Note: This page contains sample records for the topic viral genetic material from Science.gov.
While these samples are representative of the content of Science.gov,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of Science.gov
to obtain the most current and comprehensive results.
Last update: November 12, 2013.
1

Viral tracing of genetically defined neural circuitry.  

PubMed

Classical methods for studying neuronal circuits are fairly low throughput. Transsynaptic viruses, particularly the pseudorabies (PRV) and rabies virus (RABV), and more recently vesicular stomatitis virus (VSV), for studying circuitry, is becoming increasingly popular. These higher throughput methods use viruses that transmit between neurons in either the anterograde or retrograde direction. Recently, a modified RABV for monosynaptic retrograde tracing was developed. (Figure 1A). In this method, the glycoprotein (G) gene is deleted from the viral genome, and resupplied only in targeted neurons. Infection specificity is achieved by substituting a chimeric G, composed of the extracellular domain of the ASLV-A glycoprotein and the cytoplasmic domain of the RABV-G (A/RG), for the normal RABV-G(1). This chimeric G specifically infects cells expressing the TVA receptor(1). The gene encoding TVA can been delivered by various methods(2-8). Following RABV-G infection of a TVA-expressing neuron, the RABV can transmit to other, synaptically connected neurons in a retrograde direction by nature of its own G which was co-delivered with the TVA receptor. This technique labels a relatively large number of inputs (5-10%)(2) onto a defined cell type, providing a sampling of all of the inputs onto a defined starter cell type. We recently modified this technique to use VSV as a transsynaptic tracer(9). VSV has several advantages, including the rapidity of gene expression. Here we detail a new viral tracing system using VSV useful for probing microcircuitry with increased resolution. While the original published strategies by Wickersham et al.(4) and Beier et al.(9) permit labeling of any neurons that project onto initially-infected TVA-expressing-cells, here VSV was engineered to transmit only to TVA-expressing cells (Figure 1B). The virus is first pseudotyped with RABV-G to permit infection of neurons downstream of TVA-expressing neurons. After infecting this first population of cells, the virus released can only infect TVA-expressing cells. Because the transsynaptic viral spread is limited to TVA-expressing cells, presence of absence of connectivity from defined cell types can be explored with high resolution. An experimental flow chart of these experiments is shown in Figure 2. Here we show a model circuit, that of direction-selectivity in the mouse retina. We examine the connectivity of starburst amacrine cells (SACs) to retinal ganglion cells (RGCs). PMID:23117695

Beier, Kevin; Cepko, Constance

2012-10-17

2

Genetic Heterogeneity of Bovine Viral Diarrhoea Virus In Italy  

Microsoft Academic Search

The genetic characteristics, of 38 field isolates of bovine viral diarrhoea virus (BVDV) collected in 1999 from sick or healthy and persistently infected cattle of dairy farms situated in northern Italy, were investigated. A partial 5'-untranslated region (5'-UTR) sequence of each isolate was determined and a phylogenetic analysis was performed. All the isolates were classified as belonging to the BVDV-1

E. Falcone; P. Cordioli; M. Tarantino; M. Muscillo; G. La Rosa; M. Tollis

2003-01-01

3

Genetic typing of bovine viral diarrhea virus isolates from Argentina  

Microsoft Academic Search

Genetic typing of 29 Bovine Viral Diarrhea Virus (BVDV) isolates from Argentina was carried out by sequencing 245 nucleotides of the RT-PCR products of the 5?-UTR region. Sequence analysis shows that these Argentinean BVDV include types 1 and 2. The majority (26\\/29) of the isolates are type 1, which comprises subtypes 1a and 1b, together with an additional subgroup within

Leandro R Jones; Rubén Zandomeni; E. Laura Weber

2001-01-01

4

Viral hit and run-oncogenesis: genetic and epigenetic scenarios.  

PubMed

It is well documented that viral genomes either inserted into the cellular DNA or co-replicating with it in episomal form can be lost from neoplastic cells. Therefore, "hit and run"-mechanisms have been a topic of longstanding interest in tumor virology. The basic idea is that the transient acquisition of a complete or incomplete viral genome may be sufficient to induce malignant conversion of host cells in vivo, resulting in neoplastic development. After eliciting a heritable change in the gene expression pattern of the host cell (initiation), the genomes of tumor viruses may be completely lost, i.e. in a hit and run-scenario they are not necessary for the maintenance of the malignant state. The expression of viral oncoproteins and RNAs may interfere not only with regulators of cell proliferation, but also with DNA repair mechanisms. DNA recombinogenic activities induced by tumor viruses or activated by other mechanisms may contribute to the secondary loss of viral genomes from neoplastic cells. Viral oncoproteins can also cause epigenetic dysregulation, thereby reprogramming cellular gene expression in a heritable manner. Thus, we expect that epigenetic scenarios of viral hit and run-tumorigenesis may facilitate new, innovative experiments and clinical studies in spite of the fact that the regular presence of a suspected human tumor virus in an early phase of neoplastic development and its subsequent regular loss have not been demonstrated yet. We propose that virus-specific "epigenetic signatures", i.e. alterations of the host cell epigenome, especially altered DNA methylation patterns, may help to identify viral hit and run-oncogenic events, even after the complete loss of tumor viruses from neoplastic cells. PMID:20813452

Niller, Hans Helmut; Wolf, Hans; Minarovits, Janos

2010-09-01

5

Genetic and antigenic variability in bovine viral diarrhea virus (BVDV) isolates from Belgium  

Microsoft Academic Search

This report describes the genetic and antigenic variability of bovine viral diarrhea virus strains isolated in Belgium. Part of the 5? untranslated region and the 5? end of the gp53 (E2) coding sequence were amplified by PCR and sequenced. Phylogenetic analysis showed that most field isolates segregated into genotypes Ib or II. Only one out of 28 field isolates belonged

B. Couvreur; C. Letellier; A. Collard; P. Quenon; P. Dehan; C. Hamers; P.-P. Pastoret; P. Kerkhofs

2002-01-01

6

Ownership of genetic material and information.  

PubMed

As a result of the International Human Genome Project genetic information is rapidly multiplying. To avoid some of the problems regarding the availability and use of genetic information, it is sometimes suggested to apply the concept of ownership. This article focuses on the clarification of the status of genetic material and genetic information, obtained as a result of screening and counseling of individual patients. First, some philosophical theories of ownership are examined for a justification of the use of the concept of ownership with regard to the human body. Next, arguments with regard to ownership of the human body are examined. The results of this analysis are applied to genetic material and genetic information. PMID:9203271

de Witte, J I; ten Have, H

1997-07-01

7

Genetic variability and viral seroconversion in an outcrossing vertebrate population  

PubMed Central

Inverse correlations between genetic variability and parasitism are important concerns for conservation biologists. We examined correlations between neutral genetic variability and the presence of antibodies to canine distemper virus (CDV) and feline parvovirus (FPV) in a free-ranging population of raccoons. Over 3 years there was a strong relationship between age and seroprevalence rates. Most young animals were seronegative to CDV and FPV, but the oldest age class was greater than 80 per cent seropositive to both viruses. CDV-seropositive animals had greater heterozygosity and lower measures of inbreeding compared with CDV-seronegative animals. This relationship was strongest among the youngest animals and did not occur during a 1 year CDV epidemic. In contrast, FPV-seropositive animals only had significantly lower measures of inbreeding in 1 year, perhaps because FPV-associated mortality is relatively low or primarily occurs among very young individuals that were under-represented in our sampling. These results suggest that even in large outcrossing populations, animals with lower heterozygosity and higher measures of inbreeding are less likely to successfully mount an immune response when challenged by highly pathogenic parasites.

Gompper, Matthew E.; Monello, Ryan J.; Eggert, Lori S.

2011-01-01

8

Genetic variability and viral seroconversion in an outcrossing vertebrate population.  

PubMed

Inverse correlations between genetic variability and parasitism are important concerns for conservation biologists. We examined correlations between neutral genetic variability and the presence of antibodies to canine distemper virus (CDV) and feline parvovirus (FPV) in a free-ranging population of raccoons. Over 3 years there was a strong relationship between age and seroprevalence rates. Most young animals were seronegative to CDV and FPV, but the oldest age class was greater than 80 per cent seropositive to both viruses. CDV-seropositive animals had greater heterozygosity and lower measures of inbreeding compared with CDV-seronegative animals. This relationship was strongest among the youngest animals and did not occur during a 1 year CDV epidemic. In contrast, FPV-seropositive animals only had significantly lower measures of inbreeding in 1 year, perhaps because FPV-associated mortality is relatively low or primarily occurs among very young individuals that were under-represented in our sampling. These results suggest that even in large outcrossing populations, animals with lower heterozygosity and higher measures of inbreeding are less likely to successfully mount an immune response when challenged by highly pathogenic parasites. PMID:20667873

Gompper, Matthew E; Monello, Ryan J; Eggert, Lori S

2010-07-28

9

Effects of Route of Inoculation and Viral Genetic Variation on Antibody Responses to Polyomavirus SV40 in Syrian Golden Hamsters  

PubMed Central

Genetic variants of polyomavirus SV40 are powerful agents with which to define viral effects on cells and carcinogenesis pathways. We hypothesized that differences in biologic variation among viral strains affect the process of viral infection and are reflected in antibody responses to the viral nonstructural large T-antigen (TAg) protein but not in neutralizing antibody responses against the inoculated viral particles. We analyzed the production of TAg antibody and neutralizing antibody in Syrian golden hamsters that were inoculated with SV40 viral strains by intracardiac, intravenous, or intraperitoneal routes and remained tumor free. Compared with the intraperitoneal route, intravascular (that is, intravenous, intracardiac) inoculation resulted in increased frequency of responsiveness to TAg but not in higher TAg antibody titers. The intravascular route was superior both for eliciting neutralizing antibody responses and for higher titers of those responses. Viruses with complex regulatory regions induced TAg antibody more often than did viruses with simple regulatory regions after intraperitoneal but not intravascular injections, with no differences in antibody titers. This viral genetic variation had no effect on neutralizing antibody production after intraperitoneal or intravascular inoculations or on neutralizing antibody titers achieved. These findings confirm that SV40 variants differ in their biologic properties. Route of inoculation combined with viral genetic variation significantly influence the development of serum antibodies to SV40 TAg in tumor-free hamsters. Route of inoculation—but not viral genetic variation—is an important factor in production of neutralizing antibody to SV40.

Swain, Jody L; Sroller, Vojtech; Wong, Connie; Zhang, Shaojie; Halvorson, Steven J; Herron, Alan J; Kozinetz, Claudia A; Butel, Janet S

2012-01-01

10

Genetic disruption of KSHV major latent nuclear antigen LANA enhances viral lytic transcriptional program  

SciTech Connect

Following primary infection, KSHV establishes a lifelong persistent latent infection in the host. The mechanism of KSHV latency is not fully understood. The latent nuclear antigen (LANA or LNA) encoded by ORF73 is one of a few viral genes expressed during KSHV latency, and is consistently detected in all KSHV-related malignancies. LANA is essential for KSHV episome persistence, and regulates the expression of viral lytic genes through epigenetic silencing, and inhibition of the expression and transactivation function of the key KSHV lytic replication initiator RTA (ORF50). In this study, we used a genetic approach to examine the role of LANA in regulating KSHV lytic replication program. Deletion of LANA did not affect the expression of its adjacent genes vCyclin (ORF72) and vFLIP (ORF71). In contrast, the expression levels of viral lytic genes including immediate-early gene RTA, early genes MTA (ORF57), vIL-6 (ORF-K2) and ORF59, and late gene ORF-K8.1 were increased before and after viral lytic induction with 12-O-tetradecanoyl-phorbol-13-acetate and sodium butyrate. This enhanced expression of viral lytic genes was also observed following overexpression of RTA with or without simultaneous chemical induction. Consistent with these results, the LANA mutant cells produced more infectious virions than the wild-type virus cells did. Furthermore, genetic repair of the mutant virus reverted the phenotypes to those of wild-type virus. Together, these results have demonstrated that, in the context of viral genome, LANA contributes to KSHV latency by regulating the expression of RTA and its downstream genes.

Li Qiuhua [Tumor Virology Program, Greehey Children's Cancer Research Institute, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Microbiology and Immunology, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Zhou Fuchun; Ye Fengchun [Tumor Virology Program, Greehey Children's Cancer Research Institute, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Pediatrics, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Gao Shoujiang [Tumor Virology Program, Greehey Children's Cancer Research Institute, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Pediatrics, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Microbiology and Immunology, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Medicine, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Department of Molecular Medicine, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Cancer Therapy and Research Center, University of Texas Health Science Center at San Antonio, 8403 Floyd Curl Drive, San Antonio, TX 78229 (United States); Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, 44 Xiaohongshan, Wuhan (China)], E-mail: gaos@uthscsa.edu

2008-09-30

11

Viral Genome Segmentation Can Result from a Trade-Off between Genetic Content and Particle Stability  

PubMed Central

The evolutionary benefit of viral genome segmentation is a classical, yet unsolved question in evolutionary biology and RNA genetics. Theoretical studies anticipated that replication of shorter RNA segments could provide a replicative advantage over standard size genomes. However, this question has remained elusive to experimentalists because of the lack of a proper viral model system. Here we present a study with a stable segmented bipartite RNA virus and its ancestor non-segmented counterpart, in an identical genomic nucleotide sequence context. Results of RNA replication, protein expression, competition experiments, and inactivation of infectious particles point to a non-replicative trait, the particle stability, as the main driver of fitness gain of segmented genomes. Accordingly, measurements of the volume occupation of the genome inside viral capsids indicate that packaging shorter genomes involves a relaxation of the packaging density that is energetically favourable. The empirical observations are used to design a computational model that predicts the existence of a critical multiplicity of infection for domination of segmented over standard types. Our experiments suggest that viral segmented genomes may have arisen as a molecular solution for the trade-off between genome length and particle stability. Genome segmentation allows maximizing the genetic content without the detrimental effect in stability derived from incresing genome length.

Ojosnegros, Samuel; Garcia-Arriaza, Juan; Escarmis, Cristina; Manrubia, Susanna C.; Perales, Celia; Arias, Armando; Mateu, Mauricio Garcia; Domingo, Esteban

2011-01-01

12

Bovine viral diarrhoea virus genotype 1 can be separated into at least eleven genetic groups  

Microsoft Academic Search

Summary.  ?Seventy-eight bovine viral diarrhoea viruses (BVDV) recently collected in Austria, France, Hungary, Italy, Slovakia, Spain\\u000a and UK were genetically typed in the 5?-untranslated (5?UTR) and autoprotease (Npro) regions of the pestivirus genome. Seventy-six of the isolates were BVDV-1 and two French isolates were of the BVDV-2 genotype.\\u000a Phylogenetic analysis of the 5?UTR (245?nt), including additional BVDV-1 sequences from USA, Canada,

Š. Vil?ek; D. J. Paton; B. Durkovic; L. Strojny; G. Ibata; A. Moussa; A. Loitsch; W. Rossmanith; S. Vega; M. T. Scicluna; V. Palfi

2001-01-01

13

The Nature of Genetic Material Online Module  

NSDL National Science Digital Library

The Nature of Genetic Material, a new resource from Baylor College of MedicineâÂÂs comprehensive website, BioEd Online, is one module of a three-part, interactive Web-based course called Genes, Health and Society. [The course, which explores the rapidly evolving world of genetics and genomics, can be taken free of charge for professional or personal development. Each module stands alone. Educators can work through the modules in sequence or move freely among them.

Center for Educational Outreach and Center for Collaborative and Interactive Technologies * (Baylor College of Medicine;)

2010-05-27

14

Current challenges to viral load testing in the context of emerging genetic diversity of HIV-1.  

PubMed

Introduction: One of the major characteristics of HIV-1 is its extreme genetic diversity. A key factor in assessing the sensitivity of a molecular-based assay measuring HIV-1 RNA viral load (VL) in plasma is its ability to detect/quantify all (or most of) relevant HIV-1 genetic subtype/recombinant forms accurately. Areas covered: This review provides an overview of the current commercially available quantitative real-time assays (the Abbott RealTime HIV-1, Roche TaqMan HIV-1 versions 1.0 and 2.0, BioMérieux Nuclisens EasyQ HIV-1, Siemens VERSANT HIV-1 RNA 1.0 kinetic PCR, and Biocentric Generic HIV Viral Load assays). For each assay, studies from 2005 to 2010 assessing the impact of HIV-1 genetic diversity on the reliability of HIV-1 RNA quantification are described. Expert opinion: In light of HIV-1 genetic diversity, a general recommendation to favor one test over the other cannot categorically be made. Larger field evaluations of HIV-1 RNA assays should be conducted in areas where HIV-1 genetic diversity is the highest. The large-scale implementation of HIV-1 VL testing is urgently required in the developing world to change HIV infection from a likely death sentence into a manageable chronic infection, as done in Northern countries. PMID:23484497

Rouet, François; Liégeois, Florian; Mouinga-Ondémé, Augustin; Kania, Dramane; Viljoen, Johannes; Wambua, Sammy; Ngo-Giang-Huong, Nicole; Ménan, Hervé; Peeters, Martine; Nerrienet, Eric

2011-03-29

15

A Yeast-Based Genetic System for Functional Analysis of Viral mRNA Capping Enzymes  

PubMed Central

Virus-encoded mRNA capping enzymes are attractive targets for antiviral therapy, but functional studies have been limited by the lack of genetically tractable in vivo systems that focus exclusively on the RNA-processing activities of the viral proteins. Here we have developed such a system by engineering a viral capping enzyme—vaccinia virus D1(1-545)p, an RNA triphosphatase and RNA guanylyltransferase—to function in the budding yeast Saccharomyces cerevisiae in lieu of the endogenous fungal triphosphatase (Cet1p) and guanylyltransferase (Ceg1p). This was accomplished by fusion of D1(1-545)p to the C-terminal guanylyltransferase domain of mammalian capping enzyme, Mce1(211-597)p, which serves as a vehicle to target the viral capping enzyme to the RNA polymerase II elongation complex. An inactivating mutation (K294A) of the mammalian guanylyltransferase active site in the fusion protein had no impact on genetic complementation of cet1?ceg1? cells, thus proving that (i) the viral guanylyltransferase was active in vivo and (ii) the mammalian domain can serve purely as a chaperone to direct other proteins to the transcription complex. Alanine scanning had identified five amino acids of vaccinia virus capping enzyme—Glu37, Glu39, Arg77, Glu192, and Glu194—that are essential for ? phosphate cleavage in vitro. Here we show that the introduction of mutation E37A, R77A, or E192A into the fusion protein abrogates RNA triphosphatase function in vivo. The essential residues are located within three motifs that define a family of viral and fungal metal-dependent phosphohydrolases with a distinctive capacity to hydrolyze nucleoside triphosphates to nucleoside diphosphates in the presence of manganese or cobalt. The acidic residues Glu37, Glu39, and Glu192 likely comprise the metal-binding site of vaccinia virus triphosphatase, insofar as their replacement by glutamine abolishes the RNA triphosphatase and ATPase activities.

Ho, C. Kiong; Martins, Alexandra; Shuman, Stewart

2000-01-01

16

Patenting human genetic material: refocusing the debate  

Microsoft Academic Search

The biotechnology industry has become firmly established over the past twenty years and gene patents have played an important part in this phenomenon. However, concerns have been raised over the patentability of human genetic material, through public protests and international statements, but to little effect. Here we discuss some of these concerns, the patent authorities' response to them, and ways

Timothy Caulfield; E. Richard Gold; Mildred K. Cho

2000-01-01

17

Downstream processing of viral vectors and vaccines  

Microsoft Academic Search

Viral vectors and viral vaccines more and more play an important role in current medical approaches. Gene vectors like adenoviruses, adeno-associated viruses or retroviruses are the vehicles being developed for delivering genetic material to the target cell in gene therapy. Viral vaccines, like attenuated or inactivated rabies virus, influenza virus or hepatitis virus vaccines, are powerful tools to limit the

R Morenweiser

2005-01-01

18

Patenting human genetic material: refocusing the debate  

PubMed Central

The biotechnology industry has become firmly established over the past twenty years and gene patents have played an important part in this phenomenon. However, concerns have been raised over the patentability of human genetic material, through public protests and international statements, but to little effect. Here we discuss some of these concerns, the patent authorities’ response to them, and ways in which to address these issues and to move the debate forward using current legal structures.

Caulfield, Timothy; Gold, E. Richard; Cho, Mildred K.

2008-01-01

19

Viral transduction of the neonatal brain delivers controllable genetic mosaicism for visualising and manipulating neuronal circuits in vivo.  

PubMed

The neonatal intraventricular injection of adeno-associated virus has been shown to transduce neurons widely throughout the brain, but its full potential for experimental neuroscience has not been adequately explored. We report a detailed analysis of the method's versatility with an emphasis on experimental applications where tools for genetic manipulation are currently lacking. Viral injection into the neonatal mouse brain is fast, easy, and accesses regions of the brain including the cerebellum and brainstem that have been difficult to target with other techniques such as electroporation. We show that viral transduction produces an inherently mosaic expression pattern that can be exploited by varying the titer to transduce isolated neurons or densely-packed populations. We demonstrate that the expression of virally-encoded proteins is active much sooner than previously believed, allowing genetic perturbation during critical periods of neuronal plasticity, but is also long-lasting and stable, allowing chronic studies of aging. We harness these features to visualise and manipulate neurons in the hindbrain that have been recalcitrant to approaches commonly applied in the cortex. We show that viral labeling aids the analysis of postnatal dendritic maturation in cerebellar Purkinje neurons by allowing individual cells to be readily distinguished, and then demonstrate that the same sparse labeling allows live in vivo imaging of mature Purkinje neurons at a resolution sufficient for complete analytical reconstruction. Given the rising availability of viral constructs, packaging services, and genetically modified animals, these techniques should facilitate a wide range of experiments into brain development, function, and degeneration. PMID:23347239

Kim, Ji-Yoen; Ash, Ryan T; Ceballos-Diaz, Carolina; Levites, Yona; Golde, Todd E; Smirnakis, Stelios M; Jankowsky, Joanna L

2013-01-24

20

2011 Meeting Materials of the Molecular and Clinical Genetics ...  

Center for Biologics Evaluation and Research (CBER)

... 2011 Meeting Materials of the Molecular and Clinical Genetics Panel. -. March 8-9, 2011: Molecular and Clinical Genetics ... More results from www.fda.gov/advisorycommittees/committeesmeetingmaterials/medicaldevices

21

H5N1 Influenza Virus Pathogenesis in Genetically Diverse Mice Is Mediated at the Level of Viral Load  

PubMed Central

ABSTRACT The genotype of the host is one of several factors involved in the pathogenesis of an infectious disease and may be a key parameter in the epidemiology of highly pathogenic H5N1 influenza virus infection in humans. Gene polymorphisms may affect the viral replication rate or alter the host’s immune response to the virus. In humans, it is unclear which aspect dictates the severity of H5N1 virus disease. To identify the mechanism underlying differential responses to H5N1 virus infection in a genetically diverse population, we assessed the host responses and lung viral loads in 21 inbred mouse strains upon intranasal inoculation with A/Hong Kong/213/03 (H5N1). Resistant mouse strains survived large inocula while susceptible strains succumbed to infection with 1,000- to 10,000-fold-lower doses. Quantitative analysis of the viral load after inoculation with an intermediate dose found significant associations with lethality as early as 2 days postinoculation, earlier than any other disease indicator. The increased viral titers in the highly susceptible strains mediated a hyperinflamed environment, indicated by the distinct expression profiles and increased production of inflammatory mediators on day 3. Supporting the hypothesis that viral load rather than an inappropriate response to the virus was the key severity-determining factor, we performed quantitative real-time PCR measuring the cytokine/viral RNA ratio. No significant differences between susceptible and resistant mouse strains were detected, confirming that it is the host genetic component controlling viral load, and therefore replication dynamics, that is primarily responsible for a host’s susceptibility to a given H5N1 virus.

Boon, Adrianus C. M.; Finkelstein, David; Zheng, Ming; Liao, Guochun; Allard, John; Klumpp, Klaus; Webster, Robert; Peltz, Gary; Webby, Richard J.

2011-01-01

22

Multiple genetic pathways to similar fitness limits during viral adaptation to a new host  

PubMed Central

The gain in fitness during adaptation depends on the supply of beneficial mutations. Despite a good theoretical understanding of how evolution proceeds for a defined set of mutations, there is little understanding of constraints on net fitness - whether fitness will reach a limit despite ongoing selection and mutation, and if there is a limit, what determines it. Here, the dsDNA bacteriophage SP6, a virus of Salmonella, was adapted to Escherichia coli K-12. From an isolate capable of modest growth on E. coli, 4 lines were adapted for rapid growth by protocols differing in use of mutagen, propagation method, and duration, but using the same media, temperature, and a continual excess of the novel host. Nucleotide changes underlying those adaptations differed greatly in number and identity, but the four lines achieved similar absolute fitnesses at the end, an increase of more than 4000-fold phage descendants per hour. Thus the fitness landscape allows multiple genetic paths to the same approximate fitness limit. The existence and causes of fitness limits have ramifications to genome engineering, vaccine design, and ‘lethal mutagenesis’ treatments to cure viral infections.

Nguyen, A. H.; Molineux, I. J.; Springman, R.; Bull, J. J.

2012-01-01

23

Optimizing Viral and Non-Viral Gene Transfer Methods for Genetic Modification of Porcine Mesenchymal Stem Cells  

Microsoft Academic Search

INTRODUCTION: Mesenchymal stem cells (MSCs) provide an excellent source of pluripotent progenitor cells for tissue-engineering\\u000a applications due to their proliferation capacity and differentiation potential. Genetic modification of MSCs with genes encoding\\u000a tissue-specific growth factors and cytokines can induce and maintain lineagespecific differentiation. Due to anatomical and\\u000a physiological similarities to humans, porcine research models have been proven valuable for the preclinical

Maik Stiehler; Mogens Duch; Tina Mygind; Haisheng Li; Michael Ulrich-Vinther; Charlotte Modin; Anette Baatrup; Martin Lind; Finn S. Pedersen; Cody E. Bünger

24

Human Genetics. Informational and Educational Materials, Vol. I, No. 1.  

ERIC Educational Resources Information Center

This catalogue, prepared by the National Clearinghouse for Human Genetic Diseases, provides educational and informational materials on the latest advances in testing, diagnosing, counseling, and treating individuals with a concern for genetic diseases. The materials include books, brochures, pamphlets, journal articles, audio cassettes,…

National Clearinghouse for Human Genetic Diseases (DHEW/PHS), Rockville, MD.

25

Comparison of non-viral methods to genetically modify and enrich populations of primary human corneal endothelial cells  

PubMed Central

Purpose To compare different techniques of transfection of primary human corneal endothelial cells (HCECs) by non-viral methods and to enrich genetically modified cells to a highly pure population. Methods HCECs were cultured following previously published methods. Dissection of the Descemet membrane (DM) was performed by tearing off strips from corneal buttons with forceps or by hydrodissection. Confirmation of HCECs identity was performed by reverse transcriptase polymerase chain reaction (RT–PCR) for ?2 collagen VIII. For transfection, non-viral methods such as lipid-/liposome-mediated reagents and electroporation techniques were compared. Genetically modified cells were enriched by use of selection antibiotics and flow cytometry. Results Viability of primary HCECs was lower in hydrodissected corneas. The rate of transfection varied from approximately 5%–30%. Highest rates of transfection were obtained with the Amaxa electroporation method. The next highest rate was yielded by the lipid-mediated reagent GenCarrier2, followed by electroporation with the BTX apparatus. Toxicity was moderate and manageable by adjusting the concentration of reagents, incubation times, and electrical parameters. Selection by flow cytometry was superior to antibiotic selection and produced nearly 100% genetically modified cells. Conclusions Electroporation of HCECs yields higher transfection efficiency than chemically mediated methods. It is possible to select genetically modified HCECs to high levels of homogeneity. Techniques to genetically modify and select HCECs as shown in this study could lead to improved success of future endothelial transplant procedures.

Engler, Christoph; Kelliher, Clare; Wahlin, Karl J.; Speck, Caroline L.

2009-01-01

26

A Drosophila Model for Genetic Analysis of Influenza Viral/Host Interactions  

PubMed Central

Influenza viruses impose a constant threat to vertebrates susceptible to this family of viruses. We have developed a new tool to study virus–host interactions that play key roles in viral replication and to help identify novel anti-influenza drug targets. Via the UAS/Gal4 system we ectopically expressed the influenza virus M2 gene in Drosophila melanogaster and generated dose-sensitive phenotypes in the eye and wing. We have confirmed that the M2 proton channel is properly targeted to cell membranes in Drosophila tissues and functions as a proton channel by altering intracellular pH. As part of the efficacy for potential anti-influenza drug screens, we have also demonstrated that the anti-influenza drug amantadine, which targets the M2 proton channel, suppressed the UAS-M2 mutant phenotype when fed to larvae. In a candidate gene screen we identified mutations in components of the vacuolar V1V0 ATPase that modify the UAS-M2 phenotype. Importantly, in this study we demonstrate that Drosophila genetic interactions translate directly to physiological requirements of the influenza A virus for these components in mammalian cells. Overexpressing specific V1 subunits altered the replication capacity of influenza virus in cell culture and suggests that drugs targeting the enzyme complex via these subunits may be useful in anti-influenza drug therapies. Moreover, this study adds credence to the idea of using the M2 “flu fly” to identify new and previously unconsidered cellular genes as potential drug targets and to provide insight into basic mechanisms of influenza virus biology.

Adamson, Amy L.; Chohan, Kultaran; Swenson, Jennifer; LaJeunesse, Dennis

2011-01-01

27

A Drosophila model for genetic analysis of influenza viral/host interactions.  

PubMed

Influenza viruses impose a constant threat to vertebrates susceptible to this family of viruses. We have developed a new tool to study virus-host interactions that play key roles in viral replication and to help identify novel anti-influenza drug targets. Via the UAS/Gal4 system we ectopically expressed the influenza virus M2 gene in Drosophila melanogaster and generated dose-sensitive phenotypes in the eye and wing. We have confirmed that the M2 proton channel is properly targeted to cell membranes in Drosophila tissues and functions as a proton channel by altering intracellular pH. As part of the efficacy for potential anti-influenza drug screens, we have also demonstrated that the anti-influenza drug amantadine, which targets the M2 proton channel, suppressed the UAS-M2 mutant phenotype when fed to larvae. In a candidate gene screen we identified mutations in components of the vacuolar V1V0 ATPase that modify the UAS-M2 phenotype. Importantly, in this study we demonstrate that Drosophila genetic interactions translate directly to physiological requirements of the influenza A virus for these components in mammalian cells. Overexpressing specific V1 subunits altered the replication capacity of influenza virus in cell culture and suggests that drugs targeting the enzyme complex via these subunits may be useful in anti-influenza drug therapies. Moreover, this study adds credence to the idea of using the M2 "flu fly" to identify new and previously unconsidered cellular genes as potential drug targets and to provide insight into basic mechanisms of influenza virus biology. PMID:21775472

Adamson, Amy L; Chohan, Kultaran; Swenson, Jennifer; LaJeunesse, Dennis

2011-07-20

28

Absence of a genetic bottleneck in a wild rabbit (Oryctolagus cuniculus) population exposed to a severe viral epizootic.  

PubMed

Infectious diseases and their demographic consequences are thought to influence the genetic diversity of populations. In Europe, during the last 50 years, the European rabbit (Oryctolagus cuniculus) has suffered two important viral epizootics: myxomatosis and rabbit viral haemorraghic disease (RVHD). Although mortality rates were very high, the impact of these diseases on genetic diversity has never been assessed directly. The subject of this paper is a wild rabbit population in France, which has been studied since the beginning of the 1980s. The first outbreak of RVHD occurred in 1995 and provoked a demographic crash. The population, sampled for the first time in 1982 and 1994, was sampled again at the end of 1996 to examine the impact of the epizootic on genetic diversity. In spite of the observed high mortality rate ( approximately 90%), analysis of 14 polymorphic loci (allozymes and microsatellites) showed no loss in genetic diversity after the epizootic. Determination of temporal changes in allele frequencies indicated that the population evolved under genetic drift. The temporal method of Waples demonstrated a significant decrease in the effective population size (Ne) correlated with the demographic crash due to the epizootic. However, the population had only been studied for two generations after the epizootic and the remnant population size probably stayed high enough ( approximately 50 individuals) to keep its genetic diversity at the precrash level. These results suggest that, contrary to what is usually thought and in spite of the subsequent high mortality rates, past epizootics (especially myxomatosis) may have had little effect on the genetic diversity of wild rabbit populations in Europe. PMID:10972766

Queney, G; Ferrand, N; Marchandeau, S; Azevedo, M; Mougel, F; Branco, M; Monnerot, M

2000-09-01

29

Viral information.  

PubMed

Viruses are major drivers of global biogeochemistry and the etiological agents of many diseases. They are also the winners in the game of life: there are more viruses on the planet than cellular organisms and they encode most of the genetic diversity on the planet. In fact, it is reasonable to view life as a viral incubator. Nevertheless, most ecological and evolutionary theories were developed, and continue to be developed, without considering the virosphere. This means these theories need to be to reinterpreted in light of viral knowledge or we need to develop new theory from the viral point-of-view. Here we briefly introduce our viral planet and then address a major outstanding question in biology: why is most of life viral? A key insight is that during an infection cycle the original virus is completely broken down and only the associated information is passed on to the next generation. This is different for cellular organisms, which must pass on some physical part of themselves from generation to generation. Based on this premise, it is proposed that the thermodynamic consequences of physical information (e.g., Landauer's principle) are observed in natural viral populations. This link between physical and genetic information is then used to develop the Viral Information Hypothesis, which states that genetic information replicates itself to the detriment of system energy efficiency (i.e., is viral in nature). Finally, we show how viral information can be tested, and illustrate how this novel view can explain existing ecological and evolutionary theories from more fundamental principles. PMID:23482918

Rohwer, Forest; Barott, Katie

2012-10-31

30

Genetics Curriculum Materials for the 21st Century  

ERIC Educational Resources Information Center

|The purpose of this project was to provide innovative and cutting edge genetics materials for 14-17 year olds (Year 10-12) in Australian schools, which aimed to engage students and encourage evidence based decision-making. In 2008, an Australian School Innovation in Science, Technology and Mathematics (ASISTM) project called "Genetics Education…

Dawson, Vaille; Carson, Katherine; Venville, Grady

2010-01-01

31

Genetic Dissection of Interaction between Poliovirus 3D Polymerase and Viral Protein 3AB  

Microsoft Academic Search

Poliovirus RNA-dependent RNA polymerase 3D and viral protein 3AB are both thought to be required for the initiation of RNA synthesis. These two proteins physically associate with each other and with viral RNA replication complexes found on virus-induced membranes in infected cells. An understanding of the interface between 3D and 3AB would provide a first step in visualizing the architecture

DEBRA A. HOPE; SCOTT E. DIAMOND; KARLA KIRKEGAARD

1997-01-01

32

Genome-Wide Identification of Susceptibility Alleles for Viral Infections through a Population Genetics Approach  

PubMed Central

Viruses have exerted a constant and potent selective pressure on human genes throughout evolution. We utilized the marks left by selection on allele frequency to identify viral infection-associated allelic variants. Virus diversity (the number of different viruses in a geographic region) was used to measure virus-driven selective pressure. Results showed an excess of variants correlated with virus diversity in genes involved in immune response and in the biosynthesis of glycan structures functioning as viral receptors; a significantly higher than expected number of variants was also seen in genes encoding proteins that directly interact with viral components. Genome-wide analyses identified 441 variants significantly associated with virus-diversity; these are more frequently located within gene regions than expected, and they map to 139 human genes. Analysis of functional relationships among genes subjected to virus-driven selective pressure identified a complex network enriched in viral products-interacting proteins. The novel approach to the study of infectious disease epidemiology presented herein may represent an alternative to classic genome-wide association studies and provides a large set of candidate susceptibility variants for viral infections.

Fumagalli, Matteo; Pozzoli, Uberto; Cagliani, Rachele; Comi, Giacomo P.; Bresolin, Nereo

2010-01-01

33

Synthetic polymers and their potential as genetic materials.  

PubMed

DNA and RNA are the only known natural genetic materials. Systematic modification of each of their chemical building blocks (nucleobase, sugar, and phosphate) has enabled the study of the key properties that make those nucleic acids genetic materials. All three moieties contribute to replication and, significantly, all three moieties can be replaced by synthetic analogs without loss of function. Synthetic nucleic acid polymers capable of storing and propagating information not only expand the central dogma, but also highlight that DNA and RNA are not unique chemical solutions for genetic information storage. By considering replication as a question of information transfer, we propose that any polymer that can be replicated could serve as a genetic material. PMID:23281109

Pinheiro, Vitor B; Loakes, David; Holliger, Philipp

2012-12-27

34

Sequence Analyses of 2012 West Nile Virus Isolates from Texas Fail to Associate Viral Genetic Factors with Outbreak Magnitude  

PubMed Central

In 2012, Texas experienced the largest outbreak of human West Nile encephalitis (WNE) since the introduction of West Nile virus (WNV) in 2002. Despite the large number of WNV infections, data indicated the rate of reported WNE among human cases was no higher than in previous years. To determine whether the increase in WNV human cases could have been caused by viral genetic changes, the complete genomes of 17 isolates made from mosquito pools in Dallas and Montgomery Counties in 2012 were sequenced. The 2012 Texas isolates were found to be composed of two distinct clades, both circulating in Dallas and Montgomery Counties despite a 5-fold higher disease incidence in the former. Although minor genetic differences existed between Dallas and Montgomery WNV populations, there was weak support for population subdivision or adaptive changes. On the basis of these data, alternative explanations for increased WNV disease incidence in 2012 are proposed.

Duggal, Nisha K.; D'Anton, Mary; Xiang, Jeannie; Seiferth, Robyn; Day, Joanne; Nasci, Roger; Brault, Aaron C.

2013-01-01

35

Genetic diversity and frequency of bovine viral diarrhea virus (BVDV) detected in cattle in Turkey  

Technology Transfer Automated Retrieval System (TEKTRAN)

Rapid detection and culling of persistently infected animals and efficacious vaccination are key factors to control bovine viral diarrhea virus (BVDV) infections in cattle. The aim of this study was to investigate frequency of detection of persistently infected cattle and examine the diversity of bo...

36

Viral protein U counteracts a human host cell restriction that inhibits HIV1 particle production  

Microsoft Academic Search

Human cells resist viral infections by a variety of mechanisms. Viruses must overcome host cell restrictions to successfully reproduce their genetic material. Here, we identify a host restriction to viral replication that acts at the stage of particle assembly. Viral protein U (Vpu) is an HIV-1 accessory protein that enhances particle assembly and release in most human cells, but not

Vasundhara Varthakavi; Rita M. Smith; Stephan P. Bour; Klaus Strebel; Paul Spearman

2003-01-01

37

Transductional and transcriptional targeting of cancer cells using genetically engineered viral vectors  

Microsoft Academic Search

Gene delivery vectors, including adenovirus (Ad) and adeno-associated virus (AAV), are inefficient and non-selective for cancer due to low levels of viral receptors with high levels on other tissues, including liver. We tested Ads and AAVs with the SIGYPLP-targeting peptide inserted into virus capsids for transduction in a panel of cancer cells. Six of twelve lines (C8161, PC-3, G-CCM, MKN-45,

Stuart A. Nicklin; Kate L. Dishart; Hildegard Buening; Paul N. Reynolds; Michael Hallek; Glen R. Nemerow; Dan J. Von Seggern; Andrew H. Baker

2003-01-01

38

Genetic algorithms in computational materials science and engineering: simulation and design of self-assembling materials  

Microsoft Academic Search

We introduce here two genetic algorithms that were developed in order to aid in the design of molecules for self-assembling materials. The first constructs molecules from sets of chemical building blocks, searching for candidates that are determined by an ancillary modeling program to assemble into low-energy aggregates. The results of running this Genetic Algorithm (GA) on a set of building

Milan Keser; Samuel I Stupp

2000-01-01

39

Genetically Engineered Nanofiber-Like Viruses For Tissue Regenerating Materials  

Microsoft Academic Search

Controlling structural organization and signaling motif display of biomimetic matrices at the nanometer scale is of great importance to the functional design of tissue regenerating materials. We have genetically engineered M13 bacteriophage (phage), naturally occurring nanofiber- like viruses, to display a high density of cell-signaling peptides on their major coat proteins. Structural orientation of these phage building blocks can be

Anna Merzlyak; Shyam Indrakanti; Seung-Wuk Lee

2009-01-01

40

Genetic Modification of Cancer Cells Using Non-Viral, Episomal S/MAR Vectors for In Vivo Tumour Modelling  

PubMed Central

The development of genetically marked animal tumour xenografts is an area of ongoing research to enable easier and more reliable testing of cancer therapies. Genetically marked tumour models have a number of advantages over conventional tumour models, including the easy longitudinal monitoring of therapies and the reduced number of animals needed for trials. Several different methods have been used in previous studies to mark tumours genetically, however all have limitations, such as genotoxicity and other artifacts related to the usage of integrating viral vectors. Recently, we have generated an episomally maintained plasmid DNA (pDNA) expression system based on Scaffold/Matrix Attachment Region (S/MAR), which permits long-term luciferase transgene expression in the mouse liver. Here we describe a further usage of this pDNA vector with the human Ubiquitin C promoter to create stably transfected human hepatoma (Huh7) and human Pancreatic Carcinoma (MIA-PaCa2) cell lines, which were delivered into “immune deficient” mice and monitored longitudinally over time using a bioluminometer. Both cell lines revealed sustained episomal long-term luciferase expression and formation of a tumour showing the pathological characteristics of hepatocellular carcinoma (HCC) and pancreatic carcinoma (PaCa), respectively. This is the first demonstration that a pDNA vector can confer sustained episomal luciferase transgene expression in various mouse tumour models and can thus be readily utilised to follow tumour formation without interfering with the cellular genome.

Gowers, Kate; Harbottle, Richard Paul

2012-01-01

41

Reverse Genetics System for Uukuniemi Virus (Bunyaviridae): RNA Polymerase I-Catalyzed Expression of Chimeric Viral RNAs  

PubMed Central

We describe here the development of a reverse genetics system for the phlebovirus Uukuniemi virus, a member of the Bunyaviridae family, by using RNA polymerase I (pol I)-mediated transcription. Complementary DNAs containing the coding sequence for either chloramphenicol acetyltransferase (CAT) or green fluorescent protein (GFP) (both in antisense orientation) were flanked by the 5?- and 3?-terminal untranslated regions of the Uukuniemi virus sense or complementary RNA derived from the medium-sized (M) RNA segment. This chimeric cDNA (pol I expression cassette) was cloned between the murine pol I promoter and terminator and the plasmid transfected into BHK-21 cells. When such cells were either superinfected with Uukuniemi virus or cotransfected with expression plasmids encoding the L (RNA polymerase), N (nucleoprotein), and NSs (nonstructural protein) viral proteins, strong CAT activity or GFP expression was observed. CAT activity was consistently stronger in cells expressing L plus N than following superinfection. No activity was seen without superinfection, nor was activity detected when either the L or N expression plasmid was omitted. Omitting NSs expression had no effect on CAT activity or GFP expression, indicating that this protein is not needed for viral RNA replication or transcription. CAT activity could be serially passaged to fresh cultures by transferring medium from CAT-expressing cells, indicating that recombinant virus containing the reporter construct had been produced. In summary, we demonstrate that the RNA pol I system, originally developed for influenza virus, which replicates in the nucleus, has strong potential for the development of an efficient reverse genetics system also for Bunyaviridae members, which replicate in the cytoplasm.

Flick, Ramon; Pettersson, Ralf F.

2001-01-01

42

Interactions between multiple genetic determinants in the 5? UTR and VP1 capsid control pathogenesis of chronic post-viral myopathy caused by coxsackievirus B1  

Microsoft Academic Search

Mice infected with coxsackievirus B1 Tucson (CVB1T) develop chronic, post-viral myopathy (PVM) with clinical manifestations of hind limb muscle weakness and myositis. The objective of the current study was to establish the genetic basis of myopathogenicity in CVB1T. Using a reverse genetics approach, full attenuation of PVM could only be achieved by simultaneously mutating four sites located at C706U in

Maribeth M. Sandager; Jaime L. Nugent; Wade L. Schulz; Ronald P. Messner; Patricia E. Tam

2008-01-01

43

Viral Replication, Persistence in Water and Genetic Characterization of Two Influenza A Viruses Isolated from Surface Lake Water  

PubMed Central

Water-borne transmission has been suggested as an important transmission mechanism for Influenza A (IA) viruses in wild duck populations; however, relatively few studies have attempted to detect IA viruses from aquatic habitats. Water-isolated viruses have rarely been genetically characterized and evaluation for persistence in water and infectivity in natural hosts has never been documented. In this study, we focused on two IA viruses (H3N8 and H4N6 subtypes) isolated from surface lake water in Minnesota, USA. We investigated the relative prevalence of the two virus subtypes in wild duck populations at the sampling site and their genetic relatedness to IA viruses isolated in wild waterbirds in North America. Viral persistence under different laboratory conditions (temperature and pH) and replication in experimentally infected Mallards (Anas platyrhynchos) were also characterized. Both viruses were the most prevalent subtype one year following their isolation in lake water. The viruses persisted in water for an extended time period at constant temperature (several weeks) but infectivity rapidly reduced under multiple freeze-thaw cycles. Furthermore, the two isolates efficiently replicated in Mallards. The complete genome characterization supported that these isolates originated from genetic reassortments with other IA viruses circulating in wild duck populations during the year of sampling. Based on phylogenetic analyses, we couldn't identify genetically similar viruses in duck populations in the years following their isolation from lake water. Our study supports the role for water-borne transmission for IA viruses but also highlights that additional field and experimental studies are required to support inter-annual persistence in aquatic habitats.

Lebarbenchon, Camille; Yang, My; Keeler, Shamus P.; Ramakrishnan, Muthannan A.; Brown, Justin D.; Stallknecht, David E.; Sreevatsan, Srinand

2011-01-01

44

Isolation and Genetic Analysis of Bovine Viral Diarrhea Virus from Infected Cattle in Indiana  

PubMed Central

Species and biotype distribution was determined in 44 bovine viral diarrhea virus- (BVDV-) positive samples submitted to the Animal Disease Diagnostic Laboratory (ADDL) in Indiana during 2006–2008. BVDV RNA was detected in the 5?-untranslated region and Npro region using reverse transcriptase PCR followed by sequencing analysis of the PCR product. Additionally, cases were classified into one of six categories according to history and/or lesions: acute symptomatic, hemorrhagic, respiratory distress, reproductive, persistent infection (PI), and mucosal disease (MD). Of 44 BVDV-positive samples, 33 were noncytopathic (ncp), 10 were cytopathic (cp), and one presented both ncp and cp biotypes. Sequencing analysis demonstrated that all samples belonged to BVDV-1a, BVDV-1b, or BVDV-2. The most common isolate was ncp BVDV-1b, (44%) followed by ncp BVDV-2a (24%). Among the six categories, respiratory clinical signs were the most common (36%) followed by PI (25%) and MD (16%).

Pogranichniy, Roman M.; Schnur, Megan E.; Raizman, Eran A.; Murphy, Duane A.; Negron, Maria; Thacker, H. Leon

2011-01-01

45

Genetic diversity of recent bovine viral diarrhoea viruses from the southeast of Austria (Styria)  

Microsoft Academic Search

To characterise the bovine virus diarrhoea virus (BVDV) isolates circulating in the southeastern region of Austria, namely in the province of Styria, 71 blood samples collected between 1998 and 2000 from persistently infected cattle in 62 herds were subjected to genetic typing. For this, 288bp fragments from the 5? untranslated region (5?-UTR) were amplified by polymerase chain reaction after reverse

Stefan Vilcek; Irene Greiser-Wilke; Branislav Durkovic; Walter Obritzhauser; Armin Deutz; Josef Köfer

2003-01-01

46

Targeting of Adenovirus via Genetic Modification of the Viral Capsid Combined with a Protein Bridge  

Microsoft Academic Search

A potential barrier to the development of genetically targeted adenovirus (Ad) vectors for cell-specific delivery of gene therapeutics lies in the fact that several types of targeting protein ligands require posttrans- lational modifications, such as the formation of disulfide bonds, which are not available to Ad capsid proteins due to their nuclear localization during assembly of the virion. To overcome

Nikolay Korokhov; Galina Mikheeva; Alexander Krendelshchikov; Natalya Belousova; Vera Simonenko; Valentina Krendelshchikova; Alexander Pereboev; Alexander Kotov; Olga Kotova; Pierre L. Triozzi; Wayne A. Aldrich; Joanne T. Douglas; Kin-Ming Lo; Papia T. Banerjee; Stephen D. Gillies; David T. Curiel; Victor Krasnykh

2003-01-01

47

Non-viral gene transfection technologies for genetic engineering of stem cells  

Microsoft Academic Search

The recent rapid progress of molecular biology together with the steady progress of genome projects has given us some essential and revolutionary information about DNA and RNA to elucidate various biological phenomena at a genetic level. Under these circumstances, the technology and methodology of gene transfection have become more and more important to enhance the efficacy of gene therapy for

Jun-ichiro Jo; Yasuhiko Tabata

2008-01-01

48

HTLV-I viral escape and host genetic changes in the development of adult T cell leukemia.  

PubMed

In the pathogenesis of adult T cell leukemia (ATL), an oncogenetic role of the human T cell lymphotropic virus type I (HTLV-I) Tax protein, viral escape from the host immune system, and host genetic changes have been proposed as contributory factors. We examined the premature stop codons in tax gene as one of the mutations that may lead to escape of HTLV-I from the cytotoxic T lymphocyte (CTL) response in HTLV-I carriers, to test whether a putative CTL escape mutant can emerge in the early stage of ATL development and whether HTLV-I infected cells with such a mutation can proliferate subsequently. We also examined deletion of cyclin-dependent kinase inhibitor 4 (INK4) genes and mutation of p53 gene in combination with changes in the HTLV-I genome in acute type ATL to test whether host genetic changes promoted the malignant transformation of ATL cells that carry putative CTL escape mutations. The premature stop codon in tax gene existed in many non-ATL HTLV-I carriers as a minor population but not in the commonest HTLV-I sequence of the individual. This minor population with a premature stop codon did not expand subsequently in 3 asymptomatic carriers tested. There were cases who had a mutation or deletion in HTLV-I who also have either deletion of INK4 genes or mutation in p53 gene. Our findings suggest that CTL escape mutation can occur at an early stage of ATL development, and that certain host genetic changes favor the development of the aggressive form of ATL. PMID:16052518

Furukawa, Yoshitaka; Tara, Mitsutoshi; Izumo, Shuji; Arimura, Kimiyoshi; Osame, Mitsuhiro

2006-01-15

49

Review of climate, landscape, and viral genetics as drivers of the Japanese encephalitis virus ecology.  

