused by the action of highly reactive oxidizing agents produced by metabolism. Because organisms depend on an unadulterated DNA template for reproduction, DNA repair mechanisms are an important defense for maintaining genomic integrity. The objective of this exploratory project was to evaluate the potential for TNT to form DNA adducts in plants. These adducts, if they exist in sufficient quantities, could be potential biomarkers of munitions exposure. The ultimate goal is to develop a simple analytical assay for the determination of blomarkers that is indicative of munitions contamination. DNA repair exists in dynamic equilibrium with DNA damage. Repair mechanisms are capable of keeping DNA damage at remarkably low concentrations provided that the repair capacity is not overwhelmed.

Harvey, S.D.; Clauss, T.W.; Fellows, R.J.; Cataldo, D.A.

1995-08-01

332

Controlled Assembly of Viral Surface Proteins into Biological Nanoparticles  

NASA Astrophysics Data System (ADS)

In recent years, therapeutic use of engineered particles on the 1-1,000 nm scale has gained popularity; these nanoparticles have been developed for use in drug delivery, gene therapy, vaccine preparation, and diagnostics. Often, viral proteins are utilized in the design of such species, and outlined here are completed studies on the in vitro assembly of nanoparticles derived from two very different viral systems. The incorporation of the human immunodeficiency virus (HIV) envelope glycoprotein precursor gp160 into phospholipid bilayer nanodiscs is discussed as a potential platform for vaccine design; efforts were successful, however yield currently limits the practical application of this approach. The utility of bacteriophage lambda procapsids and virus-like particles in therapeutic nanoparticle design is also outlined, as are efforts toward the structural and thermodynamic characterization of a urea-triggered capsid maturation event. It is demonstrated that lambda virus-like particles can be assembled from purified capsid and scaffolding proteins, and that these particles undergo urea-triggered maturation and in vitro decoration protein addition similar to that seen in lambda procapsids. The studies on lambda provided materials for the further development of nanoparticles potentially useful in a clinical setting, as well as shedding light on critical viral assembly and maturation events as they may take place in vivo.

Nakatani-Webster, Eri

333

Viral proteins function as ion channels.  

PubMed

Viral ion channels are short membrane proteins with 50-120 amino acids and play an important role either in regulating virus replication, such as virus entry, assembly and release or modulating the electrochemical balance in the subcellular compartments of host cells. This review summarizes the recent advances in viral encoded ion channel proteins (or viroporins), including PBCV-1 KcV, influenza M2, HIV-1 Vpu, HCV p7, picornavirus 2B, and coronavirus E and 3a. We focus on their function and mechanisms, and also discuss viral ion channel protein serving as a potential drug target. PMID:20478263

Wang, Kai; Xie, Shiqi; Sun, Bing

2011-02-01

334

Health Care–Acquired Viral Respiratory Diseases  

PubMed Central

Health care–associated viral respiratory infections, common among hospitalized children, also occur among adults and institutionalized persons and result in increased patient morbidity, mortality, and health care costs. Approximately 20% of patients with health care–associated pneumonia have viral respiratory infections, with 70% of these infections caused by adenovirus, influenza virus, parainfluenza virus, and respiratory syncytial virus (RSV).1 These infections typically reflect the level of viral activity within the community.1,2 This article focuses on the epidemiology, transmission, and control of health care–associated RSV and influenza virus. PMID:21316002

Goins, William P.; Talbot, H. Keipp; Talbot, Thomas R.

2014-01-01

335

P53-Mediated Rapid Induction of Apoptosis Conveys Resistance to Viral Infection in Drosophila melanogaster  

PubMed Central

Arthropod-borne pathogens account for millions of deaths each year. Understanding the genetic mechanisms controlling vector susceptibility to pathogens has profound implications for developing novel strategies for controlling insect-transmitted infectious diseases. The fact that many viruses carry genes that have anti-apoptotic activity has long led to the hypothesis that induction of apoptosis could be a fundamental innate immune response. However, the cellular mechanisms mediating the induction of apoptosis following viral infection remained enigmatic, which has prevented experimental verification of the functional significance of apoptosis in limiting viral infection in insects. In addition, studies with cultured insect cells have shown that there is sometimes a lack of apoptosis, or the pro-apoptotic response happens relatively late, thus casting doubt on the functional significance of apoptosis as an innate immunity. Using in vivo mosquito models and the native route of infection, we found that there is a rapid induction of reaper-like pro-apoptotic genes within a few hours following exposure to DNA or RNA viruses. Recapitulating a similar response in Drosophila, we found that this rapid induction of apoptosis requires the function of P53 and is mediated by a stress–responsive regulatory region upstream of reaper. More importantly, we showed that the rapid induction of apoptosis is responsible for preventing the expression of viral genes and blocking the infection. Genetic changes influencing this rapid induction of reaper-like pro-apoptotic genes led to significant differences in susceptibility to viral infection. PMID:23408884

Liu, Bo; Behura, Susanta K.; Clem, Rollie J.; Schneemann, Anette; Becnel, James; Severson, David W.; Zhou, Lei

2013-01-01

336

Sequence elements correlating with circulating viral load in genotype 1b hepatitis C virus infection.  

PubMed

The correlation between hepatitis C virus (HCV) genomic sequences and circulating HCV RNA levels was assessed to investigate the genetic elements affecting viral load. The interferon sensitivity-determining region (ISDR) sequence and the serum viral load were strongly correlated in 226 patients examined. Analysis of the entire HCV genome from six patients (three with a high and the others with a low viral load) with similar ISDR sequences identified several candidate residues associated with viral load. The amino acid (aa) sequences of these candidate residues and flanking regions in 67 additional patients revealed that only the residue at aa 962 varied significantly between the HCV patients with low and high serum loads (P=0.042). At this position, alanine was observed more frequently in the patients with a high viral load. In conclusion, our results strongly suggest that serum HCV RNA loads are inversely correlated with amino acid substitutions in the ISDR, and aa 962 was identified as a possible second determinant of serum HCV RNA load. PMID:12842626

Watanabe, Hideki; Nagayama, Kazuyoshi; Enomoto, Nobuyuki; Itakura, Jun; Tanabe, Yoko; Hamano, Kosei; Izumi, Namiki; Sato, Chifumi; Watanabe, Mamoru

2003-07-01

337

Viral Hepatitis: A through E and Beyond  

MedlinePLUS

... through E and Beyond | Share External Link Disclaimer Liver Disease Viral Hepatitis: A through E and Beyond Alternate Versions ? PDF Version? (139 KB) Additional Links ? Autoimmune Hepatitis Hepatitis A Hepatitis B Hepatitis C Contact Us Digestive Disease Information Phone: ...

338

Viral miRNAs and immune evasion  

PubMed Central

Viral miRNAs, ?22nt RNA molecules which post-transcriptionally regulate gene expression, are emerging as important tools in immune evasion. Viral infection is a complex process that requires immune evasion in order to establish persistent life-long infection of the host. During this process viruses express both protein-coding and non-coding genes, which help to modulate the cellular environment making it more favorable for infection. In the last decade, it was uncovered that DNA viruses express a diverse and abundant pool of small non-coding RNA molecules, called microRNAs (miRNAs). These virally encoded miRNAs are non-immunogenic and therefore are important tools used to evade both innate and adaptive immune responses. This review aims to summarize our current knowledge of herpesvirus- and polyomavirus-encoded miRNAs, and how they contribute to immune evasion by targeting viral and/or host cellular genes. PMID:21757042

Boss, Isaac W.; Renne, Rolf

2013-01-01

339

VIROLOGY: Sensing Viral RNA Amid Your Own  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required: Viral RNA has a structural modification that cells recognize. This modification could be used in antiviral therapies and to modulate the immune system.

Takashi Fujita (Kyoto University; Institute for Virus Research,)

2006-11-10

340

Surveillance for Viral Hepatitis - United States, 2012  

MedlinePLUS

... Page Share Compartir Surveillance for Viral Hepatitis – United States, 2012 Entire report in a printable format [PDF - ... 1 Reported cases of acute hepatitis A, by state ? United States, 2008–2012 Table 2.2 Clinical ...

341

Theory of conformational transitions of viral shells  

NASA Astrophysics Data System (ADS)

We propose a continuum theory for the conformational transitions of viral shells. Conformational transitions of viral shells, as encountered during viral maturation, are associated with a soft mode instability of the capsid proteins [F. Tama and C. L. Brooks, J. Mol. Biol. 345(2), 299 (2005)]. The continuum theory presented here is an adaptation of the Ginzburg-Landau theory of soft-mode structural phase transitions of solids to viral shells. The theory predicts that the conformational transitions are characterized by a pronounced softening of the shell elasticity in the critical region. We demonstrate that the thermodynamics of the conformational transition can be probed quantitatively by a micromechanical atomic force microscope study. The external force can drive a capsid into a state of phase coexistence characterized by a highly nonlinear force deformation curve.

Guérin, Thomas; Bruinsma, Robijn

2007-12-01

342

Viral fitness: definitions, measurement, and current insights  

USGS Publications Warehouse

Viral fitness is an active area of research, with recent work involving an expanded number of human, non-human vertebrate, invertebrate, plant, and bacterial viruses. Many publications deal with RNA viruses associated with major disease emergence events, such as HIV-1, influenza virus, and Dengue virus. Study topics include drug resistance, immune escape, viral emergence, host jumps, mutation effects, quasispecies diversity, and mathematical models of viral fitness. Important recent trends include increasing use of in vivo systems to assess vertebrate virus fitness, and a broadening of research beyond replicative fitness to also investigate transmission fitness and epidemiologic fitness. This is essential for a more integrated understanding of overall viral fitness, with implications for disease management in the future.

Wargo, Andrew R.; Kurath, Gael

2012-01-01

343

Viral and host control of cytomegalovirus maturation.  

PubMed

Maturation in herpesviruses initiates in the nucleus of the infected cell, with encapsidation of viral DNA to form nucleocapsids, and concludes with envelopment in the cytoplasm to form infectious virions that egress the cell. The entire process of virus maturation is orchestrated by protein-protein interactions and enzymatic activities of viral and host origin. Viral tegument proteins play important roles in maintaining the structural stability of capsids and directing the acquisition of virus envelope. Envelopment occurs at modified host membranes and exploits host vesicular trafficking. In this review, we summarize current knowledge of and concepts in human cytomegalovirus (HCMV) maturation and their parallels in other herpesviruses, with an emphasis on viral and host factors that regulate this process. PMID:22633075

Tandon, Ritesh; Mocarski, Edward S

2012-08-01

344

Genetic Testing: What It Means for Your Health and Your Family's Health  

MedlinePLUS

What is genetic testing? Genetic testing looks at your genetic material, such as DNA and RNA, and molecules, such as proteins. This ... affect your health. What can I learn from genetic testing? The results of genetic testing may help to: ...

345

Risk Assessment, Genetic Counseling, and Genetic Testing for BRCA-Related Cancer in Women  

MedlinePLUS

... FINAL | 1 Understanding Task Force Recommendations Risk Assessment, Genetic Counseling, and Genetic Testing for BRCA-related Cancer in Women The ... to child.) The BRCA genes help a cell’s genetic material (DNA) function normally. However, mutations (harmful changes) ...

