Science.gov

Sample records for 1-aminocyclopropane-1-carboxylate synthase gene

  1. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    PubMed Central

    Zhu, Jia-Hong; Xu, Jing; Chang, Wen-Jun; Zhang, Zhi-Li

    2015-01-01

    Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7) of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment.These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production. PMID:25690030

  2. Differential expression of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits

    SciTech Connect

    Olson, D.C.; White, J.A.; Edelman, L.; Kende, H. ); Harkins, R.N. )

    1991-06-15

    1-Aminocyclopropane-1-carboxylate synthase is the regulated enzyme in the biosynthetic pathway of the plant hormone ethylene. A full-length cDNA encoding this enzyme has been cloned from tomato fruits. The authors report here the complete nucleotide and derived amino acid sequences of a cDNA encoding a second isoform of ACC synthase from tomato fruits. The cDNAs coding for both isoforms contain highly conserved regions that are surrounded by regions of low homology, especially at the 5{prime} and 3{prime} ends. Gene-specific probes were constructed to examine the expression of transcripts encoding the two ACC synthase isoforms under two conditions of enhanced ethylene formation--namely, during fruit ripening and in response to mechanical stress (wounding). The level of mRNA encoding both isoforms, ACC synthase 1 and 2, increased during ripening. In contrast, wounding caused an increase in only the level of mRNA coding for ACC synthase 1. Blot analysis of genomic DNA digested with restriction enzymes confirmed that ACC synthase 1 and 2 are encoded by different genes.

  3. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    PubMed

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. PMID:26839981

  4. Molecular cloning and expression analysis of an 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    PubMed

    Shi, Le-Song; Liu, Jin-Ping

    2016-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) is a rate-limiting enzyme in the biosynthesis of ethylene which regulates many aspects of the plant development and responses to biotic and abiotic stresses. In this study, a full-length cDNA of ACC synthase, OnACS2, was cloned from the senescing flower of Oncidium Gower Ramsey by RACE. The full-length cDNA of OnACS2 (GenBank accession no. JQ822087) was 1557 bp in length with an open reading frame (ORF) of 1308 bp encoding for a protein of 435 amino acid residues. The predicted OnACS2 protein had a molecular mass of 49.1 kDa with pI value of 7.51. Phylogenetic analysis indicated its evolutionary relationships with corresponding orthologous sequences in orchids, Hosta ventricosa and monocots. Real-time PCR assay demonstrated that OnACS2 was constitutively expressed in all tested organs with the highest transcript level in the gynandria. Differential expression pattern of OnACS2 gene correlated to the ethylene production and the subsequent occurrence of senescent symptoms in flower suggested that OnACS2 probably played an important role in the initiation of flower senescence. PMID:26631967

  5. Identification of a 1-aminocyclopropane-1-carboxylic acid synthase gene linked to the female (F) locus that enhances female sex expression in cucumber.

    PubMed Central

    Trebitsh, T; Staub, J E; O'Neill, S D

    1997-01-01

    Sex determination in cucumber (Cucumis sativus L.) is controlled largely by three genes: F, m, and a. The F and m loci interact to produce monoecious (M_f_) or gynoecious (M_f_) sex phenotypes. Ethylene and factors that induce ethylene biosynthesis, such as 1-aminocyclopropane-1-carboxylate (ACC) and auxin, also enhance female sex expression. A genomic sequence (CS-ACS1) encoding ACC synthase was amplified from genomic DNA by a polymerase chain reaction using degenerate oligonucleotide primers. Expression of CS-ACS1 is induced by auxin, but not by ACC, in wounded and intact shoot apices. Southern blo hybridization analysis of near-isogenic gynoecious (MMFF) and monoecious (MMff) lines derived from divers genetic backgrounds revealed the existence of an additional ACC synthase (CS-ACS1G) genomic sequence in the gynoecious lines. Sex phenotype analysis of a segregating F2 population detected a 100% correlation between the CS-ACS1G marker and the presence of the F locus. The CS-ACS1G gene is located in linkage group B coincident with the F locus, and in the population tested there was no recombination between the CS-ACS1G gene and the F locus. Collectively, these data suggest that CS-ACS1G is closely linked to the F locus and may play a pivotal role in the determination of sex in cucumber flowers. PMID:9085580

  6. Differential Expression of 1-Aminocyclopropane-1-Carboxylate Synthase Genes during Orchid Flower Senescence Induced by the Protein Phosphatase Inhibitor Okadaic Acid1

    PubMed Central

    Wang, Ning Ning; Yang, Shang Fa; Charng, Yee-yung

    2001-01-01

    Applying 10 pmol of okadaic acid (OA), a specific inhibitor of type 1 or type 2A serine/threonine protein phosphatases, to the orchid (Phalaenopsis species) stigma induced a dramatic increase in ethylene production and an accelerated senescence of the whole flower. Aminoethoxyvinylglycine or silver thiosulfate, inhibitors of ethylene biosynthesis or action, respectively, effectively inhibited the OA-induced ethylene production and retarded flower senescence, suggesting that the protein phosphatase inhibitor induced orchid flower senescence through an ethylene-mediated signaling pathway. OA treatment induced a differential expression pattern for the 1-aminocyclopropane-1-carboxylic acid synthase multigene family. Accumulation of Phal-ACS1 transcript in the stigma, labelum, and ovary induced by OA were higher than those induced by pollination as determined by “semiquantitative” reverse transcriptase-polymerase chain reaction. In contrast, the transcript levels of Phal-ACS2 and Phal-ACS3 induced by OA were much lower than those induced by pollination. Staurosporine, a protein kinase inhibitor, on the other hand, inhibited the OA-induced Phal-ACS1 expression in the stigma and delayed flower senescence. Our results suggest that a hyper-phosphorylation status of an unidentified protein(s) is involved in up-regulating the expression of Phal-ACS1 gene resulting in increased ethylene production and accelerated the senescence process of orchid flower. PMID:11351088

  7. Differential Expression and Internal Feedback Regulation of 1-Aminocyclopropane-1-Carboxylate Synthase, 1-Aminocyclopropane-1-Carboxylate Oxidase, and Ethylene Receptor Genes in Tomato Fruit during Development and Ripening1

    PubMed Central

    Nakatsuka, Akira; Murachi, Shiho; Okunishi, Hironori; Shiomi, Shinjiro; Nakano, Ryohei; Kubo, Yasutaka; Inaba, Akitsugu

    1998-01-01

    We investigated the feedback regulation of ethylene biosynthesis in tomato (Lycopersicon esculentum) fruit with respect to the transition from system 1 to system 2 ethylene production. The abundance of LE-ACS2, LE-ACS4, and NR mRNAs increased in the ripening fruit concomitant with a burst in ethylene production. These increases in mRNAs with ripening were prevented to a large extent by treatment with 1-methylcyclopropene (MCP), an ethylene action inhibitor. Transcripts for the LE-ACS6 gene, which accumulated in preclimacteric fruit but not in untreated ripening fruit, did accumulate in ripening fruit treated with MCP. Treatment of young fruit with propylene prevented the accumulation of transcripts for this gene. LE-ACS1A, LE-ACS3, and TAE1 genes were expressed constitutively in the fruit throughout development and ripening irrespective of whether the fruit was treated with MCP or propylene. The transcripts for LE-ACO1 and LE-ACO4 genes already existed in preclimacteric fruit and increased greatly when ripening commenced. These increases in LE-ACO mRNA with ripening were also prevented by treatment with MCP. The results suggest that in tomato fruit the preclimacteric system 1 ethylene is possibly mediated via constitutively expressed LE-ACS1A and LE-ACS3 and negatively feedback-regulated LE-ACS6 genes with preexisting LE-ACO1 and LE-ACO4 mRNAs. At the onset of the climacteric stage, it shifts to system 2 ethylene, with a large accumulation of LE-ACS2, LE-ACS4, LE-ACO1, and LE-ACO4 mRNAs as a result of a positive feedback regulation. This transition from system 1 to system 2 ethylene production might be related to the accumulated level of NR mRNA. PMID:9847103

  8. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress.

    PubMed

    Datta, Riddhi; Kumar, Deepak; Sultana, Asma; Hazra, Saptarshi; Bhattacharyya, Dipto; Chattopadhyay, Sharmila

    2015-12-01

    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress.

  9. Expression characteristics of CS-ACS1, CS-ACS2 and CS-ACS3, three members of the 1-aminocyclopropane-1-carboxylate synthase gene family in cucumber (Cucumis sativus L.) fruit under carbon dioxide stress.

    PubMed

    Mathooko, F M; Mwaniki, M W; Nakatsuka, A; Shiomi, S; Kubo, Y; Inaba, A; Nakamura, R

    1999-02-01

    We investigated the expression pattern of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes, CS-ACS1, CS-ACS2 and CS-ACS3 in cucumber (Cucumis sativus L.) fruit under CO2 stress. CO2 stress-induced ethylene production paralleled the accumulation of only CS-ACS1 transcripts which disappeared upon withdrawal of CO2. Cycloheximide inhibited the CO2 stress-induced ethylene production but superinduced the accumulation of CS-ACS1 transcript. At higher concentrations, cycloheximide also induced the accumulation of CS-ACS2 and CS-ACS3 transcripts. In the presence of CO2 and cycloheximide, the accumulation of CS-ACS2 transcript occurred within 1 h, disappeared after 3 h and increased greatly upon withdrawal of CO2. Inhibitors of protein kinase and types 1 and 2A protein phosphatases which inhibited and stimulated, respectively, CO2 stress-induced ethylene production had little effect on the expression of these genes. The results presented here identify CS-ACS1 as the main ACC synthase gene responsible for the increased ethylene biosynthesis in cucumber fruit under CO2 stress and suggest that this gene is a primary response gene and its expression is under negative control since it is expressed by treatment with cycloheximide. The results further suggest that the regulation of CO2 stress-induced ethylene biosynthesis by reversible protein phosphorylation does not result from enhanced ACC synthase transcription. PMID:10202812

  10. Expression and regulation of pear 1-aminocyclopropane-1-carboxylic acid synthase gene (PpACS1a) during fruit ripening, under salicylic acid and indole-3-acetic acid treatment, and in diseased fruit.

    PubMed

    Shi, Hai-Yan; Zhang, Yu-Xing

    2014-06-01

    In plants, the level of ethylene is determined by the activity of the key enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS). A gene encoding an ACC synthase protein was isolated from pear (Pyrus pyrifolia). This gene designated PpACS1a (GenBank accession no. KC632526) was 1488 bp in length with an open reading frame (ORF) encoding a protein of 495 amino acids that shared high similarity with other pear ACC synthase proteins. The PpACS1a was grouped into type-1 subfamily of plant ACS based on its conserved domain and phylogenetic status. Real-time quantitative PCR indicated that PpACS1a was differentially expressed in pear tissues and predominantly expressed in anthers. The expression signal of PpACS1a was also detected in fruit and leaves, but no signal was detected in shoots and petals. Furthermore, the PpACS1a expression was regulated during fruit ripening. In addition, the PpACS1a gene expression was regulated by salicylic acid (SA) and indole-3-acetic acid (IAA) in fruit. Moreover, the expression of the PpACS1a was up-regulated in diseased pear fruit. These results indicated that PpACS1a might be involved in fruit ripening and response to SA, IAA and disease.

  11. The female-specific Cs-ACS1G gene of cucumber. A case of gene duplication and recombination between the non-sex-specific 1-aminocyclopropane-1-carboxylate synthase gene and a branched-chain amino acid transaminase gene.

    PubMed

    Knopf, Ronit Rimon; Trebitsh, Tova

    2006-09-01

    Cucumber (Cucumis sativus L.) is a monoecious plant in which female sex expression (gynoecy) is controlled by the Female (F) locus that can be modified by other sex-determining genes as well as by environmental and hormonal factors. As in many other cucurbits, ethylene is the major plant hormone regulating female sex expression. Previously we isolated the Cs-ACS1 (ACS, 1-aminocyclopropane-1-carboxylate synthase) gene that encodes the rate-limiting enzyme in the ethylene biosynthetic pathway. We proposed that Cs-ACS1 is present in a single copy in monoecious (ffMM) plants whereas gynoecious plants (FFMM) contain an additional copy Cs-ACS1G that was mapped to the F locus. To study the origin of Cs-ACS1G, we cloned and analyzed both the gynoecious-specific Cs-ACS1G gene and the non-sex-specific Cs-ACS1 gene. Our results indicate that Cs-ACS1G is the result of a relatively recent gene duplication and recombination, between Cs-ACS1 and a branched-chain amino acid transaminase (BCAT) gene. Taking into consideration that the Cs-ACS1G gene was mapped to the F locus, we propose that this duplication event gave rise to the F locus and to gynoecious cucumber plants. Computer analysis of the 1 kb region upstream of the transcription initiation site revealed several putative cis-acting regulatory elements that can potentially confer the responsiveness of Cs-ACS1G to developmental and hormonal factors and thereby control female sex determination in cucumber. These findings lead us to a model explaining the action of Cs-ACS1 and Cs-ACS1G in cucumber floral sex determination. PMID:16887844

  12. Analysis of genomic DNA of DcACS1, a 1-aminocyclopropane-1-carboxylate synthase gene, expressed in senescing petals of carnation (Dianthus caryophyllus) and its orthologous genes in D. superbus var. longicalycinus.

    PubMed

    Harada, Taro; Murakoshi, Yuino; Torii, Yuka; Tanase, Koji; Onozaki, Takashi; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru

    2011-04-01

    Carnation (Dianthus caryophyllus) flowers exhibit climacteric ethylene production followed by petal wilting, a senescence symptom. DcACS1, which encodes 1-aminocyclopropane-1-carboxylate synthase (ACS), is a gene involved in this phenomenon. We determined the genomic DNA structure of DcACS1 by genomic PCR. In the genome of 'Light Pink Barbara', we found two distinct nucleotide sequences: one corresponding to the gene previously shown as DcACS1, designated here as DcACS1a, and the other novel one designated as DcACS1b. It was revealed that both DcACS1a and DcACS1b have five exons and four introns. These two genes had almost identical nucleotide sequences in exons, but not in some introns and 3'-UTR. Analysis of transcript accumulation revealed that DcACS1b is expressed in senescing petals as well as DcACS1a. Genomic PCR analysis of 32 carnation cultivars showed that most cultivars have only DcACS1a and some have both DcACS1a and DcACS1b. Moreover, we found two DcACS1 orthologous genes with different nucleotide sequences from D. superbus var. longicalycinus, and designated them as DsuACS1a and DsuACS1b. Petals of D. superbus var. longicalycinus produced ethylene in response to exogenous ethylene, accompanying accumulation of DsuACS1 transcripts. These data suggest that climacteric ethylene production in flowers was genetically established before the cultivation of carnation.

  13. Ethylene-Enhanced 1-Aminocyclopropane-1-carboxylic Acid Synthase Activity in Ripening Apples 1

    PubMed Central

    Bufler, Gebhard

    1984-01-01

    Apples (Malus sylvestris Mill, cv Golden Delicious) were treated before harvest with aminoethoxyvinylglycine (AVG). AVG is presumed to reversibly inhibit 1-aminocyclopropane-1-carboxylic acid (ACC) activity, but not the formation of ACC synthase. AVG treatment effectively blocked initiation of autocatalytic ethylene production and ripening of harvested apples. Exogenous ethylene induced extractable ACC synthase activity and ripening in AVG-treated apples. Removal of exogenous ethylene caused a rapid decline in ACC synthase activity and in CO2 production. The results with ripened, AVG-treated apples indicate (a) a dose-response relationship between ethylene and enhancement of ACC synthase activity with a half-maximal response at approximately 0.8 μl/l ethylene; (b) reversal of ethylene-enhanced ACC synthase activity by CO2; (c) enhancement of ACC synthase activity by the ethylene-activity analog propylene. Induction of ACC synthase activity, autocatalytic ethylene production, and ripening of preclimacteric apples not treated with AVG were delayed by 6 and 10% CO2, but not by 1.25% CO2. However, each of these CO2 concentrations reduced the rate of increase of ACC synthase activity. PMID:16663569

  14. Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase

    SciTech Connect

    Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F. ); Kenny, J.W.; Thompson, G.A. )

    1990-10-01

    The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB{sup 3}H{sub 4} or Ado({sup 14}C)Met. Peptide sequencing of both {sup 3}H- and {sup 14}C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the {sup 3}H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the {sup 14}C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado ({sup 14}C)Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6.

  15. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress1[OPEN

    PubMed Central

    Kumar, Deepak; Hazra, Saptarshi; Chattopadhyay, Sharmila

    2015-01-01

    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress. PMID:26463088

  16. Increased 1-aminocyclopropane-1-carboxylate deaminase activity enhances Agrobacterium tumefaciens-mediated gene delivery into plant cells

    PubMed Central

    Someya, Tatsuhiko; Nonaka, Satoko; Nakamura, Kouji; Ezura, Hiroshi

    2013-01-01

    Agrobacterium-mediated transformation is a useful tool for the genetic modification in plants, although its efficiency is low for several plant species. Agrobacterium-mediated transformation has three major steps in laboratory-controlled experiments: the delivery of T-DNA into plant cells, the selection of transformed plant cells, and the regeneration of whole plants from the selected cells. Each of these steps must be optimized to improve the efficiency of Agrobacterium-mediated plant transformation. It has been reported that increasing the number of cells transformed by T-DNA delivery can improve the frequency of stable transformation. Previously, we demonstrated that a reduction in ethylene production by plant cells during cocultivation with A. tumefaciens-expressing 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase resulted in increased T-DNA delivery into the plant cells. In this study, to further improve T-DNA delivery by A. tumefaciens, we modified the expression cassette of the ACC deaminase gene using vir gene promoter sequences. The ACC deaminase gene driven by the virD1 promoter was expressed at a higher level, resulting in a higher ACC deaminase activity in this A. tumefaciens strain than in the strain with the lac promoter used in a previous study. The newly developed A. tumefaciens strain improves the delivery of T-DNA into Solanum lycopersicum (tomato) and Erianthus ravennae plants and thus may be a powerful tool for the Agrobacterium-mediated genetic engineering of plants. PMID:24000136

  17. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  18. An insight into the sequential, structural and phylogenetic properties of banana 1-aminocyclopropane-1-carboxylate synthase 1 and study of its interaction with pyridoxal-5'-phosphate and aminoethoxyvinylglycine.

    PubMed

    Choudhury, Swarup Roy; Singh, Sanjay Kumar; Roy, Sujit; Sengupta, Dibyendu N

    2010-06-01

    In banana, ethylene production for ripening is accompanied by a dramatic increase in 1-aminocyclopropane-1-carboxylate (ACC) content, transcript level of Musa acuminata ACC synthase 1 (MA-ACS1) and the enzymatic activity of ACC synthase 1 at the onset of the climacteric period. MA-ACS1 catalyses the conversion of S-adenosyl-L-methionine (SAM) to ACC, the key regulatory step in ethylene biosynthesis. Multiple sequence alignments of 1-aminocyclopropane-1-carboxylate synthase (ACS) amino acid sequences based on database searches have indicated that MA-ACS1 is a highly conserved protein across the plant kingdom. This report describes an in silico analysis to provide the first important insightful information about the sequential, structural and phylogenetic characteristics of MA-ACS1. The three-dimensional structure of MA-ACS1, constructed based on homology modelling, in combination with the available data enabled a comparative mechanistic analysis of MA-ACS1 to explain the catalytic roles of the conserved and non-conserved active site residues. We have further demonstrated that, as in apple and tomato, banana- ACS1 (MA-ACS1) forms a homodimer and a complex with cofactor pyridoxal-5'-phosphate (PLP) and inhibitor aminoethoxyvinylglycine (AVG). We have also predicted that the residues from the PLP-binding pocket, essential for ligand binding, are mostly conserved across the MA-ACS1 structure and the competitive inhibitor AVG binds at a location adjacent to PLP. PMID:20689184

  19. An insight into the sequential, structural and phylogenetic properties of banana 1-aminocyclopropane-1-carboxylate synthase 1 and study of its interaction with pyridoxal-5'-phosphate and aminoethoxyvinylglycine.

    PubMed

    Choudhury, Swarup Roy; Singh, Sanjay Kumar; Roy, Sujit; Sengupta, Dibyendu N

    2010-06-01

    In banana, ethylene production for ripening is accompanied by a dramatic increase in 1-aminocyclopropane-1-carboxylate (ACC) content, transcript level of Musa acuminata ACC synthase 1 (MA-ACS1) and the enzymatic activity of ACC synthase 1 at the onset of the climacteric period. MA-ACS1 catalyses the conversion of S-adenosyl-L-methionine (SAM) to ACC, the key regulatory step in ethylene biosynthesis. Multiple sequence alignments of 1-aminocyclopropane-1-carboxylate synthase (ACS) amino acid sequences based on database searches have indicated that MA-ACS1 is a highly conserved protein across the plant kingdom. This report describes an in silico analysis to provide the first important insightful information about the sequential, structural and phylogenetic characteristics of MA-ACS1. The three-dimensional structure of MA-ACS1, constructed based on homology modelling, in combination with the available data enabled a comparative mechanistic analysis of MA-ACS1 to explain the catalytic roles of the conserved and non-conserved active site residues. We have further demonstrated that, as in apple and tomato, banana- ACS1 (MA-ACS1) forms a homodimer and a complex with cofactor pyridoxal-5'-phosphate (PLP) and inhibitor aminoethoxyvinylglycine (AVG). We have also predicted that the residues from the PLP-binding pocket, essential for ligand binding, are mostly conserved across the MA-ACS1 structure and the competitive inhibitor AVG binds at a location adjacent to PLP.

  20. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.

    PubMed

    Tucker, Mark L; Xue, Ping; Yang, Ronghui

    2010-01-01

    Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

  1. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  2. Gibberellic Acid, Synthetic Auxins, and Ethylene Differentially Modulate α-l-Arabinofuranosidase Activities in Antisense 1-Aminocyclopropane-1-Carboxylic Acid Synthase Tomato Pericarp Discs1

    PubMed Central

    Sozzi, Gabriel O.; Greve, L. Carl; Prody, Gerry A.; Labavitch, John M.

    2002-01-01

    α-l-Arabinofuranosidases (α-Afs) are plant enzymes capable of releasing terminal arabinofuranosyl residues from cell wall matrix polymers, as well as from different glycoconjugates. Three different α-Af isoforms were distinguished by size exclusion chromatography of protein extracts from control tomatoes (Lycopersicon esculentum) and an ethylene synthesis-suppressed (ESS) line expressing an antisense 1-aminocyclopropane-1-carboxylic synthase transgene. α-Af I and II are active throughout fruit ontogeny. α-Af I is the first Zn-dependent cell wall enzyme isolated from tomato pericarp tissues, thus suggesting the involvement of zinc in fruit cell wall metabolism. This isoform is inhibited by 1,10-phenanthroline, but remains stable in the presence of NaCl and sucrose. α-Af II activity accounts for over 80% of the total α-Af activity in 10-d-old fruit, but activity drops during ripening. In contrast, α-Af III is ethylene dependent and specifically active during ripening. α-Af I released monosaccharide arabinose from KOH-soluble polysaccharides from tomato cell walls, whereas α-Af II and III acted on Na2CO3-soluble pectins. Different α-Af isoform responses to gibberellic acid, synthetic auxins, and ethylene were followed by using a novel ESS mature-green tomato pericarp disc system. α-Af I and II activity increased when gibberellic acid or 2,4-dichlorophenoxyacetic acid was applied, whereas ethylene treatment enhanced only α-Af III activity. Results suggest that tomato α-Afs are encoded by a gene family under differential hormonal controls, and probably have different in vivo functions. The ESS pericarp explant system allows comprehensive studies involving effects of physiological levels of different growth regulators on gene expression and enzyme activity with negligible wound-induced ethylene production. PMID:12114586

  3. Gibberellic acid, synthetic auxins, and ethylene differentially modulate alpha-L-Arabinofuranosidase activities in antisense 1-aminocyclopropane-1-carboxylic acid synthase tomato pericarp discs.

    PubMed

    Sozzi, Gabriel O; Greve, L Carl; Prody, Gerry A; Labavitch, John M

    2002-07-01

    Alpha-L-Arabinofuranosidases (alpha-Afs) are plant enzymes capable of releasing terminal arabinofuranosyl residues from cell wall matrix polymers, as well as from different glycoconjugates. Three different alpha-Af isoforms were distinguished by size exclusion chromatography of protein extracts from control tomatoes (Lycopersicon esculentum) and an ethylene synthesis-suppressed (ESS) line expressing an antisense 1-aminocyclopropane-1-carboxylic synthase transgene. alpha-Af I and II are active throughout fruit ontogeny. alpha-Af I is the first Zn-dependent cell wall enzyme isolated from tomato pericarp tissues, thus suggesting the involvement of zinc in fruit cell wall metabolism. This isoform is inhibited by 1,10-phenanthroline, but remains stable in the presence of NaCl and sucrose. alpha-Af II activity accounts for over 80% of the total alpha-Af activity in 10-d-old fruit, but activity drops during ripening. In contrast, alpha-Af III is ethylene dependent and specifically active during ripening. alpha-Af I released monosaccharide arabinose from KOH-soluble polysaccharides from tomato cell walls, whereas alpha-Af II and III acted on Na(2)CO(3)-soluble pectins. Different alpha-Af isoform responses to gibberellic acid, synthetic auxins, and ethylene were followed by using a novel ESS mature-green tomato pericarp disc system. alpha-Af I and II activity increased when gibberellic acid or 2,4-dichlorophenoxyacetic acid was applied, whereas ethylene treatment enhanced only alpha-Af III activity. Results suggest that tomato alpha-Afs are encoded by a gene family under differential hormonal controls, and probably have different in vivo functions. The ESS pericarp explant system allows comprehensive studies involving effects of physiological levels of different growth regulators on gene expression and enzyme activity with negligible wound-induced ethylene production.

  4. The Effect of Ethylene and Propylene Pulses on Respiration, Ripening Advancement, Ethylene-Forming Enzyme, and 1-Aminocyclopropane-1-carboxylic Acid Synthase Activity in Avocado Fruit.

    PubMed

    Starrett, D A; Laties, G G

    1991-03-01

    When early-season avocado fruit (Persea americana Mill. cv Hass) were treated with ethylene or propylene for 24 hours immediately on picking, the time to the onset of the respiratory climacteric, i.e. the lag period, remained unchanged compared with that in untreated fruit. When fruit were pulsed 24 hours after picking, on the other hand, the lag period was shortened. In both cases, however, a 24 hour ethylene or propylene pulse induced a transient increase in respiration, called the pulse-peak, unaccompanied by ethylene production (IL Eaks [1980] Am Soc Hortic Sci 105: 744-747). The pulse also caused a sharp rise in ethylene-forming enzyme activity in both cases, without any increase in the low level of 1-aminocyclopropane-1-carboxylic acid synthase activity. Thus, the shortening of the lag period by an ethylene pulse is not due to an effect of ethylene on either of the two key enzymes in ethylene biosynthesis. A comparison of two-dimensional polyacrylamide gel electrophoresis polypeptide profiles of in vitro translation products of poly(A(+)) mRNA from control and ethylene-pulsed fruit showed both up- and down-regulation in response to ethylene pulsing of a number of genes expressed during the ripening syndrome. It is proposed that the pulse-peak or its underlying events reflect an intrinsic element in the ripening process that in late-season or continuously ethylene-treated fruit may be subsumed in the overall climacteric response. A computerized system that allows continuous readout of multiple samples has established that the continued presentation of exogeneous ethylene or propylene to preclimacteric fruit elicits a dual respiration response comprising the merged pulse-peak and climacteric peak in series. The sequential removal of cores from a single fruit has proven an unsatisfactory sampling procedure inasmuch as coring induces wound ethylene, evokes a positive respiration response, and advances ripening.

  5. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  6. An auxin-responsive 1-aminocyclopropane-1-carboxylate synthase is responsible for differential ethylene production in gravistimulated Antirrhinum majus L. flower stems.

