Science.gov

Sample records for 1-aminocyclopropane-1-carboxylate synthase gene

  1. Isolation and molecular characterization of 1-aminocyclopropane-1-carboxylic acid synthase genes in Hevea brasiliensis.

    PubMed

    Zhu, Jia-Hong; Xu, Jing; Chang, Wen-Jun; Zhang, Zhi-Li

    2015-01-01

    Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1-7) of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production. PMID:25690030

  2. Differential expression of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits.

    PubMed Central

    Olson, D C; White, J A; Edelman, L; Harkins, R N; Kende, H

    1991-01-01

    1-Aminocyclopropane-1-carboxylate synthase (ACC synthase; S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) is the regulated enzyme in the biosynthetic pathway of the plant hormone ethylene. A full-length cDNA encoding this enzyme has been cloned from tomato fruits [Van Der Straeten, D., Van Wiemeersch, L., Goodman, H. M. & Van Montagu, M. Proc. Natl. Acad. Sci. USA (1990) 87, 4859-4863]. We report here the complete nucleotide and derived amino acid sequences of a cDNA encoding a second isoform of ACC synthase from tomato fruits. The cDNAs coding for both isoforms contain highly conserved regions that are surrounded by regions of low homology, especially at the 5' and 3' ends. Gene-specific probes were constructed to examine the expression of transcripts encoding the two ACC synthase isoforms under two conditions of enhanced ethylene formation--namely, during fruit ripening and in response to mechanical stress (wounding). The level of mRNA encoding both isoforms, ACC synthase 1 and 2, increased during ripening. In contrast, wounding caused an increase in only the level of mRNA coding for ACC synthase 1. Blot analysis of genomic DNA digested with restriction enzymes confirmed that ACC synthase 1 and 2 are encoded by different genes. Images PMID:1711229

  3. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    PubMed

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. PMID:26839981

  4. Molecular cloning and expression analysis of an 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    PubMed

    Shi, Le-Song; Liu, Jin-Ping

    2016-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) is a rate-limiting enzyme in the biosynthesis of ethylene which regulates many aspects of the plant development and responses to biotic and abiotic stresses. In this study, a full-length cDNA of ACC synthase, OnACS2, was cloned from the senescing flower of Oncidium Gower Ramsey by RACE. The full-length cDNA of OnACS2 (GenBank accession no. JQ822087) was 1557 bp in length with an open reading frame (ORF) of 1308 bp encoding for a protein of 435 amino acid residues. The predicted OnACS2 protein had a molecular mass of 49.1 kDa with pI value of 7.51. Phylogenetic analysis indicated its evolutionary relationships with corresponding orthologous sequences in orchids, Hosta ventricosa and monocots. Real-time PCR assay demonstrated that OnACS2 was constitutively expressed in all tested organs with the highest transcript level in the gynandria. Differential expression pattern of OnACS2 gene correlated to the ethylene production and the subsequent occurrence of senescent symptoms in flower suggested that OnACS2 probably played an important role in the initiation of flower senescence. PMID:26631967

  5. Three 1-Aminocyclopropane-1-Carboxylate Synthase Genes Regulated by Primary and Secondary Pollination Signals in Orchid Flowers1

    PubMed Central

    Bui, Anhthu Q.; Neill, Sharman D. O'

    1998-01-01

    The temporal and spatial expression patterns of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes were investigated in pollinated orchid (Phalaenopsis spp.) flowers. Pollination signals initiate a cascade of development events in multiple floral organs, including the induction of ethylene biosynthesis, which coordinates several postpollination developmental responses. The initiation and propagation of ethylene biosynthesis is regulated by the coordinated expression of three distinct ACC synthase genes in orchid flowers. One ACC synthase gene (Phal-ACS1) is regulated by ethylene and participates in amplification and interorgan transmission of the pollination signal, as we have previously described in a related orchid genus. Two additional ACC synthase genes (Phal-ACS2 and Phal-ACS3) are expressed primarily in the stigma and ovary of pollinated orchid flowers. Phal-ACS2 mRNA accumulated in the stigma within 1 h after pollination, whereas Phal-ACS1 mRNA was not detected until 6 h after pollination. Similar to the expression of Phal-ACS2, the Phal-ACS3 gene was expressed within 2 h after pollination in the ovary. Exogenous application of auxin, but not ACC, mimicked pollination by stimulating a rapid increase in ACC synthase activity in the stigma and ovary and inducing Phal-ACS2 and Phal-ACS3 mRNA accumulation in the stigma and ovary, respectively. These results provide the basis for an expanded model of interorgan regulation of three ACC synthase genes that respond to both primary (Phal-ACS2 and Phal-ACS3) and secondary (Phal-ACS1) pollination signals. PMID:9449850

  6. Three 1-aminocyclopropane-1-carboxylate synthase genes regulated by primary and secondary pollination signals in orchid flowers.

    PubMed

    Bui, A Q; O'Neill, S D

    1998-01-01

    The temporal and spatial expression patterns of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes were investigated in pollinated orchid (Phalaenopsis spp.) flowers. Pollination signals initiate a cascade of development events in multiple floral organs, including the induction of ethylene biosynthesis, which coordinates several postpollination developmental responses. The initiation and propagation of ethylene biosynthesis is regulated by the coordinated expression of three distinct ACC synthase genes in orchid flowers. One ACC synthase gene (Phal-ACS1) is regulated by ethylene and participates in amplification and interorgan transmission of the pollination signal, as we have previously described in a related orchid genus. Two additional ACC synthase genes (Phal-ACS2 and Phal-ACS3) are expressed primarily in the stigma and ovary of pollinated orchid flowers. Phal-ACS2 mRNA accumulated in the stigma within 1 h after pollination, whereas Phal-ACS1 mRNA was not detected until 6 h after pollination. Similar to the expression of Phal-ACS2, the Phal-ACS3 gene was expressed within 2 h after pollination in the ovary. Exogenous application of auxin, but not ACC, mimicked pollination by stimulating a rapid increase in ACC synthase activity in the stigma and ovary and inducing Phal-ACS2 and Phal-ACS3 mRNA accumulation in the stigma and ovary, respectively. These results provide the basis for an expanded model of interorgan regulation of three ACC synthase genes that respond to both primary (Phal-ACS2 and Phal-ACS3) and secondary (Phal-ACS1) pollination signals. PMID:9449850

  7. Differential regulation of genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase in etiolated pea seedlings: effects of indole-3-acetic acid, wounding, and ethylene.

    PubMed

    Peck, S C; Kende, H

    1998-12-01

    Treatment of 5- to 6-day-old etiolated pea (Pisum sativum L.) seedlings with indole-3-acetic acid (IAA) induced within 15 min an increase in the transcript levels of two genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase, Ps-ACS1 and Ps-ACS2. Simultaneous treatment with ethylene inhibited this increase and also caused a decrease in ACC synthase enzyme activity as compared to that of seedlings treated with IAA alone. These results indicate that ethylene inhibits its own biosynthesis by decreasing ACC synthase transcript levels via a negative feedback loop. Wounding of pea stems had no effect on the expression of Ps-ACS1, but led within 10 min to an increase in the mRNA levels of Ps-ACS2. This increase was also inhibited by ethylene. The wound signal was transmitted over a distance of at least 4 cm through the stem with no delay in induction or response intensity. The rapid transmission of the wound response is consistent with the possibility that a hydraulic or electric signal is responsible for the spread of the wound response. PMID:9869404

  8. The promoter of LE-ACS7, an early flooding-induced 1-aminocyclopropane-1-carboxylate synthase gene of the tomato, is tagged by a Sol3 transposon

    PubMed Central

    Shiu, Oi Yin; Oetiker, Jürg H.; Yip, Wing Kin; Yang, Shang Fa

    1998-01-01

    Many terrestrial plants respond to flooding with enhanced ethylene production. The roots of flooded plants produce 1-aminocyclopropane-1-carboxylic acid (ACC), which is transported from the root to the shoot, where it is converted to ethylene. In the roots, ACC is synthesized by ACC synthase, which is encoded by a multigene family. Previously, we identified two ACC synthase genes of tomato that are involved in flooding-induced ethylene production. Here, we report the cloning of LE-ACS7, a new tomato ACC synthase with a role early during flooding but also in the early wound response of leaves. The promoter of LE-ACS7 is tagged by a Sol3 transposon. A Sol3 transposon is also present in the tomato polygalacturonase promoter to which it conferred regulatory elements. Thus, Sol3 transposons may affect the regulation of LE-ACS7 and may be involved in the communication between the root and the shoot of waterlogged tomato plants. PMID:9707648

  9. Identification of a 1-aminocyclopropane-1-carboxylic acid synthase gene linked to the female (F) locus that enhances female sex expression in cucumber.

    PubMed Central

    Trebitsh, T; Staub, J E; O'Neill, S D

    1997-01-01

    Sex determination in cucumber (Cucumis sativus L.) is controlled largely by three genes: F, m, and a. The F and m loci interact to produce monoecious (M_f_) or gynoecious (M_f_) sex phenotypes. Ethylene and factors that induce ethylene biosynthesis, such as 1-aminocyclopropane-1-carboxylate (ACC) and auxin, also enhance female sex expression. A genomic sequence (CS-ACS1) encoding ACC synthase was amplified from genomic DNA by a polymerase chain reaction using degenerate oligonucleotide primers. Expression of CS-ACS1 is induced by auxin, but not by ACC, in wounded and intact shoot apices. Southern blo hybridization analysis of near-isogenic gynoecious (MMFF) and monoecious (MMff) lines derived from divers genetic backgrounds revealed the existence of an additional ACC synthase (CS-ACS1G) genomic sequence in the gynoecious lines. Sex phenotype analysis of a segregating F2 population detected a 100% correlation between the CS-ACS1G marker and the presence of the F locus. The CS-ACS1G gene is located in linkage group B coincident with the F locus, and in the population tested there was no recombination between the CS-ACS1G gene and the F locus. Collectively, these data suggest that CS-ACS1G is closely linked to the F locus and may play a pivotal role in the determination of sex in cucumber flowers. PMID:9085580

  10. Differential Expression of 1-Aminocyclopropane-1-Carboxylate Synthase Genes during Orchid Flower Senescence Induced by the Protein Phosphatase Inhibitor Okadaic Acid1

    PubMed Central

    Wang, Ning Ning; Yang, Shang Fa; Charng, Yee-yung

    2001-01-01

    Applying 10 pmol of okadaic acid (OA), a specific inhibitor of type 1 or type 2A serine/threonine protein phosphatases, to the orchid (Phalaenopsis species) stigma induced a dramatic increase in ethylene production and an accelerated senescence of the whole flower. Aminoethoxyvinylglycine or silver thiosulfate, inhibitors of ethylene biosynthesis or action, respectively, effectively inhibited the OA-induced ethylene production and retarded flower senescence, suggesting that the protein phosphatase inhibitor induced orchid flower senescence through an ethylene-mediated signaling pathway. OA treatment induced a differential expression pattern for the 1-aminocyclopropane-1-carboxylic acid synthase multigene family. Accumulation of Phal-ACS1 transcript in the stigma, labelum, and ovary induced by OA were higher than those induced by pollination as determined by “semiquantitative” reverse transcriptase-polymerase chain reaction. In contrast, the transcript levels of Phal-ACS2 and Phal-ACS3 induced by OA were much lower than those induced by pollination. Staurosporine, a protein kinase inhibitor, on the other hand, inhibited the OA-induced Phal-ACS1 expression in the stigma and delayed flower senescence. Our results suggest that a hyper-phosphorylation status of an unidentified protein(s) is involved in up-regulating the expression of Phal-ACS1 gene resulting in increased ethylene production and accelerated the senescence process of orchid flower. PMID:11351088

  11. Differential Expression and Internal Feedback Regulation of 1-Aminocyclopropane-1-Carboxylate Synthase, 1-Aminocyclopropane-1-Carboxylate Oxidase, and Ethylene Receptor Genes in Tomato Fruit during Development and Ripening1

    PubMed Central

    Nakatsuka, Akira; Murachi, Shiho; Okunishi, Hironori; Shiomi, Shinjiro; Nakano, Ryohei; Kubo, Yasutaka; Inaba, Akitsugu

    1998-01-01

    We investigated the feedback regulation of ethylene biosynthesis in tomato (Lycopersicon esculentum) fruit with respect to the transition from system 1 to system 2 ethylene production. The abundance of LE-ACS2, LE-ACS4, and NR mRNAs increased in the ripening fruit concomitant with a burst in ethylene production. These increases in mRNAs with ripening were prevented to a large extent by treatment with 1-methylcyclopropene (MCP), an ethylene action inhibitor. Transcripts for the LE-ACS6 gene, which accumulated in preclimacteric fruit but not in untreated ripening fruit, did accumulate in ripening fruit treated with MCP. Treatment of young fruit with propylene prevented the accumulation of transcripts for this gene. LE-ACS1A, LE-ACS3, and TAE1 genes were expressed constitutively in the fruit throughout development and ripening irrespective of whether the fruit was treated with MCP or propylene. The transcripts for LE-ACO1 and LE-ACO4 genes already existed in preclimacteric fruit and increased greatly when ripening commenced. These increases in LE-ACO mRNA with ripening were also prevented by treatment with MCP. The results suggest that in tomato fruit the preclimacteric system 1 ethylene is possibly mediated via constitutively expressed LE-ACS1A and LE-ACS3 and negatively feedback-regulated LE-ACS6 genes with preexisting LE-ACO1 and LE-ACO4 mRNAs. At the onset of the climacteric stage, it shifts to system 2 ethylene, with a large accumulation of LE-ACS2, LE-ACS4, LE-ACO1, and LE-ACO4 mRNAs as a result of a positive feedback regulation. This transition from system 1 to system 2 ethylene production might be related to the accumulated level of NR mRNA. PMID:9847103

  12. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress.

    PubMed

    Datta, Riddhi; Kumar, Deepak; Sultana, Asma; Hazra, Saptarshi; Bhattacharyya, Dipto; Chattopadhyay, Sharmila

    2015-12-01

    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress. PMID:26463088

  13. Expression characteristics of CS-ACS1, CS-ACS2 and CS-ACS3, three members of the 1-aminocyclopropane-1-carboxylate synthase gene family in cucumber (Cucumis sativus L.) fruit under carbon dioxide stress.

    PubMed

    Mathooko, F M; Mwaniki, M W; Nakatsuka, A; Shiomi, S; Kubo, Y; Inaba, A; Nakamura, R

    1999-02-01

    We investigated the expression pattern of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes, CS-ACS1, CS-ACS2 and CS-ACS3 in cucumber (Cucumis sativus L.) fruit under CO2 stress. CO2 stress-induced ethylene production paralleled the accumulation of only CS-ACS1 transcripts which disappeared upon withdrawal of CO2. Cycloheximide inhibited the CO2 stress-induced ethylene production but superinduced the accumulation of CS-ACS1 transcript. At higher concentrations, cycloheximide also induced the accumulation of CS-ACS2 and CS-ACS3 transcripts. In the presence of CO2 and cycloheximide, the accumulation of CS-ACS2 transcript occurred within 1 h, disappeared after 3 h and increased greatly upon withdrawal of CO2. Inhibitors of protein kinase and types 1 and 2A protein phosphatases which inhibited and stimulated, respectively, CO2 stress-induced ethylene production had little effect on the expression of these genes. The results presented here identify CS-ACS1 as the main ACC synthase gene responsible for the increased ethylene biosynthesis in cucumber fruit under CO2 stress and suggest that this gene is a primary response gene and its expression is under negative control since it is expressed by treatment with cycloheximide. The results further suggest that the regulation of CO2 stress-induced ethylene biosynthesis by reversible protein phosphorylation does not result from enhanced ACC synthase transcription. PMID:10202812

  14. Characterization of cultivar differences in alcohol acyltransferase and 1-aminocyclopropane-1carboxylate synthase gene expression and volatile compound emission during apple fruit maturation and ripening

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alcohol acyl transferase (AAT) catalyzes the last step of volatile ester biosynthesis, and ethylene purportedly regulates AAT gene expression. In this study, expession patterns of four apple AAT genes and two ethylene biosynthesis genes were investigated in two apple cultivars with relatively high ...

  15. Characterization of Alcohol Acyl Transferase and 1-Aminocyclopropane-1-Carboxylate Synthase Gene Expression and Volatile Compound Emission during Apple Fruit Development and Ripening

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alcohol acyl transferase (AAT) catalyzes the last step of volatile ester biosynthesis, and in this study, expression of four apple AAT genes was investigated in the peel of two apple cultivars with relatively high (‘Golden Delicious’) or low (‘Granny Smith’) volatile ester production. All four AAT ...

  16. Cloning and sequence of two different cDNAs encoding 1-aminocyclopropane-1-carboxylate synthase in tomato.

    PubMed

    Van der Straeten, D; Van Wiemeersch, L; Goodman, H M; Van Montagu, M

    1990-06-01

    1-Aminocyclopropane-1-carboxylate synthase (ACC synthase; S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14), the key enzyme in ethylene biosynthesis, was purified 5000-fold from induced tomato pericarp. ACC synthase activity was unambiguously correlated with a 45-kDa protein by two independent methods. Peptide sequences were obtained both from the N terminus after electroblotting and from tryptic peptides separated by reversed-phase chromatography. Mixed oligonucleotide probes were used to screen a lambda gt11 library prepared from RNA of induced pericarp tissue. Putative ACC synthase clones were isolated with a frequency of 0.01%. One of these contained a 1.9-kilobase insert with a single open reading frame encoding a polypeptide of 55 kDa. A second, partial cDNA clone was found that differed from the first one in 18% of its bases. Genomic Southern blotting suggests possible tandem organization of the two genes in tomato. The entire coding region was expressed in Escherichia coli and the denatured recombinant polypeptide was used to raise polyclonal antibodies. The antibody preparation both immunoinhibits and immunoprecipitates ACC synthase activity from an enriched tomato extract, confirming the identity of the clone. Northern blot analysis demonstrates that the ACC synthase messenger accumulation is coordinated with fruit ripening. PMID:2191304

  17. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  18. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress1[OPEN

    PubMed Central

    Kumar, Deepak; Hazra, Saptarshi; Chattopadhyay, Sharmila

    2015-01-01

    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress. PMID:26463088

  19. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  20. An insight into the sequential, structural and phylogenetic properties of banana 1-aminocyclopropane-1-carboxylate synthase 1 and study of its interaction with pyridoxal-5'-phosphate and aminoethoxyvinylglycine.

    PubMed

    Choudhury, Swarup Roy; Singh, Sanjay Kumar; Roy, Sujit; Sengupta, Dibyendu N

    2010-06-01

    In banana, ethylene production for ripening is accompanied by a dramatic increase in 1-aminocyclopropane-1-carboxylate (ACC) content, transcript level of Musa acuminata ACC synthase 1 (MA-ACS1) and the enzymatic activity of ACC synthase 1 at the onset of the climacteric period. MA-ACS1 catalyses the conversion of S-adenosyl-L-methionine (SAM) to ACC, the key regulatory step in ethylene biosynthesis. Multiple sequence alignments of 1-aminocyclopropane-1-carboxylate synthase (ACS) amino acid sequences based on database searches have indicated that MA-ACS1 is a highly conserved protein across the plant kingdom. This report describes an in silico analysis to provide the first important insightful information about the sequential, structural and phylogenetic characteristics of MA-ACS1. The three-dimensional structure of MA-ACS1, constructed based on homology modelling, in combination with the available data enabled a comparative mechanistic analysis of MA-ACS1 to explain the catalytic roles of the conserved and non-conserved active site residues. We have further demonstrated that, as in apple and tomato, banana- ACS1 (MA-ACS1) forms a homodimer and a complex with cofactor pyridoxal-5'-phosphate (PLP) and inhibitor aminoethoxyvinylglycine (AVG). We have also predicted that the residues from the PLP-binding pocket, essential for ligand binding, are mostly conserved across the MA-ACS1 structure and the competitive inhibitor AVG binds at a location adjacent to PLP. PMID:20689184

  1. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit. PMID:26460204

  2. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  3. Expression of apple 1-aminocyclopropane-1-carboxylate synthase in Escherichia coli: kinetic characterization of wild-type and active-site mutant forms.

    PubMed Central

    White, M F; Vasquez, J; Yang, S F; Kirsch, J F

    1994-01-01

    The pyridoxal phosphate-dependent enzyme 1-aminocyclopropane-1-carboxylate synthase (ACC synthase; S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) catalyzes the conversion of S-adenosylmethionine (AdoMet) to ACC and 5'-methylthioadenosine, the committed step in ethylene biosynthesis in plants. Apple ACC synthase was overexpressed in Escherichia coli (3 mg/liter) and purified to near homogeneity. A continuous assay was developed by coupling the ACC synthase reaction to the deamination of 5'-methylthioadenosine by adenosine deaminase (adenosine aminohydrolase, EC 3.5.4.4) from Aspergillus oryzae. The enzyme is dimeric, with kcat = 9s-1 per monomer and Km = 12 microM for AdoMet. The pyridoxal phosphate-binding site of ACC synthase appears to be highly homologous to that of aspartate aminotransferase, suggesting similar roles for corresponding residues. Site-directed mutagenesis of Lys-273, Arg-407, and Tyr-233 (corresponding to residues 258, 386, and 225 in aspartate aminotransferase) and kinetic analyses of the mutants confirms their importance in the ACC synthase mechanism. The Lys-273 to Ala mutant has no detectable activity, supporting the identification of this residue as the base catalyzing C alpha proton abstraction. Mutation of Arg-407 to Lys results in a precipitous drop in kcat/Km and an increase in Km for AdoMet of at least 20-fold, in accordance with its proposed role as principal ligand for the substrate alpha-carboxylate group. Replacement of Tyr-233 with Phe causes a 24-fold increase in the Km for AdoMet and no change in kcat, suggesting that this residue plays a role in orienting the pyridoxal phosphate cofactor in the active site. Images Fig. 4 PMID:7809054

  4. A Ser/Thr protein kinase phosphorylates MA-ACS1 (Musa acuminata 1-aminocyclopropane-1-carboxylic acid synthase 1) during banana fruit ripening.

    PubMed

    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N

    2012-08-01

    1-Aminocyclopropane-1-carboxylic acid synthase (ACS) catalyzes the rate-limiting step in ethylene biosynthesis during ripening. ACS isozymes are regulated both transcriptionally and post-translationally. However, in banana, an important climacteric fruit, little is known about post-translational regulation of ACS. Here, we report the post-translational modification of MA-ACS1 (Musa acuminata ACS1), a ripening inducible isozyme in the ACS family, which plays a key role in ethylene biosynthesis during banana fruit ripening. Immunoprecipitation analyses of phospholabeled protein extracts from banana fruit using affinity-purified anti-MA-ACS1 antibody have revealed phosphorylation of MA-ACS1, particularly in ripe fruit tissue. We have identified the induction of a 41-kDa protein kinase activity in pulp at the onset of ripening. The 41-kDa protein kinase has been identified as a putative protein kinase by MALDI-TOF/MS analysis. Biochemical analyses using partially purified protein kinase fraction from banana fruit have identified the protein kinase as a Ser/Thr family of protein kinase and its possible involvement in MA-ACS1 phosphorylation during ripening. In vitro phosphorylation analyses using synthetic peptides and site-directed mutagenized recombinant MA-ACS1 have revealed that serine 476 and 479 residues at the C-terminal region of MA-ACS1 are phosphorylated. Overall, this study provides important novel evidence for in vivo phosphorylation of MA-ACS1 at the molecular level as a possible mechanism of post-translational regulation of this key regulatory protein in ethylene signaling pathway in banana fruit during ripening. PMID:22419220

  5. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    PubMed Central

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  6. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  7. A Combinatorial Interplay Among the 1-Aminocyclopropane-1-carboxylate Isoforms Regulates Ethylene Biosynthesis in Arabidopsis thaliana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene (C2H4) is a unique plant-signaling molecule that regulates numerous developmental processes. The key enzyme in the two-step biosynthetic pathway of ethylene is 1-aminocyclopropane-1-carboxylate synthase (ACS), which catalyzes the conversion of Sadenosyl-methionine (AdoMet) to ACC, the precu...

  8. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.

    1999-01-01

    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  9. Expression of 1-aminocyclopropane-1-carboxylate oxidase during leaf ontogeny in white clover.

    PubMed

    Hunter, D A; Yoo, S D; Butcher, S M; McManus, M T

    1999-05-01

    We examined the expression of three distinct 1-aminocyclopropane-1-carboxylic acid oxidase genes during leaf ontogeny in white clover (Trifolium repens). Significant production of ethylene occurs at the apex, in newly initiated leaves, and in senescent leaf tissue. We used a combination of reverse transcriptase-polymerase chain reaction and 3'-rapid amplification of cDNA ends to identify three distinct DNA sequences designated TRACO1, TRACO2, and TRACO3, each with homology to 1-aminocyclopropane-1-carboxylic acid oxidase. Southern analysis confirmed that these sequences represent three distinct genes. Northern analysis revealed that TRACO1 is expressed specifically in the apex and TRACO2 is expressed in the apex and in developing and mature green leaves, with maximum expression in developing leaf tissue. The third gene, TRACO3, is expressed in senescent leaf tissue. Antibodies were raised to each gene product expressed in Escherichia coli, and western analysis showed that the TRACO1 antibody recognizes a protein of approximately 205 kD (as determined by gradient sodium dodecyl sulfate-polyacylamide gel electrophoresis) that is expressed preferentially in apical tissue. The TRACO2 antibody recognizes a protein of approximately 36.4 kD (as determined by gradient sodium dodecyl sulfate-polyacylamide gel electrophoresis) that is expressed in the apex and in developing and mature green leaves, with maximum expression in mature green tissue. No protein recognition by the TRACO3 antibody could be detected in senescent tissue or at any other stage of leaf development. PMID:10318691

  10. New Insights into 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Phylogeny, Evolution and Ecological Significance

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Soares, Cláudio R. F. S.; McConkey, Brendan J.; Glick, Bernard R.

    2014-01-01

    The main objective of this work is the study of the phylogeny, evolution and ecological importance of the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase, the activity of which represents one of the most important and studied mechanisms used by plant growth–promoting microorganisms. The ACC deaminase gene and its regulatory elements presence in completely sequenced organisms was verified by multiple searches in diverse databases, and based on the data obtained a comprehensive analysis was conducted. Strain habitat, origin and ACC deaminase activity were taken into account when analyzing the results. In order to unveil ACC deaminase origin, evolution and relationships with other closely related pyridoxal phosphate (PLP) dependent enzymes a phylogenetic analysis was also performed. The data obtained show that ACC deaminase is mostly prevalent in some Bacteria, Fungi and members of Stramenopiles. Contrary to previous reports, we show that ACC deaminase genes are predominantly vertically inherited in various bacterial and fungal classes. Still, results suggest a considerable degree of horizontal gene transfer events, including interkingdom transfer events. A model for ACC deaminase origin and evolution is also proposed. This study also confirms the previous reports suggesting that the Lrp-like regulatory protein AcdR is a common mechanism regulating ACC deaminase expression in Proteobacteria, however, we also show that other regulatory mechanisms may be present in some Proteobacteria and other bacterial phyla. In this study we provide a more complete view of the role for ACC deaminase than was previously available. The results show that ACC deaminase may not only be related to plant growth promotion abilities, but may also play multiple roles in microorganism's developmental processes. Hence, exploring the origin and functioning of this enzyme may be the key in a variety of important agricultural and biotechnological applications. PMID:24905353

  11. Isolation, characterization and colonization of 1-aminocyclopropane-1-carboxylate deaminase-producing bacteria XG32 and DP24.

    PubMed

    Wang, Mei-Xia; Liu, Jia; Chen, Shuang-Lin; Yan, Shu-Zhen

    2012-03-01

    Two 1-aminocyclopropane-1-carboxylate deaminase-producing bacterial strains (DP24 and XG32) were isolated from surface-sterilized tomato roots and rizhospere soil. The strains were identified as Pseudomonas fluorescens biovar. IV (XG2) and Erwinia herbicola (DP24) by physiological and biochemical tests, and 16S rRNA gene analysis. Both strains showed positive plant growth-promoting activity when inoculated into cucumber (Cucumis sativus), tomato (Lycopersicon esculentum), pepper (Capsicum annuum) and rapeseed (Brassica napus L.). Colonization ability and behavior of these two strains were determined by treating mutant strains with rifampicin and fluorescence in situ hybridization (FISH) assay with rRNA targeted probes, respectively. Both strains were endophytic colonizers of pepper plants. The behavior of the two strains was not identical. Strain XG32 only colonized the root and reached the max level of 27.7 × 10(7) c.f.u./g (fresh weight), after 12 days postinoculation, while strain DP24 was able to colonize the roots, stems and leaves. The max level was reached at 40.87 × 10(7) c.f.u./g (fresh weight) in the roots, 17 × 10(7) c.f.u./g in the stems after 7 days postinoculation and 44.84 × 10(7) c.f.u./g in the leaves after 12 days postinoculation. PMID:22805836

  12. 1-aminocyclopropane-1-carboxylic acid (ACC) in plants: more than just the precursor of ethylene!

    PubMed Central

    Van de Poel, Bram; Van Der Straeten, Dominique

    2014-01-01

    Ethylene is a simple two carbon atom molecule with profound effects on plants. There are quite a few review papers covering all aspects of ethylene biology in plants, including its biosynthesis, signaling and physiology. This is merely a logical consequence of the fascinating and pleiotropic nature of this gaseous plant hormone. Its biochemical precursor, 1-aminocyclopropane-1-carboxylic acid (ACC) is also a fairly simple molecule, but perhaps its role in plant biology is seriously underestimated. This triangularly shaped amino acid has many more features than just being the precursor of the lead-role player ethylene. For example, ACC can be conjugated to three different derivatives, but their biological role remains vague. ACC can also be metabolized by bacteria using ACC-deaminase, favoring plant growth and lowering stress susceptibility. ACC is also subjected to a sophisticated transport mechanism to ensure local and long-distance ethylene responses. Last but not least, there are now a few exciting studies where ACC has been reported to function as a signal itself, independently from ethylene. This review puts ACC in the spotlight, not to give it the lead-role, but to create a picture of the stunning co-production of the hormone and its precursor. PMID:25426135

  13. Purification and Characterization of 1-Aminocyclopropane-1-Carboxylic Acid N-Malonyltransferase from Tomato Fruit.

    PubMed Central

    Martin, M. N.; Saftner, R. A.

    1995-01-01

    1-Aminocyclopropane-1-carboxylic acid (ACC) can be oxidized to ethylene or diverted to the conjugate 1-(malonylamino)cyclopropane-1-carboxylic acid (MACC) by an ACC N-malonyltransferase. We developed a facile assay for the ACC N-malonyltransferase that resolved [14C]MACC from [14C]ACC by thin-layer chromatography and detected and quantified them using a radioisotope-imaging system. Using this assay, we showed that ACC N-malonyltransferase activity has developmental and tissue-specific patterns of expression in tomato (Lycopersicon esculentum) fruit. In the pericarp, activity was elevated for several days postanthesis, subsequently declined to a basal level, increased 3-fold at the onset of ripening, and again declined in overripe fruit. In the seed, activity increased throughout embryogenesis, maturation, and desiccation. Treatment of fruit with ethylene increased activity 50- to 100-fold in the pericarp. ACC N-malonyltransferase was purified 22,000-fold to a specific activity of 22,000 nmol min-1 mg-1 protein using ammonium sulfate precipitation, DyeMatrex Green A affinity, anion-exchange, Cibacron Blue 3GA affinity, hydrophobic interaction, and molecular filtration chromatography. Native and sodium dodecyl sulfate-denatured enzyme showed molecular masses of 38 kD, indicating that the enzyme exists as a monomer. The enzyme exhibited a Km for ACC of 500 [mu]M, was not inhibited by D- or L-amino acids, and did not conjugate [alpha]-aminoisobutyric acid or L-amino acids. PMID:12228541

  14. Characterization of plant growth promoting rhizobacteria isolated from polluted soils and containing 1-aminocyclopropane-1-carboxylate deaminase.

    PubMed

    Belimov, A A; Safronova, V I; Sergeyeva, T A; Egorova, T N; Matveyeva, V A; Tsyganov, V E; Borisov, A Y; Tikhonovich, I A; Kluge, C; Preisfeld, A; Dietz, K J; Stepanok, V V

    2001-07-01

    Fifteen bacterial strains containing 1-aminocyclopropane-1-carboxylate (ACC) deaminase were isolated from the rhizoplane of pea (Pisum sativum L.) and Indian mustard (Brassica juncea L.) grown in different soils and a long-standing sewage sludge contaminated with heavy metals. The isolated strains were characterized and assigned to various genera and species, such as Pseudomonas brassicacearum, Pseudomonas marginalis, Pseudomonas oryzihabitans, Pseudomonas putida, Pseudomonas sp., Alcaligenes xylosoxidans, Alcaligenes sp., Variovorax paradoxus, Bacillus pumilus, and Rhodococcus sp. by determination of 16S rRNA gene sequences. The root elongation of Indian mustard and rape (Brassica napus var. oleifera L.) germinating seedlings was stimulated by inoculation with 8 and 13 isolated strains, respectively. The bacteria were tolerant to cadmium toxicity and stimulated root elongation of rape seedlings in the presence of 300 microM CdCl2 in the nutrient solution. The effect of ACC-utilising bacteria on root elongation correlated with the impact of aminoethoxyvinylglycine and silver ions, chemical inhibitors of ethylene biosynthesis. A significant improvement in the growth of rape caused by inoculation with certain selected strains was also observed in pot experiments, when the plants were cultivated in cadmium-supplemented soil. The biomass of pea cv. Sparkle and its ethylene sensitive mutant E2 (sym5), in particular, was increased through inoculation with certain strains of ACC-utilising bacteria in pot experiments in quartz sand culture. The beneficial effect of the bacteria on plant growth varied significantly depending on individual bacterial strains, plant genotype, and growth conditions. The results suggest that plant growth promoting rhizobacteria containing ACC deaminase are present in various soils and offer promise as a bacterial inoculum for improvement of plant growth, particularly under unfavourable environmental conditions. PMID:11547884

  15. Transport and Metabolism of 1-Aminocyclopropane-1-carboxylic Acid in Sunflower (Helianthus annuus L.) Seedlings 1

    PubMed Central

    Finlayson, Scott A.; Foster, Kenneth R.; Reid, David M.

    1991-01-01

    Transport and metabolism of [2,3-14C] 1-aminocyclopropane-1-carboxylic acid (ACC) from roots to shoots in 4-day-old sunflower (Helianthus annuus L.) seedlings were studied. [14C]ACC was detected in, and 14C2H4 was evolved from, shoots 0.5 hours after [14C]ACC was supplied to roots. Ethylene emanation from the shoots returned to normal levels after 6 hours. The roots showed a similar pattern, although at 24 hours ethylene emanation was still slightly higher than in those plants that did not receive ACC. [14C]N-malonyl-ACC (MACC) was detected in both tissues at all times sampled. [14C]MACC levels surpassed [14C]ACC levels in the shoot at 2 hours, whereas [14C]MACC levels in the root remained below [14C]ACC levels until 6 hours, after which they were higher. Thin-layer chromatography analysis identified [14C] ACC in 1-hour shoot extracts, and [14C]MACC was identified in root tissues at 1 and 12 hours after treatment. [14C]ACC and [14C] MACC in the xylem sap of treated seedlings were identified by thin-layer chromatography. Xylem transport of [14C]ACC in treated seedlings, and transport of ACC in untreated seedlings, was confirmed by gas chromatography-mass spectrometry. Some evidence for the presence of [14C]MACC in xylem sap in [14C]ACC-treated seedlings is presented. A substantial amount of radioactivity in both ACC and MACC fractions was detected leaking from the roots over 24 hours. A second radiolabeled volatile compound was trapped in a CO2-trapping solution but not in mercuric perchlorate. Levels of this compound were highest after the peak of ACC levels and before peak MACC levels in both tissues, suggesting that an alternate pathway of ACC metabolism was operating in this system. PMID:16668342

  16. 1-Aminocyclopropane-1-Carboxylate Deaminase from Pseudomonas stutzeri A1501 Facilitates the Growth of Rice in the Presence of Salt or Heavy Metals.

    PubMed

    Han, Yunlei; Wang, Rui; Yang, Zhirong; Zhan, Yuhua; Ma, Yao; Ping, Shuzhen; Zhang, Liwen; Lin, Min; Yan, Yongliang

    2015-07-01

    1-Aminocyclopropane-1-carboxylate (ACC) deaminase, which is encoded by some bacteria, can reduce the amount of ethylene, a root elongation inhibitor, and stimulate the growth of plants under various environmental stresses. The presence of ACC deaminase activity and the regulation of ACC in several rhizospheric bacteria have been reported. The nitrogen-fixing Pseudomonas stutzeri A1501 is capable of endophytic association with rice plants and promotes the growth of rice. However, the functional identification of ACC deaminase has not been performed. In this study, the proposed effect of ACC deaminase in P. stutzeri A1501 was investigated. Genome mining showed that P. stutzeri A1501 carries a single gene encoding ACC deaminase, designated acdS. The acdS mutant was devoid of ACC deaminase activity and was less resistant to NaCl and NiCl2 compared with the wild-type. Furthermore, inactivation of acdS greatly impaired its nitrogenase activity under salt stress conditions. It was also observed that mutation of the acdS gene led to loss of the ability to promote the growth of rice under salt or heavy metal stress. Taken together, this study illustrates the essential role of ACC deaminase, not only in enhancing the salt or heavy metal tolerance of bacteria but also in improving the growth of plants, and provides a theoretical basis for studying the interaction between plant growth-promoting rhizobacteria and plants. PMID:25674802

  17. Cell wall integrity controls root elongation via a general 1-aminocyclopropane-1-carboxylic acid-dependent, ethylene-independent pathway.

    PubMed

    Tsang, Dat L; Edmond, Clare; Harrington, Jennifer L; Nühse, Thomas S

    2011-06-01

    Cell expansion in plants requires cell wall biosynthesis and rearrangement. During periods of rapid elongation, such as during the growth of etiolated hypocotyls and primary root tips, cells respond dramatically to perturbation of either of these processes. There is growing evidence that this response is initiated by a cell wall integrity-sensing mechanism and dedicated signaling pathway rather than being an inevitable consequence of lost structural integrity. However, the existence of such a pathway in root tissue and its function in a broader developmental context have remained largely unknown. Here, we show that various types of cell wall stress rapidly reduce primary root elongation in Arabidopsis (Arabidopsis thaliana). This response depended on the biosynthesis of 1-aminocyclopropane-1-carboxylic acid (ACC). In agreement with the established ethylene signaling pathway in roots, auxin signaling and superoxide production are required downstream of ACC to reduce elongation. However, this cell wall stress response unexpectedly does not depend on the perception of ethylene. We show that the short-term effect of ACC on roots is partially independent of its conversion to ethylene or ethylene signaling and that this ACC-dependent pathway is also responsible for the rapid reduction of root elongation in response to pathogen-associated molecular patterns. This acute response to internal and external stress thus represents a novel, noncanonical signaling function of ACC. PMID:21508182

  18. Novel Rhizosphere Soil Alleles for the Enzyme 1-Aminocyclopropane-1-Carboxylate Deaminase Queried for Function with an In Vivo Competition Assay

    PubMed Central

    Jin, Zhao; Di Rienzi, Sara C.; Janzon, Anders; Werner, Jeff J.; Angenent, Largus T.; Dangl, Jeffrey L.; Fowler, Douglas M.

    2015-01-01

    Metagenomes derived from environmental microbiota encode a vast diversity of protein homologs. How this diversity impacts protein function can be explored through selection assays aimed to optimize function. While artificially generated gene sequence pools are typically used in selection assays, their usage may be limited because of technical or ethical reasons. Here, we investigate an alternative strategy, the use of soil microbial DNA as a starting point. We demonstrate this approach by optimizing the function of a widely occurring soil bacterial enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase. We identified a specific ACC deaminase domain region (ACCD-DR) that, when PCR amplified from the soil, produced a variant pool that we could swap into functional plasmids carrying ACC deaminase-encoding genes. Functional clones of ACC deaminase were selected for in a competition assay based on their capacity to provide nitrogen to Escherichia coli in vitro. The most successful ACCD-DR variants were identified after multiple rounds of selection by sequence analysis. We observed that previously identified essential active-site residues were fixed in the original unselected library and that additional residues went to fixation after selection. We identified a divergent essential residue whose presence hints at the possible use of alternative substrates and a cluster of neutral residues that did not influence ACCD performance. Using an artificial ACCD-DR variant library generated by DNA oligomer synthesis, we validated the same fixation patterns. Our study demonstrates that soil metagenomes are useful starting pools of protein-coding-gene diversity that can be utilized for protein optimization and functional characterization when synthetic libraries are not appropriate. PMID:26637602

  19. Novel Rhizosphere Soil Alleles for the Enzyme 1-Aminocyclopropane-1-Carboxylate Deaminase Queried for Function with an In Vivo Competition Assay.

    PubMed

    Jin, Zhao; Di Rienzi, Sara C; Janzon, Anders; Werner, Jeff J; Angenent, Largus T; Dangl, Jeffrey L; Fowler, Douglas M; Ley, Ruth E

    2016-02-01

    Metagenomes derived from environmental microbiota encode a vast diversity of protein homologs. How this diversity impacts protein function can be explored through selection assays aimed to optimize function. While artificially generated gene sequence pools are typically used in selection assays, their usage may be limited because of technical or ethical reasons. Here, we investigate an alternative strategy, the use of soil microbial DNA as a starting point. We demonstrate this approach by optimizing the function of a widely occurring soil bacterial enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase. We identified a specific ACC deaminase domain region (ACCD-DR) that, when PCR amplified from the soil, produced a variant pool that we could swap into functional plasmids carrying ACC deaminase-encoding genes. Functional clones of ACC deaminase were selected for in a competition assay based on their capacity to provide nitrogen to Escherichia coli in vitro. The most successful ACCD-DR variants were identified after multiple rounds of selection by sequence analysis. We observed that previously identified essential active-site residues were fixed in the original unselected library and that additional residues went to fixation after selection. We identified a divergent essential residue whose presence hints at the possible use of alternative substrates and a cluster of neutral residues that did not influence ACCD performance. Using an artificial ACCD-DR variant library generated by DNA oligomer synthesis, we validated the same fixation patterns. Our study demonstrates that soil metagenomes are useful starting pools of protein-coding-gene diversity that can be utilized for protein optimization and functional characterization when synthetic libraries are not appropriate. PMID:26637602

  20. Possible Role of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Activity of Sinorhizobium sp. BL3 on Symbiosis with Mung Bean and Determinate Nodule Senescence

    PubMed Central

    Tittabutr, Panlada; Sripakdi, Sudarat; Boonkerd, Nantakorn; Tanthanuch, Waraporn; Minamisawa, Kiwamu; Teaumroong, Neung

    2015-01-01

    Sinorhizobium sp. BL3 forms symbiotic interactions with mung bean (Vigna radiata) and contains lrpL-acdS genes, which encode the 1-aminocyclopropane-1-carboxylate (ACC) deaminase enzyme that cleaves ACC, a precursor of plant ethylene synthesis. Since ethylene interferes with nodule formation in some legumes and plays a role in senescence in plant cells, BL3-enhancing ACC deaminase activity (BL3+) and defective mutant (BL3−) strains were constructed in order to investigate the effects of this enzyme on symbiosis and nodule senescence. Nodulation competitiveness was weaker in BL3− than in the wild-type, but was stronger in BL3+. The inoculation of BL3− into mung bean resulted in less plant growth, a lower nodule dry weight, and smaller nodule number than those in the wild-type, whereas the inoculation of BL3+ had no marked effects. However, similar nitrogenase activity was observed with all treatments; it was strongly detected 3 weeks after the inoculation and gradually declined with time, indicating senescence. The rate of plant nodulation by BL3+ increased in a time-dependent manner. Nodules occupied by BL3− formed smaller symbiosomes, and bacteroid degradation was more prominent than that in the wild-type 7 weeks after the inoculation. Changes in biochemical molecules during nodulation were tracked by Fourier Transform Infrared (FT-IR) microspectroscopy, and the results obtained confirmed that aging processes differed in nodules occupied by BL3 and BL3−. This is the first study to show the possible role of ACC deaminase activity in senescence in determinate nodules. Our results suggest that an increase in ACC deaminase activity in this strain does not extend the lifespan of nodules, whereas the lack of this activity may accelerate nodule senescence. PMID:26657304

  1. 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing rhizobacteria protect Ocimum sanctum plants during waterlogging stress via reduced ethylene generation.

    PubMed

    Barnawal, Deepti; Bharti, Nidhi; Maji, Deepamala; Chanotiya, Chandan Singh; Kalra, Alok

    2012-09-01

    Ocimum sanctum grown as rain-fed crop, is known to be poorly adapted to waterlogged conditions. Many a times the crop suffers extreme damages because of anoxia and excessive ethylene generation due to waterlogging conditions present under heavy rain. The usefulness of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing plant growth promoting rhizobacteria was investigated under waterlogging stress. The comparison of herb yield and stress induced biochemical changes of waterlogged and non-waterlogged plants with and without ACC deaminase-containing microbiological treatments were monitored in this study. Ten plant growth promoting rhizobacteria strains containing ACC-deaminase were isolated and characterized. Four selected isolates Fd2 (Achromobacter xylosoxidans), Bac5 (Serratia ureilytica), Oci9 (Herbaspirillum seropedicae) and Oci13 (Ochrobactrum rhizosphaerae) had the potential to protect Ocimum plants from flood induced damage under waterlogged glass house conditions. Pot experiments were conducted to evaluate the potential of these ACC deaminase-containing selected strains for reducing the yield losses caused by waterlogging conditions. Bacterial treatments protected plants from waterlogging induced detrimental changes like stress ethylene production, reduced chlorophyll concentration, higher lipid peroxidation, proline concentration and reduced foliar nutrient uptake. Fd2 (A. xylosoxidans) induced maximum waterlogging tolerance as treated waterlogged plants recorded maximum growth and herb yield (46.5% higher than uninoculated waterlogged plants) with minimum stress ethylene levels (53% lower ACC concentration as compared to waterlogged plants without bacterial inoculation) whereas under normal non-waterlogged conditions O. rhizosphaerae was most effective in plant growth promotion. PMID:22846334

  2. Southern blight disease of tomato control by 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Paenibacillus lentimorbus B-30488.

    PubMed

    Dixit, Ritu; Agrawal, Lalit; Gupta, Swati; Kumar, Manoj; Yadav, Sumit; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar

    2016-01-01

    Tomato cultivation is highly susceptible for soil born diseases and among them southern blight disease caused by Scelerotium rolfsii is very common. For its management use of chemical fungicides is not very successful as their spores are able to survive for many years in the soil. As an alternative eco-friendly approach to control the disease antagonistic microbes are being characterized.Among them plant growth promoting rhizobacteria Paenibacillus lentimorbus B-30488 (B-30488) with antagonistic properties, multiple PGP attributes stress tolerance and ACC deaminase enzyme activity is characterized to decipher its mode of action against S. rolfsii under in vitro and in vivo conditions. In vitro results obtained from this study clearly demonstrate that B-30488 has ability to show antagonistic properties under different abiotic stresses against S. rolfsii. Similar results were also obtained from in vivo experiments where B-30488 inoculation has efficiently controlled the disease caused by S. rolfsii and improve the plant growth. Deleterious enhanced ethylene level in S. rolfsii infected plants was also ameliorated by inoculation of ACC deaminase producing B-30488. The ACC accumulation, ACO and ACS activities were also modulated in S. rolfsii infected plants. Results from defense enzymes and other biochemical attributes were also support the role of B-30488 inoculation in ameliorating the biotic stress caused by S. rolfsii in tomato plants. These results were further validated by pathogen related gene expression analysis by real time PCR. Overall results from the present study may be concluded that ACC deaminase producing B-30488 has ability to control the southern blight disease caused by S. rolfsii and commercial bioinoculant package may be developed. PMID:26825539

  3. Southern blight disease of tomato control by 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Paenibacillus lentimorbus B-30488

    PubMed Central

    Dixit, Ritu; Agrawal, Lalit; Gupta, Swati; Kumar, Manoj; Yadav, Sumit; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar

    2016-01-01

    abstract Tomato cultivation is highly susceptible for soil born diseases and among them southern blight disease caused by Scelerotium rolfsii is very common. For its management use of chemical fungicides is not very successful as their spores are able to survive for many years in the soil. As an alternative eco-friendly approach to control the disease antagonistic microbes are being characterized.Among them plant growth promoting rhizobacteria Paenibacillus lentimorbus B-30488 (B-30488) with antagonistic properties, multiple PGP attributes stress tolerance and ACC deaminase enzyme activity is characterized to decipher its mode of action against S. rolfsii under in vitro and in vivo conditions. In vitro results obtained from this study clearly demonstrate that B-30488 has ability to show antagonistic properties under different abiotic stresses against S. rolfsii. Similar results were also obtained from in vivo experiments where B-30488 inoculation has efficiently controlled the disease caused by S. rolfsii and improve the plant growth. Deleterious enhanced ethylene level in S. rolfsii infected plants was also ameliorated by inoculation of ACC deaminase producing B-30488. The ACC accumulation, ACO and ACS activities were also modulated in S. rolfsii infected plants. Results from defense enzymes and other biochemical attributes were also support the role of B-30488 inoculation in ameliorating the biotic stress caused by S. rolfsii in tomato plants. These results were further validated by pathogen related gene expression analysis by real time PCR. Overall results from the present study may be concluded that ACC deaminase producing B-30488 has ability to control the southern blight disease caused by S. rolfsii and commercial bioinoculant package may be developed. PMID:26825539

  4. Inhibition of the Conversion of 1-Aminocyclopropane-1-carboxylic Acid to Ethylene by Structural Analogs, Inhibitors of Electron Transfer, Uncouplers of Oxidative Phosphorylation, and Free Radical Scavengers 1

    PubMed Central

    Apelbaum, Akiva; Wang, Shiow Y.; Burgoon, Alan C.; Baker, James E.; Lieberman, Morris

    1981-01-01

    Cyclopropane carboxylic acid (CCA) at 1 to 5 millimolar, unlike related cyclopropane ring analogs of 1-aminocyclopropane-1-carboxylic acid (ACC) which were virtually ineffective, inhibited C2H4 production, and this inhibition was nullified by ACC. Inhibition by CCA is not competitive with ACC since there is a decline, rather than an increase, in native endogenous ACC in the presence of CCA. Similarly, short-chain organic acids from acetic to butyric acid and α-aminoisobutyric acid inhibited C2H4 production at 1 to 5 millimolar and lowered endogenous ACC levels. These inhibitions, like that of CCA, were overcome with ACC. Inhibitors of electron transfer and oxidative phosphorylation effectively inhibited ACC conversion to C2H4 in pea and apple tissues. The most potent inhibitors were 2,4-dinitrophenol (DNP) and carbonyl cyanide m-chlorophenylhydrazone (CCCP) which virtually eliminated ACC-stimulated C2H4 production in both tissues. Still other inhibitors of the conversion of ACC to C2H4 were putative free radical scavengers which reduced chemiluminescence in the free radical-activated luminol reaction. These inhibitor studies suggest the involvement of a free radical in the reaction sequence which converts ACC to C2H4. Additionally, the potent inhibition of this reaction by uncouplers of oxidative phosphorylation (DNP and CCCP) suggest the involvement of ATP or the necessity for an intact membrane for C2H4 production from ACC. In the latter case, CCCP may be acting as a proton ionophore to destroy the membrane integrity necessary for C2H4 production. PMID:16661637

  5. 1-aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots and root tips and soybean cyst nematode (Heterodera glycines) colonized root pieces

    Technology Transfer Automated Retrieval System (TEKTRAN)

    It's fairly well established that a functional ethylene response path is important to root knot and cyst nematode colonization of plant roots. However, ethylene plays many roles in root development and the role of ethylene in nematode colonization of roots may be indirect, e.g. lateral root initiati...