PubMed

The Japanese encephalitis virus (JEV), an arthropod-born Flavivirus, is the major cause of viral encephalitis, responsible for 10,000-15,000 deaths each year, yet is a neglected tropical disease. Since the JEV distribution area has been large and continuously extending toward new Asian and Australasian regions, it is considered an emerging and reemerging pathogen. Despite large effective immunization campaigns, Japanese encephalitis remains a disease of global health concern. JEV zoonotic transmission cycles may be either wild or domestic: the first involves wading birds as wild amplifying hosts; the second involves pigs as the main domestic amplifying hosts. Culex mosquito species, especially Cx. tritaeniorhynchus, are the main competent vectors. Although five JEV genotypes circulate, neither clear-cut genotype-phenotype relationship nor clear variations in genotype fitness to hosts or vectors have been identified. Instead, the molecular epidemiology appears highly dependent on vectors, hosts' biology, and on a set of environmental factors. At global scale, climate, land cover, and land use, otherwise strongly dependent on human activities, affect the abundance of JEV vectors, and of wild and domestic hosts. Chiefly, the increase of rice-cultivated surface, intensively used by wading birds, and of pig production in Asia has provided a high availability of resources to mosquito vectors, enhancing the JEV maintenance, amplification, and transmission. At fine scale, the characteristics (density, size, spatial arrangement) of three landscape elements (paddy fields, pig farms, human habitations) facilitate or impede movement of vectors, then determine how the JEV interacts with hosts and vectors and ultimately the infection risk to humans. If the JEV is introduced in a favorable landscape, either by live infected animals or by vectors, then the virus can emerge and become a major threat for human health. Multidisciplinary research is essential to shed light on the biological mechanisms involved in the emergence, spread, reemergence, and genotypic changes of JEV. PMID:24069463

Le Flohic, Guillaume; Porphyre, Vincent; Barbazan, Philippe; Gonzalez, Jean-Paul

2013-09-12

50

Genetic diversity and frequency of bovine viral diarrhea virus (BVDV) detected in cattle in Turkey.  

PubMed

The aim of this study was to investigate the frequency and diversity of bovine viral diarrhea viruses (BVDV) infecting cattle in Turkey. A total of 1124 bovine blood samples from 19 farms in 4 different Turkish regions were tested by antigen capture ELISA (ACE). BVDV antigen was found in 26 samples from 13 farms. Only 20 of the 26 initial test positive cattle were available for retesting. Of these, 6 of 20 tested positive for BVDV, by ACE and real-time RT-PCR, one month after initial testing. Phylogenetic analysis, based on comparison of the E2 or the 5'UTR coding regions, from 19 of the 26 initial positive samples, indicated that 17 belonged to the BVDV-1 genotype and 2 to the BVDV-2 genotype. Comparison of 5'UTR sequences segregated 8 BVDV-1 strains (strains 5, 6, 10, 11, 12, 13, 17, and 19) to the BVDV1f, 1 strain (strain 8) to the BVDV1i and 1 strain (strain 14) to the BVDV1d subgenotypes. One strain (strain 4) did not group with other subgenotypes but was closer to the BVDV1f. The remaining 6 BVDV-1 strains (strains 1, 2, 3, 7, 9, and 18) segregated to a novel subgenotype. The E2 sequence comparison results were similar, with the exception that strain 5 grouped with the novel subgenotype rather than BVDV1f subgenotype. It appears that among the diverse BVDV strains in circulation there may be a subgenotype that is unique to Turkey. This should be considered in the design of diagnostics and vaccines to be used in Turkey. PMID:22537480

Yilmaz, Huseyin; Altan, Eda; Ridpath, Julia; Turan, Nuri

2012-04-24

51

Review of Climate, Landscape, and Viral Genetics as Drivers of the Japanese Encephalitis Virus Ecology  

PubMed Central

The Japanese encephalitis virus (JEV), an arthropod-born Flavivirus, is the major cause of viral encephalitis, responsible for 10,000–15,000 deaths each year, yet is a neglected tropical disease. Since the JEV distribution area has been large and continuously extending toward new Asian and Australasian regions, it is considered an emerging and reemerging pathogen. Despite large effective immunization campaigns, Japanese encephalitis remains a disease of global health concern. JEV zoonotic transmission cycles may be either wild or domestic: the first involves wading birds as wild amplifying hosts; the second involves pigs as the main domestic amplifying hosts. Culex mosquito species, especially Cx. tritaeniorhynchus, are the main competent vectors. Although five JEV genotypes circulate, neither clear-cut genotype-phenotype relationship nor clear variations in genotype fitness to hosts or vectors have been identified. Instead, the molecular epidemiology appears highly dependent on vectors, hosts' biology, and on a set of environmental factors. At global scale, climate, land cover, and land use, otherwise strongly dependent on human activities, affect the abundance of JEV vectors, and of wild and domestic hosts. Chiefly, the increase of rice-cultivated surface, intensively used by wading birds, and of pig production in Asia has provided a high availability of resources to mosquito vectors, enhancing the JEV maintenance, amplification, and transmission. At fine scale, the characteristics (density, size, spatial arrangement) of three landscape elements (paddy fields, pig farms, human habitations) facilitate or impede movement of vectors, then determine how the JEV interacts with hosts and vectors and ultimately the infection risk to humans. If the JEV is introduced in a favorable landscape, either by live infected animals or by vectors, then the virus can emerge and become a major threat for human health. Multidisciplinary research is essential to shed light on the biological mechanisms involved in the emergence, spread, reemergence, and genotypic changes of JEV.

Le Flohic, Guillaume; Porphyre, Vincent; Gonzalez, Jean-Paul

2013-01-01

52

62 FR 52505 - Glyphosate Oxidoreductase and the Genetic Material Necessary for Its Production in All Plants...  

Federal Register 2010, 2011, 2012, 2013

...Genetic Material Necessary for Its Production in All Plants; Exemption From Tolerance Requirement On All Raw Agricultural Commodities AGENCY: Environmental...genetic material necessary for its production in all plants when used as plant-pesticides in...

1997-10-08

53

62 FR 17717 - Phosphinothricin Acetyltransferase and the Genetic Material Necessary for Its Production in All...  

Federal Register 2010, 2011, 2012, 2013

...Genetic Material Necessary for Its Production in All Plants; Exemption From the Requirement of a Tolerance On All Raw Agricultural Commodities AGENCY: Environmental...genetic material necessary for its production in all plants when used as plant- pesticides...

1997-04-11

54

Label-Free Electrochemical Diagnosis of Viral Antigens with Genetically Engineered Fusion Protein  

PubMed Central

We have developed a simple electrochemical biosensing strategy for the label-free diagnosis of hepatitis B virus (HBV) on a gold electrode surface. Gold-binding polypeptide (GBP) fused with single-chain antibody (ScFv) against HBV surface antigen (HBsAg), in forms of genetically engineered protein, was utilized. This GBP-ScFv fusion protein can directly bind onto the gold substrate with the strong binding affinity between the GBP and the gold surface, while the recognition site orients toward the sample for target binding at the same time. Furthermore, this one-step immobilization strategy greatly simplifies a fabrication process without any chemical modification as well as maintaining activity of biological recognition elements. This system allows specific immobilization of proteins and sensitive detection of targets, which were verified by surface plasmon resonance analysis and successfully applied to electrochemical cyclic voltammetry and impedance spectroscopy upto 0.14 ng/mL HBsAg.

Heo, Nam Su; Zheng, Shun; Yang, MinHo; Lee, Seok Jae; Lee, Sang Yup; Kim, Hwa-Jung; Park, Jung Youn; Lee, Chang-Soo; Park, Tae Jung

2012-01-01

55

Identification and genetic characterization of new bovine viral diarrhea virus genotype 2 strains in pigs isolated in China.  

PubMed

Classical swine fever (CSF)-like symptoms in pigs regarded as free from CSF has been reported previously. From sick pigs with CSF-like symptoms, and who had been inoculated with the hog cholera vaccine, samples were collected and subjected to RT-PCR using specific primers. Twelve bovine viral diarrhea virus 2 (BVDV-2) strains were screened and isolated. Homology comparison showed that the E2 genes of the twelve isolates were highly conserved. The genome of the one of the BVDV-2 isolates (named as SH-28) from the sick pigs, which showed a noncytopathic effect in MDBK cell cultures and strong reactivity with monoclonal antibody (MAb) Bz-53 raised against BVDV-2, was sequenced. The genome of SH-28 comprises 12,279 nucleotides and contains a large open reading frame beginning at nucleotide 386 and ending at nucleotide 12,073. Genomic comparison and phylogenetic analyzes showed that SH-28 fall into BVDV-2 subtype and was most similar to XJ-04 (nucleotide and amino acid homologies were 89.9-93.8 % and 91.1-96.9 %, respectively), but was genetically divergent from ZM-95 (pig BVDV-1). PMID:23085884

Tao, Jie; Wang, Yin; Wang, Juan; Wang, Jian-ye; Zhu, Guo-qiang

2012-10-21

56

HIV type 1 viral infectivity factor and the RUNX transcription factors interact with core binding factor ? on genetically distinct surfaces.  

PubMed

Human immunodeficiency virus type 1 (HIV-1) requires the cellular transcription factor core binding factor subunit ? (CBF?) to stabilize its viral infectivity factor (Vif) protein and neutralize the APOBEC3 restriction factors. CBF? normally heterodimerizes with the RUNX family of transcription factors, enhancing their stability and DNA-binding affinity. To test the hypothesis that Vif may act as a RUNX mimic to bind CBF?, we generated a series of CBF? mutants at the RUNX/CBF? interface and tested their ability to stabilize Vif and impact transcription at a RUNX-dependent promoter. While several CBF? amino acid substitutions disrupted promoter activity, none of these impacted the ability of CBF? to stabilize Vif or enhance degradation of APOBEC3G. A mutagenesis screen of CBF? surface residues identified a single amino acid change, F68D, that disrupted Vif binding and its ability to degrade APOBEC3G. This mutant still bound RUNX and stimulated RUNX-dependent transcription. These separation-of-function mutants demonstrate that HIV-1 Vif and the RUNX transcription factors interact with cellular CBF? on genetically distinct surfaces. PMID:22725134

Hultquist, Judd F; McDougle, Rebecca M; Anderson, Brett D; Harris, Reuben S

2012-08-13

57

Structural plasticity and rapid evolution in a viral RNA revealed by in vivo genetic selection.  

PubMed

Satellite RNAs usually lack substantial homology with their helper viruses. The 356-nucleotide satC of Turnip crinkle virus (TCV) is unusual in that its 3'-half shares high sequence similarity with the TCV 3' end. Computer modeling, structure probing, and/or compensatory mutagenesis identified four hairpins and three pseudoknots in this TCV region that participate in replication and/or translation. Two hairpins and two pseudoknots have been confirmed as important for satC replication. One portion of the related 3' end of satC that remains poorly characterized corresponds to juxtaposed TCV hairpins H4a and H4b and pseudoknot psi(3), which are required for the TCV-specific requirement of translation (V. A. Stupina et al., RNA 14:2379-2393, 2008). Replacement of satC H4a with randomized sequence and scoring for fitness in plants by in vivo genetic selection (SELEX) resulted in winning sequences that contain an H4a-like stem-loop, which can have additional upstream sequence composing a portion of the stem. SELEX of the combined H4a and H4b region in satC generated three distinct groups of winning sequences. One group models into two stem-loops similar to H4a and H4b of TCV. However, the selected sequences in the other two groups model into single hairpins. Evolution of these single-hairpin SELEX winners in plants resulted in satC that can accumulate to wild-type (wt) levels in protoplasts but remain less fit in planta when competed against wt satC. These data indicate that two highly distinct RNA conformations in the H4a and H4b region can mediate satC fitness in protoplasts. PMID:19004956

Guo, Rong; Lin, Wai; Zhang, Jiuchun; Simon, Anne E; Kushner, David B

2008-11-12

58

Genetic variants and prostate cancer risk: candidate replication and exploration of viral restriction genes  

PubMed Central

Genetic variants underlying the strong heritable component of prostate cancer remain largely unknown. Genome-wide association studies of prostate cancer have yielded several variants that have significantly replicated across studies, predominantly in cases unselected for family history of prostate cancer. Additional candidate gene variants have also been proposed, many evaluated within familial prostate cancer study populations. Such variants hold great potential value for risk stratification, particularly for early onset or aggressive prostate cancer, given co-morbidities associated with current therapies. Here, we investigate a Caucasian study population of 523 independent familial prostate cancer cases and 523 age-matched controls without a personal or family history of prostate cancer. We replicate identified associations at genome-wide association study loci 8q24, 11q13, and 2p15 (P = 2.9 × 10?4 to P = 4.7 × 10?5), demonstrating study population power. We also find evidence to support reported associations at candidate genes RNASEL, EZH2, and NKX3-1 (P = 0.031 to P = 0.0085). We further explore a set of candidate genes related to RNASEL and to its role in retroviral restriction, identifying nominal associations at XPR1 and RBM9. Effects at 8q24 appear more pronounced for those diagnosed at an early age, while at 2p15 and RNASEL effects were more pronounced at a later age. However, these trends did not reach statistical significance. Effects at 2p15 were statistically significantly more pronounced for those diagnosed with aggressive disease.

Breyer, Joan P.; McReynolds, Kate M.; Yaspan, Brian L.; Bradley, Kevin M.; Dupont, William D.; Smith, Jeffrey R.

2009-01-01

59

Genetic characterization of bovine viral diarrhoea (BVD) viruses: confirmation of the presence of BVD genotype 2 in Africa.  

PubMed

Bovine viral diarrhoea virus (BVDV) has emerged as one of the economically important pathogens in cattle populations, with a worldwide distribution and causing a complex of disease syndromes. Two genotypes, BVDV 1 and 2, exist and are discriminated on the basis of the sequence of the 5' non-coding region (5' NCR) using real-time PCR. Real-time PCR is more sensitive, specific, and less time-consuming than conventional PCR, and it has less risk of cross-contamination of samples. Limited information exists on BVDV genetic subtypes in South Africa. The aim of this study was to determine the genotypes of BVDV currently circulating in South African feedlots. A total of 279 specimens (219 tissue samples, 59 trans-tracheal aspirates and 1 blood sample) were collected from dead and living cattle with lesions or clinical signs compatible with BVDV infection. Pooled homogenates from the same animals were prepared, and total RNA was extracted. A screening test was performed on the pooled samples, and positive pools were investigated individually. A Cador BVDV Type 1/2 RT-PCR Kit (QIAGEN, Hilden, Germany) was used for the real-time PCR assay on a LightCycler(®) V2.0 real-time PCR machine (Roche Diagnostics, Mannheim, Germany). The results were read at 530 and 640 nm for BVDV 1 and 2, respectively. Bovine viral diarrhoea virus was detected in a total of 103 samples that included 91 tissue samples, 1 blood sample and 11 trans-tracheal aspirates. Eighty-five (82.5 %) of the strains were genotype 1 and 18 (17.5 %) were genotype 2. Comparing the sequencing data, genotypes 1 and 2 from the field strains did not cluster with vaccine strains currently used in feedlots in South Africa. The present study revealed the presence of BVDV genotype 2 in cattle in South Africa based on the high sequence similarity between genotype 2 field strains and strain 890 from North America. The presence of genotype 2 viruses that phylogenetically belong to different clusters and coexist in feedlots is consistent with the possibility of multiple virus introductions. These results represent the first documented evidence for the presence of BVDV genotype 2 in African cattle. PMID:23011308

Ularamu, H G; Sibeko, K P; Bosman, A B; Venter, E H; van Vuuren, M

2012-09-26

60

A Forward-Genetic Screen and Dynamic Analysis of Lambda Phage Host-Dependencies Reveals an Extensive Interaction Network and a New Anti-Viral Strategy  

Microsoft Academic Search

Latently infecting viruses are an important class of virus that plays a key role in viral evolution and human health. Here we report a genome-scale forward-genetics screen for host-dependencies of the latently-infecting bacteriophage lambda. This screen identified 57 Escherichia coli (E. coli) genes—over half of which have not been previously associated with infection—that when knocked out inhibited lambda phage's ability

Nathaniel D. Maynard; Elsa W. Birch; Jayodita C. Sanghvi; Lu Chen; Miriam V. Gutschow; Markus W. Covert

2010-01-01

61

Appropriate use of genetic manipulation for the development of restoration plant materials  

Technology Transfer Automated Retrieval System (TEKTRAN)

The diversity of restoration plant material development approaches reflect a variety of philosophies that represent what should and can be accomplished by restoration. The "natural" approach emphasizes emulation of putative naturally occurring patterns of genetic variation. The "genetically manipu...

62

In vitro viral haemorrhagic septicaemia virus replication in excised fins of rainbow trout: correlation with resistance to waterborne challenge and genetic variation.  

PubMed

In vitro viral haemorrhagic septicaemia virus replication in excised fin tissue (VREFT) was investigated as a possible criterion to predict the resistance of groups or individuals to viral haemorrhagic septicaemia virus (VHSV) in rainbow trout. Adipose and rayed fins were compared for VREFT response, and a statistically significant correlation was found. Correlation between VREFT and survival after waterborne viral challenge was estimated on a set of 27 groups of trout, and was highly significant (R = 0.72). A further experiment with fish individually tagged and challenged some time after fin clipping for determination of VREFT confirmed that the mean value of resistant (surviving) fish was significantly lower than the mean value of susceptible (dead) ones, but there was a wide variation within each of these groups. In particular, a large proportion of fish expected to be resistant based on VREFT values died all the same. Using clones, we showed that the correlation between VREFT and survival was dramatically high (R = 0.96). Genetic analyses of the data from the different groups available in the experiment consistently indicated a large amount of genetic determination of VREFT, an encouraging result for selection purposes. Though these results were obtained in experimentally controlled conditions not identical to those in the field, they shed new light on the analysis of defence mechanisms against the virus and on the possibility of performing indirect selection for resistance, using VREFT as the secondary character. PMID:11558726

Quillet, E; Dorson, M; Aubard, G; Torhy, C

2001-08-01

63

Baculovirus expression system and method for high throughput expression of genetic material  

DOEpatents

The present invention provides novel recombinant baculovirus expression systems for expressing foreign genetic material in a host cell. Such expression systems are readily adapted to an automated method for expression foreign genetic material in a high throughput manner. In other aspects, the present invention features a novel automated method for determining the function of foreign genetic material by transfecting the same into a host by way of the recombinant baculovirus expression systems according to the present invention.

Clark, Robin (Benecia, CA); Davies, Anthony (Mill Valley, CA)

2001-01-01

64

Comparative evaluation of the performance of the Abbott RealTime HIV-1 assay for measurement of HIV-1 plasma viral load on genetically diverse samples from Greece  

PubMed Central

Background HIV-1 is characterized by increased genetic heterogeneity which tends to hinder the reliability of detection and accuracy of HIV-1 RNA quantitation assays. Methods In this study, the Abbott RealTime HIV-1 (Abbott RealTime) assay was compared to the Roche Cobas TaqMan HIV-1 (Cobas TaqMan) and the Siemens Versant HIV-1 RNA 3.0 (bDNA 3.0) assays, using clinical samples of various viral load levels and subtypes from Greece, where the recent epidemiology of HIV-1 infection has been characterized by increasing genetic diversity and a marked increase in subtype A genetic strains among newly diagnosed infections. Results A high correlation was observed between the quantitative results obtained by the Abbott RealTime and the Cobas TaqMan assays. Viral load values quantified by the Abbott RealTime were on average lower than those obtained by the Cobas TaqMan, with a mean (SD) difference of -0.206 (0.298) log10 copies/ml. The mean differences according to HIV-1 subtypes between the two techniques for samples of subtype A, B, and non-A/non-B were 0.089, -0.262, and -0.298 log10 copies/ml, respectively. Overall, differences were less than 0.5 log10 for 85% of the samples, and >1 log10 in only one subtype B sample. Similarly, Abbott RealTime and bDNA 3.0 assays yielded a very good correlation of quantitative results, whereas viral load values assessed by the Abbott RealTime were on average higher (mean (SD) difference: 0.160 (0.287) log10 copies/ml). The mean differences according to HIV-1 subtypes between the two techniques for subtype A, B and non-A/non-B samples were 0.438, 0.105 and 0.191 log10 copies/ml, respectively. Overall, the majority of samples (86%) differed by less than 0.5 log10, while none of the samples showed a deviation of more than 1.0 log10. Conclusions In an area of changing HIV-1 subtype pattern, the Abbott RealTime assay showed a high correlation and good agreement of results when compared both to the Cobas TaqMan and bDNA 3.0 assays, for all HIV-1 subtypes tested. All three assays could determine viral load from samples of different HIV-1 subtypes adequately. However, assay variation should be taken into account when viral load monitoring of the same individual is assessed by different systems.

2011-01-01

65

A genome-to-genome analysis of associations between human genetic variation, HIV-1 sequence diversity, and viral control.  

PubMed

HIV-1 sequence diversity is affected by selection pressures arising from host genomic factors. Using paired human and viral data from 1071 individuals, we ran >3000 genome-wide scans, testing for associations between host DNA polymorphisms, HIV-1 sequence variation and plasma viral load (VL), while considering human and viral population structure. We observed significant human SNP associations to a total of 48 HIV-1 amino acid variants (p<2.4 × 10(-12)). All associated SNPs mapped to the HLA class I region. Clinical relevance of host and pathogen variation was assessed using VL results. We identified two critical advantages to the use of viral variation for identifying host factors: (1) association signals are much stronger for HIV-1 sequence variants than VL, reflecting the 'intermediate phenotype' nature of viral variation; (2) association testing can be run without any clinical data. The proposed genome-to-genome approach highlights sites of genomic conflict and is a strategy generally applicable to studies of host-pathogen interaction. DOI:http://dx.doi.org/10.7554/eLife.01123.001. PMID:24171102

Bartha, István; Carlson, Jonathan M; Brumme, Chanson J; McLaren, Paul J; Brumme, Zabrina L; John, Mina; Haas, David W; Martinez-Picado, Javier; Dalmau, Judith; López-Galíndez, Cecilio; Casado, Concepción; Rauch, Andri; Günthard, Huldrych F; Bernasconi, Enos; Vernazza, Pietro; Klimkait, Thomas; Yerly, Sabine; O'Brien, Stephen J; Listgarten, Jennifer; Pfeifer, Nico; Lippert, Christoph; Fusi, Nicolo; Kutalik, Zoltán; Allen, Todd M; Müller, Viktor; Harrigan, P Richard; Heckerman, David; Telenti, Amalio; Fellay, Jacques

2013-10-29

66

A genome-to-genome analysis of associations between human genetic variation, HIV-1 sequence diversity, and viral control  

PubMed Central

HIV-1 sequence diversity is affected by selection pressures arising from host genomic factors. Using paired human and viral data from 1071 individuals, we ran >3000 genome-wide scans, testing for associations between host DNA polymorphisms, HIV-1 sequence variation and plasma viral load (VL), while considering human and viral population structure. We observed significant human SNP associations to a total of 48 HIV-1 amino acid variants (p<2.4 × 10?12). All associated SNPs mapped to the HLA class I region. Clinical relevance of host and pathogen variation was assessed using VL results. We identified two critical advantages to the use of viral variation for identifying host factors: (1) association signals are much stronger for HIV-1 sequence variants than VL, reflecting the ‘intermediate phenotype’ nature of viral variation; (2) association testing can be run without any clinical data. The proposed genome-to-genome approach highlights sites of genomic conflict and is a strategy generally applicable to studies of host–pathogen interaction. DOI: http://dx.doi.org/10.7554/eLife.01123.001

Bartha, Istvan; Carlson, Jonathan M; Brumme, Chanson J; McLaren, Paul J; Brumme, Zabrina L; John, Mina; Haas, David W; Martinez-Picado, Javier; Dalmau, Judith; Lopez-Galindez, Cecilio; Casado, Concepcion; Rauch, Andri; Gunthard, Huldrych F; Bernasconi, Enos; Vernazza, Pietro; Klimkait, Thomas; Yerly, Sabine; O'Brien, Stephen J; Listgarten, Jennifer; Pfeifer, Nico; Lippert, Christoph; Fusi, Nicolo; Kutalik, Zoltan; Allen, Todd M; Muller, Viktor; Harrigan, P Richard; Heckerman, David; Telenti, Amalio; Fellay, Jacques

2013-01-01

67

Development of hybrid viral vectors for gene therapy.  

PubMed

Adenoviral, retroviral/lentiviral, adeno-associated viral, and herpesviral vectors are the major viral vectors used in gene therapy. Compared with non-viral methods, viruses are highly-evolved, natural delivery agents for genetic materials. Despite their remarkable transduction efficiency, both clinical trials and laboratory experiments have suggested that viral vectors have inherent shortcomings for gene therapy, including limited loading capacity, immunogenicity, genotoxicity, and failure to support long-term adequate transgenic expression. One of the key issues in viral gene therapy is the state of the delivered genetic material in transduced cells. To address genotoxicity and improve the therapeutic transgene expression profile, construction of hybrid vectors have recently been developed. By adding new abilities or replacing certain undesirable elements, novel hybrid viral vectors are expected to outperform their conventional counterparts with improved safety and enhanced therapeutic efficacy. This review provides a comprehensive summary of current achievements in hybrid viral vector development and their impact on the field of gene therapy. PMID:23070017

Huang, Shuohao; Kamihira, Masamichi

2012-10-13

68

Viral pneumonia.  

PubMed

Viral pneumonias are common in infants and young children but rare in adults. Respiratory syncytial virus (RSV) and para-influenza viruses are the most frequent viral pathogens in infants and children. Influenza virus types A and B account for over one half of viral pneumonias in adults. Immunocompromised hosts are susceptible to pneumonias caused by cytomegalovirus (CMV) and other herpesviruses, as well as rubeola and adenovirus. Diagnosis of viral pneumonia depends on appropriate viral cultures and acute and convalescent sera for specific antibodies. Superinfection with bacteria is common in adults. Anti-viral therapy is available for several respiratory viruses. Ribavirin, amantadine/rimantadine, interferon alpha, and acyclovir are antiviral drugs that may be of benefit in treatment and prophylaxis. Prevention of viral pneumonia will depend upon improved viral immunization practices. PMID:1659594

Greenberg, S B

1991-09-01

69

IN VIVO STUDIES ON POSSIBLE HEALTH CONSEQUENCES OF GENETICALLY MODIFIED FOOD AND FEED—WITH PARTICULAR REGARD TO INGREDIENTS CONSISTING OF GENETICALLY MODIFIED PLANT MATERIALS  

Microsoft Academic Search

This synopsis reviews published in vivo studies on possible health consequences of genetically modified food and feed where the ingredients in question have consisted of genetically modified plant materials. The following, however, have not been taken into consideration: -ingredients consisting of genetically modified microorganisms or parts of animals\\/fish -ingredients produced by\\/from genetically modified organisms but without any DNA present -studies

IAN F. PRYME; ROLF LEMBCKE

70

62 FR 17720 - Bacillus Thuringiensis Subspecies Kurstaki CryIA(c) and the Genetic Material Necessary for Its...  

Federal Register 2010, 2011, 2012, 2013

...Genetic Material Necessary for Its Production in All Plants; Exemption From the Requirement of a Tolerance on All Raw Agricultural Commodities AGENCY: Environmental...genetic material necessary for its production in all plants when used as plant-pesticides...

1997-04-11

71

Cellular Mobile Genetic Elements in the Regulatory Region of the Pneumotropic Mouse Polyomavirus Genome: Structure and Function in Viral Gene Expression and DNA Replication  

PubMed Central

DNA from the murine pneumotropic virus was extracted from virus in lung tissue of infected mice, and the regulatory region of the genome was amplified by PCR. The regulatory region of individual plasmid cloned DNA molecules appeared to have heterogeneous enhancer segments, whereas the protein-coding part of the genome had a uniform length. Nucleotide sequence analysis revealed that the majority of the DNA molecules had a structure differing from the standard type. A 220-bp insertion at nucleotide position 142 with a concomitant deletion of nucleotides 143 to 148 was prominent. There were two variants of the 220-bp insertion, differing at two nucleotide positions at one of the termini. Other DNA molecules had complete or partial deletions of these structures and surrounding sequences in the viral enhancer. However, the end of the insertion at nucleotide 142 was frequently preserved. The viral early and late promoter activity of the variant regulatory regions was tested in a luciferase reporter assay by using transfected NIH 3T3 cells. In relation to the standard-type DNA, all variants, including a G272T mutant, had much stronger late promoters. In contrast, the early promoter activity was influenced in a positive or negative direction by individual mutations. Also, the activity of the viral origin of DNA replication was affected by the sequence variation of the regulatory region, although the effects were smaller than for the late promoter. Analysis by Southern blotting and quantification using dot blots showed that approximately 103 copies of material related to the 220-bp insert in murine pneumotropic virus DNA was present in mouse and human DNA but not in Escherichia coli DNA. Moreover, analysis by PCR indicated that there were multiple copies in the mouse genome of sequences that were identical or closely related to the 220-bp viral DNA segment. These data together with the nucleotide sequence analysis suggest that the 220-bp insertion is related to a transposable element of a novel type.

Zhang, Shouting; Magnusson, Goran

2003-01-01

72

Financial performance of using genetically improved regeneration material of Scots pine ( Pinus sylvestris L.) in Finland  

Microsoft Academic Search

The financial viability of using improved seed material of Scots pine was assessed in Finnish conditions. Based on a few dozen\\u000a field trials, a range of genetic gains for height growth was incorporated into a stand simulator. Technically genetic gain\\u000a was modelled into individual growth models by applying the Chapman-Richards type function and using genetic gain estimates\\u000a as asymptotic scaling

A. Ahtikoski; R. Ojansuu; M. Haapanen; J. Hynynen; K. Kärkkäinen

73

Evolutionary computation system for problem-tailored genetic optimization of catalytic materials  

Microsoft Academic Search

The paper addresses key problems pertaining to the commonly used evolutionary approach to optimization of catalytic materials. These are on the one hand the narrow scope of genetic algorithms developed specifically for searching optimal catalyst, on the other hand the insufficient dealing in existing implementations of genetic algorithms with mixed opti- mization. The paper outlines a program generator automatically generating

Martin Holena; David Linke; Uwe Rodemerck

2010-01-01

74

Ovine Reference Materials and Assays for Prion Genetic Testing  

Technology Transfer Automated Retrieval System (TEKTRAN)

Background: Genetic predisposition to scrapie in sheep is associated with variation in the peptide sequence of the ovine prion protein encoded by Prnp. Codon variants implicated in scrapie susceptibility or disease progression include those at amino acid positions 112, 136, 141, 154, and 171. Nin...

75

Viral infection  

PubMed Central

Viruses have developed different survival strategies in host cells by crossing cell-membrane compartments, during different steps of their viral life cycle. In fact, the non-regenerative viral membrane of enveloped viruses needs to encounter the dynamic cell-host membrane, during early steps of the infection process, in which both membranes fuse, either at cell-surface or in an endocytic compartment, to promote viral entry and infection. Once inside the cell, many viruses accomplish their replication process through exploiting or modulating membrane traffic, and generating specialized compartments to assure viral replication, viral budding and spreading, which also serve to evade the immune responses against the pathogen. In this review, we have attempted to present some data that highlight the importance of membrane dynamics during viral entry and replicative processes, in order to understand how viruses use and move through different complex and dynamic cell-membrane structures and how they use them to persist.

Puigdomenech, Isabel; de Armas-Rillo, Laura; Machado, Jose-David

2011-01-01

76

Delivery of reprogramming factors into fibroblasts for generation of non-genetic induced pluripotent stem cells using a cationic bolaamphiphile as a non-viral vector.  

PubMed

Protein delivery allows a clinical effect to be directly realized without genetic modification of the host cells. We have developed a cationic bolaamphiphile as a non-viral vector for protein delivery application. The relatively low toxicity and efficient protein delivery by the cationic bolaamphiphile prompted us to test the system for the generation of induced pluripotent stem cells (iPSCs) as an alternative to the conventional vector-based genetic approach. Studies on the kinetics and cytotoxicity of the protein delivery system led us to use an optimized cationic bolaamphiphile-protein complex ratio of 7:1 (wt/wt) and a 3 h period of incubation with human fibroblasts, to ensure complete and non-toxic protein delivery of the reprogramming proteins. The reprogrammed cells were shown to exhibit the characteristics of embryonic stem cells, including expression of pluripotent markers, teratoma formation in SCID mice, and ability to be differentiated into a specific lineage, as exemplified by neuronal differentiation. PMID:23601660

Khan, Majad; Narayanan, Karthikeyan; Lu, Hongfang; Choo, Yang; Du, Chan; Wiradharma, Nikken; Yang, Yi-Yan; Wan, Andrew C A

2013-04-16

77

Genetic Recombination between Mouse Type C RNA Viruses: A Mechanism for Endogenous Viral Gene Amplification in Mammalian Cells  

Microsoft Academic Search

A strategy based on the identification of type-specific antigenic determinants in the transitional products of gag (p15, p12, and p30 proteins), pol (reverse transcriptase), and env (gp70 glycoproteins) genes of mammalian type C viruses has been used to study genetic recombination between these RNA viruses. By this approach, recombinants involving exogenous and endogenous mouse type C viruses have been identified

Mariano Barbacid; Keith C. Robbins; Shigeo Hino; Stuart A. Aaronson

1978-01-01

78

ACMG statement: Statement on storage and use of genetic materials  

SciTech Connect

The sensitivities of DNA analytic methods have increased dramatically in the past several years. Use of such tests to analyze an individual`s genome could reveal parental origin or provide forensic evidence, as well as determine an individual`s complement of normal and abnormal genes. Some of the abnormal genes detected cause diseases in infancy, while the effects of others may become manifest only in adulthood. Finally, detection of specific, acquired genomic changes may indicate increased susceptibility to or herald the onset of certain malignancies. Many health professionals as well as lay people may not appreciate how frequently biological samples are stored and how easily samples that have been stored for an unrelated reason could be used for genetic analysis in the future. The potential problems posed by such uses were explored at length in a Workshop sponsored by the National Center for Human Genome Research and the Centers for Diseases Control and Prevention. ACMG members, recognizing these issues, may have concerns about access by insurers, employers, and others to samples or test results. Developing practices to be used at the time samples are obtained could alleviate problems that might arise in the future as the breadth and scope or potential genetic analyses increase. 6 refs.

NONE

1995-12-01

79

Molecular piracy: the viral link to carcinogenesis.  

PubMed

The vast majority of the human experience with viral infections is associated with acute symptoms, such as malaise, fever, chills, rhinitis and diarrhea. With this acute or lytic phase, the immune system mounts a response and eliminates the viral agent while acquiring antibodies to that specific viral subtype. With latent or chronic infections, the viral agent becomes incorporated into the human genome. Viral agents capable of integration into the host's genetic material are particularly dangerous and may commandeer the host's ability to regulate normal cell growth and proliferation. The oncogenic viruses may immortalize the host cell, and facilitate malignant transformation. Cell growth and proliferation may be enhanced by viral interference with tumor suppressor gene function (p53 and pRb). Viruses may act as vectors for mutated proto-oncogenes (oncogenes). Overexpression of these oncogenes in viral-infected cells interferes with normal cell function and allows unregulated cell growth and proliferation, which may lead to malignant transformation and tumour formation. Development of oral neoplasms, both benign and malignant, has been linked to several viruses. Epstein-Barr virus is associated with oral hairy leukoplakia, lymphoproliferative disease, lymphoepithelial carcinoma, B-cell lymphomas, and nasopharyngeal carcinoma. Human herpesvirus-8 has been implicated in all forms of Kaposi's sarcoma, primary effusion lymphomas, multiple myeloma, angioimmunoblastic lymphadenopathy, and Castleman's disease. Human herpesvirus-6 has been detected in lymphoproliferative disease, lymphomas, Hodgkin's disease, and oral squamous cell carcinoma. The role of human papillomavirus in benign (squamous papilloma, focal epithelial hyperplasia, condyloma acuminatum, verruca vulgaris), premalignant (oral epithelial dysplasia), and malignant (squamous cell carcinoma) neoplasms within the oral cavity is well recognized. Herpes simplex virus may participate as a cofactor in oral squamous cell carcinoma development by enhancing activation, amplification, and overexpression of pre-existing oncogenes within neoplastic tissues. Because of the integral role of viruses in malignant transformation of host cells, innovative antiviral therapy may prevent tumour development, involute neoplastic proliferations, or arrest malignant progression. PMID:9930354

Flaitz, C M; Hicks, M J

1998-11-01

80

Raw Sewage Harbors Diverse Viral Populations  

PubMed Central

ABSTRACT At this time, about 3,000 different viruses are recognized, but metagenomic studies suggest that these viruses are a small fraction of the viruses that exist in nature. We have explored viral diversity by deep sequencing nucleic acids obtained from virion populations enriched from raw sewage. We identified 234 known viruses, including 17 that infect humans. Plant, insect, and algal viruses as well as bacteriophages were also present. These viruses represented 26 taxonomic families and included viruses with single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), positive-sense ssRNA [ssRNA(+)], and dsRNA genomes. Novel viruses that could be placed in specific taxa represented 51 different families, making untreated wastewater the most diverse viral metagenome (genetic material recovered directly from environmental samples) examined thus far. However, the vast majority of sequence reads bore little or no sequence relation to known viruses and thus could not be placed into specific taxa. These results show that the vast majority of the viruses on Earth have not yet been characterized. Untreated wastewater provides a rich matrix for identifying novel viruses and for studying virus diversity. Importance At this time, virology is focused on the study of a relatively small number of viral species. Specific viruses are studied either because they are easily propagated in the laboratory or because they are associated with disease. The lack of knowledge of the size and characteristics of the viral universe and the diversity of viral genomes is a roadblock to understanding important issues, such as the origin of emerging pathogens and the extent of gene exchange among viruses. Untreated wastewater is an ideal system for assessing viral diversity because virion populations from large numbers of individuals are deposited and because raw sewage itself provides a rich environment for the growth of diverse host species and thus their viruses. These studies suggest that the viral universe is far more vast and diverse than previously suspected.

Cantalupo, Paul G.; Calgua, Byron; Zhao, Guoyan; Hundesa, Ayalkibet; Wier, Adam D.; Katz, Josh P.; Grabe, Michael; Hendrix, Roger W.; Girones, Rosina; Wang, David; Pipas, James M.

2011-01-01

81

Advances in viral oncology  

SciTech Connect

Volume 6 of Advances in Viral Oncology presents experimental approaches to multifactorial interactions in tumor development. Included are in-depth analyses of malignant phenotypes by oncogene complementation, as well as studies of complementary interactions among DNA viral oncogenes; multiple cell-derived sequences in single retroviral genomes; and sequences that influence the transforming activity and expression of the mos oncogene. The genetic regulation of tumorigenic expression in somatic cell hybrids, the inhibition of oncogenes by cellular genes, and the interaction of genes that favor and genes that suppress tumorigenesis are examined in detail. The book concludes with a study of the relationship of oncogenes to the evolution of the metastatic phenotype.

Klein, G.

1987-01-01

82

Appropriate Use of Genetic Manipulation for the Development of Restoration Plant Materials  

Microsoft Academic Search

\\u000a The diversity of approaches for developing restoration plant material reflects a variety of philosophies that represent what\\u000a can and should be accomplished by restoration. The “natural” approach emphasizes emulation of putative naturally occurring\\u000a patterns of genetic variation. The “genetically manipulated” approach involves such techniques as artificial selection, hybridization,\\u000a bulking, and chromosome doubling to create populations that are ostensibly as well

T. A. Jones; J. G. Robins

83

Advantages of using molecular coancestry in the removal of introgressed genetic material  

PubMed Central

Background When introgression of undesired exogenous genetic material occurs in a population intended to remain pure, actions are necessary to recover the original background. It has been shown that genome-wide information can replace pedigree information for different objectives and is a valuable tool in the fields of genetic conservation and breeding. In this simulation study, molecular information provided by 50 000 SNP was used to minimise the molecular coancestry between individuals of an admixed population and the foreign individuals that originally introgressed a native population in order to remove the exogenous DNA. Results This management method, which detects the ‘purest’ individuals to be used as parents for the next generation, allowed recovery of the native genetic background to a great extent in all simulated scenarios. However, it also caused an increase in inbreeding larger than expected because of the lower number of individuals selected as parents and the higher coancestry between them. In scenarios involving several introgression events the method was more efficient than in those involving a single introgression event because part of the genetic information was mixed with the native genetic material for a shorter period. Conclusions Genome-wide information can be used to identify the purest individuals via the minimisation of molecular coancestry between individuals of the admixed and exogenous populations. Removal of the undesired genetic material is more efficient with a molecular-based approach than with a pedigree-based approach.

2013-01-01

84

Viral Infections  

MedlinePLUS

... also cause severe illnesses such as HIV/AIDS, smallpox and hemorrhagic fevers. Viruses are like hijackers. They ... work for viral infections. There are a few antiviral medicines available. Vaccines can help prevent you from ...

85

[Viral hepatitis].  

PubMed

Viral hepatitis is associated with significant morbidity and mortality worldwide. Hepatitis A and E viruses are enterally transmitted and lead to usually self-limited acute hepatitis. Hepatitis B, C and D viruses are transmitted by parenteral routes and can lead to chronic hepatitis with progression to liver cirrhosis and hepatocellular carcinoma. Here, we briefly review current understanding and new developments in the virology and epidemiology, diagnosis, natural history, therapy and prevention of viral hepatitis. PMID:21452137

Moradpour, Darius; Blum, Hubert E

2011-04-01

86

Viral Hepatitis  

Microsoft Academic Search

Various forms of viral hepatitis have been identified as being sexually transmitted infections (STIs), whereas other forms\\u000a are transmitted primarily via oralfecal routes. The most common forms of viral hepatitis are hepatitis A, B, and C. Hepatitis\\u000a A virus (HAV) infection is most often a benign self-limiting disease; however, it can progress to fulminant liver failure.\\u000a Fecal-oral transmission though contact

Michelle L. Geller; Jeremy R. Herman

87

Material Symmetries from Ultrasonic Velocity Measurements: A Genetic Algorithm Based Blind Inversion Method  

NASA Astrophysics Data System (ADS)

The determination of material symmetries and principle plane orientations of anisotropic plates, whose planes of symmetries are not known apriori, were calculated using a Genetic Algorithm (GA) based blind inversion method. The ultrasonic phase velocity profiles were used as input data to the inversion. The assumption of a general anisotropy was imposed during the start of each blind inversion. The multi-parameter solution space of the Genetic Algorithm was exploited to identify the ``statistically significant'' solution sets of elastic moduli in the geometric coordinate system of the plate, by thresholding the coefficients-of-variation (Cv). Using these ``statistically significant'' elastic moduli, the unknown material symmetry and the principle planes (angles between the geometrical coordinates and the material symmetry coordinates) were evaluated using the method proposed by Cowin and Mehrabadi. This procedure was verified using simulated ultrasonic velocity data sets on material with orthotropic symmetry. Experimental validation was also performed on unidirectional Graphite Epoxy [0]7s fiber reinforced composite plate.

Vardhan, J. Vishnu; Krishnamurthy, C. V.; Balasubramaniam, Krishnan

2007-03-01

88

Material Symmetries from Ultrasonic Velocity Measurements: A Genetic Algorithm Based Blind Inversion Method  

SciTech Connect

The determination of material symmetries and principle plane orientations of anisotropic plates, whose planes of symmetries are not known apriori, were calculated using a Genetic Algorithm (GA) based blind inversion method. The ultrasonic phase velocity profiles were used as input data to the inversion. The assumption of a general anisotropy was imposed during the start of each blind inversion. The multi-parameter solution space of the Genetic Algorithm was exploited to identify the 'statistically significant' solution sets of elastic moduli in the geometric coordinate system of the plate, by thresholding the coefficients-of-variation (Cv). Using these ''statistically significant'' elastic moduli, the unknown material symmetry and the principle planes (angles between the geometrical coordinates and the material symmetry coordinates) were evaluated using the method proposed by Cowin and Mehrabadi. This procedure was verified using simulated ultrasonic velocity data sets on material with orthotropic symmetry. Experimental validation was also performed on unidirectional Graphite Epoxy [0]7s fiber reinforced composite plate.

Vardhan, J. Vishnu; Balasubramaniam, Krishnan [Department of Mechanical Engineering, Indian Institute of Technology, Chennai-600 036 (India); Krishnamurthy, C. V. [Center for Nondestructive Evaluation, Indian Institute of Technology, Chennai-600 036 (India)

2007-03-21

89

Small Organic Molecules in Pre-Cometary Ices: The Origins of Genetic Material  

Microsoft Academic Search

Speaking of genetic material, one thinks of DNA first. An understanding of its fairly complex structure, composed of the sugar deoxyribose, phosphorous acid, and the purine- and pyrimidine-bases, adenine, guanine, cytosine, and thymine has led to the abandonment of theories of its spontaneous creation. In recent times, a number of theories regarding the evolutionary precursors of DNA have been presented.

J. H. Bredehöft; U. J. Meierhenrich; W. Thiemann; H. Rosenbauer; M. Nuevo; G. M. Muñoz Caro; L. D'Hendecourt

2004-01-01

90

Huntsman Cancer Institute scientists discover new method to identify cancer-causing rearrangements of genetic material  

Cancer.gov

Researchers from Huntsman Cancer Institute at the University of Utah report they have discovered a method to identify cancer-causing rearrangements of genetic material called chromosomal translocations quickly, accurately, and inexpensively. A description of the method and the research results appear online in this month's issue of the EMBO Molecular Medicine journal.

91

VIRAL GASTROENTERITIS  

EPA Science Inventory

Two virus types have been clearly shown to have epidemiologic importance in viral gastroenteritis, i.e., rotavirus and Norwalk virus. Four other virus types have been associated with gastroenteritis but their epidemiologic importance is not yet known, i.e., enteric adenovirus, ca...

92

Genetic Analysis of cis Regulatory Elements within the 5? Region of the Human Papillomavirus Type 31 Upstream Regulatory Region during Different Stages of the Viral Life Cycle  

PubMed Central

The function of the 5? region of the upstream regulatory region (URR) in regulating E6/E7 expression in cancer-associated papillomaviruses has been largely uncharacterized. In this study we used linker-scanning mutational analysis to identify potential cis regulatory elements contained within a portion of the 5? region of the URR that are involved in regulating transcription of the E6/E7 promoter at different stages of the viral life cycle. The mutational analysis illustrated differences in the transcriptional utilization of specific regions of the URR depending on the stage of the viral life cycle. This study identified (i) viral cis elements that regulate transcription in the presence and absence of any viral gene products or viral DNA replication, (ii) the role of host tissue differentiation in viral transcriptional regulation, and (iii) cis regulatory regions that are effected by induction of the protein kinase C pathway. Our studies have provided an extensive map of functional elements in the 5? region (nuncleotides 7259 to 7510) of the human papillomavirus type 31 URR that are involved in the regulation of p99 promoter activity at different stages of the viral life cycle.

Sen, Ellora; Bromberg-White, Jennifer L.; Meyers, Craig

2002-01-01

93

Abundant dissolved genetic material in Arctic sea ice Part II: Viral dynamics during autumn freeze-up  

Microsoft Academic Search

Viruses play a significant role in nutrient cycling within the world’s oceans and are important agents of horizontal gene\\u000a transfer, but little is know about their entrainment into sea ice or their temporal dynamics once entrained. Nilas, grease\\u000a ice, pancake ice, first-year sea ice floes up to 78 cm in thickness, and under-ice seawater were sampled widely across Amundsen\\u000a Gulf (ca.

R. Eric Collins; Jody W. Deming

94

Genetic heterogeneity in psoriasis vulgaris based on linkage analyses of a large family material  

SciTech Connect

Information on psoriasis among parents and siblings in 14,008 families has been collected. On the basis of this material, evidence for monogenetic autosomal recessive inheritance of psoriasis has recently been presented. Indications from more than one type of non-pustular psoriasis has been obtained from the population genetic data. Molecular genetic linkage analysis of psoriasis to a number of polymorphic genetic markers for a large number of families has been made. It is apparent that there is genetic heterogeneity in a psoriasis population with regard to psoriasis genes. Using the computer program Linkage 5.0 and a formula for heterogeneity, a lodscore over 3.0 for one locus has been obtained. This locus has further been confirmed by several other markers in the vicinity. The locus found is linked to slightly over half of the families, indicating that there are more genetically independent types of psoriasis. The age at onset of those families that are apparently linked to this locus have a slightly higher age at onset than those not linked to that locus but with a considerable overlap. In spite of close coverage of the whole chromosomes number 6 and 17, no linkage has been found in this regions. This indicates that neither the HLA region nor the region earlier found to be involved in one family with psoriasis are primarily involved in our families.

Wahlstroem, J.; Swanbeck, G.; Inerot, A. [ Univ. of Goeteborg (Sweden)] [and others

1994-09-01

95

Viral evolution  

NASA Astrophysics Data System (ADS)

In the last two decades, viruses have been used as model systems to study evolution in short periods of time. Due to their characteristics, virus adapt rapidly to changing conditions, thus allowing the quantification of several evolutionary features under controlled laboratory conditions. Here we review the basic biology of viruses and describe in detail a number of experiments performed with RNA viruses. Particular emphasis is devoted to the interpretation of the experiments and to the involved phenomenology. This analysis sometimes represents the basis to formulate simple evolutionary models that aim at describing the observed dynamics. In other cases, theoretical results have prompted the realization of related experiments, as we discuss. Concepts as fitness loss and fitness recovery, the error threshold, increased mutagenesis, viral sex, or viral competition and interference, are discussed in an empirical framework and from the associated theoretical point of view.

Manrubia, Susanna C.; Lázaro, Ester

2006-06-01

96

Viral infection, inflammation and schizophrenia.  

PubMed

Schizophrenia is a severe neurodevelopmental disorder with genetic and environmental etiologies. Prenatal viral/bacterial infections and inflammation play major roles in the genesis of schizophrenia. In this review, we describe a viral model of schizophrenia tested in mice whereby the offspring of mice prenatally infected with influenza at E7, E9, E16, and E18 show significant gene, protein, and brain structural abnormalities postnatally. Similarly, we describe data on rodents exposed to bacterial infection or injected with a synthetic viral mimic (PolyI:C) also demonstrating brain structural and behavioral abnormalities. Moreover, human serologic data has been indispensible in supporting the viral theory of schizophrenia. Individuals born seropositive for bacterial and viral agents are at a significantly elevated risk of developing schizophrenia. While the specific mechanisms of prenatal viral/bacterial infections and brain disorder are unclear, recent findings suggest that the maternal inflammatory response may be associated with fetal brain injury. Preventive and therapeutic treatment options are also proposed. This review presents data related to epidemiology, human serology, and experimental animal models which support the viral model of schizophrenia. PMID:22349576

Kneeland, Rachel E; Fatemi, S Hossein

2012-02-10

97

Using viral vectors as gene transfer tools (Cell Biology and Toxicology Special Issue: ETCS-UK 1 day meeting on genetic manipulation of cells).  