    PubMed

    Woltering, Ernst J; Balk, Peter A; Nijenhuis-Devries, Mariska A; Faivre, Marilyne; Ruys, Gerda; Somhorst, Dianne; Philosoph-Hadas, Sonia; Friedman, Haya

    2005-01-01

    The regulation of gravistimulation-induced ethylene production and its role in gravitropic bending was studied in Antirrhinum majus L. cut flower stems. Gravistimulation increased ethylene production in both lower and upper halves of the stems with much higher levels observed in the lower half. Expression patterns of three different 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) genes, an ACC oxidase (ACO) and an ethylene receptor (ETR/ERS homolog) gene were studied in the bending zone of gravistimulated stems and in excised stem sections following treatment with different chemicals. One of the ACS genes (Am-ACS3) was abundantly expressed in the bending zone cortex at the lower side of the stems within 2 h of gravistimulation. Am-ACS3 was not expressed in vertical stems or in other parts of (gravistimulated) stems, leaves or flowers. Am-ACS3 was strongly induced by indole-3-acetic acid (IAA) but not responsive to ethylene. The Am-ACS3 expression pattern strongly suggests that Am-ACS3 is responsible for the observed differential ethylene production in gravistimulated stems; its responsiveness to IAA suggests that Am-ACS3 expression reflects changes in auxin signalling. Am-ACS1 also showed increased expression in gravistimulated and IAA-treated stems although to a much lesser extent than Am-ACS3. In contrast to Am-ACS3, Am-ACS1 was also expressed in non-bending regions of vertical and gravistimulated stems and in leaves, and Am-ACS1 expression was not confined to the lower side cortex but evenly distributed over the diameter of the stem. Am-ACO and Am-ETR/ERS expression was increased in both the lower and upper halves of gravistimulated stems. Expression of both Am-ACO and Am-ETR/ERS was responsive to ethylene, suggesting regulation by IAA-dependent differential ethylene production. Am-ACO expression and in vivo ACO activity, in addition, were induced by IAA, independent of the IAA-induced ethylene. IAA-induced growth of vertical stem sections and bending of

  7. RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

    2014-06-19

    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  8. A Ser/Thr protein kinase phosphorylates MA-ACS1 (Musa acuminata 1-aminocyclopropane-1-carboxylic acid synthase 1) during banana fruit ripening.

    PubMed

    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N

    2012-08-01

    1-Aminocyclopropane-1-carboxylic acid synthase (ACS) catalyzes the rate-limiting step in ethylene biosynthesis during ripening. ACS isozymes are regulated both transcriptionally and post-translationally. However, in banana, an important climacteric fruit, little is known about post-translational regulation of ACS. Here, we report the post-translational modification of MA-ACS1 (Musa acuminata ACS1), a ripening inducible isozyme in the ACS family, which plays a key role in ethylene biosynthesis during banana fruit ripening. Immunoprecipitation analyses of phospholabeled protein extracts from banana fruit using affinity-purified anti-MA-ACS1 antibody have revealed phosphorylation of MA-ACS1, particularly in ripe fruit tissue. We have identified the induction of a 41-kDa protein kinase activity in pulp at the onset of ripening. The 41-kDa protein kinase has been identified as a putative protein kinase by MALDI-TOF/MS analysis. Biochemical analyses using partially purified protein kinase fraction from banana fruit have identified the protein kinase as a Ser/Thr family of protein kinase and its possible involvement in MA-ACS1 phosphorylation during ripening. In vitro phosphorylation analyses using synthetic peptides and site-directed mutagenized recombinant MA-ACS1 have revealed that serine 476 and 479 residues at the C-terminal region of MA-ACS1 are phosphorylated. Overall, this study provides important novel evidence for in vivo phosphorylation of MA-ACS1 at the molecular level as a possible mechanism of post-translational regulation of this key regulatory protein in ethylene signaling pathway in banana fruit during ripening. PMID:22419220

  9. Expression of an exogenous 1-aminocyclopropane-1-carboxylate deaminase gene in Mesorhizobium spp. reduces the negative effects of salt stress in chickpea.

    PubMed

    Brígido, Clarisse; Nascimento, Francisco X; Duan, Jin; Glick, Bernard R; Oliveira, Solange

    2013-12-01

    Our goal was to study the symbiotic performance of two Mesorhizobium ciceri strains, transformed with an exogenous 1-aminocyclopropane-1-carboxylate deaminase gene (acdS), in chickpea plants under salinity stress. The EE-7 (salt-sensitive) and G-55 (salt-tolerant) M. ciceri strains were transformed with an acdS gene present on plasmid pRKACC. Salinity significantly reduced the overall growth of plants inoculated with either wild-type strains. Although the growth of plants inoculated with either salt-sensitive or salt-tolerant strain was reduced under salinity, the salt-tolerant strain showed a higher ability to nodulate chickpea under salt stress compared with the salt-sensitive strain. The shoot dry weight was significantly higher in plants inoculated with the acdS-transformed salt-sensitive strain compared with the plants inoculated with the native strain in the presence of salt. The negative effects of salt stress were also reduced in nodulation when using acdS-transformed strains in comparison with the wild-type strains. Interestingly, by expressing the exogenous acdS gene, the salt-sensitive strain was able to induce nodules in the same extent as the salt-tolerant strain. Although preliminary, these results suggest that genetic modification of a Mesorhizobium strain can improve its symbiotic performance under salt stress and indicate that ACC deaminase can play an important role in facilitating plant-rhizobium interaction under salinity conditions.

  10. Expression of an exogenous 1-aminocyclopropane-1-carboxylate deaminase gene in psychrotolerant bacteria modulates ethylene metabolism and cold induced genes in tomato under chilling stress.

    PubMed

    Subramanian, Parthiban; Krishnamoorthy, Ramasamy; Chanratana, Mak; Kim, Kiyoon; Sa, Tongmin

    2015-04-01

    The role of stress induced ethylene under low temperature stress has been controversial and hitherto remains unclear. In the present study, 1-aminocyclopropane-1-carboxylate deaminase (ACCD) gene, acdS expressing mutant strains were generated from ACCD negative psychrotolerant bacterial strains Flavobacterium sp. OR306 and Pseudomonas frederiksbergensis OS211, isolated from agricultural soil during late winter. After transformation with plasmid pRKACC which contained the acdS gene, both the strains were able to exhibit ACCD activity in vitro. The effect of this ACCD under chilling stress with regards to ethylene was studied in tomato plants inoculated with both acdS expressing and wild type bacteria. On exposing the plants to one week of chilling treatment at 12/10 °C, it was found that stress ethylene, ACC accumulation and ACO activity which are markers of ethylene stress, were significantly reduced in plants inoculated with the acdS gene transformed mutants. In case of plants inoculated with strain OS211-acdS, ethylene emission, ACC accumulation and ACO activity was significantly reduced by 52%, 75.9% and 23.2% respectively compared to uninoculated control plants. Moreover, expression of cold induced LeCBF1 and LeCBF3 genes showed that these genes were significantly induced by the acdS transformed mutants in addition to reduced expression of ethylene-responsive transcription factor 13 (ETF-13) and ACO genes. Induced expression of LeCBF1 and LeCBF3 in plants inoculated with acdS expressing mutants compared to wild type strains show that physiologically evolved stress ethylene and its transcription factors play a role in regulation of cold induced genes as reported earlier in the literature.

  11. Isolation and characterization of a potato cDNA corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene differentially activated by stress.

    PubMed

    Zanetti, María Eugenia; Terrile, María Cecilia; Arce, Débora; Godoy, Andrea Verónica; Segundo, Blanca San; Casalongué, Claudia

    2002-12-01

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase enzyme catalyses the final step in ethylene biosynthesis, converting 1-aminocyclopropane-1-carboxylic acid to ethylene. A cDNA clone encoding an ACC oxidase, ST-ACO3, was isolated from potato (Solanum tuberosum L.) by differential screening of a Fusarium eumartii infected-tuber cDNA library. The deduced amino acid sequence exhibited similarity to other ACC oxidase proteins from several plants species. Northern blot analysis revealed that the ST-ACO3 mRNA level increased in potato tubers upon inoculation with F. eumartii, as well as after treatment with salicylic acid and indole-3-acetic acid, suggesting a cross-talk between different signalling pathways involved in the defence response of potato tubers against F. eumartii attack.

  12. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.

    1999-01-01

    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  13. Tolerance of transgenic canola expressing 1-aminocyclopropane-1-carboxylic acid deaminase to growth inhibition by nickel.

    PubMed

    Stearns, Jennifer C; Shah, Saleh; Greenberg, Bruce M; Dixon, D George; Glick, Bernard R

    2005-07-01

    Plant growth-promoting bacteria are useful to phytoremediation strategies in that they confer advantages to plants in contaminated soil. When plant growth-promoting bacteria contain the enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, the bacterial cell acts as a sink for ACC, the immediate biosynthetic precursor of the plant growth regulator ethylene thereby lowering plant ethylene levels and decreasing the negative effects of various environmental stresses. In an effort to gain the advantages provided by bacterial ACC deaminase in the phytoremediation of metals from the environment two transgenic canola lines with the gene for this enzyme were generated and tested. In these transgenic canola plants, expression of the ACC deaminase gene is driven by either tandem constitutive cauliflower mosaic virus (CaMV) 35S promoters or the root specific rolD promoter from Agrobacterium rhizogenes. Following the growth of transgenic and non-transformed canola in nickel contaminated soil, it was observed that the rolD plants demonstrate significantly increased tolerance to nickel compared to the non-transformed control plants.

  14. New Insights into 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Phylogeny, Evolution and Ecological Significance

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Soares, Cláudio R. F. S.; McConkey, Brendan J.; Glick, Bernard R.

    2014-01-01

    The main objective of this work is the study of the phylogeny, evolution and ecological importance of the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase, the activity of which represents one of the most important and studied mechanisms used by plant growth–promoting microorganisms. The ACC deaminase gene and its regulatory elements presence in completely sequenced organisms was verified by multiple searches in diverse databases, and based on the data obtained a comprehensive analysis was conducted. Strain habitat, origin and ACC deaminase activity were taken into account when analyzing the results. In order to unveil ACC deaminase origin, evolution and relationships with other closely related pyridoxal phosphate (PLP) dependent enzymes a phylogenetic analysis was also performed. The data obtained show that ACC deaminase is mostly prevalent in some Bacteria, Fungi and members of Stramenopiles. Contrary to previous reports, we show that ACC deaminase genes are predominantly vertically inherited in various bacterial and fungal classes. Still, results suggest a considerable degree of horizontal gene transfer events, including interkingdom transfer events. A model for ACC deaminase origin and evolution is also proposed. This study also confirms the previous reports suggesting that the Lrp-like regulatory protein AcdR is a common mechanism regulating ACC deaminase expression in Proteobacteria, however, we also show that other regulatory mechanisms may be present in some Proteobacteria and other bacterial phyla. In this study we provide a more complete view of the role for ACC deaminase than was previously available. The results show that ACC deaminase may not only be related to plant growth promotion abilities, but may also play multiple roles in microorganism's developmental processes. Hence, exploring the origin and functioning of this enzyme may be the key in a variety of important agricultural and biotechnological applications. PMID:24905353

  15. Recent developments in use of 1-aminocyclopropane-1-carboxylate (ACC) deaminase for conferring tolerance to biotic and abiotic stress.

    PubMed

    Gontia-Mishra, Iti; Sasidharan, Shaly; Tiwari, Sharad

    2014-05-01

    Ethylene is an essential plant hormone also known as a stress hormone because its synthesis is accelerated by induction of a variety of biotic and abiotic stress. The plant growth promoting bacteria containing the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase enhances plant growth by decreasing plant ethylene levels under stress conditions. The expression of ACC deaminase (acdS) gene in transgenic plants is an alternative approach to overcome the ethylene-induced stress. Several transgenic plants have been engineered to express both bacterial/plant acdS genes which then lowers the stress-induced ethylene levels, thus efficiently combating the deleterious effects of environmental stresses. This review summarizes the current knowledge of various transgenic plants overexpressing microbial and plant acdS genes and their potential under diverse biotic and abiotic stresses. Transcription regulation mechanism of acdS gene from different bacteria, with special emphasis to nitrogen fixing bacteria is also discussed in this review.

  16. Molecular characterization and expression analysis of 1-aminocyclopropane-1-carboxylate oxidase homologs from potato under abiotic and biotic stresses.

    PubMed

    Nie, Xianzhou; Singh, Rudra P; Tai, George C C

    2002-10-01

    In this work, we report cloning of two full-length 1-aminocyclopropane-1-carboxylate oxidase (ACO) cDNAs (ACO1 and ACO2) from potato (Solanum tuberosum) and their expression in potato tissues. The sequence data indicate that the two cDNAs share a high degree of homology with each other, and with known ACO genes from other plant species, including monocots and dicots. However, these potato genes lack homology at the 5' and 3' ends, despite similarities in their open reading frames and encoded amino acids. Phylogenetic analysis places them in two subfamilies of ACOs. The genes are tissue specific: expression is high in leaves and low in roots and tubers. In sprouts and tubers, ACO1 is induced by heat (40 degrees C) and cold (0 degrees C) stresses, whereas ACO2 is induced only by cold (0 degrees C). ACO1 is markedly induced in leaves by wounding, soil-flooding, and exogenous application of 1-aminocyclopropane-1-carboxylic acid (ACC). In contrast, ACO2 induction is lower under these treatments. ACO1 and ACO2 are regulated very differently in potato leaves with respect to senescence. ACO2 expression is unaffected by senescence, whereas that of ACO1 is closely related to the age and senescence in both attached and detached leaves. Exogenous ACC not only induces ACO1, but also accelerates leaf senescence. ACO1 transcripts are induced significantly in leaves, stems, and tubers in the Potato virus A (PVA)-resistant potato cultivar Shepody when graft inoculated with PVA. PMID:12416623

  17. Ethylene Production and 1-Aminocyclopropane-1-Carboxylic Acid Conjugation in Thermoinhibited Cicer arietinum L. Seeds.

    PubMed

    Gallardo, M; Delgado, M del M; Sánchez-Calle, I M; Matilla, A J

    1991-09-01

    The effect of supraoptimal temperatures (30 degrees C, 35 degrees C) on germination and ethylene production of Cicer arietinum (chick-pea) seeds was measured. Compared with a 25 degrees C control, these temperatures inhibited both germination and ethylene production. The effect of supraoptimal temperatures could be alleviated by treating the seeds with ethylene. It was concluded that one effect of high temperature on germination was due to its negative effect on ethylene production. This inhibitory effect of high temperature was due to increased conjugation of 1-aminocyclopropane-1-carboxylic acid to 1-(malonylamino)cyclopropane-1-carboxylic acid and to an inhibition of ethylene-forming enzyme activity.

  18. A strategy for promoting astaxanthin accumulation in Haematococcus pluvialis by 1-aminocyclopropane-1-carboxylic acid application.

    PubMed

    Lee, Changsu; Choi, Yoon-E; Yun, Yeoung-Sang

    2016-10-20

    The green algae Haematococcus pluvialis is a freshwater unicellular microalga belonging to Chlorophyceae. It is one of the best natural sources of astaxanthin, a secondary metabolite commonly used as an antioxidant and anti-inflammatory agent. Due to the importance of astaxanthin, various efforts have been made to increase its production. In this study, we attempted to develop a strategy for promoting astaxanthin accumulation in H. pluvialis using 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ethylene (normally known as an aging hormone in plants). Our results demonstrated that ACC could enhance the growth of H. pluvialis, thereby promoting astaxanthin accumulation. Therefore, ACC has an indirect influence on astaxanthin production. We further verified the effect of ACC with a direct treatment of ethylene originated from banana peels. These results indicate that ethylene could be applied as an indirect method for enhancing growth and astaxanthin biosynthesis in H. pluvialis. PMID:27544287

  19. In vitro germination of Striga hermonthica and Striga aspera seeds by 1-aminocyclopropane-1-carboxylic acid.

    PubMed

    Rugutt, Kipngeno J; Rugutt, Joseph K; Berner, Dana K

    2003-01-01

    Treatment of conditioned seeds of four isolates of Striga hermonthica and one isolate of Striga aspera with various concentrations of the ethylene precursor, 1-aminocyclopropane-1-carboxylic acid (ACC), caused complex stimulation of germination patterns. GR 24, the strigol analogue served as a positive control and its stimulatory activity was comparable to that of ACC. When conditioned Striga seeds were treated with negative control that did not contain ACC, the stimulatory effect was lost. Overall, the germination data suggested a hormonal mode of action by ACC, which involves indirect stimulation of biosynthesis of ethylene that then triggers seed germination. The various mechanisms that have been proposed for the chemical and biological oxidation of ACC to generate ethylene are discussed.

  20. 1-Aminocyclopropane-1-carboxylic acid oxidase: insight into cofactor binding from experimental and theoretical studies.

    PubMed

    Brisson, Lydie; El Bakkali-Taheri, Nadia; Giorgi, Michel; Fadel, Antoine; Kaizer, József; Réglier, Marius; Tron, Thierry; Ajandouz, El Hassan; Simaan, A Jalila

    2012-08-01

    1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a nonheme Fe(II)-containing enzyme that is related to the 2-oxoglutarate-dependent dioxygenase family. The binding of substrates/cofactors to tomato ACCO was investigated through kinetics, tryptophan fluorescence quenching, and modeling studies. α-Aminophosphonate analogs of the substrate (1-aminocyclopropane-1-carboxylic acid, ACC), 1-aminocyclopropane-1-phosphonic acid (ACP) and (1-amino-1-methyl)ethylphosphonic acid (AMEP), were found to be competitive inhibitors versus both ACC and bicarbonate (HCO(3)(-)) ions. The measured dissociation constants for Fe(II) and ACC clearly indicate that bicarbonate ions improve both Fe(II) and ACC binding, strongly suggesting a stabilization role for this cofactor. A structural model of tomato ACCO was constructed and used for docking experiments, providing a model of possible interactions of ACC, HCO(3)(-), and ascorbate at the active site. In this model, the ACC and bicarbonate binding sites are located close together in the active pocket. HCO(3)(-) is found at hydrogen-bond distance from ACC and interacts (hydrogen bonds or electrostatic interactions) with residues K158, R244, Y162, S246, and R300 of the enzyme. The position of ascorbate is also predicted away from ACC. Individually docked at the active site, the inhibitors ACP and AMEP were found coordinating the metal ion in place of ACC with the phosphonate groups interacting with K158 and R300, thus interlocking with both ACC and bicarbonate binding sites. In conclusion, HCO(3)(-) and ACC together occupy positions similar to the position of 2-oxoglutarate in related enzymes, and through a hydrogen bond HCO(3)(-) likely plays a major role in the stabilization of the substrate in the active pocket. PMID:22711330

  1. 1-aminocyclopropane-1-carboxylic acid (ACC) in plants: more than just the precursor of ethylene!

    PubMed Central

    Van de Poel, Bram; Van Der Straeten, Dominique

    2014-01-01

    Ethylene is a simple two carbon atom molecule with profound effects on plants. There are quite a few review papers covering all aspects of ethylene biology in plants, including its biosynthesis, signaling and physiology. This is merely a logical consequence of the fascinating and pleiotropic nature of this gaseous plant hormone. Its biochemical precursor, 1-aminocyclopropane-1-carboxylic acid (ACC) is also a fairly simple molecule, but perhaps its role in plant biology is seriously underestimated. This triangularly shaped amino acid has many more features than just being the precursor of the lead-role player ethylene. For example, ACC can be conjugated to three different derivatives, but their biological role remains vague. ACC can also be metabolized by bacteria using ACC-deaminase, favoring plant growth and lowering stress susceptibility. ACC is also subjected to a sophisticated transport mechanism to ensure local and long-distance ethylene responses. Last but not least, there are now a few exciting studies where ACC has been reported to function as a signal itself, independently from ethylene. This review puts ACC in the spotlight, not to give it the lead-role, but to create a picture of the stunning co-production of the hormone and its precursor. PMID:25426135

  2. Characterization of plant growth promoting rhizobacteria isolated from polluted soils and containing 1-aminocyclopropane-1-carboxylate deaminase.

    PubMed

    Belimov, A A; Safronova, V I; Sergeyeva, T A; Egorova, T N; Matveyeva, V A; Tsyganov, V E; Borisov, A Y; Tikhonovich, I A; Kluge, C; Preisfeld, A; Dietz, K J; Stepanok, V V

    2001-07-01

    Fifteen bacterial strains containing 1-aminocyclopropane-1-carboxylate (ACC) deaminase were isolated from the rhizoplane of pea (Pisum sativum L.) and Indian mustard (Brassica juncea L.) grown in different soils and a long-standing sewage sludge contaminated with heavy metals. The isolated strains were characterized and assigned to various genera and species, such as Pseudomonas brassicacearum, Pseudomonas marginalis, Pseudomonas oryzihabitans, Pseudomonas putida, Pseudomonas sp., Alcaligenes xylosoxidans, Alcaligenes sp., Variovorax paradoxus, Bacillus pumilus, and Rhodococcus sp. by determination of 16S rRNA gene sequences. The root elongation of Indian mustard and rape (Brassica napus var. oleifera L.) germinating seedlings was stimulated by inoculation with 8 and 13 isolated strains, respectively. The bacteria were tolerant to cadmium toxicity and stimulated root elongation of rape seedlings in the presence of 300 microM CdCl2 in the nutrient solution. The effect of ACC-utilising bacteria on root elongation correlated with the impact of aminoethoxyvinylglycine and silver ions, chemical inhibitors of ethylene biosynthesis. A significant improvement in the growth of rape caused by inoculation with certain selected strains was also observed in pot experiments, when the plants were cultivated in cadmium-supplemented soil. The biomass of pea cv. Sparkle and its ethylene sensitive mutant E2 (sym5), in particular, was increased through inoculation with certain strains of ACC-utilising bacteria in pot experiments in quartz sand culture. The beneficial effect of the bacteria on plant growth varied significantly depending on individual bacterial strains, plant genotype, and growth conditions. The results suggest that plant growth promoting rhizobacteria containing ACC deaminase are present in various soils and offer promise as a bacterial inoculum for improvement of plant growth, particularly under unfavourable environmental conditions.

  3. Characterization of plant growth promoting rhizobacteria isolated from polluted soils and containing 1-aminocyclopropane-1-carboxylate deaminase.

    PubMed

    Belimov, A A; Safronova, V I; Sergeyeva, T A; Egorova, T N; Matveyeva, V A; Tsyganov, V E; Borisov, A Y; Tikhonovich, I A; Kluge, C; Preisfeld, A; Dietz, K J; Stepanok, V V

    2001-07-01

    Fifteen bacterial strains containing 1-aminocyclopropane-1-carboxylate (ACC) deaminase were isolated from the rhizoplane of pea (Pisum sativum L.) and Indian mustard (Brassica juncea L.) grown in different soils and a long-standing sewage sludge contaminated with heavy metals. The isolated strains were characterized and assigned to various genera and species, such as Pseudomonas brassicacearum, Pseudomonas marginalis, Pseudomonas oryzihabitans, Pseudomonas putida, Pseudomonas sp., Alcaligenes xylosoxidans, Alcaligenes sp., Variovorax paradoxus, Bacillus pumilus, and Rhodococcus sp. by determination of 16S rRNA gene sequences. The root elongation of Indian mustard and rape (Brassica napus var. oleifera L.) germinating seedlings was stimulated by inoculation with 8 and 13 isolated strains, respectively. The bacteria were tolerant to cadmium toxicity and stimulated root elongation of rape seedlings in the presence of 300 microM CdCl2 in the nutrient solution. The effect of ACC-utilising bacteria on root elongation correlated with the impact of aminoethoxyvinylglycine and silver ions, chemical inhibitors of ethylene biosynthesis. A significant improvement in the growth of rape caused by inoculation with certain selected strains was also observed in pot experiments, when the plants were cultivated in cadmium-supplemented soil. The biomass of pea cv. Sparkle and its ethylene sensitive mutant E2 (sym5), in particular, was increased through inoculation with certain strains of ACC-utilising bacteria in pot experiments in quartz sand culture. The beneficial effect of the bacteria on plant growth varied significantly depending on individual bacterial strains, plant genotype, and growth conditions. The results suggest that plant growth promoting rhizobacteria containing ACC deaminase are present in various soils and offer promise as a bacterial inoculum for improvement of plant growth, particularly under unfavourable environmental conditions. PMID:11547884

  4. Transport and Metabolism of 1-Aminocyclopropane-1-carboxylic Acid in Sunflower (Helianthus annuus L.) Seedlings 1

    PubMed Central

    Finlayson, Scott A.; Foster, Kenneth R.; Reid, David M.

    1991-01-01

    Transport and metabolism of [2,3-14C] 1-aminocyclopropane-1-carboxylic acid (ACC) from roots to shoots in 4-day-old sunflower (Helianthus annuus L.) seedlings were studied. [14C]ACC was detected in, and 14C2H4 was evolved from, shoots 0.5 hours after [14C]ACC was supplied to roots. Ethylene emanation from the shoots returned to normal levels after 6 hours. The roots showed a similar pattern, although at 24 hours ethylene emanation was still slightly higher than in those plants that did not receive ACC. [14C]N-malonyl-ACC (MACC) was detected in both tissues at all times sampled. [14C]MACC levels surpassed [14C]ACC levels in the shoot at 2 hours, whereas [14C]MACC levels in the root remained below [14C]ACC levels until 6 hours, after which they were higher. Thin-layer chromatography analysis identified [14C] ACC in 1-hour shoot extracts, and [14C]MACC was identified in root tissues at 1 and 12 hours after treatment. [14C]ACC and [14C] MACC in the xylem sap of treated seedlings were identified by thin-layer chromatography. Xylem transport of [14C]ACC in treated seedlings, and transport of ACC in untreated seedlings, was confirmed by gas chromatography-mass spectrometry. Some evidence for the presence of [14C]MACC in xylem sap in [14C]ACC-treated seedlings is presented. A substantial amount of radioactivity in both ACC and MACC fractions was detected leaking from the roots over 24 hours. A second radiolabeled volatile compound was trapped in a CO2-trapping solution but not in mercuric perchlorate. Levels of this compound were highest after the peak of ACC levels and before peak MACC levels in both tissues, suggesting that an alternate pathway of ACC metabolism was operating in this system. PMID:16668342

  5. 1-Aminocyclopropane-1-Carboxylic Acid Transported from Roots to Shoots Promotes Leaf Abscission in Cleopatra Mandarin (Citrus reshni Hort. ex Tan.) Seedlings Rehydrated after Water Stress.

    PubMed

    Tudela, D; Primo-Millo, E

    1992-09-01

    The effect of water stress and subsequent rehydration on 1-aminocyclopropane-1-carboxylic acid (ACC) content, ACC synthase activity, ethylene production, and leaf abscission was studied in Cleopatra mandarin (Citrus reshni Hort. ex Tan.) seedlings. Leaf abscission occurred when drought-stressed plants were allowed to rehydrate, whereas no abscission was observed in plants under water stress conditions. In roots of water-stressed plants, a high ACC accumulation and an increase in ACC synthase activity were observed. Neither increase in ACC content nor significant ethylene production were detected in leaves of water-stressed plants. After rehydration, a sharp rise in ACC content and ethylene production was observed in leaves of water-stressed plants. Content of ACC in xylem fluid was 10-fold higher in plants rehydrated for 2 h after water stress than in nonstressed plants. Leaf abscission induced by rehydration after drought stress was inhibited when roots or shoots were treated before water stress with aminooxyacetic acid (AOA, inhibitor of ACC synthase) or cobalt ion (inhibitor of ethylene-forming enzyme), respectively. However, AOA treatments to shoots did not suppress leaf abscission. The data indicate that water stress promotes ACC synthesis in roots of Cleopatra mandarin seedlings. Rehydration of plants results in ACC transport to the shoots, where it is oxidized to ethylene. Subsequently, this ethylene induces leaf abscission.

  6. Changes in 1-aminocyclopropane-1-carboxylic-acid content of cut carnation flowers in relation to their senescence.

    PubMed

    Bufler, G; Mor, Y; Reid, M S; Yang, S F

    1980-12-01

    The rise in ethylene production accompanying the respiration climacteric and senescence of cut carnation flowers (Dianthus caryophyllus L. cv. White Sim) was associated with a 30-fold increase in the concentration of 1-aminocyclopropane-1-carboxylic acid (ACC) in the petals (initial content 0.3 nmol/g fresh weight). Pretreatment of the flowers with silver thiosulfate (STS) retarded flower senescence and prevented the increase in ACC concentration in the petals. An increase in ACC in the remaining flower parts, which appeared to precede the increase in the petals, was only partially prevented by the STS pretreatment. Addition of aminoxyacetic acid (2 mM) to the solution in which the flowers were kept completely inhibited accumulation of ACC in all flower parts.

  7. 1-Aminocyclopropane-1-Carboxylate Deaminase from Pseudomonas stutzeri A1501 Facilitates the Growth of Rice in the Presence of Salt or Heavy Metals.