  6. Export of Abscisic Acid, 1-Aminocyclopropane-1-Carboxylic Acid, Phosphate, and Nitrate from Roots to Shoots of Flooded Tomato Plants (Accounting for Effects of Xylem Sap Flow Rate on Concentration and Delivery).

    PubMed Central

    Else, M. A.; Hall, K. C.; Arnold, G. M.; Davies, W. J.; Jackson, M. B.

    1995-01-01

    We determined whether root stress alters the output of physiologically active messages passing from roots to shoots in the transpiration stream. Concentrations were not good measures of output. This was because changes in volume flow of xylem sap caused either by sampling procedures or by effects of root stress on rates of whole-plant transpiration modified concentrations simply by dilution. Thus, delivery rate (concentration x sap flow rate) was preferred to concentration as a measure of solute output from roots. To demonstrate these points, 1-aminocyclopropane-1-carboxylic acid (ACC), abscisic acid, phosphate, nitrate, and pH were measured in xylem sap of flooded and well-drained tomato (Lycopersicon esculentum Mill., cv Ailsa Craig) plants expressed at various rates from pressurized detopped roots. Concentrations decreased as sap flow rates were increased. However, dilution of solutes was often less than proportional to flow, especially in flooded plants. Thus, sap flowing through detopped roots at whole-plant transpiration rates was used to estimate solute delivery rates in intact plants. On this basis, delivery of ACC from roots to shoots was 3.1-fold greater in plants flooded for 24 h than in well-drained plants, and delivery of phosphate was 2.3-fold greater. Delivery rates of abscisic acid and nitrate in flooded plants were only 11 and 7%, respectively, of those in well-drained plants. PMID:12228364

  7. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  8. Characterization and expression profiles of MaACS and MaACO genes from mulberry (Morus alba L.)*

    PubMed Central

    Liu, Chang-ying; Lü, Rui-hua; Li, Jun; Zhao, Ai-chun; Wang, Xi-ling; Diane, Umuhoza; Wang, Xiao-hong; Wang, Chuan-hong; Yu, Ya-sheng; Han, Shu-mei; Lu, Cheng; Yu, Mao-de

    2014-01-01

    1-Aminocyclopropane-1-carboxylic acid synthase (ACS) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) are encoded by multigene families and are involved in fruit ripening by catalyzing the production of ethylene throughout the development of fruit. However, there are no reports on ACS or ACO genes in mulberry, partly because of the limited molecular research background. In this study, we have obtained five ACS gene sequences and two ACO gene sequences from Morus Genome Database. Sequence alignment and phylogenetic analysis of MaACO1 and MaACO2 showed that their amino acids are conserved compared with ACO proteins from other species. MaACS1 and MaACS2 are type I, MaACS3 and MaACS4 are type II, and MaACS5 is type III, with different C-terminal sequences. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) expression analysis showed that the transcripts of MaACS genes were strongly expressed in fruit, and more weakly in other tissues. The expression of MaACO1 and MaACO2 showed different patterns in various mulberry tissues. MaACS and MaACO genes demonstrated two patterns throughout the development of mulberry fruit, and both of them were strongly up-regulated by abscisic acid (ABA) and ethephon. PMID:25001221

  9. Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence.

    PubMed

    Chen, Jen-Chih; Jiang, Cai-Zhong; Gookin, Timothy E; Hunter, Donald A; Clark, David G; Reid, Michael S

    2004-07-01

    Agrobacterium-mediated infection of petunia (Petunia hybrida) plants with tobacco rattle virus (TRV) bearing fragments of Petunia genes resulted in systemic infection and virus-induced gene silencing (VIGS) of the homologous host genes. Infection with TRV containing a phytoene desaturase (PDS) fragment resulted in reduced abundance of PDS transcripts and typical photobleaching of photosynthetic tissues. Infection with TRV containing a chalcone synthase (CHS) fragment resulted in silencing of anthocyanin production in infected flowers. The silencing phenotype ranged from scattered white spots on the normal purple background to entirely white flowers. Symptoms in the V26 cultivar were a diffuse mosaic, but infection of some purple-flowered commercial cultivars resulted in large white sectors and even entirely white flowers. Abundance of CHS transcripts in the white flowers was less than 4% of that in purple flowers on the same plant. Infection with TRV containing a tandem construct of PDS and CHS resulted in leaf photobleaching and white patterns on the flowers. Transcripts of CHS and PDS were reduced both in leaves and in flowers confirming simultaneous silencing of both genes by the tandem construct. We tested the effects of infection with TRV containing CHS and a fragment of a petunia gene encoding for 1-aminocyclopropane-1-carboxylate oxidase (ACO4) Abundance of transcripts encoding ACO4 and ACO1 were reduced (by 5% and 20%, respectively) in infected flowers. Whether the flowers were treated with ACC or pollinated, the white (silenced) flowers or flower sectors produced less ethylene and senesced later than purple (non-silenced) tissues. These results indicate the value of VIGS with tandem constructs containing CHS as reporter and a target gene as a tool for examining the function of floral-associated genes. PMID:15604697

  10. Suppression of Ripening-Associated Gene Expression in Tomato Fruits Subjected to a High CO2 Concentration.

    PubMed Central

    Rothan, C.; Duret, S.; Chevalier, C.; Raymond, P.

    1997-01-01

    High concentrations of CO2 block or delay the ripening of fruits. In this study we investigated the effects of high CO2 on ripening and on the expression of stress- and ripening-inducible genes in cherry tomato (Lycopersicon esculentum Mill.) fruit. Mature-green tomato fruits were submitted to a high CO2 concentration (20%) for 3 d and then transferred to air. These conditions effectively inhibited ripening-associated color changes and ethylene production, and reduced the protein content. No clear-cut effect was observed on the expression of two proteolysis-related genes, encoding polyubiquitin and ubiquitin-conjugating enzyme E2, respectively. Exposure of fruit to high CO2 also resulted in the strong induction of two genes encoding stress-related proteins: a ripening-regulated heat-shock protein and glutamate decarboxylase. Induction of these two genes indicated that high CO2 had a stress effect, most likely through cytosolic acidification. In addition, high CO2 blocked the accumulation of mRNAs for genes involved in the main ripening-related changes: ethylene synthesis (1-aminocyclopropane-1-carboxylic acid synthase and 1-aminocyclopropane-1-carboxylic acid oxidase), color (phytoene synthase), firmness (polygalacturonase), and sugar accumulation (acid invertase). The expression of ripening-specific genes was affected by CO2 regardless of whether their induction was ethylene- or development-dependent. It is proposed that the inhibition of tomato fruit ripening by high CO2 is due, in part, to the suppression of the expression of ripening-associated genes, which is probably related to the stress effect exerted by high CO2. PMID:12223703

  11. Differential expression of ethylene biosynthesis genes in drupelets and receptacle of raspberry (Rubus idaeus).

    PubMed

    Fuentes, Lida; Monsalve, Liliam; Morales-Quintana, Luis; Valdenegro, Mónika; Martínez, Juan-Pablo; Defilippi, Bruno G; González-Agüero, Mauricio

    2015-05-01

    Red Raspberry (Rubus idaeus) is traditionally classified as non-climacteric, and the role of ethylene in fruit ripening is not clear. The available information indicates that the receptacle, a modified stem that supports the drupelets, is involved in ethylene production of ripe fruits. In this study, we report receptacle-related ethylene biosynthesis during the ripening of fruits of cv. Heritage. In addition, the expression pattern of ethylene biosynthesis transcripts was evaluated during the ripening process. The major transcript levels of 1-aminocyclopropane-1-carboxylic acid synthase (RiACS1) and 1-aminocyclopropane-1-carboxylic acid oxidase (RiACO1) were concomitant with ethylene production, increased total soluble solids (TSS) and decreased titratable acidity (TA) and fruit firmness. Moreover, ethylene biosynthesis and transcript levels of RiACS1 and RiACO1 were higher in the receptacle, sustaining the receptacle's role as a source of ethylene in regulating the ripening of raspberry. PMID:25847526

  12. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

    PubMed Central

    Chang, Ing-Feng

    2013-01-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

  13. Regulation of a Chitinase Gene Promoter by Ethylene and Elicitors in Bean Protoplasts 1

    PubMed Central

    Roby, Dominique; Broglie, Karen; Gaynor, John; Broglie, Richard

    1991-01-01

    Chitinase gene expression has been shown to be transcriptionally regulated by a number of inducers, including ethylene, elicitors, and pathogen attack. To investigate the mechanism(s) responsible for induction of chitinase gene expression in response to various stimuli, we have developed a transient gene expression system in bean (Phaseolus vulgaris) protoplasts that is responsive to ethylene and elicitor treatment. This system was used to study the expression of a chimeric gene composed of the 5′ flanking sequences of a bean endochitinase gene fused to the reporter gene β-glucuronidase linked to a 3′ fragment from nopaline synthase. Addition of 1-aminocyclopropane-1-carboxylic acid, the direct precursor of ethylene, or elicitors such as chitin oligosaccharides or cell wall fragments derived from Colletotrichum lagenarium, to transformed protoplasts resulted in a rapid and marked increase in the expression of the chimeric gene. The kinetics and dose response for these treatments were similar to those observed for the native gene in vivo. Analyses of 5′ deletion mutants in the protoplast system indicated that DNA sequences located between −305 and −236 are important for both ethylene and elicitor induction of the reporter gene. ImagesFigure 1 PMID:16668405

  14. The Tomato E8 Gene Influences Ethylene Biosynthesis in Fruit but Not in Flowers.

    PubMed Central

    Kneissl, M. L.; Deikman, J.

    1996-01-01

    We investigated the function of the tomato (Lycopersicon esculentum) E8 gene. Previous experiments in which antisense suppression of E8 was used suggested that the E8 protein has a negative effect on ethylene evolution in fruit. E8 is expressed in flowers as well as in fruit, and its expression is high in anthers. We introduced a cauliflower mosaic virus 35S-E8 gene into tomato plants and obtained plants with overexpression of E8 and plants in which E8 expression was suppressed due to co-suppression. Overexpression of E8 in unripe fruit did not affect the level of ethylene evolution during fruit ripening; however, reduction of E8 protein by cosuppression did lead to elevated levels during ripening. Levels for ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), and ACC oxidase mRNA were increased approximately 7-fold in fruit of plants with reduced E8 protein. Levels of ACC synthase 2 mRNA were increased 2.5-fold, and ACC synthase 4 mRNA was not affected. Reduction of E8 protein in anthers did not affect the accumulation of ACC or of mRNAs encoding enzymes involved in ethylene biosynthesis. Our results suggest that the product of the E8 reaction participates in feedback regulation of ethylene biosynthesis during fruit ripening. PMID:12226407

  15. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    PubMed

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. PMID:24716518

  16. The formation of ACC and competition between polyamines and ethylene for SAM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene biosynthesis involves the conversion of S-adenosylmethionine (SAM) to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS). ACC is then converted to ethylene. The genes that encode enzymes in this pathway all belong to a family of genes. Differential transcriptional regulation ...

  17. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  18. Role for the banana AGAMOUS-like gene MaMADS7 in regulation of fruit ripening and quality.

    PubMed

    Liu, Juhua; Liu, Lin; Li, Yujia; Jia, Caihong; Zhang, Jianbin; Miao, Hongxia; Hu, Wei; Wang, Zhuo; Xu, Biyu; Jin, Zhiqiang

    2015-11-01

    MADS-box transcription factors play important roles in organ development. In plants, most studies on MADS-box genes have mainly focused on flower development and only a few concerned fruit development and ripening. A new MADS-box gene named MaMADS7 was isolated from banana fruit by rapid amplification of cDNA ends (RACE) based on a MADS-box fragment obtained from a banana suppression subtractive hybridization (SSH) cDNA library. MaMADS7 is an AGAMOUS-like MADS-box gene that is preferentially expressed in the ovaries and fruits and in tobacco its protein product localizes to the nucleus. This study found that MaMADS7 expression can be induced by exogenous ethylene. Ectopic expression of MaMADS7 in tomato resulted in broad ripening phenotypes. The expression levels of seven ripening and quality-related genes, ACO1, ACS2, E4, E8, PG, CNR and PSY1 in MaMADS7 transgenic tomato fruits were greatly increased while the expression of the AG-like MADS-box gene TAGL1 was suppressed. Compared with the control, the contents of β-carotene, lycopene, ascorbic acid and organic acid in transformed tomato fruits were increased, while the contents of glucose and fructose were slightly decreased. MaMADS7 interacted with banana 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene 1 (MaACO1) and tomato phytoene synthase gene (LePSY1) promoters. Our results indicated that MaMADS7 plays an important role in initiating endogenous ethylene biosynthesis and fruit ripening. PMID:25980771

  19. The Andromonoecious Sex Determination Gene Predates the Separation of Cucumis and Citrullus Genera

    PubMed Central

    Boualem, Adnane; Lemhemdi, Afef; Sari, Marie-Agnes; Pignoly, Sarah; Troadec, Christelle; Abou Choucha, Fadi; Solmaz, Ilknur; Sari, Nebahat; Dogimont, Catherine; Bendahmane, Abdelhafid

    2016-01-01

    Understanding the evolution of sex determination in plants requires the cloning and the characterization of sex determination genes. Monoecy is characterized by the presence of both male and female flowers on the same plant. Andromonoecy is characterized by plants carrying both male and bisexual flowers. In watermelon, the transition between these two sexual forms is controlled by the identity of the alleles at the A locus. We previously showed, in two Cucumis species, melon and cucumber, that the transition from monoecy to andromonoecy results from mutations in 1-aminocyclopropane-1-carboxylic acid synthase (ACS) gene, ACS-7/ACS2. To test whether the ACS-7/ACS2 function is conserved in cucurbits, we cloned and characterized ClACS7 in watermelon. We demonstrated co-segregation of ClACS7, the homolog of CmACS-7/CsACS2, with the A locus. Sequence analysis of ClACS7 in watermelon accessions identified three ClACS7 isoforms, two in andromonoecious and one in monoecious lines. To determine whether the andromonoecious phenotype is due to a loss of ACS enzymatic activity, we expressed and assayed the activity of the three protein isoforms. Like in melon and cucumber, the isoforms from the andromonoecious lines showed reduced to no enzymatic activity and the isoform from the monoecious line was active. Consistent with this, the mutations leading andromonoecy were clustered in the active site of the enzyme. Based on this, we concluded that active ClACS7 enzyme leads to the development of female flowers in monoecious lines, whereas a reduction of enzymatic activity yields hermaphrodite flowers. ClACS7, like CmACS-7/CsACS2 in melon and cucumber, is highly expressed in carpel primordia of buds determined to develop carpels and not in male flowers. Based on this finding and previous investigations, we concluded that the monoecy gene, ACS7, likely predated the separation of the Cucumis and Citrullus genera. PMID:27171236

  20. The Andromonoecious Sex Determination Gene Predates the Separation of Cucumis and Citrullus Genera.

    PubMed

    Boualem, Adnane; Lemhemdi, Afef; Sari, Marie-Agnes; Pignoly, Sarah; Troadec, Christelle; Abou Choucha, Fadi; Solmaz, Ilknur; Sari, Nebahat; Dogimont, Catherine; Bendahmane, Abdelhafid

    2016-01-01

    Understanding the evolution of sex determination in plants requires the cloning and the characterization of sex determination genes. Monoecy is characterized by the presence of both male and female flowers on the same plant. Andromonoecy is characterized by plants carrying both male and bisexual flowers. In watermelon, the transition between these two sexual forms is controlled by the identity of the alleles at the A locus. We previously showed, in two Cucumis species, melon and cucumber, that the transition from monoecy to andromonoecy results from mutations in 1-aminocyclopropane-1-carboxylic acid synthase (ACS) gene, ACS-7/ACS2. To test whether the ACS-7/ACS2 function is conserved in cucurbits, we cloned and characterized ClACS7 in watermelon. We demonstrated co-segregation of ClACS7, the homolog of CmACS-7/CsACS2, with the A locus. Sequence analysis of ClACS7 in watermelon accessions identified three ClACS7 isoforms, two in andromonoecious and one in monoecious lines. To determine whether the andromonoecious phenotype is due to a loss of ACS enzymatic activity, we expressed and assayed the activity of the three protein isoforms. Like in melon and cucumber, the isoforms from the andromonoecious lines showed reduced to no enzymatic activity and the isoform from the monoecious line was active. Consistent with this, the mutations leading andromonoecy were clustered in the active site of the enzyme. Based on this, we concluded that active ClACS7 enzyme leads to the development of female flowers in monoecious lines, whereas a reduction of enzymatic activity yields hermaphrodite flowers. ClACS7, like CmACS-7/CsACS2 in melon and cucumber, is highly expressed in carpel primordia of buds determined to develop carpels and not in male flowers. Based on this finding and previous investigations, we concluded that the monoecy gene, ACS7, likely predated the separation of the Cucumis and Citrullus genera. PMID:27171236

  1. Cadmium-induced ethylene production and responses in Arabidopsis thaliana rely on ACS2 and ACS6 gene expression

    PubMed Central

    2014-01-01

    Background Anthropogenic activities cause metal pollution worldwide. Plants can absorb and accumulate these metals through their root system, inducing stress as a result of excess metal concentrations inside the plant. Ethylene is a regulator of multiple plant processes, and is affected by many biotic and abiotic stresses. Increased ethylene levels have been observed after exposure to excess metals but it remains unclear how the increased ethylene levels are achieved at the molecular level. In this study, the effects of cadmium (Cd) exposure on the production of ethylene and its precursor 1-aminocyclopropane-1-carboxylic acid (ACC), and on the expression of the ACC Synthase (ACS) and ACC Oxidase (ACO) multigene families were investigated in Arabidopsis thaliana. Results Increased ethylene release after Cd exposure was directly measurable in a system using rockwool-cultivated plants; enhanced levels of the ethylene precursor ACC together with higher mRNA levels of ethylene responsive genes: ACO2, ETR2 and ERF1 also indicated increased ethylene production in hydroponic culture. Regarding underlying mechanisms, it was found that the transcript levels of ACO2 and ACO4, the most abundantly expressed members of the ACO multigene family, were increased upon Cd exposure. ACC synthesis is the rate-limiting step in ethylene biosynthesis, and transcript levels of both ACS2 and ACS6 showed the highest increase and became the most abundant isoforms after Cd exposure, suggesting their importance in the Cd-induced increase of ethylene production. Conclusions Cadmium induced the biosynthesis of ACC and ethylene in Arabidopsis thaliana plants mainly via the increased expression of ACS2 and ACS6. This was confirmed in the acs2-1acs6-1 double knockout mutants, which showed a decreased ethylene production, positively affecting leaf biomass and resulting in a delayed induction of ethylene responsive gene expressions without significant differences in Cd contents between wild-type and

  2. INFLUENCE OF LIGHT ON OZONE-INDUCED 1-AMINOCYCLOPROPANE-1-CARBOXYLIC ACID AND ETHYLENE PRODUCTION FROM INTACT PLANTS

    EPA Science Inventory

    The influence of light on ozone-induced ethylene production from intact soybean (Glycine max L. Merr. cv. Dare) and tomato (Lycopersicon esculentum Mill. cv. Roma) plants was investigated. Ozone-induced stress ethylene production was 2.6-fold greater from dark-than light-incubate...

  3. Burst of ethylene upon horizontal placement of tomato seedlings

    NASA Technical Reports Server (NTRS)

    Harrison, M.; Pickard, B. G.

    1984-01-01

    Seedlings of Lycopersicon esculentum Mill. cv Rutgers emit a pulse of ethylene during the first 2 to 4 minutes following horizontal placement. Because this burst appears too rapid and brief to be mediated by increase in net activity of 1-aminocyclopropane-1-carboxylic acid synthase, it might result form accelerated transformation of vacuolar 1-aminocyclopropane-1-carboxylic acid to ethylene.

  4. The tomato terpene synthase gene family.

    PubMed

    Falara, Vasiliki; Akhtar, Tariq A; Nguyen, Thuong T H; Spyropoulou, Eleni A; Bleeker, Petra M; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E; Schilmiller, Anthony L; Last, Robert L; Schuurink, Robert C; Pichersky, Eran

    2011-10-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  5. Optimatization of transient transformation methods to study gene expression in Musa acuminata (AAA group) cultivar Ambon Lumut

    NASA Astrophysics Data System (ADS)

    Prayuni, Kinasih; Dwivany, Fenny M.

    2015-09-01

    Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.

  6. Isoprene synthase genes form a monophyletic clade of acyclic terpene synthases in the TPS-B terpene synthase family.

    PubMed

    Sharkey, Thomas D; Gray, Dennis W; Pell, Heather K; Breneman, Steven R; Topper, Lauren

    2013-04-01

    Many plants emit significant amounts of isoprene, which is hypothesized to help leaves tolerate short episodes of high temperature. Isoprene emission is found in all major groups of land plants including mosses, ferns, gymnosperms, and angiosperms; however, within these groups isoprene emission is variable. The patchy distribution of isoprene emission implies an evolutionary pattern characterized by many origins or many losses. To better understand the evolution of isoprene emission, we examine the phylogenetic relationships among isoprene synthase and monoterpene synthase genes in the angiosperms. In this study we identify nine new isoprene synthases within the rosid angiosperms. We also document the capacity of a myrcene synthase in Humulus lupulus to produce isoprene. Isoprene synthases and (E)-β-ocimene synthases form a monophyletic group within the Tps-b clade of terpene synthases. No asterid genes fall within this clade. The chemistry of isoprene synthase and ocimene synthase is similar and likely affects the apparent relationships among Tps-b enzymes. The chronology of rosid evolution suggests a Cretaceous origin followed by many losses of isoprene synthase over the course of evolutionary history. The phylogenetic pattern of Tps-b genes indicates that isoprene emission from non-rosid angiosperms likely arose independently. PMID:23550753

  7. Transcription of Biotic Stress Associated Genes in White Clover (Trifolium repens L.) Differs in Response to Cyst and Root-Knot Nematode Infection

    PubMed Central

    Islam, Afsana; Mercer, Chris F.; Leung, Susanna; Dijkwel, Paul P.

    2015-01-01

    The transcription of four members of the Kunitz proteinase inhibitor (KPI) gene family of white clover (Trifolium repens L.), designated as Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5, was investigated at both local infection (roots) and systemic (leaf tissue) sites in white clover in response to infection with the clover root knot nematode (CRKN) Meloidogyne trifoliophila and the clover cyst nematode (CCN) Heterodera trifolii. Invasion by the CRKN resulted in a significant decrease in transcript abundance of Tr-KPI4 locally at both 4 days post-infection (dpi) and at 8 dpi, and an increase in transcription of Tr-KPI1 systemically at 8 dpi. In contrast, an increase in transcript abundance of all four Tr-KPI genes locally at 4 and 8 dpi, and an increase of Tr-KPI1, Tr-KPI2, and Tr-KPI5 at 8 dpi systemically was observed in response to infection with the CCN. Challenge of a resistant (R) genotype and a susceptible (S) genotype of white clover with the CCN revealed a significant increase in transcript abundance of all four Tr-KPI genes locally in the R genotype, while an increase in abundance of only Tr-KPI1, Tr-KPI2, and Tr-KPI5 was observed in the S genotype, and only at 4 dpi. The transcript abundance of a member of the1-AMINOCYCLOPROPANE-1-CARBOXYLATE (ACC) SYNTHASE gene family from white clover (Tr-ACS1) was significantly down-regulated locally in response to CRKN infection at 4 and 8 dpi and at 4 dpi, systemically, while abundance increased locally and systemically at 8 dpi in response to CCN challenge. Conversely, the abundance of the jasmonic acid (JA) signalling gene, CORONATINE-INSENSITIVE PROTEIN 1 from white clover (Tr-COI1) increased significantly at 8 dpi locally in response to CRKN infection, but decreased at 8 dpi in response to CCN infection. The significance of this differential regulation of transcription is discussed with respect to differences in infection strategy of the two nematode species. PMID:26393362

  8. Transcription of Biotic Stress Associated Genes in White Clover (Trifolium repens L.) Differs in Response to Cyst and Root-Knot Nematode Infection.

    PubMed

    Islam, Afsana; Mercer, Chris F; Leung, Susanna; Dijkwel, Paul P; McManus, Michael T

    2015-01-01

    The transcription of four members of the Kunitz proteinase inhibitor (KPI) gene family of white clover (Trifolium repens L.), designated as Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5, was investigated at both local infection (roots) and systemic (leaf tissue) sites in white clover in response to infection with the clover root knot nematode (CRKN) Meloidogyne trifoliophila and the clover cyst nematode (CCN) Heterodera trifolii. Invasion by the CRKN resulted in a significant decrease in transcript abundance of Tr-KPI4 locally at both 4 days post-infection (dpi) and at 8 dpi, and an increase in transcription of Tr-KPI1 systemically at 8 dpi. In contrast, an increase in transcript abundance of all four Tr-KPI genes locally at 4 and 8 dpi, and an increase of Tr-KPI1, Tr-KPI2, and Tr-KPI5 at 8 dpi systemically was observed in response to infection with the CCN. Challenge of a resistant (R) genotype and a susceptible (S) genotype of white clover with the CCN revealed a significant increase in transcript abundance of all four Tr-KPI genes locally in the R genotype, while an increase in abundance of only Tr-KPI1, Tr-KPI2, and Tr-KPI5 was observed in the S genotype, and only at 4 dpi. The transcript abundance of a member of the1-AMINOCYCLOPROPANE-1-CARBOXYLATE (ACC) SYNTHASE gene family from white clover (Tr-ACS1) was significantly down-regulated locally in response to CRKN infection at 4 and 8 dpi and at 4 dpi, systemically, while abundance increased locally and systemically at 8 dpi in response to CCN challenge. Conversely, the abundance of the jasmonic acid (JA) signalling gene, CORONATINE-INSENSITIVE PROTEIN 1 from white clover (Tr-COI1) increased significantly at 8 dpi locally in response to CRKN infection, but decreased at 8 dpi in response to CCN infection. The significance of this differential regulation of transcription is discussed with respect to differences in infection strategy of the two nematode species. PMID:26393362

  9. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    PubMed

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time. PMID:24849013

  10. Thymidylate synthase gene of herpesvirus ateles.

    PubMed Central

    Richter, J; Puchtler, I; Fleckenstein, B

    1988-01-01

    The putative thymidylate synthase (TS) gene of herpesvirus ateles, a T-lymphotropic tumor virus of New World primates, has a single large open reading frame encoding a polypeptide of 32.9 kilodaltons. The gene is transcribed into an unspliced 2.4-kilobase mRNA that is abundantly expressed late in virus replication. The AT-rich 5' untranslated leader sequence of TS mRNA in herpesvirus ateles-infected cells is remarkable in length (1,184 nucleotides), containing 29 minicistrons; this may indicate a role in translation regulation. Images PMID:3404583

  11. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence

    PubMed Central

    2014-01-01

    Background Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Methods Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Results Each of the respective gene structures encompassed 6 exons and 5 introns located in conserved sites. Comparison with the corresponding gene structures of other eukaryotic species revealed lack of common introns that would be shared among selected fungi, nematodes, mammals and plants. The two deduced amino acid sequences were 96% identical. In addition to the thymidylate synthase gene, the intron-less retrocopy, i.e. a processed pseudogene, with sequence identical to the T. spiralis gene coding region, was found to be present within the T. pseudospiralis genome. This pseudogene, instead of the gene, was confirmed by RT-PCR to be expressed in the parasite muscle larvae. Conclusions Intron load, as well as distribution of exon and intron phases in thymidylate synthase genes from various sources, point against the theory of gene assembly by the primordial exon shuffling and support the theory of evolutionary late intron insertion into spliceosomal genes. Thymidylate synthase pseudogene expressed in T. pseudospiralis muscle larvae is designated a retrogene. PMID:24716800

  12. Divinyl ether synthase gene and protein, and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  13. Divinyl ether synthase gene, and protein and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2006-12-26

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  14. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    PubMed Central

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1–2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1–2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  15. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus.

    PubMed

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1-2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1-2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  16. Arabidopsis protein phosphatase 2C ABI1 interacts with type I ACC synthases and is involved in the regulation of ozone-induced ethylene biosynthesis.

    PubMed

    Ludwików, Agnieszka; Cieśla, Agata; Kasprowicz-Maluśki, Anna; Mituła, Filip; Tajdel, Małgorzata; Gałgański, Łukasz; Ziółkowski, Piotr A; Kubiak, Piotr; Małecka, Arleta; Piechalak, Aneta; Szabat, Marta; Górska, Alicja; Dąbrowski, Maciej; Ibragimow, Izabela; Sadowski, Jan

    2014-06-01

    Ethylene plays a crucial role in various biological processes and therefore its biosynthesis is strictly regulated by multiple mechanisms. Posttranslational regulation, which is pivotal in controlling ethylene biosynthesis, impacts 1-aminocyclopropane 1-carboxylate synthase (ACS) protein stability via the complex interplay of specific factors. Here, we show that the Arabidopsis thaliana protein phosphatase type 2C, ABI1, a negative regulator of abscisic acid signaling, is involved in the regulation of ethylene biosynthesis under oxidative stress conditions. We found that ABI1 interacts with ACS6 and dephosphorylates its C-terminal fragment, a target of the stress-responsive mitogen-activated protein kinase, MPK6. In addition, ABI1 controls MPK6 activity directly and by this means also affects the ACS6 phosphorylation level. Consistently with this, ozone-induced ethylene production was significantly higher in an ABI1 knockout strain (abi1td) than in wild-type plants. Importantly, an increase in stress-induced ethylene production in the abi1td mutant was compensated by a higher ascorbate redox state and elevated antioxidant activities. Overall, the results of this study provide evidence that ABI1 restricts ethylene synthesis by affecting the activity of ACS6. The ABI1 contribution to stress phenotype underpins its role in the interplay between the abscisic acid (ABA) and ethylene signaling pathways. PMID:24637173

  17. The Tomato Terpene Synthase Gene Family1[W][OA

    PubMed Central

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  18. Selection of Reference Genes for Gene Expression Normalization in Peucedanum praeruptorum Dunn under Abiotic Stresses, Hormone Treatments and Different Tissues

    PubMed Central

    Zhao, Yucheng; Luo, Jun; Xu, Sheng; Wang, Wei; Liu, Tingting; Han, Chao; Chen, Yijun; Kong, Lingyi

    2016-01-01

    Peucedanum praeruptorum Dunn is one of the main traditional Chinese medicines producing coumarins and plenty of literatures are focused on the biosynthesis of coumarins. Quantitative real-time reverse transcription PCR (qRT-PCR) is a widely used method in studying the biosynthesis pathway and the selection of reference genes plays a crucial role in accurate normalization. To facilitate biosynthesis study of coumarins, twelve candidate reference genes were selected from the transcriptome database of P. praeruptorum according to previous studies. Then, BestKeeper, geNoFrm and NormFinder were used for selecting stably expressed reference genes in different tissues and under various stress treatments. The results indicated that, among the twelve candidate reference genes, the SAND family protein (SAND), actin 2 (ACT2), ubiquitin-conjugating enzyme 9 (UBC9), protein phosphatase 2A gene (PP2A) and polypyrimidine tract-binding protein (PTBP1) were the most stable reference genes under different experimental treatments, while glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and tubulin beta-6 (TUB6) were the least stable genes. In addition, the suitability of SAND, TIP41-like protein (TIP41), UBC9, ACT2, TUB6 and their combination as reference genes were confirmed by normalizing the expression of 1-aminocyclopropane-1-carboxylate oxidase (ACO) in different treatments. This work is the first survey of the stability of reference genes in P. praeruptorum and provides guidelines to obtain more accurate qRT-PCR results in P. praeruptorum and other plant species. PMID:27022972

  19. A geraniol-synthase gene from Cinnamomum tenuipilum.

    PubMed

    Yang, Tao; Li, Jing; Wang, Hao-Xin; Zeng, Ying

    2005-02-01

    Geraniol may accumulate up to 86-98% of the leaf essential oils in geraniol chemotypes of the evergreen camphor tree Cinnamomum tenuipilum. A similarity-based cloning strategy yielded a cDNA clone that appeared to encode a terpene synthase and which could be phylogenetically grouped within the angiosperm monoterpene synthase/subfamily. After its expression in Escherichia coli and enzyme assay with prenyl diphosphates as substrates, the enzyme encoded by the putative C. tenuipilum monoterpene synthase gene was shown to specifically convert geranyl diphosphate to geraniol as a single product by GC-MS analysis. Biochemical characterization of the partially purified recombinant protein revealed a strong dependency for Mg2+ and Mn2+, and an apparent Michaelis constant of 55.8 microM for geranyl diphosphate. Thus, a new member of the monoterpene synthase family was identified and designated as CtGES. The genome contains a single copy of CtGES gene. Expression of CtGES was exclusively observed in the geraniol chemotype of C. tenuipilum. Furthermore, in situ hybridization analysis demonstrated that CtGES mRNA was localized in the oil cells of the leaves. PMID:15680985

  20. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.)

    PubMed Central

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-01-01

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar ‘EP6392’ which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296

  1. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.).

    PubMed

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-01-01

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar 'EP6392' which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296

  2. Effects of bacterial ACC deaminase on Brassica napus gene expression.

    PubMed

    Stearns, Jennifer C; Woody, Owen Z; McConkey, Brendan J; Glick, Bernard R

    2012-05-01

    Plants in association with plant growth-promoting rhizobacteria can benefit from lower plant ethylene levels through the action of the bacterial enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase. This enzyme cleaves the immediate biosynthetic precursor of ethylene, ACC. Ethylene is responsible for many aspects of plant growth and development but, under stressful conditions, it exacerbates stress symptoms. The ACC deaminase-containing bacterium Pseudomonas putida UW4 is a potent plant growth-promoting strain and, as such, was used to elaborate the detailed role of bacterial ACC deaminase in Brassica napus (canola) plant growth promotion. Transcriptional changes in bacterially treated canola plants were investigated with the use of an Arabidopsis thaliana oligonucleotide microarray. A heterologous approach was necessary because there are few tools available at present to measure global expression changes in nonmodel organisms, specifically with the sensitivity of microarrays. The results indicate that the transcription of genes involved in plant hormone regulation, secondary metabolism, and stress response was altered in plants by the presence of the bacterium, whereas the upregulation of genes for auxin response factors and the downregulation of stress response genes was observed only in the presence of bacterial ACC deaminase. These results support the suggestion that there is a direct link between ethylene and the auxin response, which has been suggested from physiological studies, and provide more evidence for the stress-reducing benefits of ACC deaminase-expressing plant growth-promoting bacteria. PMID:22352713

  3. Ethylene is Involved in Brassinosteroids Induced Alternative Respiratory Pathway in Cucumber (Cucumis sativus L.) Seedlings Response to Abiotic Stress

    PubMed Central

    Wei, Li-Jie; Deng, Xing-Guang; Zhu, Tong; Zheng, Ting; Li, Peng-Xu; Wu, Jun-Qiang; Zhang, Da-Wei; Lin, Hong-Hui

    2015-01-01

    Effects of brassinosteroids (BRs) on cucumber (Cucumis sativus L.) abiotic stresses resistance to salt, polyethylene glycol (PEG), cold and the potential mechanisms were investigated in this work. Previous reports have indicated that BRs can induce ethylene production and enhance alternative oxidase (AOX) pathway. The mechanisms whether ethylene is involved as a signal molecule which connected BR with AOX in regulating stress tolerance are still unknown. Here, we found that pretreatment with 1 μM brassinolide (BL, the most active BRs) relieved stress-caused oxidative damage in cucumber seedlings and clearly enhanced the capacity of AOX and the ethylene biosynthesis. Furthermore, transcription level of ethylene signaling biosynthesis genes including ripening-related ACC synthase1 (CSACS1), ripening-related ACC synthase2 (CSACS2), ripening-related ACC synthase3 (CSACS3), 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2), and CSAOX were increased after BL treatment. Importantly, the application of the salicylhydroxamic acid (SHAM, AOX inhibitor) and ethylene biosynthesis inhibitor aminooxyacetic acid (AOA) decreased plant resistance to environmental stress by blocking BRs-induced alternative respiration. Taken together, our results demonstrated that ethylene was involved in BRs-induced AOX activity which played important roles in abiotic stresses tolerance in cucumber seedlings. PMID:26617622

  4. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research. PMID:26638491

  5. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed Central

    Jin, S; Sonenshein, A L

    1994-01-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ. Images PMID:8045899

  6. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses.

    PubMed

    Schwerdt, Julian G; MacKenzie, Katrin; Wright, Frank; Oehme, Daniel; Wagner, John M; Harvey, Andrew J; Shirley, Neil J; Burton, Rachel A; Schreiber, Miriam; Halpin, Claire; Zimmer, Jochen; Marshall, David F; Waugh, Robbie; Fincher, Geoffrey B

    2015-07-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  7. Plant–Agrobacterium interaction mediated by ethylene and super-Agrobacterium conferring efficient gene transfer

    PubMed Central

    Nonaka, Satoko; Ezura, Hiroshi

    2014-01-01

    Agrobacterium tumefaciens has a unique ability to transfer genes into plant genomes. This ability has been utilized for plant genetic engineering. However, the efficiency is not sufficient for all plant species. Several studies have shown that ethylene decreased the Agrobacterium-mediated transformation frequency. Thus, A. tumefaciens with an ability to suppress ethylene evolution would increase the efficiency of Agrobacterium-mediated transformation. Some studies showed that plant growth-promoting rhizobacteria (PGPR) can reduce ethylene levels in plants through 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, which cleaves the ethylene precursor ACC into α-ketobutyrate and ammonia, resulting in reduced ethylene production. The whole genome sequence data showed that A. tumefaciens does not possess an ACC deaminase gene in its genome. Therefore, providing ACC deaminase activity to the bacteria would improve gene transfer. As expected, A. tumefaciens with ACC deaminase activity, designated as super-Agrobacterium, could suppress ethylene evolution and increase the gene transfer efficiency in several plant species. In this review, we summarize plant–Agrobacterium interactions and their applications for improving Agrobacterium-mediated genetic engineering techniques via super-Agrobacterium. PMID:25520733

  8. Surrogate Splicing for Functional Analysis of Sesquiterpene Synthase Genes1[w

    PubMed Central

    Wu, Shuiqin; Schoenbeck, Mark A.; Greenhagen, Bryan T.; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M.; Chappell, Joseph

    2005-01-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing β-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for α-barbatene, thujopsene, and β-chamigrene biosynthesis. PMID:15965019

  9. Characterization of ACC deaminase gene in Pseudomonas entomophila strain PS-PJH isolated from the rhizosphere soil.

    PubMed

    Kamala-Kannan, Seralathan; Lee, Kui-Jae; Park, Seung-Moon; Chae, Jong-Chan; Yun, Bong-Sik; Lee, Yong Hoon; Park, Yool-Jin; Oh, Byung-Taek

    2010-04-01

    The enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase cleaves the ethylene precursor ACC into alpha-ketobutyrate and ammonia. The decreased level of ethylene allows the plant to be more resistant to a wide environmental stress including plant pathogens. In the present study, we characterized the ACC deaminase activity of a Pseudomonas entomophila strain PS-PJH isolated from the red pepper rhizosphere region of red pepper grown at Jinan, Korea. The isolate produced 23.8 +/- 0.4 micromol of alpha-ketobutyrate/mg of protein/h during ACC deamination under in vitro conditions. Polymerase chain reaction for acdS gene showed that the isolated P. entomophila strain PS-PJH carry sequences similar to the known acdS genes. Results of the multiple sequence alignment revealed >99% identity (nucleotide and amino acid) with acdS gene of Pseudomonas putida strains AM15 and UW4. The isolated bacteria promoted 43.3 and 34.1% of growth in Raphanus sativus and Lactuca sativa plants, respectively. Based on the 16S-23S internal transcribed spacer region sequences, the isolate was identified as P. entomophila. To the best of our knowledge this is the first study to report the acdS gene in P. entomophila. PMID:20082369

  10. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    PubMed

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  11. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    PubMed Central

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  12. Molecular characterization of a Phi-class mustard (Brassica juncea) glutathione S-transferase gene in Arabidopsis thaliana by 5'-deletion analysis of its promoter.

    PubMed

    Gong, Haibiao; Hu, Wen-Wei; Jiao, Yuxia; Pua, Eng-Chong

    2005-09-01

    Glutathione S-transferases (GSTs) are regulated by various stimuli at the transcriptional level. In this study, a 2,640-bp promoter sequence of a mustard GST gene, BjGSTF2, was cloned. Several truncated BjGSTF2 promoters were generated by 5'-deletion, fused to the beta-glucuronidase (GUS) coding sequence and the chimeric genes expressed in Arabidopsis thaliana. Transgene expression in GST2623::GUS plants carrying the longest promoter varied considerably. GUS activity was high in the roots, cotyledons, anthers and both ends of the silique, but it was low or barely detectable in the leaves, seeds, petals and stamens. Analysis of transgenic plants expressing the GUS gene under the control of different truncated BjGSTF2 promoters revealed several regions that possessed cis-acting elements required for the basal and induced expression by H(2)O(2), salicylic acid and 1-aminocyclopropane-1-carboxylate and down-regulation by spermidine. The results also showed that the GUS activity of GST2623::GUS coincided well with the H(2)O(2) accumulation pattern in cultured leaf-disc explants during the regeneration process. PMID:15926064

  13. Expression of ipt gene controlled by an ethylene and auxin responsive fragment of the LEACO1 promoter increases flower number in transgenic Nicotiana tabacum.

    PubMed

    Khodakovskaya, Mariya; Zhao, Degang; Smith, William; Li, Yi; McAvoy, Richard

    2006-11-01

    Cytokinins play important roles in regulating plant growth and development. A new genetic construct for regulating cytokinin content in plant cells was cloned and tested. The gene coding for isopentenyl transferase (ipt) was placed under the control of a 0.821 kb fragment of the 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene promoter from Lycopersicon esculentum (LEACO1) and introduced into Nicotiana tabacum (cv. Havana). Some LEACO1(0.821) (kb)-ipt transgenic plant lines displayed normal shoot morphology but with a dramatic increase in the number of flower buds compared to nontransgenic plants. Other transgenic lines produced excessive lateral branch development but no change in flower bud number. Isolated leaves of transgenic tobacco plants showed a significantly prolonged retention of chlorophyll under dark incubation (25 degrees C for 20 days). Leaves of nontransformed plants senesced gradually under the same conditions. Experiments with LEACO1(0.821) (kb)-gus transgenic tobacco plants suggested auxin and ethylene involvement in induction of LEACO1(0.821) (kb) promoter activity. Multiple copies of nucleotide base sequences associated with either ethylene or auxin response elements were identified in the LEACO1(0.821) (kb) promoter fragment. The LEACO1(0.821) (kb)-ipt fusion gene appears to have potential utility for improving certain ornamental and agricultural crop species by increasing flower bud initiation and altering branching habit. PMID:16786314

  14. Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene

    SciTech Connect

    Feinbaum, R.L.; Ausubel, F.M.

    1988-05-01

    The authors cloned an Arabiodpsis thaliana chalcone synthase (CHS) gene on the basis of cross-hybridization with a Petroselinum hortense CHS cDNA clone. The protein sequence deduced from the A. thaliana CHS DNA sequence is at least 85% homologous to the CHS sequences from P. hortense, Antirrhinum majus, and Petunia hybrida. Southern blot analysis indicated that CHS is a single-copy gene in A. thaliana. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time. The accumulation of CHS mRNA in response to high-intensity light was due, at least in part, to an increased rate of transcription of the CHS gene as demonstrated by nuclear runoff experiment.

  15. Compensation for a Mutated Auxin Biosynthesis Gene of Agrobacterium Ti Plasmid A66 in Nicotiana glutinosa Does Not Result from Increased Auxin Accumulation.

    PubMed

    Campell, B R; Su, L Y; Pengelly, W L

    1989-04-01

    Nicotiana glutinosa compensated for a mutated tumor-morphology-shooty (tms) (auxin biosynthesis) locus of Agrobacterlum tumefaciens strain A66 and showed the same virulent tumor response to infection by strain A66 or the wild-type strain A6. Cloned cell lines transformed by strains A6 or A66 were fully hormone independent in culture and grew rapidly as friable, unorganized tissues on hormone-free growth medium. Growth of N. glutinosa tumor cells was inhibited by addition of alpha-naphthaleneacetic acid to the growth medium, and A6- and A66-transformed cells showed similar dose responses to this auxin. On the other hand, A6-transformed cells contained much higher levels of indole-3-acetic acid (IAA) and 1-aminocyclopropane-1-carboxylic acid (ACC) than A66-transformed cells. Differences in IAA and ACC levels in N. glutinosa tumor lines were consistent with the expected activity of the tms locus and were quantitatively similar to results obtained previously with A6- and A66-transformed cells of Nicotiana tabacum, which does not compensate for mutated tms genes. Thus, compensation for mutated tms genes in N. glutinosa did not result from increased auxin accumulation and did not appear to be related to the capacity of this host for auxin biosynthesis. PMID:16666706

  16. Ethylene Signaling Negatively Regulates Freezing Tolerance by Repressing Expression of CBF and Type-A ARR Genes in Arabidopsis[W][OA

    PubMed Central

    Shi, Yiting; Tian, Shouwei; Hou, Lingyan; Huang, Xiaozhen; Zhang, Xiaoyan; Guo, Hongwei; Yang, Shuhua

    2012-01-01

    The phytohormone ethylene regulates multiple aspects of plant growth and development and responses to environmental stress. However, the exact role of ethylene in freezing stress remains unclear. Here, we report that ethylene negatively regulates plant responses to freezing stress in Arabidopsis thaliana. Freezing tolerance was decreased in ethylene overproducer1 and by the application of the ethylene precursor 1-aminocyclopropane-1-carboxylic acid but increased by the addition of the ethylene biosynthesis inhibitor aminoethoxyvinyl glycine or the perception antagonist Ag+. Furthermore, ethylene-insensitive mutants, including etr1-1, ein4-1, ein2-5, ein3-1, and ein3 eil1, displayed enhanced freezing tolerance. By contrast, the constitutive ethylene response mutant ctr1-1 and EIN3-overexpressing plants exhibited reduced freezing tolerance. Genetic and biochemical analyses revealed that EIN3 negatively regulates the expression of CBFs and type-A Arabidopsis response regulator5 (ARR5), ARR7, and ARR15 by binding to specific elements in their promoters. Overexpression of these ARR genes enhanced the freezing tolerance of plants. Thus, our study demonstrates that ethylene negatively regulates cold signaling at least partially through the direct transcriptional control of cold-regulated CBFs and type-A ARR genes by EIN3. Our study also provides evidence that type-A ARRs function as key nodes to integrate ethylene and cytokinin signaling in regulation of plant responses to environmental stress. PMID:22706288

  17. Interspecific Variation in the Promoter Region of A Sucrose Synthase Gene in the Genus Saccharum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sucrose synthase is an important enzyme of sucrose metabolism in sugarcane, a polyploid interspecific hybrid of the genus Saccharum. One of the genes for sucrose synthase (Sus2, homologous to maize Sh1) is more highly expressed in sucrose-storing hybrids than in low sucrose S. spontaneum. We amplifi...

  18. MOLECULAR CLONING AND CHARACTERIZATION OF CHROMOSOME-ENCODED CITRATE SYNTHASE GENE FROM SINORHIZOBIUM FREDII USDA257

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Citrate synthase, a key metabolic enzyme that condenses acetyl-CoA and oxaloacetate to citrate, plays an important role in nodulation and nitrogen fixation. We have isolated a citrate synthase gene by screening a Sinorhizobium fredii USDA257 cosmid library with a heterologous probe from S. meliloti....

  19. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.

    2007-01-01

    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  20. Identification and characterization of a novel gene (CTPsH) homologous to murine CTP synthase gene

    SciTech Connect

    Yang, B.Z.; Dng, J.H.; Roe, C.R.

    1994-09-01

    CTP synthase (CTPs) plays an important role in pyrimidine metabolism in eukaryotic cells. Alteration of this enzyme was associated with multidrug resistant phenotype of cancer cells to several cytotoxic pyrimidine ribonucleosides. In order to elucidate the mechanism of this type of drug resistance, a murine CTP synthase cDNA has been previously isolated from a mouse liver cDNA library. Here report the identification of a new gene which is highly similar to mouse CTPs gene. A cDNA clone, designated CTPsH, contained an open reading frame of 1758 nucleotides that predicts a polypeptide of 586 amino acids with an M(r) of 66,002.6. The predicted amino acid sequence shares 79% identity with mouse liver CTPs gene. Both genes are expressed in a wide variety of tissues, as judged by RNA blot analysis, but the relative levels of the two mRNAs differ. So far this is the only gene which shares many features with murine CTPs gene. The availability of the CTPsH would provide an opportunity to characterize the biological function of this gene. The possible role of this new gene (CTPsH) in drug resistance of malignant cells is under investigation.