PubMed

In recent years, the development of powerful viral gene transfer techniques has greatly facilitated the study of gene function. This review summarises some of the viral delivery systems routinely used to mediate gene transfer into cell lines, primary cell cultures and in whole animal models. The systems described were originally discussed at a 1-day European Tissue Culture Society (ETCS-UK) workshop that was held at University College London on 1st April 2009. Recombinant-deficient viral vectors (viruses that are no longer able to replicate) are used to transduce dividing and post-mitotic cells, and they have been optimised to mediate regulatable, powerful, long-term and cell-specific expression. Hence, viral systems have become very widely used, especially in the field of neurobiology. This review introduces the main categories of viral vectors, focusing on their initial development and highlighting modifications and improvements made since their introduction. In particular, the use of specific promoters to restrict expression, translational enhancers and regulatory elements to boost expression from a single virion and the development of regulatable systems is described. PMID:19830583

Howarth, Joanna L; Lee, Youn Bok; Uney, James B

2009-10-15

98

Evolution of Cyanobacteria by Exchange of Genetic Material among Phyletically Related Strains  

PubMed Central

The cyanobacterial radiation consists of several lineages of phyletically (morphologically and genetically) related organisms. Several of these organisms show a striking resemblance to fossil counterparts. To investigate the molecular mechanisms responsible for stabilizing or homogenizing cyanobacterial characters, we compared the evolutionary rates and phylogenetic origins of the small-subunit rRNA-encoding DNA (16S rDNA), the conserved gene rbcL (encoding d-ribulose 1,5-bisphosphate carboxylase-oxygenase large subunit), and the less conserved gene rbcX. This survey includes four categories of phyletically related organisms: 16 strains of Microcystis, 6 strains of Tychonema, 10 strains of Planktothrix, and 12 strains of Nostoc. Both rbcL and rbcX can be regarded as neutrally evolving genes, with 95 to 100% and 50 to 80% synonymous nucleotide substitutions, respectively. There is generally low sequence divergence within the Microcystis, Tychonema, and Planktothrix categories both for rbcLX and 16S rDNA. The Nostoc category, on the other hand, consists of three genetically clustered lineages for these loci. The 16S rDNA and rbcLX phylogenies are not congruent for strains within the clustered groups. Furthermore, analysis of the phyletic structure for rbcLX indicates recombinational events between the informative sites within this locus. Thus, our results are best explained by a model involving both intergenic and intragenic recombinations. This evolutionary model explains the DNA sequence clustering for the modern species as a result of sequence homogenization (concerted evolution) caused by exchange of genetic material for neutrally evolving genes. The morphological clustering, on the other hand, is explained by structural and functional stability of these characters. We also suggest that exchange of genetic material for neutrally evolving genes may explain the apparent stability of cyanobacterial morphological characters, perhaps over billions of years.

Rudi, Knut; Skulberg, Olav M.; Jakobsen, Kjetill S.

1998-01-01

99

Small Organic Molecules in Pre-Cometary Ices: The Origins of Genetic Material  

NASA Astrophysics Data System (ADS)

Speaking of genetic material, one thinks of DNA first. An understanding of its fairly complex structure, composed of the sugar deoxyribose, phosphorous acid, and the purine- and pyrimidine-bases, adenine, guanine, cytosine, and thymine has led to the abandonment of theories of its spontaneous creation. In recent times, a number of theories regarding the evolutionary precursors of DNA have been presented. Namely these are the theories of the `RNA-world' (1) and a theory about the precursors of RNA, the so called `PNA-world' (2). In laboratory simulations of inter- and circumstellar pre-cometary ice analogues a number of organic molecules have been identified that corroborate these theories about the evolution of genetic material. Namely these are specific amino acids, which form the necessary material of the backbone of PNA, and a number of purine- and pyrimidine-bases which may have formed the elements of the code itself (3). The delivery of these constituents to earth via impact scenarios of mainly carbonaceous chondrites has also been confirmed in the case of the Murchinson meteorite (4, 5). (1) Gilbert, W., Nature 319, 618 (1986) (2) Egholm, M., Burchardt, O. et al., Nature 365, 566 (1993) (3) Bredehoeft, J.H., diploma, Univ. of Bremen, Germany, 2004. (4) Van der Welden, W. & Schwartz, A.W. , Geochim. cosmochim. Acta 41, 961-968 (1977) (5) Stoks, P.G. & Schwartz A.W., Nature 282, 709-710 (1979)

Bredehöft, J. H.; Meierhenrich, U. J.; Thiemann, W.; Rosenbauer, H.; Nuevo, M.; Muñoz Caro, G. M.; D'Hendecourt, L.

100

Temperature-dependent internuclear transfer of genetic material in heterokaryons of Candida albicans.  

PubMed

Heterokaryons (hets) of Candida albicans are produced by fusing protoplasts of complementing auxotrophic strains and can be propagated continuously on minimal medium despite their tendency to assort nuclei into monokaryotic blastospores. Most mono-karyons have parental-type nuclei, but some are nuclear hybrids with DNA contents between one and two times that of their parental strains. Evidence is presented that hybrids arise by transfer of a portion of the genetic material of one bet nucleus to another, and that the amount of material conveyed during transfer increases with increasing het growth temperatures over the range 25°C to 41°C. This partial hybridization is a general property of hets and is not determined by the wild-type strain backgrounds of their parental components or by the kinds of auxotrophies forcing heterokaryosis. Frequencies of mitotic recombinants induced in partial hybrids by ultraviolet radiation indicate that nuclei of C. albicans are naturally diploid. PMID:24177737

Sarachek, A; Weber, D A

1984-04-01

101

The Impact of Viral RNA on the Association Rates of Capsid Protein Assembly: Bacteriophage MS2 as a Case Study  

Microsoft Academic Search

A large number of single-stranded RNA viruses, which form a major class of all viruses, co-assemble their protein container and their genomic material. The multiple roles of the viral genome in this process are presently only partly understood. Recent experimental results indicate that RNA, in addition to its function as a repository for genetic information, could play important functional roles

Karim M. ElSawy; Leo S. D. Caves; Reidun Twarock

2010-01-01

102

Nest materials as a source of genetic data for avian ecological studies  

USGS Publications Warehouse

We examined the utility of feathers and egg shell membranes, deposited in the nests of Spectacled Eiders (Somateria fischeri), as a source of DNA for genetic studies at both the population and individual level. The potential for feather DNA contamination as a result of female behavioral interactions (e.g. nest parasitism), reuse of nest sites from previous years, or other unknown occurrences was acknowledged and specifically tested. DNA was successfully extracted from both feathers and egg shell membranes and waterfowl microsatellite loci were used to construct individual genotypes. We found no difference in the genotypes obtained from nest feathers or blood of the incubating female. Detection of nest feather contamination was possible with as little as one feather when samples from multiple females were intentionally mixed. Triplicate DNA extractions from 33 nests provided a means of detecting contamination in 3 nests. Egg membranes proved a viable source of offspring DNA and can contribute valuable data to investigations of parentage when assayed jointly with maternal feather DNA. Nest materials provide an efficient, non-invasive method of genetic sampling that can be readily incorporated into field research. However, the natural history traits and mating strategies of a species must be considered during sample collection to identify the possible sources of nest materials (e.g., paternal, maternal, parasite, etc.). Specific experiments should also be designed to test sampling assumptions.

Pearce, J. M.; Fields, R. L.; Scribner, K. T.

1997-01-01

103

Presence of Host ICAM-1 in Human Immunodeficiency Virus Type 1 Virions Increases Productive Infection of CD4+ T Lymphocytes by Favoring Cytosolic Delivery of Viral Material  

PubMed Central

Although there is now convincing evidence that the infectivity of human immunodeficiency virus type 1 (HIV-1) is increased by incorporation of host intercellular adhesion molecule 1 (ICAM-1) in budding virions, the exact mechanism(s) through which ICAM-1 can so significantly affect HIV-1 biology remains obscure. To address this question, we focused our attention on the most proximal events in the virus life cycle. We made comparative analyses to estimate attachment and internalization of isogenic HIV-1 particles either lacking or bearing host-derived ICAM-1. Using attachment-and-entry assays and confocal fluorescence microscopy, we found that virus binding and uptake were both markedly enhanced by insertion of ICAM-1 within the virus envelope when PM1 lymphoid cells and primary human cells (i.e., peripheral blood lymphocytes and purified CD4+ T cells) were used as targets. Moreover, ICAM-1-bearing virions entered cells with faster uptake kinetics than viruses devoid of ICAM-1. Experiments conducted with fully competent viruses further confirmed the positive effect of virion-anchored host ICAM-1 on HIV-1 replication. Interestingly, subcellular-fractionation assays revealed that ICAM-1 incorporation modifies the HIV-1 entry route by increasing the level of viral material released in the cytosol, a process of internalization known to be mediated mainly by pH-independent membrane fusion and to result in productive infection. A virion-based fusion assay confirmed that the acquisition of ICAM-1 increases the efficiency of productive HIV-1 entry in primary CD4+ T lymphocytes. These observations provide new insights into how interactions other than those with gp120 and CD4-coreceptor complex can modulate the process of productive HIV-1 infection in CD4+ T lymphocytes, a cell target highly relevant to HIV-1 pathogenesis.

Tardif, Melanie R.; Tremblay, Michel J.

2003-01-01

104

Molecular Genetics of Herpes Simplex Virus VI. Characterization of a Temperature-Sensitive Mutant Defective in the Expression of All Early Viral Gene Products  

Microsoft Academic Search

The herpes simplex virus 1 (HFEM) mutant tsB7 failed to express any detect- able viral polypeptides and did not significantly inhibit host cell protein synthesis in infected cells maintained at the nonpermissive temperature. The mutant could complement the growth of a coinfecting temperature-sensitive mutant virus differing in plaque phenotype and thus appeared capable of penetrating doubly infected cells. The yield

DAVID M. KNIPE; WILLIAM BATTERSON; CATHY NOSAL; BERNARD ROIZMAN; ALEXANDER BUCHAN

105

Viral vectors for vaccine applications  

PubMed Central

Traditional approach of inactivated or live-attenuated vaccine immunization has resulted in impressive success in the reduction and control of infectious disease outbreaks. However, many pathogens remain less amenable to deal with the traditional vaccine strategies, and more appropriate vaccine strategy is in need. Recent discoveries that led to increased understanding of viral molecular biology and genetics has rendered the used of viruses as vaccine platforms and as potential anti-cancer agents. Due to their ability to effectively induce both humoral and cell-mediated immune responses, viral vectors are deemed as an attractive alternative to the traditional platforms to deliver vaccine antigens as well as to specifically target and kill tumor cells. With potential targets ranging from cancers to a vast number of infectious diseases, the benefits resulting from successful application of viral vectors to prevent and treat human diseases can be immense.

Choi, Youngjoo

2013-01-01

106

Viral hepatitis*  

PubMed Central

Three forms of viral hepatitis can be recognized: hepatitis A, hepatitis B, and hepatitis non-A, non-B. Hepatitis A is caused by a picornavirus, is transmitted by the faceal—oral route, does not become chronic, and no chronic virus carriers exist. The virus can be grown in cell cultures, and killed as well as live attenuated virus vaccines are under development. Hepatitis B is caused by an enveloped virus containing a circular, double-stranded form of DNA. The disease is transmitted parenterally through inoculation of blood or blood products containing virus or through close personal contact with a virus-positive person. Hepatitis B becomes chronic in a certain number of cases and can lead to cirrhosis and primary liver cell carcinoma. The blood and certain body secretions of individuals with a persistent or chronic infection may remain infectious for many years. The hepatitis B virus cannot be grown in cell cultures but the entire genome has been sequenced and cloned in bacterial and eukaryotic cells. An inactivated virus vaccine has been prepared from hepatitis B surface antigen present in the plasma of hepatitis B virus carriers and further vaccines are under development. The agents of hepatitis non-A, non-B have not been identified. It is possible to distinguish between a predominantly parenterally transmitted and an orally transmitted form of hepatitis non-A, non-B. The latter is reported to be caused by a picornavirus that does not, however, have any antigenic relationship with hepatitis A virus.

Deinhardt, F.; Gust, I. D.

1982-01-01

107

Mechanical oscillations of a viral capsid  

NASA Astrophysics Data System (ADS)

Viruses are sub-microscopic infectious agents that infect almost every living creature on Earth. They are unable to grow or reproduce outside of a host cell and are therefore parasitic in nature. A virus' internal genetic material is protected by an external protein coat (capsid). We developed a theoretical model which uses the interaction of light with a viral capsid to create large amplitude motions within the capsid. This work displays the results of the model on the tobacco mosaic virus (TMV) with attached RNA genome. The development of this model was motivated by the experimental work of Tsen et. al. [1] who used ultra-short laser pulses to inactivate viruses. [1] K-T. Tsen et al., J. of Physics -- Cond. Mat. 19, 472201 (2007).

Benson, Daryn; Sankey, Otto; Dykeman, Eric

2010-03-01

108

Genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials: Final report  

SciTech Connect

We have completed an extensive program to investigate the toxicity---including mutagenic, carcinogenic, and teratogenic potential---of SRC-I (Solvent Refined Coal-I) products, along with selected intermediates and waste materials, as represented by the SRC-I Design Baseline. The original primary objective of the toxicology program was to produce data that could be used for four main purposes: to support design of programs to ensure workers' health and safety; to help estimate environmental impacts of SRC-I technology; to support the Toxic Substances Control Act (TSCA) premanufacturing notification process for SRC-I technology; and to promote public understanding and acceptance of the potential health effects of the emerging synfuels industry. The toxicology program consists of five main elements: (1) Genetic Toxicity Evaluations; (2) Acute Animal Toxicity Evaluations; (3) Subchronic Animal Toxicity Evaluations; (4) Chronic (life-span) Animal Carcinogenicity Evaluation; (5) Quality Control/Quality Assurance (QC/QA) Monitoring and Evaluation.

Drozdowicz, B.Z.; Kelly, C.M.

1987-11-01

109

Gene- and Viral-Based Therapies for Brain Tumors  

PubMed Central

Summary Advances in understanding and controlling genes and their expression have set the stage to alter genetic material to fight or prevent disease with brain tumors being among one of the first human malignancies to be targeted by gene therapy. All proteins are coded for by DNA and most neoplastic diseases ultimately result from the expression or lack thereof with one or more proteins (e.g., coded by oncogenes or tumor suppressor genes, respectively). In theory, therefore, diseases could be treated by expression of the appropriate protein in the affected cells. Gene therapy is an experimental treatment that involves introducing genetic material (DNA or RNA) into cells, and it has made important advances in the past decade. Within this short time span, it has moved from the conceptual laboratory research stage to clinical translational trials for brain tumors. The most efficient approaches for gene delivery are based on viral vectors, which have been proven relatively safe in the CNS, despite occasional cases of morbidity and death in non-neurosurgical trials. However, the human response to various viral vectors can not be predicted in a reliable manner from animal experimentation, nor can size, consistency, and extent of experimental brain tumors in mouse models reflect the large, necrotic, infiltrative nature of malignant gliomas. Furthermore, the problem of delivering genetic vectors into solid brain tumors and the efficiency in situ gene transfer remains one of the most significant hurdles in gene therapy.

Asadi-Moghaddam, Kaveh; Chiocca, E. Antonio

2011-01-01

110

Viral precursor polyproteins: keys of regulation from replication to maturation.  

PubMed

Many viruses use a replication strategy involving the translation of a large polyprotein, which is cleaved by viral and/or cellular proteases. Several of these viruses severely impact human health around the globe, including HIV, HCV, Dengue virus, and West Nile virus. This method of genome organization has many benefits to the virus such as condensation of genetic material, as well as temporal and spatial regulation of protein activity depending on polyprotein cleavage state. The study of polyprotein precursors is necessary to fully understand viral infection, and identify possible new drug targets; however, few atomic structures are currently available. Presented here are structures of four recent polyprotein precursors from viruses with a positive sense RNA genome. PMID:23602469

Yost, Samantha A; Marcotrigiano, Joseph

2013-04-18

111

Development of genomic DNA reference materials for genetic testing of disorders common in people of ashkenazi jewish descent.  

PubMed

Many recessive genetic disorders are found at a higher incidence in people of Ashkenazi Jewish (AJ) descent than in the general population. The American College of Medical Genetics and the American College of Obstetricians and Gynecologists have recommended that individuals of AJ descent undergo carrier screening for Tay Sachs disease, Canavan disease, familial dysautonomia, mucolipidosis IV, Niemann-Pick disease type A, Fanconi anemia type C, Bloom syndrome, and Gaucher disease. Although these recommendations have led to increased test volumes and number of laboratories offering AJ screening, well-characterized genomic reference materials are not publicly available. The Centers for Disease Control and Prevention-based Genetic Testing Reference Materials Coordination Program, in collaboration with members of the genetic testing community and Coriell Cell Repositories, have developed a panel of characterized genomic reference materials for AJ genetic testing. DNA from 31 cell lines, representing many of the common alleles for Tay Sachs disease, Canavan disease, familial dysautonomia, mucolipidosis IV, Niemann-Pick disease type A, Fanconi anemia type C, Bloom syndrome, Gaucher disease, and glycogen storage disease, was prepared by the Repository and tested in six clinical laboratories using three different PCR-based assay platforms. A total of 33 disease alleles was assayed and 25 different alleles were identified. These characterized materials are publicly available from Coriell and may be used for quality control, proficiency testing, test development, and research. PMID:19815695

Kalman, Lisa; Wilson, Jean Amos; Buller, Arlene; Dixon, John; Edelmann, Lisa; Geller, Louis; Highsmith, William Edward; Holtegaard, Leonard; Kornreich, Ruth; Rohlfs, Elizabeth M; Payeur, Toby L; Sellers, Tina; Toji, Lorraine; Muralidharan, Kasinathan

2009-10-08

112

20 VIRAL INFECTION  

Microsoft Academic Search

Approach to Viral Exposure Compared with primary care physicians, such as internists, fami- ly physicians, and pediatricians, surgeons are seldom called on to treat viral infections.Viral infections nonetheless deserve the atten- tion of surgeons because these infections can cause illness in patients after operation, albeit infrequently, and can spread to the hospital staff. Some viral infections (e.g., infections with the

Jennifer W. Janelle; Richard J. Howard

2002-01-01

113

Autistic disorder and viral infections  

Microsoft Academic Search

Autistic disorder (autism) is a behaviorally defined developmental disorder with a wide range of behaviors. Although the etiology\\u000a of autism is unknown, data suggest that autism results from multiple etiologies with both genetic and environmental contributions,\\u000a which may explain the spectrum of behaviors seen in this disorder. One proposed etiology for autism is viral infection very\\u000a early in development. The

Jane E. Libbey; Thayne L. Sweeten; William M. McMahon; Robert S. Fujinami

2005-01-01

114

Genetics.  

PubMed

The present state of knowledge on the genetics of anxiety disorders, in particular panic disorder, comprising clinical and molecular genetic studies, interaction analyses, as well as meta-analyses of single association studies will be presented in detail. A particular focus will be on the most robust findings in panic disorder to date in the serotonergic, noradrenergic, and dopaminergic system, such as the catechol-O-methyltransferase (COMT) gene. Additionally, findings on the adenosine receptor 2A (A2A) gene, which has been reported to be associated with panic disorder and also with anxiety levels after caffeine administration in a gene--environment interactional model, will be discussed. Furthermore, the first imaging genetic findings in panic disorder, social phobia, and anxiety-related traits using fMRI and PET techniques in combination with molecular genetic association analyses are reviewed, taking into account the present intermediate phenotype discussion in the investigation of complex genetic disorders. Finally, the first exemplary pharmacogenetic studies in panic disorder and generalized social phobia will be presented. The pathomechanism of anxiety disorders and in particular panic disorder is considered to be multifactorial with converging evidence for a pivotal role of genetic factors in particular, which will be presented in detail in this chapter. PMID:21309106

Domschke, Katharina; Deckert, Jürgen

2010-01-01

115

Endogenous Viral Elements in Animal Genomes  

PubMed Central

Integration into the nuclear genome of germ line cells can lead to vertical inheritance of retroviral genes as host alleles. For other viruses, germ line integration has only rarely been documented. Nonetheless, we identified endogenous viral elements (EVEs) derived from ten non-retroviral families by systematic in silico screening of animal genomes, including the first endogenous representatives of double-stranded RNA, reverse-transcribing DNA, and segmented RNA viruses, and the first endogenous DNA viruses in mammalian genomes. Phylogenetic and genomic analysis of EVEs across multiple host species revealed novel information about the origin and evolution of diverse virus groups. Furthermore, several of the elements identified here encode intact open reading frames or are expressed as mRNA. For one element in the primate lineage, we provide statistically robust evidence for exaptation. Our findings establish that genetic material derived from all known viral genome types and replication strategies can enter the animal germ line, greatly broadening the scope of paleovirological studies and indicating a more significant evolutionary role for gene flow from virus to animal genomes than has previously been recognized.

Katzourakis, Aris; Gifford, Robert J.

2010-01-01

116

Natural supramolecular building blocks: from virus coat proteins to viral nanoparticles.  

PubMed

Viruses belong to a fascinating class of natural supramolecular structures, composed of multiple copies of coat proteins (CPs) that assemble into different shapes with a variety of sizes from tens to hundreds of nanometres. Because of their advantages including simple/economic production, well-defined structural features, unique shapes and sizes, genetic programmability and robust chemistries, recently viruses and virus-like nanoparticles (VLPs) have been used widely in biomedical applications and materials synthesis. In this critical review, we highlight recent advances in the use of virus coat proteins (VCPs) and viral nanoparticles (VNPs) as building blocks in self-assembly studies and materials development. We first discuss the self-assembly of VCPs into VLPs, which can efficiently incorporate a variety of different materials as cores inside the viral protein shells. Then, the self-assembly of VNPs at surfaces or interfaces is summarized. Finally, we discuss the co-assembly of VNPs with different functional materials (178 references). PMID:22880206

Liu, Zhi; Qiao, Jing; Niu, Zhongwei; Wang, Qian

2012-08-10

117

Genetic Characterization of Human Immunodeficiency Virus Type 1 in Blood and Genital Secretions: Evidence for Viral Compartmentalization and Selection during Sexual Transmission  

Microsoft Academic Search

To explore the mechanism of sexual transmission of human immunodeficiency virus type 1 (HIV-1), we compared HIV-1 gp120 sequences in longitudinal samples fromfive acute seroconvertors with those from their corresponding sexual partners (transmitters). We used a quantitative homoduplex tracking assay to compare the overall genetic composition of HIV-1 quasispecies in each transmission pair and to track the transmitted viruses during

TUOFU ZHU; NING WANG; ANDREW CARR; DANIEL S. NAM; ROBERT MOOR-JANKOWSKI; DAVID A. COOPER; ANDDAVID D. HO

1996-01-01

118

Development of a genomic DNA reference material panel for myotonic dystrophy type 1 (DM1) genetic testing.  

PubMed

Myotonic dystrophy type 1 (DM1) is caused by expansion of a CTG triplet repeat in the 3' untranslated region of the DMPK gene that encodes a serine-threonine kinase. Patients with larger repeats tend to have a more severe phenotype. Clinical laboratories require reference and quality control materials for DM1 diagnostic and carrier genetic testing. Well-characterized reference materials are not available. To address this need, the Centers for Disease Control and Prevention-based Genetic Testing Reference Material Coordination Program, in collaboration with members of the genetic testing community, the National Registry of Myotonic Dystrophy and Facioscapulohumeral Muscular Dystrophy Patients and Family Members, and the Coriell Cell Repositories, has established and characterized cell lines from patients with DM1 to create a reference material panel. The CTG repeats in genomic DNA samples from 10 DM1 cell lines were characterized in three clinical genetic testing laboratories using PCR and Southern blot analysis. DMPK alleles in the samples cover four of five DM1 clinical categories: normal (5 to 34 repeats), mild (50 to 100 repeats), classical (101 to 1000 repeats), and congenital (>1000 repeats). We did not identify or establish Coriell cell lines in the premutation range (35 to 49 repeats). These samples are publicly available for quality control, proficiency testing, test development, and research and should help improve the accuracy of DM1 testing. PMID:23680132

Kalman, Lisa; Tarleton, Jack; Hitch, Monica; Hegde, Madhuri; Hjelm, Nick; Berry-Kravis, Elizabeth; Zhou, Lili; Hilbert, James E; Luebbe, Elizabeth A; Moxley, Richard T; Toji, Lorraine

2013-05-13

119

A verification of the genetic programming method in the inverse analysis of moisture transport in building materials  

NASA Astrophysics Data System (ADS)

Verification of genetic programming (GP) as a new approach for solving inverse problems of moisture transport in building materials is presented. The GP is applied on experimental data in order to optimize the moisture diffusivity as a function of moisture content. The results show that GP is very powerful tool for the inverse analysis of transport equations.

Ko?í, Jan; Mad?ra, Ji?í; ?erný, Robert

2013-10-01

120

The Leeuwenhoek lecture, 1985. A molecular biologist's view of viral hepatitis.  

PubMed

Three forms of viral hepatitis can be distinguished serologically. Hepatitis A virus is a picornavirus, which is being studied increasingly after its propagation in cell cultures. The B virus (HBV) is the prototype of a family now termed hepadna viruses and is by far the best understood. The third, by exclusion, is non-A non-B, about which little else is known. Molecular cloning methods enable copies of viral genes to be propagated and analysed quite readily and provide the means for isolation and expression of individual genes in microbial and animal cells. Determination of the nucleotide sequences of HBV DNA revealed its genetic organization and so guided studies of the mechanism of gene expression both in infected animals and cultures of transformed cells. Replication of the viral genome has also been studied in natural infections, particularly with duck HBV, but also with the human virus. Expression of HBV genes in microbial cells is valuable as a source of antigens for diagnostic reagents and vaccine preparations, but has also been of consequence for the identification of viral gene products not previously recognized and which are of considerable current interest. The methods and materials now available provide additional opportunities for inquiring into the course of viral infection, replication of the virus and, for HBV, the possible role in the development of hepatomas of integration of the viral genome into the host chromosome. PMID:2884666

Murray, K

1987-03-23

121

Viral Perturbations of Host Networks Reflect Disease Etiology  

PubMed Central

Many human diseases, arising from mutations of disease susceptibility genes (genetic diseases), are also associated with viral infections (virally implicated diseases), either in a directly causal manner or by indirect associations. Here we examine whether viral perturbations of host interactome may underlie such virally implicated disease relationships. Using as models two different human viruses, Epstein-Barr virus (EBV) and human papillomavirus (HPV), we find that host targets of viral proteins reside in network proximity to products of disease susceptibility genes. Expression changes in virally implicated disease tissues and comorbidity patterns cluster significantly in the network vicinity of viral targets. The topological proximity found between cellular targets of viral proteins and disease genes was exploited to uncover a novel pathway linking HPV to Fanconi anemia.

Dricot, Amelie; Padi, Megha; Byrdsong, Danielle; Franchi, Rachel; Lee, Deok-Sun; Rozenblatt-Rosen, Orit; Mar, Jessica C.; Calderwood, Michael A.; Baldwin, Amy; Zhao, Bo; Santhanam, Balaji; Braun, Pascal; Simonis, Nicolas; Huh, Kyung-Won; Hellner, Karin; Grace, Miranda; Chen, Alyce; Rubio, Renee; Marto, Jarrod A.; Christakis, Nicholas A.; Kieff, Elliott; Roth, Frederick P.; Roecklein-Canfield, Jennifer; DeCaprio, James A.; Cusick, Michael E.; Quackenbush, John; Hill, David E.; Munger, Karl; Vidal, Marc; Barabasi, Albert-Laszlo

2012-01-01

122

Viral perturbations of host networks reflect disease etiology.  

PubMed

Many human diseases, arising from mutations of disease susceptibility genes (genetic diseases), are also associated with viral infections (virally implicated diseases), either in a directly causal manner or by indirect associations. Here we examine whether viral perturbations of host interactome may underlie such virally implicated disease relationships. Using as models two different human viruses, Epstein-Barr virus (EBV) and human papillomavirus (HPV), we find that host targets of viral proteins reside in network proximity to products of disease susceptibility genes. Expression changes in virally implicated disease tissues and comorbidity patterns cluster significantly in the network vicinity of viral targets. The topological proximity found between cellular targets of viral proteins and disease genes was exploited to uncover a novel pathway linking HPV to Fanconi anemia. PMID:22761553

Gulbahce, Natali; Yan, Han; Dricot, Amélie; Padi, Megha; Byrdsong, Danielle; Franchi, Rachel; Lee, Deok-Sun; Rozenblatt-Rosen, Orit; Mar, Jessica C; Calderwood, Michael A; Baldwin, Amy; Zhao, Bo; Santhanam, Balaji; Braun, Pascal; Simonis, Nicolas; Huh, Kyung-Won; Hellner, Karin; Grace, Miranda; Chen, Alyce; Rubio, Renee; Marto, Jarrod A; Christakis, Nicholas A; Kieff, Elliott; Roth, Frederick P; Roecklein-Canfield, Jennifer; Decaprio, James A; Cusick, Michael E; Quackenbush, John; Hill, David E; Münger, Karl; Vidal, Marc; Barabási, Albert-László

2012-06-28

123

Dynamic Localisation of Mature MicroRNAs in Human Nucleoli is Influenced by Exogenous Genetic Materials.  

PubMed

Although microRNAs are commonly known to function as a component of RNA-induced silencing complexes in the cytoplasm, they have been detected in other organelles, notably the nucleus and the nucleolus, of mammalian cells. We have conducted a systematic search for miRNAs in HeLa cell nucleoli, and identified 11 abundant miRNAs with a high level of nucleolar accumulation. Through in situ hybridisation, we have localised these miRNAs, including miR-191 and miR-484, in the nucleolus of a diversity of human and rodent cell lines. The nucleolar association of these miRNAs is resistant to various cellular stresses, but highly sensitive to the presence of exogenous nucleic acids. Introduction of both single- and double-stranded DNA as well as double stranded RNA rapidly induce the redistribution of nucleolar miRNAs to the cytoplasm. A similar change in subcellular distribution is also observed in cells infected with the influenza A virus. The partition of miRNAs between the nucleolus and the cytoplasm is affected by Leptomycin B, suggesting a role of Exportin-1 in the intracellular shuttling of miRNAs. This study reveals a previously unknown aspect of miRNA biology, and suggests a possible link between these small noncoding RNAs and the cellular management of foreign genetic materials. PMID:23940654

Li, Zhou Fang; Liang, Yi Min; Lau, Pui Ngan; Shen, Wei; Wang, Dai Kui; Cheung, Wing Tai; Xue, Chun Jason; Poon, Lit Man; Lam, Yun Wah

2013-08-06

124

Molecular and physiological characteristics of a grape yeast strain containing atypical genetic material.  

PubMed

The knowledge about wine yeasts remains largely dominated by the extensive studies on Saccharomyces (S.) cerevisiae. Molecular methods, allowing discrimination of both species and strains in winemaking, can profitably be applied for characterization of the microflora occurring in winemaking and for monitoring the fermentation process. Recently, some novel yeast isolates have been described as hybrid between S. cerevisiae and Saccharomyces species, leaving the Saccharomyces strains containing non-Saccharomyces hybrids essentially unexplored. In this study, we have analyzed a yeast strain isolated from "Primitivo" grape (http://www.ispa.cnr.it/index.php?page=collezioni&lang=en accession number 12998) and we found that, in addition to the S. cerevisiae genome, it has acquired genetic material from a non-Saccharomyces species. The study was focused on the analysis of chromosomal and mitochondrial gene sequences (ITS and 26S rRNA, SSU and COXII, ACTIN-1 and TEF), 2D-PAGE mitochondrial proteins, and spore viability. The results allowed us to formulate the hypothesis that in the MSH199 isolate a DNA containing an rDNA sequence from Hanseniaspora vineae, a non-Saccharomyces yeast, was incorporated through homologous recombination in the grape environment where yeast species are propagated. Moreover, physiological characterization showed that the MSH199 isolate possesses high technological quality traits (fermentation performance) and glycerol production, resistance to ethanol, SO? and temperature) useful for industrial application. PMID:20880601

Cappello, M S; Poltronieri, P; Blaiotta, G; Zacheo, G

2010-08-25

125

The genetic drift of human papillomavirus type 16 is a means of reconstructing prehistoric viral spread and the movement of ancient human populations.  

PubMed Central

We have investigated the diversity of a hypervariable segment of the human papillomavirus type 16 (HPV-16) genome among 301 virus isolates that were collected from 25 different ethnic groups and geographic locations. Altogether, we distinguished 48 different variants that had diversified from one another along five phylogenetic branches. Variants from two of these branches were nearly completely confined to Africa. Variants from a third branch were the only variants identified in Europeans but occurred at lower frequency in all other ethnic groups. A fourth branch was specific for Japanese and Chinese isolates. A small fraction of all isolates from Asia and from indigenous as well as immigrant populations in the Americas formed a fifth branch. Important patterns of HPV-16 phylogeny suggested coevolution of the virus with people of the three major human races, namely, Africans, Caucasians, and East Asians. But several minor patterns are indicative of smaller bottlenecks of viral evolution and spread, which may correlate with the migration of ethnic groups in prehistoric times. The colonization of the Americas by Europeans and Africans is reflected in the composition of their HPV-16 variants. We discuss arguments that today's HPV-16 genomes represent a degree of diversity that evolved over a large time span, probably exceeding 200,000 years, from a precursor genome that may have originated in Africa. The identification of molecular variants is a powerful epidemiological and phylogenetic tool for revealing the ancient spread of papillomaviruses, whose trace through the world has not yet been completely lost.

Ho, L; Chan, S Y; Burk, R D; Das, B C; Fujinaga, K; Icenogle, J P; Kahn, T; Kiviat, N; Lancaster, W; Mavromara-Nazos, P

1993-01-01

126

THz absorption signature detection of genetic material of E. coli and B. subtilis  

NASA Astrophysics Data System (ADS)

The development of efficient biological agent detection techniques requires in-depth understanding of THz absorption spectral features of different cell components. Chromosomal DNA, RNAs, proteins, bacterial cell wall, proteinaceous coat might be essential for bacterial cells and spores THz signature. As a first step, the DNA's contribution into entire cell THz spectra was analyzed. The experimental study of cells and DNAs of E. coli and cells/spores and DNA of Bacillus subtilis was conducted. Samples were prepared in the form of water solutions (suspension) with the concentrations in the range 0.01-1 mg/ml. The measurable difference in the THz transmission spectra of E. coli and Bacillus subtilis DNAs was observed. The correlation between chromosomal DNA signature and a corresponding entire spore/cell signature was observed. This correlation was especially pronounced for spores of Bacillus subtilis and their DNA. These experimental results justify our approach to develop a model for THz signatures of biological simulants and agents. In parallel with the experimental study, for the first time, the computer modeling and simulation of chromosome DNAs of E. coli and Bacillus subtilis was performed and their THz signatures were calculated. The DNA structures were optimized using the Amber software package. Also, we developed the initial model of the DNA fragment poly(dAT)-poly(dTA) solvated in water to be used in the simulations of genetic material (DNA and RNA) of spores and cells. Molecular dynamical simulations were conducted using explicit solvent (3-point TIP3P water) and implicit solvent (generalized Born) models. The calculated THz signatures of E. coli and Bacillus subtilis DNAs and poly(dAT)-poly(dTA) reproduce many features of our measured spectra. The results of this study demonstrate that THz Fourier transform infrared spectroscopy is a promising tool in generating spectral data for complex biological objects such as bacterial cells and spores.

Bykhovski, Alexei; Li, Xiaowei; Globus, Tatiana; Khromova, Tatyana; Gelmont, Boris; Woolard, Dwight; Samuels, Alan C.; Jensen, James O.

2005-11-01

127

Generation of Reference Material by the Use of Multiple Displacement Amplification (MDA) for the Detection of Genetically Modified Organisms (GMOs)  

Microsoft Academic Search

The identification of genetically modified (GM) organisms (GMOs) in unknown samples by polymerase chain reaction (PCR) requires\\u000a the use of a positive control sample, containing the target sequence derived from the respective GMO. For this purpose, either\\u000a DNA extracted from suitable reference material or plasmids bearing the sequence are used. In the case of isolated genomic\\u000a DNA, the preparation is

Lillian Roth; Jutta Zagon; Ines Laube; Arne Holst-Jensen; Hermann Broll

2008-01-01

128

Severe Viral Infections and Primary Immunodeficiencies  

PubMed Central

Patients with severe viral infections are often not thoroughly evaluated for immunodeficiencies. In this review, we summarize primary immunodeficiencies that predispose individuals to severe viral infections. Some immunodeficiencies enhance susceptibility to disease with a specific virus or family of viruses, whereas others predispose to diseases with multiple viruses in addition to disease with other microbes. Although the role of cytotoxic T cells in controlling viral infections is well known, a number of immunodeficiencies that predispose to severe viral diseases have recently been ascribed to defects in the Toll-like receptor–interferon signaling pathway. These immunodeficiencies are rare, but it is important to identify them both for prognostic information and for genetic counseling. Undoubtedly, additional mutations in proteins in the innate and adaptive arms of the immune system will be identified in the future, which will reveal the importance of these proteins in controlling infections caused by viruses and other pathogens.

Cohen, Jeffrey I.

2011-01-01

129

[Kunjin virus replicon--a novel viral vector].  

PubMed

Viral replicon is a kind of self-replicating viral RNA sourced from viral genome, which contains viral non-structural genes that are critical for viral genome replication with structural proteins deleted or replaced by foreign genes. Kunjin virus is a member of the Flavivirida family, Flavivirus genus, and Kunjin virus replicon is the first and the clearly defined flavivirus replicon. Kunjun virus replicon has been regarded as an excellent viral vector on account of its high expression, lower cytotoxicity and genetic stability. These unique characteristics of kunjin virus replicons make them suitable for the study of viral genome replication, recombinant proteins production, vaccine development and gene therapy. In this article, recent progress in the development, properties and applications of kunjin virus replicon system was briefly reviewed. PMID:21650037

Li, Shihua; Li, Xiaofeng; Qin, E'de; Qin, Chengfeng

2011-02-01

130

A Genetic Engineering Approach to Genetic Algorithms  

Microsoft Academic Search

We present an extension to the standard genetic algorithm (GA), which is based on con- cepts of genetic engineering. The motivation is to discover useful and harmful genetic materials and then execute an evolutionary process in such a way that the population becomes increasingly composed of useful genetic material and increasingly free of the harmful genetic material. Compared to the

John S. Gero; Vladimir A. Kazakov

2001-01-01

131

A Genetic Engineering Approach to Genetic Algorithms  

Microsoft Academic Search

We present an extension to the standard genetic algorithm (GA), which is based on concepts of genetic engineering. The motivation is to discover useful and harmful genetic materials and then execute an evolutionary process in such a way that the population becomes increasingly composed of useful genetic material and increasingly free of the harmful genetic material. Compared to the standard

John S. Gero; Vladimir Kazakov

2006-01-01

132

Chimeric feline coronaviruses that encode type II spike protein on type I genetic background display accelerated viral growth and altered receptor usage.  

PubMed

Persistent infection of domestic cats with feline coronaviruses (FCoVs) can lead to a highly lethal, immunopathological disease termed feline infectious peritonitis (FIP). Interestingly, there are two serotypes, type I and type II FCoVs, that can cause both persistent infection and FIP, even though their main determinant of host cell tropism, the spike (S) protein, is of different phylogeny and displays limited sequence identity. In cell culture, however, there are apparent differences. Type II FCoVs can be propagated to high titers by employing feline aminopeptidase N (fAPN) as a cellular receptor, whereas the propagation of type I FCoVs is usually difficult, and the involvement of fAPN as a receptor is controversial. In this study we have analyzed the phenotypes of recombinant FCoVs that are based on the genetic background of type I FCoV strain Black but encode the type II FCoV strain 79-1146 S protein. Our data demonstrate that recombinant FCoVs expressing a type II FCoV S protein acquire the ability to efficiently use fAPN for host cell entry and corroborate the notion that type I FCoVs use another main host cell receptor. We also observed that recombinant FCoVs display a large-plaque phenotype and, unexpectedly, accelerated growth kinetics indistinguishable from that of type II FCoV strain 79-1146. Thus, the main phenotypic differences for type I and type II FCoVs in cell culture, namely, the growth kinetics and the efficient usage of fAPN as a cellular receptor, can be attributed solely to the FCoV S protein. PMID:19906918

Tekes, Gergely; Hofmann-Lehmann, Regina; Bank-Wolf, Barbara; Maier, Reinhard; Thiel, Heinz-Jürgen; Thiel, Volker

2009-11-11

133

Quality assurance for Duchenne and Becker muscular dystrophy genetic testing: development of a genomic DNA reference material panel.  

PubMed

Duchenne and Becker muscular dystrophies (DMD/BMD) are allelic X-linked recessive disorders that affect approximately 1 in 3500 and 1 in 20,000 male individuals, respectively. Approximately 65% of patients with DMD have deletions, 7% to 10% have duplications, and 25% to 30% have point mutations in one or more of the 79 exons of the dystrophin gene. Most clinical genetics laboratories test for deletions, and some use technologies that can detect smaller mutations and duplications. Reference and quality control materials for DMD/BMD diagnostic and carrier genetic testing are not commercially available. To help address this need, the Centers for Disease Control and Prevention-based Genetic Testing Reference Material Coordination Program, in collaboration with members of the genetic testing and the DMD/BMD patient communities and the Coriell Cell Repositories, have characterized new and existing cell lines to create a comprehensive DMD/BMD reference material panel. Samples from 31 Coriell DMD cell lines from male probands and female carriers were analyzed using the Affymetrix SNP Array 6.0 and Multiplex Ligation-Dependent Probe Amplification (MRC-Holland BV, Amsterdam, the Netherlands), a multiplex PCR assay, and DNA sequence analysis. Identified were 16 cell lines with deletions, 9 with duplications, and 4 with point mutations distributed throughout the dystrophin gene. There were no discordant results within assay limitations. These samples are publicly available from Coriell Institute for Medical Research (Camden, NJ) and can be used for quality assurance, proficiency testing, test development, and research, and should help improve the accuracy of DMD testing. PMID:21354051

Kalman, Lisa; Leonard, Jay; Gerry, Norman; Tarleton, Jack; Bridges, Christina; Gastier-Foster, Julie M; Pyatt, Robert E; Stonerock, Eileen; Johnson, Monique A; Richards, C Sue; Schrijver, Iris; Ma, Tianhui; Miller, Vanessa Rangel; Adadevoh, Yetsa; Furlong, Pat; Beiswanger, Christine; Toji, Lorraine

2011-03-01

134

Methods and Devices for Catheter-Based Intracoronary Myocardial Delivery of Cellular, Genetic or Biological Materials.  

National Technical Information Service (NTIS)

Methods and systems infuse therapeutic materials into a vascular vessel by means of a catheter based infusion system. In especially preferred forms, the infusate (which comprises a therapeutic material) is infused through a distal end of the catheter and ...

A. S. Shah D. D. Glower S. M. Emani W. J. Koch

2004-01-01

135

Viral Proteins Acquired from a Host Converge to Simplified Domain Architectures  

PubMed Central

The infection cycle of viruses creates many opportunities for the exchange of genetic material with the host. Many viruses integrate their sequences into the genome of their host for replication. These processes may lead to the virus acquisition of host sequences. Such sequences are prone to accumulation of mutations and deletions. However, in rare instances, sequences acquired from a host become beneficial for the virus. We searched for unexpected sequence similarity among the 900,000 viral proteins and all proteins from cellular organisms. Here, we focus on viruses that infect metazoa. The high-conservation analysis yielded 187 instances of highly similar viral-host sequences. Only a small number of them represent viruses that hijacked host sequences. The low-conservation sequence analysis utilizes the Pfam family collection. About 5% of the 12,000 statistical models archived in Pfam are composed of viral-metazoan proteins. In about half of Pfam families, we provide indirect support for the directionality from the host to the virus. The other families are either wrongly annotated or reflect an extensive sequence exchange between the viruses and their hosts. In about 75% of cross-taxa Pfam families, the viral proteins are significantly shorter than their metazoan counterparts. The tendency for shorter viral proteins relative to their related host proteins accounts for the acquisition of only a fragment of the host gene, the elimination of an internal domain and shortening of the linkers between domains. We conclude that, along viral evolution, the host-originated sequences accommodate simplified domain compositions. We postulate that the trimmed proteins act by interfering with the fundamental function of the host including intracellular signaling, post-translational modification, protein-protein interaction networks and cellular trafficking. We compiled a collection of hijacked protein sequences. These sequences are attractive targets for manipulation of viral infection.

Rappoport, Nadav; Linial, Michal

2012-01-01

136

DNA as Genetic Material: Revisiting Classic Experiments through a Simple, Practical Class  

ERIC Educational Resources Information Center

|In 1928, Frederick Griffith demonstrated a transmission process of genetic information by transforming "Pneumococcus". In 1944, Avery et al. demonstrated that Griffith's transforming principle was DNA. We revisited these classic experiments in a practical class for undergraduate students. Both experiments were reproduced in simple, adapted forms.…

Malago, Wilson, Jr.; Soares-Costa, Andrea; Henrique-Silva, Flavio

2009-01-01

137

Material Representations: From the Genetic Code to the Evolution of Cellular Automata  

Microsoft Academic Search

We present a new definition of the concept of representation for cognitive science that is based on a study of the origin of structures that are used to store memory in evolving systems. This study consists of novel computer experiments in the evolution of cellular automata to perform nontrivial tasks as well as evidence from biology concerning genetic memory. Our

Luis Mateus Rocha; Wim Hordijk

2005-01-01

138

Development and pilot evaluation of novel genetic educational materials designed for an underserved patient population.  

PubMed

Genetic counseling for BRCA1 and BRCA2 mutations involves teaching about hereditary cancer, genetics and risk, subjects that are difficult to grasp and are routinely misunderstood. Supported by a grant from the Avon Foundation, the UCSF Cancer Risk Program started the first genetic testing and counseling service for a population of traditionally underserved women of varied ethnic and social backgrounds at the San Francisco General Hospital (SFGH). Informed by educational theory and clinical experience, we devised and piloted two simplified explanations of heredity and genetic risk, with the aim of uncovering how to best communicate genetics and risk to this underserved population. A "conventional" version comprised pictures of genes, pedigrees, and quantitative representations of risk. A "colloquial" pictorial version used an analogy of the "information book" of genes, family stories and vignettes, and visual representations of risk, without using scientific words such as genes or chromosomes. A verbal narrative accompanied each picture. We presented these modules to four focus groups of five to eight women recruited from the SFGH Family Practice Clinic. Overall, women preferred a picture-based approach and commented that additional text would have been distracting. The majority of women preferred the colloquial version because it was easier to understand and better conveyed a sense of comfort and hope. We conclude that simplicity, analogies, and familiarity support comprehension while vignettes, family stories, and photos of real people provide comfort and hope. These elements may promote understanding of complex scientific topics in healthcare, particularly when communicating with patients who come from disadvantaged backgrounds. PMID:17949289

Lubitz, Rebecca Jean; Komaromy, Miriam; Crawford, Beth; Beattie, Mary; Lee, Robin; Luce, Judith; Ziegler, John

2007-01-01

139

MicroManipulating viral-based therapeutics.  

PubMed

Despite the social stigma and manufacturing hurdles that come with using viruses as therapeutic tools, the molecular specificity offered by these bugs makes them too attractive to ignore. Still largely based on vaccines, viral vectors offer exciting tools to treat cancer or deliver specific genetic payloads to a desired tissue. Unfortunately, early clinical trials utilizing such vectors have been plagued with poor performance or even clinical toxicity most commonly associated with spurious genetic regulation and/or replication of the vector. Past efforts to control for unwanted toxicity have focused on modification of the receptor or use of tissue-specific genetic elements that added specificity to the transcriptional induction of the gene(s) of interest. While this has had some success, engineering receptors to control viral tropism often fails or results in a loss of replicative fitness. In addition, the use of tissue-specific promoter elements not only restricts the vector that can be used, bona fide small promoter elements are often not available for the desired target. With the caveats of viral vector-based therapeutics largely centered on a lack of in vivo control, the recent success of exploiting microRNA expression to limit viral tropism may breathe new life into the field. PMID:19788867

Tenoever, Benjamin

2009-08-01

140

Engineering Biomaterial Systems to Enhance Viral Vector Gene Delivery  

Microsoft Academic Search

Integrating viral gene delivery with engineered biomaterials is a promising strategy to overcome a number of challenges associated with virus-mediated gene delivery, including inefficient delivery to specific cell types, limited tropism, spread of vectors to distant sites, and immune responses. Viral vectors can be combined with biomaterials either through encapsulation within the material or immobilization onto a material surface. Subsequent

Jae-Hyung Jang; David V Schaffer; Lonnie D Shea

2011-01-01

141

[Viral hepatitis during pregnancy].  

PubMed

Viral hepatitis is one of the most common liver diseases appearing during pregnancy. Prevention against hepatotropic viruses is restricted due to lack of vaccines being effective in induction of efficient immunization in the majority of these microorganisms. In general, there is no possibility of active immunization against hepatotropic viruses except type A and B viral hepatitis. An issue of viral hepatitis in pregnancy as an aspect of potential risk factor connected with infection of pregnant women and a fetus has been described in this paper. Furthermore, the most important topics in the field of the epidemiology, prophylaxis and possible treatment options of viral hepatitis A, B, C, D, E and G have been discussed. The newest reports of pregnant women lamivudine therapy as a preventive treatment against vertical transmission during delivery have been reviewed. Rarly diagnosed viral hepatitis caused by herpes simplex virus, cytomegalovirus, Epstein-Barr virus and adenoviruses have been characterized as well. PMID:17219815

Gutkowski, Krzysztof; Gutkowska, Dorota; Lepiech, Jacek

2006-10-01

142

DNA repair enables sex identification in genetic material from human teeth  

PubMed Central

Background: The purpose of this study was to test the effectiveness of a DNA repair protocol in improving genetic testing in compromised samples, frequently encountered in Forensic Medicine. Methods: In order to stretch the experiment conditions to the limits, as far as quality of samples and DNA is concerned, we tried the repair protocol on ten ancient human teeth obtained from an equal number of skeletons from a burial site in Lerna, Middle Helladic Greece (2100 - 1700 BC). For these samples, sex was previously determined morphologically, serving as a reference to compare our molecular data with. The samples were analysed using the DNA amelogenin sex test assay prior and after DNA polymerase repair. For every individual, two molecular sex determinations were obtained by visualising PCR products on an agarose gel. Results: DNA repair enabled genetic testing in these samples. Successful amplification of the amelogenin gene was obtained only from the repaired DNA in eight out of ten samples. Prior to the repair treatment, none of these samples yielded any PCR products, thus attesting to the authenticity of the amplified sequence. The concordance between morphological and molecular analysis was in reasonable agreement (71%). Conclusions: These results reveal the impact of the repair process in studying single copy genes from low quality DNA. This protocol could facilitate molecular analysis in compromised samples, encountered in forensic medicine, as well as enable genetic studies in ancient remnants.

Kovatsi, L; Nikou, D; Triantaphyllou, S; Njau, S N; Voutsaki, S; Kouidou, S

2009-01-01

143

69 FR 26770 - Phosphomannose Isomerase and the Genetic Material Necessary for Its Production in All Plants...  

Federal Register 2010, 2011, 2012, 2013

...Material Necessary for Its Production in All Plants; Exemption from the Requirement...material necessary for its production in all plants when applied/used as plant-incorporated...permissible level for residues in or on all plant commodities of phosphomannose...

2004-05-14

144

De novo assembly of highly diverse viral populations  

PubMed Central

Background Extensive genetic diversity in viral populations within infected hosts and the divergence of variants from existing reference genomes impede the analysis of deep viral sequencing data. A de novo population consensus assembly is valuable both as a single linear representation of the population and as a backbone on which intra-host variants can be accurately mapped. The availability of consensus assemblies and robustly mapped variants are crucial to the genetic study of viral disease progression, transmission dynamics, and viral evolution. Existing de novo assembly techniques fail to robustly assemble ultra-deep sequence data from genetically heterogeneous populations such as viruses into full-length genomes due to the presence of extensive genetic variability, contaminants, and variable sequence coverage. Results We present VICUNA, a de novo assembly algorithm suitable for generating consensus assemblies from genetically heterogeneous populations. We demonstrate its effectiveness on Dengue, Human Immunodeficiency and West Nile viral populations, representing a range of intra-host diversity. Compared to state-of-the-art assemblers designed for haploid or diploid systems, VICUNA recovers full-length consensus and captures insertion/deletion polymorphisms in diverse samples. Final assemblies maintain a high base calling accuracy. VICUNA program is publicly available at: http://www.broadinstitute.org/scientific-community/science/projects/viral-genomics/ viral-genomics-analysis-software. Conclusions We developed VICUNA, a publicly available software tool, that enables consensus assembly of ultra-deep sequence derived from diverse viral populations. While VICUNA was developed for the analysis of viral populations, its application to other heterogeneous sequence data sets such as metagenomic or tumor cell population samples may prove beneficial in these fields of research.