    PubMed

    Han, Yunlei; Wang, Rui; Yang, Zhirong; Zhan, Yuhua; Ma, Yao; Ping, Shuzhen; Zhang, Liwen; Lin, Min; Yan, Yongliang

    2015-07-01

    1-Aminocyclopropane-1-carboxylate (ACC) deaminase, which is encoded by some bacteria, can reduce the amount of ethylene, a root elongation inhibitor, and stimulate the growth of plants under various environmental stresses. The presence of ACC deaminase activity and the regulation of ACC in several rhizospheric bacteria have been reported. The nitrogen-fixing Pseudomonas stutzeri A1501 is capable of endophytic association with rice plants and promotes the growth of rice. However, the functional identification of ACC deaminase has not been performed. In this study, the proposed effect of ACC deaminase in P. stutzeri A1501 was investigated. Genome mining showed that P. stutzeri A1501 carries a single gene encoding ACC deaminase, designated acdS. The acdS mutant was devoid of ACC deaminase activity and was less resistant to NaCl and NiCl2 compared with the wild-type. Furthermore, inactivation of acdS greatly impaired its nitrogenase activity under salt stress conditions. It was also observed that mutation of the acdS gene led to loss of the ability to promote the growth of rice under salt or heavy metal stress. Taken together, this study illustrates the essential role of ACC deaminase, not only in enhancing the salt or heavy metal tolerance of bacteria but also in improving the growth of plants, and provides a theoretical basis for studying the interaction between plant growth-promoting rhizobacteria and plants. PMID:25674802

  8. 1-Aminocyclopropane-1-Carboxylate Deaminase from Pseudomonas stutzeri A1501 Facilitates the Growth of Rice in the Presence of Salt or Heavy Metals.

    PubMed

    Han, Yunlei; Wang, Rui; Yang, Zhirong; Zhan, Yuhua; Ma, Yao; Ping, Shuzhen; Zhang, Liwen; Lin, Min; Yan, Yongliang

    2015-07-01

    1-Aminocyclopropane-1-carboxylate (ACC) deaminase, which is encoded by some bacteria, can reduce the amount of ethylene, a root elongation inhibitor, and stimulate the growth of plants under various environmental stresses. The presence of ACC deaminase activity and the regulation of ACC in several rhizospheric bacteria have been reported. The nitrogen-fixing Pseudomonas stutzeri A1501 is capable of endophytic association with rice plants and promotes the growth of rice. However, the functional identification of ACC deaminase has not been performed. In this study, the proposed effect of ACC deaminase in P. stutzeri A1501 was investigated. Genome mining showed that P. stutzeri A1501 carries a single gene encoding ACC deaminase, designated acdS. The acdS mutant was devoid of ACC deaminase activity and was less resistant to NaCl and NiCl2 compared with the wild-type. Furthermore, inactivation of acdS greatly impaired its nitrogenase activity under salt stress conditions. It was also observed that mutation of the acdS gene led to loss of the ability to promote the growth of rice under salt or heavy metal stress. Taken together, this study illustrates the essential role of ACC deaminase, not only in enhancing the salt or heavy metal tolerance of bacteria but also in improving the growth of plants, and provides a theoretical basis for studying the interaction between plant growth-promoting rhizobacteria and plants.

  9. Kinetin Enhanced 1-Aminocyclopropane-1-Carboxylic Acid Utilization during Alleviation of High Temperatures Stress in Lettuce Seeds.

    PubMed

    Khan, A A; Prusinski, J

    1989-10-01

    The thermoinhibition at 35 and 32 degrees C of pregermination ethylene production and germination in lettuce (Lactuca sativa L. cv Mesa 659) seeds was synergistically or additively alleviated by 0.05 millimolar kinetin (KIN) and 10 millimolar 1-aminocyclopropane-1-carboxylic acid (ACC). The synergistic effect of KIN + ACC on ethylene production and germination at 35 degrees C was inhibited by Co(2+) (44-46%) but not by aminoethoxyvinyl glycine (AVG). The uptake of ACC by the seed was not influenced by KIN. Upon slitting of the seed coats (composed of pericarp, testa and endosperm), following the uptake of chemicals, ACC was readily converted into ethylene at all temperatures, and the synergistic effects of KIN + ACC at 35 degrees C were lost. At 35 degrees C, KIN acted synergistically with ACC or ethephon (ETH) in alleviating the osmotic restraint. At 25 degrees C, ETH was more active than KIN or KIN + ACC in overcoming the osmotic restraint. Thus, the integrity of the seed coats, the KIN-enhanced ACC utilization, and an interaction of KIN with the ethylene produced may be the basis for the synergistic or additive effects of KIN + ACC at high temperature.

  10. Dissecting the role of climacteric ethylene in kiwifruit (Actinidia chinensis) ripening using a 1-aminocyclopropane-1-carboxylic acid oxidase knockdown line.

    PubMed

    Atkinson, Ross G; Gunaseelan, Kularajathevan; Wang, Mindy Y; Luo, Luke; Wang, Tianchi; Norling, Cara L; Johnston, Sarah L; Maddumage, Ratnasiri; Schröder, Roswitha; Schaffer, Robert J

    2011-07-01

    During climacteric fruit ripening, autocatalytic (Type II) ethylene production initiates a transcriptional cascade that controls the production of many important fruit quality traits including flavour production and softening. The last step in ethylene biosynthesis is the conversion of 1-aminocyclopropane-1-carboxylic acid (ACC) to ethylene by the enzyme ACC oxidase (ACO). Ten independent kiwifruit (Actinidia chinensis) lines were generated targeting suppression of fruit ripening-related ACO genes and the fruit from one of these lines (TK2) did not produce detectable levels of climacteric ethylene. Ripening behaviour in a population of kiwifruit at harvest is asynchronous, so a short burst of exogenous ethylene was used to synchronize ripening in TK2 and control fruit. Following such a treatment, TK2 and control fruit softened to an 'eating-ripe' firmness. Control fruit produced climacteric ethylene and softened beyond eating-ripe by 5 d. In contrast, TK2 fruit maintained an eating-ripe firmness for >25 d and total volatile production was dramatically reduced. Application of continuous exogenous ethylene to the ripening-arrested TK2 fruit re-initiated fruit softening and typical ripe fruit volatiles were detected. A 17 500 gene microarray identified 401 genes that changed after ethylene treatment, including a polygalacturonase and a pectate lyase involved in cell wall breakdown, and a quinone oxidoreductase potentially involved in volatile production. Many of the gene changes were consistent with the softening and flavour changes observed after ethylene treatment. However, a surprisingly large number of genes of unknown function were also observed, which could account for the unique flavour and textural properties of ripe kiwifruit.

  11. Novel Rhizosphere Soil Alleles for the Enzyme 1-Aminocyclopropane-1-Carboxylate Deaminase Queried for Function with an In Vivo Competition Assay

    PubMed Central

    Jin, Zhao; Di Rienzi, Sara C.; Janzon, Anders; Werner, Jeff J.; Angenent, Largus T.; Dangl, Jeffrey L.; Fowler, Douglas M.

    2015-01-01

    Metagenomes derived from environmental microbiota encode a vast diversity of protein homologs. How this diversity impacts protein function can be explored through selection assays aimed to optimize function. While artificially generated gene sequence pools are typically used in selection assays, their usage may be limited because of technical or ethical reasons. Here, we investigate an alternative strategy, the use of soil microbial DNA as a starting point. We demonstrate this approach by optimizing the function of a widely occurring soil bacterial enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase. We identified a specific ACC deaminase domain region (ACCD-DR) that, when PCR amplified from the soil, produced a variant pool that we could swap into functional plasmids carrying ACC deaminase-encoding genes. Functional clones of ACC deaminase were selected for in a competition assay based on their capacity to provide nitrogen to Escherichia coli in vitro. The most successful ACCD-DR variants were identified after multiple rounds of selection by sequence analysis. We observed that previously identified essential active-site residues were fixed in the original unselected library and that additional residues went to fixation after selection. We identified a divergent essential residue whose presence hints at the possible use of alternative substrates and a cluster of neutral residues that did not influence ACCD performance. Using an artificial ACCD-DR variant library generated by DNA oligomer synthesis, we validated the same fixation patterns. Our study demonstrates that soil metagenomes are useful starting pools of protein-coding-gene diversity that can be utilized for protein optimization and functional characterization when synthetic libraries are not appropriate. PMID:26637602

  12. ACC (1-aminocyclopropane-1-carboxylate) deaminase activity, a widespread trait in Burkholderia species, and its growth-promoting effect on tomato plants.

    PubMed

    Onofre-Lemus, Janette; Hernández-Lucas, Ismael; Girard, Lourdes; Caballero-Mellado, Jesús

    2009-10-01

    The genus Burkholderia includes pathogens of plants and animals and some human opportunistic pathogens, such as the Burkholderia cepacia complex (Bcc), but most species are nonpathogenic, plant associated, and rhizospheric or endophytic. Since rhizobacteria expressing ACC (1-aminocyclopropane-1-carboxylate) deaminase may enhance plant growth by lowering plant ethylene levels, in this work we investigated the presence of ACC deaminase activity and the acdS gene in 45 strains, most of which are plant associated, representing 20 well-known Burkholderia species. The results demonstrated that ACC deaminase activity is a widespread feature in the genus Burkholderia, since 18 species exhibited ACC deaminase activities in the range from 2 to 15 mumol of alpha-ketobutyrate/h/mg protein, which suggests that these species may be able to modulate ethylene levels and enhance plant growth. In these 18 Burkholderia species the acdS gene sequences were highly conserved (76 to 99% identity). Phylogenetic analysis of acdS gene sequences in Burkholderia showed tight clustering of the Bcc species, which were clearly distinct from diazotrophic plant-associated Burkholderia species. In addition, an acdS knockout mutant of the N(2)-fixing bacterium Burkholderia unamae MTl-641(T) and a transcriptional acdSp-gusA fusion constructed in this strain showed that ACC deaminase could play an important role in promotion of the growth of tomato plants. The widespread ACC deaminase activity in Burkholderia species and the common association of these species with plants suggest that this genus could be a major contributor to plant growth under natural conditions.

  13. Novel Rhizosphere Soil Alleles for the Enzyme 1-Aminocyclopropane-1-Carboxylate Deaminase Queried for Function with an In Vivo Competition Assay.

    PubMed

    Jin, Zhao; Di Rienzi, Sara C; Janzon, Anders; Werner, Jeff J; Angenent, Largus T; Dangl, Jeffrey L; Fowler, Douglas M; Ley, Ruth E

    2015-12-04

    Metagenomes derived from environmental microbiota encode a vast diversity of protein homologs. How this diversity impacts protein function can be explored through selection assays aimed to optimize function. While artificially generated gene sequence pools are typically used in selection assays, their usage may be limited because of technical or ethical reasons. Here, we investigate an alternative strategy, the use of soil microbial DNA as a starting point. We demonstrate this approach by optimizing the function of a widely occurring soil bacterial enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase. We identified a specific ACC deaminase domain region (ACCD-DR) that, when PCR amplified from the soil, produced a variant pool that we could swap into functional plasmids carrying ACC deaminase-encoding genes. Functional clones of ACC deaminase were selected for in a competition assay based on their capacity to provide nitrogen to Escherichia coli in vitro. The most successful ACCD-DR variants were identified after multiple rounds of selection by sequence analysis. We observed that previously identified essential active-site residues were fixed in the original unselected library and that additional residues went to fixation after selection. We identified a divergent essential residue whose presence hints at the possible use of alternative substrates and a cluster of neutral residues that did not influence ACCD performance. Using an artificial ACCD-DR variant library generated by DNA oligomer synthesis, we validated the same fixation patterns. Our study demonstrates that soil metagenomes are useful starting pools of protein-coding-gene diversity that can be utilized for protein optimization and functional characterization when synthetic libraries are not appropriate.

  14. 1-Aminocyclopropane-1-carboxylic acid and abscisic acid during the germination of sugar beet (Beta vulgaris L.): a comparative study of fruits and seeds.

    PubMed

    Hermann, Katrin; Meinhard, Juliane; Dobrev, Peter; Linkies, Ada; Pesek, Bedrich; Hess, Barbara; Machácková, Ivana; Fischer, Uwe; Leubner-Metzger, Gerhard

    2007-01-01

    The control of sugar beet (Beta vulgaris L.) germination by plant hormones was studied by comparing fruits and seeds. Treatment of sugar beet fruits and seeds with gibberellins, brassinosteroids, auxins, cytokinins, and jasmonates or corresponding hormone biosynthesis inhibitors did not appreciably affect radicle emergence of fruits or seeds. By contrast, treatment with ethylene or the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) promoted radicle emergence of fruits and seeds. Abscisic acid (ABA) acted as an antagonist of ethylene and inhibited radicle emergence of seeds, but not appreciably of fruits. High endogenous contents of ACC and of ABA were evident in seeds and pericarps of dry mature fruits, but declined early during imbibition. ABA-treatment of seeds and fruits induced seed ACC accumulation while ACC-treatment did not affect the seed ABA content. Transcripts of ACC oxidase (ACO, ethylene-forming enzyme) and ABA 8'-hydroxylase (CYP707A, ABA-degrading enzyme) accumulate in fruits and seeds upon imbibition. ABA and ACC and the pericarp did not affect the seed CYP707A transcript levels. By contrast, seed ACO transcript accumulation was promoted by ABA and by pericarp removal, but not by ACC. Quantification of the endogenous ABA and ACC contents, ABA and ACC leaching, and ethylene evolution, demonstrate that an embryo-mediated active ABA extrusion system is involved in keeping the endogenous seed ABA content low by 'active ABA leaching', while the pericarp restricts ACC leaching during imbibition. Sugar beet radicle emergence appears to be controlled by the pericarp, by ABA and ACC leaching, and by an ABA-ethylene antagonism that affects ACC biosynthesis and ACO gene expression.

  15. Genetic identification of ACC-RESISTANT2 reveals involvement of LYSINE HISTIDINE TRANSPORTER1 in the uptake of 1-aminocyclopropane-1-carboxylic acid in Arabidopsis thaliana.

    PubMed

    Shin, Kihye; Lee, Sumin; Song, Won-Yong; Lee, Rin-A; Lee, Inhye; Ha, Kyungsun; Koo, Ja-Choon; Park, Soon-Ki; Nam, Hong-Gil; Lee, Youngsook; Soh, Moon-Soo

    2015-03-01

    1-Aminocyclopropane-1-carboxylic acid (ACC) is a biosynthetic precursor of ethylene, a gaseous plant hormone which controls a myriad of aspects of development and stress adaptation in higher plants. Here, we identified a mutant in Arabidopsis thaliana, designated as ACC-resistant2 (are2), displaying a dose-dependent resistance to exogenously applied ACC. Physiological analyses revealed that mutation of are2 impaired various aspects of exogenous ACC-induced ethylene responses, while not affecting sensitivity to other plant hormones during seedling development. Interestingly, the are2 mutant was normally sensitive to gaseous ethylene, compared with the wild type. Double mutant analysis showed that the ethylene-overproducing mutations, eto1 or eto3, and the constitutive ethylene signaling mutation, ctr1 were epistatic to the are2 mutation. These results suggest that the are2 mutant is not defective in ethylene biosynthesis or ethylene signaling per se. Map-based cloning of ARE2 demonstrated that LYSINE HISTIDINE TRANSPORTER1 (LHT1), encoding an amino acid transporter, is the gene responsible. An uptake experiment with radiolabeled ACC indicated that mutations of LHT1 reduced, albeit not completely, uptake of ACC. Further, we performed an amino acid competition assay and found that two amino acids, alanine and glycine, known as substrates of LHT1, could suppress the ACC-induced triple response in a LHT1-dependent way. Taken together, these results provide the first molecular genetic evidence supporting that a class of amino acid transporters including LHT1 takes part in transport of ACC, thereby influencing exogenous ACC-induced ethylene responses in A. thaliana. PMID:25520403

  16. Silicon-mediated changes in polyamine and 1-aminocyclopropane-1-carboxylic acid are involved in silicon-induced drought resistance in Sorghum bicolor L.

    PubMed

    Yin, Lina; Wang, Shiwen; Liu, Peng; Wang, Wenhua; Cao, Dan; Deng, Xiping; Zhang, Suiqi

    2014-07-01

    The fact that silicon application alleviates drought stress has been widely reported, but the mechanism it underlying remains unclear. Here, morphologic and physiological changes were investigated in sorghum (Sorghum bicolor L.) seedlings treated with silicon and exposed to PEG-simulated drought stress for seven days. Drought stress dramatically decreased growth parameters (biomass, root/shoot ratio, leaf area, chlorophyll concentration and photosynthetic rate), while silicon application reduced the drought-induced decreases in those parameters. Leaf relative water content and transpiration rate were maintained at high levels compared to those in seedlings without silicon. The soluble sugar contents were increased, but the proline contents and the osmotic potential were decreased, showing that osmotic adjustment did not contribute to the silicon induced-drought resistance. Furthermore, levels of both free and conjugated polyamines (PAs) levels, including putrescine, spermidine and spermine, were all found to be increased by silicon under drought stress both in leaf and root. Meanwhile, 1-aminocyclopropane-1-carboxylic acid (ACC), the precursor of ethylene, was markedly decreased by supplemental silicon. Several key PA synthesis genes were upregulated by silicon under drought stress. These results suggest that silicon improves sorghum drought resistance by mediating the balance of PAs and ethylene levels. In leaf, the increased PAs and decreased ACC help to retard leaf senescence. In root, the balance between PAs and ACC participates in the modulation of root plasticity, increases the root/shoot ratio, and contributes to an increase in water uptake. These results suggest that silicon increases drought resistance through regulating several important physiological processes in plants.

  17. Possible Role of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Activity of Sinorhizobium sp. BL3 on Symbiosis with Mung Bean and Determinate Nodule Senescence.

    PubMed

    Tittabutr, Panlada; Sripakdi, Sudarat; Boonkerd, Nantakorn; Tanthanuch, Waraporn; Minamisawa, Kiwamu; Teaumroong, Neung

    2015-01-01

    Sinorhizobium sp. BL3 forms symbiotic interactions with mung bean (Vigna radiata) and contains lrpL-acdS genes, which encode the 1-aminocyclopropane-1-carboxylate (ACC) deaminase enzyme that cleaves ACC, a precursor of plant ethylene synthesis. Since ethylene interferes with nodule formation in some legumes and plays a role in senescence in plant cells, BL3-enhancing ACC deaminase activity (BL3(+)) and defective mutant (BL3(-)) strains were constructed in order to investigate the effects of this enzyme on symbiosis and nodule senescence. Nodulation competitiveness was weaker in BL3(-) than in the wild-type, but was stronger in BL3(+). The inoculation of BL3(-) into mung bean resulted in less plant growth, a lower nodule dry weight, and smaller nodule number than those in the wild-type, whereas the inoculation of BL3(+) had no marked effects. However, similar nitrogenase activity was observed with all treatments; it was strongly detected 3 weeks after the inoculation and gradually declined with time, indicating senescence. The rate of plant nodulation by BL3(+) increased in a time-dependent manner. Nodules occupied by BL3(-) formed smaller symbiosomes, and bacteroid degradation was more prominent than that in the wild-type 7 weeks after the inoculation. Changes in biochemical molecules during nodulation were tracked by Fourier Transform Infrared (FT-IR) microspectroscopy, and the results obtained confirmed that aging processes differed in nodules occupied by BL3 and BL3(-). This is the first study to show the possible role of ACC deaminase activity in senescence in determinate nodules. Our results suggest that an increase in ACC deaminase activity in this strain does not extend the lifespan of nodules, whereas the lack of this activity may accelerate nodule senescence.

  18. Possible Role of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Activity of Sinorhizobium sp. BL3 on Symbiosis with Mung Bean and Determinate Nodule Senescence

    PubMed Central

    Tittabutr, Panlada; Sripakdi, Sudarat; Boonkerd, Nantakorn; Tanthanuch, Waraporn; Minamisawa, Kiwamu; Teaumroong, Neung

    2015-01-01

    Sinorhizobium sp. BL3 forms symbiotic interactions with mung bean (Vigna radiata) and contains lrpL-acdS genes, which encode the 1-aminocyclopropane-1-carboxylate (ACC) deaminase enzyme that cleaves ACC, a precursor of plant ethylene synthesis. Since ethylene interferes with nodule formation in some legumes and plays a role in senescence in plant cells, BL3-enhancing ACC deaminase activity (BL3+) and defective mutant (BL3−) strains were constructed in order to investigate the effects of this enzyme on symbiosis and nodule senescence. Nodulation competitiveness was weaker in BL3− than in the wild-type, but was stronger in BL3+. The inoculation of BL3− into mung bean resulted in less plant growth, a lower nodule dry weight, and smaller nodule number than those in the wild-type, whereas the inoculation of BL3+ had no marked effects. However, similar nitrogenase activity was observed with all treatments; it was strongly detected 3 weeks after the inoculation and gradually declined with time, indicating senescence. The rate of plant nodulation by BL3+ increased in a time-dependent manner. Nodules occupied by BL3− formed smaller symbiosomes, and bacteroid degradation was more prominent than that in the wild-type 7 weeks after the inoculation. Changes in biochemical molecules during nodulation were tracked by Fourier Transform Infrared (FT-IR) microspectroscopy, and the results obtained confirmed that aging processes differed in nodules occupied by BL3 and BL3−. This is the first study to show the possible role of ACC deaminase activity in senescence in determinate nodules. Our results suggest that an increase in ACC deaminase activity in this strain does not extend the lifespan of nodules, whereas the lack of this activity may accelerate nodule senescence. PMID:26657304

  19. Mechanistic studies of 1-aminocyclopropane-1-carboxylate deaminase: characterization of an unusual pyridoxal 5'-phosphate-dependent reaction.

    PubMed

    Thibodeaux, Christopher J; Liu, Hung-Wen

    2011-03-22

    1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase (ACCD) is a pyridoxal 5'-phosphate (PLP)-dependent enzyme that cleaves the cyclopropane ring of ACC, to give α-ketobutyric acid and ammonia as products. The cleavage of the C(α)-C(β) bond of an amino acid substrate is a rare event in PLP-dependent enzyme catalysis. Potential chemical mechanisms involving nucleophile- or acid-catalyzed cyclopropane ring opening have been proposed for the unusual transformation catalyzed by ACCD, but the actual mode of cyclopropane ring cleavage remains obscure. In this report, we aim to elucidate the mechanistic features of ACCD catalysis by investigating the kinetic properties of ACCD from Pseudomonas sp. ACP and several of its mutant enzymes. Our studies suggest that the pK(a) of the conserved active site residue, Tyr294, is lowered by a hydrogen bonding interaction with a second conserved residue, Tyr268. This allows Tyr294 to deprotonate the incoming amino group of ACC to initiate the aldimine exchange reaction between ACC and the PLP coenzyme and also likely helps to activate Tyr294 for a role as a nucleophile to attack and cleave the cyclopropane ring of the substrate. In addition, solvent kinetic isotope effect (KIE), proton inventory, and (13)C KIE studies of the wild type enzyme suggest that the C(α)-C(β) bond cleavage step in the chemical mechanism is at least partially rate-limiting under k(cat)/K(m) conditions and is likely preceded in the mechanism by a partially rate-limiting step involving the conversion of a stable gem-diamine intermediate into a reactive external aldimine intermediate that is poised for cyclopropane ring cleavage. When viewed within the context of previous mechanistic and structural studies of ACCD enzymes, our studies are most consistent with a mode of cyclopropane ring cleavage involving nucleophilic catalysis by Tyr294.

  20. The final step of the ethylene biosynthesis pathway in turnip tops (Brassica rapa): molecular characterization of the 1-aminocyclopropane-1-carboxylate oxidase BrACO1 throughout zygotic embryogenesis and germination of heterogeneous seeds.

    PubMed

    Del Carmen Rodríguez-Gacio, María; Nicolás, Carlos; Matilla, Angel Jesús

    2004-05-01

    In a previous report from the present authors, it was shown that the 1-aminocyclopropane-1-carboxylate (ACC) oxidation may play a crucial role during zygotic embryogenesis of turnip tops seeds. The present study was performed to elucidate the contribution of the silique-wall and seeds in ethylene production during this developmental process. ACC content in the silique wall is only higher than in seeds during the middle phases of zygotic embryogenesis. The ACC-oxidase (ACO) activity peaks in the silique-wall and seeds during the onset of embryogenesis, declining gradually afterwards, being undetectable during desiccation period. Using reverse transcriptase-polymerase chain reaction, one cDNA clone coding for an ACO and called BrACO1, was isolated. The deduced protein for BrACO1 has a molecular weight of 36.8 kDa and a high homology with other crucifer ACOs. The heterologous expression of this cDNA confirmed that BrACO1 is an ACO. The expression of this gene was high during the first phases of silique-wall development, low during the middle phases and undetectable during desiccation. By contrast, BrACO1 transcript was accumulated only in the earliest phases of seed embryogenesis and may participate in the highest ACO activity and ethylene production by seeds at the beginning of embryogenesis. Finally, in this work a correlation between the heterogeneity of Brassica rapa L. cv. Rapa seeds and the ability to oxidize the ACC to ethylene has been demonstrated.

  1. Inhibition by 1-aminocyclobutane-1-carboxylate of the activity of 1-aminocyclopropane-1-carboxylate oxidase obtained from senescing petals of carnation (Dianthus caryophyllus L.) flowers.

    PubMed

    Kosugi, Y; Oyamada, N; Satoh, S; Yoshioka, T; Onodera, E; Yamada, Y

    1997-03-01

    We partially purified 1-aminocyclopropane-1-carboxylate (ACC) oxidase from senescing petals of carnation (Dianthus caryophyllus L. cv. Nora) flowers and investigated its general characteristics, and, in particular, the inhibition of its activity by ACC analogs. The enzyme had an optimum pH at 7-7.5 and required Fe2+, ascorbate and NaHCO3 for its maximal activity. The Km for ACC was calculated as 111-125 microM in the presence of NaHCO3. Its M(r) was estimated to be 35 and 36 kDa by gel-filtration chromatography on HPLC and SDS-PAGE, respectively, indicating that the enzyme exists in a monomeric form. These properties were in agreement with those reported previously with ACC oxidases from different plant tissues including senescing carnation petals. Among six ACC analogs tested, 1-aminocyclobutane-1-carboxylate (ACBC) inhibited most severely the activity of ACC oxidase from carnation petals. ACBC acted as a competitive inhibitor with the Ki of 20-30 microM. The comparison between the Km for ACC and the Ki for ACBC indicated that ACBC had an affinity which was ca. 5-fold higher than that of ACC. Whereas ACC inactivated carnation ACC oxidase in a time-dependent manner during incubation, ACBC did not cause the inactivation of the enzyme. Preliminary experiments showed that ACBC and its N-substituted derivatives delayed the onset of senescence in cut carnation flowers.

  2. 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing rhizobacteria protect Ocimum sanctum plants during waterlogging stress via reduced ethylene generation.

    PubMed

    Barnawal, Deepti; Bharti, Nidhi; Maji, Deepamala; Chanotiya, Chandan Singh; Kalra, Alok

    2012-09-01

    Ocimum sanctum grown as rain-fed crop, is known to be poorly adapted to waterlogged conditions. Many a times the crop suffers extreme damages because of anoxia and excessive ethylene generation due to waterlogging conditions present under heavy rain. The usefulness of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing plant growth promoting rhizobacteria was investigated under waterlogging stress. The comparison of herb yield and stress induced biochemical changes of waterlogged and non-waterlogged plants with and without ACC deaminase-containing microbiological treatments were monitored in this study. Ten plant growth promoting rhizobacteria strains containing ACC-deaminase were isolated and characterized. Four selected isolates Fd2 (Achromobacter xylosoxidans), Bac5 (Serratia ureilytica), Oci9 (Herbaspirillum seropedicae) and Oci13 (Ochrobactrum rhizosphaerae) had the potential to protect Ocimum plants from flood induced damage under waterlogged glass house conditions. Pot experiments were conducted to evaluate the potential of these ACC deaminase-containing selected strains for reducing the yield losses caused by waterlogging conditions. Bacterial treatments protected plants from waterlogging induced detrimental changes like stress ethylene production, reduced chlorophyll concentration, higher lipid peroxidation, proline concentration and reduced foliar nutrient uptake. Fd2 (A. xylosoxidans) induced maximum waterlogging tolerance as treated waterlogged plants recorded maximum growth and herb yield (46.5% higher than uninoculated waterlogged plants) with minimum stress ethylene levels (53% lower ACC concentration as compared to waterlogged plants without bacterial inoculation) whereas under normal non-waterlogged conditions O. rhizosphaerae was most effective in plant growth promotion. PMID:22846334

  3. 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing rhizobacteria protect Ocimum sanctum plants during waterlogging stress via reduced ethylene generation.