  1. Plasticity and Evolution of (+)-3-Carene Synthase and (−)-Sabinene Synthase Functions of a Sitka Spruce Monoterpene Synthase Gene Family Associated with Weevil Resistance*

    PubMed Central

    Roach, Christopher R.; Hall, Dawn E.; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (−)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (−)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (−)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. PMID:25016016

  2. Identification of a second cellulose synthase gene (acsAII) in Acetobacter xylinum.

    PubMed Central

    Saxena, I M; Brown, R M

    1995-01-01

    A second cellulose synthase gene (acsAII) coding for a 175-kDa polypeptide that is similar in size and sequence to the acsAB gene product has been identified in Acetobacter xylinum AY201. Evidence for the presence of this gene was obtained during analysis of A. xylinum mutants in which the acsAB gene was disrupted (I.M. Saxena, K. Kudlicka, K. Okuda, and R.M. Brown, Jr., J. Bacteriol. 176:5735-5752, 1994). Although these mutants produced no detectable cellulose, they exhibited significant cellulose synthase activity in vitro. The acsAII gene was isolated by using an acsAB gene fragment as a probe. The acsAII gene coded for cellulose synthase activity as determined from sequence analysis and study of mutants in which this gene was disrupted. A mutant in which only the acsAII gene was disrupted showed no significant differences in either the in vivo cellulose production or the in vitro cellulose synthase activity compared with wild-type cells. Mutants in which both the acsAII and acsAB genes were disrupted produced no cellulose in vivo and exhibited negligible cellulose synthase activity in vitro, thus confirming that the cellulose synthase activity observed in the acsAB mutants was coded by the acsAII gene. These results establish the presence of an additional gene for cellulose synthase expressed in cells of A. xylinum, yet this gene is not required for cellulose production when cells are grown under laboratory conditions. PMID:7665515

  3. Cellulose synthase gene expression profiling of Physcomitrella patens.

    PubMed

    Tran, M L; Roberts, A W

    2016-05-01

    The cellulose synthase (CESA) gene family of seed plants comprises six clades that encode isoforms with conserved expression patterns and distinct functions in cellulose synthesis complex (CSC) formation and primary and secondary cell wall synthesis. In mosses, which have rosette CSCs like those of seed plants but lack lignified secondary cell walls, the CESA gene family diversified independently and includes no members of the six functionally distinct seed plant clades. There are seven CESA isoforms encoded in the genome of the moss Physcomitrella patens. However, only PpCESA5 has been characterised functionally, and little information is available on the expression of other PpCESA family members. We have profiled PpCESA expression through quantitative RT-PCR, analysis of promoter-reporter lines, and cluster analysis of public microarray data in an effort to identify expression and co-expression patterns that could help reveal the functions of PpCESA isoforms in protein complex formation and development of specific tissues. In contrast to the tissue-specific expression observed for seed plant CESAs, each of the PpCESAs was broadly expressed throughout most developing tissues. Although a few statistically significant differences in expression of PpCESAs were noted when some tissues and hormone treatments were compared, no strong co-expression patterns were observed. Along with CESA phylogenies and lack of single PpCESA mutant phenotypes reported elsewhere, broad overlapping expression of the PpCESAs indicates a high degree of inter-changeability and is consistent with a different pattern of functional specialisation in the evolution of the seed plant and moss CESA families. PMID:26572930

  4. Molecular and biochemical characterization of benzalacetone synthase and chalcone synthase genes and their proteins from raspberry (Rubus idaeus L.).

    PubMed

    Zheng, Desen; Hrazdina, Geza

    2008-02-15

    Two new members of the polyketide synthase (PKS) gene family (RiPKS4 and RiPKS5) were cloned from raspberry fruits (Rubus idaeus L., cv Royalty) and expressed in Escherichia coli. Characterization of the recombinant enzyme products indicated that RiPKS4 is a bifunctional polyketide synthase producing both 4-hydroxybenzalacetone and naringenin chalcone. The recombinant RiPKS4 protein, like the native protein from raspberry fruits [W. Borejsza-Wysocki, G. Hrazdina, Plant Physiol. 1996;110: 791-799] accepted p-coumaryl-CoA and ferulyl-CoA as starter substrates and catalyzed the formation of both naringenin chalcone, 4-hydroxy-benzalacetone and 3-methoxy-4-hydroxy-benzalacetone. Although activity of RiPKS4 was higher with ferulyl-CoA than with p-coumaryl-CoA, the corresponding product, 3-methoxy-4-hydroxy phenylbutanone could not be detected in raspberries to date. Sequence analysis of the genes and proteins suggested that this feature of RiPKS4 was created by variation in the C-terminus due to DNA recombination at the 3' region of its coding sequence. RiPKS5 is a typical chalcone synthase (CHS) that uses p-coumaryl-CoA only as starter substrate and produces naringenin chalcone exclusively as the reaction product. PMID:18068110

  5. Molecular Evolution and Functional Divergence of Soluble Starch Synthase Genes in Cassava (Manihot Esculenta Crantz)

    PubMed Central

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes. PMID:23888108

  6. Arabidopsis thaliana contains a single gene encoding squalene synthase.

    PubMed

    Busquets, Antoni; Keim, Verónica; Closa, Marta; del Arco, Ana; Boronat, Albert; Arró, Montserrat; Ferrer, Albert

    2008-05-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate (FPP) to produce squalene (SQ), the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. Arabidopsis thaliana contains two SQS-annotated genomic sequences, At4g34640 (SQS1) and At4g34650 (SQS2), organized in a tandem array. Here we report that the SQS1 gene is widely expressed in all tissues throughout plant development, whereas SQS2 is primarily expressed in the vascular tissue of leaf and cotyledon petioles, and the hypocotyl of seedlings. Neither the complete A. thaliana SQS2 protein nor the chimeric SQS resulting from the replacement of the 69 C-terminal residues of SQS2 by the 111 C-terminal residues of the Schizosaccharomyces pombe SQS were able to confer ergosterol prototrophy to a Saccharomyces cerevisiae erg9 mutant strain lacking SQS activity. A soluble form of SQS2 expressed in Escherichia coli and purified was unable to synthesize SQ from FPP in the presence of NADPH and either Mg2+ or Mn2+. These results demonstrated that SQS2 has no SQS activity, so that SQS1 is the only functional SQS in A. thaliana. Mutational studies revealed that the lack of SQS activity of SQS2 cannot be exclusively attributed to the presence of an unusual Ser replacing the highly conserved Phe at position 287. Expression of green fluorescent protein (GFP)-tagged versions of SQS1 in onion epidermal cells demonstrated that SQS1 is targeted to the endoplasmic reticulum (ER) membrane and that this location is exclusively dependent on the presence of the SQS1 C-terminal hydrophobic trans-membrane domain. PMID:18236008

  7. Functional Inducible Nitric Oxide Synthase Gene Variants Associate With Hypertension

    PubMed Central

    Nikkari, Seppo T.; Määttä, Kirsi M.; Kunnas, Tarja A.

    2015-01-01

    Abstract Increased inducible nitric oxide synthase (iNOS) activity and expression has been associated with hypertension, but less is known whether the 2 known functional polymorphic sites in the iNOS gene (g.–1026 C/A (rs2779249), g.2087 G/A (rs2297518)) affect susceptibility to hypertension. The objective of this study was to investigate the association between the genetic variants of iNOS and diagnosed hypertension in a Finnish cohort. This study included 320 hypertensive cases and 439 healthy controls. All participants were 50-year-old men and women and the data were collected from the Tampere adult population cardiovascular risk study (TAMRISK). DNA was extracted from buccal swabs and iNOS single nucleotide polymorphisms (SNPs) were analyzed using KASP genotyping PCR. Data analysis was done by logistic regression. At the age of 50 years, the SNP rs2779249 (C/A) associated significantly with hypertension (P = 0.009); specifically, subjects carrying the A-allele had higher risk of hypertension compared to those carrying the CC genotype (OR = 1.47; CI = 1.08–2.01; P = 0.015). In addition, a 15-year follow-up period (35, 40, and 45 years) of the same individuals showed that carriers of the A-allele had more often hypertension in all of the studied age-groups. The highest risk for developing hypertension was obtained among 35-year-old subjects (odds ratio [OR] 3.83; confidence interval [CI] = 1.20–12.27; P = 0.024). Those carrying variant A had also significantly higher readings of both systolic (P = 0.047) and diastolic (P = 0.048) blood pressure during the follow-up. No significant associations between rs2297518 (G/A) variants alone and hypertension were found. However, haplotype analysis of rs2779249 and rs2297518 revealed that individuals having haplotype H3 which combines both A alleles (CA–GA, 19.7% of individuals) was more commonly found in the hypertensive group than in the normotensive group (OR = 2.01; CI = 1

  8. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F

    1980-01-01

    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  9. A novel allele of monoecious (m) locus is responsible for elongated fruit shape and perfect flowers in cucumber (Cucumis sativus L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In cucumber (Cucumis sativus L.), sex determination is controlled primarily by the F (female) and M (monoecy) loci. Homozygous recessive mm plants bear bisexual (perfect) flowers and the fruits are often round shaped. CsACS2 encoding the 1-aminocyclopropane-1-carboxylic acid synthase has been shown ...

  10. Regulation of the cellulose synthase-like gene family by light in the maize mesocotyl.

    PubMed

    van Erp, Harrie; Walton, Jonathan D

    2009-03-01

    The cellulose synthase-like (ZmCSL) gene family of maize was annotated and its expression studied in the maize mesocotyl. A total of 28 full-length CSL genes and another 13 partial sequences were annotated; four are predicted to be pseudogenes. Maize has all of the CSL subfamilies that are present in rice, but the CSLC subfamily is expanded from 6 in rice to 12 in maize, and the CSLH subfamily might be reduced from 3 to 1. Unlike rice, maize has a gene in the CSLG subfamily, based on its sequence similarity to two genes annotated as CSLG in poplar. Light regulation of glycan synthase enzyme activities and CSL gene expression were analyzed in the mesocotyl. A Golgi-localized glucan synthase activity is reduced by ~50% 12 h after exposure to light. beta-1,4-Mannan synthase activity is reduced even more strongly (>85%), whereas beta-1,4-xylan synthase, callose synthase, and latent IDPase activity respond only slightly, if at all, to light. At least 17 of the CSL genes (42%) are expressed in the mesocotyl, of which four are up-regulated at least twofold, seven are down-regulated at least twofold, and six are not affected by light. The results contribute to our understanding of the structure of the CSL gene family in an important food and biofuel plant, show that a large percentage of the CSL genes are expressed in the specialized tissues of the mesocotyl, and demonstrate that members of the CSL gene family are differentially subject to photobiological regulation. PMID:19130077

  11. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  12. Characterization of Two Polyketide Synthase Genes Involved in Zearalenone Biosynthesis in Gibberella zeae

    PubMed Central

    Gaffoor, Iffa; Trail, Frances

    2006-01-01

    Zearalenone, a mycotoxin produced by several Fusarium spp., is most commonly found as a contaminant in stored grain and has chronic estrogenic effects on mammals. Zearalenone is a polyketide derived from the sequential condensation of multiple acetate units by a polyketide synthase (PKS), but the genetics of its biosynthesis are not understood. We cloned two genes, designated ZEA1 and ZEA2, which encode polyketide synthases that participate in the biosynthesis of zearalenone by Gibberella zeae (anamorph Fusarium graminearum). Disruption of either gene resulted in the loss of zearalenone production under inducing conditions. ZEA1 and ZEA2 are transcribed divergently from a common promoter region. Quantitative PCR analysis of both PKS genes and six flanking genes supports the view that the two polyketide synthases make up the core biosynthetic unit for zearalenone biosynthesis. An appreciation of the genetics of zearalenone biosynthesis is needed to understand how zearalenone is synthesized under field conditions that result in the contamination of grain. PMID:16517624

  13. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  14. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    SciTech Connect

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  15. Isolation and partial characterization of the gene for goose fatty acid synthase.

    PubMed

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  16. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.

    PubMed

    Weiss, N; Sztejnberg, A; Yarden, O

    1996-02-01

    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  17. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    PubMed

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. PMID:25688574

  18. [Intraspecific polymorphism of the sucrose synthase genes in Russian and Kazakhstan potato cultivars].

    PubMed

    Slugina, M A; Boris, K V; Kakimzhanova, A A; Kochieva, E Z

    2014-06-01

    In 12 different Russian and Kazakhstan potato cultivars, the polymorphism of the glycosyltransferase domain of the sucrose synthase gene was first examined, as well as the polymorphism of the sucrose synthase domain fragment of the same gene in the potato cultivars of Kazakhstan breed. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions, including those not described earlier. Amino acid substitutions specific to heat- and drought-tolerant varieties were also identified and could be associated with the development of abiotic stress resistance. PMID:25715458

  19. Small-Interfering RNAs from Natural Antisense Transcripts Derived from a Cellulose Synthase Gene Modulate Cell Wall Biosynthesis in Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral-induced gene silencing of members of the cellulose synthase/cellulose synthase-like (CesA/Csl) gene superfamily in barley (Hordeum vulgare cv. Blackhulless) using the Barley Stripe Mosaic Virus reduced theincorporation of D-14C-Glc into cellulose and into mixed-linkage (1'3),(1'4)-'-D-glucans ...

  20. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host.

    PubMed

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin-ya, Kazuo; Cane, David E; Ikeda, Haruo

    2015-06-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match with any known compounds in spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11) and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported. PMID:25605043

  1. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host

    PubMed Central

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin’ya, Kazuo; Cane, David E.; Ikeda, Haruo

    2016-01-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match any known compounds in the spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11), and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported. PMID:25605043

  2. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    PubMed Central

    2009-01-01

    In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence. PMID:21637458

  3. Recent Progress on the Construction and Testing of a Fusion Poly(hydroxyalkanoate) Synthase Gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poly(hydroxyalkanoates) (PHAs) are biodegradable polyesters produced by some bacteria. Two genes in Allochromatium vinosum, phaE and phaC, respectively code for the two subunits of the enzyme complex, PHA synthase, which catalyzes the polymerization of precursors into PHA. We hypothesized that by ...

  4. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  5. Interactions between ethylene and auxin are crucial to the control of grape (Vitis vinifera L.) berry ripening

    PubMed Central

    2013-01-01

    Background Fruit development is controlled by plant hormones, but the role of hormone interactions during fruit ripening is poorly understood. Interactions between ethylene and the auxin indole-3-acetic acid (IAA) are likely to be crucial during the ripening process, since both hormones have been shown to be implicated in the control of ripening in a range of different fruit species. Results Grapevine (Vitis vinifera L.) homologues of the TRYPTOPHAN AMINOTRANSFERASE RELATED (TAR) and YUCCA families, functioning in the only characterized pathway of auxin biosynthesis, were identified and the expression of several TAR genes was shown to be induced by the pre-ripening application of the ethylene-releasing compound Ethrel. The induction of TAR expression was accompanied by increased IAA and IAA-Asp concentrations, indicative of an upregulation of auxin biosynthesis and conjugation. Exposure of ex planta, pre-ripening berries to the ethylene biosynthesis inhibitor aminoethoxyvinylglycine resulted in decreased IAA and IAA-Asp concentrations. The delayed initiation of ripening observed in Ethrel-treated berries might therefore represent an indirect ethylene effect mediated by increased auxin concentrations. During berry development, the expression of three TAR genes and one YUCCA gene was upregulated at the time of ripening initiation and/or during ripening. This increase in auxin biosynthesis gene expression was preceded by high expression levels of the ethylene biosynthesis genes 1-aminocyclopropane-1-carboxylate synthase and 1-aminocyclopropane-1-carboxylate oxidase. Conclusions In grape berries, members of both gene families involved in the two-step pathway of auxin biosynthesis are expressed, suggesting that IAA is produced through the combined action of TAR and YUCCA proteins in developing berries. The induction of TAR expression by Ethrel applications and the developmental expression patterns of auxin and ethylene biosynthesis genes indicate that elevated

  6. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006

    PubMed Central

    Gamez, Rocío M.; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David

    2016-01-01

    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds. PMID:27151797

  7. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006.

    PubMed

    Gamez, Rocío M; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David; Mariño-Ramírez, Leonardo

    2016-01-01

    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds. PMID:27151797

  8. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes. PMID:10369673

  9. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids

    PubMed Central

    Zavala, Kattina; Opazo, Juan C.

    2015-01-01

    Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas). Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense). We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation. PMID:26181912

  10. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13,3

    SciTech Connect

    Lehto, M. Helsinki Univ. ); Stoffel, M.; Espinosa, R. III; Beau, M.M. le; Bell, G.I. ); Groop, L. )

    1993-02-01

    The enzyme glycogen synthase (UDP glocose:glycogen 4-[alpha]-D-glucosyltransferase, EC 2.4.1.11) catalyzes the formation of glycogen from uridine diphosphate glucose (UPDG). Impaired activation of muscle glycogen synthase by insulin has been noted in patients with genetic risk of developing non-insulin-dependent diabets mellitus (NIDDM) and this may represent an early defect in the pathogenesis of this disorder. As such, glycogen synthase represents a candidate gene for contributing to genetic susceptibility. As a first step in studying the role of glycogen synthase in the genetics of NIDDM, we have isolated a cosmid encoding the human glycogen synthase gene (gene symbol GYS) and determined its chromosomal localization by fluorescence in situ hybridization. 4 refs., 1 fig.

  11. Identification of 6-Hydroxymellein Synthase and Accessory Genes in the Lichen Cladonia uncialis.

    PubMed

    Abdel-Hameed, Mona; Bertrand, Robert L; Piercey-Normore, Michele D; Sorensen, John L

    2016-06-24

    A transcribed polyketide synthase (PKS) gene has been identified in the lichen Cladonia uncialis. The complete nucleotide sequence of this PKS was determined from the amplified cDNA, and an assignment of individual domains was accomplished by homology searching using AntiSMASH. A scan of the complete genome sequence of C. uncialis revealed the accessory genes associated with this PKS gene. A homology search has identified that several genes in this cluster are similar to genes responsible for the biosynthesis of terrein in Aspergillus terreus. This permitted assignment of putative function to each of the genes in this new C. uncialis cluster. It is proposed that this gene cluster is responsible for the biosynthesis of a halogenated iscoumarin. This is the first report linking a gene cluster to a halogenated metabolite in lichen. PMID:27264554

  12. Expression of cellulose synthase-like (Csl) genes in insect cells reveals that CslA family members encode mannan synthases

    PubMed Central

    Liepman, Aaron H.; Wilkerson, Curtis G.; Keegstra, Kenneth

    2005-01-01

    Glucuronoarabinoxylan, xyloglucan, and galactomannan are noncellulosic polysaccharides found in plant cell walls. All consist of β-linked glycan backbones substituted with sugar side chains. Although considerable progress has been made in characterizing the structure of these polysaccharides, little is known about the biosynthetic enzymes that produce them. Cellulose synthase-like (Csl) genes are hypothesized to encode Golgi-localized β-glycan synthases that polymerize the backbones of noncellulosic polysaccharides. To investigate this hypothesis, we used heterologous expression in Drosophila Schneider 2 (S2) cells to systematically analyze the functions of the gene products of a group of Csl genes from Arabidopsis and rice (Oryza sativa L.), including members from five Csl gene families (CslA, CslC, CslD, CslE, and CslH). Our analyses indicate that several members of the CslA gene family encode β-mannan synthases. Recombinant CslA proteins produce β-linked mannan polymers when supplied GDP-mannose. The same proteins can produce β-linked glucomannan heteropolymers when supplied both GDP-mannose and GDP-glucose. One CslA protein also produced β-linked glucan polymers when supplied GDP-glucose alone. Heterologous expression studies of additional candidate glycan synthases in insect cells or other systems may help identify other noncellulosic polysaccharide biosynthetic enzymes. PMID:15647349

  13. Arabidopsis MYC2 Interacts with DELLA Proteins in Regulating Sesquiterpene Synthase Gene Expression[W][OA

    PubMed Central

    Hong, Gao-Jie; Xue, Xue-Yi; Mao, Ying-Bo; Wang, Ling-Jian; Chen, Xiao-Ya

    2012-01-01

    Arabidopsis thaliana flowers emit volatile terpenes, which may function in plant–insect interactions. Here, we report that Arabidopsis MYC2, a basic helix-loop-helix transcription factor, directly binds to promoters of the sesquiterpene synthase genes TPS21 and TPS11 and activates their expression. Expression of TPS21 and TPS11 can be induced by the phytohormones gibberellin (GA) and jasmonate (JA), and both inductions require MYC2. The induction of TPS21 and TPS11 results in increased emission of sesquiterpene, especially (E)-β-caryophyllene. DELLAs, the GA signaling repressors, negatively affect sesquiterpene biosynthesis, as the sesquiterpene synthase genes were repressed in plants overaccumulating REPRESSOR OF GA1-3 (RGA), one of the Arabidopsis DELLAs, and upregulated in a penta DELLA-deficient mutant. Yeast two-hybrid and coimmunoprecipitation assays demonstrated that DELLAs, represented by RGA, directly interact with MYC2. In yeast cells, the N terminus of MYC2 was responsible for binding to RGA. MYC2 has been proposed as a major mediator of JA signaling and crosstalk with abscisic acid, ethylene, and light signaling pathways. Our results demonstrate that MYC2 is also connected to GA signaling in regulating a subset of genes. In Arabidopsis inflorescences, it integrates both GA and JA signals into transcriptional regulation of sesquiterpene synthase genes and promotes sesquiterpene production. PMID:22669881

  14. Coordinate expression of transcriptionally regulated isocitrate lyase and malate synthase genes in Brassica napus L.

    PubMed Central

    Comai, L; Dietrich, R A; Maslyar, D J; Baden, C S; Harada, J J

    1989-01-01

    We have analyzed the temporal and spatial expression of genes encoding the glycoxylate cycle enzymes isocitrate lyase and malate synthase in Brassica napus L. to determine whether they are coordinately expressed. Both enzymes participate in reactions associated with lipid mobilization in oilseed plant seedlings and are sequestered in a specialized organelle, the glyoxysome. We have identified an isocitrate lyase cDNA clone containing the complete protein coding region. RNA blot and in situ hybridization studies with isocitrate lyase and malate synthase cDNA clones from B. napus showed that the genes exhibit similar expression patterns. The mRNAs begin to accumulate during late embryogeny, reach maximal levels in seedling cotyledons, are not detected at significant amounts in leaves, and are distributed similarly in cotyledons and axes of seedlings. Furthermore, transcription studies with isolated nuclei indicate that the genes are controlled primarily although not exclusively at the transcriptional level. We conclude that glyoxysome biogenesis is regulated in part through the coordinate expression of isocitrate lyase and malate synthase genes. PMID:2535504

  15. Identification and Characterization of the Sucrose Synthase 2 Gene (Sus2) in Durum Wheat

    PubMed Central

    Volpicella, Mariateresa; Fanizza, Immacolata; Leoni, Claudia; Gadaleta, Agata; Nigro, Domenica; Gattulli, Bruno; Mangini, Giacomo; Blanco, Antonio; Ceci, Luigi R.

    2016-01-01

    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase (SUS), which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for SUS in durum wheat (cultivars Ciccio and Svevo) is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur, and 5-BIL42). The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modeling approaches. The combined results of sucrose synthase 2 expression and activity levels were then considered in the light of their possible involvement in starch yield. PMID:27014292

  16. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp

    SciTech Connect

    Schendel, F.J.; August, P.R.; Anderson, C.R.; Flickinger, M.C. ); Hanson, R.S. )

    1992-01-01

    Acetate salts are emerging as potentially attractive bulk chemicals for a variety of environmental applications, for example, as catalysts to facilitate combustion of high-sulfur coal by electrical utilities and as the biodegradable noncorrosive highway deicing salt calcium magnesium acetate. The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (M{sub r}, 84,500) with a sub unit with an M{sub r} of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes.

  17. Ethylene modulates the role of NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 in cross talk between salicylate and jasmonate signaling.

    PubMed

    Leon-Reyes, Antonio; Spoel, Steven H; De Lange, Elvira S; Abe, Hiroshi; Kobayashi, Masatomo; Tsuda, Shinya; Millenaar, Frank F; Welschen, Rob A M; Ritsema, Tita; Pieterse, Corné M J

    2009-04-01

    The plant hormones salicylic acid (SA), jasmonic acid (JA), and ethylene (ET) play crucial roles in the signaling network that regulates induced defense responses against biotic stresses. Antagonism between SA and JA operates as a mechanism to fine-tune defenses that are activated in response to multiple attackers. In Arabidopsis (Arabidopsis thaliana), NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 (NPR1) was demonstrated to be required for SA-mediated suppression of JA-dependent defenses. Because ET is known to enhance SA/NPR1-dependent defense responses, we investigated the role of ET in the SA-JA signal interaction. Pharmacological experiments with gaseous ET and the ET precursor 1-aminocyclopropane-1-carboxylic acid showed that ET potentiated SA/NPR1-dependent PATHOGENESIS-RELATED1 transcription, while it rendered the antagonistic effect of SA on methyl jasmonate-induced PDF1.2 and VSP2 expression NPR1 independent. This overriding effect of ET on NPR1 function in SA-JA cross talk was absent in the npr1-1/ein2-1 double mutant, demonstrating that it is mediated via ET signaling. Abiotic and biotic induction of the ET response similarly abolished the NPR1 dependency of the SA-JA signal interaction. Furthermore, JA-dependent resistance against biotic attackers was antagonized by SA in an NPR1-dependent fashion only when the plant-attacker combination did not result in the production of high levels of endogenous ET. Hence, the interaction between ET and NPR1 plays an important modulating role in the fine tuning of the defense signaling network that is activated upon pathogen and insect attack. Our results suggest a model in which ET modulates the NPR1 dependency of SA-JA antagonism, possibly to compensate for enhanced allocation of NPR1 to function in SA-dependent activation of PR genes. PMID:19176718

  18. Nucleotide sequence variation of chitin synthase genes among ectomycorrhizal fungi and its potential use in taxonomy.

    PubMed Central

    Mehmann, B; Brunner, I; Braus, G H

    1994-01-01

    DNA sequences of single-copy genes coding for chitin synthases (UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyltransferase; EC 2.4.1.16) were used to characterize ectomycorrhizal fungi. Degenerate primers deduced from short, completely conserved amino acid stretches flanking a region of about 200 amino acids of zymogenic chitin synthases allowed the amplification of DNA fragments of several members of this gene family. Different DNA band patterns were obtained from basidiomycetes because of variation in the number and length of amplified fragments. Cloning and sequencing of the most prominent DNA fragments revealed that these differences were due to various introns at conserved positions. The presence of introns in basidiomycetous fungi therefore has a potential use in identification of genera by analyzing PCR-generated DNA fragment patterns. Analyses of the nucleotide sequences of cloned fragments revealed variations in nucleotide sequences from 4 to 45%. By comparison of the deduced amino acid sequences, the majority of the DNA fragments were identified as members of genes for chitin synthase class II. The deduced amino acid sequences from species of the same genus differed only in one amino acid residue, whereas identity between the amino acid sequences of ascomycetous and basidiomycetous fungi within the same taxonomic class was found to be approximately 43 to 66%. Phylogenetic analysis of the amino acid sequence of class II chitin synthase-encoding gene fragments by using parsimony confirmed the current taxonomic groupings. In addition, our data revealed a fourth class of putative zymogenic chitin synthesis. Images PMID:7944356

  19. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    SciTech Connect

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. )

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  20. Cloning and transformation analysis of isoflavone synthase gene into Minshan Trifolium pratense.

    PubMed

    Hu, H H; Jing, C Q; Liu, R; Li, W D; Feng, H G

    2015-01-01

    The aim of this study was to clone the isoflavone synthase (IFS) gene and establish the recombinant Minshan Trifolium pratense. The IFS gene was cloned from the callus of Minshan T. pratense using reverse transcription-polymerase chain reaction. The plant expression vector pRI101-AN-IFS was constructed and introduced into Agrobacterium tumefaciens strain LBA4404, and then screened under cephalosporin. IFS expression was detected by reverse transcription-polymerase chain reaction. The IFS gene was cloned successfully. Sequence analysis indicated that IFS gene had high homology with similar genes from other plants. The IFS-overexpressing callus was obtained by introducing the LBA4404-harboring IFS-pRI101-AN-IFS vector into T. pratense calluses. PMID:26345862

  1. Functional Analysis of the Polyketide Synthase Genes in the Filamentous Fungus Gibberella zeae (Anamorph Fusarium graminearum)

    PubMed Central

    Gaffoor, Iffa; Brown, Daren W.; Plattner, Ron; Proctor, Robert H.; Qi, Weihong; Trail, Frances

    2005-01-01

    Polyketides are a class of secondary metabolites that exhibit a vast diversity of form and function. In fungi, these compounds are produced by large, multidomain enzymes classified as type I polyketide synthases (PKSs). In this study we identified and functionally disrupted 15 PKS genes from the genome of the filamentous fungus Gibberella zeae. Five of these genes are responsible for producing the mycotoxins zearalenone, aurofusarin, and fusarin C and the black perithecial pigment. A comprehensive expression analysis of the 15 genes revealed diverse expression patterns during grain colonization, plant colonization, sexual development, and mycelial growth. Expression of one of the PKS genes was not detected under any of 18 conditions tested. This is the first study to genetically characterize a complete set of PKS genes from a single organism. PMID:16278459

  2. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. PMID:26611530

  3. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    PubMed

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  4. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    PubMed Central

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  5. Truncating mutation in the nitric oxide synthase 1 gene is associated with infantile achalasia.

    PubMed

    Shteyer, Eyal; Edvardson, Simon; Wynia-Smith, Sarah L; Pierri, Ciro Leonardo; Zangen, Tzili; Hashavya, Saar; Begin, Michal; Yaacov, Barak; Cinamon, Yuval; Koplewitz, Benjamin Z; Vromen, Amos; Elpeleg, Orly; Smith, Brian C

    2015-03-01

    Nitric oxide is thought to have a role in the pathogenesis of achalasia. We performed a genetic analysis of 2 siblings with infant-onset achalasia. Exome analysis revealed that they were homozygous for a premature stop codon in the gene encoding nitric oxide synthase 1. Kinetic analyses and molecular modeling showed that the truncated protein product has defects in folding, nitric oxide production, and binding of cofactors. Heller myotomy had no effect in these patients, but sildenafil therapy increased their ability to drink. The finding recapitulates the previously reported phenotype of nitric oxide synthase 1-deficient mice, which have achalasia. Nitric oxide signaling appears to be involved in the pathogenesis of achalasia in humans. PMID:25479138

  6. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    PubMed

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  7. Functional Characterization of the Xanthophyllomyces dendrorhous Farnesyl Pyrophosphate Synthase and Geranylgeranyl Pyrophosphate Synthase Encoding Genes That Are Involved in the Synthesis of Isoprenoid Precursors

    PubMed Central

    Niklitschek, Mauricio; Sepúlveda, Dionisia; Rojas, María Cecilia; Baeza, Marcelo; Cifuentes, Víctor

    2014-01-01

    The yeast Xanthophyllomyces dendrorhous synthesizes the carotenoid astaxanthin, which has applications in biotechnology because of its antioxidant and pigmentation properties. However, wild-type strains produce too low amounts of carotenoids to be industrially competitive. Considering this background, it is indispensable to understand how the synthesis of astaxanthin is controlled and regulated in this yeast. In this work, the steps leading to the synthesis of the carotenoid precursor geranylgeranyl pyrophosphate (GGPP, C20) in X. dendrorhous from isopentenyl pyrophosphate (IPP, C5) and dimethylallyl pyrophosphate (DMAPP, C5) was characterized. Two prenyl transferase encoding genes, FPS and crtE, were expressed in E. coli. The enzymatic assays using recombinant E. coli protein extracts demonstrated that FPS and crtE encode a farnesyl pyrophosphate (FPP, C15) synthase and a GGPP-synthase, respectively. X. dendrorhous FPP-synthase produces geranyl pyrophosphate (GPP, C10) from IPP and DMAPP and FPP from IPP and GPP, while the X. dendrorhous GGPP-synthase utilizes only FPP and IPP as substrates to produce GGPP. Additionally, the FPS and crtE genes were over-expressed in X. dendrorhous, resulting in an increase of the total carotenoid production. Because the parental strain is diploid, the deletion of one of the alleles of these genes did not affect the total carotenoid production, but the composition was significantly altered. These results suggest that the over-expression of these genes might provoke a higher carbon flux towards carotenogenesis, most likely involving an earlier formation of a carotenogenic enzyme complex. Conversely, the lower carbon flux towards carotenogenesis in the deletion mutants might delay or lead to a partial formation of a carotenogenic enzyme complex, which could explain the accumulation of astaxanthin carotenoid precursors in these mutants. In conclusion, the FPS and the crtE genes represent good candidates to manipulate to favor

  8. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  9. Diversity of benzyl- and alkylsuccinate synthase genes in hydrocarbon-impacted environments and enrichment cultures.

    PubMed

    Callaghan, Amy V; Davidova, Irene A; Savage-Ashlock, Kristen; Parisi, Victoria A; Gieg, Lisa M; Suflita, Joseph M; Kukor, Jerome J; Wawrik, Boris

    2010-10-01

    Hydrocarbon-degrading microorganisms play an important role in the natural attenuation of spilled petroleum in a variety of anoxic environments. The role of benzylsuccinate synthase (BSS) in aromatic hydrocarbon degradation and its use as a biomarker for field investigations are well documented. The recent discovery of alkylsuccinate synthase (ASS) allows the opportunity to test whether its encoding gene, assA, can serve as a comparable biomarker of anaerobic alkane degradation. Degenerate assA- and bssA-targeted PCR primers were designed in order to survey the diversity of genes associated with aromatic and aliphatic hydrocarbon biodegradation in petroleum-impacted environments and enrichment cultures. DNA was extracted from an anaerobic alkane-degrading isolate (Desulfoglaeba alkenexedens ALDC), hydrocarbon-contaminated river and aquifer sediments, a paraffin-degrading enrichment, and a propane-utilizing mixed culture. Partial assA and bssA genes were PCR amplified, cloned, and sequenced, yielding several novel clades of assA genes. These data expand the range of alkane-degrading conditions for which relevant gene sequences are available and indicate that considerable diversity of assA genes can be found in hydrocarbon-impacted environments. The detection of genes associated with anaerobic alkane degradation in conjunction with the in situ detection of alkylsuccinate metabolites was also demonstrated. Comparable molecular signals of assA/bssA were not found when environmental metagenome databases of uncontaminated sites were searched. These data confirm that the assA gene is a useful biomarker for anaerobic alkane metabolism. PMID:20504044

  10. Identification and characterization of two chitin synthase genes in African malaria mosquito, Anopheles gambiae.

    PubMed

    Zhang, Xin; Zhang, Jianzhen; Park, Yoonseong; Zhu, Kun Yan

    2012-09-01

    Chitin synthase (CHS) represents an attractive target site for combating insect pests as insect growth and development are strictly dependent on precisely tuned chitin biosynthesis and this pathway is absent in humans and other vertebrates. Current knowledge on CHS in insects, especially their structures, functions, and regulations is still very limited. We report the identification and characterization of two chitin synthase genes, AgCHS1 and AgCHS2, in African malaria mosquito, Anopheles gambiae. AgCHS1 and AgCHS2 were predicted to encode proteins of 1,578 and 1,586 amino acid residues, respectively. Their deduced amino acid sequences show high similarities to other insect chitin synthases. Transcriptional analysis indicated that AgCHS1 was expressed in egg, larval, pupal and adult stages whereas AgCHS2 appeared to be expressed at relatively low levels, particularly during the larval stages as examined by reverse transcription (RT)-PCR and real-time quantitative PCR. Relatively high expression was detected in the carcass followed by the foregut and hindgut for AgCHS1, and the foregut (cardia included) followed by the midgut for AgCHS2. Fluorescence in situ hybridization (FISH) and immunohistochemical analysis revealed new information including the localization of the two enzymes in the ommatidia of the compound eyes, and AgCHS2 in the thoracic and abdominal inter-segmental regions of pupal integument. PMID:22683441

  11. Isolation of an Arabidopsis thaliana gene encoding cycloartenol synthase by functional expression in a yeast mutant lacking lanosterol synthase by the use of a chromatographic screen.

    PubMed

    Corey, E J; Matsuda, S P; Bartel, B

    1993-12-15

    Whereas vertebrates and fungi synthesize sterols from epoxysqualene through the intermediate lanosterol, plants cyclize epoxysqualene to cycloartenol as the initial sterol. We report the cloning and characterization of CAS1, an Arabidopsis thaliana gene encoding cycloartenol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, cycloartenol forming), EC 5.4.99.8]. A yeast mutant lacking lanosterol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, lanosterol forming), EC 5.4.99.7] was transformed with an A. thaliana cDNA yeast expression library, and colonies were assayed for epoxysqualene mutase activity by thin-layer chromatography. One out of approximately 10,000 transformants produced a homogenate that cyclized 2,3-epoxysqualene to the plant sterol cycloartenol. This activity was shown to be plasmid dependent. The plasmid insert contains a 2277-bp open reading frame capable of encoding an 86-kDa protein with significant homology to lanosterol synthase from Candida albicans and squalene-hopene cyclase (EC 5.4.99.-) from Bacillus acidocalcarius. The method used to clone this gene should be generally applicable to genes responsible for secondary metabolite biosynthesis. PMID:7505443

  12. Lanosterol Synthase Gene Polymorphisms and Changes in Endogenous Ouabain in the Response to Low Sodium Intake.

    PubMed

    Lanzani, Chiara; Gatti, Guido; Citterio, Lorena; Messaggio, Elisabetta; Delli Carpini, Simona; Simonini, Marco; Casamassima, Nunzia; Zagato, Laura; Brioni, Elena; Hamlyn, John M; Manunta, Paolo

    2016-02-01

    Circulating levels of endogenous ouabain (EO), a vasopressor hormone of adrenocortical origin, are increased by sodium depletion. Furthermore, lanosterol synthase, an enzyme involved in cholesterol biosynthesis, has a missense polymorphism (rs2254524 V642L) that affects EO biosynthesis in adrenocortical cells. Here, we investigated the hypothesis that lanosterol synthase rs2254524 alleles in vivo impact the blood pressure (BP) and EO responses evoked by a low dietary Na intake (<100 mEq/d, 2 weeks) among patients with mild essential hypertension. During the low salt diet, the declines in both systolic BP (SBP: -8.7±1.7 versus -3.0±1.5; P=0.013) and diastolic BP (DBP: -5.1±0.98 versus -1.4±0.94 mm Hg; P<0.05), and the slope of the long-term pressure-natriuresis relationship affected significantly the presence of the lanosterol synthase rs2254524 A variant (AA: 0.71±0.22, AC 0.09±0.13, and CC 0.04±0.11 mEq/mm Hg/24 h; P=0.028). In addition, BP rose in ≈25% of the patients in response to the low salt diet and this was associated with increased circulating EO. Lanosterol synthase gene polymorphisms influence both the salt sensitivity of BP and changes in circulating EO in response to a low salt diet. The response of BP and EO to the low salt diet is markedly heterogeneous. Approximately 25% of patients experienced adverse effects, that is, increased BP and EO when salt intake was reduced and may be at increased long-term risk. The augmented response of EO to the low salt diet further supports the view that adrenocortical function is abnormal in some essential hypertensives. PMID:26667413

  13. Cloning, sequencing, and enhanced expression of the dihydropteroate synthase gene of Escherichia coli MC4100.

    PubMed Central

    Dallas, W S; Gowen, J E; Ray, P H; Cox, M J; Dev, I K

    1992-01-01

    The Escherichia coli gene coding for dihydropteroate synthase (DHPS) has been cloned and sequenced. The protein has 282 amino acids and a compositional molecular mass of 30,314 daltons. Increased expression of the enzyme was realized by using a T7 expression system. The enzyme was purified and crystallized. A temperature-sensitive mutant was isolated and found to express a DHPS with a lower specific activity and lower affinities for para-aminobenzoic acid and sulfathiazole. The allele had a point mutation that changed a phenylalanine codon to a leucine codon, and the mutation was in a codon that is conserved among published DHPS sequences. Images PMID:1522070

  14. Polymerase chain reaction comparison of the gene for strictosidine synthase from ten Rauvolfia species.

    PubMed

    Bracher, D; Kutchan, T M

    1992-05-01

    The gene for strictosidine synthase, str1, has been analyzed by the polymerase chain reaction in ten species of Rauvolfia, the origins of which span the tropical belt: R. cambodiana (Indochina), R. canescens (India), R. chinensis (China), R. heterophylla (Central America), R. mannii (West Africa), R. nitida (West Indies), R. praecox (Brasil), R. serpentina (India), R. sumatrana (Indonesia) and R. verticillata (Indochina). Restriction endonuclease analysis of the gene fragments produced with genomic DNA from each of the ten species as template revealed that str1 is highly conserved in the Rauvolfia species investigated. These results suggest that there is a stringent selection pressure on the gene for this key enzyme of indole alkaloid biosynthesis. PMID:24202981

  15. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  16. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.

    2008-01-01

    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  17. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  18. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    PubMed Central

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  19. Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family.

    PubMed

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three "Arabidopsis-like" subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of oilseeds

  20. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  1. Transcriptional regulation of the squalene synthase gene (ERG9) in the yeast Saccharomyces cerevisiae.

    PubMed

    Kennedy, M A; Barbuch, R; Bard, M

    1999-04-14

    The ergosterol biosynthetic pathway is a specific branch of the mevalonate pathway. Since the cells requirement for sterols is greater than for isoprenoids, sterol biosynthesis must be regulated independently of isoprenoid biosynthesis. In this study we explored the transcriptional regulation of squalene synthase (ERG9) in Saccharomyces cerevisiae, the first enzyme dedicated to the synthesis of sterols. A mutant search was performed to identify genes that were involved in the regulation of the expression of an ERG9-lacZ promoter fusion. Mutants with phenotypes consistent with known sterol biosynthetic mutations (ERG3, ERG7, ERG24) increased expression of ERG9. In addition, treatment of wild-type cells with the sterol inhibitors zaragozic acid and ketoconazole, which target squalene synthase and the C-14 sterol demethylase respectively, also caused an increase in ERG9 expression. The data also demonstrate that heme mutants increased ERG9 expression while anaerobic conditions decreased expression. Additionally, the heme activator protein transcription factors HAP1 and HAP2/3/4, the yeast activator protein transcription factor yAP-1, and the phospholipid transcription factor complex INO2/4 regulate ERG9 expression. ERG9 expression is decreased in hap1, hap2/3/4, and yap-1 mutants while ino2/4 mutants showed an increase in ERG9 expression. This study demonstrates that ERG9 transcription is regulated by several diverse factors, consistent with the idea that as the first step dedicated to the synthesis of sterols, squalene synthase gene expression and ultimately sterol biosynthesis is highly regulated. PMID:10209263

  2. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    SciTech Connect

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  3. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    PubMed Central

    Su, Yanjing; Zhao, Guoqi; Wei, Zhenwu; Yan, Changjie; Liu, Sujiao

    2012-01-01

    Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase) and its wild type (WT) were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p<0.01) and a lower leaf blade proportion (25.21% vs 32.14%, p<0.01) than WT. Chemical composition analysis showed that BM rice straw was significantly (p<0.01) higher in CP (crude protein), hemicellulose and acid insoluble ash (AIA) contents, but lower in dry matter (DM), acid detergent fiber (ADFom) and cellulose contents when compared to WT. No significant difference (p>0.05) was detected in neutral detergent fiber (NDFom) and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05). The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05), but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants. PMID:25049629

  4. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    PubMed

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. PMID:26471689

  5. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    PubMed

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis. PMID:15190053

  6. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  7. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    PubMed

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way. PMID:21847661

  8. Mutations in the gene encoding starch synthase II profoundly alter amylopectin structure in pea embryos.

    PubMed Central

    Craig, J; Lloyd, J R; Tomlinson, K; Barber, L; Edwards, A; Wang, T L; Martin, C; Hedley, C L; Smith, A M

    1998-01-01

    Mutations at the rug5 (rugosus5) locus have been used to elucidate the role of the major soluble isoform of starch synthase II (SSII) in amylopectin synthesis in the developing pea embryo. The SSII gene maps to the rug5 locus, and the gene in one of three rug5 mutant lines has been shown to carry a base pair substitution that introduces a stop codon into the open reading frame. All three mutant alleles cause a dramatic reduction or loss of the SSII protein. The mutations have pleiotropic effects on the activities of other isoforms of starch synthase but apparently not on those of other enzymes of starch synthesis. These mutations result in abnormal starch granule morphology and amylopectin structure. Amylopectin contains fewer chains of intermediate length (B2 and B3 chains) and more very short and very long chains than does amylopectin from wild-type embryos. The results suggest that SSII may play a specific role in the synthesis of B2 and B3 chains of amylopectin. The extent to which these findings can be extrapolated to other species is discussed. PMID:9501114

  9. Cardiovascular roles of nitric oxide: A review of insights from nitric oxide synthase gene disrupted mice†

    PubMed Central

    Liu, Victor W.T.; Huang, Paul L.

    2009-01-01

    Nitric oxide (NO) is a gaseous molecule that plays many key roles in the cardiovascular system. Each of the enzymes that generate NO—neuronal, inducible and endothelial NO synthase—has been genetically disrupted in mice. This review discusses the cardiovascular phenotypes of each of the NO synthase (NOS) gene knockout mice, and the insights gained into the roles of NO in the cardiovascular system. Mice lacking the endothelial isoform are hypertensive, have endothelial dysfunction and show a more severe outcome in response to vascular injury, to stroke and cerebral ischaemia, and to diet-induced atherosclerosis. Mice lacking the neuronal isoform show a less severe outcome in response to stroke and cerebral ischaemia but have increased diet-induced atherosclerosis. Mice lacking the inducible isoform show reduced hypotension to septic shock. Together, NOS gene knockout mice have been useful tools that complement our other approaches to studying the multiple roles of NO in the cardiovascular system. PMID:17658499

  10. Sulfate metabolism in Tuber borchii: characterization of a putative sulfate transporter and the homocysteine synthase genes.

    PubMed

    Zeppa, Sabrina; Marchionni, C; Saltarelli, R; Guidi, C; Ceccaroli, P; Pierleoni, R; Zambonelli, A; Stocchi, V

    2010-04-01

    The homocysteine synthase (tbhos) and putative sulfate transporter (tbsul1) genes have been characterized in order to understand the sulfate metabolism and regulation in the ectomycorrhizal fungus Tuber borchii. The analyses of tbsul1 and tbhos nucleotide and deduced amino acid sequences led to the identification of the typical domains shown in homologous proteins. Sulfate starvation condition upregulates both genes. The real-time PCR assay of tbsul1 revealed that gene expression was about threefold higher in mycelia grown under sulfate starvation for 2 days than in the mycelial control and in the same starvation condition, the sulfate uptake increased. Real-time PCR and enzymatic assays showed regulation of tbhos when sulfur sources were lacking, suggesting that a transcriptional regulation of this gene rather than a post-transcriptional one occurred. Furthermore, the tbsul1 and tbhos expression patterns were evaluated during the truffle life cycle, revealing an over-expression in the mature ascomata for both genes. In the ectomycorrhizal tissue, only tbhos was upregulated suggesting its substantial role in T. borchii cysteine synthesis. The regulation of tbsul1 and tbhos occurs primarily at the transcriptional level both during vegetative and fruiting phases and these genes could be directly involved in VOCs production. PMID:20039042

  11. Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela.

    PubMed

    Urdaneta, L; Plowe, C; Goldman, I; Lal, A A

    1999-09-01

    The present study was designed to characterize mutations in dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) genes of Plasmodium falciparum in the Bolivar region of Venezuela, where high levels of clinical resistance to sulfadoxine-pyrimethamine (SP, Fansidar; F. Hoffman-La Roche, Basel, Switzerland) has been documented. We used a nested mutation-specific polymerase chain reaction and restriction digestion methods to measure 1) the prevalence of DHFR mutations at 16, 50, 51, 59, 108, and 164 codon positions, and 2) the prevalence of mutations in the 436, 437, 581, and 613 codon sites in DHPS gene. In the case of the DHFR gene, of the 54 parasite isolates analyzed, we detected the presence of Asn-108 and Ile-51 in 96% of the isolates and Arg-50 mutation in 64% of the isolates. Each of these mutations has been associated with high level of resistance to pyrimethamine. Only 2 samples (4%) showed the wild type Ser-108 mutation and none showed Thr-108 and Val-16 mutations that are specific for resistance to cycloguanil. In the case of DHPS gene, we found a mutation at position 437 (Gly) in 100% of the isolates and Gly-581 in 96% of the isolates. The simultaneous presence of mutations Asn-108 and Ile-51 in the DHFR gene and Gly-437 and Gly-581 in the DHPS gene in 96% of the samples tested suggested that a cumulative effect of mutations could be the major mechanism conferring high SP resistance in this area. PMID:10497990

  12. Two Origins for the Gene Encoding α-Isopropylmalate Synthase in Fungi

    PubMed Central

    Larson, Erica M.; Idnurm, Alexander

    2010-01-01

    Background The biosynthesis of leucine is a biochemical pathway common to prokaryotes, plants and fungi, but absent from humans and animals. The pathway is a proposed target for antimicrobial therapy. Methodology/Principal Findings Here we identified the leuA gene encoding α-isopropylmalate synthase in the zygomycete fungus Phycomyces blakesleeanus using a genetic mapping approach with crosses between wild type and leucine auxotrophic strains. To confirm the function of the gene, Phycomyces leuA was used to complement the auxotrophic phenotype exhibited by mutation of the leu3+ gene of the ascomycete fungus Schizosaccharomyces pombe. Phylogenetic analysis revealed that the leuA gene in Phycomyces, other zygomycetes, and the chytrids is more closely related to homologs in plants and photosynthetic bacteria than ascomycetes or basidiomycetes, and suggests that the Dikarya have acquired the gene more recently. Conclusions/Significance The identification of leuA in Phycomyces adds to the growing body of evidence that some primary metabolic pathways or parts of them have arisen multiple times during the evolution of fungi, probably through horizontal gene transfer events. PMID:20657649

  13. Induction of Malate Synthase Gene Expression in Senescent and Detached Organs of Cucumber.

    PubMed Central

    Graham, IA; Leaver, CJ; Smith, SM

    1992-01-01

    Expression of the malate synthase (MS) gene is activated in cotyledons of cucumber seedlings during postgerminative growth and then repressed as the cotyledons become photosynthetic. MS gene expression is subsequently reactivated in the cotyledons as they senesce a few weeks later. In situ hybridization revealed that MS RNA is distributed throughout the organ during postgerminative growth and senescence, showing that the same cells express the gene at different stages of development. MS RNA also appears in senescing leaves and petals of cucumber plants. In addition, we found that MS RNA appears in mature expanded leaves and roots when they are removed from the plant and incubated in darkness for several days, thus providing a potential experimental system for the manipulation of MS gene expression. Leaves from transgenic Nicotiana plumbaginifolia containing the cucumber MS promoter fused to the [beta]-glucuronidase (GUS) reporter gene accumulated GUS activity when detached, demonstrating an activation of transcription from the MS promoter following leaf excision. These results are discussed in terms of the metabolic regulation of MS gene expression. PMID:12297649

  14. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes. PMID:24548412

  15. Evolution of ketosynthase domains of polyketide synthase genes in the Cladonia chlorophaea species complex (Cladoniaceae).