346

History and Current Status of Development and Use of Viral Insecticides in China  

PubMed Central

The use of insect viruses as biological control agents started in the early 1960s in China. To date, more than 32 viruses have been used to control insect pests in agriculture, forestry, pastures, and domestic gardens in China. In 2014, 57 products from 11 viruses were authorized as commercial viral insecticides by the Ministry of Agriculture of China. Approximately 1600 tons of viral insecticidal formulations have been produced annually in recent years, accounting for about 0.2% of the total insecticide output of China. The development and use of Helicoverpa armigera nucleopolyhedrovirus, Mamestra brassicae nucleopolyhedrovirus, Spodoptera litura nucleopolyhedrovirus, and Periplaneta fuliginosa densovirus are discussed as case studies. Additionally, some baculoviruses have been genetically modified to improve their killing rate, infectivity, and ultraviolet resistance. In this context, the biosafety assessment of a genetically modified Helicoverpa armigera nucleopolyhedrovirus is discussed. PMID:25609304

Sun, Xiulian

2015-01-01

347

The role of viral evolution in rabies host shifts and emergence  

PubMed Central

Despite its ability to infect all mammals, Rabies virus persists in numerous species-specific cycles that rarely sustain transmission in alternative species. The determinants of these species-associations and the adaptive significance of genetic divergence between host-associated viruses are poorly understood. One explanation is that epidemiological separation between reservoirs causes neutral genetic differentiation. Indeed, recent studies attributed host shifts to ecological factors and selection of ‘preadapted’ viral variants from the existing viral community. However, phenotypic differences between isolates and broad scale comparative and molecular evolutionary analyses indicate multiple barriers that Rabies virus must overcome through adaptation. This review assesses various lines of evidence and proposes a synthetic hypothesis for the respective roles of ecology and evolution in Rabies virus host shifts. PMID:25064563

Mollentze, Nardus; Biek, Roman; Streicker, Daniel G

2014-01-01

348

Seroprevalence of viral childhood infections in Eritrea  

Microsoft Academic Search

Background: The seroprevalence of viral childhood infections in Africa has not been thoroughly investigated. The relatively recently discovered human parvovirus B19 (B19) and human herpesvirus 6 (HHV-6) have received particularly little attention.Objective: To investigate the seroprevalence of viral childhood infections in different Eritrean populations and to define groups at high risk for infection.Study design: Five population groups in Eritrea have

T Tolfvenstam; M Enbom; H Ghebrekidan; U Rudén; A Linde; M Grandien; B Wahren

2000-01-01

349

Viral Interplay with the Host Sumoylation System  

Microsoft Academic Search

\\u000a Viruses have elaborate means to regulate cellular transcription in order to create a cellular environment that facilitates\\u000a viral survival and reproduction. This includes enhancing viral macromolecular synthesis and preventing antiviral responses\\u000a such as apoptosis and cell cycle arrest. There are numerous mechanisms by which viruses mediate their effects on the host\\u000a cell, and this includes targeting various cellular post-translational modification

Adeline F. Deyrieux; Van G. Wilson

350

The nucleolus – a gateway to viral infection?  

Microsoft Academic Search

Summary.  ?A number of viruses and viral proteins interact with a dynamic sub-nuclear structure called the nucleolus. The nucleolus\\u000a is present during interphase in mammalian cells and is the site of ribosome biogenesis, and has been implicated in controlling\\u000a regulatory processes such as the cell cycle. Viruses interact with the nucleolus and its antigens; viral proteins co-localise\\u000a with factors such as

J. A. Hiscox

2002-01-01

351

Genetic Counseling  

MedlinePLUS

... this page It's been added to your dashboard . Genetic counseling Genetic counseling is a service to help ... child care and genetic testing. Who should get genetic counseling? Anyone who has unanswered questions about origins ...

352

Viral Metagenomics: MetaView Software  

SciTech Connect

The purpose of this report is to design and develop a tool for analysis of raw sequence read data from viral metagenomics experiments. The tool should compare read sequences of known viral nucleic acid sequence data and enable a user to attempt to determine, with some degree of confidence, what virus groups may be present in the sample. This project was conducted in two phases. In phase 1 we surveyed the literature and examined existing metagenomics tools to educate ourselves and to more precisely define the problem of analyzing raw read data from viral metagenomic experiments. In phase 2 we devised an approach and built a prototype code and database. This code takes viral metagenomic read data in fasta format as input and accesses all complete viral genomes from Kpath for sequence comparison. The system executes at the UNIX command line, producing output that is stored in an Oracle relational database. We provide here a description of the approach we came up with for handling un-assembled, short read data sets from viral metagenomics experiments. We include a discussion of the current MetaView code capabilities and additional functionality that we believe should be added, should additional funding be acquired to continue the work.

Zhou, C; Smith, J

2007-10-22

353

Generating viral metagenomes from the coral holobiont  

PubMed Central

Reef-building corals comprise multipartite symbioses where the cnidarian animal is host to an array of eukaryotic and prokaryotic organisms, and the viruses that infect them. These viruses are critical elements of the coral holobiont, serving not only as agents of mortality, but also as potential vectors for lateral gene flow, and as elements encoding a variety of auxiliary metabolic functions. Consequently, understanding the functioning and health of the coral holobiont requires detailed knowledge of the associated viral assemblage and its function. Currently, the most tractable way of uncovering viral diversity and function is through metagenomic approaches, which is inherently difficult in corals because of the complex holobiont community, an extracellular mucus layer that all corals secrete, and the variety of sizes and structures of nucleic acids found in viruses. Here we present the first protocol for isolating, purifying and amplifying viral nucleic acids from corals based on mechanical disruption of cells. This method produces at least 50% higher yields of viral nucleic acids, has very low levels of cellular sequence contamination and captures wider viral diversity than previously used chemical-based extraction methods. We demonstrate that our mechanical-based method profiles a greater diversity of DNA and RNA genomes, including virus groups such as Retro-transcribing and ssRNA viruses, which are absent from metagenomes generated via chemical-based methods. In addition, we briefly present (and make publically available) the first paired DNA and RNA viral metagenomes from the coral Acropora tenuis. PMID:24847321

Wood-Charlson, Elisha M.; Suttle, Curtis A.; van Oppen, Madeleine J. H.

2014-01-01

354

Generating viral metagenomes from the coral holobiont.  

PubMed

Reef-building corals comprise multipartite symbioses where the cnidarian animal is host to an array of eukaryotic and prokaryotic organisms, and the viruses that infect them. These viruses are critical elements of the coral holobiont, serving not only as agents of mortality, but also as potential vectors for lateral gene flow, and as elements encoding a variety of auxiliary metabolic functions. Consequently, understanding the functioning and health of the coral holobiont requires detailed knowledge of the associated viral assemblage and its function. Currently, the most tractable way of uncovering viral diversity and function is through metagenomic approaches, which is inherently difficult in corals because of the complex holobiont community, an extracellular mucus layer that all corals secrete, and the variety of sizes and structures of nucleic acids found in viruses. Here we present the first protocol for isolating, purifying and amplifying viral nucleic acids from corals based on mechanical disruption of cells. This method produces at least 50% higher yields of viral nucleic acids, has very low levels of cellular sequence contamination and captures wider viral diversity than previously used chemical-based extraction methods. We demonstrate that our mechanical-based method profiles a greater diversity of DNA and RNA genomes, including virus groups such as Retro-transcribing and ssRNA viruses, which are absent from metagenomes generated via chemical-based methods. In addition, we briefly present (and make publically available) the first paired DNA and RNA viral metagenomes from the coral Acropora tenuis. PMID:24847321

Weynberg, Karen D; Wood-Charlson, Elisha M; Suttle, Curtis A; van Oppen, Madeleine J H

2014-01-01

355

Macrolide Therapy in Respiratory Viral Infections  

PubMed Central

Background. Macrolides have received considerable attention for their anti-inflammatory and immunomodulatory actions beyond the antibacterial effect. These two properties may ensure some efficacy in a wide spectrum of respiratory viral infections. We aimed to summarize the properties of macrolides and their efficacy in a range of respiratory viral infection. Methods. A search of electronic journal articles through PubMed was performed using combinations of the following keywords including macrolides and respiratory viral infection. Results. Both in vitro and in vivo studies have provided evidence of their efficacy in respiratory viral infections including rhinovirus (RV), respiratory syncytial virus (RSV), and influenza virus. Much data showed that macrolides reduced viral titers of RV ICAM-1, which is the receptor for RV, and RV infection-induced cytokines including IL-1?, IL-6, IL-8, and TNF-?. Macrolides also reduced the release of proinflammatory cytokines which were induced by RSV infection, viral titers, RNA of RSV replication, and the susceptibility to RSV infection partly through the reduced expression of activated RhoA which is an RSV receptor. Similar effects of macrolides on the influenza virus infection and augmentation of the IL-12 by macrolides which is essential in reducing virus yield were revealed. Conclusion. This paper provides an overview on the properties of macrolides and their efficacy in various respiratory diseases. PMID:22719178

Min, Jin-Young; Jang, Yong Ju

2012-01-01

356

Reprogramming axonal behavior by axon-specific viral transduction  

PubMed Central

The treatment of axonal disorders, such as diseases associated with axonal injury and degeneration, is limited by the inability to directly target therapeutic protein expression to injured axons. Current gene therapy approaches rely on infection and transcription of viral genes in the cell body. Here we describe an approach to target gene expression selectively to axons. Using a genetically engineered mouse containing epitope-labeled ribosomes, we find that neurons in adult animals contain ribosomes in distal axons. To use axonal ribosomes to alter local protein expression, we utilized a Sindbis virus containing an RNA genome that has been modified so that it can be directly used as a template for translation. Selective application of this virus to axons leads to local translation of heterologous proteins. Furthermore, we demonstrate that selective axonal protein expression can be used to modify axonal signaling in cultured neurons, enabling axons to grow over inhibitory substrates typically encountered following axonal injury. We also show that this viral approach also can be used to achieve heterologous expression in axons of living animals, indicating that this approach can be used to alter the axonal proteome in vivo. Together, these data identify a novel strategy to manipulate protein expression in axons, and provides a novel approach for using gene therapies for disorders of axonal function. PMID:22278412

Walker, Breset A.; Hengst, Ulrich; Kim, Hyung Joon; Jeon, Noo Li; Schmidt, Eric F.; Heintz, Nathaniel; Milner, Teresa A.; Jaffrey, Samie R.

2012-01-01

357

Evolution of the fish rhabdovirus viral haemorrhagic septicaemia virus.  

PubMed

Viral haemorrhagic septicaemia (VHS) caused by the rhabdovirus VHSV is economically the most important viral disease in European rainbow trout farming. Until 1989, this virus was mainly isolated from freshwater salmonids but in the last decade, it has also been isolated from an increasing number of free-living marine fish species. To study the genetic evolution of VHSV, the entire G gene from 74 isolates was analysed. VHSV from wild marine species caught in the Baltic Sea, Skagerrak, Kattegat, North Sea, and English Channel and European freshwater isolates, appeared to share a recent common ancestor. Based on the estimated nucleotide substitution rate, the ancestor of the European fresh water isolates was dated some 50 years ago. This finding fits with the initial reports in the 1950s on clinical observations of VHS in Danish freshwater rainbow trout farms. The study also indicates that European marine VHSV and the North American marine line separated approx. 500 years ago. The codon substitution rate among the freshwater VHSV isolates was found to be 2.5 times faster than among marine isolates. The data support the hypothesis of the marine environment being the original reservoir of VHSV and that the change in host range (to include rainbow trout) may have occurred several times. Virus from the marine environment will therefore continue to represent a threat to the trout aquaculture industry. PMID:15105533

Einer-Jensen, Katja; Ahrens, Peter; Forsberg, Roald; Lorenzen, Niels

2004-05-01

358

Synthetic DNA vaccine strategies against persistent viral infections  

PubMed Central

The human body has developed an elaborate defense system against microbial pathogens and foreign antigens. However, particular microbes have evolved sophisticated mechanisms to evade immune surveillance, allowing persistence within the human host. In an effort to combat such infections, intensive research has focused on the development of effective prophylactic and therapeutic countermeasures to suppress or clear persistent viral infections. To date, popular therapeutic strategies have included the use of live-attenuated microbes, viral vectors and dendritic-cell vaccines aiming to help suppress or clear infection. In recent years, improved DNA vaccines have now re-emerged as a promising candidate for therapeutic intervention due to the development of advanced optimization and delivery technologies. For instance, genetic optimization of synthetic plasmid constructs and their encoded antigens, in vivo electroporation-mediated vaccine delivery, as well as codelivery with molecular adjuvants have collectively enhanced both transgene expression and the elicitation of vaccine-induced immunity. In addition, the development of potent heterologous prime–boost regimens has also provided significant contributions to DNA vaccine immunogenicity. Herein, the authors will focus on these recent improvements to this synthetic platform in relation to their application in combating persistent virus infection. PMID:23659301

Villarreal, Daniel O; Talbott, Kendra T; Choo, Daniel K; Shedlock, Devon J; Weiner, David B

2015-01-01

359

DNA Vaccination of Rainbow Trout against Viral Hemorrhagic Septicemia Virus: A Dose–Response and Time–Course Study  

Microsoft Academic Search

Viral hemorrhagic septicemia (VHS) in rainbow trout Oncorhynchus mykiss is caused by VHS virus (VHSV), which belongs to the rhabdovirus family. Among the different strategies for immunizing fish with a recombinant vaccine, genetic immunization has recently proven to be highly effective. To further investigate the potential for protecting fish against VHS by DNA vaccination, experiments were conducted to determine the

Ellen Lorenzen; Katja Einer-Jensen; Torben Martinussen; Scott E. LaPatra; Niels Lorenzen

2000-01-01

360

Entry is a rate-limiting step for viral infection in a Drosophila melanogaster model of pathogenesis  

Microsoft Academic Search

The identification of host factors that control susceptibility to infection has been hampered by a lack of amenable genetic systems. We established an in vivo model to determine the host factors that control pathogenesis and identified viral entry as a rate-limiting step for infection. We infected Drosophila melanogaster cells and adults with drosophila C virus and found that the clathrin-mediated

Norbert Perrimon; Sara Cherry

2003-01-01

361

Detection of viral pathogens in high grade gliomas from unmapped next-generation sequencing data.  