2012-01-01

145

The universal epitope of influenza A viral neuraminidase fundamentally contributes to enzyme activity and viral replication.  

PubMed

The only universally conserved sequence among all influenza A viral neuraminidases is located between amino acids 222 and 230. However, the potential roles of these amino acids remain largely unknown. Through an array of experimental approaches including mutagenesis, reverse genetics, and growth kinetics, we found that this sequence could markedly affect viral replication. Additional experiments revealed that enzymes with mutations in this region demonstrated substantially decreased catalytic activity, substrate binding, and thermostability. Consistent with viral replication analyses and enzymatic studies, protein modeling suggests that these amino acids could either directly bind to the substrate or contribute to the formation of the active site in the enzyme. Collectively, these findings reveal the essential role of this unique region in enzyme function and viral growth, which provides the basis for evaluating the validity of this sequence as a potential target for antiviral intervention and vaccine development. PMID:23645684

Doyle, Tracey M; Jaentschke, Bozena; Van Domselaar, Gary; Hashem, Anwar M; Farnsworth, Aaron; Forbes, Nicole E; Li, Changgui; Wang, Junzhi; He, Runtao; Brown, Earl G; Li, Xuguang

2013-05-03

146

Genetics 101 — The Hereditary Material of Life | NIH MedlinePlus the Magazine  

MedlinePLUS

... attched to a sugar phosphate backbone. What is DNA? DNA, or deoxyribonucleic acid, is the hereditary material in ... cell in a person's body has the same DNA. Most DNA is located in the cell nucleus ( ...

147

Viral Hepatitis Therapies  

MedlinePLUS

... Cancer Liaison Program Cardiovascular Information Diabetes Information - Viral Hepatitis Therapies Click on drug brand name for additional information. Approved Treatments for Hepatitis B Brand Name Generic Names Manufacturer Name Indication ...

148

Classical Live Viral Vaccines  

Microsoft Academic Search

\\u000a Classical, live viral vaccines have been developed by adapting viruses by serial passages in animals, tissue or cell cultures\\u000a during which multiple mutations in the viral genome have accumulated. The majority of vaccines in use today were developed\\u000a in this way and a number of similar investigational vaccines are currently in development. The principal advantage of live\\u000a vaccines is that

Thomas P. Monath

149

Community Respiratory Viral Infections  

Microsoft Academic Search

\\u000a Transplantation has become an increasingly effective strategy for the treatment of many end-stage and life-threatening illnesses.\\u000a Despite many advances in post-transplant care, infection remains a major problem for transplant recipients. Although the specific\\u000a infectious complications vary among different transplant populations, viral infections are increasingly recognized to occur\\u000a in all types of transplant patients. Post-transplant viral infections can occur through reactivation

Lisa R. Young; Scott M. Palmer

150

Genetic heterogeneity of bovine viral diarrhoea viruses isolated in Southern Africa 1 The GenBank accession numbers of the sequences from the 5?NCR reported in this paper are U97409–U97481. 1  

Microsoft Academic Search

Seventy three field isolates of bovine viral diarrhoea virus (BVDV), obtained from cattle in Mozambique and South Africa, were characterised by comparative nucleotide sequence analysis of part of the 5? non-coding region (5?NCR) of the viral genome. The target region was amplified by reverse transcription-polymerase chain reaction (RT-PCR). The amplicons were cloned in pUC 19 plasmid and both strands were

C Baule; M van Vuuren; J. P Lowings; S Belák

1997-01-01

151

Selling Genes, Selling Gender: Egg Agencies, Sperm Banks, and the Medical Market in Genetic Material  

Microsoft Academic Search

Eggs and sperm are parallel bodily goods in that each contributes half of the reproductive material needed to create life. Yet these cells are produced by differently sexed bodies, allowing for a comparative analysis of how the social process of bodily commodification varies based on sex and gender. Drawing on interview and observational data from two egg agencies and two

Rene Almeling

2007-01-01

152

Viral assembly of oriented quantum dot nanowires.  

PubMed

The highly organized structure of M13 bacteriophage was used as an evolved biological template for the nucleation and orientation of semiconductor nanowires. To create this organized template, peptides were selected by using a pIII phage display library for their ability to nucleate ZnS or CdS nanocrystals. The successful peptides were expressed as pVIII fusion proteins into the crystalline capsid of the virus. The engineered viruses were exposed to semiconductor precursor solutions, and the resultant nanocrystals that were templated along the viruses to form nanowires were extensively characterized by using high-resolution analytical electron microscopy and photoluminescence. ZnS nanocrystals were well crystallized on the viral capsid in a hexagonal wurtzite or a cubic zinc blende structure, depending on the peptide expressed on the viral capsid. Electron diffraction patterns showed single-crystal type behavior from a polynanocrystalline area of the nanowire formed, suggesting that the nanocrystals on the virus were preferentially oriented with their [001] perpendicular to the viral surface. Peptides that specifically directed CdS nanocrystal growth were also engineered into the viral capsid to create wurtzite CdS virus-based nanowires. Lastly, heterostructured nucleation was achieved with a dual-peptide virus engineered to express two distinct peptides within the same viral capsid. This work represents a genetically controlled biological synthesis route to a semiconductor nanoscale heterostructure. PMID:12777631

Mao, Chuanbin; Flynn, Christine E; Hayhurst, Andrew; Sweeney, Rozamond; Qi, Jifa; Georgiou, George; Iverson, Brent; Belcher, Angela M

2003-05-30

153

Viral assembly of oriented quantum dot nanowires  

PubMed Central

The highly organized structure of M13 bacteriophage was used as an evolved biological template for the nucleation and orientation of semiconductor nanowires. To create this organized template, peptides were selected by using a pIII phage display library for their ability to nucleate ZnS or CdS nanocrystals. The successful peptides were expressed as pVIII fusion proteins into the crystalline capsid of the virus. The engineered viruses were exposed to semiconductor precursor solutions, and the resultant nanocrystals that were templated along the viruses to form nanowires were extensively characterized by using high-resolution analytical electron microscopy and photoluminescence. ZnS nanocrystals were well crystallized on the viral capsid in a hexagonal wurtzite or a cubic zinc blende structure, depending on the peptide expressed on the viral capsid. Electron diffraction patterns showed single-crystal type behavior from a polynanocrystalline area of the nanowire formed, suggesting that the nanocrystals on the virus were preferentially oriented with their [001] perpendicular to the viral surface. Peptides that specifically directed CdS nanocrystal growth were also engineered into the viral capsid to create wurtzite CdS virus-based nanowires. Lastly, heterostructured nucleation was achieved with a dual-peptide virus engineered to express two distinct peptides within the same viral capsid. This work represents a genetically controlled biological synthesis route to a semiconductor nanoscale heterostructure.

Mao, Chuanbin; Flynn, Christine E.; Hayhurst, Andrew; Sweeney, Rozamond; Qi, Jifa; Georgiou, George; Iverson, Brent; Belcher, Angela M.

2003-01-01

154

Viral assembly of oriented quantum dot nanowires  

NASA Astrophysics Data System (ADS)

The highly organized structure of M13 bacteriophage was used as an evolved biological template for the nucleation and orientation of semiconductor nanowires. To create this organized template, peptides were selected by using a pIII phage display library for their ability to nucleate ZnS or CdS nanocrystals. The successful peptides were expressed as pVIII fusion proteins into the crystalline capsid of the virus. The engineered viruses were exposed to semiconductor precursor solutions, and the resultant nanocrystals that were templated along the viruses to form nanowires were extensively characterized by using high-resolution analytical electron microscopy and photoluminescence. ZnS nanocrystals were well crystallized on the viral capsid in a hexagonal wurtzite or a cubic zinc blende structure, depending on the peptide expressed on the viral capsid. Electron diffraction patterns showed single-crystal type behavior from a polynanocrystalline area of the nanowire formed, suggesting that the nanocrystals on the virus were preferentially oriented with their [001] perpendicular to the viral surface. Peptides that specifically directed CdS nanocrystal growth were also engineered into the viral capsid to create wurtzite CdS virus-based nanowires. Lastly, heterostructured nucleation was achieved with a dual-peptide virus engineered to express two distinct peptides within the same viral capsid. This work represents a genetically controlled biological synthesis route to a semiconductor nanoscale heterostructure.

Mao, Chuanbin; Flynn, Christine E.; Hayhurst, Andrew; Sweeney, Rozamond; Qi, Jifa; Georgiou, George; Iverson, Brent; Belcher, Angela M.

2003-06-01

155

Intergenerational phenotypic mixing in viral evolution.  

PubMed

Viral particles (virions) are made of genomic material packaged with proteins, drawn from the pool of proteins in the parent cell. It is well known that when virion concentrations are high, cells can be coinfected with multiple viral strains that can complement each other. Viral genomes can then interact with proteins derived from different strains, in a phenomenon known as phenotypic mixing. But phenotypic mixing is actually far more common: viruses mutate very often, and each time a mutation occurs, the parent cell contains different types of viral genomes. Due to phenotypic mixing, changes in viral phenotypes can be shifted by a generation from the mutations that cause them. In the regime of evolutionary invasion and escape, when mutations are crucial for the virus to survive, this timing can have a large influence on the probability of emergence of an adapted strain. Modeling the dynamics of viral evolution in these contexts thus requires attention to the mutational mechanism and the determinants of fitness. PMID:23730772

Loverdo, Claude; Lloyd-Smith, James O

2013-02-04

156

A genetic algorithm for the inter-cell layout and material handling system design  

Microsoft Academic Search

The traditional optimization processes for the cell system layout (CSL) and material handling system in cellular manufacturing\\u000a systems (CMSs) were carried out sequentially and separately. The solutions obtained by this means can be far from the total\\u000a optimum. In this paper, an integrated approach to the problem is proposed that attempts to design CSL and flow path structure\\u000a simultaneously. The

G. H. Hu; Y. P. Chen; Z. D. Zhou; H. C. Fang

2007-01-01

157

Assessment of screening methods for the identification of genetically modified potatoes in raw materials and finished products.  

PubMed

Qualitative polymerase chain reaction methods for the detection of genetically modified potatoes have been investigated that can be used for screening purposes and identification of insect-resistant and virus-resistant potatoes in food. The presence of the nos terminator from Agrobacterium tumefaciens and the antibiotic marker gene nptII (neomycin-phosphotransferase II) was demonstrated in three commercialized Bt-potato lines (Monsanto Co., St. Louis, MO, USA) and one noncommercial GM-potato product (high amylopectin starch, AVEBE, Veendam, The Netherlands) and allows for general screening in foods. For further identification, specific primers for the FMV promoter derived from the figwort mosaic virus, the CryIIIA gene (delta-endotoxin from Bacillus thuringiensis subsp. tenebrionis), potato leafroll virus replicase gene, and the potato virus Y coat protein gene, were designed. The methods described were successfully applied to processed potato raw materials (dehydrated potato powders and flakes), starch samples, and finished products. PMID:12537422

Jaccaud, Etienne; Höhne, Michaela; Meyer, Rolf

2003-01-29

158

Concepts in viral pathogenesis II  

SciTech Connect

This paper contains papers divided among 10 sections. The section titles are: Viral Structure and Function; Viral Constructs; Oncogenes, Transfection, and Differentiation; Viral Tropism and Entry into Cells; Immune Recognition of Viruses; Evolving Concepts in Viral Pathogenesis Illustrated by Selected Plant and Animal Models; Evolving Concepts in Viral Pathogenesis Illustrated by Selected Diseases in Humans; New Trends in Diagnosis and Epidemiology; and Vaccines and Antiviral Therapy.

Notkins, A.L.; Oldstone, M.B.A.

1986-01-01

159

Genetic and Biochemical Analysis of cis Regulatory Elements within the Keratinocyte Enhancer Region of the Human Papillomavirus Type 31 Upstream Regulatory Region during Different Stages of the Viral Life Cycle  

PubMed Central

Using linker scanning mutational analysis, we recently identified potential cis regulatory elements contained within the 5? upstream regulatory region (URR) domain and auxiliary enhancer (AE) region of the human papillomavirus type 31 (HPV31) URR involved in the regulation of E6/E7 promoter activity at different stages of the viral life cycle. For the present study, we extended the linker scanning mutational analysis to identify potential cis elements located in the keratinocyte enhancer (KE) region (nucleotides 7511 to 7762) of the HPV31 URR and to characterize cellular factors that bind to these elements under conditions representing different stages of the viral life cycle. The linker scanning mutational analysis identified viral cis elements located in the KE region that regulate transcription in the presence and absence of any viral gene products or viral DNA replication and determine the role of host tissue differentiation on viral transcriptional regulation. Using electrophoretic mobility shift assays, we illustrated defined reorganization in the composition of cellular transcription factors binding to the same cis regulatory elements at different stages of the HPV differentiation-dependent life cycle. Our studies provide an extensive map of functional elements in the KE region of the HPV31 URR, identify cis regulatory elements that exhibit significant transcription regulatory potential, and illustrate changes in specific protein-DNA interactions at different stages of the viral life cycle. The variable recruitment of transcription factors to the same cis element under different cellular conditions may represent a mechanism underlying the tight link between keratinocyte differentiation and E6/E7 expression.

Sen, Ellora; Alam, Samina; Meyers, Craig

2004-01-01

160

Coxsackie viral myocarditis  

PubMed Central

Coxsackie viral myocarditis is a common disease, yet idiopathic dilated cardiomyopathy is a less common consequence. Insights gained from studying the Coxsackie virus B-3 murine model of myocarditis has led to the hypothesis that an acute Coxsackie viral myocarditis can result in persistent, non-viral mediated cellular responses that result in a chronic inflammatory state leading to progressive myocyte loss and ultimate development of dilated cardiomyopathy. Although the evidence linking myocarditis to dilated cardiomyopathy is circumstantial in man, the identification of defects in immunoregulation may provide the impetus to further research into the pathogenesis and ultimately the development of more rational therapies directed at modulating immune responses to alter the natural history of clinical dilated cardiomyopathy.

O'Connell, John B.; Robinson, John A.

1985-01-01

161

Selected nosocomial viral infections.  

PubMed

A nosocomial viral infection is defined as a viral infection the onset of which occurs when the patient has been hospitalized longer than the incubation period of the virus. Viruses account for about 5% of all nosocomial infections. Viral cross-infection is most common in infants and children but also occurs in other groups, including the elderly, institutionalized persons of all ages, immunocompromised hosts, and patients with underlying chronic pulmonary, renal, or cardiac disease. These infections are associated with extended length of hospital stay and considerable morbidity and mortality. The spectrum of nosocomial viruses is wide and includes blood-borne, respiratory tract, and enteric pathogens, among others. This review will discuss the clinical characteristics, transmission, and control of the common nosocomial respiratory viruses: respiratory syncytial virus, varicella zoster virus, influenza virus, adenovirus, parainfluenza, and rubeola. PMID:8449764

Wright, S A; Bieluch, V M

162

Acute viral myocarditis  

PubMed Central

Acute myocarditis is one of the most challenging diagnosis in cardiology. At present, no diagnostic gold standard is generally accepted, due to the insensitivity of traditional diagnostic tests. This leads to the need for new diagnostic approaches, which resulted in the emergence of new molecular tests and a more detailed immunohistochemical analysis of endomyocardial biopsies. Recent findings using these new diagnostic tests resulted in increased interest in inflammatory cardiomyopathies and a better understanding of its pathophysiology, the recognition in overlap of virus-mediated damage, inflammation, and autoimmune dysregulation. Novel results also pointed towards a broader spectrum of viral genomes responsible for acute myocarditis, indicating a shift of enterovirus and adenovirus to parvovirus B19 and human herpes virus 6. The present review proposes a general diagnostic approach, focuses on the viral aetiology and associated autoimmune processes, and reviews treatment options for patients with acute viral myocarditis.

Dennert, Robert; Crijns, Harry J.; Heymans, Stephane

2008-01-01

163

Emerging viral infections.  

PubMed

Unique disorders appear episodically in human populations and cause life-threatening systemic or neurological disease. Historical examples of such disorders include von Economo encephalitis, a disorder of presumed viral etiology; acquired immune deficiency syndrome, caused by the human immunodeficiency virus; and severe acute respiratory syndrome, caused by a member of the coronavirus family. This article describes the factors that contribute to the emergence of infectious diseases and focuses on selected recent examples of emerging viral infections that can affect the nervous system of infants, children, and adolescents. PMID:22889544

Bale, James F

2012-09-01

164

The modular analytical procedure and validation approach and the units of measurement for genetically modified materials in foods and feeds.  

PubMed

Food and feed analysts are confronted with a number of common problems, irrespective of the analytical target. The analytical procedure can be described as a series of successive steps: sampling, sample processing, analyte extraction, and ending, finally, in interpretation of an analytical result produced with, e.g., real-time polymerase chain reaction. The final analytical result is dependent on proper method selection and execution and is only valid if valid methods (modules) are used throughout the analytical procedure. The final step is easy to validate-the measurement uncertainty added from this step is relatively limited and can be estimated with a high degree of precision. In contrast, the front-end sampling and processing steps have not evolved much, and the corresponding methods are rarely or never experimentally validated according to internationally harmonized protocols. In this paper, we outlined a strategy for modular validation of the entire analytical procedure, using an upstream validation approach, illustrated with methods for genetically modified materials that may partially apply also to other areas of food and feed analyses. We have also discussed some implications and consequences of this approach in relation to reference materials, measurement units, and thresholds for labelling and enforcement, and for application of the validated methods (modules) in routine food and feed analysis. PMID:15295887

Holst-Jensen, Arne; Berdal, Knut G

165

Genetics of the Steller's Sea Cow (Hydrodamalis gigas): A Study of Ancient Bone Material  

NASA Astrophysics Data System (ADS)

Georg Wilhelm Steller was born 100 years before Darwin in 1709 and he was part of a vast exploration fifty years before Lewis and Clark explored America. Steller was important to the study of marine mammals because he was the only naturalist to see and describe the great northern sea cow ( Hydrodamalis gigas). Knowledge of an extinct population can be used to aid the conservation of a current population. Extraction of DNA from this extinct animal was performed in order to determine the population structure of the Steller's sea cow. A test was also developed that can definitively state whether or not a random bone sample came from H. gigas. This test could be used by the Fish and Wildlife Service (FWS) and the National Oceanic and Atmospheric Administration (NOAA) to examine material distributed in the North Pacific to determine whether samples are legally traded extinct Steller's sea cow or illegally traded extant marine mammal species protected under the Marine Mammal Protection Act (MMPA).

Crerar, Lorelei D.

166

WATERBORNE VIRAL GASTROENTERITIS  

EPA Science Inventory

In the study of human gastroenteritis, the use of electron microscopy and related techniques has led to the identification of new viral agents which had previously escaped detection by routine cell-culture procedures. Efforts to characterize and further study these agents are cur...

167

Leafhopper viral pathogens  

Technology Transfer Automated Retrieval System (TEKTRAN)

Four newly discovered viral pathogens in leafhopper vectors of Pierce’s disease of grapes, have been shown to replicate in sharpshooter leafhoppers; the glassy-winged sharpshooter, GWSS, Homalodisca vitripennis, and Oncometopia nigricans (Hemiptera: Cicadellidae). The viruses were classified as memb...

168

Bovine viral diarrhea viruses  

Technology Transfer Automated Retrieval System (TEKTRAN)

Infections with bovine viral diarrhea viruses (BVDV) result in significant economic losses for beef and dairy producers worldwide. BVDV is actually an umbrella term for two species of viruses, BVDV1 and BVDV2, within the Pestivirus genus of the Flavivirus family. While denoted as a bovine pathogen...

169

Haraway's Viral Cyborg  

Microsoft Academic Search

Nearly thirty years ago, Donna Haraway began writing her famous essay published in 1985 as “A Manifesto for Cyborgs: Science, Technology, and Feminism in the 1980s.” In its vision, argument, and detail, it resonates strongly with what today is called viral analysis and criticism. In what follows I’ll briefly suggest how. First, the essay was blasphemous, transgressive, and invasive, arguably

Joseph Schneider

2012-01-01

170

Autophagy and viral neurovirulence  

PubMed Central

Summary As terminally differentiated vital cells, neurons may be specialized to fight viral infections without undergoing cellular self-destruction. The cellular lysosomal degradation pathway, autophagy, is emerging as one such mechanism of neuronal antiviral defence. Autophagy has diverse physiological functions, such as cellular adaptation to stress, routine organelle and protein turnover, and innate immunity against intracellular pathogens, including viruses. Most of the in vivo evidence for an antiviral role of autophagy is related to viruses that specifically target neurons, including the prototype alphavirus, Sindbis virus, and the ?-herpesvirus, herpes simplex virus type 1 (HSV-1). In the case of HSV-1, viral evasion of autophagy is essential for lethal encephalitis. As basal autophagy is important in preventing neurodegeneration, and induced autophagy is important in promoting cellular survival during stress, viral antagonism of autophagy in neurons may lead to neuronal dysfunction and/or neuronal cell death. This review provides background information on the roles of autophagy in immunity and neuroprotection, and then discusses the relationships between autophagy and viral neurovirulence.

Orvedahl, Anthony; Levine, Beth

2009-01-01

171

VIRAL INFECTION OF RABBITS  

Microsoft Academic Search

The three most important viruses of rabbits include : Myxoma virus (MV), the poxvirus that causes Myxomatosis, the calicivirus ( genus Lagovirus) of Rabbit Haemorrhagic Disease (RHDV), and Lapine Rotavirus (LRV), which is an enteric agent. There a re some other viral agents in rabbits (parvovirus, coronavirus, adenovirus, calicivirus ( genus Vesivirus), enterovirus-like, reovirus, herpesvirus and coronavirus) but both their

172

Transport of viral specimens.  

PubMed Central

The diagnosis of viral infections by culture relies on the collection of proper specimens, proper care to protect the virus in the specimens from environmental damage, and use of an adequate transport system to maintain virus activity. Collection of specimens with swabs that are toxic to either virus or cell culture should be avoided. A variety of transport media have been formulated, beginning with early bacteriological transport media. Certain swab-tube combinations have proven to be both effective and convenient. Of the liquid transport media, sucrose-based and broth-based media appear to be the most widely accepted and used. Studies on virus stability show that most viruses tested are sufficiently stable in transport media to withstand a transport time of 1 to 3 days. Some viruses may withstand longer transport times. In many cases, it is not necessary to store virus specimens in a refrigerator or send them to the laboratory on wet ice or frozen on dry ice. However, the specimen should not be exposed to environmental extremes. Modern viral transport media allow for more effective use of viral culture and culture enhancement techniques for the diagnosis of human viral infections.

Johnson, F B

1990-01-01

173

Controlling Viral Capsid Assembly with Templating  

PubMed Central

We develop coarse-grained models that describe the dynamic encapsidation of functionalized nanoparticles by viral capsid proteins. We find that some forms of cooperative interactions between protein subunits and nanoparticles can dramatically enhance rates and robustness of assembly, as compared to the spontaneous assembly of subunits into empty capsids. For large core-subunit interactions, subunits adsorb onto core surfaces en masse in a disordered manner, and then undergo a cooperative rearrangement into an ordered capsid structure. These assembly pathways are unlike any identified for empty capsid formation. Our models can be directly applied to recent experiments in which viral capsid proteins assemble around the functionalized inorganic nanoparticles [Sun et al., Proc. Natl. Acad. Sci (2007) 104, 1354]. In addition, we discuss broader implications for understanding the dynamic encapsidation of single-stranded genomic molecules during viral replication and for developing multicomponent nanostructured materials.

Hagan, Michael F.

2009-01-01

174

Performance of the Novel Qiagen artus QS-RGQ Viral Load Assays Compared to That of the Abbott RealTime System with Genetically Diversified HIV and Hepatitis C Virus Plasma Specimens  

PubMed Central

We compared two novel Qiagen QS-RGQ viral load assays with the established Abbott RealTime assays on a highly diversified panel of 121 human immunodeficiency virus (HIV) and 107 hepatitis C virus (HCV) specimens. The quantifications correlated well for all HIV and HCV types, but Qiagen yielded higher HCV concentrations than Abbott, predominantly in genotypes 4 and 5.

Drexler, Jan Felix; Reber, Ulrike; Wuttkopf, Andrea; Eis-Hubinger, Anna Maria

2012-01-01

175

Vaccination against a hit-and-run viral cancer.  

PubMed

Cancers with viral aetiologies can potentially be prevented by antiviral vaccines. Therefore, it is important to understand how viral infections and cancers might be linked. Some cancers frequently carry gammaherpesvirus genomes. However, they generally express the same viral genes as non-transformed cells, and differ mainly in also carrying oncogenic host mutations. Infection, therefore, seems to play a triggering or accessory role in disease. The hit-and-run hypothesis proposes that cumulative host mutations can allow viral genomes to be lost entirely, such that cancers remaining virus-positive represent only a fraction of those to which infection contributes. This would have considerable implications for disease control. However, the hit-and-run hypothesis has so far lacked experimental support. Here, we tested it by using Cre-lox recombination to trigger transforming mutations in virus-infected cells. Thus, 'floxed' oncogene mice were infected with Cre recombinase-positive murid herpesvirus-4 (MuHV-4). The emerging cancers showed the expected genetic changes but, by the time of presentation, almost all lacked viral genomes. Vaccination with a non-persistent MuHV-4 mutant nonetheless conferred complete protection. Equivalent human gammaherpesvirus vaccines could therefore potentially prevent not only viral genome-positive cancers, but possibly also some cancers less suspected of a viral origin because of viral genome loss. PMID:20573854

Stevenson, Philip G; May, Janet S; Connor, Viv; Efstathiou, Stacey

2010-06-23

176

Tracking of microinjected DNA in live cells reveals the intracellular behavior and elimination of extrachromosomal genetic material  

PubMed Central

We here addressed the basic question, how does extrachromosomal DNA behave when it is placed in the nuclear or the cytoplasmic environment and how is it eliminated? To do this, we tracked microinjected DNA molecules in live cells. In the cytoplasm, the diffusion of microinjected DNA was inhibited in a size- and linearity-dependent manner, probably by the intermediate filament. This was followed by the rapid disappearance of the DNA fluorescent signal. In the nucleus, the diffusion was also dependent on the size of the molecule and was accompanied by the aggregation of the DNA. The aggregation may be due to a putative DNA-binding molecule, whose level is high during the G1 phase. Surprisingly, the injected DNA could move across the nuclear membrane and appeared in the cytoplasm, which suggests the presence of a transport system. The intracytoplasmic behavior and the elimination of such DNA was obviously different from the DNA that was directly injected at the cytoplasm. The DNA remaining in the nucleus appeared to be stable and persisted in the nucleus or, after cell division, in the cytoplasm, for more than one cell cycle. These findings provide a novel and basic understanding of the behavior and elimination of a wide variety of extrachromosomal genetic material.

Shimizu, Noriaki; Kamezaki, Fumie; Shigematsu, Shiho

2005-01-01

177

PCR-free quantitative detection of genetically modified organism from raw materials. An electrochemiluminescence-based bio bar code method.  

PubMed

A bio bar code assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio bar code assay requires lengthy experimental procedures including the preparation and release of bar code DNA probes from the target-nanoparticle complex and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio bar code assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2,2'-bipyridyl) ruthenium (TBR)-labeled bar code DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909

Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R

2008-04-03

178

Clay-Nucleic Acid Complexes: Characteristics and Implications for the Preservation of Genetic Material in Primeval Habitats  

NASA Astrophysics Data System (ADS)

The equilibrium adsorption of three nucleic acids: chromosomal DNA, supercoiled plasmid DNA, and 25S rRNA, on the clay minerals, montmorillonite (M) and kaolinite (K), were studied. Adsorption of the nucleic acid on the clays was rapid and maximal after 90 min of contact time. Chromosomal DNA was adsorbed to a greater extent than plasmid DNA and RNA, and the adsorption was also greater on M than on K. Adsorption isotherms were of the L type, and a plateau was reached with all the complexes, with the exception of chromosomal DNA adsorbed on M. To determine where nucleic acids are adsorbed on clay minerals and the nature of the interaction, complexes were studied by X-ray diffraction (X-RD), electron microscopy, and Fourier transform infrared (FT-IR) spectroscopy. X-RD showed that nucleic acids did not penetrate the clay, indicating that the adsorption occurred primarily on the external surfaces of clay particles, as also suggested by electron microscopy observations. FT-IR spectra of clay-tightly bound nucleic acid complexes showed absorption bands that indicate a variation of the nucleic acids status as a consequence of their adsorption on clay. Data obtained suggested that the formation of clay-nucleic acid complex could have an important role in the preservation of genetic material in primeval habitats.

Franchi, Marco; Bramanti, Emilia; Morassi Bonzi, Laura; Luigi Orioli, Pier; Vettori, Cristina; Gallori, Enzo

1999-05-01

179

Viral membrane scission.  

PubMed

Virus budding is a complex, multistep process in which viral proteins make specific alterations in membrane curvature. Many different viral proteins can deform the membrane and form a budding virion, but very few can mediate membrane scission to complete the budding process. As a result, enveloped viruses have developed numerous ways of facilitating membrane scission, including hijacking host cellular scission machinery and expressing their own scission proteins. These proteins mediate scission in very different ways, though the biophysical mechanics underlying their actions may be similar. In this review, we explore the mechanisms of membrane scission and the ways in which enveloped viruses use these systems to mediate the release of budding virions. PMID:24099087

Rossman, Jeremy S; Lamb, Robert A

2013-05-31

180

Prevention of viral hepatitis  

Microsoft Academic Search

Opinion statement  Despite the availability of vaccines against hepatitis A and B, acute viral hepatitis due to these agents continues to be\\u000a among the most commonly reported notifiable infectious diseases in the United States. Currently available hepatitis A and\\u000a B vaccines are highly immunogenic and well tolerated, but vaccine coverage needs to be expanded. Use of the hepatitis A vaccine\\u000a in

Raymond S. Koff

2002-01-01

181

Viral otitis media  

Microsoft Academic Search

Acute otitis media (AOM) and viral upper respiratory tract infections (URIs) represent the two most common diseases affecting\\u000a the human population, and account for substantial patient morbidity and health care costs. Epidemiologic and experimental\\u000a studies suggest that URIs play a causal role in the pathogenesis of AOM. Specifically, viruses can either invade the middle\\u000a ear (ME) space and invoke an

Craig A. Buchman; George M. Brinson

2003-01-01

182

Coxsackievirus-adenovirus receptor genetically fused to anti-human CD40 scFv enhances adenoviral transduction of dendritic cells  

Microsoft Academic Search

A promising approach to immunotherapy involves the loading of dendritic cells (DCs) with genetic material to facilitate sustained expression of a relevant antigen in this population of potent antigen presenting cells (APC). Viral vectors such as adenovirus (Ad) have been used for this purpose. Existing methods for DC infection are limited by lack of specificity and a requirement for DC

A V Pereboev; C K Asiedu; Y Kawakami; S S Dong; J L Blackwell; E A Kashentseva; P L Triozzi; W A Aldrich; D T Curiel; J M Thomas; I P Dmitriev

2002-01-01

183

Chronic Viral Infection and Primary Central Nervous System Malignancy  

PubMed Central

Primary central nervous system (CNS) tumors cause significant morbidity and mortality in both adults and children. While some of the genetic and molecular mechanisms of neuro-oncogenesis are known, much less is known about possible epigenetic contributions to disease pathophysiology. Over the last several decades, chronic viral infections have been associated with a number of human malignancies. In primary CNS malignancies, two families of viruses, namely polyomavirus and herpesvirus, have been detected with varied frequencies in a number of pediatric and adult histological tumor subtypes. However, establishing a link between chronic viral infection and primary CNS malignancy has been an area of considerable controversy, due in part to variations in detection frequencies and methodologies used among researchers. Since a latent viral neurotropism can be seen with a variety of viruses and a widespread seropositivity exists among the population, it has been difficult to establish an association between viral infection and CNS malignancy based on epidemiology alone. While direct evidence of a role of viruses in neuro-oncogenesis in humans is lacking, a more plausible hypothesis of neuro-oncomodulation has been proposed. The overall goals of this review are to summarize the many human investigations that have studied viral infection in primary CNS tumors, discuss potential neuro-oncomodulatory mechanisms of viral-associated CNS disease and propose future research directions to establish a more firm association between chronic viral infections and primary CNS malignancies.

Saddawi-Konefka, Robert

2010-01-01

184

Viral infections and asthma inception.  

PubMed

Respiratory tract infections caused by viruses have been implicated in the pathogenesis of asthma. Of these respiratory pathogens, viruses have been demonstrated to be associated with asthma epidemiologically in at least 3 ways ( Fig 1 ). First, during infancy, certain viruses have been implicated in the inception of the asthmatic phenotype. Genetic susceptibility, particularly genes coding for atopic phenotypic characteristics, might differentiate, at least in part, those children who are destined to have persistent wheezing, asthma, or both later in childhood. Second, repeated exposure to infectious viruses in daycare centers or in households with multiple older siblings increases the number of respiratory infections, but in doing so, it might paradoxically reduce the long-term risk of allergies and asthma through either pre-existing or newly formed alterations in cytokine response profiles. Third, in patients with established asthma, particularly children, viral upper respiratory tract infections play a significant role in producing acute exacerbations of airway obstruction that might result in frequent outpatient visits or in hospitalizations. This review will highlight available data on respiratory syncytial virus infections and their relationship to asthma inception in childhood. PMID:15536404

Lemanske, Robert F

2004-11-01

185

High diversity of the viral community from an Antarctic lake.  

PubMed

Viruses are the most abundant biological entities and can control microbial communities, but their identity in terrestrial and freshwater Antarctic ecosystems is unknown. The genetic structure of an Antarctic lake viral community revealed unexpected genetic richness distributed across the highest number of viral families that have been found to date in aquatic viral metagenomes. In contrast to other known aquatic viromes, which are dominated by bacteriophage sequences, this Antarctic virus assemblage had a large proportion of sequences related to eukaryotic viruses, including phycodnaviruses and single-stranded DNA (ssDNA) viruses not previously identified in aquatic environments. We also observed that the transition from an ice-covered lake in spring to an open-water lake in summer led to a change from a ssDNA- to a double-stranded DNA-virus-dominated assemblage, possibly reflecting a seasonal shift in host organisms. PMID:19892985

López-Bueno, Alberto; Tamames, Javier; Velázquez, David; Moya, Andrés; Quesada, Antonio; Alcamí, Antonio

2009-11-01

186

A genetic engineering approach to genetic algorithms.  

PubMed

We present an extension to the standard genetic algorithm (GA), which is based on concepts of genetic engineering. The motivation is to discover useful and harmful genetic materials and then execute an evolutionary process in such a way that the population becomes increasingly composed of useful genetic material and increasingly free of the harmful genetic material. Compared to the standard GA, it provides some computational advantages as well as a tool for automatic generation of hierarchical genetic representations specifically tailored to suit certain classes of problems. PMID:11290285

Gero, J S; Kazakov, V

2001-01-01

187

Assessing the biocompatibility of degradable metallic materials: state-of-the-art and focus on the potential of genetic regulation.  

PubMed

For decades, the design, development and use of metallic biomaterials has focused on the corrosion resistance of these materials once implanted in the human body. Recently, degradable metallic biomaterials (DMMs) have been proposed for some specific applications, including paediatric, orthopaedic and cardiovascular applications. DMMs are expected to disappear via corrosion after providing structural support for a certain period of time depending on the application site. Over the past decades, a wide-ranging and comprehensive set of in vitro, in vivo and for some cases also ex vivo tests have been proposed and exhaustively investigated for conventional corrosion-resistant metallic biomaterials. Standardization and regulatory bodies in the United States, Japan and Europe have therefore developed tests to license corrosion-resistant metals for use as "biomaterials". This is not the case for DMMs. Once implanted, this new class of biomaterials is expected to support the healing process of a diseased tissue or organ while degrading at a potentially adjustable degradation rate. The tests developed for corrosion-resistant metals cannot simply be transposed to DMMs. These tests can in some cases be adapted, but the expected unique properties of DMMs should also inspire and lead to the design and the development of new specific tests. The current challenge is how to assess the tolerance of surrounding tissues and organs to the presence of degradation products. This work precisely focuses on this topic. The tests usually used to assess the biocompatibility of conventional corrosion-resistant metals are briefly reviewed. Then, genetic regulation is proposed as an original and novel approach to assess the biocompatibility of DMMs. This method appears to predict cell behaviour in the presence of degradation products that are closely related to DNA damage. Various genes have been related to the toxicity and inflammatory responses, indicating their role as biomarkers to assess the toxicity of degradation products. Finally, some gene families that have the potential to be applied as biomarkers of degradation product toxicity are summarized. PMID:20176149

Purnama, Agung; Hermawan, Hendra; Couet, Jacques; Mantovani, Diego

2010-02-20

188

“Infectobesity: viral infections (especially with human adenovirus-36: Ad36) may be a cause of obesity  

Microsoft Academic Search

In recent years viral infections have been recognized as possible cause of obesity, alongside the traditionally recognized causes (genetic inheritance, and behaviour\\/environmental causes such as diet exercise, cultural practices and stress). Although four viruses have been reported to induce obesity (infectoobesity) in animal models (chickens, mice, sheep, goat, dogs, rats and hamsters), until recently the viral etiology of human obesity

Vincent van Ginneken; Laura Sitnyakowsky; Jonathan E. Jeffery

2009-01-01

189

Cellular Immune Responses and Viral Diversity in Individuals Treated during Acute and Early HIV1 Infection  

Microsoft Academic Search

Immune responses induced during the early stages of chronic viral infections are thought to in- fluence disease outcome. Using HIV as a model, we examined virus-specific cytotoxic T lym- phocytes (CTLs), T helper cells, and viral genetic diversity in relation to duration of infection and subsequent response to antiviral therapy. Individuals with acute HIV-1 infection treated before seroconversion had weaker

Marcus Altfeld; Eric S. Rosenberg; Raj Shankarappa; Joia S. Mukherjee; Frederick M. Hecht; Robert L. Eldridge; Marylyn M. Addo; Samuel H. Poon; Mary N. Phillips; Gregory K. Robbins; Paul E. Sax; Steve Boswell; James O. Kahn; Christian Brander; Philip J. R. Goulder; Jay A. Levy; James I. Mullins; Bruce D. Walker

190

Complement and Viral Pathogenesis  

PubMed Central

The complement system functions as an immune surveillance system that rapidly responds to infection. Activation of the complement system by specific recognition pathways triggers a protease cascade, generating cleavage products that function to eliminate pathogens, regulate inflammatory responses, and shape adaptive immune responses. However, when dysregulated, these powerful functions can become destructive and the complement system has been implicated as a pathogenic effector in numerous diseases, including infectious diseases. This review highlights recent discoveries that have identified critical roles for the complement system in the pathogenesis of viral infection.

Stoermer, Kristina A.; Morrison, Thomas E.

2011-01-01

191

[Viral exanthematic childhood diseases].  

PubMed

Exanthem is defined as multiple, inflammatory skin alteration with a hematogenic, lymphogenic or neurogenic origin. Typically, so called exanthematic children's diseases are measles, mumps, rubella, varicella, erythema infectiosum (fifth disease) and in the past small pox. The pathogenesis of the viral-caused diseases primarily occurs in the vascular connective tissue. The cytopathogenetic effects result in inflammatory tissue reactions with activation of defence mechanism and producing of immune complexes. First symptoms are hyperemia, edema and inflammatory infiltrates with itchy swellings. Virological laboratory diagnosis are necessary especially for the progress of atypical infectious diseases, for persons with immunological or chronical illness and under chemotherapeutical or immunosuppressival treatment. PMID:9471842

Allwinn, R; Doerr, H W

1997-01-01

192

Viral hepatitis in Bucharest.  

PubMed

A seroprevalence survey of viral hepatitis was conducted in Bucharest, Romania, between April and July 1990 on a systematic sample of 1355 persons drawn from the general population and groups at higher risk of infection. Sera were tested for hepatitis A, B, and C (HAV, HBV and HCV, resp.) markers using an enzyme-linked immunosorbent assay (ELISA) method. The prevalences of HAV and HBV markers were high in all groups. A total of 47% of the adults from the general population and 39.8% of the children aged 0-16 years had at least one HBV marker. Of the pregnant women 7.8% were positive for hepatitis B surface antigen. Among infants (0-3 years of age) living in orphanages, the prevalence of at least one HBV marker was 54.6%. The findings also confirmed that HCV was circulating in Romania. The results are consistent with national surveillance data and confirm that viral hepatitis is a major public health problem in Romania. Preventive measures will have to include HBV immunization of infants, with an appropriately targeted immunization strategy being determined through further epidemiological studies. PMID:8313496

Paquet, C; Babes, V T; Drucker, J; Sénémaud, B; Dobrescu, A

1993-01-01

193

Viral hemorrhagic fevers.  

PubMed

A taxonomically diverse set of single-stranded ribonucleic acid(ssRNA) viruses from four diverse viral families Arenaviridae,Bunyaviridae, Filoviridae, and Flaviviridae cause an acute systemic febrile syndrome called viral hemorrhagic fever (VHF). The syndrome produces combinations of prostration, malaise, increased vascular permeability, and coagulation maladies. In severe illness,VHF may include generalized bleeding but the bleeding does not typically constitute a life-threatening loss of blood volume. To a certain extent, it is a sign of damage to the vascular endothelium and is an indicator of disease severity in specific target organs. Although the viruses that cause hemorrhagic fever (HF) can productively replicate in endothelial cells, much of the disease pathology including impairment to the vascular system is thought to result primarily from the release of a variety of mediators from virus-infected cells, such as monocytes and macrophages that subsequently alter vascular function and trigger the coagulation disorders that epitomize these infections. While significant progress has been made over the last several years in dissecting out the molecular biology and pathogenesis of the HF viruses, there are currently no vaccines or drugs licensed available for most of the VHFs. PMID:16815457

Marty, Aileen M; Jahrling, Peter B; Geisbert, Thomas W

2006-06-01

194

Broad surveys of DNA viral diversity obtained through viral metagenomics of mosquitoes.  

PubMed

Viruses are the most abundant and diverse genetic entities on Earth; however, broad surveys of viral diversity are hindered by the lack of a universal assay for viruses and the inability to sample a sufficient number of individual hosts. This study utilized vector-enabled metagenomics (VEM) to provide a snapshot of the diversity of DNA viruses present in three mosquito samples from San Diego, California. The majority of the sequences were novel, suggesting that the viral community in mosquitoes, as well as the animal and plant hosts they feed on, is highly diverse and largely uncharacterized. Each mosquito sample contained a distinct viral community. The mosquito viromes contained sequences related to a broad range of animal, plant, insect and bacterial viruses. Animal viruses identified included anelloviruses, circoviruses, herpesviruses, poxviruses, and papillomaviruses, which mosquitoes may have obtained from vertebrate hosts during blood feeding. Notably, sequences related to human papillomaviruses were identified in one of the mosquito samples. Sequences similar to plant viruses were identified in all mosquito viromes, which were potentially acquired through feeding on plant nectar. Numerous bacteriophages and insect viruses were also detected, including a novel densovirus likely infecting Culex erythrothorax. Through sampling insect vectors, VEM enables broad survey of viral diversity and has significantly increased our knowledge of the DNA viruses present in mosquitoes. PMID:21674005

Ng, Terry Fei Fan; Willner, Dana L; Lim, Yan Wei; Schmieder, Robert; Chau, Betty; Nilsson, Christina; Anthony, Simon; Ruan, Yijun; Rohwer, Forest; Breitbart, Mya

2011-06-06

195

Broad Surveys of DNA Viral Diversity Obtained through Viral Metagenomics of Mosquitoes  

PubMed Central

Viruses are the most abundant and diverse genetic entities on Earth; however, broad surveys of viral diversity are hindered by the lack of a universal assay for viruses and the inability to sample a sufficient number of individual hosts. This study utilized vector-enabled metagenomics (VEM) to provide a snapshot of the diversity of DNA viruses present in three mosquito samples from San Diego, California. The majority of the sequences were novel, suggesting that the viral community in mosquitoes, as well as the animal and plant hosts they feed on, is highly diverse and largely uncharacterized. Each mosquito sample contained a distinct viral community. The mosquito viromes contained sequences related to a broad range of animal, plant, insect and bacterial viruses. Animal viruses identified included anelloviruses, circoviruses, herpesviruses, poxviruses, and papillomaviruses, which mosquitoes may have obtained from vertebrate hosts during blood feeding. Notably, sequences related to human papillomaviruses were identified in one of the mosquito samples. Sequences similar to plant viruses were identified in all mosquito viromes, which were potentially acquired through feeding on plant nectar. Numerous bacteriophages and insect viruses were also detected, including a novel densovirus likely infecting Culex erythrothorax. Through sampling insect vectors, VEM enables broad survey of viral diversity and has significantly increased our knowledge of the DNA viruses present in mosquitoes.

Ng, Terry Fei Fan; Willner, Dana L.; Lim, Yan Wei; Schmieder, Robert; Chau, Betty; Nilsson, Christina; Anthony, Simon; Ruan, Yijun; Rohwer, Forest; Breitbart, Mya

2011-01-01

196

Influenza and endemic viral pneumonia.  

PubMed

Viruses are a common and important cause of severe community-acquired pneumonia, and may lead to severe respiratory disease and admission to the intensive care unit. Influenza is the most common virus associated with severe viral pneumonia, although other important causes include respiratory syncytial virus, adenovirus, metapneumonia virus, and coronaviruses. Viral pneumonias tend to have a seasonal predilection and are often preceded by a typical viral prodrome. This article focuses on severe influenza pneumonia, including the 2009 H1N1 pandemic, and briefly discusses other causes of severe respiratory disease of viral etiology. PMID:24094391

Ramsey, Clare D; Kumar, Anand

2013-10-01

197

Viral hepatitis in India.  

PubMed

Viral hepatitis is a major public health problem in India, which is hyperendemic for HAV and HEV. Seroprevalence studies reveal that 90%-100% of the population acquires anti-HAV antibody and becomes immune by adolescence. Many epidemics of HEV have been reported from India. HAV related liver disease is uncommon in India and occurs mainly in children. HEV is also the major cause of sporadic adult acute viral hepatitis and ALF. Pregnant women and patients with CLD constitute the high risk groups to contract HEV infection, and HEV-induced mortality among them is substantial, which underlines the need for preventive measures for such groups. Children with HAV and HEV coinfection are prone to develop ALF. India has intermediate HBV endemicity, with a carrier frequency of 2%-4%. HBV is the major cause of CLD and HCC. Chronic HBV infection in India is acquired in childhood, presumably before 5 years of age, through horizontal transmission. Vertical transmission of HBV in India is considered to be infrequent. Inclusion of HBV vaccination in the expanded programme of immunization is essential to reduce the HBV carrier frequency and disease burden. HBV genotypes A and D are prevalent in India, which are similar to the HBV genotypes in the West. HCV infection in India has a population prevalence of around 1%, and occurs predominantly through transfusion and the use of unsterile glass syringes. HCV genotypes 3 and 2 are prevalent in 60%-80% of the population and they respond well to a combination of interferon and ribavirin. About 10%-15% of CLD and HCC are associated with HCV infection in India. HCV infection is also a major cause of post-transfusion hepatitis. HDV infection is infrequent in India and is present about 5%-10% of patients with HBV-related liver disease. HCC appears to be less common in India than would be expected from the prevalence rates of HBV and HCV. The high disease burden of viral hepatitis and related CLD in India, calls for the setting up of a hepatitis registry and formulation of government-supported prevention and control strategies. PMID:17100109

Acharya, S K; Madan, Kaushal; Dattagupta, S; Panda, S K

198

Therapy of viral hepatitis.  

PubMed

Worldwide viral hepatitis is the most common cause of jaundice, chronic liver disease cirrhosis and hepatocellular carcinoma. While important advances have been made in prevention of viral hepatitis, therapy of this disease remains unsatisfactory. There are no specific therapies of proven benefit for acute hepatitis, although use of alpha-interferon during the acute phase of hepatitis C may result in a decrease in the rate of chronicity. For chronic viral hepatitis, alpha-interferon has been widely used, but is expensive, poorly tolerated and limited in effectiveness. New antiviral agents and use of combinations of antivirals are now being evaluated and promise to provide a therapy that is effective in the majority of patients. The currently recommended therapy of chronic hepatitis B is a 4- to 6-month course of alpha-interferon in doses of 5-10 million units three times a week; a regimen that results in sustained clearance of hepatitis B virus (HBV) DNA and hepatitis B e antigen (HBeAg) from serum in approximately one-third and a loss of hepatitis B surface antigen (HBsAg) in one-tenth of patients. Long-term follow-up of patients who respond to interferon treatment with clearance of HBeAg indicate that the majority ultimately clear HBsAg as well and have continued remission in the liver disease, although low levels of HBV DNA can commonly be detected in liver tissue. Better therapies of hepatitis B are needed. Recently, several oral 'second-generation' nucleoside analogues have been developed that have potent activity against HBV. The best studied is lamivudine (3-thiacytidine) which results in marked inhibition of HBV DNA levels and improvement in serum aminotransferases and hepatic histology in the majority of patients. When stopped, however, most patients relapse and the shortcomings of long-term therapy have been the development of viral resistance in up to one-quarter of patients within a year and a higher percentage with more prolonged therapy. Future approaches of therapy of promise for hepatitis B are combinations of lamivudine with interferon and other antiviral nucleoside analogues. The currently recommended therapy of chronic hepatitis C is a 12- to 18-month course of alpha interferon in doses of 3 million units three times a week: a regimen that results in sustained clearance of hepatitis C virus (HCV) RNA in approximately 20% of patients. Sustained responses have been associated with marked improvements in hepatic histology and long-term studies indicate that the majority of patients remain free of virus in serum and liver, suggesting a 'cure' of infection. Responses to interferon correlate to some degree with clinical and virological features, including young age, absence of hepatic fibrosis, low levels of HCV RNA in serum and HCV genotypes 2 and 3. (ABSTRACT TRUNCATED) PMID:9705540

Hoofnagle, J H

1998-08-01

199

Viral pathogen discovery.  

PubMed

Viral pathogen discovery is of critical importance to clinical microbiology, infectious diseases, and public health. Genomic approaches for pathogen discovery, including consensus polymerase chain reaction (PCR), microarrays, and unbiased next-generation sequencing (NGS), have the capacity to comprehensively identify novel microbes present in clinical samples. Although numerous challenges remain to be addressed, including the bioinformatics analysis and interpretation of large datasets, these technologies have been successful in rapidly identifying emerging outbreak threats, screening vaccines and other biological products for microbial contamination, and discovering novel viruses associated with both acute and chronic illnesses. Downstream studies such as genome assembly, epidemiologic screening, and a culture system or animal model of infection are necessary to establish an association of a candidate pathogen with disease. PMID:23725672

Chiu, Charles Y

2013-05-29

200

Viral quasispecies evolution.  