    PubMed

    Timsina, Brinda A; Hausner, Georg; Piercey-Normore, Michele D

    2014-11-01

    Lichen-forming fungi synthesize a diversity of polyketides, but only a few non-reducing polyketide synthase (PKS) genes from a lichen-forming fungus have been linked with a specific polyketide. While it is a challenge to link the large number of PKS paralogs in fungi with specific products, it might be expected that the PKS paralogs from closely related species would be similar because of recent evolutionary divergence. The objectives of this study were to reconstruct a PKS gene phylogeny of the Cladonia chlorophaea species complex based on the ketosynthase domain, a species phylogeny of the complex, and to explore the presence of PKS gene paralogs among members of the species complex. DNA was isolated from 51 individuals of C. chlorophaea and allies to screen for the presence of 13 PKS paralogs. A 128 sequence PKS gene phylogeny using deduced amino acid sequences estimated from the 13 PKS paralogs and sequences subjected to BLASTx comparisons showed losses of each of two PKS domains (reducing and methylation). This research provided insight into the evolution of PKS genes in the C. chlorophaea group, species evolution in the group, and it identified potential directions for further investigation of polyketide synthesis in the C. chlorophaea species complex. PMID:25442293

  16. Intron-exon organization of the gene for the multifunctional animal fatty acid synthase.

    PubMed Central

    Amy, C M; Williams-Ahlf, B; Naggert, J; Smith, S

    1992-01-01

    The complete intron-exon organization of the gene encoding a multifunctional mammalian fatty acid synthase has been elucidated, and specific exons have been assigned to coding sequences for the component domains of the protein. The rat gene is interrupted by 42 introns and the sequences bordering the splice-site junctions universally follow the GT/AG rule. However, of the 41 introns that interrupt the coding region of the gene, 23 split the reading frame in phase I, 14 split the reading frame in phase 0, and only 4 split the reading frame in phase II. Remarkably, 46% of the introns interrupt codons for glycine. With only one exception, boundaries between the constituent enzymes of the multifunctional polypeptide coincide with the location of introns in the gene. The significance of the predominance of phase I introns, the almost uniformly short length of the 42 introns and the overall small size of the gene, is discussed in relation to the evolution of multifunctional proteins. Images PMID:1736293

  17. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    PubMed Central

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  18. Acetohydroxyacid synthase activity and transcripts profiling reveal tissue-specific regulation of ahas genes in sunflower.

    PubMed

    Ochogavía, Ana C; Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana A; Nestares, Graciela

    2014-07-01

    Acetohydroxyacid synthase (AHAS) is the target site of several herbicides and catalyses the first step in the biosynthesis of branched chain amino acid. Three genes coding for AHAS catalytic subunit (ahas1, ahas2 and ahas3) have been reported for sunflower. The aim of this work was to study the expression pattern of ahas genes family and AHAS activity in sunflower (Helianthus annuus L.). Different organs (leaves, hypocotyls, roots, flowers and embryos) were evaluated at several developmental stages. The transcriptional profile was studied through RT-qPCR. The highest expression for ahas1 was shown in leaves, where all the induced and natural gene mutations conferring herbicide resistance were found. The maximal expression of ahas2 and ahas3 occurred in immature flowers and embryos. The highest AHAS activity was found in leaves and immature embryos. Correlation analysis among ahas gene expression and AHAS activity was discussed. Our results show that differences in ahas genes expression are tissue-specific and temporally regulated. Moreover, the conservation of multiple AHAS isoforms in sunflower seems to result from different expression requirements controlled by tissue-specific regulatory mechanisms at different developmental stages. PMID:24908515

  19. Common polymorphisms in nitric oxide synthase (NOS) genes influence quality of aging and longevity in humans.

    PubMed

    Montesanto, Alberto; Crocco, Paolina; Tallaro, Federica; Pisani, Francesca; Mazzei, Bruno; Mari, Vincenzo; Corsonello, Andrea; Lattanzio, Fabrizia; Passarino, Giuseppe; Rose, Giuseppina

    2013-04-01

    Nitric oxide (NO) triggers multiple signal transduction pathways and contributes to the control of numerous cellular functions. Previous studies have shown in model organisms that the alteration of NO production has important effects on aging and lifespan. We studied in a large sample (763 subjects, age range 19-107 years) the variability of the three human genes (NOS1, -2, -3) coding for the three isoforms of the NADPH-dependent enzymes named NO synthases (NOS) which are responsible of NO synthesis. We have then verified if the variability of these genes is associated with longevity, and with a number of geriatric parameters. We found that gene variation of NOS1 and NOS2 was associated with longevity. In addition NOS1 rs1879417 was also found to be associated with a lower cognitive performance, while NOS2 rs2297518 polymorphism showed to be associated with physical performance. Moreover, SNPs in the NOS1 and NOS3 genes were respectively associated with the presence of depression symptoms and disability, two of the main factors affecting quality of life in older individuals. On the whole, our study shows that genetic variability of NOS genes has an effect on common age related phenotypes and longevity in humans as well as previously reported for model organisms. PMID:23572278

  20. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

  1. Sugar-Dependent Gibberellin-Induced Chalcone Synthase Gene Expression in Petunia Corollas.

    PubMed Central

    Moalem-Beno, D.; Tamari, G.; Leitner-Dagan, Y.; Borochov, A.; Weiss, D.

    1997-01-01

    The induction of anthocyanin synthesis and anthocyanin biosynthetic gene expression in detached petunia (Petunia hybrida) corollas by gibberellic acid (GA3) requires sucrose. Neither sucrose nor GA3 alone can induce these processes. We found that GA3 enhances sucrose uptake by 20 to 30%, and we tested whether this is the mechanism by which the hormone induces gene expression. Changing the intracellular level of sucrose with the inhibitors p-chloromercuribenzenesulfonic acid and vanadate did not inhibit the induction of chalcone synthase gene (chs) expression by GA3. Growing detached corollas in various sucrose concentrations did not affect the induction of the gene but did affect its level of expression and the level of anthocyanin accumulated. Only metabolic sugars promoted GA3-induced anthocyanin accumulation. Mannitol and sorbitol had no effect and 3-O-methylglucose only slightly promoted chs expression and anthocyanin accumulation. Our results do not support the suggestion that sugars act as specific signals in the activation of anthocyanin biosynthetic gene expression during petunia corolla development. We suggest that sugars are essential as general sources of carbohydrates for carbon metabolism, upon which the induction of pigmentation is dependent. PMID:12223616

  2. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    PubMed

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii. PMID:24440296

  3. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    PubMed

    Zheng, Shigang; Zhao, Shanchang; Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  4. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    PubMed Central

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  5. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    PubMed Central

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K.

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content. PMID:23755054

  6. Associations between Nitric Oxide Synthase Genes and Exhaled NO-Related Phenotypes according to Asthma Status

    PubMed Central

    Bouzigon, Emmanuelle; Monier, Florent; Boussaha, Mekki; Le Moual, Nicole; Huyvaert, Hélène; Matran, Régis; Letort, Sébastien; Bousquet, Jean; Pin, Isabelle; Lathrop, Mark; Kauffmann, Francine; Demenais, Florence; Nadif, Rachel

    2012-01-01

    Background The nitric oxide (NO) pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs) of NO synthase genes (NOS) and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma) and blood eosinophil counts. Methodology SNPs (N = 121) belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA). Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (FeNO), plasma and exhaled breath condensate (EBC) nitrite-nitrate levels (NO2–NO3) and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. Principal Findings In non-asthmatics, after correction for multiple comparisons, we found significant associations of FeNO levels with three SNPs in NOS3 and NOS2 (P≤0.002), and of EBC NO2–NO3 level with NOS2 (P = 0.002). In asthmatics, a single significant association was detected between FeNO levels and one SNP in NOS3 (P = 0.004). Moreover, there was significant heterogeneity of NOS3 SNP effect on FeNO between asthmatics and non-asthmatics (P = 0.0002 to 0.005). No significant association was found between any SNP and NO2–NO3 plasma levels or blood eosinophil counts. Conclusions Variants in NO synthase genes influence FeNO and EBC NO2–NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid. PMID:22590587

  7. Open reading frame 3, which is adjacent to the mycocerosic acid synthase gene, is expressed as an acyl coenzyme A synthase in Mycobacterium bovis BCG.

    PubMed Central

    Fitzmaurice, A M; Kolattukudy, P E

    1997-01-01

    The aim of this study was to test for expression of a 900-bp open reading frame (ORF), ORF3, located at the 5' end of the mycocerosic acid synthase gene in Mycobacterium bovis BCG and to determine the nature of the ORF3 protein. ORF3 was expressed as a 61-kDa C-terminal fusion protein with glutathione S-transferase in Escherichia coli. Polyclonal rabbit antiserum, prepared against this fusion protein, cross-reacted with a 65-kDa protein in M. bovis BCG crude extracts. Since this protein was larger than that predicted from the nucleotide sequence (32 kDa), ORF3 was resequenced, revealing an ORF of 1,749 bp that encodes a 64.8-kDa protein containing 583 amino acids. Reverse transcription-PCR revealed that ORF3 is expressed in M. bovis BCG. The ORF3 product has a high degree of similarity to the acyladenylate family of enzymes. Immunoaffinity absorption chromatography was used to isolate the 65-kDa cross-reacting protein from M. bovis BCG. This purified protein catalyzed coenzyme A (CoA) ester synthesis of n-C10 to n-C18 fatty acids but not mycocerosic acids. ORF3 antibodies severely inhibited acyl-CoA synthase activities of the purified protein and extracts of M. bovis BCG, Mycobacterium smegmatis, and E. coli. They also showed immunological cross-reactivity with proteins in these extracts. Both the ORF3 protein and the acyl-CoA synthase activity were located in the cell cytosol or were loosely associated with the cell membrane. These results indicate that ORF3 encodes an acyl-CoA synthase-like protein. PMID:9098059

  8. Screen for mitochondrial DNA copy number maintenance genes reveals essential role for ATP synthase

    PubMed Central

    Fukuoh, Atsushi; Cannino, Giuseppe; Gerards, Mike; Buckley, Suzanne; Kazancioglu, Selena; Scialo, Filippo; Lihavainen, Eero; Ribeiro, Andre; Dufour, Eric; Jacobs, Howard T

    2014-01-01

    The machinery of mitochondrial DNA (mtDNA) maintenance is only partially characterized and is of wide interest due to its involvement in disease. To identify novel components of this machinery, plus other cellular pathways required for mtDNA viability, we implemented a genome-wide RNAi screen in Drosophila S2 cells, assaying for loss of fluorescence of mtDNA nucleoids stained with the DNA-intercalating agent PicoGreen. In addition to previously characterized components of the mtDNA replication and transcription machineries, positives included many proteins of the cytosolic proteasome and ribosome (but not the mitoribosome), three proteins involved in vesicle transport, some other factors involved in mitochondrial biogenesis or nuclear gene expression, > 30 mainly uncharacterized proteins and most subunits of ATP synthase (but no other OXPHOS complex). ATP synthase knockdown precipitated a burst of mitochondrial ROS production, followed by copy number depletion involving increased mitochondrial turnover, not dependent on the canonical autophagy machinery. Our findings will inform future studies of the apparatus and regulation of mtDNA maintenance, and the role of mitochondrial bioenergetics and signaling in modulating mtDNA copy number. PMID:24952591

  9. The diversity of polyketide synthase genes from sugarcane-derived fungi.

    PubMed

    Rojas, Juan Diego; Sette, Lara Durães; de Araujo, Welington L; Lopes, Mateus Schreiner Garcez; da Silva, Luiziana Ferreira; Furlan, Renata L A; Padilla, Gabriel

    2012-04-01

    The chemical ecology and biotechnological potential of metabolites from endophytic and rhizosphere fungi are receiving much attention. A collection of 17 sugarcane-derived fungi were identified and assessed by PCR for the presence of polyketide synthase (PKS) genes. The fungi were all various genera of ascomycetes, the genomes of which encoded 36 putative PKS sequences, 26 shared sequence homology with β-ketoacyl synthase domains, while 10 sequences showed homology to known fungal C-methyltransferase domains. A neighbour-joining phylogenetic analysis of the translated sequences could group the domains into previously established chemistry-based clades that represented non-reducing, partially reducing and highly reducing fungal PKSs. We observed that, in many cases, the membership of each clade also reflected the taxonomy of the fungal isolates. The functional assignment of the domains was further confirmed by in silico secondary and tertiary protein structure predictions. This genome mining study reveals, for the first time, the genetic potential of specific taxonomic groups of sugarcane-derived fungi to produce specific types of polyketides. Future work will focus on isolating these compounds with a view to understanding their chemical ecology and likely biotechnological potential. PMID:21938508

  10. Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Owens, Daniel K.; Alerding, Anne B.; Crosby, Kevin C.; Bandara, Aloka B.; Westwood, James H.; Winkel, Brenda S.J.

    2008-01-01

    The genome of Arabidopsis (Arabidopsis thaliana) contains five sequences with high similarity to FLAVONOL SYNTHASE1 (AtFLS1), a previously characterized flavonol synthase gene that plays a central role in flavonoid metabolism. This apparent redundancy suggests the possibility that Arabidopsis uses multiple isoforms of FLS with different substrate specificities to mediate the production of the flavonols, quercetin and kaempferol, in a tissue-specific and inducible manner. However, biochemical and genetic analysis of the six AtFLS sequences indicates that, although several of the members are expressed, only AtFLS1 encodes a catalytically competent protein. AtFLS1 also appears to be the only member of this group that influences flavonoid levels and the root gravitropic response in seedlings under nonstressed conditions. This study showed that the other expressed AtFLS sequences have tissue- and cell type-specific promoter activities that overlap with those of AtFLS1 and encode proteins that interact with other flavonoid enzymes in yeast two-hybrid assays. Thus, it is possible that these “pseudogenes” have alternative, noncatalytic functions that have not yet been uncovered. PMID:18467451

  11. Molecular cloning of the human leukotriene C4 synthase gene and assignment to chromosome 5q35.

    PubMed Central

    Bigby, T. D.; Hodulik, C. R.; Arden, K. C.; Fu, L.

    1996-01-01

    BACKGROUND: Cysteinyl leukotrienes (LT) are mediators involved in inflammatory and allergic disorders LTC4 synthase catalyzes the first committed step in the synthesis of these inflammatory mediators, and its cellular distribution appears to be unique. MATERIALS AND METHODS: A human genomic library was screened by polymerase chain reaction (PCR) with primers that were designed based on the reported cDNA sequence for the LTC4 synthase gene. The gene was identified in one clone by Southern blotting of restriction enzyme digests, subcloning of fragments containing regions of interest, and DNA sequencing of these subclones. The transcription initiation site was determined by primer extension analysis. Chromosome location was determined by fluorescent in situ hybridization and screening of somatic cell hybrids by PCR. RESULTS: The LTC4 synthase gene is approximately 2.5 kb in length, consisting of five exons (136, 100, 71, 82, and 257 bp, respectively) and four introns (1,447, 102, 84, and 230 bp, respectively). Transcription initiation occurs at a single site 78 bp upstream of the coding region. The 5'-flanking region contains neither a TATA nor a CAAT box. The first 1 kb of the 5'-flanking region, however, contains putative DNA binding motifs for SP-1, AP-1, AP-2, ets factors, and CREB/ATF. A STAT binding motif is present in the first intron. The LTC4 synthase gene is located in the distal region of the long arm of chromosome 5 in 5q35. CONCLUSIONS: The LTC4 synthase gene does not contain elements of a typical regulated gene and may therefore contain novel regulatory elements. This gene is also located in a region on chromosome 5 that appears to play a role in allergic and inflammatory disorders, such as asthma. Images FIG. 1 FIG. 5 FIG. 4 FIG. 6 PMID:8898379

  12. Potential impact of a single nucleotide polymorphism in the hyaluronan synthase 1 gene in Waldenstrom's macroglobulinemia.

    PubMed

    Adamia, Sophia; Treon, Steven P; Reiman, Tony; Tournilhac, Olivier; McQuarrie, Carrie; Mant, Michael J; Belch, Andrew R; Pilarski, Linda M

    2005-03-01

    The hyaluronan synthase 1 (HAS1) gene encodes a plasma membrane protein that synthesizes hyaluronan, an extracellular matrix molecule. Previously, in patients with Waldenstrom's macroglobulinemia (WM), we detected upregulation of HAS1 transcripts and identified aberrant splice variants of this gene. Aberrant splicing of HAS1 results from activation of cryptic splice sites. In turn, activation of cryptic donor and acceptor splice sites can be promoted by mutations occurring upstream of these sites and/or at the branch point of slicing. We measured the frequency of the HAS1 833A/G polymorphism (ie, single-nucleotide polymorphism; SNP) in patients with WM and healthy donors. Additionally, HAS1 gene expression was evaluated in the same group of patients. Our observations so far suggest that HAS1 833A/G SNPs contribute to aberrant splicing of this gene; this idea is supported by the fact that 833A/G SNP is located on an exonic splicing enhancer motif. Based on the results obtained thus far, we speculate that individuals with HAS1 833G/G genotype are predisposed toward aberrant HAS1 splicing and expression of HAS1 variants, resulting in an enhanced risk of developing WM. Study of a larger group of patients and healthy donors is needed to confirm these speculations and to evaluate the prognostic significance of these findings. PMID:15794859

  13. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    PubMed

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis. PMID:26690515

  14. Endothelial nitric oxide synthase gene transfer enhances dilation of newborn piglet pulmonary arteries.

    PubMed

    Aschner, J L; Kovacs, N; Perciaccante, J V; Figueroa, J P; Thrikawala, N; Robins, G S; Busija, D W

    1999-07-01

    We determined the expression and functional correlate of in vitro transfection with a recombinant adenoviral vector encoding the gene for bovine endothelial nitric oxide synthase (AdCMVeNOS) or Escherichia coli beta-galactosidase (AdCMVLacZ) in pulmonary endothelial cells (EC), vascular smooth muscle cells (VSMC), and pulmonary arteries (PA) from newborn piglets. AdCMVeNOS and AdCMVeLacZ vectors, grown in 293-cell monolayers, were purified by double-cesium gradient ultracentrifugation. Cell cultures and PA were incubated with increasing vector titers for 30 or 60 min, followed by incubation in fresh medium for 18 h at 37 degrees C. LacZ expression was assessed by histochemical staining; eNOS expression was evaluated by Western blot analysis. Functional eNOS expression was determined by measurement of cGMP and quantification of the relaxation response to bradykinin (BK). In PA, LacZ transgene expression was preferentially localized to the adventitia and endothelium. Increased eNOS protein expression was observed in EC and VSMC transfected with AdCMVeNOS. Functional studies revealed increased cGMP abundance in cultured cells and enhanced relaxation to BK in AdCMVeNOS-transfected PA. These studies demonstrate that gene transfer with AdCMVeNOS results in functional expression and altered vasoactive responses in the neonatal pulmonary vasculature. Gene transfer with replication-deficient adenovirus vectors is a useful tool for the study of targeted genes in vascular biology. PMID:10409217

  15. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    PubMed

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. PMID:26991299

  16. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment.

    PubMed

    Funk, C D; Funk, L B; Kennedy, M E; Pong, A S; Fitzgerald, G A

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A2, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide-derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human--hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and its gene regulation. PMID:1907252

  17. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    SciTech Connect

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. )

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  18. Cloning and manipulation of the Escherichia coli cyclopropane fatty acid synthase gene: physiological aspects of enzyme overproduction.

    PubMed Central

    Grogan, D W; Cronan, J E

    1984-01-01

    Like many other eubacteria, cultures of Escherichia coli accumulate cyclopropane fatty acids (CFAs) at a well-defined stage of growth, due to the action of the cytoplasmic enzyme CFA synthase. We report the isolation of the putative structural gene, cfa, for this enzyme on an E. coli-ColE1 chimeric plasmid by the use of an autoradiographic colony screening technique. When introduced into a variety of E. coli strains, this plasmid, pLC18-11, induced corresponding increases in CFA content and CFA synthase activity. Subsequent manipulation of the cfa locus, facilitated by the insertion of pLC18-11 into a bacteriophage lambda vector, allowed genetic and physiological studies of CFA synthase in E. coli. Overproduction of this enzyme via multicopy cfa plasmids caused abnormally high levels of CFA in membrane phospholipid but no discernable growth perturbation. Infection with phage lambda derivatives bearing cfa caused transient overproduction of the enzyme, although pL-mediated expression of cfa could not be demonstrated in plasmids derived from such phages. CFA synthase specific activities could be raised to very high levels by using cfa runaway-replication plasmids. A variety of physiological factors were found to modulate the levels of CFA synthase in normal and gene-amplified cultures. These studies argue against several possible mechanisms for the temporal regulation of CFA formation. PMID:6325391

  19. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    PubMed Central

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families were identified. Although three NAS genes have been characterized in maize, there is still no systematic identification of maize NAS family by genomic mining. Results In this study, nine NAS genes in maize were identified and their expression patterns in different organs including developing seeds were determined. According to the evolutionary relationship and tissue specific expression profiles of ZmNAS genes, they can be subgrouped into two classes. Moreover, the expression patterns of ZmNAS genes in response to fluctuating metal status were analysed. The class I ZmNAS genes were induced under Fe deficiency and were suppressed under Fe excessive conditions, while the expression pattern of class II genes were opposite to class I. The complementary expression patterns of class I and class II ZmNAS genes confirmed the classification of this family. Furthermore, the histochemical localization of ZmNAS1;1/1;2 and ZmNAS3 were determined using in situ hybridization. It was revealed that ZmNAS1;1/1;2, representing the class I genes, mainly expressed in cortex and stele of roots with sufficient Fe, and its expression can expanded in epidermis, as well as shoot apices under Fe deficient conditions. On the contrary, ZmNAS3, one of the class II genes, was accumulated in axillary meristems, leaf primordia and mesophyll cells. These results suggest that the two classes of ZmNAS genes may be regulated on transcriptional level when responds to various demands for iron uptake, translocation

  20. Nitric oxide synthase polymorphisms, gene expression and lung function in chronic obstructive pulmonary disease

    PubMed Central

    2013-01-01

    Background Due to the pleiotropic effects of nitric oxide (NO) within the lungs, it is likely that NO is a significant factor in the pathogenesis of chronic obstructive pulmonary disease (COPD). The aim of this study was to test for association between single nucleotide polymorphisms (SNPs) in three NO synthase (NOS) genes and lung function, as well as to examine gene expression and protein levels in relation to the genetic variation. Methods One SNP in each NOS gene (neuronal NOS (NOS1), inducible NOS (NOS2), and endothelial NOS (NOS3)) was genotyped in the Lung Health Study (LHS) and correlated with lung function. One SNP (rs1800779) was also analyzed for association with COPD and lung function in four COPD case–control populations. Lung tissue expression of NOS3 mRNA and protein was tested in individuals of known genotype for rs1800779. Immunohistochemistry of lung tissue was used to localize NOS3 expression. Results For the NOS3 rs1800779 SNP, the baseline forced expiratory volume in one second in the LHS was significantly higher in the combined AG + GG genotypic groups compared with the AA genotypic group. Gene expression and protein levels in lung tissue were significantly lower in subjects with the AG + GG genotypes than in AA subjects. NOS3 protein was expressed in the airway epithelium and subjects with the AA genotype demonstrated higher NOS3 expression compared with AG and GG individuals. However, we were not able to replicate the associations with COPD or lung function in the other COPD study groups. Conclusions Variants in the NOS genes were not associated with lung function or COPD status. However, the G allele of rs1800779 resulted in a decrease of NOS3 gene expression and protein levels and this has implications for the numerous disease states that have been associated with this polymorphism. PMID:24192154

  1. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    PubMed Central

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi. PMID:24036343

  2. Callose Synthase Family Genes Involved in the Grapevine Defense Response to Downy Mildew Disease.

    PubMed

    Yu, Ying; Jiao, Li; Fu, Shufang; Yin, Ling; Zhang, Yali; Lu, Jiang

    2016-01-01

    The deposition of callose is a common plant defense response to intruding pathogens and part of the plant's innate immunity. In this study, eight grapevine callose synthase (CalS) genes were identified and characterized. To investigate biological function of CalS in grapevine against the infection of Plasmopara viticola, expression patterns of grapevine CalS family genes were analyzed among resistant/susceptible cultivars. After P. viticola infection, expression of CalS1, 3, 7, 8, 9, 10, and 11 were significantly modified among the grapevine cultivars. For example, the expression of CalS1 and CalS10 were greatly increased in downy mildew (DM)-immune Muscadinia rotundifolia 'Carlos' and 'Noble'. Transient expression assay with promoters of the CalS1 and CalS10 genes confirmed that they were regulated by the oomycete pathogen P. viticola. CalS1 promoter activity was also significantly up-regulated by ABA in DM-immune M. rotundifolia 'Noble', but down-regulated in DM-susceptible Vitis vinifera 'Chardonnay'. The CalS1 promoter, however, was also down-regulated by GA in 'Chardonnay', but not affected in 'Noble'. The promoter activity of CalS10 was significantly up-regulated by GA in 'Chardonnay', but not regulated by ABA at all. It is proposed that CalS1 and CalS10 were involved in grapevine defense against DM disease. PMID:26474330

  3. Expression of Allene Oxide Synthase Determines Defense Gene Activation in Tomato1

    PubMed Central

    Sivasankar, Sobhana; Sheldrick, Bay; Rothstein, Steven J.

    2000-01-01

    Allene oxide synthase (AOS; hydroperoxide dehydratase; EC 4.2.1.92) catalyzes the first step in the biosynthesis of jasmonic acid from lipoxygenase-derived hydroperoxides of free fatty acids. Using the AOS cDNA from tomato (Lycopersicon esculentum), in which the role of jasmonic acid in wound-induced defense gene activation has been best described, we examined the kinetics of AOS induction in response to wounding and elicitors, in parallel with that of the wound-inducible PIN II (proteinase inhibitor II) gene. AOS was induced in leaves by wounding, systemin, 12-oxophytodienoic acid, and methyl jasmonate. The levels of AOS mRNA started declining by 4 h after induction, whereas the levels of PIN II mRNA continued to increase up to 20 h after induction. Salicylic acid inhibited AOS and PIN II expression, and the addition of 12-oxophytodienoic acid or methyl jasmonate did not prevent the inhibition of PIN II expression in the presence of salicylic acid. Ethylene induced the expression of AOS, but the presence of ethylene alone did not produce an optimal induction of PIN II. The addition of silver thiosulfate, an ethylene action inhibitor, prevented the wound-induced expression of both AOS and PIN II. Products of hydroperoxide lyase affected neither AOS nor PIN II, but induced expression of prosystemin. Based on these results, we propose an updated model for defense gene activation in tomato. PMID:10759530

  4. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  5. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    PubMed Central

    Wang, Jianrong; Li, Yangyuan; Liu, Danni

    2014-01-01

    Poria cocos (P. cocos) has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS) is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%). The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP) from geranyl diphosphate (GPP) and isopentenyl diphosphate (IPP). Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos. PMID:25474088

  6. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    SciTech Connect

    Okamoto, Mitsuhiro . E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp; Nonaka, Yasuki; Takemori, Hiroshi; Doi, Junko

    2005-12-09

    11{beta}-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11{beta}-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression.

  7. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-01-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems (P <0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS (P <0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  8. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  9. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    PubMed Central

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  10. The Evolutionary Fate of the Horizontally Transferred Agrobacterial Mikimopine Synthase Gene in the Genera Nicotiana and Linaria

    PubMed Central

    Talianova, Martina; Vyskot, Boris

    2014-01-01

    Few cases of spontaneously horizontally transferred bacterial genes into plant genomes have been described to date. The occurrence of horizontally transferred genes from the T-DNA of Agrobacterium rhizogenes into the plant genome has been reported in the genus Nicotiana and in the species Linaria vulgaris. Here we compare patterns of evolution in one of these genes (a gene encoding mikimopine synthase, mis) following three different events of horizontal gene transfer (HGT). As this gene plays an important role in Agrobacterium, and there are known cases showing that genes from pathogens can acquire plant protection function, we hypothesised that in at least some of the studied species we will find signs of selective pressures influencing mis sequence. The mikimopine synthase (mis) gene evolved in a different manner in the branch leading to Nicotiana tabacum and N. tomentosiformis, in the branch leading to N. glauca and in the genus Linaria. Our analyses of the genus Linaria suggest that the mis gene began to degenerate soon after the HGT. In contrast, in the case of N. glauca, the mis gene evolved under significant selective pressures. This suggests a possible role of mikimopine synthase in current N. glauca and its ancestor(s). In N. tabacum and N. tomentosiformis, the mis gene has a common frameshift mutation that disrupted its open reading frame. Interestingly, our results suggest that in spite of the frameshift, the mis gene could evolve under selective pressures. This sequence may still have some regulatory role at the RNA level as suggested by coverage of this sequence by small RNAs in N. tabacum. PMID:25420106

  11. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    PubMed

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (P<0.0001), whereas the frequency of a wild haplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients. PMID:24088668

  12. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    SciTech Connect

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  13. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

    PubMed Central

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  14. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    PubMed

    Catone, Mariela V; Ruiz, Jimena A; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  15. Structural, Functional, and Evolutionary Analysis of the Unusually Large Stilbene Synthase Gene Family in Grapevine1[W

    PubMed Central

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A.B.; Aubourg, Sébastien; Hugueney, Philippe

    2012-01-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed. PMID:22961129

  16. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    PubMed Central

    Domingo, Pere; Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/106 cells (interquartile range [IQR] = 8.12 to 13.87 fmol/106 cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/106 cells (IQR = 18.90 to 27.0 fmol/106 cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  17. Association of thymidylate synthase gene polymorphisms with stavudine triphosphate intracellular levels and lipodystrophy.

    PubMed

    Domingo, Pere; Cabeza, M Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M; Mateo, M Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-04-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/10(6) cells (interquartile range [IQR] = 8.12 to 13.87 fmol/10(6) cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/10(6) cells (IQR = 18.90 to 27.0 fmol/10(6) cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  18. Insertional mutagenesis and characterization of a polyketide synthase gene (PKS1) required for melanin biosynthesis in Bipolaris oryzae.

    PubMed

    Moriwaki, Akihiro; Kihara, Junichi; Kobayashi, Tsutomu; Tokunaga, Toshiko; Arase, Sakae; Honda, Yuichi

    2004-09-01

    A polyketide synthase gene named PKS1, involved in the melanin biosynthesis pathway of the phytopathogenic fungus Bipolaris oryzae, was isolated using restriction enzyme-mediated integration. Sequence analysis showed that the PKS1 encodes a putative protein that has 2155 amino acids and significant similarity to other fungal polyketide synthases. Targeted disruption of the PKS1 gene showed that it is necessary for melanin biosynthesis in B. oryzae. Northern blot analysis showed that PKS1 transcripts were specifically enhanced by near-ultraviolet radiation (300-400 nm) and that its temporal transcriptional patterns were similar to those of THR1 and SCD1 genes involved in the melanin biosynthesis pathway of B. oryzae. PMID:15336395

  19. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    PubMed

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  20. Nonribosomal Peptide Synthase Gene Clusters for Lipopeptide Biosynthesis in Bacillus subtilis 916 and Their Phenotypic Functions

    PubMed Central

    Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu

    2014-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  1. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  2. Chromosomal organization of the inducible and constitutive prostaglandin synthase/cyclooxygenase genes in mouse

    SciTech Connect

    Ping Zi Wen; Warden C.; Fletcher, B.S.; Kujubu, D.A.; Herschman, H.R.; Lusis, A.J. )

    1993-02-01

    Two distinct prostaglandin synthase/cyclooxygenase (PGS/COS) enzymes have recently been recognized. One (EC 1.14.00.1) is largely constitutive and has been characterized in a variety of species, whereas the other (also known as TIS10) is inducible by mitogens and inhibitable by glucocorticoids. Along with activation of phospholipase A2, the latter PGS/COS is likely to mediate ligand-induced prostaglandin production in a variety of cell types. The two enzymes have similar gene structures and activities. There is accumulating evidence that PGS/COX activity may play a role in inflammatory diseases. For example, PGS/COX expression is upregulated in inflammatory joint diseases and is genetically controlled. As part of an effort to examine genetic factors regulating PGS/COX expression and the possible involvement of the enzymes in mouse models of inflammatory disorders, we report here the chromosomal mapping of the genes for the constitutive and regulated PGS/COX enzymes. We will refer to the constitutive enzyme as Pgs-1 and the inducible enzyme as Pgs-2. 14 refs., 1 tab.

  3. Gene transfer of the neuronal NO synthase isoform to cirrhotic rat liver ameliorates portal hypertension

    PubMed Central

    Yu, Qing; Shao, Rong; Qian, Hu Sheng; George, Samuel E.; Rockey, Don C.

    2000-01-01

    Reduced production of nitric oxide (NO) in the cirrhotic liver results from a defect in hepatic endothelial cell nitric oxide synthase (ecNOS) and appears to contribute to the high intrahepatic resistance and portal hypertension typical of cirrhosis. Therefore, we postulated that targeting a heterologous NOS isoform to sinusoidal endothelial cells or other perisinusoidal cells, such as hepatic stellate cells, would counter the defect in NO production and reduce resistance to blood flow. Recombinant adenovirus (Ad) carrying the neuronal NOS gene (nNOS) targeted liver sinusoidal endothelial cells, stellate cells, and hepatocytes more efficiently than the corresponding cells in cirrhotic livers, but transduction rates were substantial even in cirrhotic animals. Expression of nNOS in each liver cell type, whether from normal or injured liver, caused increased NO production and inhibited endothelin-1–induced contractility of perisinusoidal stellate cells. Finally, in 2 different in vivo models of cirrhosis and portal hypertension, transduction of livers with recombinant Ad.nNOS significantly reduced intrahepatic resistance and portal pressure. The data highlight the feasibility of gene transfer to diseased liver and hepatic cells and demonstrate the potential of a novel therapy for portal hypertension caused by cirrhosis. PMID:10727442

  4. Cellulose production and cellulose synthase gene detection in acetic acid bacteria.

    PubMed

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2015-02-01

    The ability of acetic acid bacteria (AAB) to produce cellulose has gained much industrial interest due to the physical and chemical characteristics of bacterial cellulose. The production of cellulose occurs in the presence of oxygen and in a glucose-containing medium, but it can also occur during vinegar elaboration by the traditional method. The vinegar biofilm produced by AAB on the air-liquid interface is primarily composed of cellulose and maintains the cells in close contact with oxygen. In this study, we screened for the ability of AAB to produce cellulose using different carbon sources in the presence or absence of ethanol. The presence of cellulose in biofilms was confirmed using the fluorochrome Calcofluor by microscopy. Moreover, the process of biofilm formation was monitored under epifluorescence microscopy using the Live/Dead BacLight Kit. A total of 77 AAB strains belonging to 35 species of Acetobacter, Komagataeibacter, Gluconacetobacter, and Gluconobacter were analysed, and 30 strains were able to produce a cellulose biofilm in at least one condition. This cellulose production was correlated with the PCR amplification of the bcsA gene that encodes cellulose synthase. A total of eight degenerated primers were designed, resulting in one primer pair that was able to detect the presence of this gene in 27 AAB strains, 26 of which formed cellulose. PMID:25381910

  5. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  6. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  7. Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

    SciTech Connect

    Ge Shimei; Xie Baoen; Chen Sanfeng . E-mail: chensf@cau.edu.cn

    2006-03-10

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not exist in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.

  8. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed Central

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-01-01

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS. Images Fig. 2 PMID:7692452

  9. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    PubMed

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat. PMID:17721773

  10. Presence of two transcribed malate synthase genes in an n-alkane-utilizing yeast, Candida tropicalis.

    PubMed

    Hikida, M; Atomi, H; Fukuda, Y; Aoki, A; Hishida, T; Teranishi, Y; Ueda, M; Tanaka, A

    1991-12-01

    The presence of two genomic DNA regions encoding malate synthase (MS) was shown by Southern blot analysis of the genomic DNA from an n-alkane-assimilating yeast, Candida tropicalis, using a partial MS cDNA probe, in accordance with the fact that two types of partial MS cDNAs have previously been isolated. This was also confirmed by the restriction mapping of the two genes screened from the yeast lambda EMBL library. Nucleotide sequence analysis of the respective genomic DNAs, named MS-1 gene and MS-2 gene, revealed that both regions encoding MS had the same length of 1,653 base pairs, corresponding to 551 amino acids (molecular mass of MS-1, 62,448 Da; MS-2, 62,421 Da). Although 29 nucleotide pairs differed in the sequences of the coding regions, the number of amino acid replacements was only one: 159Asn (MS-1)----159Ser (MS-2). In the 5'-flanking regions, there were replacements of four nucleotide pairs, deletion of one pair, and insertion of four pairs. In spite of the fact that two genomic genes were present and transcribed, RNA blot analysis demonstrated that only one band (about 2 kb) was observable even when the carbon sources in the cultivation medium were changed. A comparison of the amino acid sequences was made with MSs of rape (Brassica napus L.), cucumber seed, pumpkin seed, Escherichia coli, and Hansenula polymorpha. A high homology was observed among these enzymes, the results indicating that the protein structure was relatively well conserved through the evolution of the molecule.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1794980

  11. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria×ananassa)

    PubMed Central

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O.

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria×ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus. PMID:19443619

  12. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    PubMed

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  13. Identification, cloning and expression of the mouse N-acetylglutamate synthase gene.

    PubMed Central

    Caldovic, Ljubica; Morizono, Hiroki; Yu, Xiaolin; Thompson, Mark; Shi, Dashuang; Gallegos, Rene; Allewell, Norma M; Malamy, Michael H; Tuchman, Mendel

    2002-01-01

    In ureotelic animals, N-acetylglutamate (NAG) is an essential allosteric activator of carbamylphosphate synthetase I (CPSI), the first enzyme in the urea cycle. NAG synthase (NAGS; EC 2.3.1.1) catalyses the formation of NAG from glutamate and acetyl-CoA in liver and intestinal mitochondria. This enzyme is supposed to regulate ureagenesis by producing variable amounts of NAG, thus modulating CPSI activity. Moreover, inherited deficiencies in NAGS have been associated with hyperammonaemia, probably due to the loss of CPSI activity. Although the existence of the NAGS protein in mammals has been known for decades, the gene has remained elusive. We identified the mouse (Mus musculus) and human NAGS genes using their similarity to the respective Neurospora crassa gene. NAGS was cloned from a mouse liver cDNA library and was found to encode a 2.3 kb message, highly expressed in liver and small intestine with lower expression levels in kidney, spleen and testis. The deduced amino acid sequence contains a putative mitochondrial targeting signal at the N-terminus. The cDNA sequence complements an argA (NAGS)-deficient Escherichia coli strain, reversing its arginine auxotrophy. His-tagged versions of the pre-protein and two putative mature proteins were each overexpressed in E. coli, and purified to apparent homogeneity by using a nickel-affinity column. The pre-protein and the two putative mature proteins catalysed the NAGS reaction but one of the putative mature enzymes had significantly higher activity than the pre-protein. The addition of l-arginine increased the catalytic activity of the purified recombinant NAGS enzymes by approx. 2-6-fold. PMID:12049647

  14. Endothelial nitric oxide synthase gene polymorphism is associated with Legg-Calvé-Perthes disease

    PubMed Central

    ZHAO, YULONG; LIAO, SHIJIE; LU, RONGBIN; DANG, HAO; ZHAO, JINMIN; DING, XIAOFEI

    2016-01-01

    The aim of this study was to assess the association of 27-bp variable number tandem repeat (VNTR) polymorphism in intron 4 and G894T polymorphism in exon 7 of the endothelial nitric oxide synthase (eNOS) gene with Legg-Calvé-Perthes disease (LCPD), and to provide a scientific basis for further research into the pathogenic mechanism. A total of 80 patients with LCPD and 100 healthy subjects were recruited in this case-control study. The 27-bp VNTR and G894T polymorphisms of the eNOS gene were genotyped using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism, respectively, followed by agarose gel electrophoresis and DNA sequencing. Allelic and genotypic frequencies were computed in the two groups and subjected to statistical analysis. For the 27-bp VNTR polymorphism, individuals with LCPD showed a higher frequency of the ab genotype [27.5 vs. 14%; odds ratio (OR), 2.33; 95% confidence interval (CI), 1.10–4.92; P=0.024]. For the G894T polymorphism, the LCPD case group showed a higher frequency of the heterozygous genotype GT than the healthy control group (35 vs. 17%; OR, 2.67; 95% CI, 1.33–5.36; P=0.005). The results indicate that these eNOS gene polymorphisms may be a risk factor for LCPD. The 27-bp VNTR polymorphism in intron 4 and G894T polymorphism in exon 7 may be involved in the etiology of LCPD. PMID:27168827

  15. Thymidylate synthase gene amplification in human colon cancer cell lines resistant to 5-fluorouracil.

    PubMed

    Copur, S; Aiba, K; Drake, J C; Allegra, C J; Chu, E

    1995-05-17

    A series of 5-fluorouracil (5-FU)-resistant human colon H630 cancer cell lines were established by continuous exposure of cells to 5-FU. The concentration of 5-FU required to inhibit cell proliferation by 50% (IC50) in the parent colon line (H630) was 5.5 microM. The 5-FU IC50 values for the resistant H630-R1, H630-R10, and H630-R cell lines were 11-, 29-, and 27-fold higher than that for the parent H630 cell line. Using both the radioenzymatic 5-fluoro-2'-deoxyuridine-5'-monophosphate (FdUMP) binding and catalytic assays for measurement of thymidylate synthase (TS) enzyme activity, there was significantly increased TS activity in resistant H630-R1 (13- and 23-fold), H630-R10 (37- and 40-fold), and H630-R (24- and 34-fold) lines, for binding and catalytic assays, respectively, compared with the parent H630 line. The level of TS protein, as determined by western immunoblot analysis, was increased markedly in resistant H630-R1 (23-fold), H630-R10 (33-fold), and H630-R (26-fold) cells. Northern analysis revealed elevations in TS mRNA levels in H630-R1 (18-fold), H630-R10 (39-fold), and H630-R (36-fold) cells relative to parent H630 cells. Although no major rearrangements of the TS gene were noted by Southern analysis, there was significant amplification of the TS gene in 5-FU-resistant cells, which was confirmed by DNA slot blot analysis. These studies demonstrate that continuous exposure of human colon cancer cells to 5-FU leads to TS gene amplification and overexpression of TS protein with resultant development of fluoropyrimidine resistance. PMID:7763285

  16. Identification, cloning and expression of the mouse N-acetylglutamate synthase gene.

    PubMed

    Caldovic, Ljubica; Morizono, Hiroki; Yu, Xiaolin; Thompson, Mark; Shi, Dashuang; Gallegos, Rene; Allewell, Norma M; Malamy, Michael H; Tuchman, Mendel

    2002-06-15

    In ureotelic animals, N-acetylglutamate (NAG) is an essential allosteric activator of carbamylphosphate synthetase I (CPSI), the first enzyme in the urea cycle. NAG synthase (NAGS; EC 2.3.1.1) catalyses the formation of NAG from glutamate and acetyl-CoA in liver and intestinal mitochondria. This enzyme is supposed to regulate ureagenesis by producing variable amounts of NAG, thus modulating CPSI activity. Moreover, inherited deficiencies in NAGS have been associated with hyperammonaemia, probably due to the loss of CPSI activity. Although the existence of the NAGS protein in mammals has been known for decades, the gene has remained elusive. We identified the mouse (Mus musculus) and human NAGS genes using their similarity to the respective Neurospora crassa gene. NAGS was cloned from a mouse liver cDNA library and was found to encode a 2.3 kb message, highly expressed in liver and small intestine with lower expression levels in kidney, spleen and testis. The deduced amino acid sequence contains a putative mitochondrial targeting signal at the N-terminus. The cDNA sequence complements an argA (NAGS)-deficient Escherichia coli strain, reversing its arginine auxotrophy. His-tagged versions of the pre-protein and two putative mature proteins were each overexpressed in E. coli, and purified to apparent homogeneity by using a nickel-affinity column. The pre-protein and the two putative mature proteins catalysed the NAGS reaction but one of the putative mature enzymes had significantly higher activity than the pre-protein. The addition of l-arginine increased the catalytic activity of the purified recombinant NAGS enzymes by approx. 2-6-fold. PMID:12049647

  17. Endothelial nitric oxide synthase G894T gene polymorphism and response to skin reactive hyperemia.

    PubMed

    Rasool, Aida Hanum Ghulam; Ghazali, Dzuzaini Mohd; Abdullah, Haswati; Halim, Ahmad Sukari; Wong, Abd Rahim

    2009-09-01

    Post occlusive skin reactive hyperemia (PORH) is a tool used to assess microcirculation. Endothelial nitric oxide synthase (eNOS) mediates nitric oxide (NO) production; polymorphism of the eNOS gene may affect response to the PORH process. This study aims to determine whether eNOS G894T gene polymorphism affects response to skin PORH. 230 normotensive male and females between 18 and 40 years participated in this cross-sectional study. 170 subjects were of the homozygous GG genotype, whereas 60 were of the GT genotype. Skin PORH was performed by occlusion of the upper arm at 200 mm Hg for 3 min. Skin perfusion and temperature were monitored before, during and after occlusion release using the laser Doppler fluximetry. There were no significant differences between genotypes in their baseline blood pressure, serum cholesterol, BMI and age. Maximum change in perfusion after occlusion release (PORHmax) for the GG and GT genotypes were not significantly different at 50.15+/-1.29 vs. 47.92+/-2.17 AU; ANCOVA, p=0.351. Peak perfusion (PORHpeak) were also not significantly different between the two genotypes (61.23+/-1.36 vs. 57.72+/-2.32 AU; p=0.169). Minimum baseline perfusion were however higher in the GG compared to the GT genotype (10.83+/-0.29 vs. 9.61+/-0.50, p=0.029). We conclude that microvascular reactivity, assessed by change in perfusion after temporary ischemia was not significantly different between the GG and GT genotypes of the eNOS G894T gene. eNOS 894T allele carriers however, have lower baseline perfusion compared to the homozygous G894 allele carrier. PMID:19481100

  18. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  19. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  20. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

    PubMed Central

    Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  1. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    PubMed

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding. PMID:23612253

  2. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    PubMed

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  3. Identification and Characterization of a Novel Trehalose Synthase Gene Derived from Saline-Alkali Soil Metagenomes

    PubMed Central

    Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn2+ and Hg2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficientcy (Kcat/Km) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis. PMID:24146994

  4. Cloning and sequence analysis of the Blumea balsamifera DC farnesyl diphosphate synthase gene.

    PubMed

    Pang, Y X; Guan, L L; Wu, L F; Chen, Z X; Wang, K; Xie, X L; Yu, F L; Chen, X L; Zhang, Y B; Jiang, Q

    2014-01-01

    Blumea balsamifera DC is a member of the Compositae family and is frequently used as traditional Chinese medicine. Blumea balsamifera is rich in monoterpenes, which possess a variety of pharmacological activities, such as antioxidant, anti-bacteria, and anti-viral activities. Farnesyl diphosphate synthase (FPS) is a key enzyme in the biosynthetic pathway of terpenes, playing an important regulatory role in plant growth, such as resistance and secondary metabolism. Based on the conserved oligo amino acid residues of published FPS genes from other higher plant species, a cDNA sequence, designated BbFPS, was isolated from B. balsamifera DC using polymerase chain reaction. The clones were an average of 1.6 kb and contained an open reading frame that predicted a polypeptide of 342 amino acids with 89.07% identity to FPS from other plants. The deduced amino acid sequence was dominated by hydrophobic regions and contained 2 highly conserved DDxxD motifs that are essential for proper functioning of FPS. Phylogenetic analysis indicated that FPS grouped with other composite families. Prediction of secondary structure and subcellular localization suggested that alpha helices made up 70% of the amino acids of the sequence. PMID:25501197

  5. Congenital erythropoietic porphyria: identification and expression of 10 mutations in the uroporphyrinogen III synthase gene.