PubMed

Viral pathogens have been implicated in the development of certain cancers including human papillomavirus (HPV) in squamous cell carcinoma and Epstein-Barr virus (EBV) in Burkitt's lymphoma. The significance of viral pathogens in brain tumors is controversial, and human cytomegalovirus (HCMV) has been associated with glioblastoma (GBM) in some but not all studies, making the role of HCMV unclear. In this study we sought to determine if viral pathogen sequences could be identified in an unbiased manner from previously discarded, unmapped, non-human, next-generation sequencing (NGS) reads obtained from targeted oncology, panel-based sequencing of high grade gliomas (HGGs), including GBMs. Twenty one sequential HGG cases were analyzed by a targeted NGS clinical oncology panel containing 151 genes using DNA obtained from formalin-fixed, paraffin-embedded (FFPE) tissue. Sequencing reads that did not map to the human genome (average of 38,000 non-human reads/case (1.9%)) were filtered and low quality reads removed. Extracted high quality reads were then sequentially aligned to the National Center for Biotechnology Information (NCBI) non-redundant nucleotide (nt and nr) databases. Aligned reads were classified based on NCBI taxonomy database and all eukaryotic viral sequences were further classified into viral families. Two viral sequences (both herpesviruses), EBV and Roseolovirus were detected in 5/21 (24%) cases and in 1/21 (5%) cases, respectively. None of the cases had detectable HCMV. Of the five HGG cases with detectable EBV DNA, four had additional material for EBV in situ hybridization (ISH), all of which were negative for expressed viral sequence. Overall, a similar discovery approach using unmapped non-human NGS reads could be used to discover viral sequences in other cancer types. PMID:24704430

Cimino, Patrick J; Zhao, Guoyan; Wang, David; Sehn, Jennifer K; Lewis, James S; Duncavage, Eric J

2014-06-01

362

Vaccines 85: Molecular and chemical basis of resistance to parasitic, bacterial, and viral diseases  

SciTech Connect

This book contains 70 selections. Some of the selection titles are: Structure of the Gene Encoding of Immunodominant Surface Antigen on the Sprozoite of the Human Malaria Parasite Plasmodium falciparum; Cloning and Expression in Bacteria of the Genes for Merozite-specific Antigens from the Malaria Parasite Plasmodium falciparum; A Major Surface Antigen of Plasmodium falciparum in Merozoites: Studies on the Protein and its Gene; Genetic Construction of Cholera Vaccine Prototypes; and Viral Genes, Cytotoxic T Lymphocytes and Immunity.

Lerner, R.A.; Chanock, R.M.; Brown, F.

1985-01-01

363

Prevalence of genotypes 1 and 2 of bovine viral diarrhea virus in Lower Saxony, Germany  

Microsoft Academic Search

The aim of this study was to find whether an antigenic drift had occurred in Lower Saxony in the past 40 years. For this, the genetic diversity of bovine viral diarrhea virus (BVDV) isolates mainly from Lower Saxony was estimated by RT-PCR and sequencing of a 420 bp fragment of the E2 glycoprotein gene. Sixty-one field virus isolates collected during

Motoshi Tajima; Hans-Richard Frey; Osamu Yamato; Yoshimitsu Maede; Volker Moennig; Henner Scholz; Irene Greiser-Wilke

2001-01-01

364

Persistence in Muscle of an Adenoviral Vector that Lacks All Viral Genes  

Microsoft Academic Search

Genetic correction of inherited muscle diseases, such as Duchenne muscular dystrophy, will require long term expression of the recombinant protein following gene transfer. We have shown previously that a new adenoviral vector that lacks all viral genes expressed both full-length dystrophin and beta -galactosidase in mdx (dystrophin-deficient) mouse muscle. We observed a significant histologic improvement of vector-transduced mdx muscle before

Hsiao-Huei Chen; Lisa M. Mack; Robert Kelly; Marcia Ontell; Stefan Kochanek; Paula R. Clemens

1997-01-01

365

Small RNAs in viral infection and host defense.  

PubMed

Small RNAs are the key mediators of RNA silencing and related pathways in plants and other eukaryotic organisms. Silencing pathways couple the destruction of double-stranded RNA with the use of the resulting small RNAs to target other nucleic acid molecules that contain the complementary sequence. This discovery has revolutionized our ideas about host defense and genetic regulatory mechanisms in eukaryotes. Small RNAs can direct the degradation of mRNAs and single-stranded viral RNAs, the modification of DNA and histones, and the inhibition of translation. Viruses might even use small RNAs to do some targeting of their own to manipulate host gene expression. This review highlights the current understanding and new insights concerning the roles of small RNAs in virus infection and host defense in plants. PMID:18550416

Mlotshwa, Sizolwenkosi; Pruss, Gail J; Vance, Vicki

2008-07-01

366

Genetics Education Network  

NSDL National Science Digital Library

This is a searchable database of the state science standards reflective of genetics content for each grade in the US. Genetics content includes standards on heredity, DNA, evolution, population ecology, some disease and biotechnology. One half of the standards are currently linked to websites that cover the material and more are vetted and linked every day. Activities to help teach the material will also be added soon.

Kenna Shaw (American Society of Human Genetics; )

2006-05-31

367

Differential genetic variation of chickens and MD vaccine protective efficacy  

Technology Transfer Automated Retrieval System (TEKTRAN)

Vaccine protective efficacy is determined by multiple factors including host genetics, the type of vaccine, vaccine dosage, the virulence and dose of challenging viruses, and the interval between vaccination and viral challenge. Studies on human immune responses to vaccinations suggest host genetic...

368

Edinburgh Research Explorer The genetics of hostvirus coevolution in invertebrates  

E-print Network

Edinburgh Research Explorer The genetics of host­virus coevolution in invertebrates Citation for published version: Obbard, DJ & Dudas, G 2014, 'The genetics of host­virus coevolution in invertebrates­virus coevolution in invertebrates Darren J Obbard1,2 and Gytis Dudas1 Although viral infection and antiviral

Millar, Andrew J.

369

Applying horizontal gene transfer phenomena to enhance non-viral gene therapy  

PubMed Central

Horizontal gene transfer (HGT) is widespread amongst prokaryotes, but eukaryotes tend to be far less promiscuous with their genetic information. However, several examples of HGT from pathogens into eukaryotic cells have been discovered and mimicked to improve non-viral gene delivery techniques. For example, several viral proteins and DNA sequences have been used to significantly increase cytoplasmic and nuclear gene delivery. Plant genetic engineering is routinely performed with the pathogenic bacterium Agrobacterium tumefaciens and similar pathogens (e.g. Bartonella henselae) may also be able to transform human cells. Intracellular parasites like Trypanosoma cruzi may also provide new insights into overcoming cellular barriers to gene delivery. Finally, intercellular nucleic acid transfer between host cells will also be briefly discussed. This article will review the unique characteristics of several different viruses and microbes and discuss how their traits have been successfully applied to improve non-viral gene delivery techniques. Consequently, pathogenic traits that originally caused diseases may eventually be used to treat many genetic diseases. PMID:23994344

Elmer, Jacob J.; Christensen, Matthew D.; Rege, Kaushal

2014-01-01

370

Exosomes from Hepatitis C Infected Patients Transmit HCV Infection and Contain Replication Competent Viral RNA in Complex with Ago2-miR122-HSP90  

PubMed Central

Antibodies targeting receptor-mediated entry of HCV into hepatocytes confer limited therapeutic benefits. Evidence suggests that exosomes can transfer genetic materials between cells; however, their role in HCV infection remains obscure. Here, we show that exosomes isolated from sera of chronic HCV infected patients or supernatants of J6/JFH1-HCV-infected Huh7.5 cells contained HCV RNA. These exosomes could mediate viral receptor-independent transmission of HCV to hepatocytes. Negative sense HCV RNA, indicative of replication competent viral RNA, was present in exosomes of all HCV infected treatment non-responders and some treatment-naïve individuals. Remarkably, HCV RNA was associated with Ago2, HSP90 and miR-122 in exosomes isolated from HCV-infected individuals or HCV-infected Huh7.5 cell supernatants. Exosome-loading with a miR-122 inhibitor, or inhibition of HSP90, vacuolar H+-ATPases, and proton pumps, significantly suppressed exosome-mediated HCV transmission to naïve cells. Our findings provide mechanistic evidence for HCV transmission by blood-derived exosomes and highlight potential therapeutic strategies. PMID:25275643

Kodys, Karen; Bala, Shashi; Szabo, Gyongyi

2014-01-01

371

Viral load, organ distribution, histopathological lesions, and cytokine mRNA expression in goats infected with a molecular clone of the caprine arthritis encephalitis virus.  

PubMed

Caprine arthritis encephalitis virus (CAEV) is a lentivirus of goats that causes persistent infection characterized by the appearance of inflammatory lesions in various organs. To define the sites of persistence, 5 goats were infected with a molecular clone of CAEV, and the viral load was monitored by real-time-PCR and RT-PCR in different sites 8 years after infection. The lymph nodes proved to be an important virus reservoir, with moderate virus replication relative to what is reported for lentiviruses of primates. Mammary gland and milk cells were preferred sites of viral replication. The viral load varied significantly between animals, which points to an important role of the genetic background. We found a clear association between occurrence of histopathological lesions and viral load in specific sites. The mRNA expression analysis of several cytokines did not reveal differences between animals that could explain the considerable individual variations in viral load observed. PMID:16537085

Ravazzolo, Ana Paula; Nenci, Chiara; Vogt, Hans-Rudolf; Waldvogel, Andreas; Obexer-Ruff, Gabriela; Peterhans, Ernst; Bertoni, Giuseppe

2006-06-20

372

Viral immune evasion strategies and the underlying cell biology.  

PubMed

Evasion of the immune system by viruses is a well-studied field. It remains a challenge to understand how these viral tactics affect pathogenesis and the viral lifecycle. At the same time, the study of viral proteins involved in immune evasion has helped us to better understand a number of cellular processes at the molecular level. Here we review recent data on different viral tactics for immune evasion and highlight what these viral interventions might teach us about cell biology. PMID:11289794

Lorenzo, M E; Ploegh, H L; Tirabassi, R S

2001-02-01

373

Duck viral enteritis in domestic muscovy ducks in Pennsylvania  

USGS Publications Warehouse

Duck viral enteritis (DVE) outbreaks occurred at two different locations in Pennsylvania in 1991 and 1992. In the first outbreak, four ducks died out of a group of 30 domestic ducks; in the second outbreak, 65 ducks died out of a group of 114 domestic ducks, and 15 domestic geese died as well. A variety of species of ducks were present on both premises, but only muscovy ducks (Cairina moschata) died from the disease. On necropsy, gross lesions included hepatomegaly with petechial hemorrhages, petechial hemorrhages in the abdominal fat, petechial hemorrhages on the epicardial surface of the heart, and multifocal to coalescing areas of fibrinonecrotic material over the mucosal surface of the trachea, esophagus, intestine, and cloaca. Histologically, the liver had random multifocal areas of necrosis and eosinophilic intranuclear inclusion bodies in hepatocytes. DVE virus was isolated and identified using muscovy duck embryo fibroblast inoculation and virus neutralization. /// En dos sitios diferentes se presentaron brotes de enteritis viral de los patos en el estados de Pensilvania en los a??os 1991 y 1992. En el primer brote, cuatro de un lote de 30 patos murieron mientras que en el segundo brote murieron 65 patos de un lote de 114 patos y 15 gansos. En ambas localidades exist?-a una variedad de especies de patos, sin embargo, s??lamente los patos almizcleros (Cairina moschata) murieron. A la necropsia, las lesiones macrosc??picas incluyeron hepatomegalia con hemorragias petequiales, hemorragias petequiales en la grasa abdominal y en la superficie del epicardio, y ?!reas multifocales o coalescentes de material fibrinonecr??tico sobre la superficie de la mucosa de la tr?!quea, es??fago, intestino y cloaca. Histol??gicamente, el h?-gado mostraba ?!reas multifocales de necrosis y cuerpos de inclusi??n intranucleares eosinof?-licos en los hepatocitos. El virus de la enteritis viral de los patos fue aislado e identificado usando fibroblasto de embriones de pato almizclero y mediante la virus neutralizaci??n.