PubMed

Evolution of RNA viruses occurs through disequilibria of collections of closely related mutant spectra or mutant clouds termed viral quasispecies. Here we review the origin of the quasispecies concept and some biological implications of quasispecies dynamics. Two main aspects are addressed: (i) mutant clouds as reservoirs of phenotypic variants for virus adaptability and (ii) the internal interactions that are established within mutant spectra that render a virus ensemble the unit of selection. The understanding of viruses as quasispecies has led to new antiviral designs, such as lethal mutagenesis, whose aim is to drive viruses toward low fitness values with limited chances of fitness recovery. The impact of quasispecies for three salient human pathogens, human immunodeficiency virus and the hepatitis B and C viruses, is reviewed, with emphasis on antiviral treatment strategies. Finally, extensions of quasispecies to nonviral systems are briefly mentioned to emphasize the broad applicability of quasispecies theory. PMID:22688811

Domingo, Esteban; Sheldon, Julie; Perales, Celia

2012-06-01

201

Sudden Deafness: Is It Viral?  

Microsoft Academic Search

A number of theories have been proposed to explain the etiopathogenesis of idiopathic sudden sensorineural hearing loss (ISSHL), including viral infection, vascular occlusion, breaks of labyrinthine membranes, immune-mediated mechanisms and abnormal cellular stress responses within the cochlea. In the present paper, we provide a critical review of the viral hypothesis of ISSHL. The evidence reviewed includes published reports of epidemiological

Saumil N. Merchant; Marlene L. Durand; Joe C. Adams

2008-01-01

202

Pleocytosis Is Associated with Disruption of HIV Compartmentalization between Blood and Cerebral Spinal Fluid Viral Populations  

PubMed Central

Introduction We hypothesized that pleocytosis, which is a marker of central nervous system (CNS) inflammation, would result in viral genetic equilibration or de-compartmentalization between HIV populations in the blood and cerebrospinal fluid (CSF), suggesting lymphocyte trafficking. Methods Study subjects, who started or interrupted their antiretroviral treatment, had viral loads measured and clonal viral env sequences generated from HIV RNA extracted from paired blood and CSF samples. White blood counts in CSF were also measured at each timepoint. Degree of inter-compartment segregation was calculated by posterior probability using linear discriminant analysis and multidimensional scaling. Co-receptor usage was determined using a trained support vector machine. Results Pleocytosis was strongly associated with disruption of viral compartmentalization. Conclusions Inflammation in the CNS, marked by pleocytosis, allows HIV populations to mix between blood and CSF, which may increase the overall viral genetic diversity within the CSF.

Smith, Davey M.; Zarate, Selene; Shao, Hai; Pillai, Satish K.; Letendre, Scott L.; Wong, Joseph K.; Richman, Douglas D.; Frost, Simon D. W.; Ellis, Ronald J.

2009-01-01

203

Viral vectors: a look back and ahead on gene transfer technology.  

PubMed

No matter what their origin, strain and family, viruses have evolved exquisite strategies to reach and penetrate specific target cells where they hijack the cellular machinery to express viral genes and produce progeny particles. The ability to deliver and express genetic information to cells is the basis for exploiting viruses as "Trojan horses" to genetically modify the natural cell target or, upon manipulation of the viral receptor to retarget the virus, to genetically engineer different cell types. This process, known as transduction, is accomplished using viral vectors derived from parental wild type viruses whose viral genes, essential for replication and virulence, have been replaced with the heterologous gene(s) required for cell manipulation. Rearrangement of the viral genome to impede replication or generation of infectious virions but maintaining the ability to deliver nucleic acids has been the object of intense research since the early 1980s. Technological advances and the ever-growing knowledge of molecular virology and virus-host cell relationships have constantly improved the safety profile of viral vectors that are now used in vitro and in vivo to study cellular gene function, correct genetic defects (gene therapy), express therapeutic proteins, vaccinate against infectious agents and tumors, produce experimental animal models, and for other purposes. This review illustrates the strategies used to generate some of the most used viral vectors, and their advantages, limitations and principal applications. PMID:23435812

Vannucci, Laura; Lai, Michele; Chiuppesi, Flavia; Ceccherini-Nelli, Luca; Pistello, Mauro

2013-01-01

204

Interim report on the genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials. Appendix G. Sample history and documentation  

SciTech Connect

This document traces the history of the samples used in the genetic and animal toxicity testing of SRC products, process intermediates, and waste materials. It begins with a brief summary (Table G-1, page G.1.2), which indicates the source, further processing, storage, and transmittals of all sample materials used in the testing. This summary is followed by more detailed descriptions of the various stages in the handling of sample materials, which in turn refer to various letters, work orders, and memos that document the history of these materials. A large number of materials originating from several sources are involved in this testing. Almost all of thes materials received further processing to prepare samples that are more representative of products, process intermediates, and waste materials expected to be produced by the SRC-I Demonstration Plant. ICRC believes that all the samples were produced, handled, and prepared in such a way as to render them fully representative of the SRC-I process as it would be practiced at the SRC-I Demonstration Plant.

Drozdowicz, B.Z.; Kelly, C.M.

1983-09-01

205

Evaluation and molecular characterization of human adenovirus in drinking water supplies: viral integrity and viability assays  

PubMed Central

Background Human adenoviruses (HAdVs) are the second-leading cause of childhood gastroenteritis worldwide. This virus is commonly found in environmental waters and is very resistant to water disinfection and environmental stressors, especially UV light inactivation. Molecular techniques, such as PCR-based methods (Polymerase Chain Reaction), are commonly used to detect and identify viral contamination in water, although PCR alone does not allow the discrimination between infectious and non-infectious viral particles. A combination of cell culture and PCR has allowed detection of infectious viruses that grow slowly or fail to produce cytopathic effects (CPE) in cell culture. This study aimed to assess the integrity and viability of human adenovirus (HAdV) in environmental water and evaluate circulating strains by molecular characterization in three sites of the water supply in Florianópolis, Santa Catarina Island, Brazil: Peri Lagoon water, spring source water, and water from the public water supply system. Methods Water samples were collected, concentrated and HAdV quantified by real-time PCR. Viral integrity was evaluated by enzymatic assay (DNase I) and infectivity by plaque assay (PA) and integrated cell culture using transcribed mRNA (ICC-RT-qPCR). Samples containing particles of infectious HAdV were selected for sequencing and molecular characterization. Results The analyzed sites contained 83, 66 and 58% undamaged HAdV particles (defined as those in which the genetic material is protected by the viral capsid) at Peri Lagoon, spring source water and public supply system water, respectively. Of these, 66% of the particles (by PA) and 75% (by ICC-RT-qPCR) HAdV were shown to be infectious, due to being undamaged in Peri Lagoon, 33% (by PA) and 58% (by ICC-RT-qPCR) in spring source water and 8% (by PA) and 25% (by ICC-RT-qPCR) in the public water supply system. ICC-RT-qPCR, a very sensitive and rapid technique, was able to detect as low as 1?×?102 HAdV genome copies per milliliter of infectious viral particles in the environmental water samples. The molecular characterization studies indicated that HAdV-2 was the prevalent serotype. Conclusions These results indicate a lack of proper public health measures. We suggest that HAdV can be efficiently used as a marker of environmental and drinking water contamination and ICC-RT-qPCR demonstrated greater sensitivity and speed of detection of infectious viral particles compared to PA.

2013-01-01

206

Fiber-mosaic adenovirus as a novel approach to design genetically modified adenoviral vectors  

Microsoft Academic Search

Genetic modification of the adenovirus (Ad) capsid is one of the successful strategies to achieve viral retargeting. However, it has been widely recognized that structural constraints imposed by viral proteins limit the number and nature of incorporated targeting ligands and often hamper viral propagation. To address this issue, we propose a genetic fiber-mosaic virus (having two distinct fibers in one

Larisa Pereboeva; Svetlana Komarova; Parameshwar J. Mahasreshti; David T. Curiel

2004-01-01

207

HIV-1 Transmitting Couples Have Similar Viral Load Set-Points in Rakai, Uganda  

PubMed Central

It has been hypothesized that HIV-1 viral load set-point is a surrogate measure of HIV-1 viral virulence, and that it may be subject to natural selection in the human host population. A key test of this hypothesis is whether viral load set-points are correlated between transmitting individuals and those acquiring infection. We retrospectively identified 112 heterosexual HIV-discordant couples enrolled in a cohort in Rakai, Uganda, in which HIV transmission was suspected and viral load set-point was established. In addition, sequence data was available to establish transmission by genetic linkage for 57 of these couples. Sex, age, viral subtype, index partner, and self-reported genital ulcer disease status (GUD) were known. Using ANOVA, we estimated the proportion of variance in viral load set-points which was explained by the similarity within couples (the ‘couple effect’). Individuals with suspected intra-couple transmission (97 couples) had similar viral load set-points (p?=?0.054 single factor model, p?=?0.0057 adjusted) and the couple effect explained 16% of variance in viral loads (23% adjusted). The analysis was repeated for a subset of 29 couples with strong genetic support for transmission. The couple effect was the major determinant of viral load set-point (p?=?0.067 single factor, and p?=?0.036 adjusted) and the size of the effect was 27% (37% adjusted). Individuals within epidemiologically linked couples with genetic support for transmission had similar viral load set-points. The most parsimonious explanation is that this is due to shared characteristics of the transmitted virus, a finding which sheds light on both the role of viral factors in HIV-1 pathogenesis and on the evolution of the virus.

Hollingsworth, T. Deirdre; Laeyendecker, Oliver; Shirreff, George; Donnelly, Christl A.; Serwadda, David; Wawer, Maria J.; Kiwanuka, Noah; Nalugoda, Fred; Collinson-Streng, Aleisha; Ssempijja, Victor; Hanage, William P.; Quinn, Thomas C.; Gray, Ronald H.; Fraser, Christophe

2010-01-01

208

Theoretical basis of a beneficial role for vitamin D in viral hepatitis  

PubMed Central

Abnormal bone metabolism and dysfunction of the calcium-parathyroid hormone-vitamin D axis have been reported in patients with viral hepatitis. Some studies suggested a relationship between vitamin D and viral hepatitis. Genetic studies have provided an opportunity to identify the proteins that link vitamin D to the pathology of viral hepatitis (i.e., the major histocompatibility complex class II molecules, the vitamin D receptor, cytochrome P450, the renin-angiotensin system, apolipoprotein E, liver X receptor, toll-like receptor, and the proteins regulated by the Sp1 promoter gene). Vitamin D also exerts its effects on viral hepatitis via non-genomic factors, i.e., matrix metalloproteinase, endothelial vascular growth factor, prostaglandins, cyclooxygenase-2, and oxidative stress. In conclusion, vitamin D could have a beneficial role in viral hepatitis. Calcitriol is best used for viral hepatitis because it is the active form of the vitamin D3 metabolite.

Luong, Khanh vinh quoc; Nguyen, Lan Thi Hoang

2012-01-01

209

Fall 2010 SCI 1210: Principles of Modern Biology (with Laboratory): Course Materials: Laboratory: Detection of Genetically Modified Foods  

Microsoft Academic Search

This course introduces students to the fundamental aspects of biological science including biochemistry, molecular biology, human molecular genetics, and cellular communication. Students gain experience with contemporary research methods and scientific reasoning through laboratory experiments. The relevance of biology to the environment and health is emphasized.

Jean J. Huang

2010-01-01

210

Viral BLIP dynamics during HAART.  

SciTech Connect

Intermittent episodes of low-level viremia (blips) are often observed in well-suppressed, HAART-treated patients. It has been reported that viral blips do not correlate with the emergence of new HAART-related mutations; however, increased frequency of blips correlates with slower decay of latently infected cells. Since blips are transient and unpredictable, detailed knowledge about them is difficult to obtain. We present an analysis of the dynamics of viral blips from viral load (VL) measurements on 123 patients for a period of 809k480d (21-1817d) and sampled every 31{+-}12d for a total of 26{+-}15 samples per patient.

Markowitz, M.; Louie, M. (Michael); Hurley, A. (Arlene); Ho, David D.; Perelson, Alan S.,; Di Mascio, M. (Michele)

2001-01-01

211

Simultaneous optimization by neuro-genetic approach for analysis of plant materials by laser induced breakdown spectroscopy  

NASA Astrophysics Data System (ADS)

A simultaneous optimization strategy based on a neuro-genetic approach is proposed for selection of laser induced breakdown spectroscopy operational conditions for the simultaneous determination of macro-nutrients (Ca, Mg and P), micro-nutrients (B, Cu, Fe, Mn and Zn), Al and Si in plant samples. A laser induced breakdown spectroscopy system equipped with a 10 Hz Q-switched Nd:YAG laser (12 ns, 532 nm, 140 mJ) and an Echelle spectrometer with intensified coupled-charge device was used. Integration time gate, delay time, amplification gain and number of pulses were optimized. Pellets of spinach leaves (NIST 1570a) were employed as laboratory samples. In order to find a model that could correlate laser induced breakdown spectroscopy operational conditions with compromised high peak areas of all elements simultaneously, a Bayesian Regularized Artificial Neural Network approach was employed. Subsequently, a genetic algorithm was applied to find optimal conditions for the neural network model, in an approach called neuro-genetic. A single laser induced breakdown spectroscopy working condition that maximizes peak areas of all elements simultaneously, was obtained with the following optimized parameters: 9.0 µs integration time gate, 1.1 µs delay time, 225 (a.u.) amplification gain and 30 accumulated laser pulses. The proposed approach is a useful and a suitable tool for the optimization process of such a complex analytical problem.

Nunes, Lidiane Cristina; da Silva, Gilmare Antônia; Trevizan, Lilian Cristina; Santos Júnior, Dario; Poppi, Ronei Jesus; Krug, Francisco José

2009-06-01

212

Randomly Amplified Polymorphic DNA PCR as a Tool for Assessment of Marine Viral Richness  

Microsoft Academic Search

Recent discoveries have uncovered considerable genetic diversity among aquatic viruses and raised ques- tions about the variability of this diversity within and between environments. Studies of the temporal and spatial dynamics of aquatic viral assemblages have been hindered by the lack of a common genetic marker among viruses for rapid diversity assessments. Randomly amplified polymorphic DNA (RAPD) PCR bypasses this

Danielle M. Winget; K. Eric Wommack

2008-01-01

213

Viral hepatitis and the surgeon  

PubMed Central

Background. Viral hepatitis is an infection of the liver caused by one or more of six known (HAV-HGV) hepatotropic viruses. It is a common problem among health care workers and their patients. Surgeons are at particular risk of both acquiring and transmitting some of these viruses from and to their patients. Unfortunately, specific immunoprophylaxis for viral hepatitis is presently limited to protecting against the spread of hepatitis A and B viral infections, leaving a high degree of vigilance and careful surgical technique as the only means available to prevent the transmission of other viruses relative to the surgeon. The purpose of this paper is to review the various forms of viral hepatitis including the nature of the virus, serologic testing, clinical features, epidemiology (with specific reference to those issues that arise in surgical practice), treatment and prevention.

Cohen, A. J.; Assy, N.; Moser, M.

2005-01-01

214

[Viral infection and ear diseases].  

PubMed

The association of viral infection to ear disease has triggered a great deal of interests. In the present paper, we provide a critical review of the viral hypothesis of ear diseases. Detection of viral antigen and antibody or RNA and DNA in the patients serum, endolymphatic fluid or surgical pathology specimens reveals that virus may have relevance to certain kinds of ear diseases, such as Meniere's disease, idiopathic sudden sensorineural hearing loss, otosclerosis. Bell's palsy and otitis media. The most appealing is the herpesvirus, which can cause latent infection in the neurons, and its reactivation may be the mechanism of recurrent attacks of ear diseases. Currently, antiviral drug treatment plus supportive therapy are the most effective managements dealing with viral infection. Although antiviral vaccine will become a promising preventive strategy in the future. PMID:23937021

Liu, Yuehang; Wang, Zhengmin

2013-05-01

215

A RealTime HIV-1 viral load assay for automated quantitation of HIV-1 RNA in genetically diverse group M subtypes A-H, group O and group N samples.  

PubMed

The Abbott RealTime HIV-1 assay is an automated test for monitoring HIV-1 viral load in plasma samples. The assay uses reverse transcription polymerase chain reaction (RT-PCR) technology with homogeneous real-time fluorescent detection. Automated sample preparation is performed on the m2000sp instrument where RNA is isolated using magnetic microparticle technology and dispensed to a PCR tray together with the amplification reagents. The PCR tray is then transferred to the Abbott m2000rt instrument for amplification and real-time detection. The assay utilizes two distinct sets of primers and probes for HIV-1 and for internal control (IC). The IC is processed along with each sample to control for sample recovery and inhibition. The HIV-1 primer and probe sequences are targeted to the integrase (IN) region of the polymerase (pol) gene. Due to the selection of a highly conserved target region and a novel, mismatch tolerant probe design, the assay can quantitate HIV-1 group M subtypes A-H, group O, and group N isolates. The assay provides high reproducibility and a wide dynamic range, allowing quantitation from 40 copies to 10 million copies of HIV-1 RNA per milliliter of plasma. HIV-1 RNA concentrations detected with 95% probability were 25copies/mL with 1.0mL of plasma, 39copies/mL with 0.6mL of plasma, 65copies/mL with 0.5mL of plasma, and 119copies/mL with 0.2mL of plasma. PMID:17707519

Tang, Ning; Huang, Shihai; Salituro, John; Mak, Wai-Bing; Cloherty, Gavin; Johanson, Julie; Li, Yu Hong; Schneider, George; Robinson, John; Hackett, John; Swanson, Priscilla; Abravaya, Klara

2007-08-17

216

Treating viral infection at smallpox vaccination site  

US Patent & Trademark Office Database

An adhesive patch is provided wherein the patch includes a porous backing having a front side and a back side. The patch also includes a therapeutic formulation located on the front side of the backing. The backing includes a flexible sheet of water insoluble porous material. The therapeutic formulation includes a combination of a antiviral agent useful for treating a viral infection in a mammal (e.g., human), a medicament that relieves topical discomfort, an adhesive, and a solvent. The solvent can preferably include a fragrance.

Rolf; David (Eden Prairie, MN)

2007-10-30

217

Genetic Analysis of HIV1 Subtypes in Nairobi, Kenya  

Microsoft Academic Search

BackgroundGenetic analysis of a viral infection helps in following its spread in a given population, in tracking the routes of infection and, where applicable, in vaccine design. Additionally, sequence analysis of the viral genome provides information about patterns of genetic divergence that may have occurred during viral evolution.ObjectiveIn this study we have analyzed the subtypes of Human Immunodeficiency Virus -1

Suhail Khoja; Peter Ojwang; Saeed Khan; Nancy Okinda; Reena Harania; Syed Ali; Jean K. Carr

2008-01-01

218

Phylodynamic analysis of a viral infection network.  

PubMed

Viral infections by sexual and droplet transmission routes typically spread through a complex host-to-host contact network. Clarifying the transmission network and epidemiological parameters affecting the variations and dynamics of a specific pathogen is a major issue in the control of infectious diseases. However, conventional methods such as interview and/or classical phylogenetic analysis of viral gene sequences have inherent limitations and often fail to detect infectious clusters and transmission connections. Recent improvements in computational environments now permit the analysis of large datasets. In addition, novel analytical methods have been developed that serve to infer the evolutionary dynamics of virus genetic diversity using sample date information and sequence data. This type of framework, termed "phylodynamics," helps connect some of the missing links on viral transmission networks, which are often hard to detect by conventional methods of epidemiology. With sufficient number of sequences available, one can use this new inference method to estimate theoretical epidemiological parameters such as temporal distributions of the primary infection, fluctuation of the pathogen population size, basic reproductive number, and the mean time span of disease infectiousness. Transmission networks estimated by this framework often have the properties of a scale-free network, which are characteristic of infectious and social communication processes. Network analysis based on phylodynamics has alluded to various suggestions concerning the infection dynamics associated with a given community and/or risk behavior. In this review, I will summarize the current methods available for identifying the transmission network using phylogeny, and present an argument on the possibilities of applying the scale-free properties to these existing frameworks. PMID:22993510

Shiino, Teiichiro

2012-07-31

219

Metagenomic analysis of viral communities in (hado)pelagic sediments.  

PubMed

In this study, we analyzed viral metagenomes (viromes) in the sedimentary habitats of three geographically and geologically distinct (hado)pelagic environments in the northwest Pacific; the Izu-Ogasawara Trench (water depth?=?9,760 m) (OG), the Challenger Deep in the Mariana Trench (10,325 m) (MA), and the forearc basin off the Shimokita Peninsula (1,181 m) (SH). Virus abundance ranged from 10(6) to 10(11) viruses/cm(3) of sediments (down to 30 cm below the seafloor [cmbsf]). We recovered viral DNA assemblages (viromes) from the (hado)pelagic sediment samples and obtained a total of 37,458, 39,882, and 70,882 sequence reads by 454 GS FLX Titanium pyrosequencing from the virome libraries of the OG, MA, and SH (hado)pelagic sediments, respectively. Only 24-30% of the sequence reads from each virome library exhibited significant similarities to the sequences deposited in the public nr protein database (E-value <10(-3) in BLAST). Among the sequences identified as potential viral genes based on the BLAST search, 95-99% of the sequence reads in each library were related to genes from single-stranded DNA (ssDNA) viral families, including Microviridae, Circoviridae, and Geminiviridae. A relatively high abundance of sequences related to the genetic markers (major capsid protein [VP1] and replication protein [Rep]) of two ssDNA viral groups were also detected in these libraries, thereby revealing a high genotypic diversity of their viruses (833 genotypes for VP1 and 2,551 genotypes for Rep). A majority of the viral genes predicted from each library were classified into three ssDNA viral protein categories: Rep, VP1, and minor capsid protein. The deep-sea sedimentary viromes were distinct from the viromes obtained from the oceanic and fresh waters and marine eukaryotes, and thus, deep-sea sediments harbor novel viromes, including previously unidentified ssDNA viruses. PMID:23468952

Yoshida, Mitsuhiro; Takaki, Yoshihiro; Eitoku, Masamitsu; Nunoura, Takuro; Takai, Ken

2013-02-27

220

Stability of dendriplexes formed by anti-HIV genetic material and poly(propylene imine) dendrimers in the presence of glucosaminoglycans.  

PubMed

There are several barriers to the application of dendriplexes formed by poly(propylene imine) dendrimers and genetic material for gene therapy. One limitation is their interaction with extracellular matrix components such as glucosaminoglycans. These can displace the genetic material from the dendriplexes, affecting their transfection activity. In this study, we analyzed the interaction between dendriplexes and the four main glucosaminoglycans (heparin, heparan sulfate, chondroitin sulfate, and hyaluronic acid) by fluorescence polarization and gel electrophoresis. Dendriplexes were formed by combining three anti-HIV antisense oligodeoxynucleotides with three poly(propylene imine) dendrimers of the fourth generation: unmodified and partially modified with maltose and maltotriose (open shell glycodendrimers). The data showed that the effect of glucosaminoglycans on dendriplexes depends on the glucosaminoglycan type and the oligosaccharide serving as the surface group of the dendrimer. Heparin at physiological concentrations destroys dendriplexes formed by open shell glycodendrimers, but dendriplexes based on unmodified poly(propylene imine) dendrimers are stable in its presence. The other glucosaminoglycans at physiological concentrations cannot destroy dendriplexes formed by any of the dendrimers studied. PMID:23199071

Szewczyk, Michal; Drzewinska, Joanna; Dzmitruk, Volha; Shcharbin, Dzmitry; Klajnert, Barbara; Appelhans, Dietmar; Bryszewska, Maria

2012-12-07

221

Estimation of the minimum uncertainty of DNA concentration in a genetically modified maize sample candidate certified reference material  

Microsoft Academic Search

Homogeneity testing and the determination of minimum sample mass are an important part of the certification of reference\\u000a materials. The smallest theoretically achievable uncertainty of certified concentration values is limited by the concentration\\u000a distribution of analyte in the different particle size fractions of powdered biological samples. This might be of special\\u000a importance if the reference material is prepared by dry

J. Prokisch; R. Zeleny; S. Trapmann; L. Le Guern; H. Schimmel; G. N. Kramer; J. Pauwels

2001-01-01

222

Molecular piracy: the viral link to carcinogenesis  

Microsoft Academic Search

The vast majority of the human experience with viral infectons is associated with acute symptoms, such as malaise, fever, chills, rhinitis and diarrhea. With this acute or lytic phase, the immune system mounts a response and eliminates the viral agent while acquiring antibodies to that specific viral subtype. With latent or chronic infections, the viral agent becomes incorporated into the

C. M. Flaitz; M. J. Hicks

1998-01-01

223

Immunologic features and HLA associations in chronic viral hepatitis  

Microsoft Academic Search

Background\\/Aims: Chronic viral hepatitis may have immunologic manifestations, and such features may reflect genetic predispositions. The aim of this study was to assess associations between immune manifestations and HLA-DR antigens. Methods: Ninety-five patients were evaluated prospectively for immunologic features. A microlymphocytotoxicity technique was used to determine DR3, DR4, and A1-B8-DR3 phenotypes. DR antigens were also determined by restriction fragment length

Albert J. Czaja; Herschel A. Carpenter; Paula J. Santrach; S. Breanndan Moore

1995-01-01

224

Highly Sensitive and Specific Detection of Rare Variants in Mixed Viral Populations from Massively Parallel Sequence Data  

Microsoft Academic Search

Viruses diversify over time within hosts, often undercutting the effectiveness of host defenses and therapeutic interventions. To design successful vaccines and therapeutics, it is critical to better understand viral diversification, including comprehensively characterizing the genetic variants in viral intra-host populations and modeling changes from transmission through the course of infection. Massively parallel sequencing technologies can overcome the cost constraints of

Alexander R. Macalalad; Michael C. Zody; Patrick Charlebois; Niall J. Lennon; Ruchi M. Newman; Christine M. Malboeuf; Elizabeth M. Ryan; Christian L. Boutwell; Karen A. Power; Doug E. Brackney; Kendra N. Pesko; Joshua Z. Levin; Gregory D. Ebel; Todd M. Allen; Bruce W. Birren; Matthew R. Henn

2012-01-01

225

Current Status of Gene Delivery and Gene Therapy in Lacrimal Gland using Viral Vectors  

PubMed Central

Gene delivery is one of the biggest challenges in the field of gene therapy. It involves the efficient transfer of transgenes into somatic cells for therapeutic purposes. A few major drawbacks in gene delivery include inefficient gene transfer and lack of sustained transgene expression. However, the classical method of using viral vectors for gene transfer has circumvented some of these issues. Several kinds of viruses, including retrovirus, adenovirus, adeno-associated virus, and herpes simplex virus, have been manipulated for use in gene transfer and gene therapy applications. The transfer of genetic material into lacrimal epithelial cells and tissues, both in vitro and in vivo, has been critical for the study of tear secretory mechanisms and autoimmunity of the lacrimal gland. These studies will help in the development of therapeutic interventions for autoimmune disorders such as Sjögren’s syndrome and dry eye syndromes which are associated with lacrimal dysfunction. These studies are also critical for future endeavors which utilize the lacrimal gland as a reservoir for the production of therapeutic factors which can be released in tears, providing treatment for diseases of the cornea and posterior segment. This review will discuss the developments related to gene delivery and gene therapy in the lacrimal gland using several viral vector systems.

Selvam, Shivaram; Thomas, Padmaja B.; Hamm-Alvarez, Sarah F.; Schechter, Joel E.; Stevenson, Douglas; Mircheff, Austin K.; Trousdale*, Melvin D.

2006-01-01

226

Comparison of commercial viral genomic extraction kits for the molecular detection of foodborne viruses.  

PubMed

When genetic material is extracted from viruses responsible for food illnesses, two broad types of possibilities are offered: conventional methods, which are well established but usually long and exacting to perform, or commercial kits, which are faster and easy to use but much more expensive. Thus, it is important to evaluate some performance parameters such as the analytical sensitivity to be able to select the optimal technique for each situation. The principal objective of this study was to establish and compare the analytical sensitivities of three commercial genetic material extraction methods (TRIzol reagent, FTA cards, and QIAGEN kits) along with three selected viruses, adenovirus, hepatitis A virus, and rotavirus. Viral detection was carried out using a standard PCR technique for adenovirus and reverse transcription PCR for rotavirus and hepatitis A virus. The results obtained showed that with the QIAGEN kit, the sensitivity was 2 logs lower than with the two other methods for all three viruses studied. Nevertheless, despite their lower analytical sensitivities, the other two extraction methods should not be overlooked and ought to be considered when evaluating the most efficient approach suitable for a specific commodity, since food-related outbreaks may be traced to a wide variety of food types. PMID:19898543

Brassard, Julie; Lamoureux, Lisyanne; Gagné, Marie-Josée; Poitras, Elyse; Trottier, Yvon-Louis; Houde, Alain

2009-08-01

227

Differences in viral and host genetic risk factors for development of human T-cell lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis between Iranian and Japanese HTLV-1-infected individuals.  

PubMed

Human T-cell lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP) is a neurological disease observed only in 1-2 % of infected individuals. HTLV-1 provirus load, certain HLA alleles and HTLV-1 tax subgroups are reported to be associated with different levels of risk for HAM/TSP in Kagoshima, Japan. Here, it was determined whether these risk factors were also valid for HTLV-1-infected individuals in Mashhad in northeastern Iran, another region of endemic HTLV-1 infection. In Iranian HTLV-1-infected individuals (n=132, 58 HAM/TSP patients and 74 seropositive asymptomatic carriers), although HLA-DRB1*0101 was associated with disease susceptibility in the absence of HLA-A*02 (P=0.038; odds ratio=2.71) as observed in Kagoshima, HLA-A*02 and HLA-Cw*08 had no effect on either the risk of developing HAM/TSP or HTLV-1 provirus load. All Iranian subjects possessed tax subgroup A sequences, and the protective effects of HLA-A*02 were observed only in Kagoshima subjects with tax subgroup B but not in those with tax subgroup A. Both the prevalence of HTLV-1 subgroups and the host genetic background may explain the different risks levels for HAM/TSP development in these two populations. PMID:15722539

Sabouri, Amir H; Saito, Mineki; Usuku, Koichiro; Bajestan, Sepideh Naghibzadeh; Mahmoudi, Mahmoud; Forughipour, Mohsen; Sabouri, Zahra; Abbaspour, Zahra; Goharjoo, Mohammad E; Khayami, Esmaeil; Hasani, Ali; Izumo, Shuji; Arimura, Kimiyoshi; Farid, Reza; Osame, Mitsuhiro

2005-03-01

228

Noncoding RNPs of Viral Origin  

PubMed Central

SUMMARY Like their host cells, many viruses produce noncoding (nc)RNAs. These show diversity with respect to time of expression during viral infection, length and structure, protein-binding partners and relative abundance compared with their host-cell counterparts. Viruses, with their limited genomic capacity, presumably evolve or acquire ncRNAs only if they selectively enhance the viral life cycle or assist the virus in combating the host’s response to infection. Despite much effort, identifying the functions of viral ncRNAs has been extremely challenging. Recent technical advances and enhanced understanding of host-cell ncRNAs promise accelerated insights into the RNA warfare mounted by this fascinating class of RNPs.

Steitz, Joan; Borah, Sumit; Cazalla, Demian; Fok, Victor; Lytle, Robin; Mitton-Fry, Rachel; Riley, Kasandra; Samji, Tasleem

2011-01-01

229

Genetic determinants of pathogenesis by feline infectious peritonitis virus.  

PubMed

Feline infectious peritonitis (FIP) is a fatal, immune-augmented, and progressive viral disease of cats associated with feline coronavirus (FCoV). Viral genetic determinants specifically associated with FIPV pathogenesis have not yet been discovered. Viral gene signatures in the spike, non-structural protein 3c, and membrane of the coronavirus genome have been shown to often correlate with disease manifestation. An "in vivo mutation transition hypothesis" is widely accepted and postulates that de novo virus mutation occurs in vivo giving rise to virulence. The existence of "distinct circulating avirulent and virulent strains" is an alternative hypothesis of viral pathogenesis. It may be possible that viral dynamics from both hypotheses are at play in the occurrence of FIP. Epidemiologic data suggests that the genetic background of the cat contributes to the manifestation of FIP. Further studies exploring both viral and host genetic determinants of disease in FIP offer specific opportunities for the management of this disease. PMID:21719115

Brown, Meredith A

2011-06-12

230

Experimental Bacterial and Viral Diarrhea (Experimental Viral Diarrhea in Pigs).  

National Technical Information Service (NTIS)

This investigation was undertaken to develop a system by which one could induce viral and/or bacterial diarrhea in pigs at will, and study the physiological and morphological changes induced by the pathogen preceeding overt signs of diarrhea. A strain of ...

L. R. Otero-Vilardebo

1981-01-01

231

Development of plasmid DNA reference material for the quantification of genetically modified common bean embrapa 5.1.  

PubMed

The genetically modified (GM) common bean Embrapa 5.1 was recently approved for commercialization. The reliable detection and quantification of GM organisms is strongly dependent on validated methods as well as calibration systems. This work presents the development of a calibrant plasmid for Embrapa 5.1 common bean detection. The reaction parameters were determined and compared for both the plasmid DNA (pDNA) and the genomic DNA (gDNA). PCR efficiencies for pDNA were 81% for the construction-specific assays and 76% for the taxon-specific assay, whereas for gDNA efficiencies were 94 and 93%, respectively. The limits of detection (LOD) in both qPCR assays were 10(2) and 10(3) copies of gDNA and pDNA per PCR reaction, respectively. This is sufficient to detect 0.067 and 0.67% of GM common bean in 100 ng of DNA, respectively, which is in agreement with detecting the 1% GM content required by the Brazilian legislation. PMID:23627349

Brod, Fábio C A; Dinon, Andréia Z; Kolling, Deise J; Faria, Josias C; Arisi, Ana C M

2013-05-08

232

Chapter VIII. Contributions of propagation techniques and genetic modification to breeding - genetic engineering for disease resistance  

Technology Transfer Automated Retrieval System (TEKTRAN)

Genetic engineering offers an opportunity to develop flower bulb crops with resistance to fungal, viral, and bacterial pathogens. Several of the flower bulb crops, Lilium spp., Gladiolus, Zantedeschia, Muscari, Hyacinthus, Narcissus, Ornithogalum, Iris, and Alstroemeria, have been transformed with t...

233

Genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials: Final report: Appendix A, Subchronic studies of first-stage solid products  

SciTech Connect

We have completed an extensive program to investigate the toxicity---including mutagenic, carcinogenic, and teratogenic potential---of SRC-I (Solvent Refined Coal-I) products, along with selected intermediates and waste materials, as represented by the SRC-I Design Baseline. The original primary objective of the toxicology program was to produce data that could be used for four main purposes: to support design of programs to ensure workers' health and safety; to help estimate environmental impacts of SRC-I technology; to support the Toxic Substances Control Act (TSCA) premanufacturing notification process for SRC-I technology; and to promote public understanding and acceptance of the potential health effects of the emerging synfuels industry. The toxicology program consists of five main elements: (1) Genetic Toxicity Evaluations; (2) Acute Animal Toxicity Evaluations; (3) Subchronic Animal Toxicity Evaluations; (4) Chronic (life-span) Animal Carcinogenicity Evaluation; (5) Quality Control/Quality Assurance (QC/QA) Monitoring and Evaluation.

Drozdowicz, B.Z.; Kelly, C.M.

1987-11-01

234

Genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials: Final report: Appendix D, First-stage middle distillate subchronic studies  

SciTech Connect

We have completed an extensive program to investigate the toxicity---including mutagenic, carcinogenic, and teratogenic potential---of SRC-I (Solvent Refined Coal-I) products, along with selected intermediates and waste materials, as represented by the SRC-I Design Baseline. The original primary objective of the toxicology program was to produce data that could be used for four main purposes: to support design of programs to ensure workers' health and safety; to help estimate environmental impacts of SRC-I technology; to support the Toxic Substances Control Act (TSCA) premanufacturing notification process for SRC-I technology; and to promote public understanding and acceptance of the potential health effects of the emerging synfuels industry. The toxicology program consists of five main elements: (1) Genetic Toxicity Evaluations; (2) Acute Animal Toxicity Evaluations; (3) Subchronic Animal Toxicity Evaluations (4) Chronic (life-span) Animal Carcinogenicity Evaluation; (5) Quality Control/Quality Assurance (QC/QA) Monitoring and Evaluation.

Drozdowicz, B.Z.; Kelly, C.M.

1987-11-01

235

Genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials: Final report: Appendix G, Second-stage middle distillate dermal carcinogenesis studies  

SciTech Connect

We have completed an extensive program to investigate the toxicity---including mutagenic, carcinogenic, and teratogenic potential---of SRC-I (Solvent Refined Coal-I) products, along with selected intermediates and waste materials, as represented by the SRC-I Design Baseline. The original primary objective of the toxicology program was to produce data that could be used for four main purposes: to support design of programs to ensure workers' health and safety; to help estimate environmental impacts of SRC-I technology; to support the Toxic Substances Control Act (TSCA) premanufacturing notification process for SRC-I technology; and to promote public understanding and acceptance of the potential health effects of the emerging synfuels industry. The toxicology program consists of five main elements: (1) Genetic Toxicity Evaluations; (2) Acute Animal Toxicity Evaluations; (3) Subchronic Animal Toxicity Evaluations; (4) Chronic (life-span) Animal Carcinogenicity Evaluation; (5) Quality Control/Quality Assurance (QC/QA) Monitoring and Evaluation.

Drozdowicz, B.Z.; Kelly, C.M.

1987-11-01

236

Genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials: Final report: Appendix F, First-stage middle distillate dermal carcinogenesis studies  

SciTech Connect

We have completed an extensive program to investigate the toxicity---including mutagenic,, carcinogenic, and teratogenic potential---of SRC-I (Solvent Refined Coal-I) products, along with selected intermediates and waste materials, as represented by the SRC-I Design Baseline. The original primary objective of the toxicology program was to produce data that could be used for four main purposes: to support design of programs to ensure workers' health and safety; to help estimate environmental impacts of SRC-I technology; to support the Toxic Substances Control Act (TSCA) premanufacturing notification process for SRC-I technology; and to promote public understanding and acceptance of the potential health effects of the emerging synfuels industry. The toxicology program consists of five main elements: (1) Genetic Toxicity Evaluations; (2) Acute Animal Toxicity Evaluations; (3) Subchronic Animal Toxicity Evaluations; (4) Chronic (life-span) Animal Carcinogenicity Evaluation; (5) Quality Control/Quality Assurance (QC/QA) Monitoring and Evaluation.

Drozdowicz, B.Z.; Kelly, C.M.

1987-11-01

237

Genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials: Final report: Appendix B, Subchronic studies of second-stage solid products (TSL solids)  

SciTech Connect

We have completed an extensive program to investigate the toxicity---including mutagenic, carcinogenic, and teratogenic potential---of SRC-I (Solvent Refined Coal-I) products, along with selected intermediates and waste materials, as represented by the SRC-I Design Baseline. The original primary objective of the toxicology program was to produce data that could be used for four main purposes: to support design of programs to ensure workers' health and safety; to help estimate environmental impacts of SRC-I technology; to support the Toxic Substances Control Act (TSCA) premanufacturing notification process for SRC-I technology; and to promote public understanding and acceptance of the potential health effects of the emerging synfuels industry. The toxicology program consists of five main elements: (1) Genetic Toxicity Evaluations; (2) Acute Animal Toxicity Evaluations; (3) Subchronic Animal Toxicity Evaluations; (4) Chronic (life-span) Animal Carcinogenicity Evaluation; (5) Quality Control/Quality Assurance (QC/QA) Monitoring and Evaluation.

Drozdowicz, B.Z.; Kelly, C.M.

1987-11-01

238

Genetic and animal toxicity testing of SRC-I products, intermediates, and waste materials: Final report: Appendix E, Second-stage middle distillate subchronic studies  

SciTech Connect

We have completed an extensive program to investigate the toxicity---including mutagenic, carcinogenic, and teratogenic potential---of SRC-I (Solvent Refined Coal-I) products, along with selected intermediates and waste materials, as represented by the SRC-I Design Baseline. The original primary objective of the toxicology program was to produce data that could be used for four main purposes: to support design of programs to ensure workers' health safety; to help estimate environmental impacts of SRC-I technology; to support the Toxic Substances Control Act (TSCA) premanufacturing notification process for SRC-I technology; and to promote public understanding and acceptance of the potential health effects of the emerging synfuels industry. The toxicology program consists of five main elements: (1) Genetic Toxicity Evaluations; (2) Acute Animal Toxicity Evaluations; (3) Subchronic Animal Toxicity Evaluations; (4) Chronic (life-span) Animal Carcinogenicity Evaluation; (5) Quality Control/Quality Assurance (QC/QA) Monitoring and Evaluation.

Drozdowicz, B.Z.; Kelly, C.M.

1987-11-01

239

Therapeutic treatment for viral infections  

US Patent & Trademark Office Database

The administration internally to humans of 1-(B-hydroxethyl)-2-methyl-5-nitroimidazole, (metronidazole) in a dosage range for adult humans of about 31-2,500 mgs per twenty-four hour period, is an effective therapeutic treatment for certain viral infections causing diverse symptoms, both acute and chronic. Corresponding dosage proportional to body weight appears effective in other mammals also.

Mercer; James B. (Lenexa, KS)

1985-08-27

240

Viral hepatitis in the Arctic  

Microsoft Academic Search

Objectives. Summarize research on viral hepatitis in indigenous populations in the Arctic. Study De- sign. Literature review. Methods. Medline search from 1966-2003. Results. High prevalence rates of total hepatitis A antibody of > 50% and of hepatitis B of between 22% in Alaska and 42% in Greenland for total infection and between 3% in Canada and 12% in Siberia for

Brian J McMahon

241

Viral haemorrhagic fevers of man.  

PubMed

This article reviews the current state of knowledge on the viral haemorrhagic fevers that infect man, namely smallpox, chikungunya fever, dengue fever, Rift Valley fever, yellow fever, Crimean haemorrhagic fever, Kyasanur Forest disease, Omsk haemorrhagic fever, Argentinian haemorrhagic fever (Junin virus), Bolivian haemorrhagic fever (Machupo virus), Lassa fever, haemorrhagic fever with renal syndrome, and Marburg and Ebola virus diseases. PMID:310725

Simpson, D I

1978-01-01

242

Sequencing Needs for Viral Diagnostics  

Microsoft Academic Search

We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to

Shea N. Gardner; Marisa W. Lam; Nisha J. Mulakken; Clinton L. Torres; Jason R. Smith; Tom R. Slezak

2004-01-01

243

Viral haemorrhagic fevers of man*  

PubMed Central

This article reviews the current state of knowledge on the viral haemorrhagic fevers that infect man, namely smallpox, chikungunya fever, dengue fever, Rift Valley fever, yellow fever, Crimean haemorrhagic fever, Kyasanur Forest disease, Omsk haemorrhagic fever, Argentinian haemorrhagic fever (Junin virus), Bolivian haemorrhagic fever (Machupo virus), Lassa fever, haemorrhagic fever with renal syndrome, and Marburg and Ebola virus diseases.

Simpson, D. I. H.

1978-01-01

244

Nosocomial Spread of Viral Disease  

PubMed Central

Viruses are important causes of nosocomial infection, but the fact that hospital outbreaks often result from introduction(s) from community-based epidemics, together with the need to initiate specific laboratory testing, means that there are usually insufficient data to allow the monitoring of trends in incidences. The most important defenses against nosocomial transmission of viruses are detailed and continuing education of staff and strict adherence to infection control policies. Protocols must be available to assist in the management of patients with suspected or confirmed viral infection in the health care setting. In this review, we present details on general measures to prevent the spread of viral infection in hospitals and other health care environments. These include principles of accommodation of infected patients and approaches to good hygiene and patient management. They provide detail on individual viral diseases accompanied in each case with specific information on control of the infection and, where appropriate, details of preventive and therapeutic measures. The important areas of nosocomial infection due to blood-borne viruses have been extensively reviewed previously and are summarized here briefly, with citation of selected review articles. Human prion diseases, which present management problems very different from those of viral infection, are not included.

Aitken, Celia; Jeffries, Donald J.

2001-01-01

245

Maternal immunization against viral disease  

Microsoft Academic Search

The protective effect of maternal antibody against many viral diseases has been recognized. The use of maternal immunization has been considered as a means to augment this protection in the young infant against disease. Advantages of maternal immunization include the fact that young infants are most susceptible to infections but least responsive to vaccines, that pregnant women are accessible to

Janet Englund; W. Paul Glezen; Pedro A. Piedra

1998-01-01

246

Dengue viral infections; pathogenesisand epidemiology  

Microsoft Academic Search

Dengue viral infections affect up to 100 million individuals per year. Dengue haemorrhagic fever is a clinical form of disease characterised by intravascular fluid loss. There has been a marked increase in the incidence of this form of the disease over the last few decades, associated with significant mortality, particularly in the paediatric population. A number of theories relating to

William J. H McBride; Helle Bielefeldt-Ohmann

2000-01-01

247

Concepts of genetics: II edition  

SciTech Connect

This book provides an introduction to the molecule, and progresses logically through cellular genetics and the genetics of organisms to the larger picture of population genetics. The Second Edition features new chapters on quantitative inheritance and recombinant DNA, a new appendix with a human gene map and coverage of gene disorders, expanded coverage of bacterial and viral genetics, and consolidated coverage of sex linkage, sex determination, sex chromosome abberations, and sex differentiation. Dozens of new figures are added in this edition. All diagrams, photographs, and tables work hand-in-hand with the text to explain important concepts. Practical exercises with answers at the back of the text provide immediate feedback.

Klug, W.S.; Cummings, M.R.

1986-01-01

248

Herbal medicines for viral myocarditis  

PubMed Central

Background Herbal medicines are being used for treating viral diseases including viral myocarditis, and many controlled trials have been done to investigate their efficacy. Objectives To assess the effects of herbal medicines on clinical and indirect outcomes in patients with viral myocarditis. Search strategy We searched the Cochrane Central Register of Controlled Trials (CENTRAL) in The Cochrane Library Issue 3, 2009, MEDLINE (January 1966 - July 2009), EMBASE (January 1998 - July 2009), Chinese Biomedical Database (1979 - 2009), China National Knowledge Infrastructure (1979 - 2009), Chinese VIP Information (1989 - 2009), Chinese Academic Conference Papers Database and Chinese Dissertation Database (1980 - 2009), AMED (1985 - 2009), LILACS accessed in July 2009 and the trials register of the Cochrane Complementary Medicine Field. We handsearched Chinese journals and conference proceedings. No language restrictions were applied. Selection criteria Randomised controlled trials of herbal medicines (with a minimum of seven days treatment duration) compared with placebo, no intervention, or conventional interventions were included. Trials of herbal medicine plus conventional drug versus drug alone were also included. Only trials that reported adequate description of allocation sequence generation were included. Data collection and analysis Two review authors independently extracted data and evaluated trial quality. Adverse effects information was collected from the trials. Main results Fourteen randomised trials involving 1463 people were included. All trials were conducted and published in China. Quality of the trials was assessed to be low. No trial had diagnosis of viral myocarditis confirmed histologically, and only a few trials attempted to establish viral aetiology. Nine different herbal medicines were tested in the included trials. The trials reported electrocardiogram results, level of myocardial enzymes, cardiac function, symptoms, and adverse effects. Astragalus membranaceus (either as an injection or granules) showed significant positive effects in symptom improvement, normalisation of electrocardiogram results, CPK levels, and cardiac function. Shengmai injection also showed significant effects in symptom improvement. Shengmai decoction triggered significant improvement in quality of life measured by SF-36. No serious adverse effects were reported. Authors’ conclusions Some herbal medicines may lead to improvement of symptoms, ventricular premature beat, electrocardiogram, level of myocardial enzymes, and cardiac function in viral myocarditis. However, interpretation of these findings should be taken with care due to the low methodological quality, small sample size, and limited number of trials on individual herbs. Further robust trials are needed to explore the use of herbal medicines in viral myocarditis.

Liu, Zhao Lan; Liu, Zhi Jun; Liu, Jian Ping; Yang, Min; Kwong, Joey

2012-01-01

249

Herbal medicines for viral myocarditis  

PubMed Central

Background Herbal medicines are being used for treating viral diseases including viral myocarditis, and many controlled trials have been done to investigate their efficacy. Objectives To assess the effects of herbal medicines on clinical and indirect outcomes in patients with viral myocarditis. Search methods We searched the Cochrane Central Register of Controlled Trials (CENTRAL) in The Cochrane Library Issue 3, 2009, MEDLINE (January 1966 - July 2009), EMBASE (January 1998 - July 2009), Chinese Biomedical Database (1979 - 2009), China National Knowledge Infrastructure (1979 - 2009), Chinese VIP Information (1989 - 2009), Chinese Academic Conference Papers Database and Chinese Dissertation Database (1980 - 2009), AMED (1985 - 2009), LILACS accessed in July 2009 and the trials register of the Cochrane Complementary Medicine Field. We handsearched Chinese journals and conference proceedings. No language restrictions were applied. Selection criteria Randomised controlled trials of herbal medicines (with a minimum of seven days treatment duration) compared with placebo, no intervention, or conventional interventions were included. Trials of herbal medicine plus conventional drug versus drug alone were also included. Only trials that reported adequate description of allocation sequence generation were included. Data collection and analysis Two review authors independently extracted data and evaluated trial quality. Adverse effects information was collected from the trials. Results Fourteen randomised trials involving 1463 people were included. All trials were conducted and published in China. Quality of the trials was assessed to be low. No trial had diagnosis of viral myocarditis confirmed histologically, and only a few trials attempted to establish viral aetiology. Nine different herbal medicines were tested in the included trials. The trials reported electrocardiogram results, level of myocardial enzymes, cardiac function, symptoms, and adverse effects. Astragalus membranaceus (either as an injection or granules) showed significant positive effects in symptom improvement, normalisation of electrocardiogram results, CPK levels, and cardiac function. Shengmai injection also showed significant effects in symptom improvement. Shengmai decoction triggered significant improvement in quality of life measured by SF-36. No serious adverse effects were reported. Authors' conclusions Some herbal medicines may lead to improvement of symptoms, ventricular premature beat, electrocardiogram, level of myocardial enzymes, and cardiac function in viral myocarditis. However, interpretation of these findings should be taken with care due to the low methodological quality, small sample size, and limited number of trials on individual herbs. Further robust trials are needed to explore the use of herbal medicines in viral myocarditis.

Liu, Zhao Lan; Liu, Zhi Jun; Liu, Jian Ping; Yang, Min; Kwong, Joey

2011-01-01

250

Sequential bottlenecks drive viral evolution in early acute hepatitis C virus infection.  