    PubMed Central

    Xu, W; Warner, C A; Desnick, R J

    1995-01-01

    To investigate the molecular basis of the phenotypic heterogeneity in congenital erythropoietic porphyria, the mutations in the uroporphyrinogen III synthase gene from unrelated patients were determined. Six missense (L4F, Y19C, V82F, V99A, A104V, and G225S), a nonsense (Q249X), a frameshift (633insA), and two splicing mutations (IVS2+1 and IVS9 delta A + 4) were identified. When L4F, Y19C, V82F, V99A, A104V, 633insA, G225S, and Q249X were expressed in Escherichia coli, only the V82F, V99A, and A104V alleles expressed residual enzymatic activity. Of note, the V82F mutation, which occurs adjacent to the 5' donor site of intron 4, resulted in approximately 54% aberrantly spliced transcripts with exon 4 deleted. Thus, this novel exonic single-base substitution caused two lesions, a missense mutation and an aberrantly spliced transcript. Of the splicing mutations, the IVS2+1 allele produced a single transcript with exon 2 deleted, whereas the IVS9 delta A+4 allele was alternatively spliced, approximately 26% being normal transcripts and the remainder with exon 9 deleted. The amount of residual activity expressed by each allele provided a basis to correlate genotype with disease severity, thereby permitting genotype/phenotype predictions in this clinically heterogeneous disease. Images PMID:7860775

  6. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    PubMed

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes. PMID:25543026

  7. Borna disease virus P protein inhibits nitric oxide synthase gene expression in astrocytes

    SciTech Connect

    Peng Guiqing; Zhang Fengmin; Zhang Qi; Wu Kailang; Zhu Fan; Wu Jianguo

    2007-09-30

    Borna disease virus (BDV) is one of the potential infectious agents involved in the development of central nervous system (CNS) diseases. Neurons and astrocytes are the main targets of BDV infection, but little is known about the roles of BDV infection in the biological effects of astrocytes. Here we reported that BDV inhibits the activation of inducible nitric oxide synthase (iNOS) in murine astrocytes induced by bacterial LPS and PMA. To determine which protein of BDV is responsible for the regulation of iNOS expression, we co-transfected murine astrocytes with reporter plasmid iNOS-luciferase and plasmid expressing individual BDV proteins. Results from analyses of reporter activities revealed that only the phosphoprotein (P) of BDV had an inhibitory effect on the activation of iNOS. In addition, P protein inhibits nitric oxide production through regulating iNOS expression. We also reported that the nuclear factor kappa B (NF-{kappa}B) binding element, AP-1 recognition site, and interferon-stimulated response element (ISRE) on the iNOS promoter were involved in the repression of iNOS gene expression regulated by the P protein. Functional analysis indicated that sequences from amino acids 134 to 174 of the P protein are necessary for the regulation of iNOS. These data suggested that BDV may suppress signal transduction pathways, which resulted in the inhibition of iNOS activation in astrocytes.

  8. Characterization and Biological Function of the ISOCHORISMATE SYNTHASE2 Gene of Arabidopsis1[OA

    PubMed Central

    Garcion, Christophe; Lohmann, Antje; Lamodière, Elisabeth; Catinot, Jérémy; Buchala, Antony; Doermann, Peter; Métraux, Jean-Pierre

    2008-01-01

    Salicylic acid (SA) is an important mediator of plant defense response. In Arabidopsis (Arabidopsis thaliana), this compound was proposed to derive mainly from isochorismate, itself produced from chorismate through the activity of ISOCHORISMATE SYNTHASE1 (ICS1). Null ics1 mutants still accumulate some SA, suggesting the existence of an enzymatic activity redundant with ICS1 or of an alternative ICS-independent SA biosynthetic route. Here, we studied the role of ICS2, a second ICS gene of the Arabidopsis genome, in the production of SA. We have shown that ICS2 encodes a functional ICS enzyme and that, similar to ICS1, ICS2 is targeted to the plastids. Comparison of SA accumulation in the ics1, ics2, and ics1 ics2 mutants indicates that ICS2 participates in the synthesis of SA, but in limited amounts that become clearly detectable only when ICS1 is lacking. This unequal redundancy relationship was also observed for phylloquinone, another isochorismate-derived end product. Furthermore, detection of SA in the double ics1 ics2 double mutant that is completely devoid of phylloquinone provides genetic evidence of the existence of an ICS-independent SA biosynthetic pathway in Arabidopsis. PMID:18451262

  9. Acid Sphingomyelinase Gene Knockout Ameliorates Hyperhomocysteinemic Glomerular Injury in Mice Lacking Cystathionine-β-Synthase

    PubMed Central

    Boini, Krishna M.; Xia, Min; Abais, Justine M.; Xu, Ming; Li, Cai-xia; Li, Pin-Lan

    2012-01-01

    Acid sphingomyelinase (ASM) has been implicated in the development of hyperhomocysteinemia (hHcys)-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs) and Asm mouse gene by cross breeding Cbs+/− and Asm+/− mice. Given that the homozygotes of Cbs−/−/Asm−/− mice could not survive for 3 weeks. Cbs+/−/Asm+/+, Cbs+/−/Asm+/− and Cbs+/−/Asm−/− as well as their Cbs wild type littermates were used to study the role of Asm−/− under a background of Cbs+/− with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs+/−) mice with different copies of Asm gene compared to Cbs+/+ mice with different Asm gene copies. Cbs+/−/Asm+/+ mice had significantly increased renal Asm activity, ceramide production and O2.− level compared to Cbs+/+/Asm+/+, while Cbs+/−/Asm−/− mice showed significantly reduced renal Asm activity, ceramide production and O2.− level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs+/−/Asm−/− mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O2.− production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or

  10. RNA interference-based gene silencing of phytoene synthase impairs growth, carotenoids, and plastid phenotype in Oncidium hybrid orchid.

    PubMed

    Liu, Jian-Xin; Chiou, Chung-Yi; Shen, Chin-Hui; Chen, Peng-Jen; Liu, Yao-Chung; Jian, Chin-Der; Shen, Xiao-Lan; Shen, Fu-Quan; Yeh, Kai-Wun

    2014-01-01

    Phytoene synthase (PSY) is the first rate-limiting regulatory enzyme in the carotenoid biosynthesis pathway. In order to modify the floral color pattern by reducing carotenoid contents, a phytoene synthase-RNAi construct was delivered into protocorm-like body (PLB) of Oncidium hybrid orchid. The transgenic orchids show down-regulated level of PSY and geranyl synthase gene. They displayed semi-dwarf phenotype and brilliant green leaves. The microscopic anatomy revealed development-arrested plastids with rare grana. The total carotenoid content was decreased and the efficiency of the photosynthetic electron transport was declined. The chlorophyll level and the expression of chlorophyll biosynthetic genes, such as OgGLUTR and OgCS were dramatically reduced. HPLC analysis showed that the endogenous level of gibberellic acid and abscisic acid in the dwarf transformants are 4-fold lower than in wild type plants. In addition, chilling tolerance of the transgenic Oncidium plants was reduced. The data showed that down-regulation of PSY resulted in alterations of gene expression in enzymes involved in many metabolic pathways, such as carotenoid, gibberellic acid, abscisic acid and chlorophyll biosynthetic pathway as well as causes predominant defects in plant growth and development. PMID:25221736

  11. Chitin synthase 3 from yeast has zymogenic properties that depend on both the CAL1 and the CAL3 genes.

    PubMed Central

    Choi, W J; Sburlati, A; Cabib, E

    1994-01-01

    In previous studies, chitin synthase 3 (Chs3), the enzyme responsible for synthesis of most of the chitin present in the yeast cell, was found to be inactivated by incubation with trypsin, in contrast to other yeast chitin synthases (Chs1 and Chs2), which are stimulated by this treatment (chitin synthase; UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyl-transferase, EC 2.4.1.16). It has now been found that the substrate UDPGlcNAc protects Chs3 against proteolytic inactivation. Treatment of Chs3-containing membranes with detergents drastically reduced the enzymatic activity. Activity could, however, be restored by subsequent incubation with trypsin or other proteases in the presence of UDPGlcNAc. Under such conditions, protease treatment stimulated activity as much as 10-fold. A change in divalent cation specificity after trypsin treatment suggests that the protease directly affects the enzyme molecule. Experiments with mutants in the three genes involved in Chs3 activity--CAL1, CAL2, and CAL3--showed that only CAL1 and CAL3 are required for the protease-elicited (zymogenic) activity. It is concluded that Chs3 is a zymogen and that the CAL2 product functions as its activator. The differences and possible similarities between Chs3 and the other chitin synthases are discussed. PMID:8197125

  12. Functional Analysis of the Phycomyces carRA Gene Encoding the Enzymes Phytoene Synthase and Lycopene Cyclase

    PubMed Central

    Sanz, Catalina; Velayos, Antonio; Álvarez, María Isabel; Benito, Ernesto P.; Eslava, Arturo P.

    2011-01-01

    Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism. PMID:21858003

  13. Insulin inhibits delta-aminolevulinate synthase gene expression in rat hepatocytes and human hepatoma cells.

    PubMed

    Scassa, M E; Varone, C L; Montero, L; Cánepa, E T

    1998-11-01

    Insulin has been known to regulate intracellular metabolism by modifying the activity or location of many enzymes but it is only in the past few years that the regulation of gene expression is recognized to be a major action of this hormone. The present work provides evidences that insulin inhibits delta-aminolevulinate synthase (ALA-S) gene expression, the enzyme which governs the rate-limiting step in heme biosynthesis. The addition of 5 nM insulin to hepatocytes culture led to a significant decrease of both basal and phenobarbital-induced ALA-S mRNA in a dose-dependent manner, as measured by Northern and slot-blot analysis. Several clues as to how insulin regulates ALA-S transcription were determined. The inhibitory effect is achieved at physiological concentrations but much higher proinsulin doses are needed. Insulin's effect is rapid, quite specific, and protein synthesis is not required. Moreover, ALA-S mRNA half-life is not modified by the presence of the peptidic hormone. Our results demonstrate that the insulin effect is dominant; it overrides 8-CPT-cAMP plus phenobarbital-mediated induction. Also, insulin requires the activation of protein kinase C to exert its full effect. On the other hand, a 870-bp fragment of the ALA-S promoter region is able to sustain the inhibition of CAT expression in plasmid-transfected HepG2 cells. Thus, these results indicate that insulin plays an important role in regulating ALA-S expression by inhibiting its transcription. PMID:9806796

  14. Functional characterization of the Ginkgo biloba chalcone synthase gene promoter in transgenic tobacco.

    PubMed

    Li, L L; Cheng, H; Yuan, H H; Xu, F; Cheng, S Y; Cao, F L

    2014-01-01

    The regulative sequence (2273 bp) of the chalcone synthase gene promoter of biloba was cloned by genomic walking. A 2273-bp promoter 5' upstream translation start site of GbCHS was cloned and designated as GbCHSP. pBI121+CHSP:GUS and pBI121-35S:GUS were constructed and transformed into tobacco by LBA4404. We found that GbCHSP could drive transient expression of GUS in tobacco and differentially expressed in root, stem and leaf tissues of this plant. GUS activity regulated by the CHSP promoter were located in tissues (apical meristems) at the growing points of roots and stems. pBI121+CHSP:GUS could be induced by wounding, copper, UV-B, abscisic acid, and ethephon treatments of transgenic seedlings. This activity was weakly inhibited by gibberellin. Deletion analysis of the CHSP promoter in transgenic tobacco showed that CHSP1 complete promoter conferred a GUS expression and activity similar to that of 35 S(CaMV). GUS activity dropped dramatically when there were CHSP4, CHSP5 constructs and was almost totally absent when the CHSP6 construct was present. We conclude that the upstream sequence -1548 to -306 of GbCHSP is the main region for transcriptional regulation of the CHS gene and that it is activated by hormone and stress factors in G. biloba. These results will help us to understand the transcriptional regulatory mechanisms involved in GbCHS expression and flavonoid accumulation in G. biloba. PMID:24841790

  15. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  16. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    PubMed

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation. PMID:23238915

  17. Complete Genome Sequence of the Rhizobacterium Pseudomonas trivialis Strain IHBB745 with Multiple Plant Growth-Promoting Activities and Tolerance to Desiccation and Alkalinity.

    PubMed

    Gulati, Arvind; Swarnkar, Mohit Kumar; Vyas, Pratibha; Rahi, Praveen; Thakur, Rishu; Thakur, Namika; Singh, Anil Kumar

    2015-01-01

    The complete genome sequence of 6.45 Mb is reported here for Pseudomonas trivialis strain IHBB745 (MTCC 5336), which is an efficient, stress-tolerant, and broad-spectrum plant growth-promoting rhizobacterium. The gene-coding clusters predicted the genes for phosphate solubilization, siderophore production, 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, indole-3-acetic acid (IAA) production, and stress response. PMID:26337878

  18. Transcripts of two ent-copalyl diphosphate synthase genes differentially localize in rice plants according to their distinct biological roles

    PubMed Central

    Toyomasu, Tomonobu; Usui, Masami; Sugawara, Chizu; Kanno, Yuri; Sakai, Arisa; Takahashi, Hirokazu; Nakazono, Mikio; Kuroda, Masaharu; Miyamoto, Koji; Morimoto, Yu; Mitsuhashi, Wataru; Okada, Kazunori; Yamaguchi, Shinjiro; Yamane, Hisakazu

    2015-01-01

    Gibberellins (GAs) are diterpenoid phytohormones that regulate various aspects of plant growth. Tetracyclic hydrocarbon ent-kaurene is a biosynthetic intermediate of GAs, and is converted from geranylgeranyl diphosphate, a common precursor of diterpenoids, via ent-copalyl diphosphate (ent-CDP) through successive cyclization reactions catalysed by two distinct diterpene synthases, ent-CDP synthase and ent-kaurene synthase. Rice (Oryza sativa L.) has two ent-CDP synthase genes, OsCPS1 and OsCPS2. It has been thought that OsCPS1 participates in GA biosynthesis, while OsCPS2 participates in the biosynthesis of phytoalexins, phytocassanes A–E, and oryzalexins A–F. It has been shown previously that loss-of-function OsCPS1 mutants display a severe dwarf phenotype caused by GA deficiency despite possessing another ent-CDP synthase gene, OsCPS2. Here, experiments were performed to account for the non-redundant biological function of OsCPS1 and OsCPS2. Quantitative reverse transcription–PCR (qRT–PCR) analysis showed that OsCPS2 transcript levels were drastically lower than those of OsCPS1 in the basal parts, including the meristem of the second-leaf sheaths of rice seedlings. qRT–PCR results using tissue samples prepared by laser microdissection suggested that OsCPS1 transcripts mainly localized in vascular bundle tissues, similar to Arabidopsis CPS, which is responsible for GA biosynthesis, whereas OsCPS2 transcripts mainly localized in epidermal cells that address environmental stressors such as pathogen attack. Furthermore, the OsCPS2 transgene under regulation of the OsCPS1 promoter complemented the dwarf phenotype of an OsCPS1 mutant, oscps1-1. The results indicate that transcripts of the two ent-CDP synthase genes differentially localize in rice plants according to their distinct biological roles, OsCPS1 for growth and OsCPS2 for defence. PMID:25336684

  19. Localization of the squalene synthase gene (FDFT1) to human chromosome 8p22-p23. 1

    SciTech Connect

    Shechter, I.; Conrad, D.G.; Hart, I.; Berger, R.C.; McKenzie, T.L.; Bleskan, J.; Patterson, D. )

    1994-03-01

    Recently, the authors reported the isolation of a cDNA encoding the human enzyme squalene synthase, the first step of sterol biosynthesis uniquely committed to synthesis of cholesterol. As such, it is likely that this enzyme occupies a critical regulatory position in the synthesis of cholesterol. As part of continuing studies of the role of this gene in cellular metabolism, they undertook the mapping of this gene on the human chromosomes. To localize the gene, they first isolated a yeast artificial chromosome (YAC) containing the squalene synthase gene. They then used fluorescence in situ hybridization (FISH) with yeast DNA containing the YAC to localize the gene to chromosome 8. Assignment to human chromosome 8 was confirmed by polymerase chain reaction analysis of a somatic cell hybrid containing human chromosome 8. Use of a somatic cell hybrid regional mapping panel dividing chromosome 8 into several fragments localized the gene to 8p21-pter. Fractional length analysis of the FISH mapping placed the signal generated with this YAC at 8p22-p23.1. 13 refs., 2 figs.

  20. Expression of the Rhodobacter sphaeroides hemA and hemT genes, encoding two 5-aminolevulinic acid synthase isozymes.

    PubMed Central

    Neidle, E L; Kaplan, S

    1993-01-01

    The nucleotide sequences of the Rhodobacter sphaeroides hemA and hemT genes, encoding 5-aminolevulinic acid (ALA) synthase isozymes, were determined. ALA synthase catalyzes the condensation of glycine and succinyl coenzyme A, the first and rate-limiting step in tetrapyrrole biosynthesis. The hemA and hemT structural gene sequences were 65% identical to each other, and the deduced HemA and HemT polypeptide sequences were 53% identical, with an additional 16% of aligned amino acids being similar. HemA and HemT were homologous to all characterized ALA synthases, including two human ALA synthase isozymes. In addition, they were evolutionarily related to 7-keto-8-aminopelargonic acid synthetase (BioF) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), enzymes which catalyze similar reactions. Two hemA transcripts were identified, both expressed under photosynthetic conditions at levels approximately three times higher than those found under aerobic conditions. A single transcriptional start point was identified for both transcripts, and a consensus sequence at this location indicated that an Fnr-like protein may be involved in the transcriptional regulation of hemA. Transcription of hemT was not detected in wild-type cells under the physiological growth conditions tested. In a mutant strain in which the hemA gene had been inactivated, however, hemT was expressed. In this mutant, hemT transcripts were characterized by Northern (RNA) hybridization, primer extension, and ribonuclease protection techniques. A small open reading frame of unknown function was identified upstream of, and transcribed in the same direction as, hemA. Images PMID:8468290

  1. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    NASA Technical Reports Server (NTRS)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  2. Multiple resistance to sulfonylureas and imidazolinones conferred by an acetohydroxyacid synthase gene with separate mutations for selective resistance.

    PubMed

    Hattori, J; Rutledge, R; Labbé, H; Brown, D; Sunohara, G; Miki, B

    1992-03-01

    The acetohydroxyacid synthase (AHAS) gene from the Arabidopsis thaliana mutant line GH90 carrying the imidazolinone resistance allele imr1 was cloned. Expression of the AHAS gene under the control of the CaMV 35S promoter in transgenic tobacco resulted in selective imidazolinone resistance, confirming that the single base-pair change found near the 3' end of the coding region of this gene is responsible for imidazolinone resistance. A chimeric AHAS gene containing both the imr1 mutation and the csr1 mutation, responsible for selective resistance to sulfonylurea herbicides, was constructed. It conferred on transgenic tobacco plants resistance to both sulfonylurea and imidazolinone herbicides. The data illustrate that a multiple-resistance phenotype can be achieved in an AHAS gene through combinations of separate mutations, each of which individually confers resistance to only one class of herbicides. PMID:1557022

  3. Chitin synthase gene FgCHS8 affects virulence and fungal cell wall sensitivity to environmental stress in Fusarium graminearum.

    PubMed

    Zhang, Ya-Zhou; Chen, Qing; Liu, Cai-Hong; Liu, Yu-Bin; Yi, Pan; Niu, Ke-Xin; Wang, Yan-Qing; Wang, An-Qi; Yu, Hai-Yue; Pu, Zhi-En; Jiang, Qian-Tao; Wei, Yu-Ming; Qi, Peng-Fei; Zheng, You-Liang

    2016-05-01

    Fusarium graminearum is the major causal agent of Fusarium head blight (FHB) of wheat and barley and is considered to be one of the most devastating plant diseases worldwide. Chitin is a critical component of the fungal cell wall and is polymerized from UDP-N-acetyl-alpha-D-glucosamine by chitin synthase. We characterized FgCHS8, a new class of the chitin synthase gene in F. graminearum. Disruption of FgCHS8 resulted in reduced accumulation of chitin, decreased chitin synthase activity, and had no effect on conidia growth when compared with the wild-type isolate. ΔFgCHS8 had a growth rate comparable to that of the wild-type isolate in vitro. However, ΔFgCHS8 had reduced growth when grown on agar supplemented with either 0.025% SDS or 0.9 mM salicylic acid. ΔFgCHS8 produced significantly less deoxynivalenol and exhibited reduced pathogenicity in wheat spikes. Re-introduction of a functional FgCHS8 gene into the ΔFgCHS8 mutant strain restored the wild-type phenotypes. Fluorescence microscopy revealed that FgCHS8 protein was initially expressed in the septa zone, and then gradually distributed over the entire cellular membrane, indicating that FgCHS8 was required for cell wall development. Our results demonstrated that FgCHS8 is important for cell wall sensitivity to environmental stress factors and deoxynivalenol production in F. graminearum. PMID:27109372

  4. Transcripts for genes encoding soluble acid invertase and sucrose synthase accumulate in root tip and cortical cells containing mycorrhizal arbuscules.

    PubMed

    Blee, Kristopher A; Anderson, Anne J

    2002-09-01

    Arbuscule formation by the arbuscular mycorrhizal fungus Glomus intraradices (Schenck & Smith) was limited to cortical cells immediately adjacent to the endodermis. Because these cortical cells are the first to intercept photosynthate exiting the vascular cylinder, transcript levels for sucrose metabolizing-enzymes were compared between mycorrhizal and non-mycorrhizal roots. The probes corresponded to genes encoding a soluble acid invertase with potential vacuolar targeting, which we generated from Phaseolus vulgaris roots, a Rhizobium-responsive sucrose synthase of soybean and a cell wall acid invertase of carrot. Transcripts in non-mycorrhizal roots were developmentally regulated and abundant in the root tips for all three probes but in differentiated roots of P. vulgaris they were predominantly located in phloem tissues for sucrose synthase or the endodermis and phloem for soluble acid invertase. In mycorrhizal roots increased accumulations of transcripts for sucrose synthase and vacuolar invertase were both observed in the same cortical cells bearing arbuscules that fluoresce. There was no effect on the expression of the cell wall invertase gene in fluorescent carrot cells containing arbuscules. Thus, it appears that presence of the fungal hyphae in the fluorescent arbusculated cell stimulates discrete alterations in expression of sucrose metabolizing enzymes to increase the sink potential of the cell. PMID:12175013

  5. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis.

    PubMed

    Sundari, Balachandran Karpaga Raja; Dasgupta, Modhumita Ghosh

    2014-08-01

    Cellulose synthases (CesA) represent a group of β-1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs. PMID:25189235

  6. The maize An2 gene is induced by Fusarium attack and encodes an ent-copalyl diphosphate synthase.

    PubMed

    Harris, L J; Saparno, A; Johnston, A; Prisic, S; Xu, M; Allard, S; Kathiresan, A; Ouellet, T; Peters, R J

    2005-12-01

    Using the technique of differential display, a maize transcript was identified whose silk tissue expression is induced in the presence of the ear rot pathogen Fusarium graminearum. The 3445 nt transcript includes a 727 nt 5' untranslated leader with the potential for extensive secondary structure and represents the maize gene An2. An2 encodes a copalyl diphosphate synthase (CPS)-like protein with 60% amino acid sequence identity with the maize An1 gene product involved in gibberellin (GA) biosynthesis. Recombinant expression and functional analysis demonstrated that both AN1 and AN2 are ent-copalyl diphosphate (ent-CPP) synthases (ent-CPS). Notably, the presence of an additional ent-CPS gene is consistent with previous reports that maize GA biosynthesis can proceed in the absence of An1. In addition, northern blot analysis showed that An2 transcript levels were strongly up-regulated by Fusarium attack, with an increase in silk, husk and ear tip tissues as early as 6 h after inoculation of silk channels with spore suspensions of various Fusarium sp. Gene expression of a third maize CPS-like gene, Cpsl1, is not affected by Fusarium infection. The Fusarium-inducible nature of An2 is also consistent with a previous report that cell-free extracts from maize seedlings produce ent-CPP derived diterpenes in response to Fusarium infection. However, it is not known whether An2 is involved in defense-related secondary metabolism in addition to GA synthesis. PMID:16307364

  7. Pneumocystis jiroveci dihydropteroate synthase gene mutations among colonized individuals and Pneumocystis pneumonia patients from Spain.

    PubMed

    Friaza, Vicente; Morilla, Rubén; Respaldiza, Nieves; de la Horra, Carmen; Calderón, Enrique J

    2010-11-01

    Cotrimoxazole, an association of trimethoprim and sulfamethoxazole, and dapsone, are mainstays for the prophylaxis and treatment of Pneumocystis pneumonia (PcP). The inability to culture Pneumocystis prevents routine susceptibility testing and detection of drug resistance. Instead, molecular techniques have been used to detect Pneumocystis jiroveci dihydropteroate synthase (DHPS) mutations that cause sulfa resistance in other microorganisms. The most frequent DHPS mutations occur at nucleotide positions 165 and 171, which lead to an amino acid change at positions 55 and 57. Several studies suggest that these mutations are associated with the failure of chemoprophylaxis for PcP. The aim was to establish the frequency and characteristics of P jiroveci DHPS mutations among colonized individuals and PcP patients from Spain. A total of 50 colonized individuals and 25 PcP patients were studied. DHPS polymorphisms were identified by restriction fragment length polymorphism assay. The analysis provided a rate of 28% of DHPS gene mutations in our population, with the presence of all possible polymorphisms described. The presence of mutations was higher in PcP patients than in colonized subjects (40% vs 22%), probably because of the chemoprophylaxis used in PcP patients. The comparison between patients with and without DHPS mutations did not show statistical differences due to age, sex, steroid use, sulfa drug exposure, or smoking. A high rate of DHPS mutations in our area of Spain, not only confined to patients previously exposed to sulfa drugs, is shown in this study. As well as PcP patients, colonized individuals who harbor P jiroveci strains with DHPS mutations could play a major role in the transmission cycle of these mutations, representing a reservoir and source of infection for susceptible individuals. Further research is thus warranted to assess the true scope of the problem and to design rational preventive strategies. PMID:21084778

  8. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    SciTech Connect

    Yoshigai, Emi; Machida, Toru; Okuyama, Tetsuya; Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota; Okumura, Tadayoshi; Ikeya, Yukinobu; Nishino, Hoyoku; Nishizawa, Mikio

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  9. Polymorphisms of cystathionine beta-synthase gene are associated with susceptibility to sepsis.

    PubMed

    Sponholz, Christoph; Kramer, Marcel; Schöneweck, Franziska; Menzel, Uwe; Inanloo Rahatloo, Kolsoum; Giamarellos-Bourboulis, Evangelos J; Papavassileiou, Vassileios; Lymberopoulou, Korina; Pavlaki, Maria; Koutelidakis, Ioannis; Perdios, Ioannis; Scherag, André; Bauer, Michael; Platzer, Matthias; Huse, Klaus

    2016-07-01

    Sepsis is the systemic inflammatory host response to infection. Cystathionine beta-synthase (CBS)-dependent homocysteine (Hcy) pathway was demonstrated to affect disease severity and mortality in patients with severe sepsis/septic shock. Independent studies identified a single-nucleotide polymorphism (SNP, rs6586282, hg19 chr21:g.44478497C>T) in intron 14 of the CBS-coding gene (CBS) associated with Hcy plasma levels. We aimed to describe the association of this SNP and variants of a splice donor-affecting variable-number tandem repeat (VNTR, NG_008938.1:g.22763_22793[16_22]) 243 bp downstream of rs6586282 with severe human sepsis. We analyzed the VNTR structure and genotyped variants of rs6586282 and a neighboring SNP (rs34758144, hg19 chr21:g.44478582G>A) in two case-control studies including patients with severe sepsis/septic shock from Germany (n=168) and Greece (n=237). In both studies, we consistently observed an association of CBS VNTR alleles with sepsis susceptibility. Risk linearly increased with number of tandem repeats (per allele odds ratio in the adjusted analysis 1.34; 95% confidence interval (CI)=1.17-1.55; P<0.001). Association had also been shown for rs34758144 whose risk allele is in linkage disequilibrium with one long VNTR allele (19 repeat). In contrast, we observed no evidence for an effect on 28-day survival in patients with severe sepsis/septic shock (per allele hazard ratio in the adjusted analysis for VNTR 1.10; 95% CI=0.95-1.28; P=0.20). In a minigene approach, we demonstrated alternative splicing in distinct VNTR alleles, which, however, was independent of the number of tandem units. In conclusion, there is no ordinary conjunction between human CBS and severe sepsis/septic shock, but CBS genotypes are involved in disease susceptibility. PMID:26508567

  10. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites. PMID:27183792

  11. Oxygen control of ethylene biosynthesis during seed development in Arabidopsis thaliana (L.) Heynh

    NASA Technical Reports Server (NTRS)

    Ramonell, K. M.; McClure, G.; Musgrave, M. E.

    2002-01-01

    An unforeseen side-effect on plant growth in reduced oxygen is the loss of seed production at concentrations around 25% atmospheric (50 mmol mol-1 O2). In this study, the model plant Arabidopsis thaliana (L.) Heynh. cv. 'Columbia' was used to investigate the effect of low oxygen on ethylene biosynthesis during seed development. Plants were grown in a range of oxygen concentrations (210 [equal to ambient], 160, 100, 50 and 25 mmol mol-1) with 0.35 mmol mol-1 CO2 in N2. Ethylene in full-sized siliques was sampled using gas chromatography, and viable seed production was determined at maturity. Molecular analysis of ethylene biosynthesis was accomplished using cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase in ribonuclease protection assays and in situ hybridizations. No ethylene was detected in siliques from plants grown at 50 and 25 mmol mol-1 O2. At the same time, silique ACC oxidase mRNA increased three-fold comparing plants grown under the lowest oxygen with ambient controls, whereas ACC synthase mRNA was unaffected. As O2 decreased, tissue-specific patterning of ACC oxidase and ACC synthase gene expression shifted from the embryo to the silique wall. These data demonstrate how low O2 modulates the activity and expression of the ethylene biosynthetic pathway during seed development in Arabidopsis.

  12. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    PubMed

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  13. The Maize Gene terpene synthase 1 Encodes a Sesquiterpene Synthase Catalyzing the Formation of (E)-β-Farnesene, (E)-Nerolidol, and (E,E)-Farnesol after Herbivore Damage1

    PubMed Central

    Schnee, Christiane; Köllner, Tobias G.; Gershenzon, Jonathan; Degenhardt, Jörg

    2002-01-01

    Maize (Zea mays) emits a mixture of volatile compounds upon attack by the Egyptian cotton leafworm (Spodoptera littoralis). These substances, primarily mono- and sesquiterpenes, are used by parasitic wasps to locate the lepidopteran larvae, which are their natural hosts. This interaction among plant, lepidopteran larvae, and hymenopteran parasitoids benefits the plant and has been termed indirect defense. The committed step in the biosynthesis of the different skeletal types of mono- and sesquiterpenes is catalyzed by terpene synthases, a class of enzymes that forms a large variety of mono- and sesquiterpene products from prenyl diphosphate precursors. We isolated a terpene synthase gene, terpene synthase 1 (tps1), from maize that exhibits only a low degree of sequence identity to previously identified terpene synthases. Upon expression in a bacterial system, the encoded enzyme produced the acyclic sesquiterpenes, (E)-β-farnesene, (E,E)-farnesol, and (3R)-(E)-nerolidol, the last an intermediate in the formation of (3E)-4,8-dimethyl-1,3,7-nonatriene. Both (E)-β-farnesene and (3E)-4,8-dimethyl-1,3,7-nonatriene are prominent compounds of the maize volatile blend that is emitted after herbivore damage. The biochemical characteristics of the encoded enzyme are similar to those of terpene synthases from both gymnosperms and dicotyledonous angiosperms, suggesting that catalysis involves a similar electrophilic reaction mechanism. The transcript level of tps1 in the maize cv B73 was elevated after herbivory, mechanical damage, and treatment with elicitors. In contrast, the increase in the transcript level of the tps1 gene or gene homolog in the maize cv Delprim after herbivory was less pronounced, suggesting that the regulation of terpene synthase expression may vary among maize varieties. PMID:12481088

  14. Ectopic overexpression of the cell wall invertase gene CIN1 leads to dehydration avoidance in tomato.

    PubMed

    Albacete, Alfonso; Cantero-Navarro, Elena; Großkinsky, Dominik K; Arias, Cintia L; Balibrea, María Encarnación; Bru, Roque; Fragner, Lena; Ghanem, Michel E; González, María de la Cruz; Hernández, Jose A; Martínez-Andújar, Cristina; van der Graaff, Eric; Weckwerth, Wolfram; Zellnig, Günther; Pérez-Alfocea, Francisco; Roitsch, Thomas

    2015-02-01

    senescence-delaying hormone trans-zeatin and decreases in the senescence-inducing ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) in the leaves. Thus, cwInv critically functions at the integration point of metabolic, hormonal, and stress signals, providing a novel strategy to overcome drought-induced limitations to crop yield, without negatively affecting plant fitness under optimal growth conditions. PMID:25392479

  15. Ectopic overexpression of the cell wall invertase gene CIN1 leads to dehydration avoidance in tomato

    PubMed Central

    Albacete, Alfonso; Cantero-Navarro, Elena; Großkinsky, Dominik K.; Arias, Cintia L.; Balibrea, María Encarnación; Bru, Roque; Fragner, Lena; Ghanem, Michel E.; González, María de la Cruz; Hernández, Jose A.; Martínez-Andújar, Cristina; van der Graaff, Eric; Weckwerth, Wolfram; Zellnig, Günther; Pérez-Alfocea, Francisco; Roitsch, Thomas

    2015-01-01

    the senescence-delaying hormone trans-zeatin and decreases in the senescence-inducing ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) in the leaves. Thus, cwInv critically functions at the integration point of metabolic, hormonal, and stress signals, providing a novel strategy to overcome drought-induced limitations to crop yield, without negatively affecting plant fitness under optimal growth conditions. PMID:25392479

  16. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress.

    PubMed

    Xie, D W; Wang, X N; Fu, L S; Sun, J; Zheng, W; Li, Z F

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat-rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae. PMID:25846877

  17. Over-expression of a grape stilbene synthase gene in tomato induces parthenocarpy and causes abnormal pollen development.

    PubMed

    Ingrosso, Ilaria; Bonsegna, Stefania; De Domenico, Stefania; Laddomada, Barbara; Blando, Federica; Santino, Angelo; Giovinazzo, Giovanna

    2011-10-01

    A novel strategy to induce parthenocarpy in tomato fruits by the induction of resveratrol biosynthesis in flower tissues was exploited. Two transgenic tomato lines were considered: a higher resveratrol-producing (35SS) line, constitutively expressing a grape stilbene synthase cDNA, and a lower resveratrol-producing (LoxS) line, expressing stilbene synthase under a fruit-specific promoter. The expression of the stilbene synthase gene affected flavonoid metabolism in a different manner in the transgenic lines, and in one of these, the 35SS line, resulted in complete male sterility. Resveratrol was synthesised either in 35SS or LoxS tomato flowers, at an even higher extent (about 8-10 times) in the former line. We further investigated whether stilbene synthase expression may have resulted in impaired naringenin accumulation during flower development. In the 35SS flowers, naringenin was significantly impaired by about 50%, probably due to metabolic competition. Conversely, the amount of glycosylated flavonols increased in transgenic flowers, thereby excluding the diminished production of flavonols as a reason for parthenocarpy in tomato. We further investigated whether resveratrol synthesis may have resulted changes to pollen structure. Microscopic observations revealed the presence of few and abnormal flake-like pollen grains in 35SS flowers with no germination capability. Finally, the analysis of coumaric and ferulic acids, the precursors of lignin and sporopollenin biosynthesis, revealed significant depletion of these compounds, therefore suggesting an impairment in structural compounds as a reason for pollen ablation. These overall outcomes, to the best of our knowledge, reveal for the first time the major role displayed by resveratrol synthesis on parthenocarpy in tomato fruits. PMID:21843947

  18. The Saccharomyces cerevisiae FKS1 (ETG1) gene encodes an integral membrane protein which is a subunit of 1,3-beta-D-glucan synthase.

    PubMed Central

    Douglas, C M; Foor, F; Marrinan, J A; Morin, N; Nielsen, J B; Dahl, A M; Mazur, P; Baginsky, W; Li, W; el-Sherbeini, M

    1994-01-01

    In Saccharomyces cerevisiae, mutations in FKS1 confer hypersensitivity to the immunosuppressants FK506 and cyclosporin A, while mutations in ETG1 confer resistance to the cell-wall-active echinocandins (inhibitors of 1,3-beta-D-glucan synthase) and, in some cases, concomitant hypersensitivity to the chitin synthase inhibitor nikkomycin Z. The FKS1 and ETG1 genes were cloned by complementation of these phenotypes and were found to be identical. Disruption of the gene results in (i) a pronounced slow-growth phenotype, (ii) hypersensitivity to FK506 and cyclosporin A, (iii) a slight increase in sensitivity to echinocandin, and (iv) a significant reduction in 1,3-beta-D-glucan synthase activity in vitro. The nucleotide sequence encodes a 215-kDa polypeptide predicted to be an integral membrane protein with 16 transmembrane helices, consistent with previous observations that the etg1-1 mutation results in echinocandin-resistant glucan synthase activity associated with the nonextractable membrane fraction of the enzyme. These results suggest that FKS1 encodes a subunit of 1,3-beta-D-glucan synthase. The residual activity present in the disruption mutant, the nonessential nature of the gene, and results of Southern blot hybridization analysis point to the existence of a glucan synthase isozyme. Images Fig. 1 Fig. 3 Fig. 5 PMID:7528927

  19. mRNA Transcript abundance during plant growth and the influence of Li(+) exposure.

    PubMed

    Duff, M C; Kuhne, W W; Halverson, N V; Chang, C-S; Kitamura, E; Hawthorn, L; Martinez, N E; Stafford, C; Milliken, C E; Caldwell, E F; Stieve-Caldwell, E

    2014-12-01

    Lithium (Li) toxicity in plants is, at a minimum, a function of Li(+) concentration, exposure time, species and growth conditions. Most plant studies with Li(+) focus on short-term acute exposures. This study examines short- and long-term effects of Li(+) exposure in Arabidopsis with Li(+) uptake studies and measured shoot mRNA transcript abundance levels in treated and control plants. Stress, pathogen-response and arabinogalactan protein genes were typically more up-regulated in older (chronic, low level) Li(+)-treatment plants and in the much younger plants from acute high-level exposures. The gene regulation behavior of high-level Li(+) resembled prior studies due to its influence on: inositol synthesis, 1-aminocyclopropane-1-carboxylate synthases and membrane ion transport. In contrast, chronically-exposed plants had gene regulation responses that were indicative of pathogen, cold, and heavy-metal stress, cell wall degradation, ethylene production, signal transduction, and calcium-release modulation. Acute Li(+) exposure phenocopies magnesium-deficiency symptoms and is associated with elevated expression of stress response genes that could lead to consumption of metabolic and transcriptional energy reserves and the dedication of more resources to cell development. In contrast, chronic Li(+) exposure increases expression signal transduction genes. The identification of new Li(+)-sensitive genes and a gene-based "response plan" for acute and chronic Li(+) exposure are delineated. PMID:25443852

  20. mRNA Transcript Abundance during Plant Growth and the Influence of Li+ Exposure

    DOE PAGESBeta

    Duff, M. C.; Kuhne, W. W.; Halverson, N. V.; Chang, C. -S.; Kitamura, E.; Hawthorn, L.; Martinez, N. E.; Stafford, C.; Milliken, C. E.; Caldwell, E. F.; et al

    2014-10-23

    Lithium (Li) toxicity in plants is, at a minimum, a function of Li+ concentration, exposure time, species and growth conditions. Most plant studies with Li+ focus on short-term acute exposures. This study examines short- and long-term effects of Li+ exposure in Arabidopsis with Li+ uptake studies and measured shoot mRNA transcript abundance levels in treated and control plants. Stress, pathogen-response and arabinogalactan protein genes were typically more up-regulated in older (chronic, low level) Li+-treatment plants and in the much younger plants from acute high-level exposures. The gene regulation behavior of high-level Li+ resembled prior studies due to its influence on:more » inositol synthesis, 1-aminocyclopropane-1-carboxylate synthases and membrane ion transport. In contrast, chronically-exposed plants had gene regulation responses that were indicative of pathogen, cold, and heavy-metal stress, cell wall degradation, ethylene production, signal transduction, and calcium-release modulation. Acute Li+ exposure phenocopies magnesium-deficiency symptoms and is associated with elevated expression of stress response genes that could lead to consumption of metabolic and transcriptional energy reserves and the dedication of more resources to cell development. In contrast, chronic Li+ exposure increases expression signal transduction genes. The identification of new Li+-sensitive genes and a gene-based “response plan” for acute and chronic Li+ exposure are delineated.« less

  1. Association of Polymorphism of Neuronal Nitric Oxide Synthase Gene with Risk to Parkinson's Disease.

    PubMed

    Gupta, Satya Prakash; Kamal, Ritul; Mishra, Sarad Kumar; Singh, Maneesh Kumar; Shukla, Rakesh; Singh, Mahendra Pratap

    2016-07-01

    Environmental factors are implicated in aging as well as genetic predisposition-induced Parkinson's disease (PD) pathogenesis. Wrongdoers increase oxidative stress and nitrosative burden, which eventually degenerate the nigrostriatal dopaminergic neurons. Inhibition of the expression of nitric oxide synthase (NOS), an enzyme responsible for nitric oxide (NO) biosynthesis, prevents the demise of the nigrostriatal dopaminergic neurons. Polymorphism of NOS is thus expected to alter PD susceptibility. The study therefore aimed to examine an association of neuronal NOS (nNOS) gene polymorphism with nitrite, an indicator of nitrosative load; lipid peroxidation, an index of oxidative stress and PD susceptibility. An age-matched case-control study was performed in the north Indian residents enrolled at the Neurology Department of the King George's Medical University, Lucknow, India. While nNOS exon 29 TT variant genotype [odds ratio (OR) = 2.20, 95 % CI = 1.08-5.34, P = 0.040], combined TT and CT variants [OR = 1.68, 95 % CI = 1.05-2.69, P = 0.031] and T allele [OR = 1.58, 95 % CI = 1.10-2.28, P = 0.014] were found to be significantly associated with PD susceptibility, no association between nNOS exon 18 [OR for TT carriers = 1.97, 95 % CI = 0.89-4.20, P = 0.09 and OR for T allele = 1.35, 95 % CI = 0.94-1.93, P = 0.098] and PD risk was observed. Lipid peroxidation was augmented in all patients irrespective of their genotype. While genotype independent increase in nitrite content was observed in PD patients of exon 29 polymorphic groups, only heterozygous variant genotype of exon 18 was associated with augmentation in nitrite level as compared with respective control. The results obtained thus demonstrate that selected nNOS polymorphisms do not significantly contribute to PD risk in north Indian population. PMID:26081147

  2. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

    PubMed Central

    Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

    2015-01-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  3. Discovery of bacterial polyhydroxyalkanoate synthase (PhaC)-encoding genes from seasonal Baltic Sea ice and cold estuarine waters.

    PubMed

    Pärnänen, Katariina; Karkman, Antti; Virta, Marko; Eronen-Rasimus, Eeva; Kaartokallio, Hermanni

    2015-01-01

    Polyhydroxyalkanoates (PHAs) are macromolecules produced by bacteria as means for storing carbon and energy in intracellular granules. PHAs have physical properties similar to those of plastics and have become of interest to industry as materials for environmentally friendly bioplastic production. There is an ongoing search for new PHA-producing bacterial strains and PHA-synthesizing enzymes tolerating extreme conditions to find ways of producing PHAs at cold temperatures and high solute concentrations. Moreover, the study of PHA producers in the sea-ice biome can aid in understanding the microbial ecology of carbon cycling in ice-associated ecosystems. In this study, PHA producers and PHA synthase genes were examined under the extreme environmental conditions of sea ice and cold seawater to find evidence of PHA production in an environment requiring adaptation to high salinity and cold temperatures. Sea ice and cold estuarine water samples were collected from the northern Baltic Sea and evidence of PHA production was gathered, using microscopy with Nile Blue A staining of PHA-granules and PCR assays detecting PHA-synthesis genes. The PHA granules and PHA synthases were found at all sampling locations, in both sea ice and water, and throughout the sampling period spanning over 10 years. Our study shows, for the first time, that PHA synthesis occurs in Baltic Sea cold-adapted bacteria in their natural environment, which makes the Baltic Sea and its cold environments an interesting choice in the quest for PHA-synthesizing bacteria and synthesis genes. PMID:25280551

  4. Roles of ceramide synthase and ceramide clearence genes in nilotinib-induced cell death in chronic myeloid leukemia cells.

    PubMed

    Camgoz, Aylin; Gencer, Emel Basak; Ural, Ali Ugur; Avcu, Ferit; Baran, Yusuf

    2011-08-01

    In this study, we aimed to increase the sensitivity of human K562 and Meg-01 chronic myeloid leukemia (CML) cells to nilotinib by targeting bioactive sphingolipids, in addition to investigating the roles of ceramide metabolizing genes in nilotinib induced apoptosis. Cytotoxic effects of nilotinib, C8:ceramide, glucosyle ceramide synthase (GCS) and sphingosine kinase-1 (SK-1) inhibitors were determined by XTT cell proliferation assay and synergism between the agents was determined by isobologram analysis. Also, quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) results demonstrated that expression levels of longevity assurance (LASS) genes in response to nilotinib were correlated with sensitivity to nilotinib. For the first time, The results of this study showed for the first time that nilotinib induces apoptosis through upregulating ceramide synthase genes and downregulating SK-1 in CML cells in addition to inhibition of BCR/ABL. On the other hand, manipulating bioactive sphingolipids toward generation/accumulation of ceramides increased the apoptotic effects of nilotinib in CML cells. PMID:21756066

  5. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    PubMed

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  6. Agrobacterium mediated transfer of a mutant Arabidopsis acetolactate synthase gene confers resistance to chlorsulfuron in chicory (Cichorium intybus L.).

    PubMed

    Vermeulen, A; Vaucheret, H; Pautot, V; Chupeau, Y

    1992-06-01

    Leaf discs of C. intybus were inoculated with an Agrobacterium tumefaciens strain harboring a neomycin phosphotransferase (neo) gene for kanamycin resistance and a mutant acetolactate synthase gene (csr1-1) from Arabidopsis thaliana conferring resistance to sulfonylurea herbicides. A regeneration medium was optimized which permitted an efficient shoot regeneration from leaf discs. Transgenic shoots were selected on rooting medium containing 100 mg/l kanamycin sulfate. Integration of the csr1-1 gene into genomic DNA of kanamycin resistant chicory plants was confirmed by Southern blot hybridizations. Analysis of the selfed progenies (S1 and S2) of two independent transformed clones showed that kanamycin and chlorsulfuron resistances were inherited as dominant Mendelian traits. The method described here for producing transformed plants will allow new opportunities for chicory breeding. PMID:24203132

  7. Analysis of the endothelial nitric oxide synthase gene as a modifier of the cerebral response to ischemia.

    PubMed

    Dutra, Ana Virginia; Lin, Hsiu-Fen; Juo, Suh-Hang Hank; Boyadjis, Melanie; Moussouttas, Michael; Reddy, P Leema; Grewal, Raji Paul

    2006-01-01

    We studied the endothelial nitric oxide synthase (eNOS or NOS-3) gene as a potential modifier of the cerebral response to ischemia by investigating the association of two common polymorphisms with ischemic stroke volume. We genotyped an intronic variable number tandem repeat and a single nucleotide polymorphism, G894T, in 132 patients with nonlacunar ischemic strokes in whom clinical data and stroke lesion volume were recorded. Our results show that all genotypes are in Hardy-Weinberg equilibrium. After adjustment of covariates, neither of the NOS-3 polymorphisms showed significant differences comparing the genotypes and mean stroke volume (analysis of variance). Our results do not suggest a major gene effect of the NOS-3 gene as a modifier of the cerebral response to ischemia. PMID:17904064

  8. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  9. Cloning and Expression of Poly(hydroxyalkanoate) Synthase Genes from Photosynthetic bacterium Allochromatium vinosum ATCC 35206

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poly(hydroxyalkanoate) (PHA) synthases catalyze the polymerization of beta-hydroxy fatty acids to form PHA biopolyesters. These enzymes are grouped into four classes (classes I to IV) based on their subunit composition and substrate specificity. Since PHA biopolymers are naturally synthesized by b...

  10. Genetic Diversity of Polyketide Synthase/Nonribosomal Peptide Synthetase Genes in Isolates of the Barley Net Blotch Fungus Pyrenophora teres f. teres

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are multifunctional enzymes responsible for biosynthesis of diverse small molecules (e.g., mycotoxins and phytotoxins) in filamentous ascomycetes. Both PKS and NRPS genes are present in fungal genomes as large gene families but...

  11. Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to Fusarium head blight and seedling blight in wheat.

    PubMed

    Cheng, Wei; Song, Xiu-Shi; Li, He-Ping; Cao, Le-Hui; Sun, Ke; Qiu, Xiao-Li; Xu, Yu-Bin; Yang, Peng; Huang, Tao; Zhang, Jing-Bo; Qu, Bo; Liao, Yu-Cai

    2015-12-01

    Fusarium head blight (FHB) and Fusarium seedling blight (FSB) of wheat, caused by Fusarium pathogens, are devastating diseases worldwide. We report the expression of RNA interference (RNAi) sequences derived from an essential Fusarium graminearum (Fg) virulence gene, chitin synthase (Chs) 3b, as a method to enhance resistance of wheat plants to fungal pathogens. Deletion of Chs3b was lethal to Fg; disruption of the other Chs gene family members generated knockout mutants with diverse impacts on Fg. Comparative expression analyses revealed that among the Chs gene family members, Chs3b had the highest expression levels during Fg colonization of wheat. Three hairpin RNAi constructs corresponding to the different regions of Chs3b were found to silence Chs3b in transgenic Fg strains. Co-expression of these three RNAi constructs in two independent elite wheat cultivar transgenic lines conferred high levels of stable, consistent resistance (combined type I and II resistance) to both FHB and FSB throughout the T3 to T5 generations. Confocal microscopy revealed profoundly restricted mycelia in Fg-infected transgenic wheat plants. Presence of the three specific short interfering RNAs in transgenic wheat plants was confirmed by Northern blotting, and these RNAs efficiently down-regulated Chs3b in the colonizing Fusarium pathogens on wheat seedlings and spikes. Our results demonstrate that host-induced gene silencing of an essential fungal chitin synthase gene is an effective strategy for enhancing resistance in crop plants under field test conditions. PMID:25735638

  12. Characterization of the Saccharomyces cerevisiae ARG7 gene encoding ornithine acetyltransferase, an enzyme also endowed with acetylglutamate synthase activity.