    PubMed

    Barnawal, Deepti; Bharti, Nidhi; Maji, Deepamala; Chanotiya, Chandan Singh; Kalra, Alok

    2012-09-01

    Ocimum sanctum grown as rain-fed crop, is known to be poorly adapted to waterlogged conditions. Many a times the crop suffers extreme damages because of anoxia and excessive ethylene generation due to waterlogging conditions present under heavy rain. The usefulness of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing plant growth promoting rhizobacteria was investigated under waterlogging stress. The comparison of herb yield and stress induced biochemical changes of waterlogged and non-waterlogged plants with and without ACC deaminase-containing microbiological treatments were monitored in this study. Ten plant growth promoting rhizobacteria strains containing ACC-deaminase were isolated and characterized. Four selected isolates Fd2 (Achromobacter xylosoxidans), Bac5 (Serratia ureilytica), Oci9 (Herbaspirillum seropedicae) and Oci13 (Ochrobactrum rhizosphaerae) had the potential to protect Ocimum plants from flood induced damage under waterlogged glass house conditions. Pot experiments were conducted to evaluate the potential of these ACC deaminase-containing selected strains for reducing the yield losses caused by waterlogging conditions. Bacterial treatments protected plants from waterlogging induced detrimental changes like stress ethylene production, reduced chlorophyll concentration, higher lipid peroxidation, proline concentration and reduced foliar nutrient uptake. Fd2 (A. xylosoxidans) induced maximum waterlogging tolerance as treated waterlogged plants recorded maximum growth and herb yield (46.5% higher than uninoculated waterlogged plants) with minimum stress ethylene levels (53% lower ACC concentration as compared to waterlogged plants without bacterial inoculation) whereas under normal non-waterlogged conditions O. rhizosphaerae was most effective in plant growth promotion.

  4. Effect of the ethylene precursor, 1-aminocyclopropane-1-carboxylic acid on different growth stages of Haematococcus pluvialis.

    PubMed

    Vo, Thi-Thao; Lee, Changsu; Han, Sang-Il; Kim, Jee Young; Kim, Sok; Choi, Yoon-E

    2016-11-01

    In this study, we explored the effects of ACC on other stages of H. pluvialis. Interestingly, even though ACC displayed a dose-dependent effect on astaxanthin production, it is evident that astaxanthin production could be facilitated whenever the cells were treated at the early red stage. The transcriptional levels of BKT, CHY, SOD, and CAT genes supported enhanced astaxanthin biosynthesis upon ACC treatment at the early red stage. The combinatorial synergistic effect of ACC and light intensity was also confirmed. Finally, two-step application of ACC at the vegetative phase to increase biomass production and at the early-red stage to promote astaxanthin biosynthesis was proposed to maximize the efficiency of ACC treatment. PMID:27566516

  5. 1-aminocyclopropane-1-carboxylate deaminase from Pseudomonas fluorescens promoting the growth of Chinese cabbage and its polyclonal antibody.

    PubMed

    Soh, Byoung Yul; Lee, Gun Woong; Go, Eun Byeul; Kim, Byeo-Ri; Lee, Kui-Jae; Chae, Jong-Chan

    2014-05-01

    Bacterial 1-aminocyclopropane-1-carboxlyate (ACC) deaminase (AcdS) is an enzyme that cleaves ACC, a precursor of the plant hormone ethylene, into α-ketobutyrate and ammonia. The acdS gene was cloned from Pseudomonas fluorescens, which was capable of improving the seedling of Chinese cabbage under salinity condition. The recombinant AcdS (rAcdS) exhibited optimal activity at pH 8.5 and 30°C. Strong activity was sustained at up to 100 mM NaCl. The polyclonal anti-P. fluorescens AcdS antibody was produced in a rabbit that had been immunized with the purified rAcdS. This antibody successfully recognized the homologous antigens derived from the total proteins of isolated plant growth-promoting microorganisms. A statistically significant correlation was observed between the intensity of hybridization signal and AcdS activity measured by a biochemical method, suggesting its application as a useful indicator for active deaminases.

  6. Southern blight disease of tomato control by 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Paenibacillus lentimorbus B-30488

    PubMed Central

    Dixit, Ritu; Agrawal, Lalit; Gupta, Swati; Kumar, Manoj; Yadav, Sumit; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar

    2016-01-01

    abstract Tomato cultivation is highly susceptible for soil born diseases and among them southern blight disease caused by Scelerotium rolfsii is very common. For its management use of chemical fungicides is not very successful as their spores are able to survive for many years in the soil. As an alternative eco-friendly approach to control the disease antagonistic microbes are being characterized.Among them plant growth promoting rhizobacteria Paenibacillus lentimorbus B-30488 (B-30488) with antagonistic properties, multiple PGP attributes stress tolerance and ACC deaminase enzyme activity is characterized to decipher its mode of action against S. rolfsii under in vitro and in vivo conditions. In vitro results obtained from this study clearly demonstrate that B-30488 has ability to show antagonistic properties under different abiotic stresses against S. rolfsii. Similar results were also obtained from in vivo experiments where B-30488 inoculation has efficiently controlled the disease caused by S. rolfsii and improve the plant growth. Deleterious enhanced ethylene level in S. rolfsii infected plants was also ameliorated by inoculation of ACC deaminase producing B-30488. The ACC accumulation, ACO and ACS activities were also modulated in S. rolfsii infected plants. Results from defense enzymes and other biochemical attributes were also support the role of B-30488 inoculation in ameliorating the biotic stress caused by S. rolfsii in tomato plants. These results were further validated by pathogen related gene expression analysis by real time PCR. Overall results from the present study may be concluded that ACC deaminase producing B-30488 has ability to control the southern blight disease caused by S. rolfsii and commercial bioinoculant package may be developed. PMID:26825539

  7. Expression and characterization of 1-aminocyclopropane-1-carboxylate deaminase from the rhizobacterium Pseudomonas putida UW4: a key enzyme in bacterial plant growth promotion.

    PubMed

    Hontzeas, Nikos; Zoidakis, Jérôme; Glick, Bernard R; Abu-Omar, Mahdi M

    2004-12-01

    The enzyme 1-aminocyclopropane-1-carboxylate deaminase (ACCD) converts ACC, the precursor of the plant hormone ethylene, to alpha-ketobutyrate and ammonium. This enzyme has been identified in soil bacteria and has been proposed to play a key role in microbe-plant association. A soluble recombinant ACCD from Pseudomonas putida UW4 of molecular weight 41 kDa has been cloned, expressed, and purified. It showed selectivity and high activity towards the substrate ACC: K(M)=3.4+/-0.2 mM and k(cat)=146+/-5 min(-1) at pH 8.0 and 22 degrees C. The enzyme displayed optimal activity at pH 8.0 with a sharp decline to essentially no activity below pH 6.5 and a slightly less severe tapering in activity at higher pH resulting in loss of activity at pH>10. The major component of the enzyme's secondary structure was determined to be alpha-helical by circular dichroism (CD). P. putida UW4 ACCD unfolded at 60 degrees C as determined by its CD temperature profile as well as by differential scanning microcalorimetry (DSC). Enzyme activity was knocked out in the point mutant Gly44Asp. Modeling this mutation into the known yeast ACCD structure shed light on the role this highly conserved residue plays in allowing substrate accessibility to the active site. This enzyme's biochemical and biophysical properties will serve as an important reference point to which newly isolated ACC deaminases from other organisms can be compared. PMID:15588698

  8. Synergistic enhancement of ethylene production and germination with kinetin and 1-aminocyclopropane-1-carboxylic Acid in lettuce seeds exposed to salinity stress.

    PubMed

    Khan, A A; Huang, X L

    1988-08-01

    Relief of salt (0.1 molar NaCl) stress on germination of lettuce (Lactuca sativa L., cv Mesa 659) seeds occurred with applications of 0.05 millimolar kinetin (KIN) and 1 to 10 millimolar 1-aminocyclopropane 1-carboxylic acid (ACC). Treatment with KIN enhanced the pregermination ethylene production under saline condition. A synergistic or an additive enhancement of pregermination ethylene production and germination occurred under saline condition in the presence of KIN and a saturating dose (10 millimolar) of ACC. No KIN-ACC synergism was noted in ethylene production or germination under nonsaline condition. Addition of 1 millimolar aminoethoxyvinylglycine (AVG) inhibited the KIN-enhanced pregermination ethylene production (85 to 89%) and germination (58%) under saline condition but not the synergistic effect of KIN + ACC on ethylene production. Under nonsaline condition, AVG had no effect on germination even though ethylene production was strongly inhibited. Alleviation of salt stress by KIN was inhibited in a competitive manner by 2,5-norbornadiene (NBD) (0.02-0.2 milliliter per liter), and the addition of ACC and/or ethylene reduced this inhibition. An increase in the pregermination ethylene production and germination occurred also by cotylenin E (CN) under saline condition. However, neither AVG (1 millimolar) nor NBD (0.02 to 0.2 milliliter per liter) prevented the relief of salt stress by CN. Thus, KIN may alleviate salt stress on germination by promoting both ACC production and its conversion to ethylene. Rapid utilization of ACC may be the basis for the synergistic or the additive effect of KIN plus ACC. The need for ethylene production and action for the relief of salt stress is circumvented by a treatment with CN.

  9. Inducing salt tolerance in mung bean through coinoculation with rhizobia and plant-growth-promoting rhizobacteria containing 1-aminocyclopropane-1-carboxylate deaminase.

    PubMed

    Ahmad, Maqshoof; Zahir, Zahir A; Asghar, H Naeem; Asghar, M

    2011-07-01

    Twenty-five strains of plant-growth-promoting rhizobacteria (PGPR) containing 1-aminocyclopropane-1-carboxylate (ACC) deaminase and 10 strains of rhizobia were isolated from rhizosphere soil samples and nodules of mung bean. They were screened in separate trials under salt-stressed axenic conditions. The three most effective strains of PGPR (Mk1, Pseudomonas syringae ; Mk20, Pseudomonas fluorescens ; and Mk25, Pseudomonas fluorescens biotype G) and Rhizobium phaseoli strains M1, M6, and M9 were evaluated in coinoculation for their growth-promoting activity at three salinity levels (original, 4 dS·m(-1), and 6 dS·m(-1)) under axenic conditions. The results showed that salinity stress significantly reduced plant growth but inoculation with PGPR containing ACC deaminase and rhizobia enhanced plant growth, thus reducing the inhibitory effect of salinity. However, their combined application was more effective under saline conditions, and the combination Mk20 × M6 was the most efficient for improving seedling growth and nodulation. The effect of high ethylene concentrations on plant growth and the performance of these strains for reducing the negative impact of saline stress was also evaluated by conducting a classical triple-response bioassay. The intensity of the classical triple response decreased owing to inoculation with these strains, with the root and shoot lengths of inoculated mung bean seedlings increasing and stem diameter decreasing, which is a typical response to the dilution in a classical triple response bioassay. Thus, coinoculation with PGPR containing ACC deaminase and Rhizobium spp. could be a useful approach for inducing salt tolerance and thus improving growth and nodulation in mung bean under salt-affected conditions.

  10. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings.

    PubMed

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-07-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-alpha1, -alpha2, -gamma1, and -delta, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-gamma1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-gamma 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PA(PLD) signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity.

  11. Induction of isoprenyl diphosphate synthases, plant hormones and defense signalling genes correlates with traumatic resin duct formation in Norway spruce (Picea abies).

    PubMed

    Schmidt, Axel; Nagel, Raimund; Krekling, Trygve; Christiansen, Erik; Gershenzon, Jonathan; Krokene, Paal

    2011-12-01

    Norway spruce (Picea abies) defends itself against herbivores and pathogens by formation of traumatic resin ducts filled with terpenoid-based oleoresin. An important group of enzymes in terpenoid biosynthesis are the short-chain isoprenyl diphosphate synthases which produce geranyl diphosphate (C(10)), farnesyl diphosphate (C(15)), and geranylgeranyl diphosphate (C(20)) as precursors of monoterpenes, sesquiterpenes, and diterpene resin acids, respectively. After treatment with methyl jasmonate (MJ) we investigated the expression of all isoprenyl diphosphate synthase genes characterized to date from Norway spruce and correlated this with formation of traumatic resin ducts and terpene accumulation. Formation of traumatic resin ducts correlated with higher amounts of monoterpenes, sesquiterpenes and diterpene resin acids and an upregulation of isoprenyl diphosphate synthase genes producing geranyl diphosphate or geranylgeranyl diphosphate. Among defense hormones, jasmonate and jasmonate-isoleucine conjugate accumulated to higher levels in trees with extensive traumatic resin duct formation, whereas salicylate did not. Jasmonate and ethylene are likely to both be involved in formation of traumatic resin ducts based on elevated transcripts of genes encoding lipoxygenase and 1-aminocyclopropane-1-carboxylic acid oxidase associated with resin duct formation. Other genes involved in defense signalling in other systems, mitogen-activated protein kinase3 and nonexpressor of pathogenesis-related gene1, were also associated with traumatic resin duct formation. These responses were detected not only at the site of MJ treatment, but also systemically up to 60 cm above the site of treatment on the trunk.

  12. Suppression of Ripening-Associated Gene Expression in Tomato Fruits Subjected to a High CO2 Concentration.

    PubMed Central

    Rothan, C.; Duret, S.; Chevalier, C.; Raymond, P.

    1997-01-01

    High concentrations of CO2 block or delay the ripening of fruits. In this study we investigated the effects of high CO2 on ripening and on the expression of stress- and ripening-inducible genes in cherry tomato (Lycopersicon esculentum Mill.) fruit. Mature-green tomato fruits were submitted to a high CO2 concentration (20%) for 3 d and then transferred to air. These conditions effectively inhibited ripening-associated color changes and ethylene production, and reduced the protein content. No clear-cut effect was observed on the expression of two proteolysis-related genes, encoding polyubiquitin and ubiquitin-conjugating enzyme E2, respectively. Exposure of fruit to high CO2 also resulted in the strong induction of two genes encoding stress-related proteins: a ripening-regulated heat-shock protein and glutamate decarboxylase. Induction of these two genes indicated that high CO2 had a stress effect, most likely through cytosolic acidification. In addition, high CO2 blocked the accumulation of mRNAs for genes involved in the main ripening-related changes: ethylene synthesis (1-aminocyclopropane-1-carboxylic acid synthase and 1-aminocyclopropane-1-carboxylic acid oxidase), color (phytoene synthase), firmness (polygalacturonase), and sugar accumulation (acid invertase). The expression of ripening-specific genes was affected by CO2 regardless of whether their induction was ethylene- or development-dependent. It is proposed that the inhibition of tomato fruit ripening by high CO2 is due, in part, to the suppression of the expression of ripening-associated genes, which is probably related to the stress effect exerted by high CO2. PMID:12223703

  13. Delayed ripening and improved fruit processing quality in tomato by RNAi-mediated silencing of three homologs of 1-aminopropane-1-carboxylate synthase gene.

    PubMed

    Gupta, Aarti; Pal, Ram Krishna; Rajam, Manchikatla Venkat

    2013-07-15

    The ripening hormone, ethylene is known to initiate, modulate and co-ordinate the expression of various genes involved in the ripening process. The burst in ethylene production is the key event for the onset of ripening in climacteric fruits, including tomatoes. Therefore ethylene is held accountable for the tons of post-harvest losses due to over-ripening and subsequently resulting in fruit rotting. In the present investigation, delayed ripening tomatoes were generated by silencing three homologs of 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) gene during the course of ripening using RNAi technology. The chimeric RNAi-ACS construct designed to target ACS homologs, effectively repressed the ethylene production in tomato fruits. Fruits from such lines exhibited delayed ripening and extended shelf life for ∼45 days, with improved juice quality. The ethylene suppression brought about compositional changes in these fruits by enhancing polyamine (PA) levels. Further, decreased levels of ethylene in RNAi-ACS fruits has led to the altered levels of various ripening-specific transcripts, especially the up-regulation of PA biosynthesis and ascorbic acid (AsA) metabolism genes and down-regulation of cell wall hydrolyzing enzyme genes. These results suggest that the down-regulation of ACS homologs using RNAi can be an effective approach for obtaining delayed ripening with longer shelf life and an enhanced processing quality of tomato fruits. Also, the chimeric gene fusion can be used as an effective design for simultaneous silencing of more than one gene. These observations would be useful in better understanding of the ethylene and PA signaling during fruit ripening and molecular mechanisms underlying the interaction of these two molecules in affecting fruit quality traits.

  14. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    PubMed

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  15. Differential expression of ethylene biosynthesis genes in drupelets and receptacle of raspberry (Rubus idaeus).

    PubMed

    Fuentes, Lida; Monsalve, Liliam; Morales-Quintana, Luis; Valdenegro, Mónika; Martínez, Juan-Pablo; Defilippi, Bruno G; González-Agüero, Mauricio

    2015-05-01

    Red Raspberry (Rubus idaeus) is traditionally classified as non-climacteric, and the role of ethylene in fruit ripening is not clear. The available information indicates that the receptacle, a modified stem that supports the drupelets, is involved in ethylene production of ripe fruits. In this study, we report receptacle-related ethylene biosynthesis during the ripening of fruits of cv. Heritage. In addition, the expression pattern of ethylene biosynthesis transcripts was evaluated during the ripening process. The major transcript levels of 1-aminocyclopropane-1-carboxylic acid synthase (RiACS1) and 1-aminocyclopropane-1-carboxylic acid oxidase (RiACO1) were concomitant with ethylene production, increased total soluble solids (TSS) and decreased titratable acidity (TA) and fruit firmness. Moreover, ethylene biosynthesis and transcript levels of RiACS1 and RiACO1 were higher in the receptacle, sustaining the receptacle's role as a source of ethylene in regulating the ripening of raspberry.

  16. Expression of genes responsible for ethylene production and wilting are differently regulated in carnation (Dianthus caryophyllus L.) petals.

    PubMed

    Kosugi; Shibuya; Tsuruno; Iwazaki; Mochizuki; Yoshioka; Hashiba; Satoh

    2000-09-01

    Carnation petals exhibit autocatalytic ethylene production and wilting during senescence. The autocatalytic ethylene production is caused by the expression of 1-aminocyclopropane-1-carboxylate (ACC) synthase and ACC oxidase genes, whereas the wilting of petals is related to the expression of the cysteine proteinase (CPase) gene. So far, it has been believed that the ethylene production and wilting are regulated in concert in senescing carnation petals, since the two events occurred closely in parallel with time. In the present study, we investigated the expression of these genes in petals of a transgenic carnation harboring a sense ACC oxidase transgene and in petals of carnation flowers treated with 1,1-dimethyl-4-(phenylsulfonyl)semicarbazide (DPSS). In petals of the transgenic carnation flowers, treatment with exogenous ethylene caused accumulation of the transcript for CPase and in-rolling (wilting), whereas it caused no or little accumulation of the transcripts for ACC oxidase and ACC synthase and negligible ethylene production. In petals of the flowers treated with DPSS, the transcripts for ACC synthase and ACC oxidase were accumulated, but no significant change in the level of the transcript for CPase was observed. These results suggest that the expression of ACC synthase and ACC oxidase genes, which leads to ethylene production, is differentially regulated from the expression of CPase, which leads to wilting, in carnation petals.

  17. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

    PubMed Central

    Chang, Ing-Feng

    2013-01-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

  18. Regulation of a Chitinase Gene Promoter by Ethylene and Elicitors in Bean Protoplasts 1

    PubMed Central

    Roby, Dominique; Broglie, Karen; Gaynor, John; Broglie, Richard

    1991-01-01

    Chitinase gene expression has been shown to be transcriptionally regulated by a number of inducers, including ethylene, elicitors, and pathogen attack. To investigate the mechanism(s) responsible for induction of chitinase gene expression in response to various stimuli, we have developed a transient gene expression system in bean (Phaseolus vulgaris) protoplasts that is responsive to ethylene and elicitor treatment. This system was used to study the expression of a chimeric gene composed of the 5′ flanking sequences of a bean endochitinase gene fused to the reporter gene β-glucuronidase linked to a 3′ fragment from nopaline synthase. Addition of 1-aminocyclopropane-1-carboxylic acid, the direct precursor of ethylene, or elicitors such as chitin oligosaccharides or cell wall fragments derived from Colletotrichum lagenarium, to transformed protoplasts resulted in a rapid and marked increase in the expression of the chimeric gene. The kinetics and dose response for these treatments were similar to those observed for the native gene in vivo. Analyses of 5′ deletion mutants in the protoplast system indicated that DNA sequences located between −305 and −236 are important for both ethylene and elicitor induction of the reporter gene. ImagesFigure 1 PMID:16668405

  19. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    PubMed

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. PMID:24716518

  20. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    PubMed

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling.

  1. Ethylene biosynthetic genes are differentially expressed during carnation (Dianthus caryophyllus L.) flower senescence.

    PubMed

    ten Have, A; Woltering, E J

    1997-05-01

    Ethylene production and expression patterns of an 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase (CARAO1) and of two ACC synthase (EC 4.4.1.14) genes (CARACC3 and CARAS1) were studied in floral organs of cut carnation flowers (Dianthus caryophyllus L.) cv. White Sim. During the vase life and after treatment of fresh flowers with ethylene, production of ethylene and expression of ethylene biosynthetic genes first started in the ovary followed by the styles and the petals. ACC oxidase was expressed in all the floral organs whereas, during the vase life, tissue-specific expression of the two ACC synthase genes was observed. After treatment with a high ethylene concentration, tissue specificity of the two ACC synthase genes was lost and only a temporal difference in expression remained. In styles, poor correlation between ethylene production and ACC synthase (CARAS1) gene expression was observed suggesting that either activity is regulated at the translational level or that the CARAS1 gene product requires an additional factor for activity. Isolated petals showed no increase in ethylene production and expression of ethylene biosynthetic genes when excised from the flower before the increase in petal ethylene production (before day 7); showed rapid cessation of ethylene production and gene expression when excised during the early phase of petal ethylene production (day 7) and showed a pattern of ethylene production and gene expression similar to the pattern observed in the attached petals when isolated at day 8. The interorgan regulation of gene expression and ethylene as a signal molecule in flower senescence are discussed.

  2. The formation of ACC and competition between polyamines and ethylene for SAM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene biosynthesis involves the conversion of S-adenosylmethionine (SAM) to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS). ACC is then converted to ethylene. The genes that encode enzymes in this pathway all belong to a family of genes. Differential transcriptional regulation ...

  3. Analysis of gene expression during the transition to climacteric phase in carnation flowers (Dianthus caryophyllus L.).

    PubMed

    In, Byung-Chun; Binder, Brad M; Falbel, Tanya G; Patterson, Sara E

    2013-11-01

    It has been generally thought that in ethylene-sensitive plants such as carnations, senescence proceeds irreversibly once the tissues have entered the climacteric phase. While pre-climacteric petal tissues have a lower sensitivity to ethylene, these tissues are converted to the climacteric phase at a critical point during flower development. In this study, it is demonstrated that the senescence process initiated by exogenous ethylene is reversible in carnation petals. Petals treated with ethylene for 12h showed sustained inrolling and senescence, while petals treated with ethylene for 10h showed inrolling followed by recovery from inrolling. Reverse transcription-PCR analysis revealed differential expression of genes involved in ethylene biosynthesis and ethylene signalling between 10h and 12h ethylene treatment. Ethylene treatment at or beyond 12h (threshold time) decreased the mRNA levels of the receptor genes (DcETR1, DcERS1, and DcERS2) and DcCTR genes, and increased the ethylene biosynthesis genes DcACS1 and DcACO1. In contrast, ethylene treatment under the threshold time caused a transient decrease in the receptor genes and DcCTR genes, and a transient increase in DcACS1 and DcACO1. Sustained DcACS1 accumulation is correlated with decreases in DcCTR genes and increase in DcEIL3 and indicates that tissues have entered the climacteric phase and that senescence proceeds irreversibly. Inhibition of ACS (1-aminocyclopropane-1-carboxylic acid synthase) prior to 12h ethylene exposure was not able to prevent reduction in transcripts of DcCTR genes, yet suppressed transcript of DcACS1 and DcACO1. This leads to the recovery from inrolling of the petals, indicating that DcACS1 may act as a signalling molecule in senescence of flowers.

  4. Exogenous ethylene influences flower opening of cut roses (Rosa hybrida) by regulating the genes encoding ethylene biosynthesis enzymes.

    PubMed

    Ma, Nan; Cai, Lei; Lu, Wangjin; Tan, Hui; Gao, Junping

    2005-10-01

    The purpose of this paper is to investigate the differential responses of flower opening to ethylene in two cut rose cultivars, 'Samantha', whose opening process is promoted, and 'Kardinal', whose opening process is inhibited by ethylene. Ethylene production and 1-aminocyclopropane-1-carboxylate (ACC) synthase and oxidase activities were determined first. After ethylene treatment, ethylene production, ACC synthase (ACS) and ACC oxidase (ACO) activities in petals increased and peaked at the earlier stage (stage 3) in 'Samantha', and they were much more dramatically enhanced and peaked at the later stage (stage 4) in 'Kardinal' than control during vasing. cDNA fragments of three Rh-ACSs and one Rh-ACO genes were cloned and designated as Rh-ACS1, Rh-ACS2, Rh-ACS3 and Rh-ACO1 respectively. Northern blotting analysis revealed that, among three genes of ACS, ethylene-in- duced expression patterns of Rh-ACS3 gene corresponded to ACS activity and ethylene production in both cultivars. A more dramatic accumulation of Rh-ACS3 mRNA was induced by ethylene in 'Kardinal' than that of 'Samantha'. As an ethylene action inhibitor, STS at concentration of 0.2 mmol/L generally inhibited the expression of Rh-ACSs and Rh-ACO in both cultivars, although it induced the expression of Rh-ACS3 transiently in 'Kardinal'. Our results suggests that 'Kardinal' is more sensitive to ethylene than 'Samantha'; and the changes of Rh-ACS3 expression caused by ethylene might be related to the acceleration of flower opening in 'Samantha' and the inhibition in 'Kardinal'. Additional results indicated that three Rh-ACSs genes were differentially associated with flower opening and senescence as well as wounding

  5. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon.

  6. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  7. Role for the banana AGAMOUS-like gene MaMADS7 in regulation of fruit ripening and quality.

    PubMed

    Liu, Juhua; Liu, Lin; Li, Yujia; Jia, Caihong; Zhang, Jianbin; Miao, Hongxia; Hu, Wei; Wang, Zhuo; Xu, Biyu; Jin, Zhiqiang

    2015-11-01

    MADS-box transcription factors play important roles in organ development. In plants, most studies on MADS-box genes have mainly focused on flower development and only a few concerned fruit development and ripening. A new MADS-box gene named MaMADS7 was isolated from banana fruit by rapid amplification of cDNA ends (RACE) based on a MADS-box fragment obtained from a banana suppression subtractive hybridization (SSH) cDNA library. MaMADS7 is an AGAMOUS-like MADS-box gene that is preferentially expressed in the ovaries and fruits and in tobacco its protein product localizes to the nucleus. This study found that MaMADS7 expression can be induced by exogenous ethylene. Ectopic expression of MaMADS7 in tomato resulted in broad ripening phenotypes. The expression levels of seven ripening and quality-related genes, ACO1, ACS2, E4, E8, PG, CNR and PSY1 in MaMADS7 transgenic tomato fruits were greatly increased while the expression of the AG-like MADS-box gene TAGL1 was suppressed. Compared with the control, the contents of β-carotene, lycopene, ascorbic acid and organic acid in transformed tomato fruits were increased, while the contents of glucose and fructose were slightly decreased. MaMADS7 interacted with banana 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene 1 (MaACO1) and tomato phytoene synthase gene (LePSY1) promoters. Our results indicated that MaMADS7 plays an important role in initiating endogenous ethylene biosynthesis and fruit ripening. PMID:25980771

  8. Role for the banana AGAMOUS-like gene MaMADS7 in regulation of fruit ripening and quality.

    PubMed

    Liu, Juhua; Liu, Lin; Li, Yujia; Jia, Caihong; Zhang, Jianbin; Miao, Hongxia; Hu, Wei; Wang, Zhuo; Xu, Biyu; Jin, Zhiqiang

    2015-11-01

    MADS-box transcription factors play important roles in organ development. In plants, most studies on MADS-box genes have mainly focused on flower development and only a few concerned fruit development and ripening. A new MADS-box gene named MaMADS7 was isolated from banana fruit by rapid amplification of cDNA ends (RACE) based on a MADS-box fragment obtained from a banana suppression subtractive hybridization (SSH) cDNA library. MaMADS7 is an AGAMOUS-like MADS-box gene that is preferentially expressed in the ovaries and fruits and in tobacco its protein product localizes to the nucleus. This study found that MaMADS7 expression can be induced by exogenous ethylene. Ectopic expression of MaMADS7 in tomato resulted in broad ripening phenotypes. The expression levels of seven ripening and quality-related genes, ACO1, ACS2, E4, E8, PG, CNR and PSY1 in MaMADS7 transgenic tomato fruits were greatly increased while the expression of the AG-like MADS-box gene TAGL1 was suppressed. Compared with the control, the contents of β-carotene, lycopene, ascorbic acid and organic acid in transformed tomato fruits were increased, while the contents of glucose and fructose were slightly decreased. MaMADS7 interacted with banana 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene 1 (MaACO1) and tomato phytoene synthase gene (LePSY1) promoters. Our results indicated that MaMADS7 plays an important role in initiating endogenous ethylene biosynthesis and fruit ripening.