PubMed

Hepatitis C is a pandemic human RNA virus, which commonly causes chronic infection and liver disease. The characterization of viral populations that successfully initiate infection, and also those that drive progression to chronicity is instrumental for understanding pathogenesis and vaccine design. A comprehensive and longitudinal analysis of the viral population was conducted in four subjects followed from very early acute infection to resolution of disease outcome. By means of next generation sequencing (NGS) and standard cloning/Sanger sequencing, genetic diversity and viral variants were quantified over the course of the infection at frequencies as low as 0.1%. Phylogenetic analysis of reassembled viral variants revealed acute infection was dominated by two sequential bottleneck events, irrespective of subsequent chronicity or clearance. The first bottleneck was associated with transmission, with one to two viral variants successfully establishing infection. The second occurred approximately 100 days post-infection, and was characterized by a decline in viral diversity. In the two subjects who developed chronic infection, this second bottleneck was followed by the emergence of a new viral population, which evolved from the founder variants via a selective sweep with fixation in a small number of mutated sites. The diversity at sites with non-synonymous mutation was higher in predicted cytotoxic T cell epitopes, suggesting immune-driven evolution. These results provide the first detailed analysis of early within-host evolution of HCV, indicating strong selective forces limit viral evolution in the acute phase of infection. PMID:21912520

Bull, Rowena A; Luciani, Fabio; McElroy, Kerensa; Gaudieri, Silvana; Pham, Son T; Chopra, Abha; Cameron, Barbara; Maher, Lisa; Dore, Gregory J; White, Peter A; Lloyd, Andrew R

2011-09-01

251

Synthesis of genetically engineered protein polymers (recombinamers) as an example of advanced self-assembled smart materials.  

PubMed

In this chapter, we describe two methods for bio-producing recombinant repetitive polypeptide polymers for use in biomedical devices. These polymers, known as elastin-like recombinamers (ELRs), are derived from the repetition of selected amino acid domains of extracellular matrix proteins with the aim of recreating their mechanical and physiological features. The proteinaceous nature of ELRs allows us to make use of the natural biosynthetic machinery of heterologous hosts to express advanced and large polymers or "recombinamers." Despite the essentially unlimited possibilities for designing recombinamers, the production of synthetic genes to encode them should allow us to overcome the difficulties surrounding bioproduction of these non-natural monotonous DNA and protein sequences. The aim of this work is to supply the biotechnologist with fine-tuning methods to biosynthesize advanced self-assembled smart materials. PMID:22042670

Rodríguez-Cabello, José Carlos; Girotti, Alessandra; Ribeiro, Artur; Arias, Francisco Javier

2012-01-01

252

Read length versus depth of coverage for viral quasispecies reconstruction.  

PubMed

Recent advancements of sequencing technology have opened up unprecedented opportunities in many application areas. Virus samples can now be sequenced efficiently with very deep coverage to infer the genetic diversity of the underlying virus populations. Several sequencing platforms with different underlying technologies and performance characteristics are available for viral diversity studies. Here, we investigate how the differences between two common platforms provided by 454/Roche and Illumina affect viral diversity estimation and the reconstruction of viral haplotypes. Using a mixture of ten HIV clones sequenced with both platforms and additional simulation experiments, we assessed the trade-off between sequencing coverage, read length, and error rate. For fixed costs, short Illumina reads can be generated at higher coverage and allow for detecting variants at lower frequencies. They can also be sufficient to assess the diversity of the sample if sequences are dissimilar enough, but, in general, assembly of full-length haplotypes is feasible only with the longer 454/Roche reads. The quantitative comparison highlights the advantages and disadvantages of both platforms and provides guidance for the design of viral diversity studies. PMID:23056573

Zagordi, Osvaldo; Däumer, Martin; Beisel, Christian; Beerenwinkel, Niko

2012-10-03

253

Unexpected maintenance of hepatitis C viral diversity following liver transplantation.  

PubMed

Chronic hepatitis C virus (HCV) infection can lead to liver cirrhosis in up to 20% of individuals, often requiring liver transplantation. Although the new liver is known to be rapidly reinfected, the dynamics and source of the reinfecting virus(es) are unclear, resulting in some confusion concerning the relationship between clinical outcome and viral characteristics. To clarify the dynamics of liver reinfection, longitudinal serum viral samples from 10 transplant patients were studied. Part of the E1/E2 region was sequenced, and advanced phylogenetic analysis methods were used in a multiparameter analysis to determine the history and ancestry of reinfecting lineages. Our results demonstrated the complexity of HCV evolutionary dynamics after liver transplantation, in which a large diverse population of viruses is transmitted and maintained for months to years. As many as 30 independent lineages in a single patient were found to reinfect the new liver. Several later posttransplant lineages were more closely related to older pretransplant viruses than to viruses detected immediately after transplantation. Although our data are consistent with a number of interpretations, the persistence of high viral genetic variation over long periods of time requires an active mechanism. We discuss possible scenarios, including frequency-dependent selection or variation in selective pressure among viral subpopulations, i.e., the population structure. The latter hypothesis, if correct, could have relevance to the success of newer direct-acting antiviral therapies. PMID:22623804

Gray, Rebecca R; Strickland, Samantha L; Veras, Nazle M; Goodenow, Maureen M; Pybus, Oliver G; Lemon, Stanley M; Fried, Michael W; Nelson, David R; Salemi, Marco

2012-05-23

254

Unexpected Maintenance of Hepatitis C Viral Diversity following Liver Transplantation  

PubMed Central

Chronic hepatitis C virus (HCV) infection can lead to liver cirrhosis in up to 20% of individuals, often requiring liver transplantation. Although the new liver is known to be rapidly reinfected, the dynamics and source of the reinfecting virus(es) are unclear, resulting in some confusion concerning the relationship between clinical outcome and viral characteristics. To clarify the dynamics of liver reinfection, longitudinal serum viral samples from 10 transplant patients were studied. Part of the E1/E2 region was sequenced, and advanced phylogenetic analysis methods were used in a multiparameter analysis to determine the history and ancestry of reinfecting lineages. Our results demonstrated the complexity of HCV evolutionary dynamics after liver transplantation, in which a large diverse population of viruses is transmitted and maintained for months to years. As many as 30 independent lineages in a single patient were found to reinfect the new liver. Several later posttransplant lineages were more closely related to older pretransplant viruses than to viruses detected immediately after transplantation. Although our data are consistent with a number of interpretations, the persistence of high viral genetic variation over long periods of time requires an active mechanism. We discuss possible scenarios, including frequency-dependent selection or variation in selective pressure among viral subpopulations, i.e., the population structure. The latter hypothesis, if correct, could have relevance to the success of newer direct-acting antiviral therapies.

Strickland, Samantha L.; Veras, Nazle M.; Goodenow, Maureen M.; Pybus, Oliver G.; Lemon, Stanley M.; Fried, Michael W.; Nelson, David R.

2012-01-01

255

Introductory molecular genetics  

SciTech Connect

This book begins with an overview of the current principles of genetics and molecular genetics. Over this foundation, it adds detailed and specialized information: a description of the translation, transcription, expression and regulation of DNA and RNA; a description of the manipulation of genetic material via promoters, enhancers, and gene splicing; and a description of cloning techniques, especially those for blood group genes. The last chapter looks to the impact of molecular genetics on transfusion medicine.

Edwards-Moulds, J.

1986-01-01

256

Laboratory procedures to generate viral metagenomes  

Microsoft Academic Search

This collection of laboratory protocols describes the steps to collect viruses from various samples with the specific aim of generating viral metagenome sequence libraries (viromes). Viral metagenomics, the study of uncultured viral nucleic acid sequences from different biomes, relies on several concentration, purification, extraction, sequencing and heuristic bioinformatic methods. No single technique can provide an all-inclusive approach, and therefore the

Matthew Haynes; Mya Breitbart; Linda Wegley; Forest Rohwer; Rebecca V Thurber

2009-01-01

257

Viral vectors for malaria vaccine development  

Microsoft Academic Search

A workshop on viral vectors for malaria vaccine development, organized by the PATH Malaria Vaccine Initiative, was held in Bethesda, MD on October 20, 2005. Recent advancements in viral-vectored malaria vaccine development and emerging vector technologies were presented and discussed. Classic viral vectors such as poxvirus, adenovirus and alphavirus vectors have been successfully used to deliver malaria antigens. Some of

Shengqiang Li; Emily Locke; Joseph Bruder; David Clarke; Denise L. Doolan; Menzo J. E. Havenga; Adrian V. S. Hill; Peter Liljestrom; Thomas P. Monath; Hussein Y. Naim; Christian Ockenhouse; De-chu C. Tang; Kent R. Van Kampen; Jean-Francois Viret; Fidel Zavala; Filip Dubovsky

2007-01-01

258

Assessment of Experimental and Natural Viral Aerosols.  

National Technical Information Service (NTIS)

The purpose of these studies was to describe procedures employed in studies on the role of viral aerosols in human viral respiratory disease. The results showed that viral aerosols prepared with the Collison atomizer can be adjusted to a desired content o...

P. J. Gerone R. B. Couch G. V. Keefer R. G. Douglas E. B. Derrenbacher

1966-01-01

259

Genetic Engineering: The Modification of Man  

ERIC Educational Resources Information Center

|Describes somatic and genetic manipulations of individual genotypes, using diabetes control as an example of the first mode that is potentially realizable be derepression or viral transduction of genes. Advocates the use of genetic engineering of the second mode to remove man from his biological limitations, but offers maxims to ensure the…

Sinsheimer, Robert L.

1970-01-01

260

Laboratory formulated magnetic nanoparticles for enhancement of viral gene expression in suspension cell line.  

PubMed

One factor critical to successful gene therapy is the development of efficient delivery systems. Although advances in gene transfer technology including viral and non-viral vectors have been made, an ideal vector system has not yet been constructed. Due to the growing concerns over the toxicity and immunogenicity of viral DNA delivery systems, DNA delivery via improve viral routes has become more desirable and advantageous. The ideal improve viral DNA delivery system should be a synthetic materials plus viral vectors. The materials should also be biocompatible, efficient, and modular so that it is tunable to various applications in both research and clinical settings. The successful steps towards this improve viral DNA delivery system is demonstrated: a magnetofection system mediated by modified cationic chitosan-coated iron oxide nanoparticles. Dense colloidal cationic iron oxide nanoparticles serve as an uptake-enhancing component by physical concentration at the cell surface in presence of external magnetic fields; enhanced viral gene expression (3-100-fold) due to the particles is seen as compared to virus vector alone with little virus dose. PMID:17935796

Bhattarai, Shanta Raj; Kim, Sun Young; Jang, Kyu Yun; Lee, Ki Chang; Yi, Ho Keun; Lee, Dae Yeol; Kim, Hak Yong; Hwang, Pyoung Han

2007-11-01

261

HIV controllers: a multifactorial phenotype of spontaneous viral suppression  

PubMed Central

A small minority of HIV-infected individuals, known as HIV controllers, is able to exert long-term control over HIV replication in the absence of treatment. Increasing evidence suggests that the adaptive immune system plays a critical role in this control but also that a combination of several host and/or viral factors, rather than a single cause, leads to this rare phenotype. Here, we review recent advances in the study of these remarkable individuals. We summarize the epidemiology and clinical characteristics of HIV controllers, and subsequently describe contributing roles of host genetic factors, innate and adaptive immune responses, and viral factors to this phenotype. We emphasize distinctive characteristics of HIV-specific CD4 T cell responses and of CD4 T cell subpopulations that are frequently found in HIV controllers. We discuss major controversies in the field and the relevance of the study of HIV controllers for the development of novel therapeutic strategies and vaccines.

Theze, Jacques; Chakrabarti, Lisa A.; Vingert, Benoit; Porichis, Filippos; Kaufmann, Daniel E.

2011-01-01

262

Histone deacetylases in viral infections  

Microsoft Academic Search

Chromatin remodeling and gene expression are regulated by histone deacetylases (HDACs) that condense the chromatin structure\\u000a by deacetylating histones. HDACs comprise a group of enzymes that are responsible for the regulation of both cellular and\\u000a viral genes at the transcriptional level. In mammals, a total of 18 HDACs have been identified and grouped into four classes,\\u000a i.e., class I (HDACs

Georges Herbein; Daniel Wendling

2010-01-01

263

Treatment of Acute Viral Bronchiolitis  

PubMed Central

Acute viral bronchiolitis represents the most common lower respiratory tract infection in infants and young children and is associated with substantial morbidity and mortality. Respiratory syncytial virus is the most frequently identified virus, but many other viruses may also cause acute bronchiolitis. There is no common definition of acute viral bronchiolitis used internationally, and this may explain part of the confusion in the literature. Most children with bronchiolitis have a self limiting mild disease and can be safely managed at home with careful attention to feeding and respiratory status. Criteria for referral and admission vary between hospitals as do clinical practice in the management of acute viral bronchiolitis, and there is confusion and lack of evidence over the best treatment for this condition. Supportive care, including administration of oxygen and fluids, is the cornerstone of current treatment. The majority of infants and children with bronchiolitis do not require specific measures. Bronchodilators should not be routinely used in the management of acute viral bronchiolitis, but may be effective in some patients. Most of the commonly used management modalities have not been shown to have a clear beneficial effect on the course of the disease. For example, inhaled and systemic corticosteroids, leukotriene receptor antagonists, immunoglobulins and monoclonal antibodies, antibiotics, antiviral therapy, and chest physiotherapy should not be used routinely in the management of bronchiolitis. The potential effect of hypertonic saline on the course of the acute disease is promising, but further studies are required. In critically ill children with bronchiolitis, today there is little justification for the use of surfactant and heliox. Nasal continuous positive airway pressure may be beneficial in children with severe bronchiolitis but a large trial is needed to determine its value. Finally, very little is known on the effect of the various interventions on the development of post-bronchiolitic wheeze.

Eber, Ernst

2011-01-01

264

The morphological, material-level, and ash properties of turkey femurs from 3 different genetic strains during production.  

PubMed

Femoral fractures are observed in selective-bred commercial turkeys; however, the etiology of such fractures is unknown. The current study investigated the whole bone morphological, material-level mechanical, and bone ash properties to determine the effect of selective breeding on bone strength. Femora from 3 divergent strains of turkeys, a commercial line, a different selectively bred heavy line (F-line), and a lighter age or weight matched random-bred line (RBC2/R-EQ, respectively), were compared. Bone geometric properties were measured with micro-CT and bone mechanical properties were measured using 3-point bending tests. Whole bone ash quantities were also recorded. Statistics were run using a general linear model multivariate ANOVA (GLM ANOVA). Results showed that at similar ages, the faster growing birds (commercial and F-line) had femurs twice the size of the RBC2 line as measured by cross-sectional area as early as 8 wk into the study. The femurs of the commercial and F-lines also exhibited as much as 20% greater mechanical strength than femurs from the RBC2 line at 16 and 20 wk of age as measured by properties such as elastic modulus and ultimate tensile strength. However, at similar BW, the slower growing R-EQ line had higher mechanical properties than the other lines, with the elastic modulus being 40% greater and the ultimate tensile strength being 37% greater at weights equivalent to those of the commercial and F-lines at 12 wk of age. Moreover, it was observed that the morphological properties (i.e., cross-sectional area, moments of inertia) are largely governed by BW, as there is little difference in the amount gained per week of age across the different lines. Conversely, the mechanical properties, as well as the related ash content, appear to be governed at least in part by time. Therefore, whereas modulation of bone geometry is the key responder for changes in BW, sufficient time for matrix mineralization or maturation or both to occur is also essential for mechanical competence of bone. PMID:23091126

Zhong, Z; Muckley, M; Agcaoglu, S; Grisham, M E; Zhao, H; Orth, M; Lilburn, M S; Akkus, O; Karcher, D M

2012-11-01

265

Evaluation of the metabolic fate of munitions material (TNT & RDX) in plant systems and initial assessment of material interaction with plant genetic material (DNA). Initial assessment of plant DNA adducts as biomarkers  

SciTech Connect

Genetic damage to deoxyribonucleic acid (DNA) has long been suspected of being a fundamental event leading to cancer. A variety of causal factors can result in DNA damage including photodimerization of base pairs, ionizing radiation, specific reaction of DNA with environmental pollutants, and nonspecific oxidative damage caused by the action of highly reactive oxidizing agents produced by metabolism. Because organisms depend on an unadulterated DNA template for reproduction, DNA repair mechanisms are an important defense for maintaining genomic integrity. The objective of this exploratory project was to evaluate the potential for TNT to form DNA adducts in plants. These adducts, if they exist in sufficient quantities, could be potential biomarkers of munitions exposure. The ultimate goal is to develop a simple analytical assay for the determination of blomarkers that is indicative of munitions contamination. DNA repair exists in dynamic equilibrium with DNA damage. Repair mechanisms are capable of keeping DNA damage at remarkably low concentrations provided that the repair capacity is not overwhelmed.

Harvey, S.D.; Clauss, T.W.; Fellows, R.J.; Cataldo, D.A.

1995-08-01

266

Sudden Deafness: Is It Viral?  

PubMed Central

A number of theories have been proposed to explain the etiopathogenesis of idiopathic sudden sensorineural hearing loss (ISSHL), including viral infection, vascular occlusion, breaks of labyrinthine membranes, immune-mediated mechanisms and abnormal cellular stress responses within the cochlea. In the present paper, we provide a critical review of the viral hypothesis of ISSHL. The evidence reviewed includes published reports of epidemiological and serological studies, clinical observations and results of antiviral therapy, morphological and histopathological studies, as well as results of animal experiments. The published evidence does not satisfy the majority of the Henle-Koch postulates for viral causation of an infectious disease. Possible explanations as to why these postulates remain unfulfilled are reviewed, and future studies that may provide more insight are described. We also discuss other mechanisms that have been postulated to explain ISSHL. Our review indicates that vascular occlusion, labyrinthine membrane breaks and immune-mediated mechanisms are unlikely to be common causes of ISSHL. Finally, we review our recently proposed theory that abnormal cellular stress responses within the cochlea may be responsible for ISSHL.

Merchant, Saumil N.; Durand, Marlene L.; Adams, Joe C.

2008-01-01

267

Molecular Engineering of Viral Gene Delivery Vehicles  

PubMed Central

Viruses can be engineered to efficiently deliver exogenous genes, but their natural gene delivery properties often fail to meet human therapeutic needs. Therefore, engineering viral vectors with new properties, including enhanced targeting abilities and resistance to immune responses, is a growing area of research. This review discusses protein engineering approaches to generate viral vectors with novel gene delivery capabilities. Rational design of viral vectors has yielded successful advances in vitro, and to an extent in vivo. However, there is often insufficient knowledge of viral structure-function relationships to reengineer existing functions or create new capabilities, such as virus-cell interactions, whose molecular basis is distributed throughout the primary sequence of the viral proteins. Therefore, high-throughput library and directed evolution methods offer alternative approaches to engineer viral vectors with desired properties. Parallel and integrated efforts in rational and library-based design promise to aid the translation of engineered viral vectors toward the clinic.

Schaffer, David V.; Koerber, James T.; Lim, Kwang-il

2009-01-01

268

Collaboration at the Nanoscale: Exploring Viral Genetics with Electron Microscopy  

ERIC Educational Resources Information Center

|The Maine Science Corps is a project sponsored by the National Science Foundation's (NSF) Graduate Teaching Fellows in K-12 Education (GK-12 ) program. Through this program, the University of Southern Maine's (USM) virology and transmission electron microscopy (TEM) research group provides high school teachers and students in rural areas with…

Duboise, S. Monroe; Moulton, Karen D.; Jamison, Jennifer L.

2009-01-01

269

Molecular phylogenetic analysis of bovine viral diarrhoea virus: A Bayesian approach  

Microsoft Academic Search

Genetic typing of bovine viral diarrhoea virus (BVDV) is important for precise classification of viruses. Traditionally, inferring BVDV phylogeny has been performed by distance-based method, i.e. neighbor-joining for single genes. In this study, a Bayesian approach was exploited to analyze five genetic regions of BVDV genome (5? UTR, Npro, E2a, E2b, and NS3) for 68 taxa retrieved from GenBank. The

Hongyan Xia; Lihong Liu; Niklas Wahlberg; Claudia Baule; Sándor Belák

2007-01-01

270

Genetic Diversity and Biochemical Characteristics of Trichosporon asahii Isolated from Clinical Specimens, Houses of Patients with Summer-Type-Hypersensitivity Pneumonitis, and Environmental Materials  

PubMed Central

Trichosporon asahii, which is distributed in the environment, is the major causative agent of the opportunistic infection trichosporonosis, and it also causes summer-type hypersensitivity pneumonitis (SHP). Random amplification of polymorphic DNA analysis was used to determine the intraspecies diversity of 39 T. asahii isolates from clinical specimens, SHP patients' houses, and environmental materials. The three primers used revealed 46 polymorphic bands. A phenogram was generated by the unweighted pair-group method with arithmetic mean. Clinical isolates formed a cluster, characterized by a 90% matching coefficient, but they did not cluster with strains isolated from SHP patients' houses or environmental sources. In addition, the biochemical characteristics of 86 strains from three sources were examined with 31 compounds using an ID32C kit, and a phenogram was constructed. The phenogram consisted of three major clusters. Cluster I included most of the clinical SHP isolates, and cluster II included most of the environmental isolates. Cluster III contained only one strain. A remarkable difference was found in the abilities of the strains belonging to clusters I and II to utilize six compounds. These results suggest that the genetic diversity and biochemical characteristics of T. asahii seem to be related to the source of the isolate. We also found a specific DNA fragment for the clinical isolates and strains isolated from SHP patients' houses.

Sugita, Takashi; Ichikawa, Tomoe; Matsukura, Manami; Sueda, Mika; Takashima, Masako; Ikeda, Reiko; Nishikawa, Akemi; Shinoda, Takako

2001-01-01

271

Biological Gene Delivery Vehicles: Beyond Viral Vectors  

PubMed Central

Gene therapy covers a broad spectrum of applications, from gene replacement and knockdown for genetic or acquired diseases such as cancer, to vaccination, each with different requirements for gene delivery. Viral vectors and synthetic liposomes have emerged as the vehicles of choice for many applications today, but both have limitations and risks, including complexity of production, limited packaging capacity, and unfavorable immunological features, which restrict gene therapy applications and hold back the potential for preventive gene therapy. While continuing to improve these vectors, it is important to investigate other options, particularly nonviral biological agents which include bacteria, bacteriophage, virus-like particles (VLPs), erythrocyte ghosts, and exosomes. Exploiting the natural properties of these biological entities for specific gene delivery applications will expand the repertoire of gene therapy vectors available for clinical use. Here, we review the prospects for nonviral biological delivery vehicles as gene therapy agents with focus on their unique evolved biological properties and respective limitations and potential applications. The potential of these nonviral biological entities to act as clinical gene therapy delivery vehicles has already been shown in clinical trials using bacteria-mediated gene transfer and with sufficient development, these entities will complement the established delivery techniques for gene therapy applications.

Seow, Yiqi; Wood, Matthew J

2009-01-01

272

Genetic modification of human hematopoietic stem cells  

Microsoft Academic Search

Transplantation of genetically modified hematopoietic stem cells is a potential therapy for a variety of genetic and acquired\\u000a blood disorders, such as severe combined immunodeficiencies, thalassemia and AIDS. Genetic modification of stem cells can\\u000a be carried out ex vivo, by transducing bone marrow or peripheral blood stem cell-rich fractions with viral vectors carrying\\u000a therapeutic genes. These vectors must be able

Fulvio Mavilio

2005-01-01

273

Bovine viral diarrhea virus (BVDV) infections in pigs.  

PubMed

Cattle are the natural hosts of bovine viral diarrhea virus (BVDV), which causes mucosal disease, respiratory and gastrointestinal tract infections, and reproductive problems in cattle. However, BVDV can also infect goats, sheep, deer, and pigs. The prevalence of BVDV infection in pig herds has substantially increased in the last several years, causing increased economic losses to the global pig breeding industry. This article is a summary of BVDV infections in pigs, including a historical overview, clinical signs, pathology, source of infection, genetic characteristics, impacts of porcine BVDV infection for diagnosis of classical swine fever virus (CSFV), differentiation of infection with CSFV and BVDV, and future prospects of porcine BVDV infection. PMID:23587625

Tao, Jie; Liao, Jinhu; Wang, Yin; Zhang, Xinjun; Wang, Jianye; Zhu, Guoqiang

2013-03-26

274

Drug Sanctuaries, Low Steady State Viral Loads and Viral Blips.  

SciTech Connect

Patients on HAART for long periods of time obtain viral loads (VLs) below 50 copies/ml. Ultrasensitive VL assays show that some of these patients obtain a low steady state VL, while others continue to exhibit VL declines to below 5 copies/ml. Low steady states can be explained by two-compartment models that incorporate a drug sanctuary. Interestingly, when patients exhibit continued declines below 50 copies/ml the rate of decline has a half-life of {approx} 6 months, consistent with some estimates of the rate of latent cell decline. Some patients, despite having sustained undetectable VLs show periods of transient viremia (blips). I will present some statistical characterization of the blips observed in a set of 123 patients, suggesting that blips are generated largely by random processes, that blips tend to correspond to periods of a few weeks in which VLs are elevated, and that VL decay from the peak of a blip may have two-phases. Using new results suggesting that the viral burst size, N {approx} 5 x 10{sup 4}, we estimate the number of cells needed to produce a blip.

Perelson, Alan S.,; Callaway, D. (Duncan); Pomerantz, R. J. (Roger J.); Chen, H. Y.; Markowitz, M.; Ho, David D.; Di Mascio, M. (Michele)

2002-01-01

275

The S2 Gene of Equine Infectious Anemia Virus Is a Highly Conserved Determinant of Viral Replication and Virulence Properties in Experimentally Infected Ponies  

Microsoft Academic Search

Equine infectious anemia virus (EIAV) is genetically one of the simplest lentiviruses in that the viral genome encodes only three accessory genes, tat, rev, and S2. Although serological analyses demonstrate the expression of the S2 protein in persistently infected horses, the role of this viral gene remains undefined. We recently reported that the S2 gene is not essential for EIAV

FENG LI; CAROLINE LEROUX; JODI K. CRAIGO; SHEILA J. COOK; CHARLES J. ISSEL; RONALD C. MONTELARO

2000-01-01

276

Bovine viral diarrhea virus genomic associations in mucosal disease, enteritis and generalized dermatitis outbreaks in Argentina  

Microsoft Academic Search

The objective of the present work is the description outbreaks caused by bovine viral diarrhea virus (BVDV) in commercial beef cattle ranches in Argentina. Genetic affiliation and their association with the clinical manifestation were carried out with five BVDV isolates from an outbreak of mucosal disease (MD) (Outbreak #1), acute enteritis (Outbreaks #2 and #3) and generalized dermatitis (Outbreaks #4

Anselmo C. Odeón; Guillermo Risatti; Germán G. Kaiser; Mar??a R Leunda; Ernesto Odriozola; Carlos M Campero; Ruben O Donis

2003-01-01

277

Selected Readings in Genetic Engineering  

ERIC Educational Resources Information Center

|Describes different sources of readings for understanding issues and concepts of genetic engineering. Broad categories of reading materials are: concerns about genetic engineering; its background; procedures; and social, ethical and legal issues. References are listed. (PS)|

Mertens, Thomas R.; Robinson, Sandra K.

1973-01-01

278

Distribution and genetic heterogeneity of Puumala virus in Sweden  

Microsoft Academic Search

Small mammals trapped in Sweden were analysed for specific antibody responses against three hanta- virus serotypes and for the presence of viral antigen. To determine the genetic identity of viral RNA in lungs of seropositive bank voles (Clethrionomys gloreolus), polymerase chain reactions and sub- sequent partial sequencing of both the M and S segments were employed. The sequences obtained were

J. Horling; A. Lundkvist; M. Jaarola; A. Plyusnin; H. Tegelstrom; K. Persson; H. Lehvaslaiho; B. Hornfeldt; A. Vaheri; B. Niklasson

1996-01-01

279

Tin-coated viral nanoforests as sodium-ion battery anodes.  

PubMed

Designed as a high-capacity alloy host for Na-ion chemistry, a forest of Sn nanorods with a unique core-shell structure was synthesized on viral scaffolds, which were genetically engineered to ensure a nearly vertical alignment upon self-assembly onto a metal substrate. The interdigital spaces thus formed between individual rods effectively accommodated the volume expansion and contraction of the alloy upon sodiation/desodiation, while additional carbon-coating engineered over these nanorods further suppressed Sn aggregation during extended electrochemical cycling. Due to the unique nanohierarchy of multiple functional layers, the resultant 3D nanoforest of C/Sn/Ni/TMV1cys, binder-free composite electrode already and evenly assembled on a stainless steel current collector, exhibited supreme capacity utilization and cycling stability toward Na-ion storage and release. An initial capacity of 722 mA·h (g Sn)(-1) along with 405 mA·h (g Sn)(-1) retained after 150 deep cycles demonstrates the longest-cycling nano-Sn anode material for Na-ion batteries reported in the literature to date and marks a significant performance improvement for neat Sn material as alloy host for Na-ion chemistry. PMID:23484633

Liu, Yihang; Xu, Yunhua; Zhu, Yujie; Culver, James N; Lundgren, Cynthia A; Xu, Kang; Wang, Chunsheng

2013-03-20

280

Human Cytomegalovirus: Bacterial Artificial Chromosome (BAC) Cloning and Genetic Manipulation  

PubMed Central

Our understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells.

Paredes, Anne M.; Yu, Dong

2011-01-01

281

Common Threads in Persistent Viral Infections?  

PubMed Central

Most viral infections are self-limiting, resulting in either clearance of the pathogen or death of the host. However, a subset of viruses can establish permanent infection and persist indefinitely within the host. Even though persisting viruses are derived from various viral families with distinct replication strategies, they all utilize common mechanisms for establishment of long-lasting infections. Here, we discuss the commonalities between persistent infections with herpes-, retro-, flavi-, arena-, and polyomaviruses that distinguish them from acutely infecting viral pathogens. These shared strategies include selection of cell subsets ideal for long-term maintenance of the viral genome, modulation of viral gene expression, viral subversion of apoptotic pathways, and avoidance of clearance by the immune system.

Kane, Melissa; Golovkina, Tatyana

2010-01-01

282

Genomic analysis of uncultured marine viral communities  

PubMed Central

Viruses are the most common biological entities in the oceans by an order of magnitude. However, very little is known about their diversity. Here we report a genomic analysis of two uncultured marine viral communities. Over 65% of the sequences were not significantly similar to previously reported sequences, suggesting that much of the diversity is previously uncharacterized. The most common significant hits among the known sequences were to viruses. The viral hits included sequences from all of the major families of dsDNA tailed phages, as well as some algal viruses. Several independent mathematical models based on the observed number of contigs predicted that the most abundant viral genome comprised 2–3% of the total population in both communities, which was estimated to contain between 374 and 7,114 viral types. Overall, diversity of the viral communities was extremely high. The results also showed that it would be possible to sequence the entire genome of an uncultured marine viral community.

Breitbart, Mya; Salamon, Peter; Andresen, Bjarne; Mahaffy, Joseph M.; Segall, Anca M.; Mead, David; Azam, Farooq; Rohwer, Forest

2002-01-01

283

Bermuda Triangle for the liver: alcohol, obesity, and viral hepatitis.  

PubMed

Despite major progress in understanding and managing liver disease in the past 30 years, it is now among the top 10 most common causes of death globally. Several risk factors, such as genetics, diabetes, obesity, excessive alcohol consumption, viral infection, gender, immune dysfunction, and medications, acting individually or in concert, are known to precipitate liver damage. Viral hepatitis, excessive alcohol consumption, and obesity are the major factors causing liver injury. Estimated numbers of hepatitis B virus (HBV) and hepatitis C virus (HCV)-infected subjects worldwide are staggering (370 and 175 million, respectively), and of the 40 million known human immunodeficiency virus positive subjects, 4 and 5 million are coinfected with HBV and HCV, respectively. Alcohol and HCV are the leading causes of end-stage liver disease worldwide and the most common indication for liver transplantation in the United States and Europe. In addition, the global obesity epidemic that affects up to 40 million Americans, and 396 million worldwide, is accompanied by an alarming incidence of end-stage liver disease, a condition exacerbated by alcohol. This article focuses on the interactions between alcohol, viral hepatitis, and obesity (euphemistically described here as the Bermuda Triangle of liver disease), and discusses common mechanisms and synergy. PMID:23855291

Zakhari, Samir

2013-08-01

284

Sustained viral gene delivery through core-shell fibers.  

PubMed

Although viral gene transfer is efficient in achieving transgene expression for tissue engineering, drawbacks of virus dissemination, toxicity and transient gene expression due to immune response have hindered its widespread application. Many tissue engineering studies thus opt to genetically engineer cells in vitro prior to their introduction in vivo. However, it would be attractive to obviate the need for in vitro manipulation by transducing the infiltrating progenitor cells in situ. This study introduces the fabrication of a virus-encapsulated electrospun fibrous scaffold to achieve sustained and localized transduction. Adenovirus encoding the gene for green fluorescent protein was efficiently encapsulated into the core of poly(epsilon-caprolactone) fibers through co-axial electrospinning and was subsequently released via a porogen-mediated process. HEK 293 cells seeded on the scaffolds expressed high level of transgene expression over a month, while cells inoculated by scaffold supernatant showed only transient expression for a week. RAW 264.7 cells cultured on the virus-encapsulated fibers produced a lower level of IL-1 beta, TNF-alpha and IFN-alpha, suggesting that the activation of macrophage cells by the viral vector was reduced when encapsulated in the core-shell PCL fibers. In demonstrating sustained and localized cell transduction, this study presents an attractive alternative mode of applying viral gene transfer for regenerative medicine. PMID:19539680

Liao, I-Chien; Chen, Sulin; Liu, Jason B; Leong, Kam W

2009-06-17

285

Viral vaccines for bony fish: past, present and future.  

PubMed

Since 1970, aquaculture production has grown. In 2010, it had an annual average rate of 6.3% with 59.9 million tons of product and soon could exceed capture fisheries as a source of fishery products. However, the occurrence of viral diseases continues to be a significant limiting factor and its control is important for the development of this sector. In aquaculture farms, fish are reared under intensive culture conditions, and the use of viral vaccines has enabled an increase in production. Several types of vaccines and strategies of vaccination have been developed; however, this approach has not reached the expected goals in the most susceptible stage (fingerlings). Currently, there are inactivated and recombinant commercial vaccines, mainly for salmonids and cyprinids. In addition, updated genomic and proteomic technology has expedited the research and expansion of new vaccine models, such as those comprised of subunits or DNA. The objective of this review is to cover the various types of viral vaccines that have been developed and are available for bony fishes, as well as the advantages and challenges that DNA vaccines present for massive administration in a growing aquaculture, possible risks for the environment, the controversy regarding genetically modified organisms and possible acceptance by consumers. PMID:23659303

Salgado-Miranda, Celene; Loza-Rubio, Elizabeth; Rojas-Anaya, Edith; García-Espinosa, Gary

2013-05-01

286

[Workshop on Molecular Epidemiology of Viral Diseases].  

PubMed

A workshop on viral epidemiology was held on September 29, 1995 at the Medical School of the Universidad Nacional Autónoma de Mexico. The aim of this workshop was to promote interaction among scientists working in viral epidemiology. Eighteen scientists from ten institutions presented their experiences and work. General aspects of the epidemiology of meaningful viral diseases in the country were discussed, and lectures presented on the rota, polio, respiratory syncytial, dengue, papiloma, rabies, VIH and hepatitis viruses. PMID:9504103

Gómez, B; Cabrera, L; Arias, C F

1997-01-01

287

Viral security proteins: counteracting host defences  

Microsoft Academic Search

Interactions with host defences are key aspects of viral infection. Various viral proteins perform counter-defensive functions, but a distinct class, called security proteins, is dedicated specifically to counteracting host defences. Here, the properties of the picornavirus security proteins L and 2A are discussed. These proteins have well-defined positions in the viral polyprotein, flanking the capsid precursor, but they are structurally

Anatoly P. Gmyl; Vadim I. Agol

2010-01-01

288

Quantum dot encapsulation in viral capsids.  

PubMed

Incorporation of CdSe/ZnS semiconductor quantum dots (QDs) into viral particles provides a new paradigm for the design of intracellular microscopic probes and vectors. Several strategies for the incorporation of QDs into viral capsids were explored; those functionalized with poly(ethylene glycol) (PEG) can be self-assembled into viral particles with minimal release of photoreaction products and enhanced stability against prolonged irradiation. PMID:16968014

Dixit, Suraj K; Goicochea, Nancy L; Daniel, Marie-Christine; Murali, Ayaluru; Bronstein, Lyudmila; De, Mrinmoy; Stein, Barry; Rotello, Vincent M; Kao, C Cheng; Dragnea, Bogdan

2006-09-01

289

Viral Advertising: Definitional Review and Synthesis  

Microsoft Academic Search

The objectives of this article are threefold. First, it provides an overview of the past published social media research focusing on different aspects of the viral communication, variously termed “electronic word-of-mouth,” “word-of-mouse,” “viral marketing,” and “buzz.” Second, it clarifies and analyzes the concept of viral advertising in social media. Third, it provides a definition to reduce the prevailing ambiguities in

Maria Petrescu; Pradeep Korgaonkar

2011-01-01

290

Infection Strategies of Bacterial and Viral Pathogens through Pathogen-Human Protein-Protein Interactions  

PubMed Central

Since ancient times, even in today’s modern world, infectious diseases cause lots of people to die. Infectious organisms, pathogens, cause diseases by physical interactions with human proteins. A thorough analysis of these interspecies interactions is required to provide insights about infection strategies of pathogens. Here we analyzed the most comprehensive available pathogen–human protein interaction data including 23,435 interactions, targeting 5,210 human proteins. The data were obtained from the newly developed pathogen–host interaction search tool, PHISTO. This is the first comprehensive attempt to get a comparison between bacterial and viral infections. We investigated human proteins that are targeted by bacteria and viruses to provide an overview of common and special infection strategies used by these pathogen types. We observed that in the human protein interaction network the proteins targeted by pathogens have higher connectivity and betweenness centrality values than those proteins not interacting with pathogens. The preference of interacting with hub and bottleneck proteins is found to be a common infection strategy of all types of pathogens to manipulate essential mechanisms in human. Compared to bacteria, viruses tend to interact with human proteins of much higher connectivity and centrality values in the human network. Gene Ontology enrichment analysis of the human proteins targeted by pathogens indicates crucial clues about the infection mechanisms of bacteria and viruses. As the main infection strategy, bacteria interact with human proteins that function in immune response to disrupt human defense mechanisms. Indispensable viral strategy, on the other hand, is the manipulation of human cellular processes in order to use that transcriptional machinery for their own genetic material transcription. A novel observation about pathogen–human systems is that the human proteins targeted by both pathogens are enriched in the regulation of metabolic processes.

Durmus Tekir, Saliha; Cakir, Tunahan; Ulgen, Kutlu O

2012-01-01

291

Relationships between proteasomes and viral gene products.  

PubMed

The interrelationships between proteasomes and viral gene products are very complex. 20S proteasomes associate with a number of viral mRNAs which are cleaved by proteasome's associated endonuclease activity. In addition proteasome's endopeptidase activities are involved in the presentation of viral antigens. Viral proteins of different origin associate with the 20S and 26S complexes and interfere with their enzymatic activities. A major part of this review deals with the interactions between 20S proteasomes and the gene products of the human immunodeficiency virus (HIV) which has been studied in detail by our group. PMID:10363656

Jarrousse, A S; Gautier, K; Apcher, S; Badaoui, S; Boissonnet, G; Dadet, M H; Henry, L; Bureau, J P; Schmid, H P; Petit, F

1999-04-01

292

Viral Subversion of the Nuclear Pore Complex  

PubMed Central

The nuclear pore complex (NPC) acts as a selective barrier between the nucleus and the cytoplasm and is responsible for mediating communication by regulating the transport of RNA and proteins. Numerous viral pathogens have evolved different mechanisms to hijack the NPC in order to regulate trafficking of viral proteins, genomes and even capsids into and out of the nucleus thus promoting virus replication. The present review examines the different strategies and the specific nucleoporins utilized during viral infections as a means of promoting their life cycle and inhibiting host viral defenses.

Le Sage, Valerie; Mouland, Andrew J.

2013-01-01

293

Viral subversion of the nuclear pore complex.  

PubMed

The nuclear pore complex (NPC) acts as a selective barrier between the nucleus and the cytoplasm and is responsible for mediating communication by regulating the transport of RNA and proteins. Numerous viral pathogens have evolved different mechanisms to hijack the NPC in order to regulate trafficking of viral proteins, genomes and even capsids into and out of the nucleus thus promoting virus replication. The present review examines the different strategies and the specific nucleoporins utilized during viral infections as a means of promoting their life cycle and inhibiting host viral defenses. PMID:23959328

Le Sage, Valerie; Mouland, Andrew J

2013-08-16

294

Emotional Repression, Stress Disclosure Responses, and Epstein Barr Viral Capsid Antigen Titers  

Microsoft Academic Search

Based on the theory of psychosomatic inhibition, we hypothesized that subjects who abstained from disclosing emotional material on a laboratory task would have poorer control of latent Epstein-Barr virus (as evidenced by high titers for the viral capsid antigen), and similarly, those subjects with psychometrically derived repressive interpersonal styles would show the highest Epstein-Barr viral capsid antigen titers (EBV-VCA). Eighty

BRIAN A. ESTERLING; MICHAEL H. ANTONI; MAHENDRA KUMAR; NEIL SCHNEIDERMAN

295

Sequencing viral genomes from a single isolated plaque  

PubMed Central

Background Whole genome sequencing of viruses and bacteriophages is often hindered because of the need for large quantities of genomic material. A method is described that combines single plaque sequencing with an optimization of Sequence Independent Single Primer Amplification (SISPA). This method can be used for de novo whole genome next-generation sequencing of any cultivable virus without the need for large-scale production of viral stocks or viral purification using centrifugal techniques. Methods A single viral plaque of a variant of the 2009 pandemic H1N1 human Influenza A virus was isolated and amplified using the optimized SISPA protocol. The sensitivity of the SISPA protocol presented here was tested with bacteriophage F_HA0480sp/Pa1651 DNA. The amplified products were sequenced with 454 and Illumina HiSeq platforms. Mapping and de novo assemblies were performed to analyze the quality of data produced from this optimized method. Results Analysis of the sequence data demonstrated that from a single viral plaque of Influenza A, a mapping assembly with 3590-fold average coverage representing 100% of the genome could be produced. The de novo assembled data produced contigs with 30-fold average sequence coverage, representing 96.5% of the genome. Using only 10 pg of starting DNA from bacteriophage F_HA0480sp/Pa1651 in the SISPA protocol resulted in sequencing data that gave a mapping assembly with 3488-fold average sequence coverage, representing 99.9% of the reference and a de novo assembly with 45-fold average sequence coverage, representing 98.1% of the genome. Conclusions The optimized SISPA protocol presented here produces amplified product that when sequenced will give high quality data that can be used for de novo assembly. The protocol requires only a single viral plaque or as little as 10 pg of DNA template, which will facilitate rapid identification of viruses during an outbreak and viruses that are difficult to propagate.

2013-01-01

296

Medical genetics  

SciTech Connect

This book presents a discussion of medical genetics for the practitioner treating or counseling patients with genetic disease. It includes a discussion of the relationship of heredity and diseases, the chromosomal basis for heredity, gene frequencies, and genetics of development and maldevelopment. The authors also focus on teratology, somatic cell genetics, genetics and cancer, genetics of behavior.

Nora, J.J.; Fraser, F.C.

1989-01-01

297

Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior  

USGS Publications Warehouse

Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

2011-01-01

298

Viral Ancestors of Antiviral Systems  

PubMed Central

All life must survive their corresponding viruses. Thus antiviral systems are essential in all living organisms. Remnants of virus derived information are also found in all life forms but have historically been considered mostly as junk DNA. However, such virus derived information can strongly affect host susceptibility to viruses. In this review, I evaluate the role viruses have had in the origin and evolution of host antiviral systems. From Archaea through bacteria and from simple to complex eukaryotes I trace the viral components that became essential elements of antiviral immunity. I conclude with a reexamination of the ‘Big Bang’ theory for the emergence of the adaptive immune system in vertebrates by horizontal transfer and note how viruses could have and did provide crucial and coordinated features.

Villarreal, Luis P.

2011-01-01

299

Viral ancestors of antiviral systems.  

PubMed

All life must survive their corresponding viruses. Thus antiviral systems are essential in all living organisms. Remnants of virus derived information are also found in all life forms but have historically been considered mostly as junk DNA. However, such virus derived information can strongly affect host susceptibility to viruses. In this review, I evaluate the role viruses have had in the origin and evolution of host antiviral systems. From Archaea through bacteria and from simple to complex eukaryotes I trace the viral components that became essential elements of antiviral immunity. I conclude with a reexamination of the 'Big Bang' theory for the emergence of the adaptive immune system in vertebrates by horizontal transfer and note how viruses could have and did provide crucial and coordinated features. PMID:22069523

Villarreal, Luis P

2011-10-20

300

Viral bronchiolitis for the clinician.  

PubMed

Viral bronchiolitis is common, and about 98-99% of infants are managed in the home. Because about 95% of infants < 2 years old are infected with respiratory syncytial virus, however, bronchiolitis is the commonest reason for admission to hospital in the first 6 months of life. It is usually a self-limiting condition lasting around a week in previously well children. About 1% of infants are admitted to hospital, and about 10% of hospitalised infants will require admission to the intensive care unit. Respiratory syncytial virus is isolated from about 70% of infants hospitalised with bronchiolitis. The emphasis of hospital treatment is to ensure adequate hydration and oxygenation. Other than supplemental oxygen, little in the way of pharmacological treatment has been demonstrated to alter the course of the illness or the risk of wheezing in the months following bronchiolitis. PMID:20500436

Fitzgerald, Dominic A

2011-04-01

301

Genetic-supply industry  

Microsoft Academic Search

The genetic-supply industry (GSI), providing seed and breeding stock, has expanded with the improved efficiency of species and the value added to seeds. Over 8 billion worth of genetic material is consumed in the US each year. New market growth will occur if farmers can be persuaded to purchase seeds rather than growing their own. Plant breeders concentrate on increasing

2009-01-01

302

Viral Infection: An Evolving Insight into the Signal Transduction Pathways Responsible for the Innate Immune Response  

PubMed Central

The innate immune response is initiated by the interaction of stereotypical pathogen components with genetically conserved receptors for extracytosolic pathogen-associated molecular patterns (PAMPs) or intracytosolic nucleic acids. In multicellular organisms, this interaction typically clusters signal transduction molecules and leads to their activations, thereby initiating signals that activate innate immune effector mechanisms to protect the host. In some cases programmed cell death—a fundamental form of innate immunity—is initiated in response to genotoxic or biochemical stress that is associated with viral infection. In this paper we will summarize innate immune mechanisms that are relevant to viral pathogenesis and outline the continuing evolution of viral mechanisms that suppress the innate immunity in mammalian hosts. These mechanisms of viral innate immune evasion provide significant insight into the pathways of the antiviral innate immune response of many organisms. Examples of relevant mammalian innate immune defenses host defenses include signaling to interferon and cytokine response pathways as well as signaling to the inflammasome. Understanding which viral innate immune evasion mechanisms are linked to pathogenesis may translate into therapies and vaccines that are truly effective in eliminating the morbidity and mortality associated with viral infections in individuals.

Kotwal, Girish J.; Hatch, Steven; Marshall, William L.

2012-01-01

303

Rates of Viral Evolution Are Linked to Host Geography in Bat Rabies  

PubMed Central

Rates of evolution span orders of magnitude among RNA viruses with important implications for viral transmission and emergence. Although the tempo of viral evolution is often ascribed to viral features such as mutation rates and transmission mode, these factors alone cannot explain variation among closely related viruses, where host biology might operate more strongly on viral evolution. Here, we analyzed sequence data from hundreds of rabies viruses collected from bats throughout the Americas to describe dramatic variation in the speed of rabies virus evolution when circulating in ecologically distinct reservoir species. Integration of ecological and genetic data through a comparative Bayesian analysis revealed that viral evolutionary rates were labile following historical jumps between bat species and nearly four times faster in tropical and subtropical bats compared to temperate species. The association between geography and viral evolution could not be explained by host metabolism, phylogeny or variable selection pressures, and instead appeared to be a consequence of reduced seasonality in bat activity and virus transmission associated with climate. Our results demonstrate a key role for host ecology in shaping the tempo of evolution in multi-host viruses and highlight the power of comparative phylogenetic methods to identify the host and environmental features that influence transmission dynamics.

Streicker, Daniel G.; Lemey, Philippe; Velasco-Villa, Andres; Rupprecht, Charles E.

2012-01-01

304

Rates of viral evolution are linked to host geography in bat rabies.  

PubMed

Rates of evolution span orders of magnitude among RNA viruses with important implications for viral transmission and emergence. Although the tempo of viral evolution is often ascribed to viral features such as mutation rates and transmission mode, these factors alone cannot explain variation among closely related viruses, where host biology might operate more strongly on viral evolution. Here, we analyzed sequence data from hundreds of rabies viruses collected from bats throughout the Americas to describe dramatic variation in the speed of rabies virus evolution when circulating in ecologically distinct reservoir species. Integration of ecological and genetic data through a comparative bayesian analysis revealed that viral evolutionary rates were labile following historical jumps between bat species and nearly four times faster in tropical and subtropical bats compared to temperate species. The association between geography and viral evolution could not be explained by host metabolism, phylogeny or variable selection pressures, and instead appeared to be a consequence of reduced seasonality in bat activity and virus transmission associated with climate. Our results demonstrate a key role for host ecology in shaping the tempo of evolution in multi-host viruses and highlight the power of comparative phylogenetic methods to identify the host and environmental features that influence transmission dynamics. PMID:22615575

Streicker, Daniel G; Lemey, Philippe; Velasco-Villa, Andres; Rupprecht, Charles E

2012-05-17

305

Molecular biology of bovine viral diarrhea virus  

Technology Transfer Automated Retrieval System (TEKTRAN)

Bovine viral diarrhea viruses (BVDV) are arguably the most important viral pathogen of ruminants worldwide and can cause severe economic loss. Clinical symptoms of the disease caused by BVDV range from subclinical to severe acute hemorrhagic syndrome, with the severity of disease being strain depend...

306

Illuminating viral infections in the nervous system  

Microsoft Academic Search

Viral infections are a major cause of human disease. Although most viruses replicate in peripheral tissues, some have developed unique strategies to move into the nervous system, where they establish acute or persistent infections. Viral infections in the central nervous system (CNS) can alter homeostasis, induce neurological dysfunction and result in serious, potentially life-threatening inflammatory diseases. This Review focuses on

Silvia S. Kang; Dorian B. McGavern

2011-01-01

307

Crosslinking in viral capsids via tiling theory  

Microsoft Academic Search

A vital part of a virus is its protein shell, called the viral capsid, that encapsulates and hence protects the viral genome. It has been shown in Twarock [2004. A tiling approach to vius capsids assembly explaining a structural puzzle in virology. J. Theor. Biol. 226, 477–482] that the surface structures of viruses with icosahedrally symmetric capsids can be modelled

R. Twarock; R. W. Hendrix

2006-01-01

308

VÍRUS DA DIARRÉIA VIRAL BOVINA (BVDV)  

Microsoft Academic Search

BOVINE VIRAL DIARRHEA VIRUS. Bovine viral diarrhea virus (BVDV) is distributed worldwide among the cattle population and is considered the most important virus of cattle in countries free of foot and mouth disease virus. BVDV infection has been described in Brazil since the late 60s and is currently widespread among Brazilian beef and dairy cattle. The infection has been associated

E. F. Flores

309

Molecular Engineering of Viral Gene Delivery Vehicles  

Microsoft Academic Search

Viruses can be engineered to efficiently deliver exogenous genes, but their natural gene delivery properties often fail to meet human therapeutic needs. Therefore, engineering viral vectors with new properties, including en- hanced targeting abilities and resistance to immune responses, is a growing area of research. This review discusses protein engineering approaches to generate viral vectors with novel gene delivery capabilities.