Davison, S.; Converse, K.A.; Hamir, A.N.; Eckroade, R.J.

1993-01-01

374

Update on chronic viral hepatitis  

PubMed Central

Many recent and significant advances in the field of chronic viral hepatitis, including therapy, suggest that an update on chronic hepatitis is timely.?Chronic hepatitis B virus infection remains a significant worldwide cause of liver cirrhosis and hepatocellular carcinoma, despite the wide availability of a long established and effective vaccine. Transmission occurs via perinatal, sexual, and parenteral routes (particularly intravenous drug abuse and although blood products still carry a risk, this is now extremely low in Western countries). Only a minority of infected adult cases develop chronic hepatitis but in children under 1 year, 90% develop chronic hepatitis. The clinical spectrum of chronic liver injury ranges from mild inflammation to end stage liver cirrhosis. Interferon alfa has been the mainstay of treatment for patients with active disease but nucleoside analogues (lamivudine and adefovir) are now available with similar efficacy. Patients with end stage liver disease and hepatocellular carcinoma can be offered transplantation but infection in the graft is commonplace. The combination of hepatitis B immunoglobulin and newer antiviral drugs reduce the incidence and severity of graft infection significantly.?The hepatitis C virus epidemic of the latter half of the 20th century now affects more than 1% of populations worldwide. This RNA virus is spread parenterally and is becoming the leading indication for liver transplantation. The majority of patients develop chronic hepatitis, which may be progressive, evolving to significant liver disease (cirrhosis or hepatocellular carcinoma) in about 20% cases after decades. Treatment with the combination of interferon alfa and ribavirin is successful in up to 40% cases. Liver transplantation is a therapeutic option for some but graft infection is universal and often complicated by progressive liver fibrosis. A vaccine remains a remote prospect so that prevention is crucial.?Hepatitis D virus infection occurs on a background of hepatitis B virus infection and can also cause liver damage. The response to antiviral therapy is poor.?The newer "hepatitis" viruses G and TT do not cause significant liver injury.???Keywords: hepatitis PMID:11470928

Walsh, K; Alexander, G

2001-01-01

375

DEVELOPMENT OF GENETICALLY ENHANCED BACULOVIRUS PESTICIDES  

EPA Science Inventory

The assessment of potential environmental impacts of genetically improved viral pesticides will include an evaluation of the properties of the foreign gene product(s) as well as the biological properties of altered virus itself. It is anticipated that in the near future several t...

376

Understanding the Determinants of Mobile Viral Effects-Towards a Grounded Theory of Mobile Viral Marketing  

Microsoft Academic Search

Although there is some evidence on the usefulness of mobile viral marketing from marketers' perspective, little is known about the motivations, attitudes, and behaviors of consumers engaged in this marketing instrument. In this paper, we present the findings of a grounded theory study and focus on determining why a mobile viral effect occurs. The proposed framework helps researchers and marketers

Dietmar G. Wiedemann; Wolfgang Palka

2008-01-01

377

Washing and trypsin treatment of in vitro derived bovine embryos exposed to bovine viral diarrhea virus  

Microsoft Academic Search

Gametes, somatic cells and materials of animal origin in media are potential sources for introducing bovine viral diarrhea virus (BVDV) into systems for production of IVF bovine embryos. Further, the efficacy of washing and trypsin treatment for removal of BVDV from IVF embryos is questionable. Washing and trypsin treatments recommended by the International Embryo Transfer Society for in vivo-derived embryos

E Trachte; D Stringfellow; K Riddell; P Galik; M Riddell; J Wright

1998-01-01

378

CALF DIARRHEA OF VIRAL ETIOLOGY (1) C. A. MEBUS, E. L. STAIR  

E-print Network

and contained mucus. A report of the pathology of calf diarrhea caused by two viral agents is presented. TWIEHAUS, Department of Veterinary Scievzce, University of Nebraska, 68503 Lincoln SUMMARY The pathology. MATERIALS AND METHODS Specimens Diarrheic fecal samples were collected directly from calves within the first

Paris-Sud XI, Université de

379

Viral, Bacterial and Parasitic Etiology of Pediatric Diarrhea in Gaza, Palestine  

Microsoft Academic Search

Objectives: To determine the etiology of acute diarrhea in Palestinian children under 5 years of age and to improve knowledge of the etiology of gastrointestinal pathogens using traditional and molecular diagnostic techniques. Materials and Methods: Various common enteropathogens (viral, bacterial and parasites) associated with diarrhea were investigated by conventional and molecular techniques (PCR) in 150 children less than 5 years

Farid H. Abu-Elamreen; Abdalla A. Abed; Fadel A. Sharif

2008-01-01

380

The Remarkable Frequency of Human Immunodeficiency Virus Type 1 Genetic Recombination  

PubMed Central

Summary: The genetic diversity of human immunodeficiency virus type 1 (HIV-1) results from a combination of point mutations and genetic recombination, and rates of both processes are unusually high. This review focuses on the mechanisms and outcomes of HIV-1 genetic recombination and on the parameters that make recombination so remarkably frequent. Experimental work has demonstrated that the process that leads to recombination—a copy choice mechanism involving the migration of reverse transcriptase between viral RNA templates—occurs several times on average during every round of HIV-1 DNA synthesis. Key biological factors that lead to high recombination rates for all retroviruses are the recombination-prone nature of their reverse transcription machinery and their pseudodiploid RNA genomes. However, HIV-1 genes recombine even more frequently than do those of many other retroviruses. This reflects the way in which HIV-1 selects genomic RNAs for coencapsidation as well as cell-to-cell transmission properties that lead to unusually frequent associations between distinct viral genotypes. HIV-1 faces strong and changeable selective conditions during replication within patients. The mode of HIV-1 persistence as integrated proviruses and strong selection for defective proviruses in vivo provide conditions for archiving alleles, which can be resuscitated years after initial provirus establishment. Recombination can facilitate drug resistance and may allow superinfecting HIV-1 strains to evade preexisting immune responses, thus adding to challenges in vaccine development. These properties converge to provide HIV-1 with the means, motive, and opportunity to recombine its genetic material at an unprecedented high rate and to allow genetic recombination to serve as one of the highest barriers to HIV-1 eradication. PMID:19721086

Onafuwa-Nuga, Adewunmi; Telesnitsky, Alice

2009-01-01

381

Genetic specificity and potential for local adaptation between dengue viruses and mosquito vectors  

Microsoft Academic Search

BACKGROUND: Several observations support the hypothesis that vector-driven selection plays an important role in shaping dengue virus (DENV) genetic diversity. Clustering of DENV genetic diversity at a particular location may reflect underlying genetic structure of vector populations, which combined with specific vector genotype × virus genotype (G × G) interactions may promote adaptation of viral lineages to local mosquito vector

Louis Lambrechts; Christine Chevillon; Rebecca G Albright; Butsaya Thaisomboonsuk; Jason H Richardson; Richard G Jarman; Thomas W Scott

2009-01-01

382

Genetic Heterogeneity of Hepatitis C Virus in Association with Antiviral Therapy Determined by Ultra-Deep Sequencing  

Microsoft Academic Search

Background and AimsThe hepatitis C virus (HCV) invariably shows wide heterogeneity in infected patients, referred to as a quasispecies population. Massive amounts of genetic information due to the abundance of HCV variants could be an obstacle to evaluate the viral genetic heterogeneity in detail.MethodsUsing a newly developed massive-parallel ultra-deep sequencing technique, we investigated the viral genetic heterogeneity in 27 chronic

Akihiro Nasu; Hiroyuki Marusawa; Yoshihide Ueda; Norihiro Nishijima; Ken Takahashi; Yukio Osaki; Yukitaka Yamashita; Tetsuro Inokuma; Takashi Tamada; Takeshi Fujiwara; Fumiaki Sato; Kazuharu Shimizu; Tsutomu Chiba; Yoshio Yamaoka

2011-01-01

383

Genetic Science Learning Center (GSLC)  

NSDL National Science Digital Library

The University of Utah's Genetic Science Learning Center offers "excellent genetic science curriculum, training, and resources" through virtual (Internet-based curriculum) and actual (training programs for classroom teachers) programs. Two of the Website's main sections may be of special interest to educators: Basic Genetics (introductory materials) and Thematic Units (curriculum information). The site also offers two sections on Genetic Disorders and Genetics in Society, and lists of specialized resources for Teachers, Students, or Family (the general public). This page has much to offer as a reference for beginning genetics.

384

Medical genetics  

SciTech Connect

This book on the subject of medical genetics is a textbook aimed at a very broad audience: principally, medical students, nursing students, graduate, and undergraduate students. The book is actually a primer of general genetics as applied to humans and provides a well-balanced introduction to the scientific and clinical basis of human genetics. The twelve chapters include: Introduction, Basic Cell Biology, Genetic Variation, Autosomal Dominant and Recessive Inheritance, Sex-linked and Mitochondrial Inheritance, Clinical Cytogenetics, Gene Mapping, Immunogenetics, Cancer Genetics, Multifactorial Inheritance and Common Disease, Genetic Screening, Genetic Diagnosis and Gene Therapy, and Clinical Genetics and Genetic Counseling.

Jorde, L.B.; Carey, J.C.; White, R.L.

1995-10-01

385

Shedding new light on viral photosynthesis.  

PubMed

Viruses infecting the environmentally important marine cyanobacteria Prochlorococcus and Synechococcus encode 'auxiliary metabolic genes' (AMGs) involved in the light and dark reactions of photosynthesis. Here, we discuss progress on the inventory of such AMGs in the ever-increasing number of viral genome sequences as well as in metagenomic datasets. We contextualise these gene acquisitions with reference to a hypothesised fitness gain to the phage. We also report new evidence with regard to the sequence and predicted structural properties of viral petE genes encoding the soluble electron carrier plastocyanin. Viral copies of PetE exhibit extensive modifications to the N-terminal signal peptide and possess several novel residues in a region responsible for interaction with redox partners. We also highlight potential knowledge gaps in this field and discuss future opportunities to discover novel phage-host interactions involved in the photosynthetic process. PMID:25381655

Puxty, Richard J; Millard, Andrew D; Evans, David J; Scanlan, David J

2014-11-01

386

Molecular basis of viral and microbial pathogenesis  

SciTech Connect

The contents of this book are: Correlation Between Viroid Structure and Pathogenicty; Antigenicity of the Influenza Haemagglutinia Membrane Glycoprotein; Viral Glycoproteins as Determinants of Pathogenicity; Virus Genes Involved in Host Range and Pathogenicity; Molecular Heterogenetiy of Pathogenic Herpus Viruses; Recombination of Foreign (Viral) DNA with Host Genome: Studies in Vivo and in a Cell-Free system; Disorders of Cellular Neuro-Functions by Persistent Viral Infection; Pathogenic Aspects of Measles Virus-Persistent Infections in Man; Analysis of the Dual Lineage Specificity of E26 Avian Leukemia Virus; Mx Gene Control of Influenza Virus Susceptibility; Shiga and Shika-Like Toxins: A Family of Related Cytokinons; and Molecular Mechanisms of Pathogenicity in Shigella Flexneri.

Rott, R.; Goebel, W.

1988-01-01

387

Environmental risk assessment of replication competent viral vectors applied in clinical trials: potential effects of inserted sequences.  