  9. Ethylene and Wound-Induced Gene Expression in the Preclimacteric Phase of Ripening Avocado Fruit and Mesocarp Discs.

    PubMed Central

    Starrett, D. A.; Laties, G. G.

    1993-01-01

    Whereas intact postharvest avocado (Persea americana Mill.) fruit may take 1 or more weeks to ripen, ripening is hastened by pulsing fruit for 24 h with ethylene or propylene and is initiated promptly by cutting slices, or discs, of mesocarp tissue. Because the preclimacteric lag period constitutes the extended and variable component of the ripening syndrome, we postulated that selective gene expression during the lag period leads to the triggering of the climacteric. Accordingly, we sought to identify genes that are expressed gradually in the course of the lag period in intact fruit, are turned on sooner in response to a pulse, and are induced promptly in response to wounding (i.e. slicing). To this end, a mixed cDNA library was constructed from mRNA from untreated fruit, pulsed fruit, and aged slices, and the library was screened for genes induced by wounding or by pulsing and/or wounding. The time course of induction of genes encoding selected clones was established by probing northern blots of mRNA from tissues variously treated over a period of time. Four previously identified ripening-associated genes encoding cellulase, polygalacturonase (PG), cytochrome P-450 oxidase (P-450), and ethylene-forming enzyme (EFE, or 1-aminocyclopropane-1-carboxylic acid synthase), respectively, were studied in the same way. Whereas cellulase, PG, and EFE were ruled out as having a role in the initiation of the climacteric, the time course of P-450 induction, as well as the response of same to pulsing and wounding met the criteria[mdash]together with several clones from the mixed library[mdash]for a gene potentially involved in preclimacteric events leading to the onset of the climacteric. Further, it was established that the continuous presence of ethylene is required for persisting induction, and it is suggested that in selected cases wounding may exert a synergistic effect on ethylene action. PMID:12231929

  10. The Andromonoecious Sex Determination Gene Predates the Separation of Cucumis and Citrullus Genera.

    PubMed

    Boualem, Adnane; Lemhemdi, Afef; Sari, Marie-Agnes; Pignoly, Sarah; Troadec, Christelle; Abou Choucha, Fadi; Solmaz, Ilknur; Sari, Nebahat; Dogimont, Catherine; Bendahmane, Abdelhafid

    2016-01-01

    Understanding the evolution of sex determination in plants requires the cloning and the characterization of sex determination genes. Monoecy is characterized by the presence of both male and female flowers on the same plant. Andromonoecy is characterized by plants carrying both male and bisexual flowers. In watermelon, the transition between these two sexual forms is controlled by the identity of the alleles at the A locus. We previously showed, in two Cucumis species, melon and cucumber, that the transition from monoecy to andromonoecy results from mutations in 1-aminocyclopropane-1-carboxylic acid synthase (ACS) gene, ACS-7/ACS2. To test whether the ACS-7/ACS2 function is conserved in cucurbits, we cloned and characterized ClACS7 in watermelon. We demonstrated co-segregation of ClACS7, the homolog of CmACS-7/CsACS2, with the A locus. Sequence analysis of ClACS7 in watermelon accessions identified three ClACS7 isoforms, two in andromonoecious and one in monoecious lines. To determine whether the andromonoecious phenotype is due to a loss of ACS enzymatic activity, we expressed and assayed the activity of the three protein isoforms. Like in melon and cucumber, the isoforms from the andromonoecious lines showed reduced to no enzymatic activity and the isoform from the monoecious line was active. Consistent with this, the mutations leading andromonoecy were clustered in the active site of the enzyme. Based on this, we concluded that active ClACS7 enzyme leads to the development of female flowers in monoecious lines, whereas a reduction of enzymatic activity yields hermaphrodite flowers. ClACS7, like CmACS-7/CsACS2 in melon and cucumber, is highly expressed in carpel primordia of buds determined to develop carpels and not in male flowers. Based on this finding and previous investigations, we concluded that the monoecy gene, ACS7, likely predated the separation of the Cucumis and Citrullus genera. PMID:27171236

  11. The Andromonoecious Sex Determination Gene Predates the Separation of Cucumis and Citrullus Genera

    PubMed Central

    Boualem, Adnane; Lemhemdi, Afef; Sari, Marie-Agnes; Pignoly, Sarah; Troadec, Christelle; Abou Choucha, Fadi; Solmaz, Ilknur; Sari, Nebahat; Dogimont, Catherine; Bendahmane, Abdelhafid

    2016-01-01

    Understanding the evolution of sex determination in plants requires the cloning and the characterization of sex determination genes. Monoecy is characterized by the presence of both male and female flowers on the same plant. Andromonoecy is characterized by plants carrying both male and bisexual flowers. In watermelon, the transition between these two sexual forms is controlled by the identity of the alleles at the A locus. We previously showed, in two Cucumis species, melon and cucumber, that the transition from monoecy to andromonoecy results from mutations in 1-aminocyclopropane-1-carboxylic acid synthase (ACS) gene, ACS-7/ACS2. To test whether the ACS-7/ACS2 function is conserved in cucurbits, we cloned and characterized ClACS7 in watermelon. We demonstrated co-segregation of ClACS7, the homolog of CmACS-7/CsACS2, with the A locus. Sequence analysis of ClACS7 in watermelon accessions identified three ClACS7 isoforms, two in andromonoecious and one in monoecious lines. To determine whether the andromonoecious phenotype is due to a loss of ACS enzymatic activity, we expressed and assayed the activity of the three protein isoforms. Like in melon and cucumber, the isoforms from the andromonoecious lines showed reduced to no enzymatic activity and the isoform from the monoecious line was active. Consistent with this, the mutations leading andromonoecy were clustered in the active site of the enzyme. Based on this, we concluded that active ClACS7 enzyme leads to the development of female flowers in monoecious lines, whereas a reduction of enzymatic activity yields hermaphrodite flowers. ClACS7, like CmACS-7/CsACS2 in melon and cucumber, is highly expressed in carpel primordia of buds determined to develop carpels and not in male flowers. Based on this finding and previous investigations, we concluded that the monoecy gene, ACS7, likely predated the separation of the Cucumis and Citrullus genera. PMID:27171236

  12. The Andromonoecious Sex Determination Gene Predates the Separation of Cucumis and Citrullus Genera.

    PubMed

    Boualem, Adnane; Lemhemdi, Afef; Sari, Marie-Agnes; Pignoly, Sarah; Troadec, Christelle; Abou Choucha, Fadi; Solmaz, Ilknur; Sari, Nebahat; Dogimont, Catherine; Bendahmane, Abdelhafid

    2016-01-01

    Understanding the evolution of sex determination in plants requires the cloning and the characterization of sex determination genes. Monoecy is characterized by the presence of both male and female flowers on the same plant. Andromonoecy is characterized by plants carrying both male and bisexual flowers. In watermelon, the transition between these two sexual forms is controlled by the identity of the alleles at the A locus. We previously showed, in two Cucumis species, melon and cucumber, that the transition from monoecy to andromonoecy results from mutations in 1-aminocyclopropane-1-carboxylic acid synthase (ACS) gene, ACS-7/ACS2. To test whether the ACS-7/ACS2 function is conserved in cucurbits, we cloned and characterized ClACS7 in watermelon. We demonstrated co-segregation of ClACS7, the homolog of CmACS-7/CsACS2, with the A locus. Sequence analysis of ClACS7 in watermelon accessions identified three ClACS7 isoforms, two in andromonoecious and one in monoecious lines. To determine whether the andromonoecious phenotype is due to a loss of ACS enzymatic activity, we expressed and assayed the activity of the three protein isoforms. Like in melon and cucumber, the isoforms from the andromonoecious lines showed reduced to no enzymatic activity and the isoform from the monoecious line was active. Consistent with this, the mutations leading andromonoecy were clustered in the active site of the enzyme. Based on this, we concluded that active ClACS7 enzyme leads to the development of female flowers in monoecious lines, whereas a reduction of enzymatic activity yields hermaphrodite flowers. ClACS7, like CmACS-7/CsACS2 in melon and cucumber, is highly expressed in carpel primordia of buds determined to develop carpels and not in male flowers. Based on this finding and previous investigations, we concluded that the monoecy gene, ACS7, likely predated the separation of the Cucumis and Citrullus genera.

  13. Cadmium-induced ethylene production and responses in Arabidopsis thaliana rely on ACS2 and ACS6 gene expression

    PubMed Central

    2014-01-01

    Background Anthropogenic activities cause metal pollution worldwide. Plants can absorb and accumulate these metals through their root system, inducing stress as a result of excess metal concentrations inside the plant. Ethylene is a regulator of multiple plant processes, and is affected by many biotic and abiotic stresses. Increased ethylene levels have been observed after exposure to excess metals but it remains unclear how the increased ethylene levels are achieved at the molecular level. In this study, the effects of cadmium (Cd) exposure on the production of ethylene and its precursor 1-aminocyclopropane-1-carboxylic acid (ACC), and on the expression of the ACC Synthase (ACS) and ACC Oxidase (ACO) multigene families were investigated in Arabidopsis thaliana. Results Increased ethylene release after Cd exposure was directly measurable in a system using rockwool-cultivated plants; enhanced levels of the ethylene precursor ACC together with higher mRNA levels of ethylene responsive genes: ACO2, ETR2 and ERF1 also indicated increased ethylene production in hydroponic culture. Regarding underlying mechanisms, it was found that the transcript levels of ACO2 and ACO4, the most abundantly expressed members of the ACO multigene family, were increased upon Cd exposure. ACC synthesis is the rate-limiting step in ethylene biosynthesis, and transcript levels of both ACS2 and ACS6 showed the highest increase and became the most abundant isoforms after Cd exposure, suggesting their importance in the Cd-induced increase of ethylene production. Conclusions Cadmium induced the biosynthesis of ACC and ethylene in Arabidopsis thaliana plants mainly via the increased expression of ACS2 and ACS6. This was confirmed in the acs2-1acs6-1 double knockout mutants, which showed a decreased ethylene production, positively affecting leaf biomass and resulting in a delayed induction of ethylene responsive gene expressions without significant differences in Cd contents between wild-type and

  14. A tomato MADS-box transcription factor, SlMADS1, acts as a negative regulator of fruit ripening.

    PubMed

    Dong, Tingting; Hu, Zongli; Deng, Lei; Wang, Yi; Zhu, Mingku; Zhang, Jianling; Chen, Guoping

    2013-10-01

    MADS-box genes encode a highly conserved gene family of transcriptional factors that regulate numerous developmental processes in plants. In this study, a tomato (Solanum lycopersicum) MADS-box gene, SlMADS1, was cloned and its tissue-specific expression profile was analyzed. The real-time polymerase chain reaction results showed that SlMADS1 was highly expressed in sepals and fruits; its expression level was increased with the development of sepals, while the transcript of SlMADS1 decreased significantly in accordance with fruit ripening. To further explore the function of SlMADS1, an RNA interference (RNAi) expression vector targeting SlMADS1 was constructed and transformed into tomato plants. Shorter ripening time of fruit was observed in SlMADS1-silenced tomatoes. The accumulation of carotenoid and the expression of PHYTOENE SYNTHETASE1 were enhanced in RNAi fruits. Besides, ethylene biosynthetic genes, including 1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE1A, 1-AMINOCYCLOPROPANE-1-CARBOXYLATE SYNTHASE6, 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE1, and 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE3, and the ethylene-responsive genes E4 and E8, which were involved in fruit ripening, were also up-regulated in silenced plants. SlMADS1 RNAi fruits showed approximately 2- to 4-fold increases in ethylene production compared with the wild type. Furthermore, SlMADS1-silenced seedlings displayed shorter hypocotyls and were more sensitive to 1-aminocyclopropane-1-carboxylate than the wild type. Additionally, a yeast two-hybrid assay revealed a clear interaction between SlMADS1 and SlMADS-RIN. These results suggest that SlMADS1 plays an important role in fruit ripening as a repressive modulator.

  15. Isoelectric focusing of wound-induced tomato ACC synthase

    SciTech Connect

    White, J.A.; Kende, H. )

    1990-05-01

    Several techniques of electrofocusing have been used to determine whether 1-aminocyclopropane-1-carboxylate (ACC) synthase isolated from wounded tomato pericarp tissue exists in different isoforms, each with its characteristic isoelectric point (pI). The pI of the native enzyme was found to be 6.0 {plus minus} 0.2. When radiolabeled, denatured ACC synthase was electrofocused by non-equilibrium pH gradient electrophoresis (NEpHGE), the enzyme separated into four discernible spots which, upon reaching equilibrium, ranged in pI from 6.6 to 6.9. Immunopurified ACC synthase from four tomato cultivars (Duke, Cornell, Mountain Pride and Pik Red) migrated in each case as a 50-kDa protein on sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE). We propose that native ACC synthase in extracts of tomato pericarp tissue exists in one single form and that the charge heterogeneities observed upon electrofocusing of denatured enzyme result from modifications of preexisting protein.

  16. Burst of ethylene upon horizontal placement of tomato seedlings

    NASA Technical Reports Server (NTRS)

    Harrison, M.; Pickard, B. G.

    1984-01-01

    Seedlings of Lycopersicon esculentum Mill. cv Rutgers emit a pulse of ethylene during the first 2 to 4 minutes following horizontal placement. Because this burst appears too rapid and brief to be mediated by increase in net activity of 1-aminocyclopropane-1-carboxylic acid synthase, it might result form accelerated transformation of vacuolar 1-aminocyclopropane-1-carboxylic acid to ethylene.

  17. Targeted systems biology profiling of tomato fruit reveals coordination of the Yang cycle and a distinct regulation of ethylene biosynthesis during postclimacteric ripening.

    PubMed

    Van de Poel, Bram; Bulens, Inge; Markoula, Aikaterina; Hertog, Maarten L A T M; Dreesen, Rozemarijn; Wirtz, Markus; Vandoninck, Sandy; Oppermann, Yasmin; Keulemans, Johan; Hell, Ruediger; Waelkens, Etienne; De Proft, Maurice P; Sauter, Margret; Nicolai, Bart M; Geeraerd, Annemie H

    2012-11-01

    The concept of system 1 and system 2 ethylene biosynthesis during climacteric fruit ripening was initially described four decades ago. Although much is known about fruit development and climacteric ripening, little information is available about how ethylene biosynthesis is regulated during the postclimacteric phase. A targeted systems biology approach revealed a novel regulatory mechanism of ethylene biosynthesis of tomato (Solanum lycopersicum) when fruit have reached their maximal ethylene production level and which is characterized by a decline in ethylene biosynthesis. Ethylene production is shut down at the level of 1-aminocyclopropane-1-carboxylic acid oxidase. At the same time, 1-aminocyclopropane-1-carboxylic acid synthase activity increases. Analysis of the Yang cycle showed that the Yang cycle genes are regulated in a coordinated way and are highly expressed during postclimacteric ripening. Postclimacteric red tomatoes on the plant showed only a moderate regulation of 1-aminocyclopropane-1-carboxylic acid synthase and Yang cycle genes compared with the regulation in detached fruit. Treatment of red fruit with 1-methylcyclopropane and ethephon revealed that the shut-down mechanism in ethylene biosynthesis is developmentally programmed and only moderately ethylene sensitive. We propose that the termination of autocatalytic ethylene biosynthesis of system 2 in ripe fruit delays senescence and preserves the fruit until seed dispersal.

  18. Optimatization of transient transformation methods to study gene expression in Musa acuminata (AAA group) cultivar Ambon Lumut

    NASA Astrophysics Data System (ADS)

    Prayuni, Kinasih; Dwivany, Fenny M.

    2015-09-01

    Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.

  19. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    PubMed

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time.

  20. Transcription of Biotic Stress Associated Genes in White Clover (Trifolium repens L.) Differs in Response to Cyst and Root-Knot Nematode Infection

    PubMed Central

    Islam, Afsana; Mercer, Chris F.; Leung, Susanna; Dijkwel, Paul P.

    2015-01-01

    The transcription of four members of the Kunitz proteinase inhibitor (KPI) gene family of white clover (Trifolium repens L.), designated as Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5, was investigated at both local infection (roots) and systemic (leaf tissue) sites in white clover in response to infection with the clover root knot nematode (CRKN) Meloidogyne trifoliophila and the clover cyst nematode (CCN) Heterodera trifolii. Invasion by the CRKN resulted in a significant decrease in transcript abundance of Tr-KPI4 locally at both 4 days post-infection (dpi) and at 8 dpi, and an increase in transcription of Tr-KPI1 systemically at 8 dpi. In contrast, an increase in transcript abundance of all four Tr-KPI genes locally at 4 and 8 dpi, and an increase of Tr-KPI1, Tr-KPI2, and Tr-KPI5 at 8 dpi systemically was observed in response to infection with the CCN. Challenge of a resistant (R) genotype and a susceptible (S) genotype of white clover with the CCN revealed a significant increase in transcript abundance of all four Tr-KPI genes locally in the R genotype, while an increase in abundance of only Tr-KPI1, Tr-KPI2, and Tr-KPI5 was observed in the S genotype, and only at 4 dpi. The transcript abundance of a member of the1-AMINOCYCLOPROPANE-1-CARBOXYLATE (ACC) SYNTHASE gene family from white clover (Tr-ACS1) was significantly down-regulated locally in response to CRKN infection at 4 and 8 dpi and at 4 dpi, systemically, while abundance increased locally and systemically at 8 dpi in response to CCN challenge. Conversely, the abundance of the jasmonic acid (JA) signalling gene, CORONATINE-INSENSITIVE PROTEIN 1 from white clover (Tr-COI1) increased significantly at 8 dpi locally in response to CRKN infection, but decreased at 8 dpi in response to CCN infection. The significance of this differential regulation of transcription is discussed with respect to differences in infection strategy of the two nematode species. PMID:26393362

  1. Surrogate splicing for functional analysis of sesquiterpene synthase genes.

    PubMed

    Wu, Shuiqin; Schoenbeck, Mark A; Greenhagen, Bryan T; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M; Chappell, Joseph

    2005-07-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing beta-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for alpha-barbatene, thujopsene, and beta-chamigrene biosynthesis. PMID:15965019

  2. Ethylene production and β-cyanoalanine synthase activity in carnation flowers.

    PubMed

    Manning, K

    1986-05-01

    The relationship between ethylene production and the CN(-)-assimilating enzyme β-cyanoalanine synthase (CAS; EC 4.4.1.9) was examined in the carnation (Dianthus caryophyllus L.) flower. In petals from cut flowers aged naturally or treated with ethylene to accelerate senescence the several hundred-fold increase in ethylene production which occurred during irreversible wilting was accompanied by a one- to twofold increase in CAS activity. The basal parts of the petal, which produced the most ethylene, had the highest CAS activity. Studies of flower parts (styles, ovaries, receptacles, petals) showed that the styles had a high level of CAS together with the ethylene-forming enzyme (EFE) system for converting 1-aminocyclopropane-1-carboxylic acid (ACC) to ethylene. The close association between CAS and EFE found in styles could also be observed in detached petals after induction by ACC or ethylene. Treatment of the cut flowers with cycloheximide reduced synthesis of CAS and EFE. The data indicate that CAS and ethylene production are associated, and are discussed in relation to the hypothesis that CN(-) is formed during the conversion of ACC to ethylene.

  3. Effect of drought and high solar radiation on 1-aminocyclopropane-1-carboxylic acid and abscisic acid concentrations in Rosmarinus officinalis plants.

    PubMed

    Munné-Bosch, Sergi; López-Carbonell, Marta; Alegre, Leonor; Van Onckelen, Harry A

    2002-03-01

    The endogenous concentrations of ACC and ABA were measured, at predawn and at maximum solar radiation, during a summer drought, and recovery after autumn rainfalls, in rosemary (Rosmarinus officinalis L.), a drought-tolerant species, growing under Mediterranean field conditions. During the summer, plants were subjected to both water deficit and high solar radiation. Plants showed severe reductions in shoot water potential to -3 MPa, which were associated with drastic stomatal closure (73%), a decrease in net photosynthesis, reaching almost zero, and a severe chlorophyll loss (74%). Despite the severity of the stress, plants recovered after the autumn rainfalls. The concentration of ACC was not enhanced by drought, and at predawn these concentrations remained constant at approximately 600 pmol ACC-1 DW throughout the experiment. Thus, ethylene did not regulate the response of rosemary to drought. However, a sharp increase in ACC levels between predawn and midday was observed. This increase was positively correlated to the intensity of the incident solar radiation. ACC levels recorded in June at midday reached 16 000 pmol g DW and in October values of 1000 pmol g-1 DW were observed. In contrast, in drought-stressed plants predawn concentrations of ABA were up to 130-fold those of recovered plants, and the levels of ABA scored at midday were double of those scored at predawn. In conclusion, although drought-stressed rosemary plants showed a relatively moderate ABA accumulation (approximately 500 pmol g-1 DW#, at predawn), it seems to be an essential factor for the regulation of the plant response to stress, thereby enabling a rapid recovery after stress release, although other mechanisms can not be excluded. As drought stress did not induce ACC accumulation, it was concluded that ethylene production was not a major factor in the drought stress resistance of rosemary plants. The increased ACC and ABA concentrations at midday were correlated with day length and light intensity and not with the water status of the plant.

  4. Divinyl ether synthase gene, and protein and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2006-12-26

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  5. Divinyl ether synthase gene and protein, and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  6. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus.

    PubMed

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1-2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1-2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  7. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    PubMed Central

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1–2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1–2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  8. Arabidopsis protein phosphatase 2C ABI1 interacts with type I ACC synthases and is involved in the regulation of ozone-induced ethylene biosynthesis.

    PubMed

    Ludwików, Agnieszka; Cieśla, Agata; Kasprowicz-Maluśki, Anna; Mituła, Filip; Tajdel, Małgorzata; Gałgański, Łukasz; Ziółkowski, Piotr A; Kubiak, Piotr; Małecka, Arleta; Piechalak, Aneta; Szabat, Marta; Górska, Alicja; Dąbrowski, Maciej; Ibragimow, Izabela; Sadowski, Jan

    2014-06-01

    Ethylene plays a crucial role in various biological processes and therefore its biosynthesis is strictly regulated by multiple mechanisms. Posttranslational regulation, which is pivotal in controlling ethylene biosynthesis, impacts 1-aminocyclopropane 1-carboxylate synthase (ACS) protein stability via the complex interplay of specific factors. Here, we show that the Arabidopsis thaliana protein phosphatase type 2C, ABI1, a negative regulator of abscisic acid signaling, is involved in the regulation of ethylene biosynthesis under oxidative stress conditions. We found that ABI1 interacts with ACS6 and dephosphorylates its C-terminal fragment, a target of the stress-responsive mitogen-activated protein kinase, MPK6. In addition, ABI1 controls MPK6 activity directly and by this means also affects the ACS6 phosphorylation level. Consistently with this, ozone-induced ethylene production was significantly higher in an ABI1 knockout strain (abi1td) than in wild-type plants. Importantly, an increase in stress-induced ethylene production in the abi1td mutant was compensated by a higher ascorbate redox state and elevated antioxidant activities. Overall, the results of this study provide evidence that ABI1 restricts ethylene synthesis by affecting the activity of ACS6. The ABI1 contribution to stress phenotype underpins its role in the interplay between the abscisic acid (ABA) and ethylene signaling pathways. PMID:24637173

  9. A conserved mutation in an ethylene biosynthesis enzyme leads to andromonoecy in melons.

    PubMed

    Boualem, Adnane; Fergany, Mohamed; Fernandez, Ronan; Troadec, Christelle; Martin, Antoine; Morin, Halima; Sari, Marie-Agnes; Collin, Fabrice; Flowers, Jonathan M; Pitrat, Michel; Purugganan, Michael D; Dogimont, Catherine; Bendahmane, Abdelhafid

    2008-08-01

    Andromonoecy is a widespread sexual system in angiosperms characterized by plants carrying both male and bisexual flowers. In melon, this sexual form is controlled by the identity of the alleles at the andromonoecious (a) locus. Cloning of the a gene reveals that andromonoecy results from a mutation in the active site of 1-aminocyclopropane-1-carboxylic acid synthase. Expression of the active enzyme inhibits the development of the male organs and is not required for carpel development. A causal single-nucleotide polymorphism associated with andromonoecy was identified, which suggests that the a allele has been under recent positive selection and may be linked to the evolution of this sexual system.

  10. High diversity of polyketide synthase genes and the melanin biosynthesis gene cluster in Penicillium marneffei.

    PubMed

    Woo, Patrick C Y; Tam, Emily W T; Chong, Ken T K; Cai, James J; Tung, Edward T K; Ngan, Antonio H Y; Lau, Susanna K P; Yuen, Kwok-Yung

    2010-09-01

    Despite the unique phenotypic properties and clinical importance of Penicillium marneffei, the polyketide synthase genes in its genome have never been characterized. Twenty-three putative polyketide synthase genes and two putative polyketide synthase nonribosomal peptide-synthase hybrid genes were identified in the P. marneffei genome, a diversity much higher than found in other pathogenic thermal dimorphic fungi, such as Histoplasma capsulatum (one polyketide synthase gene) and Coccidioides immitis (10 polyketide synthase genes). These genes were evenly distributed on the phylogenetic tree with polyketide synthase genes of Aspergillus and other fungi, indicating that the high diversity was not a result of lineage-specific gene expansion through recent gene duplication. The melanin-biosynthesis gene cluster had gene order and orientations identical to those in the Talaromyces stipitatus (a teleomorph of Penicillium emmonsii) genome. Phylogenetically, all six genes of the melanin-biosynthesis gene cluster in P. marneffei were also most closely related to those in T. stipitatus, with high bootstrap supports. The polyketide synthase gene of the melanin-biosynthesis gene cluster (alb1) in P. marneffei was knocked down, which was accompanied by loss of melanin pigment production and reduced ornamentation in conidia. The survival of mice challenged with the alb1 knockdown mutant was significantly better than those challenged with wild-type P. marneffei (P < 0.005). The sterilizing doses of hydrogen peroxide, leading to a 50% reduction in survival of conidia, were 11 min for wild-type P. marneffei and 6 min for the alb1 knockdown mutant of P. marneffei, implying that the melanin-biosynthesis gene cluster contributed to virulence through decreased susceptibility to killing by hydrogen peroxide. PMID:20718860

  11. Selection of Reference Genes for Gene Expression Normalization in Peucedanum praeruptorum Dunn under Abiotic Stresses, Hormone Treatments and Different Tissues

    PubMed Central

    Zhao, Yucheng; Luo, Jun; Xu, Sheng; Wang, Wei; Liu, Tingting; Han, Chao; Chen, Yijun; Kong, Lingyi

    2016-01-01

    Peucedanum praeruptorum Dunn is one of the main traditional Chinese medicines producing coumarins and plenty of literatures are focused on the biosynthesis of coumarins. Quantitative real-time reverse transcription PCR (qRT-PCR) is a widely used method in studying the biosynthesis pathway and the selection of reference genes plays a crucial role in accurate normalization. To facilitate biosynthesis study of coumarins, twelve candidate reference genes were selected from the transcriptome database of P. praeruptorum according to previous studies. Then, BestKeeper, geNoFrm and NormFinder were used for selecting stably expressed reference genes in different tissues and under various stress treatments. The results indicated that, among the twelve candidate reference genes, the SAND family protein (SAND), actin 2 (ACT2), ubiquitin-conjugating enzyme 9 (UBC9), protein phosphatase 2A gene (PP2A) and polypyrimidine tract-binding protein (PTBP1) were the most stable reference genes under different experimental treatments, while glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and tubulin beta-6 (TUB6) were the least stable genes. In addition, the suitability of SAND, TIP41-like protein (TIP41), UBC9, ACT2, TUB6 and their combination as reference genes were confirmed by normalizing the expression of 1-aminocyclopropane-1-carboxylate oxidase (ACO) in different treatments. This work is the first survey of the stability of reference genes in P. praeruptorum and provides guidelines to obtain more accurate qRT-PCR results in P. praeruptorum and other plant species. PMID:27022972

  12. Selection of Reference Genes for Gene Expression Normalization in Peucedanum praeruptorum Dunn under Abiotic Stresses, Hormone Treatments and Different Tissues.