    PubMed

    Crabeel, M; Abadjieva, A; Hilven, P; Desimpelaere, J; Soetens, O

    1997-12-01

    We have cloned by functional complementation and characterized the yeast ARG7 gene encoding mitochondrial ornithine acetyltransferase, the enzyme catalyzing the fifth step in arginine biosynthesis. While forming ornithine, this enzyme regenerates acetylglutamate, also produced in the first step by the ARG2-encoded acetylglutamate synthase. Interestingly, total deletion of the genomic ARG7 ORF resulted in an arginine-leaky phenotype, indicating that yeast cells possess an alternative route for generating ornithine from acetylornithine. Yeast ornithine acetyltransferase has been purified and characterized previously as a heterodimer of two subunits proposed to derive from a single precursor protein [Liu, Y-S., Van Heeswijck R., Hoj, P. & Hoogenraad, N. (1995) Eur. J. Biochem. 228, 291-296]; those authors further suggested that the internal processing of Arg7p, which is a mitochondrial enzyme, might occur in the matrix, while the leader peptide would be of the non-cleavable-type. The characterization of the gene (a) establishes that Arg7p is indeed encoded by a single gene, (b) demonstrates the existence of a cleaved mitochondrial prepeptide of eight residues, and (c) shows that the predicted internal processing site is unlike the mitochondrial proteolytic peptidase target sequence. Yeast Arg7p shares between 32-43% identity in pairwise comparisons with the ten analogous bacterial ArgJ enzymes characterized. Among these evolutionarily related enzymes, some but not all appear bifunctional, being able to produce acetylglutamate not only from acetylornithine but also from acetyl-CoA, thus catalyzing the same reaction as the apparently unrelated acetylglutamate synthase. We have addressed the question of the bifunctionality of the eucaryotic enzyme, showing that overexpressed ARG7 can complement yeast arg2 and Escherichia coli argA mutations (affecting acetylglutamate synthase). Furthermore, Arg7p-linked acetylglutamate synthase activity was measurable in an assay. The

  13. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants

    PubMed Central

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  14. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants.

    PubMed

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  15. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    PubMed Central

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  16. A novel mechanism of dasatinib-induced apoptosis in chronic myeloid leukemia; ceramide synthase and ceramide clearance genes.

    PubMed

    Gencer, Emel B; Ural, Ali U; Avcu, Ferit; Baran, Yusuf

    2011-11-01

    Sphingolipids are bioeffector molecules that control various aspects of cell growth, proliferation, apoptosis, and drug resistance. Ceramides, the central molecule of sphingolipid metabolism, are inducer of apoptosis and inhibitors of proliferation. Sphingosine-1-phosphate (S1P) and glucosyleceramide, converted from ceramides by sphingosine kinase-1 (SK-1) and glucosyleceramide synthase (GCS) enzymes, respectively, inhibit apoptosis and develop resistance to chemotherapeutic drugs. In this study, we examined the therapeutic potentials of bioactive sphingolipids in chronic myeloid leukemia (CML) alone and in combination with dasatinib in addition to investigate the roles of ceramide-metabolizing genes in dasatinib-induced apoptosis. Cytotoxic effects of dasatinib, C8:ceramide, PDMP, and SK-1 inhibitor were determined by XTT cell proliferation assay. Changes in caspase-3 enzyme activity and mitochondrial membrane potential (MMP) were measured using caspase-3 colorimetric assay and JC-1 MMP detection kit. Expression levels of ceramide-metabolizing genes were examined by qRT-PCR. Application of ceramide analogs and inhibitors of ceramide clearance genes decreased cell proliferation and induced apoptosis. Targeting bioactive sphingolipids towards generation/accumulation of ceramides increased apoptotic effects of dasatinib, synergistically. It was shown for the first time that dasatinib induces apoptosis through downregulating expression levels of antiapoptotic SK-1 but not GCS, and upregulating expression levels of ceramide synthase (CerS) genes, especially CerS1, in K562 cells. On the other hand, dasatinib downregulates expression levels of both GCS and SK-1 and upregulate apoptotic CerS2, -5 and -6 genes in Meg-01 cells. Increasing endogenous ceramide levels and decreasing prosurvival lipids, S1P, and GC, can open the way of more effective treatment of CML. PMID:21455605

  17. In vitro selection of transgenic sugarcane callus utilizing a plant gene encoding a mutant form of acetolactate synthase.

    PubMed

    van der Vyver, Christell; Conradie, Tobie; Kossmann, Jens; Lloyd, James

    2013-04-01

    Selection genes are routinely used in plant genetic transformation protocols to ensure the survival of transformed cells by limiting the regeneration of non-transgenic cells. In order to find alternatives to the use of antibiotics as selection agents, we followed a targeted approach utilizing a plant gene, encoding a mutant form of the enzyme acetolactate synthase, to convey resistance to herbicides. The sensitivity of sugarcane callus (Saccharum spp. hybrids, cv. NCo310) to a number of herbicides from the sulfonylurea and imidazolinone classes was tested. Callus growth was most affected by sulfonylurea herbicides, particularly 3.6 μg/l chlorsulfuron. Herbicide-resistant transgenic sugarcane plants containing mutant forms of a tobacco acetolactate synthase (als) gene were obtained following biolistic transformation. Post-bombardment, putative transgenic callus was selectively proliferated on MS medium containing 3 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D), 20 g/l sucrose, 0.5 g/l casein, and 3.6 μg/l chlorsulfuron. Plant regeneration and rooting was done on MS medium lacking 2,4-D under similar selection conditions. Thirty vigorously growing putative transgenic plants were successfully ex vitro-acclimatized and established under glasshouse conditions. Glasshouse spraying of putative transgenic plants with 100 mg/l chlorsulfuron dramatically decreased the amount of non-transgenic plants that had escaped the in vitro selection regime. PCR analysis showed that six surviving plants were als-positive and that five of these expressed the mutant als gene. This report is the first to describe a selection system for sugarcane transformation that uses a selectable marker gene of plant origin targeted by a sulfonylurea herbicide. PMID:23543883

  18. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    PubMed

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  19. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    PubMed Central

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  20. Transgenic analysis reveals LeACS-1 as a positive regulator of ethylene-induced shikonin biosynthesis in Lithospermum erythrorhizon hairy roots.

    PubMed

    Fang, Rongjun; Wu, Fengyao; Zou, Ailan; Zhu, Yu; Zhao, Hua; Zhao, Hu; Liao, Yonghui; Tang, Ren-Jie; Yang, Tongyi; Pang, Yanjun; Wang, Xiaoming; Yang, Rongwu; Qi, Jinliang; Lu, Guihua; Yang, Yonghua

    2016-03-01

    The phytohormone ethylene (ET) is a crucial signaling molecule that induces the biosynthesis of shikonin and its derivatives in Lithospermum erythrorhizon shoot cultures. However, the molecular mechanism and the positive regulators involved in this physiological process are largely unknown. In this study, the function of LeACS-1, a key gene encoding the 1-aminocyclopropane-1-carboxylic acid synthase for ET biosynthesis in L. erythrorhizon hairy roots, was characterized by using overexpression and RNA interference (RNAi) strategies. The results showed that overexpression of LeACS-1 significantly increased endogenous ET concentration and shikonin production, consistent with the up-regulated genes involved in ET biosynthesis and transduction, as well as the genes related to shikonin biosynthesis. Conversely, RNAi of LeACS-1 effectively decreased endogenous ET concentration and shikonin production and down-regulated the expression level of above genes. Correlation analysis showed a significant positive linear relationship between ET concentration and shikonin production. All these results suggest that LeACS-1 acts as a positive regulator of ethylene-induced shikonin biosynthesis in L. erythrorhizon hairy roots. Our work not only gives new insights into the understanding of the relationship between ET and shikonin biosynthesis, but also provides an efficient genetic engineering target gene for secondary metabolite production in non-model plant L. erythrorhizon. PMID:26780904

  1. Cloning of an anthocyanidin synthase gene homolog from blackcurrant (Ribes nigrum L.) and its expression at different fruit stages.

    PubMed

    Li, X-G; Wang, J; Yu, Z-Y

    2015-01-01

    Anthocyanidin synthase (ANS), a 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase, catalyzes the penultimate step in anthocyanin biosynthesis, from leucoanthocyanidins to anthocyanidins, the first colored compound in the anthocyanin pathway. In this study, a full-length, 1427-bp long cDNA named RnANS1, which is homologous to the anthocyanidin synthase gene, was cloned from blackcurrant using a homologous cloning strategy. RnANS1 is highly homologous to other plant ANS genes at both the nucleotide and amino acid sequence levels. The deduced protein contains domains conserved in the 2OG and Fe(II)-dependent oxygenase, and is phylogenetically closely related to Paeonia suffruticosa and Paeonia lactiflora. The expression of RnANS1 was upregulated during fruit maturation, and correlated with the accumulation of anthocyanins and soluble carbohydrates in the fruit. Further characterization of the structure and expression patterns of RnANS1 will clarify our understanding of anthocyanin biosynthesis in blackcurrant, and support the development of molecular approaches to manipulate anthocyanin production in this plant. PMID:25867421

  2. Sterol biosynthesis by a prokaryote: first in vitro identification of the genes encoding squalene epoxidase and lanosterol synthase from Methylococcus capsulatus.

    PubMed

    Nakano, Chiaki; Motegi, Akihiro; Sato, Tsutomu; Onodera, Masayuki; Hoshino, Tsutomu

    2007-10-01

    Sterol biosynthesis by prokaryotic organisms is very rare. Squalene epoxidase and lanosterol synthase are prerequisite to cyclic sterol biosynthesis. These two enzymes, from the methanotrophic bacterium Methylococcus capsulatus, were functionally expressed in Escherichia coli. Structural analyses of the enzymatic products indicated that the reactions proceeded in a complete regio- and stereospecific fashion to afford (3S)-2,3-oxidosqualene from squalene and lanosterol from (3S)-2,3-oxidosqualene, in full accordance with those of eukaryotes. However, our result obtained with the putative lanosterol synthase was inconsistent with a previous report that the prokaryote accepts both (3R)- and (3S)-2,3-oxidosqualenes to afford 3-epi-lanosterol and lanosterol, respectively. This is the first report demonstrating the existence of the genes encoding squalene epoxidase and lanosterol synthase in prokaryotes by establishing the enzyme activities. The evolutionary aspect of prokaryotic squalene epoxidase and lanosterol synthase is discussed. PMID:17928701

  3. Regulation of the expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene. Its role in the control of ketogenesis.

    PubMed Central

    Casals, N; Roca, N; Guerrero, M; Gil-Gómez, G; Ayté, J; Ciudad, C J; Hegardt, F G

    1992-01-01

    We have explored the role of mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase in regulating ketogenesis. We had previously cloned the cDNA for mitochondrial HMG-CoA synthase and have now studied the regulation in vivo of the expression of this gene in rat liver. The amount of processed mitochondrial HMG-CoA synthase mRNA is rapidly changed in response to cyclic AMP, insulin, dexamethasone and refeeding, and is greatly increased by starvation, fat feeding and diabetes. We conclude that one point of ketogenic control is exercised at the level of genetic expression of mitochondrial HMG-CoA synthase. Images Fig. 1. Fig. 4. PMID:1348927

  4. Differential feedback regulation of ethylene biosynthesis in pulp and peel tissues of banana fruit.

    PubMed

    Inaba, Akitsugu; Liu, Xuejun; Yokotani, Naoki; Yamane, Miki; Lu, Wang-Jin; Nakano, Ryohei; Kubo, Yasutaka

    2007-01-01

    The feedback regulation of ethylene biosynthesis in banana [Musa sp. (AAA group, Cavendish subgroup) cv. Grand Nain] fruit was investigated in an attempt to clarify the opposite effect of 1-methylcyclopropene (1-MCP), an ethylene action inhibitor, before and after the onset of ripening. 1-MCP pre-treatment completely prevented the ripening-induced effect of propylene in pre-climacteric banana fruit, whereas treatment after the onset of ripening stimulated ethylene production. In pre-climacteric fruit, higher concentrations of propylene suppressed ethylene production more strongly, despite their earlier ethylene-inducing effect. Exposure of the fruit ripened by propylene to 1-MCP increased ethylene production concomitantly with an increase in 1-aminocyclopropane-1-carboxylate (ACC) synthase activity and ACC content, and prevented a transient decrease in MA-ACS1 transcripts in the pulp tissues. In contrast, in the peel of ripening fruit, 1-MCP prevented the increase in ethylene production and subsequently the ripening process by reduction of the increase in MA-ACS1 and MA-ACO1 transcripts and of ACC synthase and ACC oxidase activities. These results suggest that ethylene biosynthesis in ripening banana fruit may be controlled negatively in the pulp tissue and positively in the peel tissue. This differential regulation by ethylene in pulp and peel tissues was also observed for MA-PL, MA-Exp, and MA-MADS genes. PMID:17185740

  5. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    PubMed

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids. PMID:26137682

  6. Environmental Stability of Seed Carbohydrate Profiles in Soybeans Containing Different Alleles of the Raffinose Synthase 2 (RS2) Gene.

    PubMed

    Bilyeu, Kristin D; Wiebold, William J

    2016-02-10

    Soybean [Glycine max (L.) Merr.] is important for the high protein meal used for livestock feed formulations. Carbohydrates contribute positively or negatively to the potential metabolizable energy in soybean meal. The positive carbohydrate present in soybean meal consists primarily of sucrose, whereas the negative carbohydrate components are the raffinose family of oligosaccharides (RFOs), raffinose and stachyose. Increasing sucrose and decreasing raffinose and stachyose are critical targets to improve soybean. In three recently characterized lines, variant alleles of the soybean raffinose synthase 2 (RS2) gene were associated with increased sucrose and decreased RFOs. The objective of this research was to compare the environmental stability of seed carbohydrates in soybean lines containing wild-type or variant alleles of RS2 utilizing a field location study and a date of planting study. The results define the carbohydrate variation in distinct regional and temporal environments using soybean lines with different alleles of the RS2 gene. PMID:26800264

  7. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    PubMed

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication. PMID:14743314

  8. Identification of a Polyketide Synthase Gene in the Synthesis of Phleichrome of the Phytopathogenic Fungus Cladosporium phlei

    PubMed Central

    So, Kum-Kang; Chung, Yun-Jo; Kim, Jung-Mi; Kim, Beom-Tae; Park, Seung-Moon; Kim, Dae-Hyuk

    2015-01-01

    Phleichrome, a pigment produced by the phytopathogenic fungus Cladosporium phlei, is a fungal perylenequinone whose photodynamic activity has been studied intensively. To determine the biological function of phleichrome and to engineer a strain with enhanced production of phleichrome, we identified the gene responsible for the synthesis of phleichrome. Structural comparison of phleichrome with other fungal perylenequinones suggested that phleichrome is synthesized via polyketide pathway. We recently identified four different polyketide synthase (PKS) genes encompassing three major clades of fungal PKSs that differ with respect to reducing conditions for the polyketide product. Based on in silico analysis of cloned genes, we hypothesized that the non-reducing PKS gene, Cppks1, is involved in phleichrome biosynthesis. Increased accumulation of Cppks1 transcript was observed in response to supplementation with the application of synthetic inducer cyclo-(l-Pro-l-Phe). In addition, heterologous expression of the Cppks1 gene in Cryphonectria parasitica resulted in the production of phleichrome. These results provide convincing evidence that the Cppks1 gene is responsible for the biosynthesis of phleichrome. PMID:26612679

  9. [Cloning, expression and functional identification of a type III polyketide synthase gene from Huperzia serrata].

    PubMed

    Ye, Jin-cui; Zhang, Ping; Sun, Jie-yin; Guo, Chao-tan; Chen, Guo-shen; Abe, Ikuro; Noguchi, Hiroshi

    2011-10-01

    A cDNA encoding novel type III polyketide synthase (PKS) was cloned and sequenced from young leaves of Chinese club moss Huperzia serrata (Thunb.) Trev. by RT-PCR using degenerated primers based on the conserved sequences of known CHSs, and named as H. serrata PKS2. The terminal sequences of cDNA were obtained by the 3'- and 5'-RACE method. The full-length cDNA of H. serrata PKS2 contained a 1212 bp open reading frame encoding a 46.4 kDa protein with 404 amino acids. The deduced amino acid sequence of H. serrata PKS2 showed 50%-66% identities to those of other chalcone synthase super family enzymes of plant origin. The recombinant H. serrata PKS2 was functionally expressed in Escherichia coli with an additional hexahistidine tag at the N-terminus and showed unusually versatile catalytic potency to produce various aromatic tetraketides, including chalcones, benzophenones, phloroglucinols, and acridones. In particular, the enzyme accepted bulky starter substrates N-methylanthraniloyl-CoA, and carried out three condensations with malonyl-CoA to produce 1, 3-dihydroxy-N-methylacridone. Interestingly, H. serrata PKS2 lacks most of the consensus active site sequences with acridone synthase from Ruta graveolens (Rutaceae). PMID:22242464

  10. Sequence analysis of the chitin synthase A gene of the Dutch elm pathogen Ophiostoma novo-ulmi indicates a close association with the human pathogen Sporothrix schenckii.

    PubMed

    Hintz, W E

    1999-09-01

    Degenerate oligonucleotide primers were designed according to conserved regions of the chitin synthase gene family and used to amplify a 621 basepair (bp) fragment from genomic DNA of Ophiostoma novo-ulmi, the causal agent of Dutch elm disease. The amplification product was used as a hybridization probe to screen a library of genomic DNA sequences and to retrieve a full-length chitin synthase gene (chsA). The putative coding region of the gene was 2619 bp long, lacked introns, and encoded a polypeptide of 873 amino acids. Based on the similarity of the predicted amino acid sequence to the full-length chsC gene of Aspergillus nidulans and chsA gene of Ampelomyces quisqualis, the O. novo-ulmi chsA was classified as a Class I chitin synthase. The phylogenies constructed, according to a subregion of all available chitin synthases, showed that O. novo-ulmi consistently clustered most closely with the human pathogen Sporothrix schenckii, recently classified as a member of the mitosporic Ophiostomataceae. Disruption of the chsA gene locus had no obvious effects on the growth or morphology of the fungus. PMID:10524253

  11. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    PubMed Central

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  12. Against All Odds: Trehalose-6-Phosphate Synthase and Trehalase Genes in the Bdelloid Rotifer Adineta vaga Were Acquired by Horizontal Gene Transfer and Are Upregulated during Desiccation

    PubMed Central

    Hespeels, Boris; Li, Xiang; Flot, Jean-François; Pigneur, Lise-Marie; Malaisse, Jeremy; Da Silva, Corinne; Van Doninck, Karine

    2015-01-01

    The disaccharide sugar trehalose is essential for desiccation resistance in most metazoans that survive dryness; however, neither trehalose nor the enzymes involved in its metabolism have ever been detected in bdelloid rotifers despite their extreme resistance to desiccation. Here we screened the genome of the bdelloid rotifer Adineta vaga for genes involved in trehalose metabolism. We discovered a total of four putative trehalose-6-phosphate synthase (TPS) and seven putative trehalase (TRE) gene copies in the genome of this ameiotic organism; however, no trehalose-6-phosphate phosphatase (TPP) gene or domain was detected. The four TPS copies of A. vaga appear more closely related to plant and fungi proteins, as well as to some protists, whereas the seven TRE copies fall in bacterial clades. Therefore, A. vaga likely acquired its trehalose biosynthesis and hydrolysis genes by horizontal gene transfers. Nearly all residues important for substrate binding in the predicted TPS domains are highly conserved, supporting the hypothesis that several copies of the genes might be functional. Besides, RNAseq library screening showed that trehalase genes were highly expressed compared to TPS genes, explaining probably why trehalose had not been detected in previous studies of bdelloids. A strong overexpression of their TPS genes was observed when bdelloids enter desiccation, suggesting a possible signaling role of trehalose-6-phosphate or trehalose in this process. PMID:26161530

  13. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    PubMed

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. PMID:26232767

  14. Isolation of the facA (acetyl-coenzyme A synthetase) and acuE (malate synthase) genes of Aspergillus nidulans.

    PubMed

    Sandeman, R A; Hynes, M J

    1989-07-01

    Acetate inducible genes of Aspergillus nidulans were cloned via differential hybridization to cDNA probes. Using transformation of mutant strains the genes were identified as facA (acetyl-Coenzyme A synthetase) and acuE (malate synthase). The levels of RNA encoded by these genes were shown to be acetate inducible and subject to carbon catabolite repression. Induction is abolished in a facB mutant and carbon catabolite repression is relieved in a creA mutant. PMID:2571070

  15. Effect of nitric oxide on ethylene synthesis and softening of banana fruit slice during ripening.

    PubMed

    Cheng, Guiping; Yang, En; Lu, Wangjin; Jia, Yongxia; Jiang, Yueming; Duan, Xuewu

    2009-07-01

    The effects of nitric oxide (NO) on ethylene synthesis and softening of ripening-initiated banana slice were investigated. Fruit firmness, color, and contents of starch and acid-soluble pectin (ASP) were measured. In addition, ethylene production, 1-aminocyclopropane-1-carboxylic acid (ACC) content, expression and activities of ACC synthase (ACS) and ACC oxidase (ACO), and activities of cell-wall-modifying enzymes, polygalacturonase (PG), pectin methylesterase (PME), and endo-beta-1,4-glucanase, were analyzed. Application of NO reduced ethylene production, inhibited degreening of the peel and delayed softening of the pulp. The decrease of ethylene production was associated with the reduction in the activity of ACO and the expression of the MA-ACO1 gene. Moreover, the NO-treated fruit showed a lower expression of the MA-ACS1 gene but higher ACS activity and ACC content. In addition, NO treatment decreased the activities of PG, PME, and endo-beta-1,4-glucanase and maintained higher contents of ASP and starch, which may account for the delay of softening. We proposed that the inhibition of ACO activity and transcription of gene MA-ACO1 by NO resulted in decreased ethylene synthesis and the delay of ripening of banana slice. PMID:19534461

  16. Characterization of ethylene biosynthesis associated with ripening in banana fruit.

    PubMed

    Liu, X; Shiomi, S; Nakatsuka, A; Kubo, Y; Nakamura, R; Inaba, A

    1999-12-01

    We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

  17. Characterization of Ethylene Biosynthesis Associated with Ripening in Banana Fruit1

    PubMed Central

    Liu, Xuejun; Shiomi, Shinjiro; Nakatsuka, Akira; Kubo, Yasutaka; Nakamura, Reinosuke; Inaba, Akitsugu

    1999-01-01

    We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

  18. Ripening-associated ethylene biosynthesis in tomato fruit is autocatalytically and developmentally regulated

    PubMed Central

    Yokotani, Naoki; Nakano, Ryohei; Imanishi, Shunsuke; Nagata, Masayasu; Inaba, Akitsugu; Kubo, Yasutaka

    2009-01-01

    To investigate the regulatory mechanism(s) of ethylene biosynthesis in fruit, transgenic tomatoes with all known LeEIL genes suppressed were produced by RNA interference engineering. The transgenic tomato exhibited ethylene insensitivity phenotypes such as non-ripening and the lack of the triple response and petiole epinasty of seedlings even in the presence of exogenous ethylene. Transgenic fruit exhibited a low but consistent increase in ethylene production beyond 40 days after anthesis (DAA), with limited LeACS2 and LeACS4 expression. 1-Methylcyclopropene (1-MCP), a potent inhibitor of ethylene perception, failed to inhibit the limited increase in ethylene production and expression of the two 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) genes in the transgenic fruit. These results suggest that ripening-associated ethylene (system 2) in wild-type tomato fruit consists of two parts: a small part regulated by a developmental factor through the ethylene-independent expression of LeACS2 and LeACS4 and a large part regulated by an autocatalytic system due to the ethylene-dependent expression of the same genes. The results further suggest that basal ethylene (system 1) is less likely to be involved in the transition to system 2. Even if the effect of system 1 ethylene is eliminated, fruit can show a small increase in ethylene production due to unknown developmental factors. This increase would be enough for the stimulation of autocatalytic ethylene production, leading to fruit ripening. PMID:19605457

  19. Variants of gene for microsomal prostaglandin E2 synthase show association with disease and severe inflammation in rheumatoid arthritis

    PubMed Central

    Korotkova, Marina; Daha, Nina A; Seddighzadeh, Maria; Ding, Bo; Catrina, Anca I; Lindblad, Staffan; Huizinga, Tom W J; Toes, Rene E M; Alfredsson, Lars; Klareskog, Lars; Jakobsson, Per-Johan; Padyukov, Leonid

    2011-01-01

    Microsomal PGE synthase 1 (mPGES-1) is the terminal enzyme in the induced state of prostaglandin E2 (PGE2) synthesis and constitutes a therapeutic target for rheumatoid arthritis (RA) treatment. We examined the role of the prostaglandin E synthase (PTGES) gene polymorphism in susceptibility to and severity of RA and related variations in the gene to its function. The PTGES gene polymorphism was analyzed in 3081 RA patients and 1900 controls from two study populations: Swedish Epidemiological Investigation of Rheumatoid Arthritis (EIRA) and the Leiden Early Arthritis Clinic (Leiden EAC). Baseline disease activity score (DAS28) was employed as a disease severity measure. mPGES-1 expression was analyzed in synovial tissue from RA patients with known genotypes using immunohistochemistry. In the Swedish study population, among women a significant association with risk for RA was observed for PTGES single-nucleotide polymorphisms (SNPs) in univariate analysis and for the distinct haplotype. These results were substantiated by meta-analysis of data from EIRA and Leiden EAC studies with overall OR 1.31 (95% confidence interval 1.11–1.56). Several PTGES SNPs were associated with earlier onset of disease or with higher DAS28 in women with RA. Patients with the genotype associated with higher DAS28 exhibited significantly higher mPGES-1 expression in synovial tissue. Our data reveal a possible influence of PTGES polymorphism on the pathogenesis of RA and on disease severity through upregulation of mPGES-1 at the sites of inflammation. Genetically predisposed individuals may develop earlier and more active disease owing to this mechanism. PMID:21448233

  20. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance.

    PubMed

    Faulkes, Christopher G; Davies, Kalina T J; Rossiter, Stephen J; Bennett, Nigel C

    2015-05-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan--a key constituent of the extracellular matrix--that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  1. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance

    PubMed Central

    Faulkes, Christopher G.; Davies, Kalina T. J.; Rossiter, Stephen J.; Bennett, Nigel C.

    2015-01-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan—a key constituent of the extracellular matrix—that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  2. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection. PMID:25001420

  3. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    PubMed

    Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

    2014-01-01

    Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

  4. Identification, characterization and functional analysis of a chitin synthase gene in the brown citrus aphid, Toxoptera citricida (Hemiptera, Aphididae).

    PubMed

    Shang, F; Xiong, Y; Xia, W-K; Wei, D-D; Wei, D; Wang, J-J

    2016-08-01

    Chitin synthase (CHS) is a crucial enzyme involved in the final step of the insect chitin biosynthetic pathway. In this study, we cloned the full-length cDNA sequence of a chitin synthase gene (TCiCHS) from the brown citrus aphid, Toxoptera citricida, an important citrus pest and the main vector of citrus tristeza virus worldwide. TCiCHS was expressed during the entire lifecycle and in all insect tissues examined. Expression was highest in first-second-instar nymphs, nymph-adult transitions and in the abdomen (6.7-fold higher than head). Embryos had a higher expression level than the integument. Fourth-instar nymphs were exposed to 5 and 500 mg/l concentrations of the chitin synthesis inhibitor diflubenzuron (DFB) for 48 h and had the highest mortality at the 500 mg/l concentration. The mRNA expression levels of TCiCHS were significantly enhanced upon the exposure of nymphs to both low and high DFB concentrations. Silencing of TCiCHS occurred through plant-mediated double-stranded RNA (dsRNA) feeding. Most dsRNA-fed nymphs were unable to moult to the next stage, and the expression of TCiCHS decreased 48% compared with controls. These results demonstrate that TCiCHS plays an important role in nymph to adult development, is possibly help identify molecular targets for To. citricida control. PMID:26991909

  5. Thymidylate synthase and methylenetetrahy-drofolate reductase gene polymorphisms and gastric cancer susceptibility in a population of Northern Brazil.

    PubMed

    Araújo, M D; Borges, B N; Rodrigues-Antunes, S; Burbano, R M R; Harada, M L

    2015-01-01

    The folate metabolic pathway, which is involved in DNA synthesis and methylation, is associated with individual susceptibility to several diseases, including gastric tumors. In this study, we investigated four polymorphisms [thymidylate synthase enhancer region, single nucleotide polymorphism thymidylate synthase 5' (TS5'), TS3' untranslated region, and methylenetetrahydrofolate reductase (MTHFR) 677C> T] in 2 genes related to the folate pathway, TS and MTHFR, and their possible association with the risk gastric cancer development in a population from Pará state, Brazil. For the TS enhancer region, TS3' untranslated region, and single nucleotide polymorphism TS5' polymorphisms, no significant results were obtained. For the MTHFR 677C>T polymorphism, TT genotype carriers had a higher risk of developing tumors in the antrum (P = 0.19 vs CC and P = 0.02 vs CT) and intestine (odds ratio = 4.18, 95% confidence interval = 0.66-26.41; P = 0.252 vs CC and odds ratio = 2.25, 95% confidence interval = 0.32-15.75; P = 0.725 vs CT). Those carrying at least 1 T allele had an increased risk of lymph node metastasis (odds ratio = 3.00, 95% confidence interval = 0.88-10.12; P = 0.133). Our results suggest that polymorphisms in MTHFR affect the susceptibility to gastric tumors in the Brazilian population and may be a factor causing poor prognosis in such patients. PMID:26345936

  6. Wound-induced terpene synthase gene expression in Sitka spruce that exhibit resistance or susceptibility to attack by the white pine weevil.

    PubMed

    Byun-McKay, Ashley; Godard, Kimberley-Ann; Toudefallah, Morteza; Martin, Diane M; Alfaro, Rene; King, John; Bohlmann, Joerg; Plant, Aine L

    2006-03-01

    We analyzed the expression pattern of various terpene synthase (TPS) genes in response to a wounding injury applied to the apical leader of Sitka spruce (Picea sitchensis Bong. Carr.) genotypes known to be resistant (R) or susceptible (S) to white pine weevil (Pissodes strobi Peck.) attack. The purpose was to test if differences in constitutive or wound-induced TPS expression can be associated with established weevil resistance. All wounding treatments were conducted on 9-year-old R and S trees growing under natural field conditions within the range of variation for weevil R and S genotypes. Representative cDNAs of the monoterpene synthase (mono-TPS), sesquiterpene synthase (sesqui-TPS), and diterpene synthase (di-TPS) classes were isolated from Sitka spruce to assess TPS transcript levels. Based on amino acid sequence similarity, the cDNAs resemble Norway spruce (Picea abies) (-)-linalool synthase (mono-TPS; PsTPS-Linl) and levopimaradiene/abietadiene synthase (di-TPS; PsTPS-LASl), and grand fir (Abies grandis) delta-selinene synthase (sesqui-TPS; PsTPS-Sell). One other mono-TPS was functionally identified as (-)-limonene synthase (PsTPS-Lim). No significant difference in constitutive expression levels for these TPSs was detected between R and S trees. However, over a postwounding period of 16 d, only R trees exhibited significant transcript accumulation for the mono- and sesqui-TPS tested. Both R and S trees exhibited a significant accumulation of PsTPS-LASl transcripts. An assessment of traumatic resin duct formation in wounded leaders showed that both R and S trees responded by forming traumatic resin ducts; however, the magnitude of this response was significantly greater in R trees. Collectively, our data imply that the induced resinosis response is an important aspect of defense in weevil R Sitka spruce trees growing under natural conditions. PMID:16415217

  7. Cloning and characterization of a flavonol synthase gene from Scutellaria baicalensis.

    PubMed

    Kim, Yeon Bok; Kim, KwangSoo; Kim, Yeji; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  8. Inducible nitric oxide synthase gene methylation and parkinsonism in manganese-exposed welders

    PubMed Central

    Nielsen, Susan Searles; Checkoway, Harvey; Criswell, Susan R.; Farin, Federico M.; Stapleton, Patricia L.; Sheppard, Lianne; Racette, Brad A.

    2015-01-01

    Introduction Neurologist-assessed parkinsonism signs are prevalent among workers exposed to manganese (Mn)-containing welding fume. Neuroinflammation may possibly play a role. Inducible nitric oxide synthase, coded by NOS2, is involved in inflammation, and particulate exposure increases the gene’s expression through methylation of CpG sites in the 5′ region. Methods We assessed DNA methylation at three CpG sites in the NOS2 exon 1 from blood from 201 welders. All were non-Hispanic Caucasian men 25–65 years old who were examined by a neurologist specializing in movement disorders. We categorized the workers according to their Unified Parkinson Disease Rating Scale motor subsection 3 (UPDRS3) scores as parkinsonism cases (UPDRS3 ≥ 15; n = 49), controls (UPDRS3 < 6; n = 103), or intermediate (UPDRS3 ≥6 to <15; n = 49). Results While accounting for age, examiner and experimental plate, parkinsonism cases had lower mean NOS2 methylation than controls (p-value for trend = 0.04), specifically at CpG site 8329 located in an exonic splicing enhancer of NOS2 (p-value for trend = 0.07). These associations were not observed for the intermediate UPDRS3 group (both p-value for trend ≥ 0.59). Conclusions Inflammation mediated by inducible nitric oxide synthase may possibly contribute to the association between welding fume and parkinsonism, but requires verification in a longitudinal study. PMID:25634431

  9. Saccharomyces cerevisiae has a single glutamate synthase gene coding for a plant-like high-molecular-weight polypeptide.

    PubMed Central

    Cogoni, C; Valenzuela, L; González-Halphen, D; Olivera, H; Macino, G; Ballario, P; González, A

    1995-01-01

    Purification of the glutamate synthase (GOGAT) enzyme from Saccharomyces cerevisiae showed that it is an oligomeric enzyme composed of three identical 199-kDa subunits. The GOGAT structural gene was isolated by screening a yeast genomic library with a yeast PCR probe. This probe was obtained by amplification with degenerate oligonucleotides designed from conserved regions of known GOGAT genes. The derived amino-terminal sequence of the GOGAT gene was confirmed by direct amino-terminal sequence analysis of the purified protein of 199 kDa. Northern (RNA) analysis allowed the identification of an mRNA of about 7 or 8 kb. An internal fragment of the GOGAT gene was used to obtain null GOGAT mutants completely devoid of GOGAT activity. The results show that S. cerevisiae has a single NADH-GOGAT enzyme, consisting of three 199-kDa monomers, that differs from the one found in prokaryotic microorganisms but is similar to those found in other eukaryotic organisms such as alfalfa. PMID:7836314

  10. Effective treatment of vascular endothelial growth factor refractory hindlimb ischemia by a mutant endothelial nitric oxide synthase gene.

    PubMed

    Qian, H S; Liu, P; Huw, L-Y; Orme, A; Halks-Miller, M; Hill, S M; Jin, F; Kretschmer, P; Blasko, E; Cashion, L; Szymanski, P; Vergona, R; Harkins, R; Yu, J; Sessa, W C; Dole, W P; Rubanyi, G M; Kauser, K

    2006-09-01

    Gene delivery of angiogenic growth factors is a promising approach for the treatment of ischemic cardiovascular diseases. However, success of this new therapeutic principle is hindered by the lack of critical understanding as to how disease pathology affects the efficiency of gene delivery and/or the downstream signaling pathways of angiogenesis. Critical limb ischemia occurs in patients with advanced atherosclerosis often exhibiting deficiency in endothelial nitric oxide production. Similar to these patients, segmental femoral artery resection progresses into severe ischemic necrosis in mice deficient in endothelial nitric oxide synthase (ecNOS-KO) as well as in balb/c mice. We used these models to evaluate the influence of severe ischemia on transfection efficiency and duration of transgene expression in the skeletal muscle following plasmid injection in combination with electroporation. Subsequently, we also explored the potential therapeutic effect of the phosphomimetic mutant of ecNOS gene (NOS1177D) using optimized delivery parameters, and found significant benefit both in ecNOS-KO and balb/c mice. Our results indicate that NOS1177D gene delivery to the ischemic skeletal muscle can be efficient to reverse critical limb ischemia in pathological settings, which are refractory to treatments with a single growth factor, such as vascular endothelial growth factor. PMID:16642030

  11. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    PubMed Central

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-01-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  12. Transformation of Brassica napus canola cultivars with Arabidopsis thaliana acetohydroxyacid synthase genes and analysis of herbicide resistance.

    PubMed

    Miki, B L; Labbé, H; Hattori, J; Ouellet, T; Gabard, J; Sunohara, G; Charest, P J; Iyer, V N

    1990-10-01

    A survey of selected crop species and weeds was conducted to evaluate the inhibition of the enzyme acetohydroxyacid synthase (AHAS) and seedling growth in vitro by the sulfonylurea herbicides chlorsulfuron, DPX A7881, DPX L5300, DPX M6316 and the imidazolinone herbicides AC243,997, AC263,499, AC252,214. Particular attention was given to the Brassica species including canola cultivars and cruciferous weeds such as B. kaber (wild mustard) and Thlaspi arvense (stinkweed). Transgenic lines of B. napus cultivars Westar and Profit, which express the Arabidopsis thaliana wild-type AHAS gene or the mutant gene csr1-1 at levels similar to the resident AHAS genes, were generated and compared. The mutant gene was essential for resistance to the sulfonylurea chlorsulfuron but not to DPX A7881, which appeared to be tolerated by certain Brassica species. Cross-resistance to the imidazolinones did not occur. The level of resistance to chlorsulfuron in transgenic canola greatly exceeded the levels that were toxic to the Brassica species or cruciferous weeds. Direct selection of transgenic lines with chlorsulfuron sprayed at field levels under greenhouse conditions was achieved. PMID:24221001

  13. Cloning and functional analysis of the promoter of a maize starch synthase III gene (ZmDULL1).

    PubMed

    Wu, J D; Jiang, C P; Zhu, H S; Jiang, H Y; Cheng, B J; Zhu, S W

    2015-01-01

    The ZmDULL1 gene encodes a starch synthase and is a determinant of the structure of endosperm starch in maize (Zea mays L.). However, little is known regarding the regulatory mechanism of the ZmDULL1 gene. In this study, we isolated and characterized the ZmDULL1 promoter (PDULL1), which is the 5' flanking region of ZmDULL1 in maize. Sequence analysis showed that several cis-acting elements important for endosperm expression (GCN4_motif and AACA-element) were located within the promoter. A series of PDULL1 deletion derivatives, PDULL1-1-PDULL1-4, from the translation start code (-1676, -1216, -740, and -343) were fused to the β-glucuronidase (GUS) reporter gene. Each deletion construct was transformed into rice using the Agrobacterium-mediated method, and then GUS activity was measured in transgenic plants. The results showed that PDULL1 was an endosperm-specific promoter. Further analysis showed that the promoter sequence (-343 to -1 base pairs) was sufficient for mediating GUS gene expression in endosperm. These results indicate that the region from -343 to -1 base pairs of PDULL1 is valuable for transgenic rice breeding and genetic engineering studies. PMID:26125743

  14. Widespread occurrence and genomic context of unusually small polyketide synthase genes in microbial consortia associated with marine sponges.

    PubMed

    Fieseler, Lars; Hentschel, Ute; Grozdanov, Lubomir; Schirmer, Andreas; Wen, Gaiping; Platzer, Matthias; Hrvatin, Sinisa; Butzke, Daniel; Zimmermann, Katrin; Piel, Jörn

    2007-04-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge metagenomes were dominated by a ubiquitously present, evolutionarily distinct, and highly sponge-specific group of polyketide synthases (PKSs). Open reading frames resembling animal fatty acid genes were found on three corresponding DNA regions isolated from the metagenomes of Theonella swinhoei and Aplysina aerophoba. Their architecture suggests that methyl-branched fatty acids are the metabolic product. According to a phylogenetic analysis of housekeeping genes, at least one of the PKSs belongs to a bacterium of the Deinococcus-Thermus phylum. The results provide new insights into the chemistry of sponge symbionts and allow inference of a detailed phylogeny of the diverse functional PKS types present in sponge metagenomes. Based on these qualitative and quantitative data, we propose a significantly simplified strategy for the targeted isolation of biomedically relevant PKS genes from complex sponge-symbiont associations. PMID:17293531

  15. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper.

    PubMed

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd2+ and Cu2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd2+ and Cu2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu2+) in A. germinans leaves. PMID:17582515

  16. Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

    PubMed Central

    Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

    1989-01-01

    We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

  17. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    PubMed Central

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  18. The significance and effect of tandem repeats within the Mycobacterium tuberculosis leuA gene on alpha-isopropylmalate synthase.

    PubMed

    Chanchaem, Wimon; Palittapongarnpim, Prasit

    2008-09-01

    The 57-bp tandem repeats located in the Mycobacterium tuberculosis leuA gene code for the alpha-isopropylmalate synthase (alpha-IPMS). It is unique to this pathogen. It was previously demonstrated that the leuA-coding sequence Rv3710, containing the tandem repeats, can be translated to an active alpha-IPMS. The objective of the present study was to investigate the significance and effect of the two 57-bp tandem repeats upon gene expression and the general properties of alpha-IPMS. The putative M. tuberculosis H37Rv leuA gene with and without the tandem repeats was cloned by PCR and expressed in an Escherichia coli host. The enzyme product was studied for general properties, comparing that from a native leuA gene containing two repeats and that from the 57-bp tandem repeats deletion mutant. Upon deletion of the two 57-bp tandem repeats, the expression level of leuA from M. tuberculosis H37Rv was comparable with that of the native form. The general properties of the two types of enzymes were similar. They were both functional with the same range of optimal temperature and optimal pH for activity and with similar enzyme stability. Deletion of the repeats had no detectable effect on leuA expression level or the general properties of the enzyme product. PMID:18647358

  19. The glycogen synthase 2 gene (Gys2) displays parallel evolution between Old World and New World fruit bats.

    PubMed

    Qian, Yamin; Fang, Tao; Shen, Bin; Zhang, Shuyi

    2014-01-01

    Frugivorous and nectarivorous bats rely largely on hepatic glycogenesis and glycogenolysis for postprandial blood glucose disposal and maintenance of glucose homeostasis during short time starvation, respectively. The glycogen synthase 2 encoded by the Gys2 gene plays a critical role in liver glycogen synthesis. To test whether the Gys2 gene has undergone adaptive evolution in bats with carbohydrate-rich diets in relation to their insect-eating sister taxa, we sequenced the coding region of the Gys2 gene in a number of bat species, including three Old World fruit bats (OWFBs) (Pteropodidae) and two New World fruit bats (NWFBs) (Phyllostomidae). Our results showed that the Gys2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to OWFBs and NWFBs. Our explicit convergence test showed that posterior probabilities of convergence between several branches of OWFBs, and the NWFBs were markedly higher than that of divergence. Three parallel amino acid substitutions (Q72H, K371Q, and E666D) were detected among branches of OWFBs and NWFBs. Tests for parallel evolution showed that two parallel substitutions (Q72H and E666D) were driven by natural selection, while the K371Q was more likely to be fixed randomly. Thus, our results suggested that the Gys2 gene has undergone parallel evolution on amino acid level between OWFBs and NWFBs in relation to their carbohydrate metabolism. PMID:24258790

  20. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum.

    PubMed

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-08-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  1. Glycosylation defects and virulence phenotypes of Leishmania mexicana phosphomannomutase and dolicholphosphate-mannose synthase gene deletion mutants.

    PubMed

    Garami, A; Mehlert, A; Ilg, T

    2001-12-01

    Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophosphoglycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glycoinositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana the gene encoding the enzyme phosphomannomutase (PMM) and the previously described dolicholphosphate-Man synthase gene (DPMS) that are involved in Man activation. Surprisingly, gene deletion experiments resulted in viable parasite lines lacking the respective open reading frames (DeltaPMM and DeltaDPMS), a result against expectation and in contrast to the lethal phenotype observed in gene deletion experiments with fungi. L. mexicana DeltaDPMS exhibits a selective defect in LPG, protein GPI anchor, and GIPL biosynthesis, but despite the absence of these structures, which have been implicated in parasite virulence and viability, the mutant remains infectious to macrophages and mice. By contrast, L. mexicana DeltaPMM are largely devoid of all known Man-containing glycoconjugates and are unable to establish an infection in mouse macrophages or the living animal. Our results define Man activation leading to GDP-Man as a virulence pathway in Leishmania. PMID:11689705

  2. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression. PMID:16651461

  3. Transcriptome Profiling, Molecular Biological, and Physiological Studies Reveal a Major Role for Ethylene in Cotton Fiber Cell Elongation[W][OA

    PubMed Central

    Shi, Yong-Hui; Zhu, Sheng-Wei; Mao, Xi-Zeng; Feng, Jian-Xun; Qin, Yong-Mei; Zhang, Liang; Cheng, Jing; Wei, Li-Ping; Wang, Zhi-Yong; Zhu, Yu-Xian

    2006-01-01

    Upland cotton (Gossypium hirsutum) produces the most widely used natural fibers, yet the regulatory mechanisms governing fiber cell elongation are not well understood. Through sequencing of a cotton fiber cDNA library and subsequent microarray analysis, we found that ethylene biosynthesis is one of the most significantly upregulated biochemical pathways during fiber elongation. The 1-Aminocyclopropane-1-Carboxylic Acid Oxidase1-3 (ACO1-3) genes responsible for ethylene production were expressed at significantly higher levels during this growth stage. The amount of ethylene released from cultured ovules correlated with ACO expression and the rate of fiber growth. Exogenously applied ethylene promoted robust fiber cell expansion, whereas its biosynthetic inhibitor l-(2-aminoethoxyvinyl)-glycine (AVG) specifically suppressed fiber growth. The brassinosteroid (BR) biosynthetic pathway was modestly upregulated during this growth stage, and treatment with BR or its biosynthetic inhibitor brassinazole (BRZ) also promoted or inhibited, respectively, fiber growth. However, the effect of ethylene treatment was much stronger than that of BR, and the inhibitory effect of BRZ on fiber cells could be overcome by ethylene, but the AVG effect was much less reversed by BR. These results indicate that ethylene plays a major role in promoting cotton fiber elongation. Furthermore, ethylene may promote cell elongation by increasing the expression of sucrose synthase, tubulin, and expansin genes. PMID:16461577

  4. Anthropogenic increase in carbon dioxide compromises plant defense against invasive insects

    SciTech Connect

    Zavala, J.; Casteel, C.; DeLucia, E.; Berenbaum, M.

    2008-04-01

    Elevated levels of atmospheric carbon dioxide (CO{sub 2}), a consequence of anthropogenic global change, can profoundly affect the interactions between crop plants and insect pests and may promote yet another form of global change: the rapid establishment of invasive species. Elevated CO{sub 2} increased the susceptibility of soybean plants grown under field conditions to the invasive Japanese beetle (Popillia japonica) and to a variant of western corn rootworm (Diabrotica virgifera virgifera) resistant to crop rotation by down-regulating gene expression related to defense signaling [lipoxygenase 7 (lox7), lipoxygenase 8 (lox8), and 1-aminocyclopropane-1-carboxylate synthase (acc-s)]. The down-regulation of these genes, in turn, reduced the production of cysteine proteinase inhibitors (CystPIs), which are specific deterrents to coleopteran herbivores. Beetle herbivory increased CystPI activity to a greater degree in plants grown under ambient than under elevated CO{sub 2}. Gut cysteine proteinase activity was higher in beetles consuming foliage of soybeans grown under elevated CO{sub 2} than in beetles consuming soybeans grown in ambient CO{sub 2}, consistent with enhanced growth and development of these beetles on plants grown in elevated CO{sub 2}. These findings suggest that predicted increases in soybean productivity under projected elevated CO{sub 2} levels may be reduced by increased susceptibility to invasive crop pests.

  5. MPK3/MPK6 are involved in iron deficiency-induced ethylene production in Arabidopsis

    PubMed Central

    Ye, Lingxiao; Li, Lin; Wang, Lu; Wang, Shoudong; Li, Sen; Du, Juan; Zhang, Shuqun; Shou, Huixia

    2015-01-01

    Iron (Fe) is an essential micronutrient that participates in various biological processes important for plant growth. Ethylene production induced by Fe deficiency plays important roles in plant tolerance to stress induced by Fe deficiency. However, the activation and regulatory mechanisms of 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) genes in this response are not clear. In this study, we demonstrated that Fe deficiency increased the abundance of ACS2, ACS6, ACS7, and ACS11 transcripts in both leaves and roots as well as the abundance of ACS8 transcripts in leaves and ACS9 transcripts in roots. Furthermore, we investigated the role of mitogen-activated protein kinase 3 and 6 (MPK3/MPK6)-regulated ACS2/6 activation in Fe deficiency-induced ethylene production. Our results showed that MPK3/MPK6 transcript abundance and MPK3/MPK6 phosphorylation are elevated under conditions of Fe deficiency. Furthermore, mpk3 and mpk6 mutants show a lesser induction of ethylene production under Fe deficiency and a greater sensitivity to Fe deficiency. Finally, in mpk3, mpk6, and acs2 mutants under conditions of Fe deficiency, induction of transcript expression of the Fe-deficiency response genes FRO2, IRT1, and FIT is partially compromised. Taken together, our results suggest that the MPK3/MPK6 and ACS2 are part of the Fe starvation-induced ethylene production signaling pathway. PMID:26579185

  6. Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC)

    PubMed Central

    Johnson, G.; Ayers, M.; McClure, S. C. C.; Richardson, S. E.; Tellier, R.

    2003-01-01

    Several Bartonella species have now been implicated as human pathogens. The recovery of these fastidious organisms in the clinical microbiology laboratory remains difficult, and current methods are still relatively insensitive. Thus, the bartonellae are good candidates for detection by PCR. We have developed a PCR assay which uses a single primer pair targeting the riboflavin synthase gene (ribC) and detected six Bartonella species that have been implicated in human disease, B. henselae, B. quintana, B. bacilliformis, B. clarridgeiae, B. elizabethae, and B. vinsonii subsp. berkhoffii. Species identification is achieved simply by restriction enzyme digestion of the amplicon. This PCR assay appears to be specific for the Bartonella genus because it failed to amplify DNA from several other bacterial species. PMID:12624031

  7. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L.) as examples

    PubMed Central

    2010-01-01

    Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx) genes and four genome-specific primer sets for the starch synthase II (SSII) genes were developed mainly from single nucleotide polymorphisms (SNPs) and/or insertions or deletions (Indels) in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D) could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx and SSII genes in natural

  8. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    PubMed Central

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS) that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS). The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3), functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP), while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP) and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP). Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes. PMID:25784918

  9. Longiborneol Synthase Gene from Fusarium Graminearum is Required for Culmorin Biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A sesquiterpene cyclase gene, fg10397, was found in a Fusarium graminearum cDNA library that was previously used to identify trichothecene and butenolide biosynthetic genes. Gene disruption and add-back experiments showed that fg10397 was required for culmorin biosynthesis. Expression of fg10397 in...