PubMed

Risk assessments of clinical applications involving genetically modified viral vectors are carried out according to general principles that are implemented in many national and regional legislations, e.g., in Directive 2001/18/EC of the European Union. Recent developments in vector design have a large impact on the concepts that underpin the risk assessments of viral vectors that are used in clinical trials. The use of (conditionally) replication competent viral vectors (RCVVs) may increase the likelihood of the exposure of the environment around the patient, compared to replication defective viral vectors. Based on this assumption we have developed a methodology for the environmental risk assessment of replication competent viral vectors, which is presented in this review. Furthermore, the increased likelihood of exposure leads to a reevaluation of what would constitute a hazardous gene product in viral vector therapies, and a keen interest in new developments in the inserts used. One of the trends is the use of inserts produced by synthetic biology. In this review the implications of these developments for the environmental risk assessment of RCVVs are highlighted, with examples from current clinical trials. The conclusion is drawn that RCVVs, notwithstanding their replication competency, can be applied in an environmentally safe way, in particular if adequate built-in safeties are incorporated, like conditional replication competency, as mitigating factors to reduce adverse environmental effects that could occur. PMID:24397527

van den Akker, Eric; van der Vlugt, Cecile J B; Bleijs, Diederik A; Bergmans, Hans E

2013-12-01

388

Viral adaptation to immune selection pressure by HLA class I–restricted CTL responses targeting epitopes in HIV frameshift sequences  

PubMed Central

CD8+ cytotoxic T lymphocyte (CTL)–mediated immune responses to HIV contribute to viral control in vivo. Epitopes encoded by alternative reading frame (ARF) peptides may be targeted by CTLs as well, but their frequency and in vivo relevance are unknown. Using host genetic (human leukocyte antigen [HLA]) and plasma viral sequence information from 765 HIV-infected subjects, we identified 64 statistically significant (q < 0.2) associations between specific HLA alleles and sequence polymorphisms in alternate reading frames of gag, pol, and nef that did not affect the regular frame protein sequence. Peptides spanning the top 20 HLA-associated imprints were used to test for ex vivo immune responses in 85 HIV-infected subjects and showed responses to 10 of these ARF peptides. The most frequent response recognized an HLA-A*03–restricted +2 frame–encoded epitope containing a unique A*03-associated polymorphism at position 6. Epitope-specific CTLs efficiently inhibited viral replication in vitro when viruses containing the wild-type sequence but not the observed polymorphism were tested. Mutating alternative internal start codons abrogated the CTL-mediated inhibition of viral replication. These data indicate that responses to ARF-encoded HIV epitopes are induced during natural infection, can contribute to viral control in vivo, and drive viral evolution on a population level. PMID:20065065

Berger, Christoph T.; Carlson, Jonathan M.; Brumme, Chanson J.; Hartman, Kari L.; Brumme, Zabrina L.; Henry, Leah M.; Rosato, Pamela C.; Piechocka-Trocha, Alicja; Brockman, Mark A.; Harrigan, P. Richard; Heckerman, David; Kaufmann, Daniel E.

2010-01-01

389

IFITM proteins restrict viral membrane hemifusion.  

PubMed

The interferon-inducible transmembrane (IFITM) protein family represents a new class of cellular restriction factors that block early stages of viral replication; the underlying mechanism is currently not known. Here we provide evidence that IFITM proteins restrict membrane fusion induced by representatives of all three classes of viral membrane fusion proteins. IFITM1 profoundly suppressed syncytia formation and cell-cell fusion induced by almost all viral fusion proteins examined; IFITM2 and IFITM3 also strongly inhibited their fusion, with efficiency somewhat dependent on cell types. Furthermore, treatment of cells with IFN also markedly inhibited viral membrane fusion and entry. By using the Jaagsiekte sheep retrovirus envelope and influenza A virus hemagglutinin as models for study, we showed that IFITM-mediated restriction on membrane fusion is not at the steps of receptor- and/or low pH-mediated triggering; instead, the creation of hemifusion was essentially blocked by IFITMs. Chlorpromazine (CPZ), a chemical known to promote the transition from hemifusion to full fusion, was unable to rescue the IFITM-mediated restriction on fusion. In contrast, oleic acid (OA), a lipid analog that generates negative spontaneous curvature and thereby promotes hemifusion, virtually overcame the restriction. To explore the possible effect of IFITM proteins on membrane molecular order and fluidity, we performed fluorescence labeling with Laurdan, in conjunction with two-photon laser scanning and fluorescence-lifetime imaging microscopy (FLIM). We observed that the generalized polarizations (GPs) and fluorescence lifetimes of cell membranes expressing IFITM proteins were greatly enhanced, indicating higher molecularly ordered and less fluidized membranes. Collectively, our data demonstrated that IFITM proteins suppress viral membrane fusion before the creation of hemifusion, and suggested that they may do so by reducing membrane fluidity and conferring a positive spontaneous curvature in the outer leaflets of cell membranes. Our study provides novel insight into the understanding of how IFITM protein family restricts viral membrane fusion and infection. PMID:23358889

Li, Kun; Markosyan, Ruben M; Zheng, Yi-Min; Golfetto, Ottavia; Bungart, Brittani; Li, Minghua; Ding, Shilei; He, Yuxian; Liang, Chen; Lee, James C; Gratton, Enrico; Cohen, Fredric S; Liu, Shan-Lu

2013-01-01

390

Latent Herpes Viral Reactivation in Astronauts  

NASA Technical Reports Server (NTRS)

Latent viruses are ubiquitous and reactivate during stressful periods with and without symptoms. Latent herpes virus reactivation is used as a tool to predict changes in the immune status in astronauts and to evaluate associated health risks. Methods: Viral DNA was detected by real time polymerase chain reaction in saliva and urine from astronauts before, during and after short and long-duration space flights. Results and Discussion: EpsteinBarr virus (EBV), cytomegalovirus (CMV), and varicella zoster virus (VZV) reactivated, and viral DNA was shed in saliva (EBV and VZV) or urine (CMV). EBV levels in saliva during flight were 10fold higher than baseline levels. Elevations in EBV specific CD8+ T-cells, viral antibody titers, and specific cytokines were consistent with viral reactivation. Intracellular levels of cytokines were reduced in EBVspecific Tcells. CMV, rarely present in urine of healthy individuals, was shed in urine of 27% of astronauts during all phases of spaceflight. VZV, not found in saliva of asymptomatic individuals, was found in saliva of 50% of astronauts during spaceflight and 35 days after flight. VZV recovered from astronaut saliva was found to be live, infectious virus. DNA sequencing demonstrated that the VZV recovered from astronauts was from the common European strain of VZV. Elevation of stress hormones accompanied viral reactivation indicating involvement of the hypothalmic-pituitary-adrenal and sympathetic adrenal-medullary axes in the mechanism of viral reactivation in astronauts. A study of 53 shingles patients found that all shingles patients shed VZV DNA in their saliva and the VZV levels correlated with the severity of the disease. Lower VZV levels in shingles patients were similar to those observed in astronauts. We proposed a rapid, simple, and cost-effective assay to detect VZV in saliva of patients with suspected shingles. Early detection of VZV infection allows early medical intervention.

Pierson, D. L.; Mehta, S. K.; Stowe, R.

2008-01-01

391

IFITM Proteins Restrict Viral Membrane Hemifusion  

PubMed Central

The interferon-inducible transmembrane (IFITM) protein family represents a new class of cellular restriction factors that block early stages of viral replication; the underlying mechanism is currently not known. Here we provide evidence that IFITM proteins restrict membrane fusion induced by representatives of all three classes of viral membrane fusion proteins. IFITM1 profoundly suppressed syncytia formation and cell-cell fusion induced by almost all viral fusion proteins examined; IFITM2 and IFITM3 also strongly inhibited their fusion, with efficiency somewhat dependent on cell types. Furthermore, treatment of cells with IFN also markedly inhibited viral membrane fusion and entry. By using the Jaagsiekte sheep retrovirus envelope and influenza A virus hemagglutinin as models for study, we showed that IFITM-mediated restriction on membrane fusion is not at the steps of receptor- and/or low pH-mediated triggering; instead, the creation of hemifusion was essentially blocked by IFITMs. Chlorpromazine (CPZ), a chemical known to promote the transition from hemifusion to full fusion, was unable to rescue the IFITM-mediated restriction on fusion. In contrast, oleic acid (OA), a lipid analog that generates negative spontaneous curvature and thereby promotes hemifusion, virtually overcame the restriction. To explore the possible effect of IFITM proteins on membrane molecular order and fluidity, we performed fluorescence labeling with Laurdan, in conjunction with two-photon laser scanning and fluorescence-lifetime imaging microscopy (FLIM). We observed that the generalized polarizations (GPs) and fluorescence lifetimes of cell membranes expressing IFITM proteins were greatly enhanced, indicating higher molecularly ordered and less fluidized membranes. Collectively, our data demonstrated that IFITM proteins suppress viral membrane fusion before the creation of hemifusion, and suggested that they may do so by reducing membrane fluidity and conferring a positive spontaneous curvature in the outer leaflets of cell membranes. Our study provides novel insight into the understanding of how IFITM protein family restricts viral membrane fusion and infection. PMID:23358889

Golfetto, Ottavia; Bungart, Brittani; Li, Minghua; Ding, Shilei; He, Yuxian; Liang, Chen; Lee, James C.; Gratton, Enrico; Cohen, Fredric S.; Liu, Shan-Lu

2013-01-01

392

Metatranscriptomic analysis of extremely halophilic viral communities.  

PubMed

Hypersaline environments harbour the highest number of viruses reported for aquatic environments. In crystallizer ponds from solar salterns, haloviruses coexist with extremely halophilic Archaea and Bacteria and present a high diversity although little is known about their activity. In this work, we analyzed the viral expression in one crystallizer using a metatranscriptomic approach in which clones from a metaviromic library were immobilized in a microarray and used as probes against total mRNA extracted from the hypersaline community. This approach has two advantages: (i) it overcomes the fact that there is no straightforward, unambiguous way to extract viral mRNA from bulk mRNAs and (ii) it makes the sequencing of all mRNAs unnecessary. Transcriptomic data indicated that the halovirus assemblage was highly active at the time of sampling and the viral groups with the highest expression levels were those related to high GC content haloarchaea and Salinibacter representatives, which are minor components in the environment. Moreover, the changes in the viral expression pattern and in the numbers of free viral particles were analyzed after submitting the samples to two stress conditions: ultraviolet-radiation and dilution. Results showed that Archaea were more sensitive than Bacteria to these stress conditions. The overexpression in the predicted archaeal virus fraction raised and the total numbers of free viruses increased. Furthermore, we identified some very closely related viral clones, displaying single-nucleotide polymorphisms, which were expressed only under certain conditions. These clones could be part of very closely related virus genomes for which we propose the term 'ecoviriotypes'. PMID:21490689

Santos, Fernando; Moreno-Paz, Mercedes; Meseguer, Inmaculada; López, Cristina; Rosselló-Mora, Ramon; Parro, Víctor; Antón, Josefa

2011-10-01

393

BIOCHEMISTRY: Viral Glycoproteins and an Evolutionary Conundrum  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. Many animal viruses are surrounded by an envelope--a membrane that consists of a lipid bilayer derived from some host cell compartment, studded with spikes of virally encoded glycoproteins. These proteins are the targets of neutralizing antibodies and are thus of great interest as potential vaccines. From a viral perspective, glycoproteins recognize which cells a given virus may infect by binding to surface receptors and effect cell entry after initial contact has been made. Glycoproteins from two entirely different viruses share the same novel structure, raising intriguing questions about the evolutionary origins of these and other viruses.

Alasdair C. Steven (National Institute of Arthritis and Musculoskeletal and Skin Diseases; Laboratory of Structural Biology)

2006-07-14

394

Personalized genetic testing and norovirus susceptibility  

PubMed Central

BACKGROUND: The availability of direct-to-consumer personalized genetic testing has enabled the public to access and interpret their own genetic information. Various genetic traits can be determined including resistance to norovirus through a nonsense mutation (G428A) in the FUT2 gene. Although this trait is believed to confer resistance to the most dominant norovirus genotype (GII.4), the spectrum of resistance to other norovirus strains is unknown. The present report describes a cluster of symptomatic norovirus GI.6 infection in a family identified to have norovirus resistance through personalized genetic testing. CASE PRESENTATION: In January 2013, four members of a family determined by a direct-to-consumer genetic test to be homozygous for the norovirus resistance trait (A/A genotype for single nucleotide polymorphism rs601338) developed symptoms consistent with acute viral gastroenteritis. Stool and vomitus samples were submitted for enteric viral pathogen testing. Samples were positive for norovirus GI.6 in three of the four cases. CONCLUSIONS: The present report is the first to describe norovirus GI.6 infection in patients with the G428A nonsense mutation in FUT2; this cluster of cases suggests that the G428A mutation in FUT2 may not confer resistance to norovirus GI.6. Direct-to-consumer genetic testing is empowering members of the public to identify novel associations with their genetic traits. Expert consultation is important for the interpretation of personalized genetic test results, and follow-up laboratory testing can confirm any potentially novel associations. PMID:25285128

Prystajecky, Natalie; Brinkman, Fiona SL; Auk, Brian; Isaac-Renton, Judith L; Tang, Patrick

2014-01-01

395

New Genetics  

MedlinePLUS

... Gene Editing with CRISPR Computing Genetics Model Organisms RNA Interference The New Genetics is a science education ... the basics of DNA and its molecular cousin RNA, and new directions in genetic research. The New ...