    PubMed

    Zhao, Yucheng; Luo, Jun; Xu, Sheng; Wang, Wei; Liu, Tingting; Han, Chao; Chen, Yijun; Kong, Lingyi

    2016-01-01

    Peucedanum praeruptorum Dunn is one of the main traditional Chinese medicines producing coumarins and plenty of literatures are focused on the biosynthesis of coumarins. Quantitative real-time reverse transcription PCR (qRT-PCR) is a widely used method in studying the biosynthesis pathway and the selection of reference genes plays a crucial role in accurate normalization. To facilitate biosynthesis study of coumarins, twelve candidate reference genes were selected from the transcriptome database of P. praeruptorum according to previous studies. Then, BestKeeper, geNoFrm and NormFinder were used for selecting stably expressed reference genes in different tissues and under various stress treatments. The results indicated that, among the twelve candidate reference genes, the SAND family protein (SAND), actin 2 (ACT2), ubiquitin-conjugating enzyme 9 (UBC9), protein phosphatase 2A gene (PP2A) and polypyrimidine tract-binding protein (PTBP1) were the most stable reference genes under different experimental treatments, while glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and tubulin beta-6 (TUB6) were the least stable genes. In addition, the suitability of SAND, TIP41-like protein (TIP41), UBC9, ACT2, TUB6 and their combination as reference genes were confirmed by normalizing the expression of 1-aminocyclopropane-1-carboxylate oxidase (ACO) in different treatments. This work is the first survey of the stability of reference genes in P. praeruptorum and provides guidelines to obtain more accurate qRT-PCR results in P. praeruptorum and other plant species.

  13. Virus-Induced Silencing of a Plant Cellulose Synthase Gene

    PubMed Central

    Burton, Rachel A.; Gibeaut, David M.; Bacic, Antony; Findlay, Kim; Roberts, Keith; Hamilton, Andrew; Baulcombe, David C.; Fincher, Geoffrey B.

    2000-01-01

    Specific cDNA fragments corresponding to putative cellulose synthase genes (CesA) were inserted into potato virus X vectors for functional analysis in Nicotiana benthamiana by using virus-induced gene silencing. Plants infected with one group of cDNAs had much shorter internode lengths, small leaves, and a “dwarf” phenotype. Consistent with a loss of cell wall cellulose, abnormally large and in many cases spherical cells ballooned from the undersurfaces of leaves, particularly in regions adjacent to vascular tissues. Linkage analyses of wall polysaccharides prepared from infected leaves revealed a 25% decrease in cellulose content. Transcript levels for at least one member of the CesA cellulose synthase gene family were lower in infected plants. The decrease in cellulose content in cell walls was offset by an increase in homogalacturonan, in which the degree of esterification of carboxyl groups decreased from ∼50 to ∼33%. The results suggest that feedback loops interconnect the cellular machinery controlling cellulose and pectin biosynthesis. On the basis of the phenotypic features of the infected plants, changes in wall composition, and the reduced abundance of CesA mRNA, we concluded that the cDNA fragments silenced one or more cellulose synthase genes. PMID:10810144

  14. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  15. ACC deaminase genes are conserved among Mesorhizobium species able to nodulate the same host plant.

    PubMed

    Nascimento, Francisco X; Brígido, Clarisse; Glick, Bernard R; Oliveira, Solange

    2012-11-01

    Rhizobia strains expressing the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase have been reported to display an augmented symbiotic performance as a consequence of lowering the plant ethylene levels that inhibit the nodulation process. Genes encoding ACC deaminase (acdS) have been studied in Rhizobium spp.; however, not much is known about the presence of acdS genes in Mesorhizobium spp. The aim of this study was to assess the prevalence and phylogeny of acdS genes in Mesorhizobium strains including a collection of chickpea-nodulating mesorhizobia from Portugal. ACC deaminase genes were detected in 10 of 12 mesorhizobia type strains as well as in 18 of 18 chickpea Mesorhizobium isolates studied in this work. No ACC deaminase activity was detected in any Mesorhizobium strain tested under free-living conditions. Despite the lack of ACC deaminase activity, it was possible to demonstrate that in Mesorhizobium ciceri UPM-Ca7(T) , the acdS gene is transcribed under symbiotic conditions. Phylogenetic analysis indicates that strains belonging to different species of Mesorhizobium, but nodulating the same host plant, have similar acdS genes, suggesting that acdS genes are horizontally acquired by transfer of the symbiosis island. This data, together with analysis of the symbiosis islands from completely sequenced Mesorhizobium genomes, suggest the presence of the acdS gene in a Mesorhizobium common ancestor that possessed this gene in a unique symbiosis island.

  16. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.)

    PubMed Central

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-01-01

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar ‘EP6392’ which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns. PMID:25959296

  17. Identification of differentially expressed genes related to aphid resistance in cucumber (Cucumis sativus L.).

    PubMed

    Liang, Danna; Liu, Min; Hu, Qijing; He, Min; Qi, Xiaohua; Xu, Qiang; Zhou, Fucai; Chen, Xuehao

    2015-05-11

    Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphids (Aphis gossypii Glover) are among the most serious pests in cucumber production and often cause severe loss of yield and make fruit quality get worse. Identifying genes that render cucumbers resistant to aphid-induced damage and breeding aphid-resistant cucumber varieties have become the most promising control strategies. In this study, a Illumina Genome Analyzer platform was applied to monitor changes in gene expression in the whole genome of the cucumber cultivar 'EP6392' which is resistant to aphids. Nine DGE libraries were constructed from infected and uninfected leaves. In total, 49 differentially expressed genes related to cucumber aphid resistance were screened during the treatment period. These genes are mainly associated with signal transduction, plant-pathogen interactions, flavonoid biosynthesis, amino acid metabolism and sugar metabolism pathways. Eight of the 49 genes may be associated with aphid resistance. Finally, expression of 9 randomly selected genes was evaluated by qRT-PCR to verify the results for the tag-mapped genes. With the exception of 1-aminocyclopropane-1-carboxylate oxidase homolog 6, the expression of the chosen genes was in agreement with the results of the tag-sequencing analysis patterns.

  18. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research. PMID:26638491

  19. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  20. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    PubMed

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  1. Ethylene is Involved in Brassinosteroids Induced Alternative Respiratory Pathway in Cucumber (Cucumis sativus L.) Seedlings Response to Abiotic Stress

    PubMed Central

    Wei, Li-Jie; Deng, Xing-Guang; Zhu, Tong; Zheng, Ting; Li, Peng-Xu; Wu, Jun-Qiang; Zhang, Da-Wei; Lin, Hong-Hui

    2015-01-01

    Effects of brassinosteroids (BRs) on cucumber (Cucumis sativus L.) abiotic stresses resistance to salt, polyethylene glycol (PEG), cold and the potential mechanisms were investigated in this work. Previous reports have indicated that BRs can induce ethylene production and enhance alternative oxidase (AOX) pathway. The mechanisms whether ethylene is involved as a signal molecule which connected BR with AOX in regulating stress tolerance are still unknown. Here, we found that pretreatment with 1 μM brassinolide (BL, the most active BRs) relieved stress-caused oxidative damage in cucumber seedlings and clearly enhanced the capacity of AOX and the ethylene biosynthesis. Furthermore, transcription level of ethylene signaling biosynthesis genes including ripening-related ACC synthase1 (CSACS1), ripening-related ACC synthase2 (CSACS2), ripening-related ACC synthase3 (CSACS3), 1-aminocyclopropane-1-carboxylate oxidase1 (CSACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (CSACO2), and CSAOX were increased after BL treatment. Importantly, the application of the salicylhydroxamic acid (SHAM, AOX inhibitor) and ethylene biosynthesis inhibitor aminooxyacetic acid (AOA) decreased plant resistance to environmental stress by blocking BRs-induced alternative respiration. Taken together, our results demonstrated that ethylene was involved in BRs-induced AOX activity which played important roles in abiotic stresses tolerance in cucumber seedlings. PMID:26617622

  2. Ethylene is Involved in Brassinosteroids Induced Alternative Respiratory Pathway in Cucumber (Cucumis sativus L.) Seedlings Response to Abiotic Stress.

    PubMed

    Wei, Li-Jie; Deng, Xing-Guang; Zhu, Tong; Zheng, Ting; Li, Peng-Xu; Wu, Jun-Qiang; Zhang, Da-Wei; Lin, Hong-Hui

    2015-01-01

    Effects of brassinosteroids (BRs) on cucumber (Cucumis sativus L.) abiotic stresses resistance to salt, polyethylene glycol (PEG), cold and the potential mechanisms were investigated in this work. Previous reports have indicated that BRs can induce ethylene production and enhance alternative oxidase (AOX) pathway. The mechanisms whether ethylene is involved as a signal molecule which connected BR with AOX in regulating stress tolerance are still unknown. Here, we found that pretreatment with 1 μM brassinolide (BL, the most active BRs) relieved stress-caused oxidative damage in cucumber seedlings and clearly enhanced the capacity of AOX and the ethylene biosynthesis. Furthermore, transcription level of ethylene signaling biosynthesis genes including ripening-related ACC synthase1 (C S ACS1), ripening-related ACC synthase2 (C S ACS2), ripening-related ACC synthase3 (C S ACS3), 1-aminocyclopropane-1-carboxylate oxidase1 (C S ACO1), 1-aminocyclopropane-1-carboxylate oxidase2 (C S ACO2), and C S AOX were increased after BL treatment. Importantly, the application of the salicylhydroxamic acid (SHAM, AOX inhibitor) and ethylene biosynthesis inhibitor aminooxyacetic acid (AOA) decreased plant resistance to environmental stress by blocking BRs-induced alternative respiration. Taken together, our results demonstrated that ethylene was involved in BRs-induced AOX activity which played important roles in abiotic stresses tolerance in cucumber seedlings.

  3. Identification and characterization of the Populus sucrose synthase gene family.

    PubMed

    An, Xinmin; Chen, Zhong; Wang, Jingcheng; Ye, Meixia; Ji, Lexiang; Wang, Jia; Liao, Weihua; Ma, Huandi

    2014-04-10

    In this study, we indentified 15 sucrose synthase (SS) genes in Populus and the results of RT-qPCR revealed that their expression patterns were constitutive and partially overlapping but diverse. The release of the most recent Populus genomic data in Phytozome v9.1 has revealed the largest SS gene family described to date, comprising 15 distinct members. This information will now enable the analysis of transcript expression profiles for those that have not been previously reported. Here, we performed a comprehensive analysis of SS genes in Populus by describing the gene structure, chromosomal location and phylogenetic relationship of each family member. A total of 15 putative SS gene members were identified in the Populus trichocarpa (Torr. & Gray) genome using the SS domain and amino acid sequences from Arabidopsis thaliana as a probe. A phylogenetic analysis indicated that the 15 members could be classified into four groups that fall into three major categories: dicots, monocots & dicots 1 (M & D 1), and monocots & dicots 2 (M & D 2). In addition, the 15 SS genes were found to be unevenly distributed on seven chromosomes. The two conserved domains (sucrose synthase and glycosyl transferase) were found in this family. Meanwhile, the expression profiles of all 15 gene members in seven different organs were investigated in Populus tomentosa (Carr.) by using RT-qPCR. Additional analysis indicated that the poplar SS gene family is also involved in response to water-deficit. The current study provides basic information that will assist in elucidating the functions of poplar SS family. PMID:24508272

  4. Surrogate Splicing for Functional Analysis of Sesquiterpene Synthase Genes1[w

    PubMed Central

    Wu, Shuiqin; Schoenbeck, Mark A.; Greenhagen, Bryan T.; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M.; Chappell, Joseph

    2005-01-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing β-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for α-barbatene, thujopsene, and β-chamigrene biosynthesis. PMID:15965019

  5. Plant–Agrobacterium interaction mediated by ethylene and super-Agrobacterium conferring efficient gene transfer

    PubMed Central

    Nonaka, Satoko; Ezura, Hiroshi

    2014-01-01

    Agrobacterium tumefaciens has a unique ability to transfer genes into plant genomes. This ability has been utilized for plant genetic engineering. However, the efficiency is not sufficient for all plant species. Several studies have shown that ethylene decreased the Agrobacterium-mediated transformation frequency. Thus, A. tumefaciens with an ability to suppress ethylene evolution would increase the efficiency of Agrobacterium-mediated transformation. Some studies showed that plant growth-promoting rhizobacteria (PGPR) can reduce ethylene levels in plants through 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, which cleaves the ethylene precursor ACC into α-ketobutyrate and ammonia, resulting in reduced ethylene production. The whole genome sequence data showed that A. tumefaciens does not possess an ACC deaminase gene in its genome. Therefore, providing ACC deaminase activity to the bacteria would improve gene transfer. As expected, A. tumefaciens with ACC deaminase activity, designated as super-Agrobacterium, could suppress ethylene evolution and increase the gene transfer efficiency in several plant species. In this review, we summarize plant–Agrobacterium interactions and their applications for improving Agrobacterium-mediated genetic engineering techniques via super-Agrobacterium. PMID:25520733

  6. Polymorphism and expression of isoflavone synthase genes from soybean cultivars.

    PubMed

    Kim, Hyo-Kyoung; Jang, Yun-Hee; Baek, Il-Sun; Lee, Jeong-Hwan; Park, Min Joo; Chung, Young-Soo; Chung, Jong-Il; Kim, Jeong-Kook

    2005-02-28

    Isoflavones are synthesized by isoflavone synthases via the phenylpropanoid pathway in legumes. We have cloned two isoflavone synthase genes, IFS1 and IFS2, from a total of 18 soybean cultivars. The amino acid residues of the proteins that differed between cultivars were dispersed over the entire coding region. However, amino acid sequence variation did not occur in conserved domains such as the ERR triad region, except that one conserved amino acid was changed in the IFS2 protein of the GS12 cultivar (R374G) and the IFS1 proteins of the 99M06 and Soja99s65 cultivars (A109T, F105I). In three cultivars (99M06, 99M116, and Simheukpi), most of amino acid changes were such that the difference between the amino acid sequences of IFS1 and IFS2 was reduced. The expression profiles of three enzymes that convert naringenin to the isoflavone, genistein, chalcone isomerase (CHI), isoflavone synthase (IFS) and flavanone 3-hydroxylase (F3H) were examined. In general, IFS mRNA was more abundant in etiolated seedlings than mature plants whereas the levels of CHI and F3H mRNAs were similar in the two stages. During seed development, IFS was expressed a little later than CHI and F3H but expression of these three genes was barely detectable, if at all, during later seed hardening. In addition, we found that the levels of CHI, F3H, and IFS mRNAs were under circadian control. We also showed that IFS was induced by wounding and by application of methyl jasmonate to etiolated soybean seedlings. PMID:15750342

  7. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance.

    PubMed

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara; Benfield, Thomas; Miller, Robert; Rabodonirina, Meja; Helweg-Larsen, Jannik

    2004-10-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about development of resistant organisms. The inability to culture human Pneumocystis, Pneumocystis jirovecii, in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. In other microorganisms, sulfa drug resistance has resulted from specific point mutations in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone.

  8. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    PubMed

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  9. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    PubMed Central

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  10. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  11. [Chitin Synthase 2 (CHS2) gene of Malassezia species].

    PubMed

    Kano, Rui

    2005-01-01

    Malassezia species have been recognized as members of the microbiological flora of human and animal skin; they are also considered to play an important role in the pathogenesis of folliculitis, atopic dermatitis and otitis externa. Therefore, the molecular characteristics were investigated to clarify the epidemiology and the pathogenesis of diseases associated with Malassezia species in human and animals. Molecular investigation was made of 105 clinical isolates of M. pachydermatis from dogs and cats by random amplification of polymorphic DNA (RAPD) and chitin synthase 2 (CHS2) gene sequence analyses. The RAPD analysis and CHS2 gene analysis indicated that clinical isolates of M. pachydermatis were divided into four distinct genetic types (A, B, C and D). Type A was isolated from lesions of atopic dermatitis, flea allergic dermatitis, otitis externa, pyoderma and seborrheic (dermatitidis) in dogs and cats, and might be predominant on this. The phylogenetic analysis of the nucleotide sequences of CHS2 gene fragments of standard strains of 11 Malassezia species showed 11 distinct clusters of this species. PMID:16094288

  12. Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene

    SciTech Connect

    Feinbaum, R.L.; Ausubel, F.M.

    1988-05-01

    The authors cloned an Arabiodpsis thaliana chalcone synthase (CHS) gene on the basis of cross-hybridization with a Petroselinum hortense CHS cDNA clone. The protein sequence deduced from the A. thaliana CHS DNA sequence is at least 85% homologous to the CHS sequences from P. hortense, Antirrhinum majus, and Petunia hybrida. Southern blot analysis indicated that CHS is a single-copy gene in A. thaliana. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time. The accumulation of CHS mRNA in response to high-intensity light was due, at least in part, to an increased rate of transcription of the CHS gene as demonstrated by nuclear runoff experiment.

  13. Detection of biosynthetic gene and phytohormone production by endophytic actinobacteria associated with Solanum lycopersicum and their plant-growth-promoting effect.

    PubMed

    Passari, Ajit Kumar; Chandra, Preeti; Zothanpuia; Mishra, Vineet Kumar; Leo, Vincent Vineeth; Gupta, Vijai Kumar; Kumar, Brijesh; Singh, Bhim Pratap

    2016-10-01

    In the present study, fifteen endophytic actinobacterial isolates recovered from Solanum lycopersicum were studied for their antagonistic potential and plant-growth-promoting (PGP) traits. Among them, eight isolates showed significant antagonistic and PGP traits, identified by amplification of the 16S rRNA gene. Isolate number DBT204, identified as Streptomyces sp., showed multiple PGP traits tested in planta and improved a range of growth parameters in seedlings of chili (Capsicum annuum L.) and tomato (S. lycopersicum L.). Further, genes of indole acetic acid (iaaM) and 1-aminocyclopropane-1-carboxylate (ACC) deaminase (acdS) were successively amplified from five strains. Six antibiotics (trimethoprim, fluconazole, chloramphenicol, nalidixic acid, rifampicin and streptomycin) and two phytohormones [indole acetic acid (IAA) and kinetin (KI)] were detected and quantified in Streptomyces sp. strain DBT204 using UPLC-ESI-MS/MS. The study indicates the potential of these PGP strains for production of phytohormones and shows the presence of biosynthetic genes responsible for production of secondary metabolites. It is the first report showing production of phytohormones (IAA and KI) by endophytic actinobacteria having PGP and biosynthetic potential. We propose Streptomyces sp. strain DBT204 for inoculums production and development of biofertilizers for enhancing growth of chili and tomato seedlings. PMID:27421813

  14. Expression of ipt gene controlled by an ethylene and auxin responsive fragment of the LEACO1 promoter increases flower number in transgenic Nicotiana tabacum.

    PubMed

    Khodakovskaya, Mariya; Zhao, Degang; Smith, William; Li, Yi; McAvoy, Richard

    2006-11-01

    Cytokinins play important roles in regulating plant growth and development. A new genetic construct for regulating cytokinin content in plant cells was cloned and tested. The gene coding for isopentenyl transferase (ipt) was placed under the control of a 0.821 kb fragment of the 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene promoter from Lycopersicon esculentum (LEACO1) and introduced into Nicotiana tabacum (cv. Havana). Some LEACO1(0.821) (kb)-ipt transgenic plant lines displayed normal shoot morphology but with a dramatic increase in the number of flower buds compared to nontransgenic plants. Other transgenic lines produced excessive lateral branch development but no change in flower bud number. Isolated leaves of transgenic tobacco plants showed a significantly prolonged retention of chlorophyll under dark incubation (25 degrees C for 20 days). Leaves of nontransformed plants senesced gradually under the same conditions. Experiments with LEACO1(0.821) (kb)-gus transgenic tobacco plants suggested auxin and ethylene involvement in induction of LEACO1(0.821) (kb) promoter activity. Multiple copies of nucleotide base sequences associated with either ethylene or auxin response elements were identified in the LEACO1(0.821) (kb) promoter fragment. The LEACO1(0.821) (kb)-ipt fusion gene appears to have potential utility for improving certain ornamental and agricultural crop species by increasing flower bud initiation and altering branching habit. PMID:16786314

  15. The y1 gene of maize codes for phytoene synthase.

    PubMed

    Buckner, B; Miguel, P S; Janick-Buckner, D; Bennetzen, J L

    1996-05-01

    The cloned y1 locus of maize was sequenced and found to encode phytoene synthase. Different "wild-type" alleles of the locus were found to differ by the insertion of transposable elements in their promoter and polyA addition regions, and by the length of a CCA tandem repeat series, without any obvious effect on function of the gene. A dominant Y1 ("wild-type") allele was observed to be expressed at highest levels in the seedling but also in the embryo and endosperm. The Mu3 transposable element insertion responsible for a pastel allele of y1, which gives lowered levels of carotenoids in the endosperm of kernels and seedlings grown at high temperatures, was located in the 5' end of the gene. Although the size of the transcript from this y1 mutation suggests that the Mu3 element provides the promoter for this allele, leaf tissue in this mutant line contained approximately normal amounts of y1 mRNA. A recessive allele of y1, which conditions normal levels of carotenoids in the embryo and seedling, but almost no carotenoids in the endosperm, was found to accumulate normal amounts of y1 mRNA in the seedling and embryo, while y1 transcripts were not detected in the endosperm.

  16. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.

    2007-01-01

    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  17. Compensation for a Mutated Auxin Biosynthesis Gene of Agrobacterium Ti Plasmid A66 in Nicotiana glutinosa Does Not Result from Increased Auxin Accumulation 1

    PubMed Central

    Campell, Bruce R.; Su, Ling-Yuan; Pengelly, William L.

    1989-01-01

    Nicotiana glutinosa compensated for a mutated tumor-morphology-shooty (tms) (auxin biosynthesis) locus of Agrobacterlum tumefaciens strain A66 and showed the same virulent tumor response to infection by strain A66 or the wild-type strain A6. Cloned cell lines transformed by strains A6 or A66 were fully hormone independent in culture and grew rapidly as friable, unorganized tissues on hormone-free growth medium. Growth of N. glutinosa tumor cells was inhibited by addition of α-naphthaleneacetic acid to the growth medium, and A6- and A66-transformed cells showed similar dose responses to this auxin. On the other hand, A6-transformed cells contained much higher levels of indole-3-acetic acid (IAA) and 1-aminocyclopropane-1-carboxylic acid (ACC) than A66-transformed cells. Differences in IAA and ACC levels in N. glutinosa tumor lines were consistent with the expected activity of the tms locus and were quantitatively similar to results obtained previously with A6- and A66-transformed cells of Nicotiana tabacum, which does not compensate for mutated tms genes. Thus, compensation for mutated tms genes in N. glutinosa did not result from increased auxin accumulation and did not appear to be related to the capacity of this host for auxin biosynthesis. PMID:16666706

  18. Plasticity and Evolution of (+)-3-Carene Synthase and (−)-Sabinene Synthase Functions of a Sitka Spruce Monoterpene Synthase Gene Family Associated with Weevil Resistance*

    PubMed Central

    Roach, Christopher R.; Hall, Dawn E.; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (−)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (−)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (−)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. PMID:25016016

  19. All members in the sphingomyelin synthase gene family have ceramide phosphoethanolamine synthase activity[S

    PubMed Central

    Ding, Tingbo; Kabir, Inamul; Li, Yue; Lou, Caixia; Yazdanyar, Amirfarbod; Xu, Jiachen; Dong, Jibin; Zhou, Hongwen; Park, Taesik; Boutjdir, Mohamed; Li, Zhiqiang; Jiang, Xian-Cheng

    2015-01-01

    Sphingomyelin synthase-related protein (SMSr) synthesizes the sphingomyelin analog ceramide phosphoethanolamine (CPE) in cells. Previous cell studies indicated that SMSr is involved in ceramide homeostasis and is crucial for cell function. To further examine SMSr function in vivo, we generated Smsr KO mice that were fertile and had no obvious phenotypic alterations. Quantitative MS analyses of plasma, liver, and macrophages from the KO mice revealed only marginal changes in CPE and ceramide as well as other sphingolipid levels. Because SMS2 also has CPE synthase activity, we prepared Smsr/Sms2 double KO mice. We found that CPE levels were not significantly changed in macrophages, suggesting that CPE levels are not exclusively dependent on SMSr and SMS2 activities. We then measured CPE levels in Sms1 KO mice and found that Sms1 deficiency also reduced plasma CPE levels. Importantly, we found that expression of Sms1 or Sms2 in SF9 insect cells significantly increased not only SM but also CPE formation, indicating that SMS1 also has CPE synthase activity. Moreover, we measured CPE synthase Km and Vmax for SMS1, SMS2, and SMSr using different NBD ceramides. Our study reveals that all mouse SMS family members (SMSr, SMS1, and SMS2) have CPE synthase activity. However, neither CPE nor SMSr appears to be a critical regulator of ceramide levels in vivo. PMID:25605874

  20. Deletion of the trichodiene synthase gene of Fusarium venenatum: two systems for repeated gene deletions.

    PubMed

    Royer, J C; Christianson, L M; Yoder, W T; Gambetta, G A; Klotz, A V; Morris, C L; Brody, H; Otani, S

    1999-10-01

    The trichodiene synthase (tri5) gene of Fusarium venenatum was cloned from a genomic library. Vectors were created in which the tri5 coding sequence was replaced with the Neurospora crassa nitrate reductase (nit3) gene and with the Aspergillus nidulans acetamidase (amdS) gene flanked by direct repeats. The first vector was utilized to transform a nitrate reductase (niaD) mutant of F. venenatum to prototrophy, and the second vector was utilized to confer acetamide utilization to the wild-type strain. Several of the transformants lost the capacity to produce the trichothecene diacetoxyscirpenol and were shown by hybridization analysis to have gene replacements at the tri5 locus. The nit3 gene was removed by retransformation with a tri5 deletion fragment and selection on chlorate. The amdS gene was shown to excise spontaneously via the flanking direct repeats when spores were plated onto fluoroacetamide. PMID:10512673

  1. The Cellulose Synthase Gene Superfamily and Biochemical Functions of Xylem-Specific Cellulose Synthase-Like Genes in Populus trichocarpa1[W][OA

    PubMed Central

    Suzuki, Shiro; Li, Laigeng; Sun, Ying-Hsuan; Chiang, Vincent L.

    2006-01-01

    Wood from forest trees modified for more cellulose or hemicelluloses could be a major feedstock for fuel ethanol. Xylan and glucomannan are the two major hemicelluloses in wood of angiosperms. However, little is known about the genes and gene products involved in the synthesis of these wood polysaccharides. Using Populus trichocarpa as a model angiosperm tree, we report here a systematic analysis in various tissues of the absolute transcript copy numbers of cellulose synthase superfamily genes, the cellulose synthase (CesA) and the hemicellulose-related cellulose synthase-like (Csl) genes. Candidate Csl genes were characterized for biochemical functions in Drosophila Schneider 2 (S2) cells. Of the 48 identified members, 37 were found expressed in various tissues. Seven CesA genes are xylem specific, suggesting gene networks for the synthesis of wood cellulose. Four Csl genes are xylem specific, three of which belong to the CslA subfamily. The more xylem-specific CslA subfamily is represented by three types of members: PtCslA1, PtCslA3, and PtCslA5. They share high sequence homology, but their recombinant proteins produced by the S2 cells exhibited distinct substrate specificity. PtCslA5 had no catalytic activity with the substrates for xylan or glucomannan. PtCslA1 and PtCslA3 encoded mannan synthases, but PtCslA1 further encoded a glucomannan synthase for the synthesis of (1→4)-β-d-glucomannan. The expression of PtCslA1 is most highly xylem specific, suggesting a key role for it in the synthesis of wood glucomannan. The results may help guide further studies to learn about the regulation of cellulose and hemicellulose synthesis in wood. PMID:16950861

  2. Molecular evolution and functional divergence of soluble starch synthase genes in cassava (manihot esculenta crantz).

    PubMed

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes.