  10. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI) gene detected in Acinetobacter baumannii

    PubMed Central

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Mansouri, Shahla

    2016-01-01

    Background and Objectives: In present study we aimed to clone the luxI gene encoding N-acyl-homoserine synthase detected in clinical isolates of Acinetobacter baumannii and study its expression in Escherichia coli transformants. Materials and Methods: Four A. baumannii hospital strains which demonstrated strong biofilm activity were selected in this investigation. The presence of luxI gene was detected using PCR technique. Purified PCR product DNA was initially cloned into pTG19 and transformed to E. coli DH5α. The gene was then recovered from agarose gel and ligated by T4 DNA ligase into pET28a expression vector using NdeI and XhoI enzymes. pET28a + luxI was transformed into E. coli BL21 (DE3). The luxI putative gene was further detected in the transformants by colony PCR. Expression of the luxI gene in the recombinant E. coli BL21 cells was studied by quantitative real time PCR (qRT-PCR) and the presence of N-acylhomoserine lactone (AHL) was checked by colorimetric assay and Fourier Transform Infra-Red (FT-IR) spectroscopy. Results: We successfully cloned AHL gene from A. baumannii strain 23 to pET28a expression vector. There was four fold increases in expression of luxI in the transformants (P ≤ 0.05). It was found that, strain 23 and the transformants showed highest amount of AHL activity (OD = 1.524). The FT-IR analysis indicated stretching C=O bond of the lactone ring and primary amides (N=H) at 1764.69 cm−1 and 1659.23 cm−1 respectively. Conclusion: From above results we concluded that, luxI in A. baumannii is indeed responsible for AHL production and not regulation and pET28a vector allows efficient AHL expression in E. coli BL21 transformants. PMID:27307980

  11. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  12. Evolution and Functional Insights of Different Ancestral Orthologous Clades of Chitin Synthase Genes in the Fungal Tree of Life

    PubMed Central

    Li, Mu; Jiang, Cong; Wang, Qinhu; Zhao, Zhongtao; Jin, Qiaojun; Xu, Jin-Rong; Liu, Huiquan

    2016-01-01

    Chitin synthases (CHSs) are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III) was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc) identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene family in the fungal

  13. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    PubMed Central

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-01-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  14. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    PubMed

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-12-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  15. Structure Conservation and Differential Expression of Farnesyl Diphosphate Synthase Genes in Euphorbiaceous Plants

    PubMed Central

    Guo, Dong; Li, Hui-Liang; Peng, Shi-Qing

    2015-01-01

    Farnesyl diphosphate synthase (FPS) is a key enzyme of isoprenoids biosynthesis. However, knowledge of the FPSs of euphorbiaceous species is limited. In this study, ten FPSs were identified in four euphorbiaceous plants. These FPSs exhibited similar exon/intron structure. The deduced FPS proteins showed close identities and exhibited the typical structure of plant FPS. The members of the FPS family exhibit tissue expression patterns that vary among several euphorbiaceous plant species under normal growth conditions. The expression profiles reveal spatial and temporal variations in the expression of FPSs of different tissues from Euphorbiaceous plants. Our results revealed wide conservation of FPSs and diverse expression in euphorbiaceous plants during growth and development. PMID:26389894

  16. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae.

    PubMed

    Müller, Christian; Hansen, Kim; Szabo, Peter; Nielsen, Jens

    2003-03-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3.4-22.5 g kg(-1) biomass) and the power-law model adequately described the rheological properties. In the cultivations there were pellets, clumps, and freely dispersed hyphal elements. The different morphological fractions were quantified using image analysis. The apparent viscosity of the fermentation broth was significantly affected by the biomass concentration, the morphology, and also by pH. The chsB disruption strain had lower consistency index K values for all biomass concentrations investigated, which is a desirable trait for industrial Aspergillus fermentations. PMID:12514801

  17. Rhizobacteria activates (+)-δ-cadinene synthase genes and induces systemic resistance in cotton against beet armyworm (Spodoptera exigua).

    PubMed

    Zebelo, Simon; Song, Yuanyuan; Kloepper, Joseph W; Fadamiro, Henry

    2016-04-01

    Gossypol is an important allelochemical produced by the subepidermal glands of some cotton varieties and important for their ability to respond to changing biotic stress by exhibiting antibiosis against some cotton pests. Plant growth-promoting rhizobacteria (PGPR) are root-colonizing bacteria that increase plant growth and often elicit defence against plant pathogens and insect pests. Little is known about the effect of PGPR on cotton plant-insect interactions and the potential biochemical and molecular mechanisms by which PGPR enhance cotton plant defence. Here, we report that PGPR (Bacillus spp.) treated cotton plants showed significantly higher levels of gossypol compared with untreated plants. Similarly, the transcript levels of the genes (i.e. (+)-δ-cadinene synthase gene family) involved in the biosynthesis of gossypol were higher in PGPR-treated plants than in untreated plants. Furthermore, the levels of jasmonic acid, an octadecanoid-derived defence-related phytohormone and the transcript level of jasmonic acid responsive genes were higher in PGPR-treated plants than in untreated plants. Most intriguingly, Spodoptera exigua showed reduced larval feeding and development on PGPR-treated plants. These findings demonstrate that treatment of plants with rhizobacteria may induce significant biochemical and molecular changes with potential ramifications for plant-insect interactions. PMID:26715260

  18. Analysis of 6-pyruvyl tetrahydropterin synthase, a target gene product of su(s) suppressor in Drosophila

    SciTech Connect

    Yim, J.J.; Park, Y.S.; Kim, J.H.; Jacobson, K.B. . Dept. of Microbiology; Oak Ridge National Lab., TN )

    1989-01-01

    Of the 20 suppressor mutants listed in Drosophila, su(s){sup 2} has been studied for the biochemical characterization of the suppression. In su(s){sup 2} suppression, some mutants at vermilion (v, 1-33.0), sable (s, 1-43.0), speck (sp, 2-107.0), and purple (pr, 2-54.5) are suppressible by mutants at the suppressor of sable (su(s)) locus. There have been many reports of suppression mechanism studies in purple led to purple loci. The biochemical studies in purple led to in vitro demonstration of a su(s){sup +} gene product as a negative effector against suppressed purple PPH{sub 4} synthase, which has been also demonstrated in the gene product of vermilion more recently. Both studies led to a proposal for a posttranslational mechanism in which the su(s){sup +} gene produces a substance that interferes with the function of the target enzymes from the purple and vermilion mutant. In contrast to the transcriptional regulation of the su(s) locus the posttranslational mechanism is based on qualitative differences between wild and suppressed enzyme. Therefore this investigation was to determine if any quantitative or qualitative differences exist between the mutant and wild type target enzymes. 7 refs., 4 figs.

  19. Geranyl diphosphate synthase from mint

    SciTech Connect

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  20. Geranyl diphosphate synthase from mint

    SciTech Connect

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  1. The Gene CBO0515 from Clostridium botulinum Strain Hall A Encodes the Rare Enzyme N5-(Carboxyethyl) Ornithine Synthase, EC 1.5.1.24▿

    PubMed Central

    Thompson, John; Hill, Karen K.; Smith, Theresa J.; Pikis, Andreas

    2010-01-01

    Sequencing of the genome of Clostridium botulinum strain Hall A revealed a gene (CBO0515), whose putative amino acid sequence was suggestive of the rare enzyme N5-(1-carboxyethyl) ornithine synthase. To test this hypothesis, CBO0515 has been cloned, and the encoded polypeptide was purified and characterized. This unusual gene appears to be confined to proteolytic strains assigned to group 1 of C. botulinum. PMID:19933367

  2. Inadvertent gene silencing of argininosuccinate synthase (bcass1) in Botrytis cinerea by the pLOB1 vector system.

    PubMed

    Patel, Risha M; Van Kan, Jan A L; Bailey, Andy M; Foster, Gary D

    2010-09-01

    For several years, researchers working on the plant pathogen Botrytis cinerea and a number of other related fungi have routinely used the pLOB1 vector system, based on hygromycin resistance, under the control of the Aspergillus nidulans oliC promoter and what was reported to be the beta-tubulin (tubA) terminator. Recently, it has been demonstrated that this vector contains a 446-bp portion of the B. cinerea argininosuccinate synthase gene (bcass1) rather than the tubA terminator. As argininosuccinate synthase is essential for the production of L-arginine, inadvertent gene silencing of bcass1 may result in partial L-arginine auxotrophy and, indeed, may lead to altered phenotypes in planta. In this article, we report our findings relating to possible problems arising from this incorrect plasmid construction. As an absolute baseline, gene disruption of bcass1 was carried out and generated a strict auxotroph, unable to grow without exogenous arginine supplementation. The knockout displayed an alteration in host range in planta, showing a reduction in pathogenicity on strawberries, French bean leaves and tomatoes, but maintained wild-type growth on grape, which is in accordance with the reported arginine availability in such tissues. Deliberate gene silencing of bcass1 mirrored these effects, with strongly silenced lines showing reduced virulence. The degree of silencing as seen by partial auxotrophy was correlated with an observed reduction in virulence. We also showed that inadvertent silencing of bcass1 is possible when using the pLOB1 vector or derivatives thereof. Partial arginine auxotrophy and concomitant reductions in virulence were triggered in approximately 6% of transformants obtained when expressing enhanced green fluorescent protein, luciferase, monomeric red fluorescent protein or beta-glucuronidase using the pLOB1-based expression system, which inadvertently contains 446 bp of the bcass1 coding sequence. We recommend the testing of transformants obtained

  3. Polyamines Attenuate Ethylene-Mediated Defense Responses to Abrogate Resistance to Botrytis cinerea in Tomato1[C][W][OA

    PubMed Central

    Nambeesan, Savithri; AbuQamar, Synan; Laluk, Kristin; Mattoo, Autar K.; Mickelbart, Michael V.; Ferruzzi, Mario G.; Mengiste, Tesfaye; Handa, Avtar K.

    2012-01-01

    Transgenic tomato (Solanum lycopersicum) lines overexpressing yeast spermidine synthase (ySpdSyn), an enzyme involved in polyamine (PA) biosynthesis, were developed. These transgenic lines accumulate higher levels of spermidine (Spd) than the wild-type plants and were examined for responses to the fungal necrotrophs Botrytis cinerea and Alternaria solani, bacterial pathogen Pseudomonas syringae pv tomato DC3000, and larvae of the chewing insect tobacco hornworm (Manduca sexta). The Spd-accumulating transgenic tomato lines were more susceptible to B. cinerea than the wild-type plants; however, responses to A. solani, P. syringae, or M. sexta were similar to the wild-type plants. Exogenous application of ethylene precursors, S-adenosyl-Met and 1-aminocyclopropane-1-carboxylic acid, or PA biosynthesis inhibitors reversed the response of the transgenic plants to B. cinerea. The increased susceptibility of the ySpdSyn transgenic tomato to B. cinerea was associated with down-regulation of gene transcripts involved in ethylene biosynthesis and signaling. These data suggest that PA-mediated susceptibility to B. cinerea is linked to interference with the functions of ethylene in plant defense. PMID:22128140

  4. Transgenic rice with inducible ethylene production exhibits broad-spectrum disease resistance to the fungal pathogens Magnaporthe oryzae and Rhizoctonia solani.

    PubMed

    Helliwell, Emily E; Wang, Qin; Yang, Yinong

    2013-01-01

    Rice blast (Magnaporthe oryzae) and sheath blight (Rhizoctonia solani) are the two most devastating diseases of rice (Oryza sativa), and have severe impacts on crop yield and grain quality. Recent evidence suggests that ethylene (ET) may play a more prominent role than salicylic acid and jasmonic acid in mediating rice disease resistance. In this study, we attempt to genetically manipulate endogenous ET levels in rice for enhancing resistance to rice blast and sheath blight diseases. Transgenic lines with inducible production of ET were generated by expressing the rice ACS2 (1-aminocyclopropane-1-carboxylic acid synthase, a key enzyme of ET biosynthesis) transgene under control of a strong pathogen-inducible promoter. In comparison with the wild-type plant, the OsACS2-overexpression lines showed significantly increased levels of the OsACS2 transcripts, endogenous ET and defence gene expression, especially in response to pathogen infection. More importantly, the transgenic lines exhibited increased resistance to a field isolate of R. solani, as well as different races of M. oryzae. Assessment of the growth rate, generational time and seed production revealed little or no differences between wild type and transgenic lines. These results suggest that pathogen-inducible production of ET in transgenic rice can enhance resistance to necrotrophic and hemibiotrophic fungal pathogens without negatively impacting crop productivity. PMID:23031077

  5. Contrasting effects of ethylene biosynthesis on induced plant resistance against a chewing and a piercing-sucking herbivore in rice.

    PubMed

    Lu, Jing; Li, Jiancai; Ju, Hongping; Liu, Xiaoli; Erb, Matthias; Wang, Xia; Lou, Yonggen

    2014-11-01

    Ethylene is a stress hormone with contrasting effects on herbivore resistance. However, it remains unknown whether these differences are plant- or herbivore-specific. We cloned a rice 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene, OsACS2, whose transcripts were rapidly up-regulated in response to mechanical wounding and infestation by two important pests: the striped stem borer (SSB) Chilo suppressalis and the brown planthopper (BPH) Nilaparvata lugens. Antisense expression of OsACS2 (as-acs) reduced elicited ethylene emission, SSB-elicited trypsin protease inhibitor (TrypPI) activity, SSB-induced volatile release, and SSB resistance. Exogenous application of ACC restored TrypPI activity and SSB resistance. In contrast to SSB, BPH infestation increased volatile emission in as-acs lines. Accordingly, BPH preferred to feed and oviposit on wild-type (WT) plants--an effect that could be attributed to two repellent volatiles, 2-heptanone and 2-heptanol, that were emitted in higher amounts by as-acs plants. BPH honeydew excretion was reduced and natural enemy attraction was enhanced in as-acs lines, resulting in higher overall resistance to BPH. These results demonstrate that ethylene signaling has contrasting, herbivore-specific effects on rice defense responses and resistance against a chewing and a piercing-sucking insect, and may mediate resistance trade-offs between herbivores of different feeding guilds in rice. PMID:25064847

  6. Functional Genomic Analysis Supports Conservation of Function Among Cellulose Synthase-Like A Gene Family Members and Suggests Diverse Roles of Mannans in Plants1[W][OA

    PubMed Central

    Liepman, Aaron H.; Nairn, C. Joseph; Willats, William G.T.; Sørensen, Iben; Roberts, Alison W.; Keegstra, Kenneth

    2007-01-01

    Mannan polysaccharides are widespread among plants, where they serve as structural elements in cell walls, as carbohydrate reserves, and potentially perform other important functions. Previous work has demonstrated that members of the cellulose synthase-like A (CslA) family of glycosyltransferases from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze β-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced in insect cells, and each CslA protein catalyzed mannan and glucomannan synthase reactions in vitro. Microarray mining and quantitative real-time reverse transcription-polymerase chain reaction analysis demonstrated that transcripts of Arabidopsis and loblolly pine (Pinus taeda) CslA genes display tissue-specific expression patterns in vegetative and floral tissues. Glycan microarray analysis of Arabidopsis indicated that mannans are present throughout the plant and are especially abundant in flowers, siliques, and stems. Mannans are also present in chloronemal and caulonemal filaments of Physcomitrella patens, where they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall structure and carbohydrate storage. PMID:17307900

  7. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea.

    PubMed

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  8. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    SciTech Connect

    Pejcha, Robert; Ludwig, Martha L.

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  9. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel That Evolved by Gene Duplication

    PubMed Central

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα)8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys)3Zn site in the related enzymes, MetH and betaine–homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E·Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer. PMID:15630480

  10. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  11. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    PubMed

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs. PMID:24211386

  12. Development of a gene delivery system in Streptococcus gordonii using thymidylate synthase as a selection marker.

    PubMed

    Lee, Song F; Hulbah, Maram; Halperin, Scott A

    2016-06-01

    Streptococcus gordonii, a commensal bacterium of the human oral cavity, is a potential live vaccine vector. In this study, we have developed a system that delivers a vaccine antigen gene onto the chromosome of S. gordonii. The system consisted of a recipient strain, that is a thymidine auxotroph constructed by deletion of a portion of thyA gene, and a linear gene delivery construct, composed of the functional thyA gene, the vaccine antigen gene, and a DNA fragment immediately downstream of thyA. The construct is assembled by a ligation and polymerase chain reaction strategy. Upon introduction into the thyA mutant, the vaccine antigen gene integrated into the chromosome via a double crossing-over event. Using the above strategy, a test vaccine antigen gene coding for a fusion protein composed of the Bordetella pertussis filamentous hemagglutinin type I domain and the single chain antibody against complement receptor 1 was successfully delivered to S. gordonii. The resulting S. gordonii expressed the fusion protein and the delivered gene was stable in the bacterium in vitro and in a mouse colonization experiment. Mice colonized by the fusion protein-expressing S. gordonii developed antibodies that recognized the native filamentous hemagglutinin protein suggesting that an immune response was elicited. PMID:27062990

  13. Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer

    SciTech Connect

    Hur, Hyuk; Kang, Jeonghyun; Kim, Nam Kyu; Min, Byung Soh; Lee, Kang Young; Shin, Sang Joon; Keum, Ki Chang; Choi, Junjeong; Kim, Hoguen; Choi, Sung Ho; Lee, Mi-Young

    2011-11-01

    Purpose: This study aims to correlate thymidylate synthase (TS) gene polymorphisms with the tumor response to preoperative 5-fluorouracil (5-FU)-based chemoradiation therapy (CRT) in patients with rectal cancer. Methods and Materials: Forty-four patients with rectal cancer treated with 5-FU-based preoperative CRT were prospectively enrolled in this study. Thymidylate synthase expression and TS gene polymorphisms were evaluated in tumor obtained before preoperative CRT and were correlated with the pathologic response, as assessed by histopathologic staging (pTNM) and tumor regression grade. Results: Patients exhibited 2R/3R and 3R/3R tandem repeat polymorphisms in the TS gene. With regard to TS expression in these genotypes, 2R/3RC and 3RC/3RC were defined as the low-expression group and 2R/3RG, 3RC/3RG, and 3RG/3RG as the high-expression group. There was no significant correlation between TS expression and tumor response. There was no significant difference in the tumor response between patients homozygous for 3R/3R and patients heterozygous for 2R/3R. However, 13 of 14 patients in the low-expression group with a G>C single-nucleotide polymorphism (SNP) (2R/3RC [n = 5] or 3RC/3RC [n = 9]) exhibited a significantly greater tumor downstaging rate, as compared with only 12 of 30 patients in the high-expression group without the SNP (2R/3RG [n = 10], 3RC/3RG [n = 9], or 3RG/3RG [n = 11]) (p = 0.001). The nodal downstaging rate was also significantly greater in this low-expression group, as compared with the high-expression group (12 of 14 vs. 14 of 30, p = 0.014). However, there was no significant difference in the tumor regression grade between these groups. Conclusions: This study suggests that SNPs within the TS enhancer region affect the tumor response to preoperative 5-FU-based CRT in rectal cancer.

  14. Isolation and chromosomal localization of the human endothelial nitric oxide synthase (NOS3) gene

    SciTech Connect

    Robinson, L.J.; Michel, T.; Weremowicz, S.; Morton, C.C. )

    1994-01-15

    Endothelial NOS activity is a major determinant of vascular tone and blood pressure, and in several important (and sometimes hereditary) disease states, such as hypertension, diabetes, and atherosclerosis, the endothelial NO signaling system appears to be abnormal. To explore the relationship of the endothelial NOS activity, the authors isolated the human gene encoding the endothelial NOS. Genomic clones containing the 5[prime] end of this gene were identified in a human genomic library by applying a polymerase chain reaction (PCR)-based approach. Identification of the human gene for endothelial NOS (NOS3) was confirmed by nucleotide sequence analysis of the first coding exon, which was found to be identical to its cognate cDNA. The NOS3 gene spans at least 20 kb and appears to contain multiple introns. The transcription start site and promoter region of the NOS3 gene were identified by primer extension and ribonuclease protection assays. Sequencing of the putative promoter revealed consensus sequences for the shear stress-response element, as well as cytokine-responsive cis regulatory sequences, both possible important to the roles played by NOS3 in the normal and the diseased cardiovascular system. The authors also mapped the chromosomal location of the NOS3 gene. First, a chromosomal panel of human-rodent somatic cell hybrids was screened using PCR with oligonucleotide primers derived from the NOS3 genomic clone. The specificity of the amplified PCR product was confirmed by human and hamster genomic DNA controls, as well as by Southern blot analysis, using the NOS3 cDNA as probe. Definitive chromosomal assignment of the NOS3 gene to human chromosome 7 was based upon 0% discordancy; fluorescence in situ hybridization sublocalized the NOS3 gene to 7q36. The identification and characterization of the NOS3 gene may lead to further insights into heritable disease states associated with this gene product. 41 refs., 3 figs., 1 tab.

  15. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    SciTech Connect

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  16. Functional Characterization of New Polyketide Synthase Genes Involved in Ochratoxin A Biosynthesis in Aspergillus Ochraceus fc-1

    PubMed Central

    Wang, Liuqing; Wang, Yan; Wang, Qi; Liu, Fei; Selvaraj, Jonathan Nimal; Liu, Lingna; Xing, Fuguo; Zhao, Yueju; Zhou, Lu; Liu, Yang

    2015-01-01

    Ochratoxin A (OTA), a potentially carcinogenic mycotoxin which contaminates grains, is produced by several Aspergillus species. A comparative sequence analysis of the OTA-producing Aspergillus ochraceus fc-1 strain and other Aspergillus species was performed. Two new OTA-related polyketide synthase (PKS) (AoOTApks) genes were identified. The predicted amino acid sequence of AoOTApks-1 displayed high similarity to previously identified PKSs from OTA-producing A. carbonarius ITEM 5010 (67%; [PI] No. 173482) and A. niger CBS 513.88 (62%; XP_001397313). However, the predicted amino acid sequence of AoOTApks-2 displayed lower homology with A. niger CBS 513.88 (38%) and A. carbonarius ITEM 5010 (28%). A phylogenetic analysis of the β-ketosynthase and acyl-transferase domains of the AoOTApks proteins indicated that they shared a common origin with other OTA-producing species, such as A. carbonarius, A. niger, and A. westerdijkiae. A real-time reverse-transcription PCR analysis showed that the expression of AoOTApks-1 and -2 was positively correlated with the OTA concentration. The pks gene deleted mutants ∆AoOTApks-1 and ∆AoOTApks-2 produced nil and lesser OTA than the wild-type strain, respectively. Our study suggests that AoOTApks-1 could be involved in OTA biosynthesis, while AoOTApks-2 might be indirectly involved in OTA production. PMID:26213966

  17. Analysis of human hyaluronan synthase gene transcriptional regulation and downstream hyaluronan cell surface receptor mobility in myofibroblast differentiation.

    PubMed

    Midgley, Adam C; Bowen, Timothy

    2015-01-01

    The ubiquitous extracellular glycosaminoglycan hyaluronan (HA) is a polymer composed of repeated disaccharide units of alternating D-glucuronic acid and D-N-acetylglucosamine residues linked via alternating β-1,4 and β-1,3 glycosidic bonds. Emerging data continue to reveal functions attributable to HA in a variety of physiological and pathological contexts. Defining the mechanisms regulating expression of the human hyaluronan synthase (HAS) genes that encode the corresponding HA-synthesizing HAS enzymes is therefore important in the context of HA biology in health and disease. We describe here methods to analyze transcriptional regulation of the HAS and HAS2-antisense RNA 1 genes. Elucidation of mechanisms of HA interaction with receptors such as the cell surface molecule CD44 is also key to understanding HA function. To this end, we provide protocols for fluorescent recovery after photobleaching analysis of CD44 membrane dynamics in the process of fibroblast to myofibroblast differentiation, a phenotypic transition that is common to the pathology of fibrosis of large organs such as the liver and kidney. PMID:25325984

  18. Polymorphisms in the methylene tetrahydrofolate reductase and methionine synthase reductase genes and their correlation with unexplained recurrent spontaneous abortion susceptibility.

    PubMed

    Zhu, L

    2015-01-01

    We aimed to explore the correlation between unexplained recurrent spontaneous abortion and polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes. A case control study was conducted in 118 patients with unexplained recurrent spontaneous abortion (abortion group) and 174 healthy women (control group). The genetic material was extracted from the oral mucosal epithelial cells obtained from all subjects. The samples were subjected to fluorescence quantitative PCR to detect the single nucleotide polymorphisms (SNPs) in the MTHFR (C677T and A1298C) and MTRR (A66G) gene loci. The distribution frequency (18/118, 15.3%) of the MTHFR 677TT genotype was significantly higher in the abortion group (χ2 = 11.006, P = 0.004) than in the control group (2/174, 1.1%); on the other hand, the distribution frequency of the MTHFR A1298C genotype did not significantly differ between the abortion and control groups (χ(2) = 0.441, P = 0.507). The distribution frequency of the MTRR A66G genotype was also significantly higher in the abortion group (14/118, 11.9%; χ(2) = 10.503, P = 0.005) than in the control group (8/174, 4.6%). The MTHFR C677T and MTRR A66G polymorphisms are significantly correlated with the occurrence of spontaneous abortion. PMID:26345779

  19. DNA Sequence and Expression Variation of Hop (Humulus lupulus) Valerophenone Synthase (VPS), a Key Gene in Bitter Acid Biosynthesis

    PubMed Central

    Castro, Consuelo B.; Whittock, Lucy D.; Whittock, Simon P.; Leggett, Grey; Koutoulis, Anthony

    2008-01-01

    Background The hop plant (Humulus lupulus) is a source of many secondary metabolites, with bitter acids essential in the beer brewing industry and others having potential applications for human health. This study investigated variation in DNA sequence and gene expression of valerophenone synthase (VPS), a key gene in the bitter acid biosynthesis pathway of hop. Methods Sequence variation was studied in 12 varieties, and expression was analysed in four of the 12 varieties in a series across the development of the hop cone. Results Nine single nucleotide polymorphisms (SNPs) were detected in VPS, seven of which were synonymous. The two non-synonymous polymorphisms did not appear to be related to typical bitter acid profiles of the varieties studied. However, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of VPS expression during hop cone development showed a clear link with the bitter acid content. The highest levels of VPS expression were observed in two triploid varieties, ‘Symphony’ and ‘Ember’, which typically have high bitter acid levels. Conclusions In all hop varieties studied, VPS expression was lowest in the leaves and an increase in expression was consistently observed during the early stages of cone development. PMID:18519445

  20. Polyketide Synthase Gene Diversity within the Microbiome of the Sponge Arenosclera brasiliensis, Endemic to the Southern Atlantic Ocean

    PubMed Central

    Trindade-Silva, Amaro E.; Rua, Cintia P. J.; Andrade, Bruno G. N.; Vicente, Ana Carolina Paulo; Silva, Genivaldo G. Z.

    2013-01-01

    Microbes associated with marine sponges are considered important producers of bioactive, structurally unique polyketides. The synthesis of such secondary metabolites involves type I polyketide synthases (PKSs), which are enzymes that reach a maximum complexity degree in bacteria. The Haplosclerida sponge Arenosclera brasiliensis hosts a complex microbiota and is the source of arenosclerins, alkaloids with cytotoxic and antibacterial activity. In the present investigation, we performed high-throughput sequencing of the ketosynthase (KS) amplicon to investigate the diversity of PKS genes present in the metagenome of A. brasiliensis. Almost 4,000 ketosynthase reads were recovered, with about 90% annotated automatically as bacterial. A total of 235 bacterial KS contigs was rigorously assembled from this sequence pool and submitted to phylogenetic analysis. A great diversity of six type I PKS groups has been consistently detected in our phylogenetic reconstructions, including a novel and A. brasiliensis-exclusive group. Our study is the first to reveal the diversity of type I PKS genes in A. brasiliensis as well as the potential of its microbiome to serve as a source of new polyketides. PMID:23275501

  1. Normal responses to restraint stress in mice lacking the gene for neuronal nitric oxide synthase.

    PubMed

    Weissman, Ben A; Sottas, Chantal M; Holmes, Michael; Zhou, Ping; Iadecola, Costantino; Hardy, Dianne O; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in this suppression, but the evidence has not been conclusive. We used adult wild-type (WT) and nNOS knockout male mice (nNOS-/-) to assess the respective roles of CORT and nNOS-derived NO in stress mediated inhibition of T production. Animals were assigned to either basal control or 3-hour IMO groups. No difference in basal plasma and testicular T levels were observed between WT and nNOS-/-, although testicular weights of mutant mice were slightly lower compared to WT animals. The plasma contents of luteinizing hormone (LH) and CORT in unstressed mice of both genotypes were similar. Exposure to 3 hours of IMO increased plasma CORT and decreased T concentrations in mice of both genotypes. However, comparable levels of plasma LH and testicular nitrite and nitrate (NOx), NO stable metabolites, were detected in control and stressed WT and nNOS-/- mice. Adrenal concentrations of NOx declined after IMO, but the reduction was not statistically significant. These findings implicate CORT rather than NO generated by nNOS in the rapid stress-induced suppression of circulating T. PMID:19304728

  2. Inducible nitric oxide synthase gene expression in brain following cerebral ischemia

    SciTech Connect

    Iadecola, C.; Zhang, Fangyi; Xu, S.

    1995-05-01

    Cerebral ischemia is followed by a local inflammatory response that is thought to participate in the extension of the tissue damage occurring in the postischemic period. However, the mechanisms whereby the inflammation contributes to the progression of the damage have not been fully elucidated. In models of inflammation, expression of the inducible isoform of nitric oxide synthase (iNOS) is responsible for cytotoxicity through the production of large amounts of nitric oxide (NO). In this study, therefore, we sought to establish whether iNOS is expressed in the ischemic brain. Rats were killed 6 h to 7 days after occlusion of the middle cerebral artery. iNOS expression in the ischemic area was determined by reverse-transcription polymerase chain reaction. Porphobilinogen deaminase mRNA was detected in the same sample and used for normalization. In the ischemic brain, there was expression of iNOS mRNA that began at 12 h, peaked at 48 h, and returned to baseline at 7 days (n = 3/time point). iNOS mRNA expression paralleled the time course of induction of iNOS catalytic activity, determined by the citrulline assay (17.4 {+-} 4.4 pmol citrulline/{mu}g protein/min at 48 h; mean {+-} SD; n = 5 per time point). iNOS immunoreactivity was seen in neutrophils at 48-96 h after ischemia. The data provide molecular, biochemical, and immunocytochemical evidence of iNOS induction following focal cerebral ischemia. These findings, in concert with our recent demonstration that inhibition of iNOS reduces infarct volume in the same stroke model, indicate that NO production may play an important pathogenic role in the progression of the tissue damage that follows cerebral ischemia. 35 refs., 3 figs.

  3. Biosynthesis of riboflavin: cloning, sequencing, and expression of the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli.

    PubMed Central

    Richter, G; Volk, R; Krieger, C; Lahm, H W; Röthlisberger, U; Bacher, A

    1992-01-01

    3,4-Dihydroxy-2-butanone 4-phosphate is biosynthesized from ribulose 5-phosphate and serves as the biosynthetic precursor for the xylene ring of riboflavin. The gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli has been cloned and sequenced. The gene codes for a protein of 217 amino acid residues with a calculated molecular mass of 23,349.6 Da. The enzyme was purified to near homogeneity from a recombinant E. coli strain and had a specific activity of 1,700 nmol mg-1 h-1. The N-terminal amino acid sequence and the amino acid composition of the protein were in agreement with the deduced sequence. The molecular mass as determined by ion spray mass spectrometry was 23,351 +/- 2 Da, which is in agreement with the predicted mass. The previously reported loci htrP, "luxH-like," and ribB at 66 min of the E. coli chromosome are all identical to the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase, but their role had not been hitherto determined. Sequence homology indicates that gene luxH of Vibrio harveyi and the central open reading frame of the Bacillus subtilis riboflavin operon code for 3,4-dihydroxy-2-butanone 4-phosphate synthase. Images PMID:1597419

  4. Analysis of the mitochondrial ATP synthase beta-subunit gene in Drosophilidae: structure, transcriptional regulatory features and developmental pattern of expression in Drosophila melanogaster.

    PubMed Central

    Peña, P; Ugalde, C; Calleja, M; Garesse, R

    1995-01-01

    We have cloned and determined the structure of the gene encoding the H(+)-ATP synthase beta subunit in two distantly related Drosophila species, D. melanogaster and D. virilis. The gene contains three exons that are extremely well conserved at the amino acid level, not only in the region encoding the mature protein but also in that encoding the leader peptide. Primer extension analysis indicates that the 5' untranslated region is extremely short, and reveals the presence of multiple initiation sites of transcription in both Drosophila species. The promoters of D. melanogaster and D. virilis H(+)-ATP synthase beta-subunit genes contain a conserved region surrounding the initiation transcription sites. Nucleotide sequence analysis has revealed the absence of canonical TATA and CCAAT boxes and the presence of several putative regulatory elements in both promoter regions, including GAGA, GATA and Ets binding sites. We have analysed the pattern of gene expression during D. melanogaster development. The mRNA is stored in oocytes, and activation of transcription takes place after 10 h of development. The expression of the nuclear-encoded H(+)-ATP synthase beta subunit is strictly coordinated with the expression of subunits 6 and 8 of the same complex that are encoded in the mitochondrial genome. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 8 PMID:8554535

  5. Isolation of pig mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene promoter: characterization of a peroxisome proliferator-responsive element.

    PubMed Central

    Ortiz, J A; Mallolas, J; Nicot, C; Bofarull, J; Rodríguez, J C; Hegardt, F G; Haro, D; Marrero, P F

    1999-01-01

    Low expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene during development correlates with an unusually low hepatic ketogenic capacity and lack of hyperketonaemia in piglets. Here we report the isolation and characterization of the 5' end of the pig mitochondrial HMG-CoA synthase gene. The 581 bp region proximal to the transcription start site permits transcription of a reporter gene, confirming the function of the promoter. The pig mitochondrial HMG-CoA synthase promoter is trans-activated by the peroxisomal proliferator-activated receptor (PPAR), and a functional response element for PPAR (PPRE) has been localized in the promoter region. Pig PPRE is constituted by an imperfect direct repeat (DR-1) and a downstream sequence, both of which are needed to confer PPAR-sensitivity to a thymidine kinase promoter and to form complexes with PPAR.retinoid X receptor heterodimers. A role of PPAR trans-activation in starvation-associated induction of gene expression is suggested. PMID:9882632

  6. GhPSY, a phytoene synthase gene, is related to the red plant phenotype in upland cotton (Gossypium hirsutum L.).

    PubMed

    Cai, Caiping; Zhang, Xueying; Niu, Erli; Zhao, Liang; Li, Nina; Wang, Liman; Ding, Linyun; Guo, Wangzhen

    2014-08-01

    Carotenoids are important accessory pigments in plants that are essential for photosynthesis. Phytoene synthase (PSY), a rate-controlling enzyme in the carotenoid biosynthesis pathway, has been widely characterized in rice, maize, and sorghum, but at present there are no reports describing this enzyme in cotton. In this study, GhPSY was identified as a candidate gene for the red plant phenotype via a combined strategy using: (1) molecular marker data for loci closely linked to R1; (2) the whole-genome scaffold sequence from Gossypium raimondii; (3) gene expression patterns in cotton accessions expressing the red plant and green plant phenotypes; and (4) the significant correlation between a single nucleotide polymorphisms (SNP) in GhPSY and leaf phenotypes of progeny in the (Sub16 × T586) F2 segregating population. GhPSY was relatively highly expressed in leaves, and the protein was localized to the plastid where it appeared to be mostly attached to the surface of thylakoid membranes. GhPSY mRNA was expressed at a significantly higher level in T586 and SL1-7-1 red plants than TM-1 and Hai7124 green plants. SNP analysis in the GhPSY locus showed co-segregation with the red and green plant phenotypes in the (Sub16 × T586) F2 segregating population. A phylogenetic analysis showed that GhPSY belongs to the PSY2 subfamily, which is related to photosynthesis in photosynthetic tissues. Using a reverse genetics approach based on Tobacco rattle virus-induced gene silencing, we showed that the knockdown of GhPSY caused a highly uniform bleaching of the red color in newly-emerged leaves in both T586 and SL1-7-1 plants with a red plant phenotype. These findings indicate that GhPSY is important for engineering the carotenoid metabolic pathway in pigment production. PMID:24718783

  7. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    PubMed

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. PMID:22699157

  8. Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB.

    PubMed

    Fujisawa, Masaki; Watanabe, Mio; Choi, Song-Kang; Teramoto, Maki; Ohyama, Kanji; Misawa, Norihiko

    2008-06-01

    Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health. PMID:18640603

  9. Citrate-release-mediated aluminum resistance is coupled to the inducible expression of mitochondrial citrate synthase gene in Paraserianthes falcataria.

    PubMed

    Osawa, Hiroki; Kojima, Katsumi

    2006-05-01

    Aluminum (Al) resistance in some leguminous plants is achieved by enhanced citrate release from roots. Enhancement requires several hours for complete activation and is postulated to involve Al-responsive genes or components. We examined the mechanism of Al-induced citrate release by studying the relationship between citrate release and expression of the mitochondrial citrate synthase (mCS) gene in three leguminous trees. Root elongation in Leucaena leucocephala (Lam.) de Wit was arrested within 24 h by 30 microM Al, whereas root elongation in Paraserianthes falcataria (L.) Neilson and Acacia mangium Willd. was inhibited < 50% by a 48-h treatment with 100 microM Al in calcium chloride solution. Roots of P. falcataria and A. mangium maintained enhanced release and accumulation of citrate for at least 28 days in response to Al treatment. Aluminum increased the accumulation of mCS transcripts in P. falcataria roots, but not in L. leucocephala roots, and thus up-regulation decreased following removal of Al. Lanthanum did not alter the expression level of mCS. Aluminum increased mCS activity concomitantly with enhanced mCS gene expression in P. falcataria, whereas it did not affect mCS activity in L. leucocephala. Aluminum content in root apices of P. falcataria was increased by cycloheximide, supporting the idea that de novo synthesis of proteins is a prerequisite for Al resistance. Our findings suggest that Al-inducible expression of mCS coupled with enhanced citrate release mediates Al resistance in P. falcataria. PMID:16452070

  10. Characterization of two chitin synthase genes of the red flour beetle, Tribolium castaneum, and alternate exon usage in one of the genes during development.

    PubMed

    Arakane, Yasuyuki; Hogenkamp, David G; Zhu, Yu Cheng; Kramer, Karl J; Specht, Charles A; Beeman, Richard W; Kanost, Michael R; Muthukrishnan, Subbaratnam

    2004-03-01

    Two chitin synthase (CHS) genes of the red flour beetle, Tribolium castaneum, were sequenced and their transcription patterns during development examined. By screening a BAC library of genomic DNA from T. castaneum (Tc) with a DNA probe encoding the catalytic domain of a putative Tribolium CHS, several clones that contained CHS genes were identified. Two distinct PCR products were amplified from these BAC clones and confirmed to be highly similar to CHS genes from other insects, nematodes and fungi. The DNA sequences of these genes, TcCHS1 and TcCHS2, were determined by amplification of overlapping PCR fragments from two of the BAC DNAs and mapped to different linkage groups. Each ORF was identified and full-length cDNAs were also amplified, cloned and sequenced. TcCHS1 and TcCHS2 encode transmembrane proteins of 1558 and 1464 amino acids, respectively. The TcCHS1 gene was found to use alternate exons, each encoding 59 amino acids, a feature not found in the TcCHS2 gene. During development, Tribolium expressed TcCHS1 predominantly in the embryonic and pupal stages, whereas TcCHS2 was prevalent in the late larval and adult stages. The alternate exon 8a of TcCHS1 was utilized over a much broader range of development than exon 8b. We propose that the two isoforms of the TcCHS1 enzyme are used predominantly for the formation of chitin in embryonic and pupal cuticles, whereas TcCHS2 is utilized primarily for the synthesis of peritrophic membrane-associated chitin in the midgut. PMID:14871625

  11. Association of endothelial nitric oxide synthase gene T-786C promoter polymorphism with gastric cancer

    PubMed Central

    Krishnaveni, Devulapalli; Amar Chand, Bhayal; Shravan Kumar, Porika; Uma Devi, Malladi; Ramanna, Macherla; Jyothy, Akka; Pratibha, Nallari; Balakrishna, N; Venkateshwari, Ananthapur

    2015-01-01

    AIM: To investigate the role of endothelial nitric oxide synthase -786T > C promoter polymorphism in the etiology of gastric cancer (GC). METHODS: A total of 150 GC patients and 150 control subjects were included in the study. The information on demographic features was elicited with an informed consent from all the patients and control subjects using a structured questionnaire. Helicobacter pylori (H. pylori) infectivity status was tested in antral biopsies from all the subjects by rapid urease test following the method of Vaira et al. Genomic DNA was isolated from whole blood samples following the salting out method of Lahiri et al. Genotype analysis of the rs2070744 polymorphism was carried out by allele-specific polymerase chain reaction method. The genotypes were determined based on the appearance of bands on an agarose gel stained with ethidium bromide under ultraviolet gel documentation with the help of 100 bp ladder. Odds ratios and corresponding 95%CIs were determined using java stat online software. RESULTS: There was a significant difference in the distribution of C allele (C vs T; P = 0.000, OR = 5.038) in patient group compared to the control subjects exhibiting a fivefold increased risk for GC. When the T/T and C/C genotypes were compared, there was an enhanced GC risk for individuals with C/C genotype (T/T vs C/C; P = 0.000). Among the demographic factors, smoking and alcoholism were the common risk factors in patients compared to the control subjects (P < 0.05). Patients with smoking and alcoholism developed cancer even in heterozygous T/C condition (smoking: P = 0.020 and alcoholism: P = 0.005). Individuals with H. pylori infection showed seven fold increased risk for cancer. All the patients with C/C genotype revealed a significant association between H. pylori infection and GC. Among the patients 2.4% of them revealed familial incidence of GC. No significant difference was noticed between cases and controls with regard to consanguinity (P = 0

  12. The Sesquiterpene Synthase from the Botrydial Biosynthetic Gene Cluster of the Phytopathogen Botrytis cinerea

    PubMed Central

    Pinedo, Cristina; Wang, Chieh-Mei; Pradier, Jean-Marc; Dalmais, Bérengère; Choquer, Mathias; Pêcheur, Pascal Le; Morgant, Guillaume; Collado, Isidro G.; Cane, David E.; Viaud, Muriel

    2009-01-01

    The fungus Botrytis cinerea is the causal agent of the economically important gray mold disease that affects more than 200 ornamental and agriculturally important plant species. B. cinerea is a necrotrophic plant pathogen that secretes nonspecific phytotoxins, including the sesquiterpene botrydial and the polyketide botcinic acid. The region surrounding the previously characterized BcBOT1 gene has now been identified as the botrydial biosynthetic gene cluster. Five genes including BcBOT1 and BcBOT2 were shown by quantitative Reverse Transcription-PCR to be co-regulated through the calcineurin signaling pathway. Inactivation of the BcBOT2 gene, encoding a putative sesquiterpene cyclase, abolished botrydial biosynthesis, which could be restored by in trans complementation. Inactivation of BcBOT2 also resulted in over-production of botcinic acid that was observed to be strain-dependent. Recombinant BcBOT2 protein converted farnesyl diphosphate to the parent sesquiterpene of the botrydial biosynthetic pathway, the tricyclic alcohol presilphiperfolan-8β-ol. PMID:19035644

  13. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    PubMed Central

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  14. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

  15. Annotation of the Modular Polyketide Synthase and Nonribosomal Peptide Synthetase Gene Clusters in the Genome of Streptomyces tsukubaensis NRRL18488

    PubMed Central

    Blažič, Marko; Starcevic, Antonio; Lisfi, Mohamed; Baranasic, Damir; Goranovič, Dušan; Fujs, Štefan; Kuščer, Enej; Kosec, Gregor; Petković, Hrvoje; Cullum, John; Hranueli, Daslav

    2012-01-01

    The high G+C content and large genome size make the sequencing and assembly of Streptomyces genomes more difficult than for other bacteria. Many pharmaceutically important natural products are synthesized by modular polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs). The analysis of such gene clusters is difficult if the genome sequence is not of the highest quality, because clusters can be distributed over several contigs, and sequencing errors can introduce apparent frameshifts into the large PKS and NRPS proteins. An additional problem is that the modular nature of the clusters results in the presence of imperfect repeats, which may cause assembly errors. The genome sequence of Streptomyces tsukubaensis NRRL18488 was scanned for potential PKS and NRPS modular clusters. A phylogenetic approach was used to identify multiple contigs belonging to the same cluster. Four PKS clusters and six NRPS clusters were identified. Contigs containing cluster sequences were analyzed in detail by using the ClustScan program, which suggested the order and orientation of the contigs. The sequencing of the appropriate PCR products confirmed the ordering and allowed the correction of apparent frameshifts resulting from sequencing errors. The product chemistry of such correctly assembled clusters could also be predicted. The analysis of one PKS cluster showed that it should produce a bafilomycin-like compound, and reverse transcription (RT)-PCR was used to show that the cluster was transcribed. PMID:22983969

  16. 844ins68 in the cystathionine beta-synthase gene in Israel and review of its distribution in the world.

    PubMed

    Zoossmann-Diskin, Avshalom; Gazit, Efraim; Peleg, Leah; Shohat, Mordechai; Turner, David

    2004-06-01

    The 844ins68 allele in the cystathionine beta-synthase gene is always found in cis with the T833C mutation further indicating that its origin is monophyletic and that it might be a useful anthropogenetic marker. Its frequency was examined in 1087 randomly chosen subjects from Israel (twelve Jewish communities and Palestinians), and found to range from 0.034 to 0.125. The heterogeneity among the Jewish communities spans most of the range encountered among Caucasoid populations and is in accordance both with other genetic markers examined in the Jewish communities and with genetic distance and discriminant analyses. 844ins68 cannot distinguish between various European regions, because of the marked heterogeneity of the allele frequency distribution in Europe. This distribution of the insertion does not follow a recognised pattern of any known colonisation process. Its use as a reliable anthropogenetic marker discriminating between the major human groups may also be problematic until more populations are sampled. PMID:15228193

  17. The innervation of rainbow trout (Oncorhynchus mykiss) liver: protein gene product 9.5 and neuronal nitric oxide synthase immunoreactivities

    PubMed Central

    ESTEBAN, F. J.; JIMÉNEZ, A.; BARROSO, J. B.; PEDROSA, J. A.; DEL MORAL, M. L.; RODRIGO, J.; PEINADO, M. A.

    1998-01-01

    We have explored the innervation of the rainbow trout (O. mykiss) liver using immunohistochemical procedures and light microscopy to detect in situ protein gene product 9.5 and neuronal nitric oxide synthase immunoreactivities (PGP-IR and NOS-IR). The results showed PGP-IR nerve fibres running with the extralobular biliary duct (EBD), hepatic artery (EHA) and portal vein (EPV) that form the hepatic hilum, as well as following the spatial distribution of the intrahepatic blood vessel and biliary channels. These nerve fibres appear as single varicose processes, thin bundles, or thick bundles depending on their diameter and location in the wall of the blood vessel or biliary duct. No PGP-IR fibres were detected in the liver parenchyma. NOS-IR nerve fibres were located only in the vessels and ducts that form the hepatic hilum (EBD, EHA, EPV); in addition, NOS-IR nerve cell bodies were found isolated or forming ganglionated plexuses in the peribiliary fibromuscular tissue of the EBD. No PGP-IR ganglionated plexuses were detected in the EBD. The location of the general (PGP-IR) and nitrergic (nNOS-IR) intrinsic nerves of the trout liver suggest a conserved evolutionary role of the nervous control of hepatic blood flow and hepatobiliary activity. PMID:9827640

  18. Ceramides promote apoptosis for virus-infected lymphoma cells through induction of ceramide synthases and viral lytic gene expression

    PubMed Central

    Dai, Lu; Trillo-Tinoco, Jimena; Bai, Aiping; Chen, Yihan; Bielawski, Jacek; Del Valle, Luis; Smith, Charles D.; Ochoa, Augusto C.; Qin, Zhiqiang; Parsons, Chris

    2015-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent for several human cancers including primary effusion lymphoma (PEL), a rapidly progressive malignancy arising preferentially in immunocompromised patients. With conventional chemotherapy, PEL continues to portend high mortality, dictating the development of novel therapeutic strategies. Sphingosine kinase 2 (SphK2) represents a key gatekeeper for sphingolipid metabolism, responsible for conversion of ceramides to sphingosine-1-phosphate (S1P). We have previously demonstrated that targeting SphK2 using a novel selective inhibitor, ABC294640, leads to intracellular accumulation of ceramides and induces apoptosis for KSHV-infected PEL cells, while suppressing tumor progression in vivo. In the current study, we sought to determine whether specific ceramide/dh-ceramide species and related ceramide synthases (CerS) impact viability for KSHV-infected PEL cells during targeting of SphK2. We found that several specific ceramide and dihydro(dh)-ceramide species and their associated CerS reduce PEL survival and tumor expansion in vitro and in vivo. Moreover, we found that dhC16-Cer induces PEL apoptosis in part through activation of KSHV lytic gene expression. These data further implicate bioactive sphingolipids in regulation of PEL survival, and provide justification for future studies evaluating clinically relevant ceramide analogs or mimetics for their potential as therapeutic agents for PEL. PMID:26327294

  19. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    PubMed Central

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  20. Disruption of the Candida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairs formation of hyphae and decreases infectivity.

    PubMed

    Zaragoza, O; Blazquez, M A; Gancedo, C

    1998-08-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30 degreesC was indistinguishable from that of the wild type. However, at 42 degreesC it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37 degreesC, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42 degreesC, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 10(6) CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  1. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

    PubMed

    Chen, Wei; He, Shaozhen; Liu, Degao; Patil, Gunvant B; Zhai, Hong; Wang, Feibing; Stephenson, Troy J; Wang, Yannan; Wang, Bing; Valliyodan, Babu; Nguyen, Henry T; Liu, Qingchang

    2015-01-01

    Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS), named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP) was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC) analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG). Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD) in transgenic seedlings. In addition, the level of malondialdehyde (MDA) was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress. PMID:26376432

  2. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana

    PubMed Central

    Liu, Degao; Patil, Gunvant B.; Zhai, Hong; Wang, Feibing; Stephenson, Troy J.; Wang, Yannan; Wang, Bing; Valliyodan, Babu; Nguyen, Henry T.; Liu, Qingchang

    2015-01-01

    Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS), named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP) was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC) analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG). Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD) in transgenic seedlings. In addition, the level of malondialdehyde (MDA) was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress. PMID:26376432

  3. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars.