396

Genetic counseling  

E-print Network

and susceptibility genes brought forth by the sequencing of the human genome has brought challenges to the field of genetic counseling. The traditional role of genetic counseling has significantly widened to address a diversity of developing needs, ranging from... GENETIC COUNSELING What Is Genetic Counseling? The National Society of Genetic Counselors (NSGC) defines genetic counseling as the process of assisting people with understanding and adapting to the medical, psychological, and familial implications...

Stough, Laura

2014-01-01

397

Integrating Phylodynamics and Epidemiology to Estimate Transmission Diversity in Viral Epidemics  

PubMed Central

The epidemiology of chronic viral infections, such as those caused by Hepatitis C Virus (HCV) and Human Immunodeficiency Virus (HIV), is affected by the risk group structure of the infected population. Risk groups are defined by each of their members having acquired infection through a specific behavior. However, risk group definitions say little about the transmission potential of each infected individual. Variation in the number of secondary infections is extremely difficult to estimate for HCV and HIV but crucial in the design of efficient control interventions. Here we describe a novel method that combines epidemiological and population genetic approaches to estimate the variation in transmissibility of rapidly-evolving viral epidemics. We evaluate this method using a nationwide HCV epidemic and for the first time co-estimate viral generation times and superspreading events from a combination of molecular and epidemiological data. We anticipate that this integrated approach will form the basis of powerful tools for describing the transmission dynamics of chronic viral diseases, and for evaluating control strategies directed against them. PMID:23382662

Magiorkinis, Gkikas; Sypsa, Vana; Magiorkinis, Emmanouil; Paraskevis, Dimitrios; Katsoulidou, Antigoni; Belshaw, Robert; Fraser, Christophe; Pybus, Oliver George; Hatzakis, Angelos

2013-01-01

398

Respiratory viral infections in children with asthma: do they matter and can we prevent them?  

PubMed Central

Background Asthma is a major public health problem with a huge social and economic burden affecting 300 million people worldwide. Viral respiratory infections are the major cause of acute asthma exacerbations and may contribute to asthma inception in high risk young children with susceptible genetic background. Acute exacerbations are associated with decreased lung growth or accelerated loss of lung function and, as such, add substantially to both the cost and morbidity associated with asthma. Discussion While the importance of preventing viral infection is well established, preventive strategies have not been well explored. Good personal hygiene, hand-washing and avoidance of cigarette smoke are likely to reduce respiratory viral infections. Eating a healthy balanced diet, active probiotic supplements and bacterial-derived products, such as OM-85, may reduce recurrent infections in susceptible children. There are no practical anti-viral therapies currently available that are suitable for widespread use. Summary Hand hygiene is the best measure to prevent the common cold. A healthy balanced diet, active probiotic supplements and immunostimulant OM-85 may reduce recurrent infections in asthmatic children. PMID:22974166

2012-01-01

399

The combined effect of environmental and host factors on the emergence of viral RNA recombinants.  

PubMed

Viruses are masters of evolution due to high frequency mutations and genetic recombination. In spite of the significance of viral RNA recombination that promotes the emergence of drug-resistant virus strains, the role of host and environmental factors in RNA recombination is poorly understood. Here we report that the host Met22p/Hal2p bisphosphate-3'-nucleotidase regulates the frequency of viral RNA recombination and the efficiency of viral replication. Based on Tomato bushy stunt virus (TBSV) and yeast as a model host, we demonstrate that deletion of MET22 in yeast or knockdown of AHL, SAL1 and FRY1 nucleotidases/phosphatases in plants leads to increased TBSV recombination and replication. Using a cell-free TBSV recombination/replication assay, we show that the substrate of the above nucleotidases, namely 3'-phosphoadenosine-5'-phosphate pAp, inhibits the activity of the Xrn1p 5'-3' ribonuclease, a known suppressor of TBSV recombination. Inhibition of the activity of the nucleotidases by LiCl and NaCl also leads to increased TBSV recombination, demonstrating that environmental factors could also affect viral RNA recombination. Thus, host factors in combination with environmental factors likely affect virus evolution and adaptation. PMID:20975943

Jaag, Hannah M; Nagy, Peter D

2010-01-01

400

Characterization of the Viral Microbiome in Patients with Severe Lower Respiratory Tract Infections, Using Metagenomic Sequencing  

PubMed Central

The human respiratory tract is heavily exposed to microorganisms. Viral respiratory tract pathogens, like RSV, influenza and rhinoviruses cause major morbidity and mortality from respiratory tract disease. Furthermore, as viruses have limited means of transmission, viruses that cause pathogenicity in other tissues may be transmitted through the respiratory tract. It is therefore important to chart the human virome in this compartment. We have studied nasopharyngeal aspirate samples submitted to the Karolinska University Laboratory, Stockholm, Sweden from March 2004 to May 2005 for diagnosis of respiratory tract infections. We have used a metagenomic sequencing strategy to characterize viruses, as this provides the most unbiased view of the samples. Virus enrichment followed by 454 sequencing resulted in totally 703,790 reads and 110,931 of these were found to be of viral origin by using an automated classification pipeline. The snapshot of the respiratory tract virome of these 210 patients revealed 39 species and many more strains of viruses. Most of the viral sequences were classified into one of three major families; Paramyxoviridae, Picornaviridae or Orthomyxoviridae. The study also identified one novel type of Rhinovirus C, and identified a number of previously undescribed viral genetic fragments of unknown origin. PMID:22355331

Lysholm, Fredrik; Wetterbom, Anna; Lindau, Cecilia; Darban, Hamid; Bjerkner, Annelie; Fahlander, Kristina; Lindberg, A. Michael; Persson, Bengt; Allander, Tobias; Andersson, Björn

2012-01-01

401

Characterization of the viral microbiome in patients with severe lower respiratory tract infections, using metagenomic sequencing.  

PubMed

The human respiratory tract is heavily exposed to microorganisms. Viral respiratory tract pathogens, like RSV, influenza and rhinoviruses cause major morbidity and mortality from respiratory tract disease. Furthermore, as viruses have limited means of transmission, viruses that cause pathogenicity in other tissues may be transmitted through the respiratory tract. It is therefore important to chart the human virome in this compartment. We have studied nasopharyngeal aspirate samples submitted to the Karolinska University Laboratory, Stockholm, Sweden from March 2004 to May 2005 for diagnosis of respiratory tract infections. We have used a metagenomic sequencing strategy to characterize viruses, as this provides the most unbiased view of the samples. Virus enrichment followed by 454 sequencing resulted in totally 703,790 reads and 110,931 of these were found to be of viral origin by using an automated classification pipeline. The snapshot of the respiratory tract virome of these 210 patients revealed 39 species and many more strains of viruses. Most of the viral sequences were classified into one of three major families; Paramyxoviridae, Picornaviridae or Orthomyxoviridae. The study also identified one novel type of Rhinovirus C, and identified a number of previously undescribed viral genetic fragments of unknown origin. PMID:22355331

Lysholm, Fredrik; Wetterbom, Anna; Lindau, Cecilia; Darban, Hamid; Bjerkner, Annelie; Fahlander, Kristina; Lindberg, A Michael; Persson, Bengt; Allander, Tobias; Andersson, Björn

2012-01-01

402

Longitudinal studies on maternal HIV-1 variants by biological phenotyping, sequence analysis and viral load.  

PubMed

In this study, the HIV-1 variant viruses from ten pregnant women and their infants were isolated and characterized longitudinally in order to determine the role that viral envelope (gp120-V3 loop) gene variation and viral tropism play in vertical transmission. Biological phenotyping of each HIV variant was accomplished by growth in MT-2, and macrophages from healthy and non-HIV-infected donors. Genetic characterization of the variants was accomplished by DNA sequence analysis. All the women enrolled in this study received ZDV therapy. Virus was cultured from eight out of ten env V3-PCR positive mothers. HIV-1 isolates were all non-syncitium inducing variants. None of the mothers were found to transmit HIV, as determined by DNA PCR and quantitative co-cultures on their infants which were seronegative for HIV-1 through one year after birth. Viral cultures from infant blood samples were negative and infants were all healthy. However, nested env V3-PCR detected proviral DNA in five out of ten infants. In contrast, conventional gag-PCR was negative in the same five infants. Sequences of the five maternal-infant pairs were different, suggesting unique infant HIV-1 variants. The three highest maternal viral load values corresponded to infants that were env V3-PCR positive. These results suggest that HIV-1 particles are transmitted from ZDV-treated mothers to infants. Infant follow up is recommended to determine if HIV-1 has been inhibited by the immune system of the infants. PMID:9449544

Renta, J Y; Cadilla, C L; Vega, M E; Hillyer, G V; Estrada, C; Jiménez, E; Abreu, E; Méndez, I; Gandía, J; Meléndez-Guerrero, L M

1997-11-01

403

Interim report on the genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials. Appendix C. Chemical evaluation of SRC samples for genetic toxicity testing - basic program reports  

Microsoft Academic Search

This Appendix presents the reports submitted by SRI regarding the chemical analyses of 32 samples done in support of the genetic toxicity testing. This chemical characterization provided an analytical signature for comparison, to demonstrate that there had been no gross changes in the nature of the chemicals stored by SRI during their investigations. Both ICRC and SRI considered it important

B. Z. Drozdowicz; C. M. Kelly

1983-01-01

404

Viral genome sequencing by random priming methods  

Microsoft Academic Search

BACKGROUND: Most emerging health threats are of zoonotic origin. For the overwhelming majority, their causative agents are RNA viruses which include but are not limited to HIV, Influenza, SARS, Ebola, Dengue, and Hantavirus. Of increasing importance therefore is a better understanding of global viral diversity to enable better surveillance and prediction of pandemic threats; this will require rapid and flexible

Appolinaire Djikeng; Rebecca Halpin; Ryan Kuzmickas; Jay DePasse; Jeremy Feldblyum; Naomi Sengamalay; Claudio Afonso; Xinsheng Zhang; Norman G Anderson; Elodie Ghedin; David J Spiro

2008-01-01

405

Soluble antigen of bovine viral diarrhea virus  

Microsoft Academic Search

Summary Complement-fixing (CF) soluble antigen (SA) was detectable intra-cellularly prior to the appearance of infectious NADL-MD bovine viral diarrhea (BVD) virus during synthesis in roller flask cultures of bovine embryonic kidney cells. The release of infective virus into the extracellular fluid was concomitant with the release of SA.

Donald E. Gutekunst; Winston A. Malmquist

1965-01-01

406

Characterization of bovine viral diarrhea viruses  

Microsoft Academic Search

Summary Titers in susceptible cell cultures of various strains of bovine viral diarrhea (BVD) viruses after passage through Millipore filters of average pore sizes of 220, 100, 50, and 10 mµ are presented. Multiple freezethaw or sonication treatments did not change the filtration properties of cytopathogenic strains, but they did increase the filterability of noncytopathogenic strains. On the other hand,

A. L. Fernelius

1968-01-01

407

DIARREA VIRAL BOVINA: PATOGÉNESIS E INMUNOPATOLOGÍA  

Microsoft Academic Search

Bovine viral diarrhea (BVD) represents a problem of worldwide causing considerable losses so much in meat livestock as in dairy herds, affecting it in diverse ways, which are subordinated to the age of the animal, immunologic state and moment of gestation, in which the infection takes place. BVD is caused by RNA virus, gender Pestivirus, family Flaviviridae, which has been

Iang Rondón

2006-01-01

408

Lipids in innate anti-viral defense  

PubMed Central

Summary It is becoming apparent that infections by a major class of viruses, those with envelopes, can be inhibited during their entry at the step of fusion with cellular membranes. In this review, we discuss multiple innate immune mechanisms that have evolved to modify the lipid composition of cellular and viral membranes to inhibit virion fusion of enveloped viruses. PMID:24139397

Schoggins, John W.; Randall, Glenn

2013-01-01

409

Antibody Responses during Hepatitis B Viral Infection  

PubMed Central

Hepatitis B is a DNA virus that infects liver cells and can cause both acute and chronic disease. It is believed that both viral and host factors are responsible for determining whether the infection is cleared or becomes chronic. Here we investigate the mechanism of protection by developing a mathematical model of the antibody response following hepatitis B virus (HBV) infection. We fitted the model to data from seven infected adults identified during acute infection and determined the ability of the virus to escape neutralization through overproduction of non-infectious subviral particles, which have HBs proteins on their surface, but do not contain nucleocapsid protein and viral nucleic acids. We showed that viral clearance can be achieved for high anti-HBV antibody levels, as in vaccinated individuals, when: (1) the rate of synthesis of hepatitis B subviral particles is slow; (2) the rate of synthesis of hepatitis B subviral particles is high but either anti-HBV antibody production is fast, the antibody affinity is high, or the levels of pre-existent HBV-specific antibody at the time of infection are high, as could be attained by vaccination. We further showed that viral clearance can be achieved for low equilibrium anti-HBV antibody levels, as in unvaccinated individuals, when a strong cellular immune response controls early infection. PMID:25078553

Ciupe, Stanca M.; Ribeiro, Ruy M.; Perelson, Alan S.