  3. Functional Inducible Nitric Oxide Synthase Gene Variants Associate With Hypertension

    PubMed Central

    Nikkari, Seppo T.; Määttä, Kirsi M.; Kunnas, Tarja A.

    2015-01-01

    Abstract Increased inducible nitric oxide synthase (iNOS) activity and expression has been associated with hypertension, but less is known whether the 2 known functional polymorphic sites in the iNOS gene (g.–1026 C/A (rs2779249), g.2087 G/A (rs2297518)) affect susceptibility to hypertension. The objective of this study was to investigate the association between the genetic variants of iNOS and diagnosed hypertension in a Finnish cohort. This study included 320 hypertensive cases and 439 healthy controls. All participants were 50-year-old men and women and the data were collected from the Tampere adult population cardiovascular risk study (TAMRISK). DNA was extracted from buccal swabs and iNOS single nucleotide polymorphisms (SNPs) were analyzed using KASP genotyping PCR. Data analysis was done by logistic regression. At the age of 50 years, the SNP rs2779249 (C/A) associated significantly with hypertension (P = 0.009); specifically, subjects carrying the A-allele had higher risk of hypertension compared to those carrying the CC genotype (OR = 1.47; CI = 1.08–2.01; P = 0.015). In addition, a 15-year follow-up period (35, 40, and 45 years) of the same individuals showed that carriers of the A-allele had more often hypertension in all of the studied age-groups. The highest risk for developing hypertension was obtained among 35-year-old subjects (odds ratio [OR] 3.83; confidence interval [CI] = 1.20–12.27; P = 0.024). Those carrying variant A had also significantly higher readings of both systolic (P = 0.047) and diastolic (P = 0.048) blood pressure during the follow-up. No significant associations between rs2297518 (G/A) variants alone and hypertension were found. However, haplotype analysis of rs2779249 and rs2297518 revealed that individuals having haplotype H3 which combines both A alleles (CA–GA, 19.7% of individuals) was more commonly found in the hypertensive group than in the normotensive group (OR = 2.01; CI = 1

  4. Expression of the trichodiene synthase gene of Fusarium sporotrichioides in Escherichia coli results in sesquiterpene production.

    PubMed

    Hohn, T M; Plattner, R D

    1989-11-15

    Trichodiene synthase is a sesquiterpene cyclase involved in the biosynthesis of trichothecene mycotoxins. We report that insertion of the unaltered trichodiene synthase gene of Fusarium sporotrichioides into the Escherichia coli expression vector pDR540 produced an inactive polypeptide with a molecular weight approximately 2000 greater than that of trichodiene synthase. This result is consistent with the presence of an intron in the trichodiene synthase gene, and prompted us to specifically delete a putative 60-nucleotide intron sequence. Insertion of the intron-deleted open reading frame into pDR540 resulted in the production of active enzyme. Trichodiene synthase activity in crude extracts from induced cultures was 0.07 nmol/min/mg of protein and represented 0.05-0.10% of the total cell protein. A cross-reactive protein was present with the same apparent molecular weight as the subunit of native trichodiene synthase. The recombinant enzyme was partially purified and shown to have properties closely resembling those of the native enzyme. Trichodiene was detected in ethyl acetate extracts from induced cultures at a concentration of 60 micrograms/liter after 4.5 h. These findings support the primary structure recently reported for trichodiene synthase and demonstrate that the expression of a sesquiterpene cyclase in E. coli results in sesquiterpene production. PMID:2817906

  5. Production of geranylgeraniol on overexpression of a prenyl diphosphate synthase fusion gene in Saccharomyces cerevisiae.

    PubMed

    Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu

    2010-07-01

    An acyclic diterpene alcohol, (E,E,E)-geranylgeraniol (GGOH), is one of the important compounds used as perfume and pharmacological agents. A deficiency of squalene (SQ) synthase activity allows yeasts to accumulate an acyclic sesquiterpene alcohol, (E,E)-farnesol, in their cells. Since sterols are essential for the growth of yeasts, a deficiency of SQ synthase activity makes the addition of supplemental sterols to the culture media necessary. To develop a GGOH production method not requiring any supplemental sterols, we overexpressed HMG1 encoding hydroxymethylglutaryl-CoA reductase and the genes of two prenyl diphosphate synthases, ERG20 and BTS1, in Saccharomyces cerevisiae. A prototrophic diploid coexpressing HMG1 and the ERG20-BTS1 fusion accumulated GGOH with neither disruption of the SQ synthase gene nor the addition of any supplemental sterols. The GGOH content on the diploid cultivation in a 5-l jar fermenter reached 138.8 mg/l under optimal conditions.

  6. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F

    1980-01-01

    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  7. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  8. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  9. Isolation and gene disruption of the Tox5 gene encoding trichodiene synthase in Gibberella pulicaris.

    PubMed

    Hohn, T M; Desjardins, A E

    1992-01-01

    The trichodiene synthase gene (Tox5) was isolated from Gibberella pulicaris, and its nucleotide sequence was determined. Tox5 was disrupted through transformation with a plasmid carrying a doubly truncated copy of the coding region and a selectable marker for resistance to hygromycin B (Hygr). Analysis of 82 transformants for their ability to produce the trichothecene, 4,15-diacetoxyscirpenol (DAS), resulted in the identification of five DAS- strains. Southern hybridization analysis of DAS- Hygr transformants indicated that the plasmid integrated at the Tox5 locus. The disrupted Tox5 gene was shown to be mitotically stable. Analysis of nine tetrads revealed either the cosegregation of the disrupter plasmid and the DAS- phenotype or the loss of the disrupter plasmid. These results demonstrate the feasibility of using gene disruption in G. pulicaris and suggest a general method for obtaining Tox5- mutants in other trichothecene-producing fungi. PMID:1421511

  10. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    SciTech Connect

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  11. Isolation and partial characterization of the gene for goose fatty acid synthase.

    PubMed

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  12. The human liver glycogen synthase isozyme gene is located on the short arm of chromosome 12

    SciTech Connect

    Nuttall, F.Q.; Gannon, M.C. ); Kubic, V.L.; Hoyt, K.J. )

    1994-01-15

    Glycogen synthase catalyzes the rate-limiting step in glycogen synthesis. Its activity is regulated by a complex phosphorylation-dephosphorylation mechanism and by allosteric stimulators and inhibitors. Two isozymes of synthase, a skeletal muscle type and liver type, have been identified in rabbit and rat tissues using specific polyclonal antibodies. The skeletal muscle type isozyme is present in several organs in addition to skeletal muscle; the liver isozyme has been identified only in liver. Recently, we have purified and characterized the human liver synthase isozyme. We also have cloned and sequenced the gene from a human liver cDNA library. Using the entire cDNA coding sequence as a probe, we report here the localization of the liver synthase isozyme gene to the short arm of chromosome 12. These studies revealed a centromeric signal on chromosome 12 together with signal to glycogen synthase on the short arm of this chromosome in the p11.2-p12.2 region. Measurements of the relative distance from the midpoint of the centromere to the signal corresponding to glycogen synthase suggests that the locus is in the p12.2 band rather than in the more centromeric location.

  13. Gene therapy inhibiting neointimal vascular lesion: in vivo transfer of endothelial cell nitric oxide synthase gene.

    PubMed Central

    von der Leyen, H E; Gibbons, G H; Morishita, R; Lewis, N P; Zhang, L; Nakajima, M; Kaneda, Y; Cooke, J P; Dzau, V J

    1995-01-01

    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as beta-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessels. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia. Images Fig. 1 Fig. 2 Fig. 5 PMID:7532305

  14. Gene Therapy Inhibiting Neointimal Vascular Lesion: In vivo Transfer of Endothelial Cell Nitric Oxide Synthase Gene

    NASA Astrophysics Data System (ADS)

    von der Leyen, Heiko E.; Gibbons, Gary H.; Morishita, Ryuichi; Lewis, Neil P.; Zhang, Lunan; Nakajima, Masatoshi; Kaneda, Yasufumi; Cooke, John P.; Dzau, Victor J.

    1995-02-01

    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as β-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessel. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia.

  15. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    PubMed

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering.

  16. [Intraspecific polymorphism of the sucrose synthase genes in Russian and Kazakhstan potato cultivars].

    PubMed

    Slugina, M A; Boris, K V; Kakimzhanova, A A; Kochieva, E Z

    2014-06-01

    In 12 different Russian and Kazakhstan potato cultivars, the polymorphism of the glycosyltransferase domain of the sucrose synthase gene was first examined, as well as the polymorphism of the sucrose synthase domain fragment of the same gene in the potato cultivars of Kazakhstan breed. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions, including those not described earlier. Amino acid substitutions specific to heat- and drought-tolerant varieties were also identified and could be associated with the development of abiotic stress resistance. PMID:25715458

  17. The role of 1-deoxy-d-xylulose-5-phosphate synthase and phytoene synthase gene family in citrus carotenoid accumulation.

    PubMed

    Peng, Gang; Wang, Chunyan; Song, Song; Fu, Xiumin; Azam, Muhammad; Grierson, Don; Xu, Changjie

    2013-10-01

    Three 1-deoxy-D-xylulose-5-phosphate synthases (DXS) and three phytoene synthases (PSY) were identified in citrus, from Affymetrix GeneChip Citrus Genome Array, GenBank and public orange genome databases. Tissue-specific expression analysis of these genes was carried out on fruit peel and flesh, flower and leaf of Satsuma mandarin (Citrus unshiu Marc.) in order to determine their roles in carotenoid accumulation in different tissues. Expression of CitDXS1 and CitPSY1 was highest in all test tissues, while that of CitDXS2 and CitPSY2 was lower, and that of CitDXS3 and CitPSY3 undetectable. The transcript profiles of CitDXS1 and CitPSY1 paralleled carotenoid accumulation in flesh of Satsuma mandarin and orange (Citrus sinensis Osbeck) during fruit development, and CitPSY1 expression was also associated with carotenoid accumulation in peel, while the CitDXS1 transcript level was only weakly correlated with carotenoid accumulation in peel. Similar results were obtained following correlation analysis between expression of CitDXS1 and CitPSY1 and carotenoid accumulation in peel and flesh of 16 citrus cultivars. These findings identify CitPSY1 and CitDXS1 as the main gene members controlling carotenoid biosynthesis in citrus fruit. Furthermore, chromoplasts were extracted from flesh tissue of these citrus, and chromoplasts of different shape (spindle or globular), different size, and color depth were observed in different cultivars, indicating chromoplast abundance, number per gram tissue, size and color depth were closely correlated with carotenoid content in most cultivars. The relationship between carotenoid biosynthesis and chromoplast development was discussed.

  18. Small-Interfering RNAs from Natural Antisense Transcripts Derived from a Cellulose Synthase Gene Modulate Cell Wall Biosynthesis in Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral-induced gene silencing of members of the cellulose synthase/cellulose synthase-like (CesA/Csl) gene superfamily in barley (Hordeum vulgare cv. Blackhulless) using the Barley Stripe Mosaic Virus reduced theincorporation of D-14C-Glc into cellulose and into mixed-linkage (1'3),(1'4)-'-D-glucans ...

  19. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  20. Characterization of a sabinene synthase gene from rough lemon (Citrus jambhiri).

    PubMed

    Kohzaki, Keisuke; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Ozawa, Rika; Takabayashi, Junji; Akimitsu, Kazuya

    2009-10-15

    We previously isolated two putative monoterpene synthase genes, RlemTPS1 and RlemTPS2, from rough lemon (Citrus jambhiri) and showed that gene expression of RlemTPS2 was induced by microbial attack. The protein product of RlemTPS2 was obtained using a prokaryotic expression system, and GC and GC-MS of monoterpene synthesis by RlemTPS2 determined that RlemTPS2 encodes a sabinene synthase. Sabinene has antifungal activity toward Alternaria alternata. Furthermore, site-directed mutagenesis identified one amino acid, Ile, located at the front of the metal ion binding motif as an important residue for the product specificity of sabinene synthase.

  1. Inhibition of spermidine synthase gene expression by transforming growth factor-beta 1 in hepatoma cells.

    PubMed Central

    Nishikawa, Y; Kar, S; Wiest, L; Pegg, A E; Carr, B I

    1997-01-01

    We screened genes responsive to transforming growth factor-beta (TGF-beta 1) protein in a human hepatoma cell line (Hep3B) using a PCR-mediated differential display technique, in order to investigate the mechanisms involved in TGF-beta-induced growth suppression. We found a gene that was down-regulated by TGF-beta 1 to be completely identical in an approx. 620 bp segment to the gene for the enzyme spermidine synthase, which mediates the conversion of putrescine into spermidine. Both spermidine synthase mRNA expression and its enzyme activity were decreased after TGF-beta 1 treatment of Hep3B cells. The inhibition of spermidine synthase gene expression by TGF-beta 1 protein was also observed in other hepatoma cell lines. The expression of genes for other biosynthetic enzymes in polyamine metabolism (ornithine decarboxylase and S-adenosylmethionine decarboxylase) was also inhibited to the same extent as for spermidine synthase, while the gene expression of spermidine/spermine N1-acetyltransferase, a catabolic enzyme, was relatively resistant to TGF-beta 1. Spermine levels in Hep3B cells were decreased by TGF-beta 1 treatment, although the levels of spermidine and putrescine were unchanged, probably due to compensation by remaining spermidine/spermine N1-acetyltransferase activity. Exogenously added spermidine or spermine, but not putrescine, partially antagonized the growth-inhibitor effects of TGF-beta 1 on Hep3B cells. Our data suggest that down-regulation of gene expression of the enzymes involved in polyamine metabolism, including spermidine synthase, may be associated with the mechanism of TGF-beta-induced growth suppression. PMID:9020892

  2. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp.

    PubMed Central

    Schendel, F J; August, P R; Anderson, C R; Hanson, R S; Flickinger, M C

    1992-01-01

    The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (Mr, 84,500) with a subunit with an Mr of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes. PMID:1311544

  3. Cloning, sequencing, and expression of the gene for NADH-sensitive citrate synthase of Pseudomonas aeruginosa.

    PubMed Central

    Donald, L J; Molgat, G F; Duckworth, H W

    1989-01-01

    The structural gene for the allosteric citrate synthase of Pseudomonas aeruginosa has been cloned from a genomic library by using the Escherichia coli citrate synthase gene as a hybridization probe under conditions of reduced stringency. Subcloning of portions of the original 10-kilobase-pair (kbp) clone led to isolation of the structural gene, with its promoter, within a 2,083-bp length of DNA flanked by sites for KpnI and BamHI. The nucleotide sequence of this fragment is presented; the inferred amino acid sequence was 70 and 76% identical, respectively, with the citrate synthase sequences from E. coli and Acinetobacter anitratum, two other gram-negative bacteria. DEAE-cellulose chromatography of P. aeruginosa citrate synthase from an E. coli host harboring the cloned P. aeruginosa gene gave three peaks of activity. All three enzyme peaks had subunit molecular weights of 48,000; the proteins were identical by immunological criteria and very similar in kinetics of substrate saturation and NADH inhibition. Because the cloned gene contained only one open reading frame large enough to encode a polypeptide of such a size, the three peaks must represent different forms of the same protein. A portion of the cloned P. aeruginosa gene was used as a hybridization probe under stringent conditions to identify highly homologous sequences in genomic DNA of a second strain classified as P. aeruginosa and isolates of P. putida, P. stutzeri, and P. alcaligenes. When crude extracts of each of these four isolates were mixed with antiserum raised against purified P. aeruginosa citrate synthase, however, only the P. alcaligenes extract cross-reacted. Images PMID:2507528

  4. Two anthranilate synthase genes in Arabidopsis: defense-related regulation of the tryptophan pathway.

    PubMed Central

    Niyogi, K K; Fink, G R

    1992-01-01

    Arabidopsis thaliana has two genes, ASA1 and ASA2, encoding the alpha subunit of anthranilate synthase, the enzyme catalyzing the first reaction in the tryptophan biosynthetic pathway. As a branchpoint enzyme in aromatic amino acid biosynthesis, anthranilate synthase has an important regulatory role. The sequences of the plant genes are homologous to their microbial counterparts. Both predicted proteins have putative chloroplast transit peptides at their amino termini and conserved amino acids involved in feedback inhibition by tryptophan. ASA1 and ASA2 cDNAs complement anthranilate synthase alpha subunit mutations in the yeast Saccharomyces cerevisiae and in Escherichia coli, confirming that both genes encode functional anthranilate synthase proteins. The distributions of ASA1 and ASA2 mRNAs in various parts of Arabidopsis plants are overlapping but nonidentical, and ASA1 mRNA is approximately 10 times more abundant in whole plants. Whereas ASA2 is expressed at a constitutive basal level, ASA1 is induced by wounding and bacterial pathogen infiltration, suggesting a novel role for ASA1 in the production of tryptophan pathway metabolites as part of an Arabidopsis defense response. Regulation of key steps in aromatic amino acid biosynthesis in Arabidopsis appears to involve differential expression of duplicated genes. PMID:1392592

  5. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  6. Identification of a novel gene coding for neoxanthin synthase from Solanum tuberosum.

    PubMed

    Al-Babili, S; Hugueney, P; Schledz, M; Welsch, R; Frohnmeyer, H; Laule, O; Beyer, P

    2000-11-24

    The polymerase chain reaction analysis of potato plants, transformed with capsanthin capsorubin synthase ccs, revealed the presence of a highly related gene. The cloned cDNA showed at the protein level 89.6% identity to CCS. This suggested that the novel enzyme catalyzes a mechanistically similar reaction. Such a reaction is represented by neoxanthin synthase (NXS), forming the xanthophyll neoxanthin, a direct substrate for abscisic acid formation. The function of the novel enzyme could be proven by transient expression in plant protoplasts and high performance liquid chromatography analysis. The cloned NXS was imported in vitro into plastids, the compartment of carotenoid biosynthesis.

  7. Disruption of homocitrate synthase genes in Candida albicans affects growth but not virulence.

    PubMed

    Kur, Krzysztof; Gabriel, Iwona; Morschhäuser, Joachim; Barchiesi, Francesco; Spreghini, Elisabetta; Milewski, Sławomir

    2010-12-01

    Two genes, LYS21 and LYS22, encoding isoforms of homocitrate synthase, an enzyme catalysing the first committed step in the lysine biosynthetic pathway, were disrupted in Candida albicans using the SAT1 flipper strategy. The double null lys21Δ/lys22Δ mutant lacked homocitrate synthase activity and exhibited lysine auxotrophy in minimal media that could be fully rescued by the addition of 0.5-0.6 mM L: -lysine. On the other hand, its virulence in vivo in the model of disseminated murine candidiasis appeared identical to that of the mother, wild-type strain. These findings strongly question a possibility of exploitation of homocitrate synthase and possibly also other enzymes of the lysine biosynthetic pathway as targets in chemotherapy of disseminated fungal infections.

  8. EXPRESSION OF THE GEOSMIN SYNTHASE GENE IN THE CYANOBACTERIUM ANABAENA CIRCINALIS AWQC318(1).

    PubMed

    Giglio, Steven; Saint, Christopher P; Monis, Paul T

    2011-12-01

    The occurrence of taste and odor episodes attributed to geosmin continues to trouble water utilities worldwide, and only recently have advances been made in our fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in microorganisms. For the first time, we have examined the expression of the geosmin synthase gene and corresponding geosmin production by Anabaena circinalis Rabenh. ex Bornet et Flahault AWQC318 under conditions of continuous light illumination and the removal of light as a stimulus and demonstrate that the expression of geosmin synthase appears to be constitutive under these conditions. The decrease in geosmin synthase transcription post maximum cell numbers and stationary phase suggests that a decrease in isoprenoid synthesis may occur before a decrease in the transcription of ribosomal units as the process of cell death is initiated.

  9. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes.

  10. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes. PMID:10369673

  11. mRNA expressions of inducible nitric oxide synthase, endothelial nitric oxide synthase, and neuronal nitric oxide synthase genes in meningitis patients.

    PubMed

    Oztuzcu, Serdar; Igci, Yusuf Ziya; Arslan, Ahmet; Sivasli, Ercan; Ozkara, Esma; Igci, Mehri; Demiryürek, Seniz; Cengiz, Beyhan; Gogebakan, Bulent; Namiduru, Mustafa; Coskun, Mehmet Yavuz; Cakmak, Ecir Ali

    2011-03-01

    Meningitis is an inflammation of the protective membranes covering the brain and spinal cord caused by bacteria, fungi, or viruses with various clinical symptoms. Although meningitis is not so prevalent, it remains the most serious contagious disease. The aim of our study was to investigate the effect of gene expressions of nitric oxide synthases (NOS) on meningitis patients. Using samples taken from 61 meningitis patients, inducible NOS, endothelial NOS (eNOS), and neuronal NOS mRNA levels were assessed in both blood and cerebrospinal fluid (CSF). A control group was constructed of 64 healthy persons. The gene expression analysis was made using real-time polymerase chain reaction method. There was no neuronal NOS expression in either group, whereas inducible NOS expression was detected in 40 blood samples and 12 CSF samples from meningitis patients. However, there were no marked differences between groups (p=0.5104). eNOS expression was detected in all blood and CSF samples, which was markedly higher in patients (p=0.0367). Because the increase in eNOS expression increases NO production, eNOS expression in meningitis patients is of great importance. This increase of eNOS in meningitis patients compared with healthy subjects may lead to novel treatments for reducing the severity of the disease.

  12. [Advances of resveratrol synthase gene in the application of genetic engineering and biofunctional investigation].

    PubMed

    Zheng, Shigang; Li, Zhen; Zhao, Shancang; Wang, Qingguo; Liu, Wei

    2014-03-01

    Resveratrol synthase (RS) plays a key role in resveratrol (Res) biosynthesis. RS gene has been formerly reported to be transformed into many plant species and microorganisms, and to play certain roles in metabolic and regulation processes. In this paper, the transformations of RS gene in plants, and the related changes of biological properties, such as metabolites, anti-pathogen activities, anti-radical properties, and developmental characters in transgenic plants, as well as the production of resveratrol in microbes by utilizing RS gene were summarized. Moreover, the application prospects of RS gene in bioengineering were also addressed.

  13. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006.

    PubMed

    Gamez, Rocío M; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David; Mariño-Ramírez, Leonardo

    2016-05-05

    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds.

  14. Genome Sequence of the Banana Plant Growth-Promoting Rhizobacterium Pseudomonas fluorescens PS006.

    PubMed

    Gamez, Rocío M; Rodríguez, Fernando; Ramírez, Sandra; Gómez, Yolanda; Agarwala, Richa; Landsman, David; Mariño-Ramírez, Leonardo

    2016-01-01

    Pseudomonas fluorescens is a well-known plant growth-promoting rhizobacterium (PGPR). We report here the first whole-genome sequence of PGPR P. fluorescens evaluated in Colombian banana plants. The genome sequences contains genes involved in plant growth and defense, including bacteriocins, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and genes that provide resistance to toxic compounds. PMID:27151797

  15. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13,3

    SciTech Connect

    Lehto, M. Helsinki Univ. ); Stoffel, M.; Espinosa, R. III; Beau, M.M. le; Bell, G.I. ); Groop, L. )

    1993-02-01

    The enzyme glycogen synthase (UDP glocose:glycogen 4-[alpha]-D-glucosyltransferase, EC 2.4.1.11) catalyzes the formation of glycogen from uridine diphosphate glucose (UPDG). Impaired activation of muscle glycogen synthase by insulin has been noted in patients with genetic risk of developing non-insulin-dependent diabets mellitus (NIDDM) and this may represent an early defect in the pathogenesis of this disorder. As such, glycogen synthase represents a candidate gene for contributing to genetic susceptibility. As a first step in studying the role of glycogen synthase in the genetics of NIDDM, we have isolated a cosmid encoding the human glycogen synthase gene (gene symbol GYS) and determined its chromosomal localization by fluorescence in situ hybridization. 4 refs., 1 fig.

  16. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria x ananassa).

    PubMed

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria x ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus.

  17. Arabidopsis MYC2 Interacts with DELLA Proteins in Regulating Sesquiterpene Synthase Gene Expression[W][OA

    PubMed Central

    Hong, Gao-Jie; Xue, Xue-Yi; Mao, Ying-Bo; Wang, Ling-Jian; Chen, Xiao-Ya

    2012-01-01

    Arabidopsis thaliana flowers emit volatile terpenes, which may function in plant–insect interactions. Here, we report that Arabidopsis MYC2, a basic helix-loop-helix transcription factor, directly binds to promoters of the sesquiterpene synthase genes TPS21 and TPS11 and activates their expression. Expression of TPS21 and TPS11 can be induced by the phytohormones gibberellin (GA) and jasmonate (JA), and both inductions require MYC2. The induction of TPS21 and TPS11 results in increased emission of sesquiterpene, especially (E)-β-caryophyllene. DELLAs, the GA signaling repressors, negatively affect sesquiterpene biosynthesis, as the sesquiterpene synthase genes were repressed in plants overaccumulating REPRESSOR OF GA1-3 (RGA), one of the Arabidopsis DELLAs, and upregulated in a penta DELLA-deficient mutant. Yeast two-hybrid and coimmunoprecipitation assays demonstrated that DELLAs, represented by RGA, directly interact with MYC2. In yeast cells, the N terminus of MYC2 was responsible for binding to RGA. MYC2 has been proposed as a major mediator of JA signaling and crosstalk with abscisic acid, ethylene, and light signaling pathways. Our results demonstrate that MYC2 is also connected to GA signaling in regulating a subset of genes. In Arabidopsis inflorescences, it integrates both GA and JA signals into transcriptional regulation of sesquiterpene synthase genes and promotes sesquiterpene production. PMID:22669881

  18. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    PubMed

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  19. Effect of light on the gene expression and hormonal status of winter and spring wheat plants during cold hardening.

    PubMed

    Majláth, Imre; Szalai, Gabriella; Soós, Vilmos; Sebestyén, Endre; Balázs, Ervin; Vanková, Radomíra; Dobrev, Petre I; Tari, Irma; Tandori, Júlia; Janda, Tibor

    2012-06-01

    The effect of light on gene expression and hormonal status during the development of freezing tolerance was studied in winter wheat (Triticum aestivum var. Mv Emese) and in the spring wheat variety Nadro. Ten-day-old plants (3-leaf stage) were cold hardened at 5°C for 12 days under either normal (250 µmol m(-2) s(-1) ) or low (20 µmol m(-2) s(-1) ) light conditions. Comprehensive analysis was carried out to explore the background of frost tolerance and the differences between these wheat varieties. Global genome analysis was performed, enquiring about the details of the cold signaling pathways. The expression level of a large number of genes is affected by light, and this effect may differ in different wheat genotypes. Photosynthesis-related processes probably play a key role in the enhancement of freezing tolerance; however, there are several other genes whose induction is light-dependent, so either there is cross-talk between signaling of chloroplast originating and other protective mechanisms or there are other light sensors that transduce signals to the components responsible for stress tolerance. Changes in the level of both plant hormones (indole-3-acetic acid, cytokinins, nitric oxide and ethylene precursor 1-aminocyclopropane-1-carboxylic acid) and other stress-related protective substances (proline, phenolics) were investigated during the phases of the hardening period. Hormonal levels were also affected by light and their dynamics indicate that wheat plants try to keep growing during the cold-hardening period. The data from this experiment may provide a new insight into the cross talk between cold and light signaling in wheat.

  20. Effect of light on the gene expression and hormonal status of winter and spring wheat plants during cold hardening.

    PubMed

    Majláth, Imre; Szalai, Gabriella; Soós, Vilmos; Sebestyén, Endre; Balázs, Ervin; Vanková, Radomíra; Dobrev, Petre I; Tari, Irma; Tandori, Júlia; Janda, Tibor

    2012-06-01

    The effect of light on gene expression and hormonal status during the development of freezing tolerance was studied in winter wheat (Triticum aestivum var. Mv Emese) and in the spring wheat variety Nadro. Ten-day-old plants (3-leaf stage) were cold hardened at 5°C for 12 days under either normal (250 µmol m(-2) s(-1) ) or low (20 µmol m(-2) s(-1) ) light conditions. Comprehensive analysis was carried out to explore the background of frost tolerance and the differences between these wheat varieties. Global genome analysis was performed, enquiring about the details of the cold signaling pathways. The expression level of a large number of genes is affected by light, and this effect may differ in different wheat genotypes. Photosynthesis-related processes probably play a key role in the enhancement of freezing tolerance; however, there are several other genes whose induction is light-dependent, so either there is cross-talk between signaling of chloroplast originating and other protective mechanisms or there are other light sensors that transduce signals to the components responsible for stress tolerance. Changes in the level of both plant hormones (indole-3-acetic acid, cytokinins, nitric oxide and ethylene precursor 1-aminocyclopropane-1-carboxylic acid) and other stress-related protective substances (proline, phenolics) were investigated during the phases of the hardening period. Hormonal levels were also affected by light and their dynamics indicate that wheat plants try to keep growing during the cold-hardening period. The data from this experiment may provide a new insight into the cross talk between cold and light signaling in wheat. PMID:22257084

  1. Identification and Characterization of the Sucrose Synthase 2 Gene (Sus2) in Durum Wheat

    PubMed Central

    Volpicella, Mariateresa; Fanizza, Immacolata; Leoni, Claudia; Gadaleta, Agata; Nigro, Domenica; Gattulli, Bruno; Mangini, Giacomo; Blanco, Antonio; Ceci, Luigi R.