David V. Schaffer; James T. Koerber; Kwang-il Lim

2008-01-01

310

Viral control of Emiliania huxleyi blooms?  

Microsoft Academic Search

Virus and virus-like particles (VLP) have been observed in all major algal classes. Few host-virus systems of microalgae have until now been brought into culture and extensively studied. For Emiliania huxleyi we have been able to describe viral infection during blooms in mesocosms and in landlocked fjords. Evidence of viral lysis of E. huxleyi during blooms in the North Sea

Gunnar Bratbak; William Wilson; Mikal Heldal

1996-01-01

311

Diagnosis and treatment of viral encephalitis  

Microsoft Academic Search

Acute encephalitis constitutes a medical emergency. In most cases, the presence of focal neurological signs and focal seizures will distinguish encephalitis from encephalopathy. Acute disseminated encephalomyelitis is a non-infective inflammatory encephalitis that may require to be treated with steroids. Acute infective encephalitis is usually viral. Herpes simplex encephalitis (HSE) is the commonest sporadic acute viral encephalitis in the Western world.

A Chaudhuri; P G E Kennedy

2002-01-01

312

Itchy fish and viral dermatopathies: sampling, diagnosis, and management of common viral diseases.  

PubMed

Viral dermatopathies of fish bear clinical signs similar to those of dermatopathies from other causes. This article offers an overview to approaching dermatologic presentations in fish, with an emphasis on sampling, diagnosis, and management of viral dermatopathies, building on previous publications. It is vital to recognize clinical signs associated with viral dermatopathies because there are currently no treatments available. Avoidance and prevention is the key to controlling viral diseases in fish. Optimizing husbandry practices and providing appropriate quarantine procedures can help prevent viral disease outbreaks in collection and aquaculture stocks. PMID:24018032

Weber, E P Scott

2013-09-01

313

Viral Weapons of Membrane Destruction: Variable Modes of Membrane Penetration by Non-Enveloped Viruses  

PubMed Central

Significant progress has recently been obtained in our understanding of cellular entry by nonenveloped viruses (NEVs). A key step in the entry process involves the disruption or remodeling of the limiting cell membrane allowing the virus to gain access to the cellular replication machinery. Biochemical, genetic and structural data from diverse virus groups have shed light on the process of membrane penetration thereby revealing both the conservation and divergence of the mechanisms and principles governing this process. In general, membrane breach is achieved via the highly regulated spatiotemporal exposure of a virally-encoded membrane lytic factor, resulting in the transfer of the viral genome or nucleocapsid into the cytosol.

Moyer, Crystal L.; Nemerow, Glen R.

2011-01-01

314

Impact of Tat Genetic Variation on HIV-1 Disease  

PubMed Central

The human immunodeficiency virus type 1 (HIV-1) promoter or long-terminal repeat (LTR) regulates viral gene expression by interacting with multiple viral and host factors. The viral transactivator protein Tat plays an important role in transcriptional activation of HIV-1 gene expression. Functional domains of Tat and its interaction with transactivation response element RNA and cellular transcription factors have been examined. Genetic variation within tat of different HIV-1 subtypes has been shown to affect the interaction of the viral transactivator with cellular and/or viral proteins, influencing the overall level of transcriptional activation as well as its action as a neurotoxic protein. Consequently, the genetic variability within tat may impact the molecular architecture of functional domains of the Tat protein that may impact HIV pathogenesis and disease. Tat as a therapeutic target for anti-HIV drugs has also been discussed.

Li, Luna; Dahiya, Satinder; Kortagere, Sandhya; Aiamkitsumrit, Benjamas; Cunningham, David; Pirrone, Vanessa; Nonnemacher, Michael R.; Wigdahl, Brian

2012-01-01

315

Function of human cytomegalovirus UL97 kinase in viral infection and its inhibition by maribavir  

PubMed Central

Summary The serine/threonine kinase expressed by human cytomegalovirus from gene UL97 phosphorylates the antiviral drug ganciclovir, but its biological function is the phosphorylation of its natural viral and cellular protein substrates which affect viral replication at many levels. The UL97 kinase null phenotype is therefore complex, as is the mechanism of action of maribavir, a highly specific inhibitor of its enzymatic activity. Studies that utilise the drug corroborate results from genetic approaches and together have elucidated many functions of the UL97 kinase that are critical for viral replication. The kinase phosphorylates eukaryotic elongation factor 1delta, the carboxyl terminal domain of the large subunit of RNA polymerase II, the retinoblastoma tumour suppressor and lamins A and C. Each of these is also phosphorylated and regulated by cdc2/cyclin-dependent kinase 1, suggesting that the viral kinase may perform a similar function. These and other activities of the UL97 kinase appear to stimulate the cell cycle to support viral DNA synthesis, enhance the expression of viral genes, promote virion morphogenesis and facilitate the egress of mature capsids from the nucleus. In the absence of UL97 kinase activity, viral DNA synthesis is inefficient and structural proteins are sequestered in nuclear aggresomes, reducing the efficiency of virion morphogenesis. Mature capsids that do form fail to egress the nucleus as the nuclear lamina are not dispersed by the kinase. The critical functions performed by the UL97 kinase illustrate its importance in viral replication and confirm that the kinase is a target for the development of antiviral therapies.

Prichard, Mark N.

2013-01-01

316

The genome of orf virus: Restriction endonuclease analysis of viral DNA isolated from lesions of orf in sheep  

Microsoft Academic Search

Summary The purification of orf virus directly from scab material from clinical cases of orf in sheep and restriction endonuclease analysis of the viral DNA is described. Between 7×109 and 1.6×1011 virus particles, and 0.7 to 22.8 µg of viral DNA could be recovered from lg of scab material. Considerable heterogeneity was observed between different field isolates when restriction endonuclease

A. J. Robinson; G. Ellis; T. Balassu

1982-01-01

317

Genetic heterogeneity of L-Zagreb mumps virus vaccine strain  

PubMed Central

Background The most often used mumps vaccine strains Jeryl Lynn (JL), RIT4385, Urabe-AM9, L-Zagreb and L-3 differ in immunogenicity and reactogenicity. Previous analyses showed that JL, Urabe-AM9 and L-3 are genetically heterogeneous. Results We identified the heterogeneity of L-Zagreb throughout the entire genome. Two major variants were defined: variant A being identical to the consensus sequence of viral seeds and vaccine(s) and variant B which differs from variant A in three nucleotide positions. The difference between viral variants in L-Zagreb strain is insufficient for distinct viral strains to be defined. We demonstrated that proportion of variants in L-Zagreb viral population depends on cell substrate used for viral replication in vitro and in vivo. Conclusion L-Zagreb strain should be considered as a single strain composed of at least two variant viral genomes.

Kosutic-Gulija, Tanja; Forcic, Dubravko; Santak, Maja; Ramljak, Ana; Mateljak-Lukacevic, Sanja; Mazuran, Renata

2008-01-01

318

Creating genetic resistance to HIV.  

PubMed

HIV/AIDS remains a chronic and incurable disease, in spite of the notable successes of combination antiretroviral therapy. Gene therapy offers the prospect of creating genetic resistance to HIV that supplants the need for antiviral drugs. In sight of this goal, a variety of anti-HIV genes have reached clinical testing, including gene-editing enzymes, protein-based inhibitors, and RNA-based therapeutics. Combinations of therapeutic genes against viral and host targets are designed to improve the overall antiviral potency and reduce the likelihood of viral resistance. In cell-based therapies, therapeutic genes are expressed in gene modified T lymphocytes or in hematopoietic stem cells that generate an HIV-resistant immune system. Such strategies must promote the selective proliferation of the transplanted cells and the prolonged expression of therapeutic genes. This review focuses on the current advances and limitations in genetic therapies against HIV, including the status of several recent and ongoing clinical studies. PMID:22985479

Burnett, John C; Zaia, John A; Rossi, John J

2012-09-15

319

Targeting mitotic chromosomes: a conserved mechanism to ensure viral genome persistence  

PubMed Central

Viruses that maintain their genomes as extrachromosomal circular DNA molecules and establish infection in actively dividing cells must ensure retention of their genomes within the nuclear envelope in order to prevent genome loss. The loss of nuclear membrane integrity during mitosis dictates that paired host cell chromosomes are captured and organized by the mitotic spindle apparatus before segregation to daughter cells. This prevents inaccurate chromosomal segregation and loss of genetic material. A similar mechanism may also exist for the nuclear retention of extrachromosomal viral genomes or episomes during mitosis, particularly for genomes maintained at a low copy number in latent infections. It has been heavily debated whether such a mechanism exists and to what extent this mechanism is conserved among diverse viruses. Research over the last two decades has provided a wealth of information regarding the mechanisms by which specific tumour viruses evade mitotic and DNA damage checkpoints. Here, we discuss the similarities and differences in how specific viruses tether episomal genomes to host cell chromosomes during mitosis to ensure long-term persistence.

Feeney, Katherine M.; Parish, Joanna L.

2009-01-01

320

Genomic Analysis of Uncultured Marine Viral Communities  

NASA Astrophysics Data System (ADS)

Viruses are the most common biological entities in the oceans by an order of magnitude. Diversity of these viruses undoubtedly plays an important role in controlling bacterial populations and biogeochemical cycles in the marine environment. However, very little is known about the diversity of marine viral communities. Here we report the first genomic analysis of uncultured viral communities from two nearshore marine water samples and one marine sediment sample. In all three marine libraries, over 65% of the sequences were not significantly similar to previously reported sequences, suggesting that much of the diversity is novel. The most common significant hits amongst the known sequences were to viruses. The viral hits included sequences from all the major families of dsDNA tailed phage, as well as some algal viruses. BLAST analysis of the sequence data suggested fundamental differences between the viral communities. Several independent mathematical models based on the observed number of contigs predicted that the most abundant viral genome comprised 2-3% of the total population in the water communities, which were estimated to contain between 374 and 7114 viral types. Diversity of the sediment community was significantly higher. The results also showed that it would be possible to sequence the entire genome of an uncultured marine viral community.

Breitbart, M.; Salamon, P.; Andresen, B.; Mahaffy, J. M.; Segall, A. M.; Mead, D.; Azam, F.; Rohwer, F.

2002-12-01

321

Genetic engineering in biotechnology  

SciTech Connect

The objective of this book is to encourage the use of genetic engineering for economic development. The report covers: (1) Precedents of genetic engineering; (2) a brief description of the technology, including the transfer of DNA in bacteria (vectors, E. coli and B. subtilis hosts, stages, and technical problems), practical examples of techniques used and their products (interferon; growth hormone; insulin; treatment of blood cells, Talasemia, and Lesch-Nyhan syndrome; and more nutritious soya), transfer to higher organisms, and cellular fusion; (3) biological risks and precautions; (4) possible applications (production of hydrogen, hydrocarbons, alcohol, chemicals, enzymes, peptides, viral antigens, monoclonal antibodies, genes, proteins, and insecticides; metal extraction; nitrogen fixation; biodegradation; and new varieties of plants and animals; and (5) international activities.

Bedate, C.A.; Morales, J.C.; Lopez, E.H.

1981-09-01

322

Synthetic biology and genetic causation.  

PubMed

Synthetic biology research is often described in terms of programming cells through the introduction of synthetic genes. Genetic material is seemingly attributed with a high level of causal responsibility. We discuss genetic causation in synthetic biology and distinguish three gene concepts differing in their assumptions of genetic control. We argue that synthetic biology generally employs a difference-making approach to establishing genetic causes, and that this approach does not commit to a specific notion of genetic program or genetic control. Still, we suggest that a strong program concept of genetic material can be used as a successful heuristic in certain areas of synthetic biology. Its application requires control of causal context, and may stand in need of a modular decomposition of the target system. We relate different modularity concepts to the discussion of genetic causation and point to possible advantages of and important limitations to seeking modularity in synthetic biology systems. PMID:23591049

Oftedal, Gry; Parkkinen, Veli-Pekka

2013-04-13

323

Dynamical implications of Viral Tiling Theory.  

PubMed

The Caspar-Klug classification of viruses whose protein shell, called viral capsid, exhibits icosahedral symmetry, has recently been extended to incorporate viruses whose capsid proteins are exclusively organised in pentamers. The approach, named 'Viral Tiling Theory', is inspired by the theory of quasicrystals, where aperiodic Penrose tilings enjoy 5-fold and 10-fold local symmetries. This paper analyses the extent to which this classification approach informs dynamical properties of the viral capsids, in particular the pattern of Raman active modes of vibrations, which can be observed experimentally. PMID:18353372

ElSawy, K M; Taormina, A; Twarock, R; Vaughan, L

2008-02-13

324

[Cardiac manifestations during viral acute hepatitis].  

PubMed

The authors describe a retrospective study conducted on 46 patients with acute viral hepatitis, searching for cardiac disorders. These disorders appeared in about 43% of cases, only with benign evolution. The most frequent alterations are electrocardiographic disorders, followed by conduction blocks, axis deviations and arrhythmias. Acute pericarditis was also described, associated with HCV infection. The viral agents most frequently involved are HBV and HCV, followed by cytomegalovirus, and Epstein-Barr virus. In conclusion, the incidence of cardiac manifestations during viral acute hepatitis is rather high, but with benign evolution. PMID:16794376

Rombola, F; Spinoso, A; Bertuccio, S N

2006-03-01

325

BOVINE VIRAL DIARRHEA VIRUS PERSISTENTLY INFECTED AND ACUTELY INFECTED CALVES: ASSAYS FOR VIRAL INFECTIVITY, POLYMERASE CHAIN REACTION ANALYSIS, AND ANTIGEN DETECTION  

Technology Transfer Automated Retrieval System (TEKTRAN)

There are numerous assays for bovine viral diarrhea virus (BVDV) detecting infectious virus, nucleic material, and antigen. Persistently infected (PI) and acutely/transiently infected calves with BVDV represent two different manifestations. Diagnostic test results impact on differentiation of PI o...

326

Analysis of genetic diversity of southern Spain fig tree (Ficus carica L.) and reference materials as a tool for breeding and conservation.  

PubMed

The common fig tree (Ficus carica L.) is a Mediterranean crop with problematic cultivar identification. The recovery and conservation of possible local varieties for ecological production requires the previous genetic characterization of the available germplasm. In this context, 42 lines corresponding to 12 local varieties and two caprifigs, in addition to 15 reference samples have been fingerprinted using 21 SSR markers. A total of 77 alleles were revealed, detecting a useful level of genetic variability within the local germplasm pools. UPGMA clustering analysis has revealed the genetic structure and relationships among the local and reference germplasm. Eleven of the local varieties could be identified and defined as obtained clusters, showing that SSR analysis is an efficient method to evaluate the Andalusian fig tree diversity for on-farm conservation. PMID:22804343

Perez-Jiménez, M; López, B; Dorado, G; Pujadas-Salvá, A; Guzmán, G; Hernandez, P

2012-07-04

327

Genetic Science Learning Center (GSLC)  

NSDL National Science Digital Library

The University of Utah's Genetic Science Learning Center offers "excellent genetic science curriculum, training, and resources" through virtual (Internet-based curriculum) and actual (training programs for classroom teachers) programs. Two of the Website's main sections may be of special interest to educators: Basic Genetics (introductory materials) and Thematic Units (curriculum information). The site also offers two sections on Genetic Disorders and Genetics in Society, and lists of specialized resources for Teachers, Students, or Family (the general public). This page has much to offer as a reference for beginning genetics.

328

Protection against or triggering of Type 1 diabetes? Different roles for viral infections  

PubMed Central

The emergence of autoreactivity that ultimately destroys insulin-producing ?-cells and causes Type 1 diabetes (T1D) is a result of genetic susceptibility and environmental factors, such as viral infections. The ability to induce strong cellular immune responses and to cause inflammation in the target organ makes viral infections prime candidates for the initiation of islet autoreactivity. Indeed, certain viruses have been linked to the occurrence of T1D based on epidemiological, serological and histological findings; and several rodent studies clearly demonstrate that viral infections can trigger autoimmunity. However, viruses have also been shown to efficiently prevent autoimmunity, which underlines the beneficial aspects of exposure to microbial agents as suggested by the hygiene hypothesis. Here, we will try to untangle some aspects of the complex interplay between viruses and the immune system and we will recapitulate by what rationale certain viruses have been associated with T1D.

Boettler, Tobias; von Herrath, Matthias

2011-01-01

329

Role of a viral membrane polypeptide in strand-specific initiation of poliovirus RNA synthesis.  

PubMed Central

A molecular genetic analysis has been combined with an in vitro biochemical approach to define the functional interactions required for nucleotidyl protein formation during poliovirus RNA synthesis. A site-directed lesion into the hydrophobic domain of a viral membrane protein produced a mutant virus that is defective in RNA synthesis at 39 degrees C. The phenotypic expression of this lesion affects initiation of RNA synthesis, in vitro uridylylation of the genome-linked protein (VPg), and the in vivo synthesis of plus-strand viral RNAs. Our results support a model that employs a viral membrane protein as carrier for VPg in the initiation of plus-strand RNA synthesis. Our data also suggest that a separate mechanism could be used in the initiation of minus-strand RNA synthesis, thereby providing a means for strand-specific regulation of picornavirus RNA replication. Images

Giachetti, C; Semler, B L

1991-01-01

330

The Impact of Respiratory Viral Infection on Wheezing Illnesses and Asthma Exacerbations  

PubMed Central

The etiology and morbidity associated with asthma are thought to stem from both genetic factors and potentially modifiable environmental factors, such as viral infections.[1-7] Although it is unclear whether respiratory viral infections cause asthma, observational studies have demonstrated a high rate of asthma in children with a history of severe viral lower respiratory tract infections during infancy, and viruses are the associated with the majority of asthma exacerbations among both children and adults. This review will discuss the pathogens associated with virus-induced wheezing illnesses during infancy and early childhood, the association of bronchiolitis during infancy with an increased risk of childhood asthma, and the association of respiratory viruses with asthma exacerbations in older children and adults.

Carroll, Kecia N.; Hartert, Tina V.

2008-01-01

331

Magnetically Targeted Viral Envelopes: A PET Investigation of Initial Biodistribution  

PubMed Central

Gene and drug therapy for organ-specific diseases in part depends on the efficient delivery to a particular region of the body. We examined the biodistribution of a viral envelope commonly used as a nanoscale gene delivery vehicle using positron emission tomography (PET) and investigated the magnetic alteration of its biodistribution. Iron oxide nanoparticles and 18 F-fluoride were encapsulated by hemagglutinating virus of Japan envelopes (HVJ-Es). HVJ-Es were then injected intravenously in the rat and imaged dynamically using high-resolution PET. Control subjects received injections of encapsulated materials alone. For magnetic targeting, permanent magnets were fixed on the head during the scan. Based on the quantitative analysis of PET images, HVJ-Es accumulated in the liver and spleen and activity remained higher than control subjects for 2 h. Histological sections of the liver confirmed imaging findings. Pixel-wise activity patterns on coregistered PET images of the head showed a significantly different pattern for the subjects receiving magnetic targeting as compared to all control groups. Imaging demonstrated the initial biodistribution of a viral envelope within the rodent by providing quantitative behavior over time and in specific anatomical regions. Magnetic force altered the biodistribution of the viral envelope to a target structure, and could enable region-specific delivery of therapeutic vehicles noninvasively.

Flexman, Jennifer A.; Cross, Donna J.; Lewellen, Barbara L.; Miyoshi, Sosuke; Kim, Yongmin

2009-01-01

332

New Genetics  

MedlinePLUS

... Education About NIGMS NIGMS Home > Science Education The New Genetics Living Laboratories Classroom Poster Order a Free ... Genetics Model Organisms RNA Interference Studying Genes The New Genetics is a science education booklet explains the ...

333

Selective breeding provides an approach to increase resistance of rainbow trout ( Onchorhynchus mykiss) to the diseases, enteric redmouth disease, rainbow trout fry syndrome, and viral haemorrhagic septicaemia  

Microsoft Academic Search

In this study, we reasoned that if we challenged rainbow trout with the causative agents of enteric redmouth disease (ERM), rainbow trout fry syndrome (RTFS), and viral haemorrhagic septicaemia (VHS), we would: 1) detect additive genetic variation for resistance to ERM, RTFS, and VHS; and 2) find that resistance of the trout to ERM and RTFS are favourably correlated genetically,

Mark Henryon; Peer Berg; Niels J. Olesen; Torben E. Kjær; Wilhelmina J. Slierendrecht; Alfred Jokumsen; Ivar Lund

2005-01-01

334

Management of viral hepatitis C.  

PubMed

The hepatitis C virus was first identified in 1989. It causes chronic hepatitis, cirrhosis and hepatocellular carcinoma. Global anti-HCV prevalence is 1-3%. Contaminated blood product, dirty needles and instruments, and injection drug use are the main parenteral routes of transmission. Cultural practices, such as acupuncture, tattoo, body piercing and scarring, also play a role. Universal precaution is the mainstay for prevention before vaccine is developed. Therapy for chronic hepatitis C (CHC) with interferon (IFN) is not satisfactory. Non-response and early relapse reduce sustained response (SR). In 1997, National Institute of Health consensus recommended IFN therapy only for selected patients with compensated CHC, raised ALT and moderate to severe histologic disease activity; 15-20% SR is expected. Major advances in CHC therapy is combination therapy. Ribavirin in combination with IFN significantly increases SR to 30-40%. Even patients with high viral load, genotype 1, significant fibrosis or cirrhosis respond better. EASL and APASL Consensus in 1999 recommended IFN-ribavirin combination as the first line therapy. Recent data on pegylated IFN showed very encouraging results. Combined with ribavirin, 60% SR was achieved. It benefits patients with severe bridging necrosis and also cirrhosis. However, 23-27% of patients receiving combination therapy with either IFN type, experienced adverse events and required therapy discontinuation. Many important issues remained unsolved. Therapy for children, the elderly, patients with comorbidity and extra-hepatic syndromes need to be addressed. Therapy is too expensive and not affordable to the majority of patients in developing countries. PMID:12000600

Leung, Nancy W Y

2002-02-01

335

Viral evolution and transmission effectiveness.  

PubMed

Different viruses transmit among hosts with different degrees of efficiency. A basic reproductive number (R0) indicates an average number of cases getting infected from a single infected case. R0 can vary widely from a little over 1 to more than 10. Low R0 is usually found among rapidly evolving viruses that are often under a strong positive selection pressure, while high R0 is often found among viruses that are highly stable. The reason for the difference between antigenically diverse viruses with low R0, such as influenza A virus, and antigenically stable viruses with high R0, such as measles virus, is not clear and has been a subject of great interest. Optimization of transmissibility fitness considering intra-host dynamics and inter-host transmissibility was shown to result in strategies for tradeoff between transmissibility and diversity. The nature of transmission, targeting either a naïve children population or an adult population with partial immunity, has been proposed as a contributing factor for the difference in the strategies used by the two groups of viruses. The R0 determines the levels of threshold heard immunity. Lower R0 requires lower herd immunity to terminate an outbreak. Therefore, it can be assumed that the outbreak saturation can be reached more readily when the R0 is low. In addition, one may assume that when the outbreak saturation is reached, herd immunity may provide a strong positive selection pressure that could possibly result in an occurrence of escape mutants. Studies of these hypotheses will give us an important insight into viral evolution. This review discusses the above hypotheses as well as some possible mechanistic explanation for the difference in transmission efficiency of viruses. PMID:24175217

Rodpothong, Patsarin; Auewarakul, Prasert

2012-10-12

336

Viral Gastroenteritis Agents and Waterborne Disease.  

National Technical Information Service (NTIS)

The application of electron microscopic techniques in the study of human gastroenteritis led in the 1970's to the identification of new viral agents that had previously escaped detection by routine cell culture procedures. These agents have been the focus...

F. P. Williams

1987-01-01

337

Dual Viral Infections in Two Dogs.  

National Technical Information Service (NTIS)

Simultaneous viral infections in two young dogs were confirmed histologically by the finding of inclusion bodies typical of those produced by canine distemper virus and a respiratory adenovirus. Presence of an adenovirus was confirmed by electron microsco...

G. D. Whitney J. L. Stookey M. J. VanZwieten

1972-01-01

338

Dengue viral infection in children: a perspective.  

PubMed

Dengue is a vector-borne viral infection of global importance. Several pathogenetic mechanisms such as immune enhancement and selection pressure have been proposed and febrile, critical and recovery phases have been identified. A new classification proposed by WHO has recently been introduced where definitions have been changed to 'probable dengue', 'dengue with warning signs' and 'severe dengue'. The majority of dengue viral infections are self-limiting, but complications have high morbidity and mortality. The diagnosis of dengue viral infection is essentially clinical, although confirmation requires laboratory tests including serology, NS1 antigen detection, PCR and viral cultures. There are no specific anti-dengue drugs and treatment is basically supportive and consists of early recognition of complications and appropriate fluid therapy. A number of candidate vaccines are under development. PMID:22806236

Balasubramanian, S; Ramachandran, Bala; Amperayani, Sumanth

2012-07-17

339

Studies of Waterborne Agents of Viral Gastroenteritis.  

National Technical Information Service (NTIS)

The etiologic agent of a large outbreak of waterborne viral gastroenteritis was detected employing immune electron microscopy (IEM) and a newly developed solid phase radioimmunoassay (RIA). This agent, referred to as the Snow Mountain Agent (SMA), is 27-3...

R. Dolin

1983-01-01

340

Viral Hepatitis Surveillance - United States, 2010  

MedlinePLUS

... Añadir en... Favorites Delicious Digg Google Bookmarks Viral Hepatitis Surveillance – United States, 2010 Entire report in a ... C Outbreaks Related to Healthcare Reported to CDC Hepatitis A virus PAGE DESCRIPTION Table 2.1 Reported ...

341

A model freed from endogenous reference gene for quantification of genetically modified DNA by real-time PCR. 1. Quantification of DNA from genetically modified organisms in haplo-species materials  

Microsoft Academic Search

This paper is the first part of a serial study investigating a quantification model freed from endogenous reference gene for\\u000a genetically modified (GM) content by real-time polymerase chain reaction (PCR). The serial study involves two parts: (1) quantitative\\u000a determination of GM DNA in haplo-species plant samples; (2) quantitative determination of GM DNA in multi-species plant samples.\\u000a The paper describes a

Pingjian Deng; Dongyan Yang; Yongcun Yang; Xiaoke Yang; Liangrang Guo; Xiangyang Zhou; Xueling Wang

2008-01-01

342

Personal Characteristics of Older Primary Care Patients Who Provide a Buccal Swab for Apolipoprotein E Testing and Banking of Genetic Material: The Spectrum Study  

Microsoft Academic Search

Objective: To determine the personal characteristics and reasons associated with providing a buccal swab for apolipoprotein E (APOE) genetic testing in a primary care study. Methods: The study sample consisted of 342 adults aged 65 years and older recruited from primary care settings. Results: In all, 88% of patients agreed to provide a DNA sample for APOE genotyping and 78%

Hillary R. Bogner; Marsha N. Wittink; Jon F. Merz; Joseph B. Straton; Peter F. Cronholm; Peter V. Rabins; Joseph J. Gallo

2004-01-01

343

Genetic diversity of BVDV: Consequences for classification and molecular epidemiology  

Microsoft Academic Search

Genetic typing of bovine viral diarrhoea virus (BVDV) is important for the precise classification of viruses as well as for the development of molecular epidemiology. BVDV isolates were usually typed based on comparison of genomic sequences from the 5?-untranslated region (5?-UTR), Npro and E2 region. Recently we have identified 11 genetic groups (subgenotypes) of BVDV-1. Our further experiments confirmed a

S. Vilcek; B. Durkovic; M. Kolesarova; D. J. Paton

2005-01-01

344

Viral arthritis\\/tenosynovitis: A review  

Microsoft Academic Search

A review if presented of viral arthritis\\/tenosynovitis, one of the clinical manifestations of avian reovirus infection in chickens. Since the detection of a viral etiology of arthritis\\/tenosynovitis in 1957, the disease has been reported in various parts of the world.Pathological features of the disease include inflammatory lesions in the extensor and flexor tendons and tendon sheaths of the posterior limbs

L. Van Der Heide

1977-01-01

345

Ribosomal Frameshifting in Decoding Plant Viral RNAs  

Microsoft Academic Search

\\u000a Frameshifting provides an elegant mechanism by which viral RNA both encodes overlapping genes and controls expression levels\\u000a of those genes. As in animal viruses, the ?1 ribosomal frameshift site in the viral mRNA consists of a canonical shifty heptanucleotide\\u000a followed by a highly structured frameshift stimulatory element, and the gene translated as a result of frameshifting usually\\u000a encodes the RNA-dependent

W. Allen Miller; David P. Giedroc

346

Emerging viral infections of the nervous system  

Microsoft Academic Search

New viral infections of the nervous system have been appearing with great regularity. Some result from the evolution of new\\u000a agents and others from the entry of viruses into new hosts or environments. The emergence of neurovirulent enteroviruses causing\\u000a a paralytic poliomyelitis syndrome and rhomboencephalitis represent the evolution of new human viruses. Most emerging viral\\u000a infections represent movement of an

Richard T. Johnson

2003-01-01

347

A Model for Viral Genome Packing  

Microsoft Academic Search

A method is developed to simulate the process of double-stranded (ds) DNA packing in viral capsids. The dsDNA is modeled as a discrete single-stranded homopolymer with an all-elastic potential that is parameterized only by the experimentally measured rise per base pair (bp) and the persistence length of free dsDNA in physiological conditions. No properties from experiments on packaged viral DNA

C. Rebecca Locker; Stephen C. Harvey

2006-01-01

348

Synchronous Loss of Quasispecies Memory in Parallel Viral Lineages: A Deterministic Feature of Viral Quasispecies  

Microsoft Academic Search

Viral quasispecies are endowed with a memory of their past evolutionary history in the form of minority genomes of their mutant spectra. To determine the fate of memory genomes in evolving viral quasispecies, we have measured memory levels of antigenic variant of foot-and-mouth disease virus (FMDV) RED, which includes an Arg-Glu-Asp (RED) at a surface antigenic loop of the viral

Carmen M. Ruiz-Jarabo; Eric Miller; Gema Gómez-Mariano; Esteban Domingo

2003-01-01

349

Persisting Viral Sequences Shape Microbial CRISPR-based Immunity  

PubMed Central

Well-studied innate immune systems exist throughout bacteria and archaea, but a more recently discovered genomic locus may offer prokaryotes surprising immunological adaptability. Mediated by a cassette-like genomic locus termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), the microbial adaptive immune system differs from its eukaryotic immune analogues by incorporating new immunities unidirectionally. CRISPR thus stores genomically recoverable timelines of virus-host coevolution in natural organisms refractory to laboratory cultivation. Here we combined a population genetic mathematical model of CRISPR-virus coevolution with six years of metagenomic sequencing to link the recoverable genomic dynamics of CRISPR loci to the unknown population dynamics of virus and host in natural communities. Metagenomic reconstructions in an acid-mine drainage system document CRISPR loci conserving ancestral immune elements to the base-pair across thousands of microbial generations. This ‘trailer-end conservation’ occurs despite rapid viral mutation and despite rapid prokaryotic genomic deletion. The trailer-ends of many reconstructed CRISPR loci are also largely identical across a population. ‘Trailer-end clonality’ occurs despite predictions of host immunological diversity due to negative frequency dependent selection (kill the winner dynamics). Statistical clustering and model simulations explain this lack of diversity by capturing rapid selective sweeps by highly immune CRISPR lineages. Potentially explaining ‘trailer-end conservation,’ we record the first example of a viral bloom overwhelming a CRISPR system. The polyclonal viruses bloom even though they share sequences previously targeted by host CRISPR loci. Simulations show how increasing random genomic deletions in CRISPR loci purges immunological controls on long-lived viral sequences, allowing polyclonal viruses to bloom and depressing host fitness. Our results thus link documented patterns of genomic conservation in CRISPR loci to an evolutionary advantage against persistent viruses. By maintaining old immunities, selection may be tuning CRISPR-mediated immunity against viruses reemerging from lysogeny or migration.

Weinberger, Ariel D.; Sun, Christine L.; Plucinski, Mateusz M.; Denef, Vincent J.; Thomas, Brian C.; Horvath, Philippe; Barrangou, Rodolphe; Gilmore, Michael S.; Getz, Wayne M.; Banfield, Jillian F.

2012-01-01

350

Molecular biology of bovine viral diarrhea virus.  

PubMed

Bovine viral diarrhea viruses (BVDV) are arguably the most important viral pathogen of ruminants worldwide and can cause severe economic loss. Clinical symptoms of the disease caused by BVDV range from subclinical to severe acute hemorrhagic syndrome, with the severity of disease being strain dependent. These viruses are classified as members of the Pestivirus genus of the Flaviviridae. BVDV are considered primarily a pathogen of cattle but can infect most ruminant species. The virus particle consists of a lipid bilayer membrane surrounding the encapsidated genomic RNA. Inserted in the outer membrane are two virus-encoded glycoproteins that contain the major antigenic determinants of the virus as well as receptor binding and cell fusion functions. A third glycoprotein is weakly associated with the virion, but also possesses unique features that play important roles in suppression of innate immunity. The viral proteins are encoded in a single, large open reading frame. The viral proteins are proteolytically cleaved from the polyprotein by different proteases. The structural proteins are processed by cellular signal peptidases while the processing of the nonstructural proteins is by the viral serine protease. The virus is assembled and matures in the endoplasmic reticulum and golgi bodies of the cell. The virus is released via exocytosis, where viral proteins are not exposed on the surface of the cell. PMID:22884672

Neill, John D

2012-08-11

351

Viral Metagenomics: MetaView Software  

SciTech Connect

The purpose of this report is to design and develop a tool for analysis of raw sequence read data from viral metagenomics experiments. The tool should compare read sequences of known viral nucleic acid sequence data and enable a user to attempt to determine, with some degree of confidence, what virus groups may be present in the sample. This project was conducted in two phases. In phase 1 we surveyed the literature and examined existing metagenomics tools to educate ourselves and to more precisely define the problem of analyzing raw read data from viral metagenomic experiments. In phase 2 we devised an approach and built a prototype code and database. This code takes viral metagenomic read data in fasta format as input and accesses all complete viral genomes from Kpath for sequence comparison. The system executes at the UNIX command line, producing output that is stored in an Oracle relational database. We provide here a description of the approach we came up with for handling un-assembled, short read data sets from viral metagenomics experiments. We include a discussion of the current MetaView code capabilities and additional functionality that we believe should be added, should additional funding be acquired to continue the work.

Zhou, C; Smith, J

2007-10-22

352

Viral encephalitis: current treatments and future perspectives.  

PubMed

Several viruses may cause central nervous system infections that lead to a broad range of clinical manifestations. The course of the viral encephalitis can be acute, sub acute, or chronic. Some viruses have the ability to enter into the brain and cause direct injury, while others activate inflammatory cells that attack the central nervous system (CNS) secondarily. Some types of viral encephalitis occur in previously healthy individuals, while others affect immunocompromised patients. The epidemiology of viral encephalitis has undergone changes in recent years. Factors such as evolving lifestyles and ecological changes have had a considerable impact on the epidemiology of some types of viral encephalitis. The result is a change in the etiology spectrum of viral encephalitis, with new types of encephalitis arising or returning from time to time. Many scientific achievements in neuroimaging, molecular diagnosis, antiviral therapy, immunomodulatory treatments, and neurointensive care have allowed more precise and earlier diagnoses and more efficient treatments, resulting in improved outcomes. Despite these advances, there is still considerable morbidity and mortality related to these disorders. This aim of this article is to review the current knowledge of the current drugs used in the management of the most important viral encephalitis, focusing on the mechanisms of action, efficacy, and side effects of the drugs. In addition, future perspectives in this area will be addressed. Despite the technological advances, much effort has yet to be undertaken to reduce the impact of these potentially devastating diseases. PMID:22640219

Domingues, Renan Barros

2012-12-01

353

DEVELOPMENT OF GENETICALLY ENHANCED BACULOVIRUS PESTICIDES  

EPA Science Inventory

The assessment of potential environmental impacts of genetically improved viral pesticides will include an evaluation of the properties of the foreign gene product(s) as well as the biological properties of altered virus itself. It is anticipated that in the near future several t...

354

Targeting Genetically Modified Macrophages to the Glomerulus  

Microsoft Academic Search

Macrophages are key players in the development of the majority of renal diseases and are therefore ideal cellular vectors for site specifically targeting gene therapy to inflamed glomeruli. Macrophages can be genetically modified using viral vectors ex vivo then re-introduced into the body where they can home to the diseased site. This review summarises current experience in efficiently targeting modified

H. M. Wilson; D. C. Kluth

2003-01-01

355

P53-Mediated Rapid Induction of Apoptosis Conveys Resistance to Viral Infection in Drosophila melanogaster  

PubMed Central

Arthropod-borne pathogens account for millions of deaths each year. Understanding the genetic mechanisms controlling vector susceptibility to pathogens has profound implications for developing novel strategies for controlling insect-transmitted infectious diseases. The fact that many viruses carry genes that have anti-apoptotic activity has long led to the hypothesis that induction of apoptosis could be a fundamental innate immune response. However, the cellular mechanisms mediating the induction of apoptosis following viral infection remained enigmatic, which has prevented experimental verification of the functional significance of apoptosis in limiting viral infection in insects. In addition, studies with cultured insect cells have shown that there is sometimes a lack of apoptosis, or the pro-apoptotic response happens relatively late, thus casting doubt on the functional significance of apoptosis as an innate immunity. Using in vivo mosquito models and the native route of infection, we found that there is a rapid induction of reaper-like pro-apoptotic genes within a few hours following exposure to DNA or RNA viruses. Recapitulating a similar response in Drosophila, we found that this rapid induction of apoptosis requires the function of P53 and is mediated by a stress–responsive regulatory region upstream of reaper. More importantly, we showed that the rapid induction of apoptosis is responsible for preventing the expression of viral genes and blocking the infection. Genetic changes influencing this rapid induction of reaper-like pro-apoptotic genes led to significant differences in susceptibility to viral infection.

Liu, Bo; Behura, Susanta K.; Clem, Rollie J.; Schneemann, Anette; Becnel, James; Severson, David W.; Zhou, Lei

2013-01-01

356

Complete Genome Viral Phylogenies Suggests the Concerted Evolution of Regulatory Cores and Accessory Satellites  

PubMed Central

We consider the concerted evolution of viral genomes in four families of DNA viruses. Given the high rate of horizontal gene transfer among viruses and their hosts, it is an open question as to how representative particular genes are of the evolutionary history of the complete genome. To address the concerted evolution of viral genes, we compared genomic evolution across four distinct, extant viral families. For all four viral families we constructed DNA-dependent DNA polymerase-based (DdDp) phylogenies and in addition, whole genome sequence, as quantitative descriptions of inter-genome relationships. We found that the history of the polymerase gene was highly predictive of the history of the genome as a whole, which we explain in terms of repeated, co-divergence events of the core DdDp gene accompanied by a number of satellite, accessory genetic loci. We also found that the rate of gene gain in baculovirus and poxviruses proceeds significantly more quickly than the rate of gene loss and that there is convergent acquisition of satellite functions promoting contextual adaptation when distinct viral families infect related hosts. The congruence of the genome and polymerase trees suggests that a large set of viral genes, including polymerase, derive from a phylogenetically conserved core of genes of host origin, secondarily reinforced by gene acquisition from common hosts or co-infecting viruses within the host. A single viral genome can be thought of as a mutualistic network, with the core genes acting as an effective host and the satellite genes as effective symbionts. Larger virus genomes show a greater departure from linkage equilibrium between core and satellites functions.

de Andrade Zanotto, Paolo Marinho; Krakauer, David C.

2008-01-01

357

Rapid intracellular competition between hepatitis C viral genomes as a result of mitosis.  

PubMed

Cells infected with hepatitis C virus (HCV) become refractory to further infection by HCV (T. Schaller et al., J. Virol. 81:4591-4603, 2007; D. M. Tscherne et al., J. Virol. 81:3693-3703, 2007). This process, termed superinfection exclusion, does not involve downregulation of surface viral receptors but instead occurs inside the cell at the level of RNA replication. The originally infecting virus may occupy replication niches or sequester host factors necessary for viral growth, preventing effective growth of viruses that enter the cell later. However, there appears to be an additional level of intracellular competition between viral genomes that occurs at or shortly following mitosis. In the setting of cellular division, when two viral replicons of equivalent fitness are present within a cell, each has an equal opportunity to exclude the other. In a population of dividing cells, the competition between viral genomes proceeds apace, randomly clearing one or the other genome from cells in the span of 9 to 12 days. These findings demonstrate a new mechanism of intracellular competition between HCV strains, which may act to further limit HCV's genetic diversity and ability to recombine in vivo. PMID:23097449

Webster, Brian; Wissing, Silke; Herker, Eva; Ott, Melanie; Greene, Warner C

2012-10-24

358

Mobilizing monocytes to cross-present circulating viral antigen in chronic infection  

PubMed Central

Selection of antigens for therapeutic vaccination against chronic viral infections is complicated by pathogen genetic variations. We tested whether antigens present during persistent viral infections could provide a personalized antigenic reservoir for therapeutic T cell expansion in humans. We focused our study on the HBV surface antigen (HBsAg), which is present in microgram quantities in the serum of chronic HBV patients. We demonstrated by quantitative fluorescent microscopy that, out of 6 professional APC populations in the circulation, only CD14 monocytes (MNs) retained an HBsAg depot. Using TCR-redirected CD8+ T cells specific for MHC-I–restricted HBV epitopes, we showed that, despite being constantly exposed to antigen, ex vivo–isolated APCs did not constitutively activate HBV-specific CD8+ T cells. However, differentiation of HBsAg+ CD14 MNs from chronic patients to MN-derived DCs (moDCs) induced cross-presentation of the intracellular reservoir of viral antigen. We exploited this mechanism to cross-present circulating viral antigen and showed that moDCs from chronically infected patients stimulated expansion of autologous HBV-specific T cells. Thus, these data demonstrate that circulating viral antigen produced during chronic infection can serve as a personalized antigenic reservoir to activate virus-specific T cells.

Gehring, Adam J.; Haniffa, Muzlifah; Kennedy, Patrick T.; Ho, Zi Zong; Boni, Carolina; Shin, Amanda; Banu, Nasirah; Chia, Adeline; Lim, Seng Gee; Ferrari, Carlo; Ginhoux, Florent; Bertoletti, Antonio

2013-01-01

359

Cell and viral regulatory elements enhance the expression and function of a human immunodeficiency virus inhibitory gene.  

PubMed Central

Regulated expression of recombinant genes in CD4+ cells is an important objective for gene therapy of AIDS, as these cells represent the principal target for viral replication of human immunodeficiency virus (HIV). We report here that specific combinations of CD4 cell-specific and viral regulatory elements can enhance expression of an antiviral gene product. Different viral regulatory elements were incorporated into a previously reported CD4 locus control region to increase the expression of reporter genes in T and monocytic cell lines. The CD4-specific regulatory elements were included to enhance expression in CD4 cells, and viral regulatory regions, including the cytomegalovirus immediate-early (CMV IE) upstream enhancer, which contains the kappa B and Ap1 regulatory elements and a Tat-responsive element of the HIV type 1 long terminal repeat, were used to increase gene expression and modulate its activity in response to viral infection. In transient transfection assays, this vector was 100- to 1,000-fold more active than the original CD4 regulatory elements alone. Expression of an inhibitory form of the Rev protein, Rev M10, was more effective than previously described vectors and protected against productive viral replication in CD4+ peripheral blood mononuclear cells. The combination of CD4 lineage-specific and viral regulatory elements will facilitate the development of more effective antiviral genetic strategies for AIDS.

Ranga, U; Woffendin, C; Yang, Z Y; Xu, L; Verma, S; Littman, D R; Nabel, G J

1997-01-01

360

Comprehensive viral oligonucleotide probe design using conserved protein regions  

PubMed Central

Oligonucleotide microarrays have been applied to microbial surveillance and discovery where highly multiplexed assays are required to address a wide range of genetic targets. Although printing density continues to increase, the design of comprehensive microbial probe sets remains a daunting challenge, particularly in virology where rapid sequence evolution and database expansion confound static solutions. Here, we present a strategy for probe design based on protein sequences that is responsive to the unique problems posed in virus detection and discovery. The method uses the Protein Families database (Pfam) and motif finding algorithms to identify oligonucleotide probes in conserved amino acid regions and untranslated sequences. In silico testing using an experimentally derived thermodynamic model indicated near complete coverage of the viral sequence database.

Jabado, Omar J.; Liu, Yang; Conlan, Sean; Quan, P. Lan; Hegyi, Hedi; Lussier, Yves; Briese, Thomas; Palacios, Gustavo; Lipkin, W. I.

2008-01-01

361

Viral evolution in deep time: lentiviruses and mammals.  

PubMed

Lentiviruses are a distinctive genus of retroviruses that cause chronic, persistent infections in mammals, including humans. The emergence of pandemic HIV type-1 (HIV-1) infection during the late 20th century shaped a view of lentiviruses as 'modern' viruses. However, recent research has revealed an entirely different perspective, elucidating aspects of an evolutionary relationship with mammals that extends across many millions of years. Such deep evolutionary history is likely to be typical of many host-virus systems, fundamentally underpinning their interactions in the present day. For this reason, establishing the deep history of virus and host interaction is key to developing a fully informed approach to tackling viral diseases. Here, I use the example of lentiviruses to illustrate how paleovirological, geographic and genetic calibrations allow observations of virus and host interaction across a wide range of temporal and spatial scales to be integrated into a coherent ecological and evolutionary framework. PMID:22197521

Gifford, Robert J

2011-12-22

362

Medium for preserving biological materials  

US Patent & Trademark Office Database

The present invention relates to a medium allowing the preservation and cryopreservation of biological materials such as animal cells and viral particles that are directly injectable or reinjectable into an organism. A medium for preserving and/or freezing biological materials, including a saline solution, modified fluid gelatin and human serum albumin, is disclosed.

Crespo; Andre (Ormesson, FR); Soria; Henri Michel (Monts, FR)

2001-06-19

363

A statistical method for comparing viral growth curves  

Microsoft Academic Search

Viral replication is often analyzed by growth curves, in which viral multiplication in the presence of host cells is measured as a function of time. Comparing growth curves is one of the most sensitive ways of comparing viral growth under different conditions or for comparing replication of different viral mutants. However, such experiments are rarely analyzed in a statistically rigorous

Gary P. Wang; Frederic D. Bushman

2006-01-01

364

Viral evolution and challenges in the development of HIV vaccines  

Microsoft Academic Search

Potent virus-specific cytotoxic T lymphocyte (CTL) responses elicited by candidate AIDS vaccines have been shown to provide short-term control of viral replication following pathogenic viral challenges in rhesus monkeys. We have recently shown that vaccines that control rather than prevent immunodeficiency virus infections are still subject to immune escape. In particular, viral mutations can develop that result in viral escape

Dan H Barouch; Norman L Letvin

2002-01-01

365

Viral subversion of the host protein synthesis machinery  

Microsoft Academic Search

Viruses are fully reliant on the translation machinery of their host cells to produce the polypeptides that are essential for viral replication. Consequently, viruses recruit host ribosomes to translate viral mRNAs, typically using virally encoded functions to seize control of cellular translation factors and the host signalling pathways that regulate their activity. This not only ensures that viral proteins will

Derek Walsh; Ian Mohr

2011-01-01

366

Relationship of viral infections to wheezing illnesses and asthma  

Microsoft Academic Search

Viral infections can influence both the development and the severity of asthma. In early life, viral infections can either increase or, remarkably, decrease the risk of subsequent asthma. In children and adults with existing asthma, viral respiratory infections frequently cause acute airway obstruction and wheezing. This article discusses the influence of viral infections on mechanisms of virus-induced airway inflammation in

William W. Busse; James E. Gern

2002-01-01

367

Distribution pattern of bovine viral diarrhoea virus strains in intensive cattle herds in Italy  

Microsoft Academic Search

The genetic variation of bovine viral diarrhoea virus (BVDV) was studied by comparative nucleotide sequence analysis of 26 Italian field strains collected during the period 1995–2000 in 18 cattle herds. A fragment within the 5?-untranslated region (UTR) was sequenced directly from gel-purified products obtained by reverse transcription polymerase chain reaction. BVDV-1b (n=14), -1c (n=1), -1d (n=1) and BVDV-2 (n=2) strains

C. Luzzago; C. Bandi; V. Bronzo; G. Ruffo; A. Zecconi

2001-01-01

368

Viral vectors for gene therapy: the art of turning infectious agents into vehicles of therapeutics.  

PubMed

Considered by some to be among the simpler forms of life, viruses represent highly evolved natural vectors for the transfer of foreign genetic information into cells. This attribute has led to extensive attempts to engineer recombinant viral vectors for the delivery of therapeutic genes into diseased tissues. While substantial progress has been made, and some clinical successes are over the horizon, further vector refinement and/or development is required before gene therapy will become standard care for any individual disorder. PMID:11135613

Kay, M A; Glorioso, J C; Naldini, L

2001-01-01

369

Persistence in Muscle of an Adenoviral Vector that Lacks All Viral Genes  

Microsoft Academic Search

Genetic correction of inherited muscle diseases, such as Duchenne muscular dystrophy, will require long term expression of the recombinant protein following gene transfer. We have shown previously that a new adenoviral vector that lacks all viral genes expressed both full-length dystrophin and beta -galactosidase in mdx (dystrophin-deficient) mouse muscle. We observed a significant histologic improvement of vector-transduced mdx muscle before

Hsiao-Huei Chen; Lisa M. Mack; Robert Kelly; Marcia Ontell; Stefan Kochanek; Paula R. Clemens

1997-01-01

370

Vaccines 85: Molecular and chemical basis of resistance to parasitic, bacterial, and viral diseases  

SciTech Connect

This book contains 70 selections. Some of the selection titles are: Structure of the Gene Encoding of Immunodominant Surface Antigen on the Sprozoite of the Human Malaria Parasite Plasmodium falciparum; Cloning and Expression in Bacteria of the Genes for Merozite-specific Antigens from the Malaria Parasite Plasmodium falciparum; A Major Surface Antigen of Plasmodium falciparum in Merozoites: Studies on the Protein and its Gene; Genetic Construction of Cholera Vaccine Prototypes; and Viral Genes, Cytotoxic T Lymphocytes and Immunity.

Lerner, R.A.; Chanock, R.M.; Brown, F.

1985-01-01

371

Viral paratransgenesis in the malaria vector Anopheles gambiae.  