    PubMed

    Chizzali, Cornelia; Swiddan, Asya K; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in 'Harrow Sweet', while only PcBIS2 transcripts were detected in 'Alexander Lucas' and 'Conference'. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of 'Harrow Sweet', whereas the concentrations were ten times lower in 'Conference' and not even detectable in 'Alexander Lucas'. In 'Harrow Sweet', the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of 'Alexander Lucas' and 'Conference' advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  4. Endothelial nitric oxide synthase gene polymorphisms and the risk of hypertension in an Indian population.

    PubMed

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

    2014-01-01

    Genetic variants of eNOS gene play a significant role in the pathogenesis of hypertension. Many environmental factors have, also, been implicated in the aetiology of hypertension. We carried out an age-matched case-control study among adults. Hypertension was defined according to JNC-VII criteria and eNOS gene polymorphisms were determined by PCR and PCR followed by PCR-RFLP. eNOS intron 4 aa genotype (adjusted OR 6.81; 95% CI 2.29-20.25) and eNOS 894TT genotype (adjusted OR 7.84; 95% CI 2.57-23.96) were associated with the risk of hypertension. Tobacco users (either smoking/chewing or both) with eNOS intron 4 aa genotype (OR 14.00: 95% CI 1.20-163.37), eNOS 894GG genotype (OR 5.56: 95% CI 3.72-8.31), and eNOS T-786C CC genotype (OR 9.00: 95% CI 1.14-71.04) were at an increased risk of hypertension. Similarly a significant gene-environment interaction was observed between individuals consuming alcohol with eNOS intron 4 aa genotype (OR 12.00: 95% CI 1.20-143.73) and eNOS 894GG genotype (OR 1.95: 95% CI 1.35-2.81). The present study identified few susceptible genotypes of the eNOS gene with the risk of hypertension. Moreover, the interactive effects between the environmental factors and the risk of hypertension were dependent on the eNOS genotypes. PMID:25165716

  5. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants[OPEN

    PubMed Central

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-01-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  6. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants.

    PubMed

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-08-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  7. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    PubMed

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers. PMID:22268153

  8. Large-Scale Phylogenetic Classification of Fungal Chitin Synthases and Identification of a Putative Cell-Wall Metabolism Gene Cluster in Aspergillus Genomes

    PubMed Central

    Pacheco-Arjona, Jose Ramon; Ramirez-Prado, Jorge Humberto

    2014-01-01

    The cell wall is a protective and versatile structure distributed in all fungi. The component responsible for its rigidity is chitin, a product of chitin synthase (Chsp) enzymes. There are seven classes of chitin synthase genes (CHS) and the amount and type encoded in fungal genomes varies considerably from one species to another. Previous Chsp sequence analyses focused on their study as individual units, regardless of genomic context. The identification of blocks of conserved genes between genomes can provide important clues about the interactions and localization of chitin synthases. On the present study, we carried out an in silico search of all putative Chsp encoded in 54 full fungal genomes, encompassing 21 orders from five phyla. Phylogenetic studies of these Chsp were able to confidently classify 347 out of the 369 Chsp identified (94%). Patterns in the distribution of Chsp related to taxonomy were identified, the most prominent being related to the type of fungal growth. More importantly, a synteny analysis for genomic blocks centered on class IV Chsp (the most abundant and widely distributed Chsp class) identified a putative cell wall metabolism gene cluster in members of the genus Aspergillus, the first such association reported for any fungal genome. PMID:25148134

  9. Divergent properties and phylogeny of cyanobacterial 5-enol-pyruvyl-shikimate-3-phosphate synthases: evidence for horizontal gene transfer in the Nostocales.

    PubMed

    Forlani, Giuseppe; Bertazzini, Michele; Barillaro, Donatella; Rippka, Rosmarie

    2015-01-01

    As it represents the target of the successful herbicide glyphosate, great attention has been paid to the shikimate pathway enzyme 5-enol-pyruvyl-shikimate-3-phosphate (EPSP) synthase. However, inconsistent results have been reported concerning the sensitivity of the enzyme from cyanobacteria, and consequent inhibitory effects on cyanobacterial growth. The properties of EPSP synthase were investigated in a set of 42 strains representative of the large morphological diversity of these prokaryotes. Publicly available protein sequences were analyzed, and related to enzymatic features. In most cases, the native protein showed an unusual homodimeric composition and a general sensitivity to micromolar doses of glyphosate. By contrast, eight out of 15 Nostocales strains were found to possess a monomeric EPSP synthase, whose activity was inhibited only at concentrations exceeding 1 mM. Sequence analysis showed that these two forms are only distantly related, the latter clustering separately in a clade composed of diverse bacterial phyla. The results are consistent with the occurrence of a horizontal gene transfer event involving an evolutionarily distant organism. Moreover, data suggest that the existence of class I (glyphosate-sensitive) and class II (glyphosate-tolerant) EPSP synthases representing two distinct phylogenetic clades is an oversimplification because of the limited number of analyzed samples. PMID:25229999

  10. Diversity of benzylsuccinate synthase-like (bssA) genes in hydrocarbon-polluted marine sediments suggests substrate-dependent clustering.

    PubMed

    Acosta-González, Alejandro; Rosselló-Móra, Ramon; Marqués, Silvia

    2013-06-01

    The potential of hydrocarbon biodegradation in marine sediments was determined through the detection of a functional biomarker, the bssA gene, coding for benzylsuccinate synthase, the key enzyme of anaerobic toluene degradation. Eight bssA clone libraries (409 sequences) were constructed from polluted sediments affected by the Prestige oil spill in the Atlantic Islands National Park and from hydrocarbon-amended sediment microcosms in Mallorca. The amplified products and database-derived bssA-like sequences grouped into four major clusters, as determined by phylogenetic reconstruction, principal coordinate analysis (PCoA), and a subfamily prediction tool. In addition to the classical bssA sequences that were targeted, we were able to detect sequences homologous to the naphthylmethylsuccinate synthase gene (nmsA) and the alkylsuccinate synthase gene (assA), the bssA homologues for anaerobic 2-methylnaphthalene and alkane degradation, respectively. The detection of bssA-like variants was determined by the persistence and level of pollution in the marine samples. The observed level of gene diversity was lower in the Mallorca sediments, which were dominated by assA-like sequences. In contrast, the Atlantic Islands samples, which were highly contaminated with methylnaphthalene-rich crude oil, showed a high proportion of nmsA-like sequences. Some of the detected genes were phylogenetically related to Deltaproteobacteria communities, previously described as the predominant hydrocarbon degraders at these sites. Differences between all detected bssA-like genes described to date indicate separation between marine and terrestrial sequences and further subgrouping according to taxonomic affiliation. Global analysis suggested that bssA homologues appeared to cluster according to substrate specificity. We observed undetected divergent gene lineages of bssA homologues, which evidence the existence of new degrader groups in these environments. PMID:23563947

  11. Diversity of Benzylsuccinate Synthase-Like (bssA) Genes in Hydrocarbon-Polluted Marine Sediments Suggests Substrate-Dependent Clustering

    PubMed Central

    Acosta-González, Alejandro; Rosselló-Móra, Ramon

    2013-01-01

    The potential of hydrocarbon biodegradation in marine sediments was determined through the detection of a functional biomarker, the bssA gene, coding for benzylsuccinate synthase, the key enzyme of anaerobic toluene degradation. Eight bssA clone libraries (409 sequences) were constructed from polluted sediments affected by the Prestige oil spill in the Atlantic Islands National Park and from hydrocarbon-amended sediment microcosms in Mallorca. The amplified products and database-derived bssA-like sequences grouped into four major clusters, as determined by phylogenetic reconstruction, principal coordinate analysis (PCoA), and a subfamily prediction tool. In addition to the classical bssA sequences that were targeted, we were able to detect sequences homologous to the naphthylmethylsuccinate synthase gene (nmsA) and the alkylsuccinate synthase gene (assA), the bssA homologues for anaerobic 2-methylnaphthalene and alkane degradation, respectively. The detection of bssA-like variants was determined by the persistence and level of pollution in the marine samples. The observed level of gene diversity was lower in the Mallorca sediments, which were dominated by assA-like sequences. In contrast, the Atlantic Islands samples, which were highly contaminated with methylnaphthalene-rich crude oil, showed a high proportion of nmsA-like sequences. Some of the detected genes were phylogenetically related to Deltaproteobacteria communities, previously described as the predominant hydrocarbon degraders at these sites. Differences between all detected bssA-like genes described to date indicate separation between marine and terrestrial sequences and further subgrouping according to taxonomic affiliation. Global analysis suggested that bssA homologues appeared to cluster according to substrate specificity. We observed undetected divergent gene lineages of bssA homologues, which evidence the existence of new degrader groups in these environments. PMID:23563947

  12. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    PubMed

    Rai, Himanshu; Parveen, Farah; Kumar, Sudeep; Kapoor, Aditya; Sinha, Nakul

    2014-01-01

    Several association studies of endothelial nitric oxide synthase (NOS3) gene polymorphisms with respect to coronary artery disease (CAD) have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235), examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a) with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons), followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons) and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons) in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons) and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons) have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons). PMID:25409023

  13. A new quantitative PCR method for the detection of Anaplasma platys in dogs based on the citrate synthase gene.

    PubMed

    da Silva, Claudia B; Pires, Marcus S; Vilela, Joice A R; Peckle, Maristela; da Costa, Renata L; Vitari, Gabriela L V; Santos, Leandro A; Santos, Huarrisson A; Massard, Carlos L

    2016-09-01

    Anaplasma platys is an obligate intracellular bacterium that primarily affects dogs, but it can also infect humans. Our study aimed to standardize a quantitative real-time (q)PCR method using the citrate synthase gene (gltA) as a specific target for A. platys detection in naturally infected dogs. Primers (gltA84F and gltA84R) and probe (PLATYSp) were designed to amplify an 84-bp fragment based on the gltA gene sequences of A. platys available in GenBank. A total of 186 dog blood samples originating from the Brazilian state of Rio de Janeiro were tested by qPCR. Additionally, the same samples were tested by cytology and a nested (n)PCR that targeted the 16S ribosomal DNA to determine the performance of our qPCR method compared to these existing techniques. Among the samples tested with qPCR, 17.2% were considered positive, significantly more than detected by nPCR (14.0%). Under optical microscopy, inclusions were observed in platelets of 25.3% of the samples, and among these samples, only 33.9% were identified as positive for A. platys using qPCR. The qPCR technique proved to be more specific than cytology and to have superior sensitivity to nPCR for detecting A. platys in dogs. The development of this new qPCR method contributes to the advancement of research involving A. platys Furthermore, it can be used to quantify the presence of this bacterium to evaluate the treatment of infected animals, or even as a more sensitive and specific tool for situations indicating possible clinical disease but with negative cytology. PMID:27423737

  14. Methylenetetrahydrofolate reductase and methionine synthase reductase gene polymorphisms and protection from microvascular complications in adolescents with type 1 diabetes.

    PubMed

    Wiltshire, Esko J; Mohsin, Fauzia; Chan, Albert; Donaghue, Kim C

    2008-08-01

    Folate status has been associated with endothelial dysfunction in adolescents with type 1 diabetes, and elevated total plasma homoocyst(e)ine (tHcy) is a risk for vascular disease in the non-diabetic population. Polymorphisms in genes involved in folate and homocysteine metabolism are implicated in vascular disease. We aimed to determine whether polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes are risk factors for early microvascular disease in a large group of adolescents with type 1 diabetes. Four hundred and eighty adolescents were screened annually for retinopathy and microalbuminuria for a median of 4 yr. Molecular analysis for the polymorphisms 677C-->T, 1298A-->C in MTHFR, and 66A-->G in MTRR was performed. The MTRR 66GG genotype reduced the risk for elevated albumin excretion rate (AER) (OR 0.47, CI 0.25, 0.88, p = 0.018) and showed a trend to reduced risk for microalbuminuria (OR 0.27, CI 0.06-1.21, p = 0.09). Survival without elevated AER was increased with the MTRR 66GG genotype (12.4 vs. 9.7 yr, p = 0.04) and with the MTHFR 1298CC genotype (15.2 vs. 10.2 yr, p = 0.007). Conversely, survival without retinopathy was reduced with the MTHFR 677TT and MTRR 66GG combined genotype (6.2 vs. 10.2 yr, p = 0.015). The MTRR 66GG and MTHFR 1298 CC genotypes may confer protection against early nephropathy, possibly because they are associated with lower tHcy. The MTHFR 677 TT was only related to earlier onset retinopathy in combination with MTRR 66GG. PMID:18774994

  15. Promoter Polymorphisms in the Nitric Oxide Synthase 3 Gene Are Associated With Ischemic Stroke Susceptibility in Young Black Women

    PubMed Central

    Howard, Timothy D.; Giles, Wayne H.; Xu, Jianfeng; Wozniak, Marcella A.; Malarcher, Ann M.; Lange, Leslie A.; Macko, Richard F.; Basehore, Monica J.; Meyers, Deborah A.; Cole, John W.; Kittner, Steven J.

    2006-01-01

    Background and Purpose Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. Methods We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (−1468 T>A, −922 G>A, −786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Results Significant associations with both the −922 G>A and −786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the −922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the −786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D′=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Conclusion Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women. PMID:16100023

  16. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328.

    PubMed

    Kirimura, Kohtaro; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-05-13

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr_8_2: 2978617-2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni(2+)-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. PMID:27060547

  17. The role of the erythroid-specific delta-aminolevulinate synthase gene expression in erythroid heme synthesis.

    PubMed

    Meguro, K; Igarashi, K; Yamamoto, M; Fujita, H; Sassa, S

    1995-08-01

    Using antisense technology, the effects of suppressed gene expression of the erythroid-specific delta-aminolevulinate (ALA) synthase (ALAS-E) on heme synthesis, expression of mRNAs encoding an erythroid-specific transcription factor NF-E2, other heme pathway enzymes, and beta-globin were examined in murine erythroleukemia (MEL) cells. In MEL cells in which an antisense ALAS-E RNA was expressed (AS clone), sense ALAS-E mRNA levels in both untreated and dimethylsulfoxide (DMSO)-treated cells were decreased compared with their respective controls. Heme synthesis in AS clones was decreased in proportion to the suppressed levels of ALAS-E mRNA. In addition, mRNAs for ALA dehydratase, porphobilinogen deaminase, ferrochelatase (FeC), and beta-globin were also decreased in AS clones. There was a strong correlation between the level of ALAS-E mRNA and most of the mRNAs of the heme pathway enzymes and beta-globin. There was a decrease in the mRNA level of p45, but not of mafK, which are the large and the small subunits of NF-E2, respectively, in AS clones. Treatment of AS cells with hemin and ALA in the presence of DMSO partially restored the suppressed mRNA levels for beta-globin and FeC and heme content, respectively. These findings thus indicate that heme formation, which is determined by the level of ALAS-E, plays an essential role on gene expression of many proteins necessary for erythroid development. PMID:7620186

  18. [Cloning of flavone synthase (FNSII) gene and expression in three cell lines of Saussurea medusa].

    PubMed

    Wang, Bingjie; Li, Houhua; Wang, Yajie; Gaol, Yan; Fu, Wany; Weil, Xincui

    2015-12-01

    Saussurea medusa is a rare traditional Chinese medicinal herb, of which luteolin is the niain active medicinal compound for cancer prevention and treatment. A full-length FNSII gene, namely SmFNSII (GenBank Accession No. KF170286), was obtained from green cell line of Saussurea medusa by RT-PCR and RACE-PCR. Sequence analysis indicated that SmFNSII is 1 710 bp in full length, containing a 34 bp 5'-untranslated region (5'-UTR), a 125 bp 3'-UTR, and a 1 551 bp open reading frame (ORF) encoding 516 amino acid residues. Amino acid sequence analysis indicated that SmFNSII belonged to subfamily CYP93B of plant cytochrome P450. Sequence alignment and phylogenetic analysis revealed that amino acid sequences of SmFNSII shared 87% homology with the protein in Hieracium pilosella. Quantitative real-time PCR analysis indicated that SmFNSII expression is the highest in red cell line and the lowest in white cell line, corresponding to quantitative analysis of luteolin concentration. pET-SmFNSII, a prokaryotic expression recombinant plasmid, was constructed and transferred into Escherichia coli, and the expressed protein band was the same size with predicted protein. Saussurea medusa cultivars with high anti-inflammatory, anti-cancer activities and health care function would be cultivated through filtering cell lines and plants with high expression level of FNSII gene and luteolin accumulation. PMID:27093835

  19. Angelica Sinensis Polysaccharides Stimulated UDP-Sugar Synthase Genes through Promoting Gene Expression of IGF-1 and IGF1R in Chondrocytes: Promoting Anti-Osteoarthritic Activity

    PubMed Central

    Wen, Yinxian; Li, Jing; Tan, Yang; Qin, Jun; Xie, Xianfei; Wang, Linlong; Mei, Qibing; Wang, Hui; Magdalou, Jacques; Chen, Liaobin

    2014-01-01

    Background Osteoarthritis (OA) is a chronic joints disease characterized by progressive degeneration of articular cartilage due to the loss of cartilage matrix. Previously, we found, for the first time, that an acidic glycan from Angelica Sinensis Polysaccharides (APSs), namely the APS-3c, could protect rat cartilage from OA due to promoting glycosaminoglycan (GAG) synthesis in chondrocytes. In the present work, we tried to further the understanding of ASP-3c’s anti-OA activity. Methodology/Principal Findings Human primary chondrocytes were treated with APS-3c or/and recombinant human interleukin 1β (IL-1β). It turned out that APS-3c promoted synthesis of UDP-xylose and GAG, as well as the gene expression of UDP-sugar synthases (USSs), insulin like growth factor 1 (IGF1) and IGF1 receptor (IGF1R), and attenuated the degenerative phenotypes, suppressed biosynthesis of UDP-sugars and GAG, and inhibited the gene expression of USSs, IGF1 and IGF1R induced by IL-1β. Then, we induced a rat OA model with papain, and found that APS-3c also stimulated GAG synthesis and gene expression of USSs, IGF1 and IGF1R in vivo. Additionally, recombinant human IGF1 and IGF1R inhibitor NP-AEW541 were applied to figure out the correlation between stimulated gene expression of USSs, IGF1 and IGF1R induced by APS-3c. It tuned out that the promoted GAG synthesis and USSs gene expression induced by APS-3c was mediated by the stimulated IGF1 and IGF1R gene expression, but not through directly activation of IGF1R signaling pathway. Conclusions/Significances We demonstrated for the first time that APS-3c presented anti-OA activity through stimulating IGF-1 and IGF1R gene expression, but not directly activating the IGF1R signaling pathway, which consequently promoted UDP-sugars and GAG synthesis due to up-regulating gene expression of USSs. Our findings presented a better understanding of APS-3c’s anti-OA activity and suggested that APS-3c could potentially be a novel therapeutic agent

  20. Potential for Quantifying Expression of the Geobacteraceae Citrate Synthase Gene To Assess the Activity of Geobacteraceae in the Subsurface and on Current-Harvesting Electrodes

    PubMed Central

    Holmes, Dawn E.; Nevin, Kelly P.; O'Neil, Regina A.; Ward, Joy E.; Adams, Lorrie A.; Woodard, Trevor L.; Vrionis, Helen A.; Lovley, Derek R.

    2005-01-01

    The Geobacteraceae citrate synthase is phylogenetically distinct from those of other prokaryotes and is a key enzyme in the central metabolism of Geobacteraceae. Therefore, the potential for using levels of citrate synthase mRNA to estimate rates of Geobacter metabolism was evaluated in pure culture studies and in four different Geobacteraceae-dominated environments. Quantitative reverse transcription-PCR studies with mRNA extracted from cultures of Geobacter sulfurreducens grown in chemostats with Fe(III) as the electron acceptor or in batch with electrodes as the electron acceptor indicated that transcript levels of the citrate synthase gene, gltA, increased with increased rates of growth/Fe(III) reduction or current production, whereas the expression of the constitutively expressed housekeeping genes recA, rpoD, and proC remained relatively constant. Analysis of mRNA extracted from groundwater collected from a U(VI)-contaminated site undergoing in situ uranium bioremediation revealed a remarkable correspondence between acetate levels in the groundwater and levels of transcripts of gltA. The expression of gltA was also significantly greater in RNA extracted from groundwater beneath a highway runoff recharge pool that was exposed to calcium magnesium acetate in June, when acetate concentrations were high, than in October, when the levels had significantly decreased. It was also possible to detect gltA transcripts on current-harvesting anodes deployed in freshwater sediments. These results suggest that it is possible to monitor the in situ metabolic rate of Geobacteraceae by tracking the expression of the citrate synthase gene. PMID:16269721

  1. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters.

    PubMed

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  2. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    PubMed Central

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  3. Engineering the robustness of Saccharomyces cerevisiae by introducing bifunctional glutathione synthase gene.

    PubMed

    Qiu, Zhiqi; Deng, Zujun; Tan, Hongming; Zhou, Shining; Cao, Lixiang

    2015-04-01

    Robust, high-yielding Saccharomyces cerevisiae is highly desirable for cost-effective cellulosic ethanol production. In this study, the bifunctional glutathione (GSH) synthetase genes GCSGS at high copy number was integrated into ribosomal DNA of S. cerevisiae by Cre-LoxP system. Threefold higher GSH contents (54.9 μmol/g dry weight) accumulated in the engineered strain BY-G compared to the reference strain. Tolerance of BY-G to H2O2 (3 mM), temperature (40 °C), furfural (10 mM), hydroxymethylfurfural (HMF, 10 mM) and 0.5 mM Cd(2+) increased compared to reference strain. Twofold higher ethanol concentration was obtained by BY-G in simultaneous saccharification and fermentation of corn stover compared to the reference strain. The results showed that intracellular GSH content of S. cerevisiae has an influence on robustness. The strategy is used to engineer S. cerevisiae strains adaptive to a combination of tolerance to inhibitors and raised temperature that may occur in high solid simultaneous saccharification and fermentation of lignocellulosic feedstocks. PMID:25561319

  4. Expression of potato S-adenosyl-L-methionine synthase (SbSAMS) gene altered developmental characteristics and stress responses in transgenic Arabidopsis plants.

    PubMed

    Kim, Sun Hee; Kim, Sang Hyon; Palaniyandi, Sasikumar Arunachalam; Yang, Seung Hwan; Suh, Joo-Won

    2015-02-01

    S-adenosyl-L-methionine (SAM) synthase (SAMS) catalyze the biosynthesis of SAM, which is a precursor for ethylene and polyamines, and a methyl donor for a number of biomolecules. A full-length cDNA of SAMS from Solanum brevidens was expressed in Arabidopsis thaliana to study its physiological function. RT-PCR analysis showed that SbSAMS expression was enhanced significantly in S. brevidens leaves upon treatment with salt, mannitol, ethephon, IAA and ABA. The transgenic SbSAMS overexpression lines accumulated higher levels S-adenosyl homocysteine (SAHC) and ethylene concomitantly with increased SAM level. Expression levels of genes related to ethylene biosynthesis such as ACC synthase, but not polyamine biosynthesis genes were enhanced in SbSAMS overexpressing Arabidopsis lines. In addition, ABA responsive, wound and pathogen-inducible genes were upregulated in SbSAMS transgenic Arabidopsis plants. Transgenic Arabidopsis lines exhibited higher salt and drought stress tolerance compared to those of vector control. Based on these results we conclude that SbSAMS is expressed under abiotic stress to produce SAM as a broad-spectrum signal molecule to upregulate stress-related genes including ethylene and ABA biosynthetic pathway genes responsible for ABA, pathogen and wound responses. PMID:25559387

  5. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    PubMed Central

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-01-01

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley – Cer-c, Cer-q and Cer-u – known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. PMID:26962211

  6. Differential Expression of Biphenyl Synthase Gene Family Members in Fire-Blight-Infected Apple ‘Holsteiner Cox’ 1[W][OA

    PubMed Central

    Chizzali, Cornelia; Gaid, Mariam M.; Belkheir, Asma K.; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-01-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple ‘Golden Delicious’, nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple ‘Holsteiner Cox,’ heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple ‘Cox Orange,’ expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  7. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars

    PubMed Central

    Chizzali, Cornelia; Swiddan, Asya K.; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C.; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in ‘Harrow Sweet’, while only PcBIS2 transcripts were detected in ‘Alexander Lucas’ and ‘Conference’. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of ‘Harrow Sweet’, whereas the concentrations were ten times lower in ‘Conference’ and not even detectable in ‘Alexander Lucas’. In ‘Harrow Sweet’, the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of ‘Alexander Lucas’ and ‘Conference’ advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  8. Nitric oxide synthase inhibitors can antagonize neurogenic and calcitonin gene-related peptide induced dilation of dural meningeal vessels

    PubMed Central

    Akerman, S; Williamson, D J; Kaube, H; Goadsby, P J

    2002-01-01

    The detailed pathophysiology of migraine is beginning to be understood and is likely to involve activation of trigeminovascular afferents. Clinically effective anti-migraine compounds are believed to have actions that include peripheral inhibition of calcitonin gene-related peptide (CGRP) release from trigeminal neurones, or preventing dural vessel dilation, or both. CGRP antagonists can block both neurogenic and CGRP-induced dural vessel dilation. Nitric oxide (NO) can induce headache in migraine patients and often triggers a delayed migraine. The initial headache is thought to be caused via a direct action of the NO–cGMP pathway that causes vasodilation by vascular smooth muscle relaxation, while the delayed headache is likely to be a result of triggering trigeminovascular activation. Nitric oxide synthase (NOS) inhibitors are effective in the treatment of acute migraine. The present studies used intravital microscopy to examine the effects of specific NOS inhibitors on neurogenic dural vasodilation (NDV) and CGRP-induced dilation. The non-specific and neuronal NOS (nNOS) inhibitors were able to partially inhibit NDV, while the non-specific and endothelial NOS (eNOS) inhibitors were able to partially inhibit the CGRP induced dilation. There was no effect of the inducible NOS (iNOS) inhibitor. The data suggest that the delayed headache response triggered by NO donors in humans may be due, in part, to increased nNOS activity in the trigeminal system that causes CGRP release and dural vessel dilation. Further, eNOS activity in the endothelium causes NO production and smooth muscle relaxation by direct activation of the NO–cGMP pathway, and may be involved in the initial headache response. PMID:12183331

  9. In vivo gene transfer of endothelial nitric oxide synthase decreases portal pressure in anaesthetised carbon tetrachloride cirrhotic rats

    PubMed Central

    Van de Casteele, M; Omasta, A; Janssens, S; Roskams, T; Desmet, V; Nevens, F; Fevery, J

    2002-01-01

    Background: Portal hypertension in cirrhosis results from enhanced intrahepatic resistance to an augmented inflow. The former is partly due to an imbalance between intrahepatic vasoconstriction and vasodilatation. Enhanced endothelin-1 and decreased activity of hepatic constitutive endothelial nitric oxide synthase (NOS 3) was reported in carbon tetrachloride (CCl4) cirrhotic rat liver. Aims: To study whether an increase in hepatic NOS 3 could be obtained in the CCl4 cirrhotic rat liver by in vivo cDNA transfer and to investigate a possible effect on portal pressure. Methods: Hepatic NOS 3 immunohistochemistry and western blotting were used to measure the amount of NOS 3 protein. Recombinant adenovirus, carrying cDNA encoding human NOS 3, was injected into the portal vein of CCl4 cirrhotic rats. Cirrhotic controls received carrier buffer, naked adenovirus, or adenovirus carrying the lac Z gene. Results: NOS 3 immunoreactivity and amount of protein (western blotting) were significantly decreased in CCl4 cirrhotic livers. Following cDNA transfer, NOS 3 expression and the amount of protein were partially restored. Portal pressure was 11.4 (1.6) mm Hg in untreated cirrhotic (n=9) and 11.8 (0.6) in lac Z transfected (n=4) cirrhotic rats but was reduced to 7.8 (1.0) mm Hg (n=9) five days after NOS 3 cDNA transfer. No changes were observed in systemic haemodynamics, in liver tests or urinary nitrates, or in NOS 3 expression in lung or kidney, indicating a highly selective transfer. Conclusions: NOS 3 cDNA transfer to cirrhotic rat liver is feasible and the increase in hepatic NOS 3 leads to a marked decrease in portal hypertension without systemic effects. These data indicate a major haemodynamic role of intrahepatic NOS 3 in the pathogenesis of portal hypertension in CCl4 cirrhosis. PMID:12171971

  10. Inhibition of the expression of the starch synthase II gene leads to lower pasting temperature in sweetpotato starch.

    PubMed

    Takahata, Yasuhiro; Tanaka, Masaru; Otani, Motoyasu; Katayama, Kenji; Kitahara, Kanefumi; Nakayachi, Osamu; Nakayama, Hiroki; Yoshinaga, Masaru

    2010-06-01

    The sweetpotato cultivar Quick Sweet (QS) with a lower pasting temperature of starch is a unique breeding material, but the biochemical background of this property has been unknown. To assess the physiological impact of the reduced isoform II activity of starch synthase (SSII) on the starch properties in sweetpotato storage root, transgenic sweetpotato plants with reduced expressions of the SSII gene were generated and evaluated. All of the starches from transgenic plants showed lower pasting temperatures and breakdown measured by a Rapid Visco Analyzer. The pasting temperatures in transgenic plants were approximately 10-15 degrees C lower than in wild-type plants. Distribution of the amylopectin chain length of the transgenic lines showed marked differences compared to that in wild-type plants: more chains with degree of polymerization (DP) 6-11 and fewer chains with DP 13-25. The starch granules from the storage root of transgenic plants showed cracking on the hilum, while those from wild-type plants appeared to be typical sweetpotato starch. In accordance with these observations, the expression of SSII in the storage roots of the sweetpotato cultivar with low pasting temperature starch (QS) was notably lower than in cultivars with normal starch. Moreover, nucleotide sequence analysis suggested that most of the SSII transcripts in the cultivar with low pasting temperature starch were inactive alleles. These results clearly indicate that the activity of SSII in sweetpotato storage roots, like those in other plants, affects the pasting properties of starch through alteration of the amylopectin structure. PMID:20306051

  11. Jinggangmycin increases fecundity of the brown planthopper, Nilaparvata lugens (Stål) via fatty acid synthase gene expression.

    PubMed

    Li, Lei; Jiang, Yiping; Liu, Zongyu; You, Linlin; Wu, You; Xu, Bing; Ge, Linquan; Stanley, David; Song, Qisheng; Wu, Jincai

    2016-01-01

    The antibiotic jinggangmycin (JGM) is mainly used in controlling the rice sheath blight, Rhizoctonia solani, in China. JGM also enhances reproduction of the brown planthopper (BPH), Nilaparvata lugens (Stål). To date, however, molecular mechanisms of the enhancement are unclear. Our related report documented the influence of foliar JGM sprays on ovarian protein content. Here, we used isobaric tags for relative and absolute quantitation (iTRAQ) protocols to analyze ovarian proteins of BPH females following JGM spray (JGM-S) and topical application (JGM-T). We recorded changes in expression of 284 proteins (142↑ and 142↓) in JGM-S compared to the JGM-S control group (S-control); 267 proteins were differentially expressed (130↑ and 137↓) in JGM-T compared to the JGM-T control group (T-control), of which, 22 proteins were up-regulated in both groups. Comparing the JGM-S to the JGM-T group, 114 proteins were differentially expressed (62↑ and 52↓). Based on the biological significance of fatty acids, pathway annotation and enrichment analysis, we designed a dsRNA construct to silence a gene encoding fatty acid synthase (FAS). FAS was more highly expressed in JGM-S vs S-control and JGM-S vs JGM-T groups. The dsFAS treatment reduced fecundity by about 46% and reduced ovarian and fat body fatty acid concentrations in JGM-S-treated females relative to controls. We infer FAS provides critically needed fatty acids to support JGM-enhanced fecundity in BPH. PMID:26388431

  12. Associations between nitric oxide synthase 3 gene polymorphisms and preeclampsia risk: a meta-analysis

    PubMed Central

    Zeng, Fangfang; Zhu, Sui; Wong, Martin Chi-Sang; Yang, Zuyao; Tang, Jinling; Li, Keshen; Su, Xuefen

    2016-01-01

    Previous studies have examined the role of three NOS3 gene polymorphisms [G894T, T-786C, and the variable number of tandem repeats 4b/a (VNTR 4b/a)] in the susceptibility to preeclampsia with inconclusive findings. We therefore conducted an updated meta-analysis by including more studies. The most appropriate genetic model was chosen for each polymorphism by using a well-established method. Pooled results indicated that, compared with the GT + GG genotype, the TT genotype of G894T was associated with an increased risk of preeclampsia (odds ratio (OR) = 1.46; 95% confidence interval (CI) = 1.21–1.77, P < 0.001; I2 = 40.2%). The CC genotype of T-786C was also associated with a higher risk of preeclampsia (OR = 1.30; 95% CI = 1.07–1.58, P = 0.034; I2 = 46.9%) than the CT + TT genotype. No association was found for VNTR 4b/a. Stratified analysis indicated that the increased risk was evident for high-quality studies both for G894T and T-786C, and for studies conducted among Caucasians and Africans for T-786C. However, the increased risk for T-786C among Africans needs further confirmation due to the high probability of false-positive reports. Our results suggested that G894T and T-786C polymorphisms, but not VNTR 4b/a, were associated with an increased risk of preeclampsia. PMID:26997284

  13. Identification and characteristics of the structural gene for the Drosophila eye colour mutant sepia, encoding PDA synthase, a member of the omega class glutathione S-transferases.

    PubMed

    Kim, Jaekwang; Suh, Hyunsuk; Kim, Songhee; Kim, Kiyoung; Ahn, Chiyoung; Yim, Jeongbin

    2006-09-15

    The eye colour mutant sepia (se1) is defective in PDA {6-acetyl-2-amino-3,7,8,9-tetrahydro-4H-pyrimido[4,5-b]-[1,4]diazepin-4-one or pyrimidodiazepine} synthase involved in the conversion of 6-PTP (2-amino-4-oxo-6-pyruvoyl-5,6,7,8-tetrahydropteridine; also known as 6-pyruvoyltetrahydropterin) into PDA, a key intermediate in drosopterin biosynthesis. However, the identity of the gene encoding this enzyme, as well as its molecular properties, have not yet been established. Here, we identify and characterize the gene encoding PDA synthase and show that it is the structural gene for sepia. Based on previously reported information [Wiederrecht, Paton and Brown (1984) J. Biol. Chem. 259, 2195-2200; Wiederrecht and Brown (1984) J. Biol. Chem. 259, 14121-14127; Andres (1945) Drosoph. Inf. Serv. 19, 45; Ingham, Pinchin, Howard and Ish-Horowicz (1985) Genetics 111, 463-486; Howard, Ingham and Rushlow (1988) Genes Dev. 2, 1037-1046], we isolated five candidate genes predicted to encode GSTs (glutathione S-transferases) from the presumed sepia locus (region 66D5 on chromosome 3L). All cloned and expressed candidates exhibited relatively high thiol transferase and dehydroascorbate reductase activities and low activity towards 1-chloro-2,4-dinitrobenzene, characteristic of Omega class GSTs, whereas only CG6781 catalysed the synthesis of PDA in vitro. The molecular mass of recombinant CG6781 was estimated to be 28 kDa by SDS/PAGE and 56 kDa by gel filtration, indicating that it is a homodimer under native conditions. Sequencing of the genomic region spanning CG6781 revealed that the se1 allele has a frameshift mutation from 'AAGAA' to 'GTG' at nt 190-194, and that this generates a premature stop codon. Expression of the CG6781 open reading frame in an se1 background rescued the eye colour defect as well as PDA synthase activity and drosopterins content. The extent of rescue was dependent on the dosage of transgenic CG6781. In conclusion, we have discovered a new catalytic

  14. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    PubMed Central

    Zhou, Tao; Komaki, Hisayuki; Ichikawa, Natsuko; Hosoyama, Akira; Sato, Seizo; Igarashi, Yasuhiro

    2015-01-01

    The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS) domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides. PMID:25603349

  15. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms with Coronary Artery Disease: An Updated Meta-Analysis and Systematic Review

    PubMed Central

    Parveen, Farah; Kapoor, Aditya; Sinha, Nakul

    2014-01-01

    Several association studies of endothelial nitric oxide synthase (NOS3) gene polymorphisms with respect to coronary artery disease (CAD) have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235), examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27bp VNTR b/a) with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28–1.52, and P<0.00001 for all comparisons), followed by T786-C (OR range = 1.34–1.42, and P<0.00001 for all comparisons) and 4b/a, (OR range = 1.19–1.41, and P≤0.002 for all comparisons) in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54–1.87, and P<0.004 for all comparisons) and 4b/a (OR range = 1.71–3.02, and P<0.00001 for all comparisons) have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61–1.90, and P≤0.01 for all comparisons). PMID:25409023

  16. Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase

    PubMed Central

    Sellem, Carole H.; di Rago, Jean-Paul; Lasserre, Jean-Paul; Ackerman, Sharon H.; Sainsard-Chanet, Annie

    2016-01-01

    Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO) of the ATP synthase drive the rotation of a ring of 8–15 c-subunits, which induces conformational changes in the catalytic part (F1) of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary) cells while Atp9-5 is expressed in the cells at the extremity (apex) of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before. PMID:27442014

  17. Sensitivity of Aspergillus nidulans to the cellulose synthase inhibitor dichlobenil: insights from wall-related genes' expression and ultrastructural hyphal morphologies.

    PubMed

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Salerno, Marco; Pum, Dietmar; Strauss, Joseph

    2013-01-01

    The fungal cell wall constitutes an important target for the development of antifungal drugs, because of its central role in morphogenesis, development and determination of fungal-specific molecular features. Fungal walls are characterized by a network of interconnected glycoproteins and polysaccharides, namely α-, β-glucans and chitin. Cell walls promptly and dynamically respond to environmental stimuli by a signaling mechanism, which triggers, among other responses, modulations in wall biosynthetic genes' expression. Despite the absence of cellulose in the wall of the model filamentous fungus Aspergillus nidulans, we found in this study that fungal growth, spore germination and morphology are affected by the addition of the cellulose synthase inhibitor dichlobenil. Expression analysis of selected genes putatively involved in cell wall biosynthesis, carried out at different time points of drug exposure (i.e. 0, 1, 3, 6 and 24 h), revealed increased expression for the putative mixed linkage β-1,3;1,4 glucan synthase celA together with the β-1,3-glucan synthase fksA and the Rho-related GTPase rhoA. We also compared these data with the response to Congo Red, a known plant/fungal drug affecting both chitin and cellulose biosynthesis. The two drugs exerted different effects at the cell wall level, as shown by gene expression analysis and the ultrastructural features observed through atomic force microscopy and scanning electron microscopy. Although the concentration of dichlobenil required to affect growth of A. nidulans is approximately 10-fold higher than that required to inhibit plant cellulose biosynthesis, our work for the first time demonstrates that a cellulose biosynthesis inhibitor affects fungal growth, changes fungal morphology and expression of genes connected to fungal cell wall biosynthesis. PMID:24312197

  18. Stable transformation of Toxoplasma gondii based on a pyrimethamine resistant trifunctional dihydrofolate reductase-cytosine deaminase-thymidylate synthase gene that confers sensitivity to 5-fluorocytosine.

    PubMed

    Fox, B A; Belperron, A A; Bzik, D J

    1999-01-01

    To improve genetic models available for the analysis of apicomplexan protozoan parasites, bacterial sequences encoding the 427 amino acid cytosine deaminase (CD) gene were fused, in-frame, to an engineered linker domain of the high level pyrimethamine resistant form of the parasite bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene. Toxoplasma gondii was transformed with the plasmid containing the fused pyrimethamine resistant dihydrofolate reductase-cytosine deaminase-thymidylate synthase (DHFRm2m3-CD-TS) gene and parasites were selected in a high level of pyrimethamine. Transfected parasites that acquired resistance to pyrimethamine were cloned and evaluated for expression of the CD genetic marker. CD transgenic parasites acquired a high sensitivity to 5-fluorocytosine due to the intraparasitic conversion of this non-toxic prodrug to the cytotoxic compound 5-fluorouracil. Exogenously supplied cytosine or uracil rescued the growth of CD transgenic T. gondii parasites that were cultured in the presence of cytotoxic concentrations of 5-fluorouracil or 5-fluorocytosine. Bacterial CD fused to the pyrimethamine resistant DHFR-TS marker provides a novel genetic tool for new positive and negative genetic selection strategies in several protozoan parasites. An advantage of the CD genetic marker is that it is derived from a bacterial gene and can therefore be used in nearly any parasite genetic background for negative selection. This novel system should facilitate new approaches for the development of improved model genetic systems for the biological investigation of apicomplexan parasites. PMID:10029312

  19. A novel family of integrases associated with prophages and genomic islands integrated within the tRNA-dihydrouridine synthase A (dusA) gene.

    PubMed

    Farrugia, Daniel N; Elbourne, Liam D H; Mabbutt, Bridget C; Paulsen, Ian T

    2015-05-19

    Genomic islands play a key role in prokaryotic genome plasticity. Genomic islands integrate into chromosomal loci such as transfer RNA genes and protein coding genes, whilst retaining various cargo genes that potentially bestow novel functions on the host organism. A gene encoding a putative integrase was identified at a single site within the 5' end of the dusA gene in the genomes of over 200 bacteria. This integrase was discovered to be a component of numerous genomic islands, which appear to share a target site within the dusA gene. dusA encodes the tRNA-dihydrouridine synthase A enzyme, which catalyses the post-transcriptional reduction of uridine to dihydrouridine in tRNA. Genomic islands encoding homologous dusA-associated integrases were found at a much lower frequency within the related dusB and dusC genes, and non-dus genes. Excision of these dusA-associated islands from the chromosome as circularized intermediates was confirmed by polymerase chain reaction. Analysis of the dusA-associated islands indicated that they were highly diverse, with the integrase gene representing the only universal common feature. PMID:25883135

  20. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    SciTech Connect

    Lee, G.L.; Astrin, K.H.; Desnick, R.J.

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  1. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers

    PubMed Central

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K.; Müller, Carsten T.; Rosati, Carlo; Rogers, Hilary J.

    2012-01-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar ‘Sweet Laura’ is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. ‘Sweet Laura’ with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. ‘Sweet Laura’ and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. ‘Sweet Laura’ placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R28(R)X8W and D321DXXD are the putative Mg2+-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. ‘Sweet Laura’ flowers. PMID:22268153

  2. Construction of a genomic DNA library with a TA vector and its application in cloning of the phytoene synthase gene from the cyanobacterium Spirulina platensis M-135

    NASA Astrophysics Data System (ADS)

    Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima

    1998-03-01

    An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.

  3. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae).

    PubMed

    Xiong, Ke-Cai; Wang, Jia; Li, Jia-Hao; Deng, Yu-Qing; Pu, Po; Fan, Huan; Liu, Ying-Hong

    2016-01-01

    Trehalose is the major blood sugar in insects, which plays a crucial role as an instant source of energy and the starting substrate for chitin biosynthesis. In insects, trehalose is synthesized by catalysis of an important enzyme, trehalose-6-phosphate synthase (TPS). In the present study, a trehalose-6-phosphate synthase gene from Bactrocera minax (BmTPS) was cloned and characterized. BmTPS contained an open reading frame of 2445 nucleotides encoding a protein of 814 amino acids with a predicted molecular weight of 92.05kDa. BmTPS was detectable in all developmental stages of Bactrocera minax and expressed higher in the final- (third-) instar larvae. Tissue-specific expression patterns of BmTPS showed that it was mainly expressed in the fat body. The 20-hydroxyecdysone (20E) induced the expression of BmTPS and three genes in the chitin biosynthesis pathway. Moreover, injection of double-stranded RNA into third-instar larvae successfully silenced the transcription of BmTPS in B. minax, and thereby decreased the activity of TPS and trehalose content. Additionally, silencing of BmTPS inhibited the expression of three key genes in the chitin biosynthesis pathway and exhibited 52% death and abnormal phenotypes. The findings demonstrate that BmTPS is indispensable for larval-pupal metamorphosis. Besides, the establishment of RNAi experimental system in B. minax would lay a solid foundation for further investigation of molecular biology and physiology of this pest. PMID:27405007

  4. Ethylene Biosynthesis in Detached Young Persimmon Fruit Is Initiated in Calyx and Modulated by Water Loss from the Fruit1

    PubMed Central

    Nakano, Ryohei; Ogura, Emi; Kubo, Yasutaka; Inaba, Akitsugu

    2003-01-01

    Persimmon (Diospyros kaki Thunb.) fruit are usually classified as climacteric fruit; however, unlike typical climacteric fruits, persimmon fruit exhibit a unique characteristic in that the younger the stage of fruit detached, the greater the level of ethylene produced. To investigate ethylene induction mechanisms in detached young persimmon fruit, we cloned three cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (DK-ACS1, 2, and -3) and two encoding ACC oxidase (DK-ACO1 and -2) genes involved in ethylene biosynthesis, and we analyzed their expression in various fruit tissues. Ethylene production was induced within a few days of detachment in all fruit tissues tested, accompanied by temporally and spatially coordinated expression of all the DK-ACS and DK-ACO genes. In all tissues except the calyx, treatment with 1-methylcyclopropene, an inhibitor of ethylene action, suppressed ethylene production and ethylene biosynthesis-related gene expression. In the calyx, one ACC synthase gene (DK-ACS2) exhibited increased mRNA accumulation accompanied by a large quantity of ethylene production, and treatment of the fruit with 1-methylcyclopropene did not prevent either the accumulation of DK-ACS2 transcripts or ethylene induction. Furthermore, the alleviation of water loss from the fruit significantly delayed the onset of ethylene production and the expression of DK-ACS2 in the calyx. These results indicate that ethylene biosynthesis in detached young persimmon fruit is initially induced in calyx and is modulated by water loss through transcriptional activation of DK-ACS2. The ethylene produced in the calyx subsequently diffuses to other fruit tissues and acts as a secondary signal that stimulates autocatalytic ethylene biosynthesis in these tissues, leading to a burst of ethylene production. PMID:12529535

  5. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  6. Cloning and characterization of homeologous cellulose synthase catalytic subunit 2 genes from allotetraploid cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cellulose synthase catalytic subunits (CesAs) are the catalytic sites within a multisubunit complex for cellulose biosynthesis in plants. CesAs have been extensively studied in diploid plants, but are not well characterized in polyploid plants. Gossypium hirsutum is an allotetraploid cotton specie...

  7. Genetic polymorphisms in nitric oxide synthase genes modify the relationship between vegetable and fruit intake and risk of non-Hodgkin lymphoma

    PubMed Central

    Han, Xuesong; Zheng, Tongzhang; Lan, Qing; Zhang, Yaqun; Kilfoy, Briseis A.; Qin, Qin; Rothman, Nathaniel; Zahm, Shelia H.; Holford, Theodore R.; Leaderer, Brian; Zhang, Yawei

    2010-01-01

    Oxidative damage caused by reactive oxygen species (ROS) and other free radicals is involved in carcinogenesis. It has been suggested that high vegetable and fruit intake may reduce the risk of non-Hodgkin lymphoma (NHL) as vegetables and fruit are rich in antioxidants. The aim of this study is to evaluate the interaction of vegetable and fruit intake with genetic polymorphisms in oxidative stress pathway genes and NHL risk. This hypothesis was investigated in a population-based case-control study of NHL and NHL histological subtype in Connecticut women including 513 histologically confirmed incident cases and 591 randomly selected controls. Gene-vegetable/fruit joint effects were estimated using unconditional logistic regression model. The false discovery rate method was applied to adjust for multiple comparisons. Significant interactions with vegetable and fruit intake were mainly found for genetic polymorphisms on nitric oxide synthase (NOS) genes among those with diffuse large B-cell lymphoma (DLBCL) and Follicular lymphoma (FL). Two single nucleotide polymorphisms (SNPs) in the NOS1 gene were found to significantly modify the association between total vegetable and fruit intake and risk of NHL overall, as well as the risk of follicular lymphoma (FL). When vegetables, bean vegetables, cruciferous vegetables, green leafy vegetables, red vegetables, yellow/orange vegetables, fruit, and citrus fruit were examined separately, strong interaction effects were narrowed to vegetable intake among DLBCL patients. Our results suggest that genetic polymorphisms in oxidative stress pathway genes, especially in the nitric oxide synthase genes, modify the association between vegetable and fruit intake and risk of NHL. PMID:19423521

  8. An Arabidopsis callose synthase.

    PubMed

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole; Mundy, John

    2002-08-01

    Beta-1,3-glucan polymers are major structural components of fungal cell walls, while cellulosic beta-1,4-glucan is the predominant polysaccharide in plant cell walls. Plant beta-1,3-glucan, called callose, is produced in pollen and in response to pathogen attack and wounding, but it has been unclear whether callose synthases can also produce cellulose and whether plant cellulose synthases may also produce beta-1,3-glucans. We describe here an Arabidopsis gene, AtGsl5, encoding a plasma membrane-localized protein homologous to yeast beta-1,3-glucan synthase whose expression partially complements a yeast beta-1,3-glucan synthase mutant. AtGsl5 is developmentally expressed at highest levels in flowers, consistent with flowers having high beta-1,3-glucan synthase activities for deposition of callose in pollen. A role for AtGsl5 in callose synthesis is also indicated by AtGsl5 expression in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant. PMID:12081364

  9. Complete genome sequence of Kibdelosporangium phytohabitans KLBMP 1111(T), a plant growth promoting endophytic actinomycete isolated from oil-seed plant Jatropha curcas L.

    PubMed

    Qin, Sheng; Feng, Wei-Wei; Xing, Ke; Bai, Juan-Luan; Yuan, Bo; Liu, Wei-Jie; Jiang, Ji-Hong

    2015-12-20

    Kibdelosporangium phytohabitans KLBMP 1111(T) is a plant growth promoting endophytic actinomycete isolated from the oil-seed plant Jatropha curcas L. collected from dry-hot valley, in Sichuan, China. The complete genome sequence of this actinomycete consists of one chromosome (11,759,770bp) with no plasmid. From the geno