2014-01-01

410

Bovine viral diarrhea virus: biosecurity and control  

Technology Transfer Automated Retrieval System (TEKTRAN)

This paper discusses the recommended procedures involved in setting up biosecurity and control programs designed to limit bovine viral diarrhea virus infections in beef cattle operations. For the purpose of these discussions, a working definition of a biosecurity plan was considered to be an organiz...

411

Foodborne viral illness - status in Australia  

Microsoft Academic Search

Norwalk-like virus contamination of oysters and orange juice, and hepatitis A virus contamination of oysters have been responsible for large outbreaks of foodborne viral disease in Australia. Rotavirus, adenovirus, astrovirus, parvovirus and other enteroviruses also contribute to the incidence of gastroenteritis in this country but the role of foods and waters in transmitting these viruses is unclear. Protocols for the

Graham H Fleet; Paul Heiskanen; Iona Reid; Ken A Buckle

2000-01-01

412

STUDIES OF WATERBORNE AGENTS OF VIRAL GASTROENTERITIS  

EPA Science Inventory

The etiologic agent of a large outbreak of waterborne viral gastroenteritis was detected employing immune electron microscopy (IEM) and a newly developed solid phase radioimmunoassay (RIA). This agent, referred to as the Snow Mountain Agent (SMA), is 27-32 nm. in diameter, has cu...

413

A calcium fortified viral matrix protein  

PubMed Central

Summary In this issue of Structure, Leyrat and colleagues provide the first structural analysis of the HMPV matrix protein, a key regulator of viral assembly. Though structurally similar to other matrix proteins, two calcium binding sites suggest intriguing differences in regulation. PMID:24411575

Amarasinghe, Gaya K.; Dutch, Rebecca Ellis

2014-01-01

414

Viral genome sequencing bt random priming methods  

Technology Transfer Automated Retrieval System (TEKTRAN)

Most emerging health threats are of zoonotic origin. For the overwhelming majority, their causative agents are viruses which include but are not limited to HIV, Influenza, SARS, Ebola, Dengue, and Hantavirus. Of increasing importance therefore is an understanding of the viral diversity to enable b...

415

Exotic emerging viral diseases: progress and challenges  

Microsoft Academic Search

The agents causing viral hemorrhagic fever (VHF) are a taxonomically diverse group of viruses that may share commonalities in the process whereby they produce systemic and frequently fatal disease. Significant progress has been made in understanding the biology of the Ebola virus, one of the best known examples. This knowledge has guided our thinking about other VHF agents, including Marburg,

Thomas W Geisbert; Peter B Jahrling

2004-01-01

416

Viral pathogens of Glassy-winged sharpshooters  

Technology Transfer Automated Retrieval System (TEKTRAN)

A newly discovered viral pathogen to the glassy-winged sharpshooter, GWSS, Homalodisca vitripennis, (Hemiptera: Cicadellidae) was characterized. The virus genome was sequenced, and the path of infection into the leafhopper was determined to be through the midgut tissues. The virus occurs naturally i...

417

Disparities in HIV/AIDS, Viral Hepatitis, STDs, and TB  

MedlinePLUS

... this page: About CDC.gov . Disparities in HIV/AIDS, Viral Hepatitis, STDs, and TB Health Disparities Social ... Islanders LGBT Populations/MSM MMWR Publications HIV and AIDS Viral Hepatitis STDs Tuberculosis Training and Networking Resources ...

418

Viral hybrid-vectors for delivery of autonomous replicons.  

PubMed

Gene therapeutic approaches offer great opportunities to treat genetic diseases which require long-term effects after a single administration of a customized vector. For these specific approaches the optimal vector system should combine the following features: (1) it should efficiently transport the genetic cargo into target cells in vitro or in vivo, (2) it should lead to sufficient long-term expression of the therapeutic transgene, (3) it should not interfere with the expression profile or the composition of the host genome, and (4) it should not result in unwanted side effects such as immune responses or other toxic effects. Predominantly used vectors for maintenance of therapeutic DNA and long-term transgene expression in preclinical and clinical studies are based on integrase-, recombinase-, transposase- or designer nuclease-mediated somatic integration into the host genome. However, for these systems the risk of insertional mutagenesis represents a potential unwanted adverse event. Therefore, autonomously replicating genetic elements were developed and there is accumulating evidence that these episomal vectors which are maintained extrachromosomally are suitable for therapeutic applications in dividing cells. In this review we provide a state-of-the-art overview of used viral hybrid-vectors which efficiently deliver autonomous DNA (plasmid replicon pEPI and Epstein-Barr Virus-based replicons) and RNA replicons (Semliki Forest Virus replicons) into target cells. To date adenoviruses, herpesviruses and baculovirus were explored for efficient delivery of autonomous replicons into various cell types and tissues. Applications and advantages and limitations of these hybrid-vectors are discussed in this review. We believe that with further optimization autonomous replicons may play an increasingly important role in gene therapeutic applications. PMID:24365145

Zhang, Wenli; Hagedorn, Claudia; Schulz, Eric; Lipps, Hans-Joachim; Ehrhardt, Anja

2014-02-01

419

Viral detection using DNA functionalized gold filaments†  

PubMed Central

Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5? [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3? covalently attached to a 5 cm length of a 100 ?m diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 ?m capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 ?L. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

Perez, Jonas W.; Haselton, Frederick R.

2010-01-01

420

Virtual Genetics Education Centre: Genetics for Schools and Colleges  

NSDL National Science Digital Library

This material includes instructional materials on the topics of DNA, genes, chromosomes, the cell cycle, mitosis, meiosis, gene expression, genetics and other related topics. Each topic contains a brief introduction that puts the teaching resources into context. This material has been written for students up to 18 years old and is continually revised to reflect changes and developments in the topic over time. Those topics include developmental genetics, DNA, legal issues, gene expression, and much more.

421

[Bovine viral diarrhea (BVD): from biology to control].  

PubMed

Bovine viral diarrhea virus (BVDV) is endemic worldwide. Together with classical swine fever and border disease viruses, it belongs to the genus Pestivirus of the family Flaviviridae. Most infections with BVDV take a transient, acute, course. Only rarely BVDV persists in its hosts. Due to the early time point of infection in utero, persistently infected (PI) animals are immunotolerant to the infecting non-cytopathic BVDV. In such animals the virus may mutate to a cytopathic biotype, causing lethal mucosal disease. In BVD-endemic regions, approximately 1% of the animals are PI. Removal of all PI animals leads to extinction of BVD. This approach to BVD eradication has been vindicated in Scandinavia. Following the same principles, regional and country-wide eradication programs are run in different parts of the world. These programs differ in the way PI animals are detected and in the role of vaccines. The Scandinavian two-step method of detecting PI animals is based on (i) the high level of seroprevalence in herds where PI animals are present and (ii) on testing all animals for virus in such herds. However, the high average herd seroprevalence in Switzerland made it impossible to define a reasonable threshold for virus testing. Therefore, all animals were directly tested for virus in the year 2008 and all newborn calves until the end of 2012, when the PI prevalence had dropped to 0.02%. Vaccination remains prohibited. Since 2013, surveillance for BVD is accomplished by serology. As a unique consequence of eradication, over 7500 viral strains are available to us for genetic studies. PMID:24511819

Bachofen, Claudia; Stalder, Hanspeter; Vogt, Hans-Rudolf; Wegmüller, Michael; Schweizer, Matthias; Zanoni, Reto; Peterhans, Ernst

2013-01-01

422

The reverse genetics applied to fish RNA viruses  

PubMed Central

Aquaculture has expanded rapidly to become a major economic and food-producing sector worldwide these last 30 years. In parallel, viral diseases have emerged and rapidly spread from farm to farm causing enormous economic losses. The most problematic viruses encountered in the field are mainly, but not exclusively, RNA viruses belonging to the Novirhabdovirus, Aquabirnavirus, Alphavirus and Betanodavirus genera. The recent establishment of reverse genetics systems to recover infectious fish RNA viruses entirely from cDNA has made possible to genetically manipulate the viral genome. These systems have provided powerful tools to study all aspects of the virus biology and virus-host interactions but also gave the opportunity to use these viruses as live vaccines or as gene vectors. This review provides an overview on the recent breakthroughs achieved by using these reverse genetics systems in terms of viral protein function, virulence and host-specificity factor, vaccine development and vector design. PMID:21314978

2011-01-01

423

[HCMV infections after hematopoietic stem cell transplantation--diagnostic methods and importance of viral DNA level monitoring].  

PubMed

HCMV infection is very common. The virus infects 30-90% of population. In immunocompromised patients effective elimination of the virus by immune system is limited by immunosuppressive therapy. Active hCMV infection after HSCT can lead to severe posttransplant complications, graft failure or even death. In addition to direct effects of hCMV infection the virus can cause indirect effects in transplant recipients such as increased immunosuppression or GvHD development/progression. Laboratory diagnostic of hCMV infections after HSCT is now routinely used. Fast and sensitive molecular methods that detect hCMV genetic material are found particularly useful. Quantitative methods, such as R-T PCR, enable identification of patients at high risk of developing hCMV disease and fast employment of appropriate prophylaxis or treatment. Moreover it allows precise monitoring of treatment efficiency and facilitates therapy - related decisions. In last years pre-emptive therapy, which depends on viral load molecular monitoring, significantly reduced morbidity and mortality of active hCMV infections in HSCT recipients. Selective prophylaxis approach enables reduction of patients treated with toxic antiviral therapy which is associated with delayed restoration of virus - specific immune response. Occurrence of symptomatic hCMV disease is still associated with high mortality among HSCT recipients. HCMV infection diagnosis requires further development. Quantitative methods should be unified and optimized. PMID:25720612

Bocian, Joanna; Januszkiewicz-Lewandowska, Danuta

2015-01-01

424

Review article Cytopathic bovine viral diarrhea viruses (BVDV)  

E-print Network

Review article Cytopathic bovine viral diarrhea viruses (BVDV): emerging pestiviruses doomed December 2009; accepted 2 March 2010) Abstract ­ Bovine viral diarrhea virus (BVDV), a Flaviviridae, 88]. In this context, labeling bovine viral diarrhea virus (BVDV) as ``emerging'' may seem to be out

Paris-Sud XI, Université de

425

Aetiology of viral central nervous system infection, a Malaysian study  

Microsoft Academic Search

Over 100 viruses are known to cause acute viral encephalitis in human. In order to diagnose a viral central nervous system infection, various laboratory diagnosis methods have been used. In this study, we examined 220 cerebrospinal fluid samples that were received at the Diagnostic Virology Laboratory of University Malaya Medical Centre between year 2004 to 2006, by viral isolation, pathogen

Yean Kong Yong; Heng Thay Chong; Kum Thong Wong; Chong Tin Tan; Shamala Devi

426

Viral ion channels: structure and function Wolfgang B. Fischer a;  

E-print Network

Review Viral ion channels: structure and function Wolfgang B. Fischer a; *, Mark S.P. Sansom b Viral ion channels are short auxiliary membrane proteins with a length of ca. 100 amino acids, Phycodnaviridae), a Kþ selective ion channel has been discovered. The viral channels form homo oligomers to allow

Fischer, Wolfgang

427

Why pass on viral messages? Because they connect emotionally  

Microsoft Academic Search

In this article, we identify that successful viral marketing campaigns trigger an emotional response in recipients. Working under this premise, we examine the effects of viral messages containing the six primary emotions (surprise, joy, sadness, anger, fear, and disgust) on recipients' emotional responses to viral marketing campaigns and subsequent forwarding behavior. According to our findings, in order to be effective,

Angela Dobele; Adam Lindgreen; Michael Beverland; Joëlle Vanhamme; Robert van Wijk

2007-01-01

428

Viral marketing for dedicated customers Cheng Long a,n  

E-print Network

. & 2014 Elsevier Ltd. All rights reserved. 1. Introduction Viral marketing is an advertising strategy network to propagate the awareness of products. Specifically, viral marketing first targets a limited] do, viral marketing targets a limited number of initial users (by providing incentives) and utilizes