PubMed

Paratransgenesis, the genetic manipulation of insect symbiotic microorganisms, is being considered as a potential method to control vector-borne diseases such as malaria. The feasibility of paratransgenic malaria control has been hampered by the lack of candidate symbiotic microorganisms for the major vector Anopheles gambiae. In other systems, densonucleosis viruses (DNVs) are attractive agents for viral paratransgenesis because they infect important vector insects, can be genetically manipulated and are transmitted to subsequent generations. However, An. gambiae has been shown to be refractory to DNV dissemination. We discovered, cloned and characterized the first known DNV (AgDNV) capable of infection and dissemination in An. gambiae. We developed a flexible AgDNV-based expression vector to express any gene of interest in An. gambiae using a two-plasmid helper-transducer system. To demonstrate proof-of-concept of the viral paratransgenesis strategy, we used this system to transduce expression of an exogenous gene (enhanced green fluorescent protein; EGFP) in An. gambiae mosquitoes. Wild-type and EGFP-transducing AgDNV virions were highly infectious to An. gambiae larvae, disseminated to and expressed EGFP in epidemiologically relevant adult tissues such as midgut, fat body and ovaries and were transmitted to subsequent mosquito generations. These proof-of-principle data suggest that AgDNV could be used as part of a paratransgenic malaria control strategy by transduction of anti-Plasmodium peptides or insect-specific toxins in Anopheles mosquitoes. AgDNV will also be extremely valuable as an effective and easy-to-use laboratory tool for transient gene expression or RNAi in An. gambiae. PMID:18725926

Ren, Xiaoxia; Hoiczyk, Egbert; Rasgon, Jason L

2008-08-22

372

Viral Paratransgenesis in the Malaria Vector Anopheles gambiae  

PubMed Central

Paratransgenesis, the genetic manipulation of insect symbiotic microorganisms, is being considered as a potential method to control vector-borne diseases such as malaria. The feasibility of paratransgenic malaria control has been hampered by the lack of candidate symbiotic microorganisms for the major vector Anopheles gambiae. In other systems, densonucleosis viruses (DNVs) are attractive agents for viral paratransgenesis because they infect important vector insects, can be genetically manipulated and are transmitted to subsequent generations. However, An. gambiae has been shown to be refractory to DNV dissemination. We discovered, cloned and characterized the first known DNV (AgDNV) capable of infection and dissemination in An. gambiae. We developed a flexible AgDNV-based expression vector to express any gene of interest in An. gambiae using a two-plasmid helper-transducer system. To demonstrate proof-of-concept of the viral paratransgenesis strategy, we used this system to transduce expression of an exogenous gene (enhanced green fluorescent protein; EGFP) in An. gambiae mosquitoes. Wild-type and EGFP-transducing AgDNV virions were highly infectious to An. gambiae larvae, disseminated to and expressed EGFP in epidemiologically relevant adult tissues such as midgut, fat body and ovaries and were transmitted to subsequent mosquito generations. These proof-of-principle data suggest that AgDNV could be used as part of a paratransgenic malaria control strategy by transduction of anti-Plasmodium peptides or insect-specific toxins in Anopheles mosquitoes. AgDNV will also be extremely valuable as an effective and easy-to-use laboratory tool for transient gene expression or RNAi in An. gambiae.

Ren, Xiaoxia; Hoiczyk, Egbert; Rasgon, Jason L.

2008-01-01

373

DNA Vaccination of Rainbow Trout against Viral Hemorrhagic Septicemia Virus: A Dose–Response and Time–Course Study  

Microsoft Academic Search

Viral hemorrhagic septicemia (VHS) in rainbow trout Oncorhynchus mykiss is caused by VHS virus (VHSV), which belongs to the rhabdovirus family. Among the different strategies for immunizing fish with a recombinant vaccine, genetic immunization has recently proven to be highly effective. To further investigate the potential for protecting fish against VHS by DNA vaccination, experiments were conducted to determine the

Ellen Lorenzen; Katja Einer-Jensen; Torben Martinussen; Scott E. LaPatra; Niels Lorenzen

2000-01-01

374

Decomposition in soil of soluble, insoluble and lignin-rich fractions of plant material from tobacco with genetic modifications to lignin biosynthesis  

Microsoft Academic Search

The decomposition in soil of pieces of stem and different fractions of stems from uniformly-grown tobacco plants with genetic modifications to lignin biosynthesis was investigated by measuring CO2 production over 74d. The fractions used were intact stems, the insoluble fraction obtained by washing the stems with water, the lignin-rich fraction obtained by dissecting away the epidermis and cortex from the

E. A. Webster; C. Halpin; J. A. Chudek; E. L. Tilston; D. W. Hopkins

2005-01-01

375

Estimation of genetic parameters and prediction of breeding values for apple fruit-quality traits using pedigreed plant material in Europe  

Microsoft Academic Search

Genetic parameters for apple (Malus x domestica) fruit external traits (fruit size, ground colour, proportion of over colour and attractiveness) and sensory traits (firmness,\\u000a crispness, texture, juiciness, flavour, sugar, acidity and global taste) were estimated using 2,207 pedigreed genotypes from\\u000a breeding programmes in six European countries. Data were scored for 3 years and four periods during storage. Analyses were\\u000a performed with

Abou Bakari Kouassi; Charles-Eric Durel; Fabrizio Costa; Stefano Tartarini; Eric van de Weg; Kate Evans; Felicidad Fernandez-Fernandez; Ceri Govan; Anastasia Boudichevskaja; Frank Dunemann; Adriana Antofie; Marc Lateur; Marta Stankiewicz-Kosyl; Andrzej Soska; Kazimierz Tomala; Markus Lewandowski; Krzysztof Rutkovski; Edwards Zurawicz; Walter Guerra; François Laurens

2009-01-01

376

Reverse genetics for mammalian reovirus.  

PubMed

Mammalian orthoreoviruses (reoviruses) are highly tractable models for studies of viral replication and pathogenesis. The versatility of reovirus as an experimental model has been enhanced by development of a plasmid-based reverse genetics system. Infectious reovirus can be recovered from cells transfected with plasmids encoding cDNAs of each reovirus gene segment using a strategy that does not require helper virus and is independent of selection. In this system, transcription of each gene segment is driven by bacteriophage T7 RNA polymerase, which can be supplied transiently by recombinant vaccinia virus (rDIs-T7pol) or by cells that constitutively express the enzyme. Reverse genetics systems have been developed for two prototype reovirus strains, type 1 Lang (T1L) and type 3 Dearing (T3D). Each reovirus cDNA was encoded on an independent plasmid for the first-generation rescue system. The efficiency of virus recovery was enhanced in a second-generation system by combining the cDNAs for multiple reovirus gene segments onto single plasmids to reduce the number of plasmids from 10 to 4. The reduction in plasmid number and the use of baby hamster kidney cells that express T7 RNA polymerase increased the efficiency of viral rescue, reduced the incubation time required to recover infectious virus, and eliminated potential biosafety concerns associated with the use of recombinant vaccinia virus. Reovirus reverse genetics has been used to introduce mutations into viral capsid and nonstructural components to study viral protein-structure activity relationships and can be exploited to engineer recombinant reoviruses for vaccine and oncolytic applications. PMID:21798351

Boehme, Karl W; Ikizler, Miné; Kobayashi, Takeshi; Dermody, Terence S

2011-07-21

377

Dicer-2 Processes Diverse Viral RNA Species  

PubMed Central

RNA silencing pathways play critical roles in gene regulation, virus infection, and transposon control. RNA interference (RNAi) is mediated by small interfering RNAs (siRNAs), which are liberated from double-stranded (ds)RNA precursors by Dicer and guide the RNA-induced silencing complex (RISC) to targets. Although principles governing small RNA sorting into RISC have been uncovered, the spectrum of RNA species that can be targeted by Dicer proteins, particularly the viral RNAs present during an infection, are poorly understood. Dicer-2 potently restricts viral infection in insects by generating virus-derived siRNAs from viral RNA. To better characterize the substrates of Dicer-2, we examined the virus-derived siRNAs produced during the Drosophila antiviral RNAi response to four different viruses using high-throughput sequencing. We found that each virus was uniquely targeted by the RNAi pathway; dicing substrates included dsRNA replication intermediates and intramolecular RNA stem loops. For instance, a putative intergenic RNA hairpin encoded by Rift Valley Fever virus generates abundant small RNAs in both Drosophila and mosquito cells, while repetitive sequences within the genomic termini of Vaccinia virus, which give rise to abundant small RNAs in Drosophila, were found to be transcribed in both insect and mammalian cells. Moreover, we provide evidence that the RNA species targeted by Dicer-2 can be modulated by the presence of a viral suppressor of RNAi. This study uncovered several novel, heavily targeted features within viral genomes, offering insight into viral replication, viral immune evasion strategies, and the mechanism of antiviral RNAi.

Sabin, Leah R.; Zheng, Qi; Thekkat, Pramod; Yang, Jamie; Hannon, Gregory J.; Gregory, Brian D.; Tudor, Matthew; Cherry, Sara

2013-01-01

378

Genome-virome interactions: examining the role of common viral infections in complex disease  

PubMed Central

Preface New technologies have widened our view of “complex diseases”--diseases with both genetic and environmental risk factors. Here, we explore recent genetic and virologic evidence implicating host-virus interactions in three diseases—type 1 diabetes, inflammatory bowel disease, and asthma. In these examples, the viruses implicated in disease are mucosal infections that affect most of the population and that are asymptomatic or mild in many hosts. These findings place a new emphasis on common viral infections as an important environmental factor in complex disease pathogenesis, and they compel us to pursue a better understanding of host interactions with the human virome.

Foxman, Ellen F.; Iwasaki, Akiko

2013-01-01

379

Primer on molecular genetics  

SciTech Connect

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

Not Available

1992-04-01

380

Viral loads in clinical specimens and SARS manifestations.  

PubMed

1. A high viral load in nasopharyngeal aspirate (with or without a high viral load in serum) is a useful prognostic indicator of respiratory failure or mortality. The presence of viral RNA in multiple body sites is also indicative of poor prognosis. 2. Early treatment with an effective antiviral agent before day 10 may decrease the peak viral load, and thus ameliorate the clinical symptoms and mortality, and reduce viral shedding and the risk of transmission PMID:20393220

Hung, I F N; Lau, S K P; Woo, P C Y; Yuen, K Y

2009-12-01

381

Management of viral hepatitis B.  

PubMed

Hepatitis B virus (HBV) infection is a major global health concern and is the most common cause of chronic liver disease worldwide. The natural history and clinical outcomes of chronic HBV infection are determined by the viral replication cycle and the host immune responses. Treatment of chronic hepatitis B is directed at interrupting the natural history by suppressing HBV replication before development of any significant irreversible liver cell damage. Effective antiviral therapies should be followed by sustained suppression of HBV-DNA, normalization of transaminases levels and a stable stage of HBeAg seroconversion with persistence of circulating anti-HBeAg antibodies. Two major classes of antiviral therapeutic agents that have been approved for treatment of chronic hepatitis B are immunomodulating agents (i.e. interferon) and the nucleoside analogs (i.e. lamivudine). A 4-6 month course of interferon-alpha has resulted in improvement of survival in 20%-30% of patients with chronic hepatitis B who had elevated serum ALT levels without hepatic decompensation. Interferon-alpha therapy is associated with HBeAg seroconversion; normalization of ALT levels, reduced hepatic inflammation, and possibly reduced disease progression to cirrhosis and hepatocellular carcinoma. Interferon can also be used with caution in patients with early compensated cirrhosis. A 12-month course of lamivudine has been shown to be well tolerated and effective. Lamivudine can be used in decompensated cirrhosis and immunosuppressed patients and for prevention of recurrent HBV infection after liver transplantation. The response rates after 3 years of lamivudine therapy account for 40-65%. A major problem of antiviral treatment is the emergence of drug resistance conferred by mutations in the YMDD motif of HBV reverse transcriptase. The prevalence of YMDD mutations increases with longer durations of antiviral therapies and this has been detected in 20% of immunocompetent patients receiving lamivudine per year. Contentious issues remain when to stop the treatment if HBeAg seroconversion does not occur. Many new immunomodulatory therapies and antiviral agents are in various stages of clinical development and have shown some promise. Among newer HBV antivirals, adefovir dipivoxil, entecavir, emtricitabine, DAPD and clevudine appear to be at least as potent as lamivudine in suppressing HBV replication. In vitro studies have shown that YMDD mutations confer cross-resistance between lamivudine and emtricitabine. However, adefovir, dipivoxil, lobucavir, DAPD and possibly clevudine suppress replications of both YMDD mutants and wild types of HBV. Immunomodulatory approaches for treatment of chronic hepatitis B are conceptually attractive, but newer agents used to date (thymosin-alpha, interleukin-12, therapeutic vaccines) have not demonstrated sufficient efficacy for widespread use. Combinations of an immunomodulatory agent and nucleoside analog may improve the therapeutic efficacy and reduce the emergence of drug resistance. Nevertheless, combinations of interferon and lamivudine therapies do not confer such additional benefits. The next challenge for HBV treatment is to use antivirals in combination and/or in cyclical therapy to minimize the emergence of drug resistance and increase efficacy, particularly to achieve sustainable post-treatment suppression of HBV. Randomized prospective control trials of combined antiviral therapies given simultaneously or sequentially are needed to establish safe and effective combined regimens that can be recommended for future treatment strategies. PMID:12000599

Pramoolsinsup, Chutima

2002-02-01

382

Understanding the Determinants of Mobile Viral Effects-Towards a Grounded Theory of Mobile Viral Marketing  

Microsoft Academic Search

Although there is some evidence on the usefulness of mobile viral marketing from marketers' perspective, little is known about the motivations, attitudes, and behaviors of consumers engaged in this marketing instrument. In this paper, we present the findings of a grounded theory study and focus on determining why a mobile viral effect occurs. The proposed framework helps researchers and marketers

Dietmar G. Wiedemann; Wolfgang Palka

2008-01-01

383

Genetic modification and genetic determinism  

Microsoft Academic Search

In this article we examine four objections to the genetic modification of human beings: the freedom argument, the giftedness argument, the authenticity argument, and the uniqueness argument. We then demonstrate that each of these arguments against genetic modification assumes a strong version of genetic determinism. Since these strong deterministic assumptions are false, the arguments against genetic modification, which assume and

David B. Resnik; Daniel B. Vorhaus

2006-01-01

384

Genetic therapy for the nervous system  

PubMed Central

Genetic therapy is undergoing a renaissance with expansion of viral and synthetic vectors, use of oligonucleotides (RNA and DNA) and sequence-targeted regulatory molecules, as well as genetically modified cells, including induced pluripotent stem cells from the patients themselves. Several clinical trials for neurologic syndromes appear quite promising. This review covers genetic strategies to ameliorate neurologic syndromes of different etiologies, including lysosomal storage diseases, Alzheimer's disease and other amyloidopathies, Parkinson's disease, spinal muscular atrophy, amyotrophic lateral sclerosis and brain tumors. This field has been propelled by genetic technologies, including identifying disease genes and disruptive mutations, design of genomic interacting elements to regulate transcription and splicing of specific precursor mRNAs and use of novel non-coding regulatory RNAs. These versatile new tools for manipulation of genetic elements provide the ability to tailor the mode of genetic intervention to specific aspects of a disease state.

Bowers, William J.; Breakefield, Xandra O.; Sena-Esteves, Miguel

2011-01-01

385

Bacterial and viral infections associated with influenza.  

PubMed

Influenza-associated bacterial and viral infections are responsible for high levels of morbidity and death during pandemic and seasonal influenza episodes. A review was undertaken to assess and evaluate the incidence, epidemiology, aetiology, clinical importance and impact of bacterial and viral co-infection and secondary infection associated with influenza. A review was carried out of published articles covering bacterial and viral infections associated with pandemic and seasonal influenza between 1918 and 2009 (and published through December 2011) to include both pulmonary and extra-pulmonary infections. While pneumococcal infection remains the predominant cause of bacterial pneumonia, the review highlights the importance of other co- and secondary bacterial and viral infections associated with influenza, and the emergence of newly identified dual infections associated with the 2009 H1N1 pandemic strain. Severe influenza-associated pneumonia is often bacterial and will necessitate antibiotic treatment. In addition to the well-known bacterial causes, less common bacteria such as Legionella pneumophila may also be associated with influenza when new influenza strains emerge. This review should provide clinicians with an overview of the range of bacterial and viral co- or secondary infections that could present with influenza illness. PMID:24034494

Joseph, Carol; Togawa, Yu; Shindo, Nahoko

2013-09-01

386

Emerging viral diseases in kidney transplant recipients.  

PubMed

Viruses are the most important cause of infections and a major source of mortality in Kidney Transplant Recipients (KTRs). These patients may acquire viral infections through exogenous routes including community exposure, donor organs, and blood products or by endogenous reactivation of latent viruses. Beside major opportunistic infections due to CMV and EBV and viral hepatitis B and C, several viral diseases have recently emerged in KTRs. New medical practices or technologies, implementation of new diagnostic tools, and improved medical information have contributed to the emergence of these viral diseases in this special population. The purpose of this review is to summarize the current knowledge on emerging viral diseases and newly discovered viruses in KTRs over the last two decades. We identified viruses in the field of KT that had shown the greatest increase in numbers of citations in the NCBI PubMed database. BKV was the most cited in the literature and linked to an emerging disease that represents a great clinical concern in KTRs. HHV-8, PVB19, WNV, JCV, H1N1 influenza virus A, HEV, and GB virus were the main other emerging viruses. Excluding HHV8, newly discovered viruses have been infrequently linked to clinical diseases in KTRs. Nonetheless, pathogenicity can emerge long after the discovery of the causative agent, as has been the case for BKV. Overall, antiviral treatments are very limited, and reducing immunosuppressive therapy remains the cornerstone of management. PMID:23132728

Moal, Valérie; Zandotti, Christine; Colson, Philippe

2012-11-07

387

Targeting the viral Achilles' heel: recognition of 5'-triphosphate RNA in innate anti-viral defence.  

PubMed

Some RNA virus genomes bear 5'-triphosphates, which can be recognized in the cytoplasm of infected cells by host proteins that mediate anti-viral immunity. Both the innate sensor RIG-I and the interferon-induced IFIT proteins bind to 5'-triphosphate viral RNAs. RIG-I signals for induction of interferons during RNA virus infection while IFITs sequester viral RNAs to exert an anti-viral effect. Notably, the structures of these proteins reveal both similarities and differences, which are suggestive of independent evolution towards ligand binding. 5'-triphosphates, which are absent from most RNAs in the cytosol of uninfected cells, are thus a marker of virus infection that is targeted by the innate immune system for both induction and execution of the anti-viral response. PMID:23707340

Rehwinkel, Jan; Reis E Sousa, Caetano

2013-05-23

388

Genetic engineering and lignin biosynthetic regulation in forest tree species  

Microsoft Academic Search

Genetic engineering of forest tree species is regarded as a strategy to reduce worldwide pressure on natural forests, to conserve\\u000a genetic resources and ameliorate stress on global climate, and to meet growing demand for forest wood and timber products.\\u000a Genetic engineering approaches toward the control or management of fungal pathogens, arthropod herbivores, bacterial and viral\\u000a diseases, the use of pest

Tang Wei; Janet Ogbon; Aquilla McCoy

2001-01-01

389

Diagnostic dilemma encountered when detecting bovine viral diarrhea virus in IVF embryo production  

Microsoft Academic Search

Routine quality controls in production of bovine embryos by in vitro fertilization (IVF) should include screening all materials of animal origin for the presence of bovine viral diarrhea virus (BVDV). Using a reverse transcription nested polymerase chain reaction (RT-nPCR) assay, we detected BVDV in primary cultures of uterine tubal cells (UTC) that had been used during IVF procedures. The goal

M. Daniel Givens; Kay P Riddell; Patricia K Galik; David A Stringfellow; Kenny V Brock; Naida M Loskutoff

2002-01-01

390

Use of Bovine Viral Diarrhoea Virus as an Internal Control for Amplification of Hepatitis C Virus  

Microsoft Academic Search

Background and Objectives: Screening for hepatitis C virus (HCV) by polymerase chain reaction (PCR) will be mandatory for screening blood and plasma donors in Europe and elsewhere. This study describes an internally controlled, highly sensitive PCR method designed for screening blood donations in pools. Material and Methods: RNA extracted from bovine viral diarrhoea virus (BVDV) was used as an internal

A. Cleland; P. Nettleton; L. M. Jarvis; P. Simmonds

1999-01-01

391

Managing Global Genetic Resources: Forest Trees.  

National Technical Information Service (NTIS)

The Work Group on Plant Genetic Resources of the Committee on Managing Global Genetic Resources: Agricultural Imperatives examined the management of forest trees from which harvested materials are currently extracted. It was charged with assessing the use...

1991-01-01

392

Gene transfer from genetically modified food  

Microsoft Academic Search

The current debate about the safety of genetically modified food includes some important scientific issues where more scientific data would aid the robustness of safety evaluation. One example is the possibility of gene transfer, especially from genetically modified plant material.

Michael J Gasson

2000-01-01

393

[Epidemiology of viral hepatitis in Mexico].  

PubMed

The main etiology of liver disease in Mexico is alcohol and viral hepatitis. The aim of the present study was to analyze the current epidemiology of viral hepatitis in Mexico. From 2000 to 2007 the Ministry of Health reported 192 588 cases of hepatitis, 79% HAV, 3.3% HBV, 6% HCV, and 12% without a specific etiologic factor. Due to high endemic areas for HBV infection in native Mexican population, limitations in the diagnostic sensitivity and specificity of the serological immunoassays used to date and presence of occult hepatitis B in the country, the real prevalence of HBV infection could be even higher than HCV in Mexico. Hepatitis E virus in cirrhotic patients and in porcine farms could at least partially explain the cases of hepatitis that are diagnosed without a specific etiologic agent. Specific strategies to establish control regulations against viral hepatitis infections in Mexico are proposed. PMID:21877071

Panduro, Arturo; Escobedo Meléndez, Griselda; Fierro, Nora A; Ruiz Madrigal, Bertha; Zepeda-Carrillo, Eloy Alfonso; Román, Sonia

2011-01-01

394

Molecular basis of viral and microbial pathogenesis  

SciTech Connect

The contents of this book are: Correlation Between Viroid Structure and Pathogenicty; Antigenicity of the Influenza Haemagglutinia Membrane Glycoprotein; Viral Glycoproteins as Determinants of Pathogenicity; Virus Genes Involved in Host Range and Pathogenicity; Molecular Heterogenetiy of Pathogenic Herpus Viruses; Recombination of Foreign (Viral) DNA with Host Genome: Studies in Vivo and in a Cell-Free system; Disorders of Cellular Neuro-Functions by Persistent Viral Infection; Pathogenic Aspects of Measles Virus-Persistent Infections in Man; Analysis of the Dual Lineage Specificity of E26 Avian Leukemia Virus; Mx Gene Control of Influenza Virus Susceptibility; Shiga and Shika-Like Toxins: A Family of Related Cytokinons; and Molecular Mechanisms of Pathogenicity in Shigella Flexneri.

Rott, R.; Goebel, W.

1988-01-01

395

Hepatitis viral load correlates to glutathione levels.  

PubMed

Several recent scientific articles have found a direct correlation between Glutathione levels and viral activity for hepatitis B and C. When viral load increases, Glutathione decreases. Researchers from Germany report that adding NAC (N-acetyl cysteine) to HBV producing cells lines can reduce hepatitis viral load 50 fold. Glutathione is used by the liver to help break down toxins. Patients who have chronic infection for more than 90 days should ask their physicians to check their Glutathione levels. A test kit is available from ImmunoSciences Labs; contact information is included. An amino acid, L-Glutamine, can be used with Alpha Lipoic Acid and NAC to increase Glutathione levels. Chlorophyll also offers benefits to people with hepatitis and other infections. Instructions on how to use a special retention enema containing chlorophyll, water, and apple cider vinegar are provided. PMID:11366543

1998-01-01

396

Cranial viral infections in the adult.  

PubMed

Viral infections of the adult are fortunately rare conditions but may carry serious clinical sequelae. Infection is usually acquired by haematogenous spread during a systemic viral illness and may be acute, subacute or chronic. The pathological basis of neuronal degeneration and attempt to repair is common to all illnesses and diagnosis is generally made by analysis of the pattern of disease. Magnetic resonance imaging is now the mainstay of imaging diagnosis. Acute infections include encephalitis due to a wide range of infecting agents and outcome depends on the severity of the acute episode. Subacute and chronic infections, including HIV encephalopathy, most often produce a progressive leucoencephalopathy and ultimately cerebral atrophy. Additionally, disease may also be immune mediated, that most closely associated with viral infection being acute disseminated encephalomyelitis, which is usually a monophasic illness. Finally, prion diseases are characterised by long incubation period and progressive course, leading to death. PMID:14749962

Andreula, Cosma

2004-03-01

397

[Viral retinitis following intravitreal triamcinolone injection].  

PubMed

Necrotizing viral retinitis is associated with infection by the Herpes family of viruses, especially herpes simplex virus (HSV), varicella zoster virus (VZV) and occasionally cytomegalovirus (CMV). When the diagnosis is suspected clinically, antiviral therapy must be instituted immediately. We report the case of a patient presenting with necrotizing viral retinitis 3 months following intravitreal injection of triamcinolone acetonide for diabetic macular edema. Fluorescein angiography demonstrated a superior temporal occlusive vasculitis. A diagnostic anterior chamber paracentesis was performed to obtain deoxyribo-nucleic acid (DNA) for a polymerase chain reaction (PCR) test for viral retinitis. PCR was positive for CMV. The patient was placed on intravenous ganciclovir. CMV retinitis is exceedingly rare in immunocompetent patients; however, it remains the most common cause of posterior uveitis in immunocompromised patients. The incidence of this entity remains unknown. Local immunosuppression, the dose and the frequency of injections may explain the occurrence of this severe retinitis. PMID:23648134

Zghal, I; Malek, I; Amel, C; Soumaya, O; Bouguila, H; Nacef, L

2013-05-04

398

Roadblocks to translational challenges on viral pathogenesis.  

PubMed

Distinct roadblocks prevent translating basic findings in viral pathogenesis into therapies and implementing potential solutions in the clinic. An ongoing partnership between the Volkswagen Foundation and Nature Medicine resulted in an interactive meeting in 2012, as part of the "Herrenhausen Symposia" series. Current challenges for various fields of viral research were recognized and discussed with a goal in mind--to identify solutions and propose an agenda to address the translational barriers. Here, some of the researchers who participated at the meeting provide a concise outlook at the most pressing unmet research and clinical needs, identifying these key obstacles is a necessary step towards the prevention and cure of human viral diseases. PMID:23296014

Deeks, Steven; Drosten, Christian; Picker, Louis; Subbarao, Kanta; Suzich, Joann

2013-01-01

399

[Mysteries of viral latency and reactivation].  

PubMed

Varicella-zoster virus is a Herpesvirus responsible for three distinct clinical features: chicken pox (varicella), shingles (herpes zoster) and post-zosterian pain (post-herpetic neuralgia). Neurological features of these diseases such as complications of chicken pox, viral latency in sensory ganglia and reactivation as shingles with concurrent and possibly subsequent prolonged pain, are the sequels of the invasion of the peripheral nervous system during primary infection. Prevention is achieved by vaccination with a live attenuated virus strain and therapy calls for specific antiviral agents. In many respects, vzv behaves differently from close relatives. In particular, viral latency in the nervous system is basically different from that of other Herpesviridae. The recent discovery of the expression of some viral regulatory proteins during latency, although it had always been considered that vzv latency was silent, and demonstration that these proteins are immunogenic open new avenues concerning the immune control of vzv reactivation. PMID:14639872

Rentier, B

2003-01-01

400

Genetic selection and conservation of genetic diversity*.  

PubMed

For 100s of years, livestock producers have employed various types of selection to alter livestock populations. Current selection strategies are little different, except our technologies for selection have become more powerful. Genetic resources at the breed level have been in and out of favour over time. These resources are the raw materials used to manipulate populations, and therefore, they are critical to the past and future success of the livestock sector. With increasing ability to rapidly change genetic composition of livestock populations, the conservation of these genetic resources becomes more critical. Globally, awareness of the need to steward genetic resources has increased. A growing number of countries have embarked on large scale conservation efforts by using in situ, ex situ (gene banking), or both approaches. Gene banking efforts have substantially increased and data suggest that gene banks are successfully capturing genetic diversity for research or industry use. It is also noteworthy that both industry and the research community are utilizing gene bank holdings. As pressures grow to meet consumer demands and potential changes in production systems, the linkage between selection goals and genetic conservation will increase as a mechanism to facilitate continued livestock sector development. PMID:22827378

Blackburn, H D

2012-08-01

401

95. Effective Genetic Engineering of Human Embryonic Stem Cells Using the Sleeping Beauty Transposon System  

Microsoft Academic Search

Human embryonic stem (ES) cells hold great promise for the study of human development and the generation of new therapeutic approaches to tissue regeneration and their genetic modification will play a key role in this development. While viral vectors have been readily used for gene transfer into human ES cells, only limited success has been achieved using non-viral vectors for

Andrew Wilber; Jonathan L. Linehan; Xinghui Tian; R. Scott McIvor; Dan S. Kaufman

2006-01-01

402

Improving gene annotation of complete viral genomes  

PubMed Central

Gene annotation in viruses often relies upon similarity search methods. These methods possess high specificity but some genes may be missed, either those unique to a particular genome or those highly divergent from known homologs. To identify potentially missing viral genes we have analyzed all complete viral genomes currently available in GenBank with a specialized and augmented version of the gene finding program GeneMarkS. In particular, by implementing genome-specific self-training protocols we have better adjusted the GeneMarkS statistical models to sequences of viral genomes. Hundreds of new genes were identified, some in well studied viral genomes. For example, a new gene predicted in the genome of the Epstein–Barr virus was shown to encode a protein similar to ?-herpesvirus minor tegument protein UL14 with heat shock functions. Convincing evidence of this similarity was obtained after only 12 PSI-BLAST iterations. In another example, several iterations of PSI-BLAST were required to demonstrate that a gene predicted in the genome of Alcelaphine herpesvirus 1 encodes a BALF1-like protein which is thought to be involved in apoptosis regulation and, potentially, carcinogenesis. New predictions were used to refine annotations of viral genomes in the RefSeq collection curated by the National Center for Biotechnology Information. Importantly, even in those cases where no sequence similarities were detected, GeneMarkS significantly reduced the number of primary targets for experimental characterization by identifying the most probable candidate genes. The new genome annotations were stored in VIOLIN, an interactive database which provides access to similarity search tools for up-to-date analysis of predicted viral proteins.

Mills, Ryan; Rozanov, Michael; Lomsadze, Alexandre; Tatusova, Tatiana; Borodovsky, Mark

2003-01-01

403

Viral/plasmid captures in Crenarchaea.  

PubMed

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3'-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3'-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities. PMID:23659319

Das, Smarajit; Mitra, Sanga; Sahoo, Satyabrata; Chakrabarti, Jayprokas

2013-05-10

404

Liver disease during pregnancy: acute viral hepatitis.  

PubMed

Acute viral hepatitis is the most common cause of jaundice in pregnancy. The course of most viral hepatitis infections (e.g., hepatitis A, B, C and D) is unaffected by pregnancy, however, a more severe course of viral hepatitis in pregnancy has been observed in patients with hepatitis E. Notwithstanding, opinions differ over the maternal and fetal outcome of pregnancy associated with viral hepatitis. While some authors reported that acute viral hepatitis carries a high risk for both mother and fetus others conclude that non-fulminant viral hepatitis did not influence the course of pregnancy or fetal well-being. Rate of transmission of the virus during pregnancy depends on the virus. For instance, intra-utero transmission of hepatitis A virus is very rare, but perinatal transmission could occur. Conversely sixty percent of pregnant women who acquire acute HBV infections at or near delivery will transmit the HBV virus to their offspring and mother to child transmission of hepatitis E virus infection was established between 33.3 and 50%. Breast-feeding is not contra-indicated in women infected with the hepa-titis A, E or C. However, for acute hepatitis B, with appropriate immunoprophylaxis, including hepatitis B immune globulin and hepatitis B vaccine, breast-feeding of infants of HBV infected mother's poses no additional risk for the transmission of the hepatitis B virus. Finally, whether live or inactivated vaccines are used, vaccination of pregnant women should be considered on the basis of risks versus benefits. Pregnant women who think they may have been exposed to hepatitis B may be given and hepatitis B immunoglobulin (ideally within 72 hours of exposure), as well as the hepatitis B vaccine. PMID:17060891

Sookoian, Silvia

405

Viral infections of the choroid and retina.  

PubMed

DNA (herpes viruses) and RNA (rubella, rubeola) group viruses are recognized causes of viral retinitis. Severe damage is often the result, not only because the viruses have a cytologic effect but also because the antigens may cause immune complex deposition that results in vasculitis. Most of the viral retinitides are associated with systemic disease; immune-compromised individuals are more susceptible than healthy individuals. A distinct clinical entity, acute retinal necrosis, affects the eye only in healthy individuals and is associated with the herpes family of viruses. PMID:1460268

Weiter, J J; Roh, S

1992-12-01

406

[Acute viral meningitis and encephalitis in children].  

PubMed

Both viral meningitis and encephalitis in infants and children give clinical features of various severity. The mechanism of viral encephalitis varies from CNS cellular destruction, immune or oedematous process. The clinical and EEG features of herpes encephalitis in the child are usually well recognizable. CSF characteristics are important for differential diagnosis. Management therapy includes anti-oedema treatment, prevention or cure of seizures. Passive immunisation against rubella, rubeola and measles is the best prevention therapy for post-infectious encephalitis. Herpes encephalitis prognosis has improved with acyclovir therapy. In France, mortality due to post-infectious encephalitis is estimated below 5% and sequellae below 20%. PMID:2836787

Tardieu, M

1987-01-01

407

Alzheimer's disease gene signature says: beware of brain viral infections  

PubMed Central

Background Recent findings from a genome wide association investigation in a large cohort of patients with Alzheimer's disease (AD) and non demented controls (CTR) showed that a limited set of genes was in a strong association (p > l0-5) with the disease. Presentation of the hypothesis In this report we suggest that the polymorphism association in 8 of these genes is consistent with a non conventional interpretation of AD etiology. Nectin-2 (NC-2), apolipoprotein E (APOE), glycoprotein carcinoembryonic antigen related cell adhesion molecule- 16 (CEACAM-16), B-cell lymphoma-3 (Bcl-3), translocase of outer mitochondrial membrane 40 homolog (T0MM-40), complement receptor-1 (CR-l), APOJ or clusterin and C-type lectin domain A family-16 member (CLEC-16A) result in a genetic signature that might affect individual brain susceptibility to infection by herpes virus family during aging, leading to neuronal loss, inflammation and amyloid deposition. Implications of the hypothesis We hypothesized that such genetic trait may predispose to AD via complex and diverse mechanisms each contributing to an increase of individual susceptibility to brain viral infections

2010-01-01

408

Genetic Mapping  

MedlinePLUS

... Resources Genetics 101 New Horizons and Research Patient Management Policy and Ethics Issues Quick Links for Patient Care Education All About the Human Genome Project Fact Sheets Genetic Education Resources for Teachers Genomic Careers NHGRI Webinar Series National ...

409

Genetic heterogeneity of hepatocellular carcinoma  

SciTech Connect

The authors studied 80 hepatocellular carcinomas from three continents for p53 gene (TP53) mutations and hepatitis B virus (HBV) sequences. p53 mutations were frequent in tumors from Mozambique but not in tumors from South Africa, China, and Germany. Independent of geographic origin, most tumors were positive for HBV sequences. X gene coding sequences of HBV were detected in 78% of tumors, whereas viral sequences in the surface antigen- and core antigen-encoding regions were present in less than 35% of tumors. These observations indicate that hepatocellular carcinomas are genetically heterogeneous. Mozambican-types of hepatocellular carcinomas are characterized by a high incidence of p53 mutations related to aflatoxins. In other tumors, the rarity of p53 mutations combined with the frequent presence of viral X gene coding sequences suggests a possible interference of HBV with the wild-type p53 function.

Unsal, H.; Isselbacher, K.J. (Massachusetts General Hospital Cancer Center, Charlestown, MA (United States)); Yakicier, C.; Marcais, C.; Ozturk, M. (Institut National de la Sante et de la Recherche Medicale, Lyon (France)); Kew, M. (Univ. of Witwatersrand, Johannesburg (South Africa)); Volkmann, M. (Univ. of Heidelberg (Germany)); Zentgraf, H. (Deutsches Krebsforschungszentrum, Heidelberg (Germany))

1994-01-18

410

Viral Loads in Clinical Specimens and SARS Manifestations  

PubMed Central

A retrospective viral load study was performed on clinical specimens from 154 patients with laboratory-confirmed severe acute respiratory syndrome (SARS); the specimens were prospectively collected during patients' illness. Viral load in nasopharyngeal aspirates (n = 142) from day 10 to day 15 after onset of symptoms was associated with oxygen desaturation, mechanical ventilation, diarrhea, hepatic dysfunction, and death. Serum viral load (n = 53) was associated with oxygen desaturation, mechanical ventilation, and death. Stool viral load (n = 94) was associated with diarrhea, and urine viral load (n = 111) was associated with abnormal urinalysis results. Viral replications at different sites are important in the pathogenesis of clinical and laboratory abnormalities of SARS.

Hung, I.F.N.; Cheng, V.C.C.; Wu, A.K.L.; Tang, B.S.F.; Chan, K.H.; Chu, C.M.; Wong, M.M.L.; Hui, W.T.; Poon, L.L.M.; Tse, D.M.W.; Chan, K.S.; Woo, P.C.Y.; Lau, S.K.P.; Peiris, J.S.M.

2004-01-01

411

Genetic screening.  

PubMed

The family planning nurse practitioner may be the client's only link to genetic screening, education, and counseling. The principles of genetics, the types of genetic defects and their causes are presented. Clients at risk and the nurse practitioner's role in providing education, support, counseling, and referrals are discussed. PMID:6562263

Worthington, S

412

Genetic programming  

Microsoft Academic Search

The paper presents essays on genetic programming which involve topics such as: the artificial evolution of computer code, human-competitive machine intelligence by means of genetic programming, GP as automatic programming, GP application, the evolution of arbitrary computational processes and the art of genetic programming

Wolfgang Banzhaf; J. R. Koza; C. Ryan; L. Spector; C. Jacob

2000-01-01

413

Imaging Genetics  

ERIC Educational Resources Information Center

|Imaging genetics is an experimental strategy that integrates molecular genetics and neuroimaging technology to examine biological mechanisms that mediate differences in behavior and the risks for psychiatric disorder. The basic principles in imaging genetics and the development of the field are discussed.|

Munoz, Karen E.; Hyde, Luke W.; Hariri, Ahmad R.

2009-01-01

414

Genetic Testing  

MedlinePLUS

... What you need to know Noninvasive prenatal testing Prenatal genetic screening: Is it right for you? Prevention strategies, screening ... Grody WW, et al. ACMG position statement on prenatal/preconception expanded ... Medical Genetics and Genomics. Genetics in Medicine. In press. Accessed ...

415

Genetic Screening  

NSDL National Science Digital Library

Many genetic disorders can be detected with tests of blood and chromosomes. Genetic screening is the large-scale use of these tests as part of the public health program. Different members of society, worldwide, have advocated genetic screening to achieve different goals. This chapter provides a critical analysis of this controversial issue.

Slesnick, Irwin

2004-01-01

416

[Genetic counselling].  

PubMed

'Genetic counselling is the process by which patients or relatives at risk of a disorder that may be hereditary are advised of the consequences of the disorder, the probability of developing and transmitting it and of the ways in which this may be prevented or ameliorated.' The genetic counsellor will discuss the genetic basis and medical facts and also possible personal, familial, social and insurance implications of the respective disorder with the consultand. Further diagnostic investigations, such as genetic tests, may be helpful or necessary for risk predictions or may be required to reach a firm diagnosis. In asymptomatic individuals at risk for a late-onset genetic disorder genetic counselling is obligatory for predictive genetic testing. Genetic counselling also should be offered to symptomatic patients before a diagnostic test is performed. Thereby the patients might become aware in time about the personal, familial and social consequences of the test result that may exceed that of their actual illness. Due to medical confidentiality the geneticist is not allowed to contact other family members and to inform them about a familial disorder and warn them about their own genetic risk. This is the concern of the consultand. Various aspects make up genetic counselling as a specific process which concerns genetic diagnosis, risk estimation and accurate information on medical and genetic facts, but also has a supportive role ensuring that consultands may benefit from given advice and possible preventive measures. PMID:16035385

Rehder, Helga

2005-06-01

417

VIRAL GASTROENTERITIS AGENTS AND WATERBORNE DISEASE  

EPA Science Inventory

The application of electron microscopic techniques in the study of human gastroenteritis led in the 1970's to the identification of new viral agents that had previously escaped detection by routine cell culture procedures. These agents have been the focus of study by researchers ...

418

DIARREA VIRAL BOVINA: PATOGÉNESIS E INMUNOPATOLOGÍA  

Microsoft Academic Search

Bovine viral diarrhea (BVD) represents a problem of worldwide causing considerable losses so much in meat livestock as in dairy herds, affecting it in diverse ways, which are subordinated to the age of the animal, immunologic state and moment of gestation, in which the infection takes place. BVD is caused by RNA virus, gender Pestivirus, family Flaviviridae, which has been

Iang Rondón

2006-01-01

419

Viral Immunotherapy to Eradicate Subclinical Brain Metastases.  

National Technical Information Service (NTIS)

To establish an animal model of breast cancer metastases to the brain and to use this model to demonstrate that anti-tumor host memory T-cells can be re-activated to enter and destroy early BM by viral infection of Her2-positive breast BM by a recombinant...

I. Bergman

2012-01-01

420

Risk factors for bovine viral diarrhea infection  

Microsoft Academic Search

Bovine viral diarrhea virus (BLVD.) causes a wide range of clinical signs in both dairy and beef cattle including: infertility, abortions, decreased production and increased incidence of respiratory infections. Due to the economical losses caused by BVDV in many countries, several countries of the European Union have established successful control and eradication programs and recently BVDV was included on the

Maria E Negron

2009-01-01

421

Shape transformation of viral capsids and HIV  

NASA Astrophysics Data System (ADS)

We present a continuum description of the shape transformation of viral capsids. The cone-like HIV virus is shown to be an thermodynamic stable shape, intermediate between icosahedral and sphero-cylinder capsid shapes. A generalized Caspar-Klug classification is introduced to describe spherical, conical and cylinderical shapes of virus.

Nguyen, Toan

2005-03-01

422

Engineering targeted viral vectors for gene therapy  

Microsoft Academic Search

To achieve therapeutic success, transfer vehicles for gene therapy must be capable of transducing target cells while avoiding impact on non-target cells. Despite the high transduction efficiency of viral vectors, their tropism frequently does not match the therapeutic need. In the past, this lack of appropriate targeting allowed only partial exploitation of the great potential of gene therapy. Substantial progress

Reinhard Waehler; Stephen J. Russell; David T. Curiel

2007-01-01

423

Differentiating bacterial from viral pneumonias in children  

Microsoft Academic Search

58 paediatric patients with pneumonia, in whom an etiological agent had been isolated, were reviewed. The patients were designated to have either viral or bacterial pneumonia on the basis of proposed clinical and radiological criteria. These presumed diagnoses were then compared to the microbiologically proven diagnosis. When clinical features suggested a bacterial infection the chance of isolating a bacteria as

F. A. L. Bettenay; J. F. de Campo; D. B. McCrossin

1988-01-01

424

VIRAL SEQUENCES INTEGRATED INTO PLANT GENOMES  

Microsoft Academic Search

? Abstract Sequences of various DNA plant viruses have been found,integrated into the host genome. There are two forms of integrant, those that can form episomal viral infections and those that cannot. Integrants of three pararetroviruses, Banana streak virus (BSV), Tobacco vein clearing virus(TVCV), and Petunia vein clearing virus (PVCV), can generate episomal infections in certain hybrid plant hosts in

Glyn Harper; Roger Hull; Ben Lockhart; Neil Olszewski

2002-01-01

425

Viral marketing: Motivations to forward online content  

Microsoft Academic Search

Despite the increasing popularity of viral marketing, factors critical to such a new communication medium remain largely unknown. This paper examines one of the critical factors, namely Internet users' motivations to pass along online content. Conceptualizing the act of forwarding online content as a special case of a more general communication behavior, we identify four potential motivations: (1) the need

Jason Y. C. Ho; Melanie Dempsey

2010-01-01

426

Virality, Network Effects and Advertising Effectiveness  

Microsoft Academic Search

Many video ads are designed to go viral, so that the total number of views they receive depends on customers sharing the ads with their friends. This paper explores the relationship between achieving this endogenous reach and the effectiveness of the ad at persuading a consumer to purchase or adopt a favorable attitude towards a product. The analysis combines data

Catherine Tucker

2011-01-01

427

STUDIES OF WATERBORNE AGENTS OF VIRAL GASTROENTERITIS  

EPA Science Inventory

The etiologic agent of a large outbreak of waterborne viral gastroenteritis was detected employing immune electron microscopy (IEM) and a newly developed solid phase radioimmunoassay (RIA). This agent, referred to as the Snow Mountain Agent (SMA), is 27-32 nm. in diameter, has cu...

428

Characterization of the Viral Microbiome in Patients with Severe Lower Respiratory Tract Infections, Using Metagenomic Sequencing  

PubMed Central

The human respiratory tract is heavily exposed to microorganisms. Viral respiratory tract pathogens, like RSV, influenza and rhinoviruses cause major morbidity and mortality from respiratory tract disease. Furthermore, as viruses have limited means of transmission, viruses that cause pathogenicity in other tissues may be transmitted through the respiratory tract. It is therefore important to chart the human virome in this compartment. We have studied nasopharyngeal aspirate samples submitted to the Karolinska University Laboratory, Stockholm, Sweden from March 2004 to May 2005 for diagnosis of respiratory tract infections. We have used a metagenomic sequencing strategy to characterize viruses, as this provides the most unbiased view of the samples. Virus enrichment followed by 454 sequencing resulted in totally 703,790 reads and 110,931 of these were found to be of viral origin by using an automated classification pipeline. The snapshot of the respiratory tract virome of these 210 patients revealed 39 species and many more strains of viruses. Most of the viral sequences were classified into one of three major families; Paramyxoviridae, Picornaviridae or Orthomyxoviridae. The study also identified one novel type of Rhinovirus C, and identified a number of previously undescribed viral genetic fragments of unknown origin.

Lysholm, Fredrik; Wetterbom, Anna; Lindau, Cecilia; Darban, Hamid; Bjerkner, Annelie; Fahlander, Kristina; Lindberg, A. Michael; Persson, Bengt; Allander, Tobias; Andersson, Bjorn

2012-01-01

429

The Viral Replication Complex Is Associated with the Virulence of Newcastle Disease Virus?  

PubMed Central

Virulent strains of Newcastle disease virus ([NDV] also known as avian paramyxovirus type 1) can be discriminated from low-virulence strains by the presence of multiple basic amino acid residues at the proteolytic cleavage site of the fusion (F) protein. However, some NDV variants isolated from pigeons (pigeon paramyxovirus type 1 [PPMV-1]) have low levels of virulence, despite the fact that their F protein cleavage sites contain a multibasic amino acid sequence and have the same functionality as that of virulent strains. To determine the molecular basis of this discrepancy, we examined the role of the internal proteins in NDV virulence. Using reverse genetics, the genes encoding the nucleoprotein (NP), phosphoprotein (P), matrix protein (M), and large polymerase protein (L) were exchanged between the nonvirulent PPMV-1 strain AV324 and the highly virulent NDV strain Herts. Recombinant viruses were evaluated for their pathogenicities and replication levels in day-old chickens, and viral genome replication and plaque sizes were examined in cell culture monolayers. We also tested the contributions of the individual NP, P, and L proteins to the activity of the viral replication complex in an in vitro replication assay. The results showed that the replication proteins of Herts are more active than those of AV324 and that the activity of the viral replication complex is directly related to virulence. Although the M protein affected viral replication in vitro, it had only a minor effect on virulence.

Dortmans, J. C. F. M.; Rottier, P. J. M.; Koch, G.; Peeters, B. P. H.

2010-01-01

430

Integrating Phylodynamics and Epidemiology to Estimate Transmission Diversity in Viral Epidemics  

PubMed Central

The epidemiology of chronic viral infections, such as those caused by Hepatitis C Virus (HCV) and Human Immunodeficiency Virus (HIV), is affected by the risk group structure of the infected population. Risk groups are defined by each of their members having acquired infection through a specific behavior. However, risk group definitions say little about the transmission potential of each infected individual. Variation in the number of secondary infections is extremely difficult to estimate for HCV and HIV but crucial in the design of efficient control interventions. Here we describe a novel method that combines epidemiological and population genetic approaches to estimate the variation in transmissibility of rapidly-evolving viral epidemics. We evaluate this method using a nationwide HCV epidemic and for the first time co-estimate viral generation times and superspreading events from a combination of molecular and epidemiological data. We anticipate that this integrated approach will form the basis of powerful tools for describing the transmission dynamics of chronic viral diseases, and for evaluating control strategies directed against them.

Magiorkinis, Gkikas; Sypsa, Vana; Magiorkinis, Emmanouil; Paraskevis, Dimitrios; Katsoulidou, Antigoni; Belshaw, Robert; Fraser, Christophe; Pybus, Oliver George; Hatzakis, Angelos

2013-01-01

431

Low Budget Biology: Genetics Unit.  

ERIC Educational Resources Information Center

Some concepts in genetics are difficult for many students to understand. This document provides hands-on, cost efficient, fun activities for students to help them better understand abstract concepts in genetics. Each activity includes: purpose, introduction, materials, procedures, results and conclusion. Some of the topics explored are: (1)…

Wartski, Bert; Wartski, Lynn Marie

432

Low Budget Biology: Genetics Unit.  

ERIC Educational Resources Information Center

|Some concepts in genetics are difficult for many students to understand. This document provides hands-on, cost efficient, fun activities for students to help them better understand abstract concepts in genetics. Each activity includes: purpose, introduction, materials, procedures, results and conclusion. Some of the topics explored are: (1)…

Wartski, Bert; Wartski, Lynn Marie

433

Viral Loads and Duration of Viral Shedding in Adult Patients Hospitalized with Influenza  

Microsoft Academic Search

5.06 ? 1.85 3.62 ? 2.13 P p .005 +0.03 to +1.68)). Viral RNA concentration demonstrated a nonlinear decrease with time; 26% of oseltamivir- treated and 57% of untreated patients had RNA detected at 1 week after symptom onset. Oseltamivir started on or before symptom day 4 was independently associated with an accelerated decrease in viral RNA concentration (mean b

Nelson Lee; Eric Wong

2009-01-01

434

Dengue virus therapeutic intervention strategies based on viral, vector and host factors involved in disease pathogenesis.  

PubMed

Dengue virus (DV) is the most widespread arbovirus, being endemic in over 100 countries, and is estimated to cause 50 million infections annually. Viral factors, such as the genetic composition of the virus strain can play a role in determining the virus virulence and subsequent clinical disease severity. Virus vector competence plays an integral role in virus transmission and is a critical factor in determining the severity and impact of DV outbreaks. Host genetic variations in immune-related genes, including the human leukocyte antigen, have also been shown to correlate with clinical disease and thus may play a role in regulating disease severity. The host's immune system, however, appears to be the primary factor in DV pathogenesis with the delicate interplay of innate and acquired immunity playing a crucial role. Although current research of DV pathogenesis has been limited by the lack of an appropriate animal model, the development of DV therapeutics has been a primary focus of research groups around the world. In the past decade advances in both the development of vaccines and anti-virals have increased in dramatically. This review summarises the current understanding of viral, vector and host factors which contribute to dengue virus pathogenesis and how this knowledge is critically important in the development of pharmaceutical interventions. PMID:23103333

Herrero, Lara J; Zakhary, Andrew; Gahan, Michelle E; Nelson, Michelle A; Herring, Belinda L; Hapel, Andrew J; Keller, Paul A; Obeysekera, Maheshi; Chen, Weiqiang; Sheng, Kuo-Ching; Taylor, Adam; Wolf, Stefan; Bettadapura, Jayaram; Broor, Shobha; Dar, Lalit; Mahalingam, Suresh

2012-10-26