Wong, Raymond Chi-Wing

429

Intercompartmental Recombination of HIV-1 Contributes to env Intrahost Diversity and Modulates Viral Tropism and Sensitivity to Entry Inhibitors?†‡  

PubMed Central

HIV-1 circulates within an infected host as a genetically heterogeneous viral population. Viral intrahost diversity is shaped by substitutional evolution and recombination. Although many studies have speculated that recombination could have a significant impact on viral phenotype, this has never been definitively demonstrated. We report here phylogenetic and subsequent phenotypic analyses of envelope genes obtained from HIV-1 populations present in different anatomical compartments. Assessment of env compartmentalization from immunologically discrete tissues was assessed utilizing a single genome amplification approach, minimizing in vitro-generated artifacts. Genetic compartmentalization of variants was frequently observed. In addition, multiple incidences of intercompartment recombination, presumably facilitated by low-level migration of virus or infected cells between different anatomic sites and coinfection of susceptible cells by genetically divergent strains, were identified. These analyses demonstrate that intercompartment recombination is a fundamental evolutionary mechanism that helps to shape HIV-1 env intrahost diversity in natural infection. Analysis of the phenotypic consequences of these recombination events showed that genetic compartmentalization often correlates with phenotypic compartmentalization and that intercompartment recombination results in phenotype modulation. This represents definitive proof that recombination can generate novel combinations of phenotypic traits which differ subtly from those of parental strains, an important phenomenon that may have an impact on antiviral therapy and contribute to HIV-1 persistence in vivo. PMID:21471230

Brown, Richard J. P.; Peters, Paul J.; Caron, Catherine; Gonzalez-Perez, Maria Paz; Stones, Leanne; Ankghuambom, Chiambah; Pondei, Kemebradikumo; McClure, C. Patrick; Alemnji, George; Taylor, Stephen; Sharp, Paul M.; Clapham, Paul R.; Ball, Jonathan K.

2011-01-01

430

Primer on molecular genetics  

SciTech Connect

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

Not Available

1992-04-01

431

Mendelian Genetics  

NSDL National Science Digital Library

Comprehensive presentation of Mendelian genetics enhanced with schematic diagrams and color photos. A sidebar of topics includes Variations to Mendel's First Law, Pedigree Analysis, Mendel's Second Law, Pleiotropy, Epistasis, Modifier Genes, Penetrance and Expressivity, Study Questions, Mendelian Genetics Overheads, Mendelian Genetics WWW Links Genetic Topics

Phillip McClean

2000-01-01

432

Construction of a "mutagenesis cartridge" for poliovirus genome-linked viral protein: isolation and characterization of viable and nonviable mutants.  

PubMed Central

By following a strategy of genetic analysis of poliovirus, we have constructed a synthetic "mutagenesis cartridge" spanning the genome-linked viral protein coding region and flanking cleavage sites in an infectious cDNA clone of the type 1 (Mahoney) genome. The insertion of new restriction sites within the infectious clone has allowed us to replace the wild-type sequences with short complementary pairs of synthetic oligonucleotides containing various mutations. A set of mutations have been made that create methionine codons within the genome-linked viral protein region. The resulting viruses have growth characteristics similar to wild type. Experiments that led to an alteration of the tyrosine residue responsible for the linkage to RNA have resulted in nonviable virus. In one mutant, proteolytic processing assayed in vitro appeared unimpaired by the mutation. We suggest that the position of the tyrosine residue is important for genome-linked viral protein function(s). Images PMID:2829191

Kuhn, R J; Tada, H; Ypma-Wong, M F; Dunn, J J; Semler, B L; Wimmer, E

1988-01-01

433

Usp18 Driven Enforced Viral Replication in Dendritic Cells Contributes to Break of Immunological Tolerance in Autoimmune Diabetes  

PubMed Central

Infection with viruses carrying cross-reactive antigens is associated with break of immunological tolerance and induction of autoimmune disease. Dendritic cells play an important role in this process. However, it remains unclear why autoimmune-tolerance is broken during virus infection, but usually not during exposure to non-replicating cross-reactive antigens. Here we show that antigen derived from replicating virus but not from non-replicating sources undergoes a multiplication process in dendritic cells in spleen and lymph nodes. This enforced viral replication was dependent on Usp18 and was essential for expansion of autoreactive CD8+ T cells. Preventing enforced virus replication by depletion of CD11c+ cells, genetically deleting Usp18, or pharmacologically inhibiting of viral replication blunted the expansion of autoreactive CD8+ T cells and prevented autoimmune diabetes. In conclusion, Usp18-driven enforced viral replication in dendritic cells can break immunological tolerance and critically influences induction of autoimmunity. PMID:24204252

Zhang, Dong-Er; Iliakis, George; Xu, Haifeng C.; Häussinger, Dieter; Recher, Mike; Löhning, Max

2013-01-01

434

A model freed from endogenous reference gene for quantification of genetically modified DNA by real-time PCR. 1. Quantification of DNA from genetically modified organisms in haplo-species materials  

Microsoft Academic Search

This paper is the first part of a serial study investigating a quantification model freed from endogenous reference gene for\\u000a genetically modified (GM) content by real-time polymerase chain reaction (PCR). The serial study involves two parts: (1) quantitative\\u000a determination of GM DNA in haplo-species plant samples; (2) quantitative determination of GM DNA in multi-species plant samples.\\u000a The paper describes a

Pingjian Deng; Dongyan Yang; Yongcun Yang; Xiaoke Yang; Liangrang Guo; Xiangyang Zhou; Xueling Wang

2008-01-01

435

Gene transfer from genetically modified food  

Microsoft Academic Search

The current debate about the safety of genetically modified food includes some important scientific issues where more scientific data would aid the robustness of safety evaluation. One example is the possibility of gene transfer, especially from genetically modified plant material.

Michael J Gasson

2000-01-01

436

Discovery of Cationic Polymers for Non-viral Gene Delivery using Combinatorial Approaches  

PubMed Central

Gene therapy is an attractive treatment option for diseases of genetic origin, including several cancers and cardiovascular diseases. While viruses are effective vectors for delivering exogenous genes to cells, concerns related to insertional mutagenesis, immunogenicity, lack of tropism, decay and high production costs necessitate the discovery of non-viral methods. Significant efforts have been focused on cationic polymers as non-viral alternatives for gene delivery. Recent studies have employed combinatorial syntheses and parallel screening methods for enhancing the efficacy of gene delivery, biocompatibility of the delivery vehicle, and overcoming cellular level barriers as they relate to polymer-mediated transgene uptake, transport, transcription, and expression. This review summarizes and discusses recent advances in combinatorial syntheses and parallel screening of cationic polymer libraries for the discovery of efficient and safe gene delivery systems. PMID:21843141

Barua, Sutapa; Ramos, James; Potta, Thrimoorthy; Taylor, David; Huang, Huang-Chiao; Montanez, Gabriela; Rege, Kaushal

2015-01-01

437

An Integrated Map of HIV-Human Protein Complexes that Facilitate Viral Infection  

PubMed Central

Recent proteomic and genetic studies have aimed to identify a complete network of interactions between HIV and human proteins and genes. This HIV-human interaction network provides invaluable information as to how HIV exploits the host machinery and can be used as a starting point for further functional analyses. We integrated this network with complementary datasets of protein function and interaction to nominate human protein complexes with likely roles in viral infection. Based on our approach we identified a global map of 40 HIV-human protein complexes with putative roles in HIV infection, some of which are involved in DNA replication and repair, transcription, translation, and cytoskeletal regulation. Targeted RNAi screens were used to validate several proteins and complexes for functional impact on viral infection. Thus, our HIV-human protein complex map provides a significant resource of potential HIV-host interactions for further study. PMID:24817247

Emig-Agius, Dorothea; Olivieri, Kevin; Pache, Lars; Shih, Hsin Ling; Pustovalova, Olga; Bessarabova, Marina; Young, John A. T.; Chanda, Sumit K.; Ideker, Trey

2014-01-01

438

RAPD-based Analysis of Genetic Diversity and Selection of Lingonberry ( Vaccinium vitis-idaea L.) Material for ex situ Conservation  

Microsoft Academic Search

Random amplified polymorphic DNA markers were used to assess relatedness and genetic diversity for 15 lingonberry (Vaccinium vitis-idaea) populations. Seven primers yielding 59 polymorphic bands were used to analyse 13 populations, representing ssp. vitis-idaea from Sweden, Finland, Norway, Estonia and Russia, and two populations, representing ssp. minus from Japan and Canada. A cluster analysis and a multidimensional scaling analysis (MDS)

L. Garkava-Gustavsson; H. A. Persson; H. Nybom; K. Rumpunen; B. A. Gustavsson; I. V. Bartish

2005-01-01

439

Integrating Bacterial and Viral Water Quality Assessment to Predict Swimming-Associated Illness at a Freshwater Beach: A Cohort Study  

PubMed Central

Background & Objective Recreational waters impacted by fecal contamination have been linked to gastrointestinal illness in swimmer populations. To date, few epidemiologic studies examine the risk for swimming-related illnesses based upon simultaneous exposure to more than one microbial surrogate (e.g. culturable E. coli densities, genetic markers). We addressed this research gap by investigating the association between swimming-related illness frequency and water quality determined from multiple bacterial and viral genetic markers. Methods Viral and bacterial genetic marker densities were determined from beach water samples collected over 23 weekend days and were quantified using quantitative polymerase chain reaction (qPCR). These genetic marker data were paired with previously determined human exposure data gathered as part of a cohort study carried out among beach users at East Fork Lake in Ohio, USA in 2009. Using previously unavailable genetic marker data in logistic regression models, single- and multi-marker/multi-water quality indicator approaches for predicting swimming-related illness were evaluated for associations with swimming-associated gastrointestinal illness. Results Data pertaining to genetic marker exposure and 8- or 9-day health outcomes were available for a total of 600 healthy susceptible swimmers, and with this population we observed a significant positive association between human adenovirus (HAdV) exposure and diarrhea (odds ratio ?=?1.6; 95% confidence interval: 1.1–2.3) as well as gastrointestinal illness (OR ?=?1.5; 95% CI: 1.0–2.2) upon adjusting for culturable E. coli densities in multivariable models. No significant associations between bacterial genetic markers and swimming-associated illness were observed. Conclusions This study provides evidence that a combined measure of recreational water quality that simultaneously considers both bacterial and viral densities, particularly HAdV, may improve prediction of disease risk than a measure of a single agent in a beach environment likely influenced by nonpoint source human fecal contamination. PMID:25409012

Marion, Jason W.; Lee, Cheonghoon; Lee, Chang Soo; Wang, Qiuhong; Lemeshow, Stanley; Buckley, Timothy J.; Saif, Linda J.; Lee, Jiyoung

2014-01-01

440

Viral aetiology influenza like illnesses in Santa Cruz, Bolivia (2010–2012)  

PubMed Central

Background Acute respiratory infections represent a serious public health issue worldwide but virological aetiologies of Influenza Like Illnesses (ILIs) remain largely unknown in developing countries. This study represents the first attempt to characterise viral aetiologies of ILIs in Bolivia. Methods It was performed in Santa Cruz city from January 2010 to September 2012, based on 564 naso-pharyngeal swabs collected in a National Reference Laboratory and real-time PCR techniques, viral cultures and phylogenetic analyses. Results 50.2% of samples were positive for at least one virus with influenza viruses (Flu A: ~15%; Flu B: ~9%), rhinoviruses (~8%), coronaviruses (~5%) and hRSV (~4%) being the most frequently identified. The pattern of viral infections varied according to age groups. The elucidation rate was the highest (>60%) amongst patients under 10 yo and the lowest (<40%) amongst patients ?60 yo. Nearly 3% of samples showed dual viral infections. Epidemiological peaks were associated with a predominant virus but generally included 30-50% of infections by different viruses. Unexpectedly, the frequency of influenza in the 0–4 yo population was very low and a complete hRSV eclipse occurred in 2011. Genetic analyses indicated that distinct evolutionary lineages of Flu A(H1N1)pdm2009, Flu A/H3N2 and Flu B have co-circulated in Bolivia in the study period, originating from Central and North America, Europe, Asia and Australia. Conclusion Our results emphasise the requirement for a reinforced epidemiological and genetic follow-up of influenza and other ILIs in Bolivia to further inform the preparation of vaccines used in the region, guide vaccination campaigns and improve the medical management of patients. PMID:24564892

2014-01-01