    2016-01-01

    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase (SUS), which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for SUS in durum wheat (cultivars Ciccio and Svevo) is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur, and 5-BIL42). The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modeling approaches. The combined results of sucrose synthase 2 expression and activity levels were then considered in the light of their possible involvement in starch yield. PMID:27014292

  2. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp

    SciTech Connect

    Schendel, F.J.; August, P.R.; Anderson, C.R.; Flickinger, M.C. ); Hanson, R.S. )

    1992-01-01

    Acetate salts are emerging as potentially attractive bulk chemicals for a variety of environmental applications, for example, as catalysts to facilitate combustion of high-sulfur coal by electrical utilities and as the biodegradable noncorrosive highway deicing salt calcium magnesium acetate. The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (M{sub r}, 84,500) with a sub unit with an M{sub r} of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes.

  3. Ethylene Biosynthesis Is Promoted by Very-Long-Chain Fatty Acids during Lysigenous Aerenchyma Formation in Rice Roots.

    PubMed

    Yamauchi, Takaki; Shiono, Katsuhiro; Nagano, Minoru; Fukazawa, Aya; Ando, Miho; Takamure, Itsuro; Mori, Hitoshi; Nishizawa, Naoko K; Kawai-Yamada, Maki; Tsutsumi, Nobuhiro; Kato, Kiyoaki; Nakazono, Mikio

    2015-09-01

    In rice (Oryza sativa) roots, lysigenous aerenchyma, which is created by programmed cell death and lysis of cortical cells, is constitutively formed under aerobic conditions, and its formation is further induced under oxygen-deficient conditions. Ethylene is involved in the induction of aerenchyma formation. reduced culm number1 (rcn1) is a rice mutant in which the gene encoding the ATP-binding cassette transporter RCN1/OsABCG5 is defective. Here, we report that the induction of aerenchyma formation was reduced in roots of rcn1 grown in stagnant deoxygenated nutrient solution (i.e. under stagnant conditions, which mimic oxygen-deficient conditions in waterlogged soils). 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) is a key enzyme in ethylene biosynthesis. Stagnant conditions hardly induced the expression of ACS1 in rcn1 roots, resulting in low ethylene production in the roots. Accumulation of saturated very-long-chain fatty acids (VLCFAs) of 24, 26, and 28 carbons was reduced in rcn1 roots. Exogenously supplied VLCFA (26 carbons) increased the expression level of ACS1 and induced aerenchyma formation in rcn1 roots. Moreover, in rice lines in which the gene encoding a fatty acid elongase, CUT1-LIKE (CUT1L; a homolog of the gene encoding Arabidopsis CUT1, which is required for cuticular wax production), was silenced, both ACS1 expression and aerenchyma formation were reduced. Interestingly, the expression of ACS1, CUT1L, and RCN1/OsABCG5 was induced predominantly in the outer part of roots under stagnant conditions. These results suggest that, in rice under oxygen-deficient conditions, VLCFAs increase ethylene production by promoting 1-aminocyclopropane-1-carboxylic acid biosynthesis in the outer part of roots, which, in turn, induces aerenchyma formation in the root cortex.

  4. Ethylene Biosynthesis Is Promoted by Very-Long-Chain Fatty Acids during Lysigenous Aerenchyma Formation in Rice Roots1

    PubMed Central

    Yamauchi, Takaki; Shiono, Katsuhiro; Nagano, Minoru; Fukazawa, Aya; Ando, Miho; Takamure, Itsuro; Mori, Hitoshi; Nishizawa, Naoko K.; Kawai-Yamada, Maki; Tsutsumi, Nobuhiro; Kato, Kiyoaki; Nakazono, Mikio

    2015-01-01

    In rice (Oryza sativa) roots, lysigenous aerenchyma, which is created by programmed cell death and lysis of cortical cells, is constitutively formed under aerobic conditions, and its formation is further induced under oxygen-deficient conditions. Ethylene is involved in the induction of aerenchyma formation. reduced culm number1 (rcn1) is a rice mutant in which the gene encoding the ATP-binding cassette transporter RCN1/OsABCG5 is defective. Here, we report that the induction of aerenchyma formation was reduced in roots of rcn1 grown in stagnant deoxygenated nutrient solution (i.e. under stagnant conditions, which mimic oxygen-deficient conditions in waterlogged soils). 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) is a key enzyme in ethylene biosynthesis. Stagnant conditions hardly induced the expression of ACS1 in rcn1 roots, resulting in low ethylene production in the roots. Accumulation of saturated very-long-chain fatty acids (VLCFAs) of 24, 26, and 28 carbons was reduced in rcn1 roots. Exogenously supplied VLCFA (26 carbons) increased the expression level of ACS1 and induced aerenchyma formation in rcn1 roots. Moreover, in rice lines in which the gene encoding a fatty acid elongase, CUT1-LIKE (CUT1L; a homolog of the gene encoding Arabidopsis CUT1, which is required for cuticular wax production), was silenced, both ACS1 expression and aerenchyma formation were reduced. Interestingly, the expression of ACS1, CUT1L, and RCN1/OsABCG5 was induced predominantly in the outer part of roots under stagnant conditions. These results suggest that, in rice under oxygen-deficient conditions, VLCFAs increase ethylene production by promoting 1-aminocyclopropane-1-carboxylic acid biosynthesis in the outer part of roots, which, in turn, induces aerenchyma formation in the root cortex. PMID:26036614

  5. Nucleotide sequence variation of chitin synthase genes among ectomycorrhizal fungi and its potential use in taxonomy.

    PubMed Central

    Mehmann, B; Brunner, I; Braus, G H

    1994-01-01

    DNA sequences of single-copy genes coding for chitin synthases (UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyltransferase; EC 2.4.1.16) were used to characterize ectomycorrhizal fungi. Degenerate primers deduced from short, completely conserved amino acid stretches flanking a region of about 200 amino acids of zymogenic chitin synthases allowed the amplification of DNA fragments of several members of this gene family. Different DNA band patterns were obtained from basidiomycetes because of variation in the number and length of amplified fragments. Cloning and sequencing of the most prominent DNA fragments revealed that these differences were due to various introns at conserved positions. The presence of introns in basidiomycetous fungi therefore has a potential use in identification of genera by analyzing PCR-generated DNA fragment patterns. Analyses of the nucleotide sequences of cloned fragments revealed variations in nucleotide sequences from 4 to 45%. By comparison of the deduced amino acid sequences, the majority of the DNA fragments were identified as members of genes for chitin synthase class II. The deduced amino acid sequences from species of the same genus differed only in one amino acid residue, whereas identity between the amino acid sequences of ascomycetous and basidiomycetous fungi within the same taxonomic class was found to be approximately 43 to 66%. Phylogenetic analysis of the amino acid sequence of class II chitin synthase-encoding gene fragments by using parsimony confirmed the current taxonomic groupings. In addition, our data revealed a fourth class of putative zymogenic chitin synthesis. Images PMID:7944356

  6. Expression pattern of the coparyl diphosphate synthase gene in developing rice anthers.

    PubMed

    Fukuda, Ari; Nemoto, Keisuke; Chono, Makiko; Yamaguchi, Shinjiro; Nakajima, Masatoshi; Yamagishi, Junko; Maekawa, Masahiko; Yamaguchi, Isomaro

    2004-08-01

    Rice anthers contain high concentrations of gibberellins A(4) and A(7). To understand their physiological roles, we examined the site of their biosynthesis by analyzing the expression pattern of a gene (OsCPS) encoding coparyl diphosphate synthase in developing rice flowers. Expression was apparent in the anthers 1-2 days before flowering, and CPS mRNA accumulated in the maturing pollen.

  7. After-ripening induced transcriptional changes of hormonal genes in wheat seeds: the cases of brassinosteroids, ethylene, cytokinin and salicylic acid.

    PubMed

    Chitnis, Vijaya R; Gao, Feng; Yao, Zhen; Jordan, Mark C; Park, Seokhoon; Ayele, Belay T

    2014-01-01

    Maintenance and release of seed dormancy is regulated by plant hormones; their levels and seed sensitivity being the critical factors. This study reports transcriptional regulation of brassinosteroids (BR), ethylene (ET), cytokinin (CK) and salicylic acid (SA) related wheat genes by after-ripening, a period of dry storage that decays dormancy. Changes in the expression of hormonal genes due to seed after-ripening did not occur in the anhydrobiotic state but rather in the hydrated state. After-ripening induced dormancy decay appears to be associated with imbibition mediated increase in the synthesis and signalling of BR, via transcriptional activation of de-etiolated2, dwarf4 and brassinosteroid signaling kinase, and repression of brassinosteroid insensitive 2. Our analysis is also suggestive of the significance of increased ET production, as reflected by enhanced transcription of 1-aminocyclopropane-1-carboxylic acid oxidase in after-ripened seeds, and tight regulation of seed response to ET in regulating dormancy decay. Differential transcriptions of lonely guy, zeatin O-glucosyltransferases and cytokinin oxidases, and pseudo-response regulator between dormant and after-ripened seeds implicate CK in the regulation of seed dormancy in wheat. Our analysis also reflects the association of dormancy decay in wheat with seed SA level and NPR independent SA signaling that appear to be regulated transcriptionally by phenylalanine ammonia lyase, and whirly and suppressor of npr1 inducible1 genes, respectively. Co-expression clustering of the hormonal genes implies the significance of synergistic and antagonistic interaction between the different plant hormones in regulating wheat seed dormancy. These results contribute to further our understanding of the molecular features controlling seed dormancy in wheat.

  8. Suppression of vascular smooth muscle cell responses induced by TNF-α in GM3 synthase gene transfected cells.

    PubMed

    Park, Sung-Suk; Kim, Wun-Jae; Moon, Sung-Kwon

    2011-01-01

    The natural accumulation of ganglioside GM3 (N-glycolylneuraminic acid) on atherosclerotic lesions is a common theory. The present study is the first to examine the effects of the GM3 synthase gene on the responses of vascular smooth muscle cells (VSMC) to tumor necrosis factor-α (TNF-α). We found that overexpression of the GM3 synthase gene inhibited DNA synthesis and ERK1/2 activity induced by TNF-α in VSMC, whereas the basal levels of DNA synthesis and ERK1/2 activity remained unchanged. In addition, GM3 synthase gene transfectants significantly reduced the migration and invasion of VSMC following TNF-α treatment, compared with empty vector transfectants. Furthermore, TNF-α-induced matrix metalloproteinase-9 (MMP-9) expression and promoter activity were also decreased in GM3 synthase gene transfectants. GM3 synthase gene expression markedly suppressed the TNF-α-stimulated transcriptional activity of activator protein-1 (AP-1) and nuclear factor-κB (NF-κB), which are the controlling factors of MMP-9 expression. Consistent with these results, the addition of anti-GM3 antibody into the GM3 synthase gene transfectants blocked inhibition of DNA synthesis, ERK1/2 activity, migration and invasion. Finally, GM3 synthase gene transfectants treated with anti-GM3 antibody reversed the suppression of MMP-9 expression by reducing AP-1 and NF-κB binding activity. These results suggest regulatory roles for the GM3 synthase gene in VSMC proliferation and migration during the formation of atherosclerotic lesions.

  9. Phylogenetically diverse cultivable fungal community and polyketide synthase (PKS), non-ribosomal peptide synthase (NRPS) genes associated with the South China Sea sponges.

    PubMed

    Zhou, Kang; Zhang, Xia; Zhang, Fengli; Li, Zhiyong

    2011-10-01

    Compared with sponge-associated bacteria, the phylogenetic diversity of fungi in sponge and the association of sponge fungi remain largely unknown. Meanwhile, no detection of polyketide synthase (PKS) or non-ribosomal peptide synthase (NRPS) genes in sponge-associated fungi has been attempted. In this study, diverse and novel cultivable fungi including 10 genera (Aspergillus, Ascomycete, Fusarium, Isaria, Penicillium, Plectosphaerella, Pseudonectria, Simplicillium, Trichoderma, and Volutella) in four orders (Eurotiales, Hypocreales, Microascales, and Phyllachorales) of phylum Ascomycota were isolated from 10 species marine sponges in the South China Sea. Eurotiales and Hypocreales fungi were suggested as sponge generalists. The predominant isolates were Penicillium and Aspergillus in Eurotiales followed by Volutella in Hypocreales. Based on the conserved Beta-ketosynthase of PKS and A domain of NRPS, 15 polyketide synthases, and four non-ribosomal peptides synthesis genes, including non-reducing and reducing PKSs and hybrid PKS-NRPS, were detected in these fungal isolates. A lateral gene transfer event was indicated in the comparison between the phylogenetic diversity of 18S rRNA genes and β-ketoacyl synthase domain sequences. Some fungi, especially those with PKS or NRPS genes, showed antimicrobial activity against P. fluorescens, S. aureus and B. subtilis. It was the first time to investigate PKS and NRPS genes in sponge-associated fungi. Based on the detected antibiotics biosynthesis-related PKS and NRPS genes and antimicrobial activity, the potential ecological role of sponge-associated fungi in the chemical defense for sponge host was suggested. This study extended our knowledge of sponge-associated fungal phylogenetic diversity and their potential roles in the chemical defense.

  10. Detecting adaptive evolution and functional divergence in aminocyclopropane-1-carboxylate synthase (ACS) gene family.

    PubMed

    Zhang, Ti-Cao; Qiao, Qin; Zhong, Yang

    2012-06-01

    Ethylene is an essential plant gaseous hormone that controls many aspects of plant growth and development, especially the fruit ripening. It is important to know how this hormone is synthesized and how its production is regulated to understand the roles of ethylene in plant development. The aminocyclopropane-1-carboxylate synthase (ACS) gene is a rate-limiting enzyme in the ethylene biosynthesis pathway, which is encoded by a highly divergent multi-gene family in plant species. Although many ACS genes have been cloned from a wide variety of plant species previously, their origin and evolutionary process are still not clear. In this study, we conducted a phylogenetic analysis based on an updated dataset including 107 members of plant ACS genes and eight ACS-like genes from animal as well as six AATase genes. The motifs were identified and the positive selection and functional divergence in the ACS gene family were detected. The results obtained from these analyses are consistent with previous division of the ACS gene family in angiosperm, i.e., three distinct clades, and show that the duplications of three subclades (I, II and III) ACS genes have occurred after the divergence of gymnosperm and angiosperm. We conclude that the ACS genes could have experienced three times significant positive selection as they underwent expansion in land plants and gain the full-scale ethylene biosynthesis and regulatory functions, and all plant ACS genes originated from plant-ACS-like genes which come from AATase genes.

  11. Evolutionary analyses of the small subunit of glutamate synthase: gene order conservation, gene fusions, and prokaryote-to-eukaryote lateral gene transfers.

    PubMed

    Andersson, Jan O; Roger, Andrew J

    2002-04-01

    Lateral gene transfer has been identified as an important mode of genome evolution within prokaryotes. Except for the special case of gene transfer from organelle genomes to the eukaryotic nucleus, only a few cases of lateral gene transfer involving eukaryotes have been described. Here we present phylogenetic and gene order analyses on the small subunit of glutamate synthase (encoded by gltD) and its homologues, including the large subunit of sulfide dehydrogenase (encoded by sudA). The scattered distribution of the sudA and sudB gene pair and the phylogenetic analysis strongly suggest that lateral gene transfer was involved in the propagation of the genes in the three domains of life. One of these transfers most likely occurred between a prokaryote and an ancestor of diplomonad protists. Furthermore, phylogenetic analyses indicate that the gene for the small subunit of glutamate synthase was transferred from a low-GC gram-positive bacterium to a common ancestor of animals, fungi, and plants. Interestingly, in both examples, the eukaryotes encode a single gene that corresponds to a conserved operon structure in prokaryotes. Our analyses, together with several recent publications, show that lateral gene transfers from prokaryotes to unicellular eukaryotes occur with appreciable frequency. In the case of the genes for sulfide dehydrogenase, the transfer affected only a limited group of eukaryotes--the diplomonads--while the transfer of the glutamate synthase gene probably happened earlier in evolution and affected a wider range of eukaryotes.

  12. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    SciTech Connect

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. )

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  13. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    PubMed

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland.

  14. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    PubMed

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland. PMID:11272819

  15. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    PubMed Central

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  16. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity.

  17. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    PubMed Central

    2012-01-01

    Background Chrysanthemyl diphosphate synthase (CDS) is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS) gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS. PMID:23137178

  18. Expression of the patatin-related phospholipase A gene AtPLA IIA in Arabidopsis thaliana is up-regulated by salicylic acid, wounding, ethylene, and iron and phosphate deficiency.

    PubMed

    Rietz, Steffen; Holk, André; Scherer, Günther F E

    2004-09-01

    In Arabidopsis thaliana (L.) Heynh., the cytosolic, patatin-related phospholipase A enzymes comprise a family of ten genes designated AtPLAs thought to be involved in auxin and pathogen signalling [A. Holk et al. (2002) Plant Physiol 130:90-101]. One of these, AtPLA IIA, is investigated here by studying its transcriptional regulation through transgenic Arabidopsis plants containing the AtPLA IIA promoter (PIIA) fused to the beta-glucuronidase (GUS) gene. GUS activity appeared in leaves at 10-12 days and became increasingly stronger with age in all leaves. From the same age on, strong GUS activity was visible in the basal stipules of the rosette leaves. PIIA-dependent GUS activity was found in the older parts of the primary root (from 10 days on) and, later in development, in older parts of side roots, and the root cap. No GUS activity was detected in flower organs. PIIA-dependent GUS expression in 12-day-old plants was up-regulated after treatment by salicylic acid, Bion, wounding, 1-aminocyclopropane-1-carboxylic acid (ACC) and jasmonic acid. When transgenic PIIA:: uidA plants were grown devoid of iron, 9-day-old plants exhibited increased GUS activity in the leaves and, when devoid of phosphate, 11-day-old plants had increased GUS activity in the roots. In conclusion, this member of the patatin-related phospholipase A gene family showed properties of a defence and iron-stress and phosphate-stress gene, being transcriptionally up-regulated within hours or days.

  19. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    PubMed

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  20. Chalcone synthase gene lineage diversification confirms allopolyploid evolutionary relationships of European rostrate violets.

    PubMed

    van den Hof, Kevin; van den Berg, Ronald G; Gravendeel, Barbara

    2008-10-01

    Phylogenetic relationships among and within the subsections of the genus Viola are still far from resolved. We present the first organismal phylogeny of predominantly western European species of subsection Rostratae based on the plastid trnS-trnG intron and intergenic spacer and the nuclear low-copy gene chalcone synthase (CHS) sequences. CHS is a key enzyme in the synthesis of flavonoids, which are important for flower pigmentation. Genes encoding for CHS are members of a multigene family. In Viola, 3 different CHS copies are present. CHS gene lineages obtained confirmed earlier hypotheses about reticulate relationships between species of Viola subsection Rostratae based on karyotype data. Comparison of the CHS gene lineage tree and the plastid species phylogeny of Viola reconstructed in this study indicates that the different CHS copies present in Viola are the products of both recent and more ancient duplications.

  1. Harvesting of novel polyhydroxyalkanaote (PHA) synthase encoding genes from a soil metagenome library using phenotypic screening.

    PubMed

    Schallmey, Marcus; Ly, Anh; Wang, Chunxia; Meglei, Gabriela; Voget, Sonja; Streit, Wolfgang R; Driscoll, Brian T; Charles, Trevor C

    2011-08-01

    We previously reported the construction of metagenomic libraries in the IncP cosmid vector pRK7813, enabling heterologous expression of these broad-host-range libraries in multiple bacterial hosts. Expressing these libraries in Sinorhizobium meliloti, we have successfully complemented associated phenotypes of polyhydroxyalkanoate synthesis mutants. DNA sequence analysis of three clones indicates that the complementing genes are homologous to, but substantially different from, known polyhydroxyalkanaote synthase-encoding genes. Thus we have demonstrated the ability to isolate diverse genes for polyhydroxyalkanaote synthesis by functional complementation of defined mutants. Such genes might be of use in the engineering of more efficient systems for the industrial production of bioplastics. The use of functional complementation will also provide a vehicle to probe the genetics of polyhydroxyalkanaote metabolism and its relation to carbon availability in complex microbial assemblages. PMID:21631577

  2. Differential expression of acetohydroxyacid synthase genes in sunflower plantlets and its response to imazapyr herbicide.

    PubMed

    Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana; Nestares, Graciela

    2013-07-01

    Acetohydroxyacid synthase (AHAS) catalyzes the first reaction in branch chain amino acids biosynthesis. This enzyme is the target of several herbicides, including all members of the imidazolinone family. Little is known about the expression of the three acetohydroxyacid synthase genes (ahas1, ahas2 and ahas3) in sunflower. The aim of this work was to evaluate ahas gene expression and AHAS activity in different tissues of sunflower plantlets. Three genotypes differing in imidazolinone resistance were evaluated, two of which carry an herbicide resistant-endowing mutation known as Ahasl1-1 allele. In vivo and in vitro AHAS activity and transcript levels were higher in leaves than in roots. The ahas3 transcript was the less abundant in both tissues. No significant difference was observed between ahas1 and ahas2 transcript levels of the susceptible genotype but a higher ahas1 transcript level was observed in leaves of genotypes carrying Ahasl1-1 allele. Similar transcript levels were found for ahas1 and ahas2 in roots of genotypes carrying Ahasl1-1 allele whereas higher ahas2 abundance was found in the susceptible genotype. Herbicide treatment triggered tissue-specific, gene and genotype-dependent changes in ahas gene expression. AHAS activity was highly inhibited in the susceptible genotype. Differential responses were observed between in vitro and in vivo AHAS inhibition assays. These findings enhance our understanding of AHAS expression in sunflower genotypes differing for herbicide resistance and its response to herbicide treatment.

  3. Congenital hyperreninemic hypoaldosteronism unlinked to the aldosterone synthase (CYP11B2) gene.

    PubMed

    Kayes-Wandover, K M; Tannin, G M; Shulman, D; Peled, D; Jones, K L; Karaviti, L; White, P C

    2001-11-01

    Isolated hyperreninemic hypoaldosteronism presenting in infancy is usually caused by mutations in the CYP11B2 gene encoding aldosterone synthase. We studied five patients in four unrelated kindreds with hyperreninemic hypoaldosteronism, in whom we were unable to find such mutations. All presented in infancy with failure to thrive, hyponatremia, hyperkalemia, markedly elevated plasma renin activity, and low or inappropriately normal aldosterone levels. All had normal cortisol levels and no signs or symptoms of congenital adrenal hyperplasia. All responded to fludrocortisone treatment. There were no mutations detected in exons or splice junctions of CYP11B2. Linkage of the disorder to CYP11B2 was studied in two unrelated consanguineous patients and in an affected sib pair. The consanguineous patients were each heterozygous for at least one of three polymorphic microsatellite markers near CYP11B2, excluding linkage to CYP11B2. However, linkage of the disease to CYP11B2 could not be excluded in the affected sib pair. Genes involved in the regulation of aldosterone biosynthesis, including those encoding angiotensinogen, angiotensin-converting enzyme, and the AT1 angiotensin II receptor were similarly excluded from linkage. These results demonstrate the existence of an inherited form of hyperreninemic hypoaldosteronism distinct from aldosterone synthase deficiency. The affected gene(s) remain to be determined.

  4. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  5. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    PubMed

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  6. Identification and characterization of two chitin synthase genes in African malaria mosquito, Anopheles gambiae

    PubMed Central

    Zhang, Xin; Zhang, Jianzhen; Park, Yoonseong; Zhu, Kun Yan

    2012-01-01

    Chitin synthase (CHS) represents an attractive target site for combating insect pests as insect growth and development are strictly dependent on precisely tuned chitin biosynthesis and this pathway is absent in humans and other vertebrates. Current knowledge on CHS in insects, especially their structures, functions, and regulations is still very limited. We report the identification and characterization of two chitin synthase genes, AgCHS1 and AgCHS2, in African malaria mosquito, Anopheles gambiae. AgCHS1 and AgCHS2 were predicted to encode proteins of 1,578 and 1,586 amino acid residues, respectively. Their deduced amino acid sequences show high similarities to other insect chitin synthases. Transcriptional analysis indicated that AgCHS1 was expressed in egg, larval, pupal and adult stages whereas AgCHS2 appeared to be expressed at relatively low levels, particularly during the larval stages as examined by reverse transcription (RT)-PCR and real-time quantitative PCR. Relatively high expression was detected in the carcass followed by the foregut and hindgut for AgCHS1, and the foregut (cardia included) followed by the midgut for AgCHS2. Fluorescence in situ hybridization (FISH) and immunohistochemical analysis revealed new information including the localization of the two enzymes in the ommatidia of the compound eyes, and AgCHS2 in the thoracic and abdominal inter-segmental regions of pupal integument. PMID:22683441

  7. Three New Non-reducing Polyketide Synthase Genes from the Lichen-Forming Fungus Usnea longissima

    PubMed Central

    Wang, Yi; Wang, Juan; Cheong, Yong Hwa

    2014-01-01

    Usnea longissima has a long history of use as a traditional medicine. Several bioactive compounds, primarily belonging to the polyketide family, have been isolated from U. longissima. However, the genes for the biosynthesis of these compounds are yet to be identified. In the present study, three different types of non-reducing polyketide synthases (UlPKS2, UlPKS4, and UlPKS6) were identified from a cultured lichen-forming fungus of U. longissima. Phylogenetic analysis of product template domains showed that UlPKS2 and UlPKS4 belong to group IV, which includes the non-reducing polyketide synthases with an methyltransferase (MeT) domain that are involved in methylorcinol-based compound synthesis; UlPKS6 was found to belong to group I, which includes the non-reducing polyketide synthases that synthesize single aromatic ring polyketides, such as orsellinic acid. Reverse transcriptase-PCR analysis demonstrated that UlPKS2 and UlPKS4 were upregulated by sucrose; UlPKS6 was downregulated by asparagine, glycine, and alanine. PMID:24808732

  8. Codon usage bias analysis for the spermidine synthase gene from Camellia sinensis (L.) O. Kuntze.

    PubMed

    You, E; Wang, Y; Ding, Z T; Zhang, X F; Pan, L L; Zheng, C

    2015-07-03

    The spermidine synthase (SPDS) gene exists widely in all types of plants. In this paper, the codon usage of the SPDS gene from Camellia sinensis (CsSPDS) was analyzed. The results showed that the codon usage of the CsSPDS gene is biased towards the T-ended or A-ended codons, which is similar to that observed in 73 genes selected from the C. sinensis genome. An ENC-plot for 15 SPDS genes from various plant species suggested that mutational bias was the major factor in shaping codon usage in these genes. Codon usage frequency analysis indicated that there was little difference between the CsSPDS gene and dicot genomes, such as Arabidopsis thaliana and Nicotiana tabacum, but significant differences in codon usage were observed between the CsSPDS gene and monocot genomes, such as Triticum aestivum and Zea mays. Therefore, A. thaliana and N. tabacum expression systems may be more suitable for the expression of the CsSPDS gene.

  9. Noncholinergic penile erection in mice lacking the gene for endothelial nitric oxide synthase.

    PubMed

    Burnett, Arthur L; Chang, Alex G; Crone, Julie K; Huang, Paul L; Sezen, Sena E

    2002-01-01

    With the current understanding that nitric oxide (NO) mediates penile erection, the endothelial isoform of NO synthase (eNOS) has been implicated in this function. We undertook this study applying transgenic mice with targeted deletion of the eNOS gene (eNOS-/- mice) as an experimental approach to evaluate the importance of eNOS in cholinergically stimulated erectile function in vivo. Combined pharmacostimulation with intracavernosal carbachol (3 ng) administration and submaximal cavernous nerve (CN) electrical stimulation (16 Hz, 5 millisecond, 1 V) simultaneous with intracavernosal pressure (ICP) monitoring, and both biochemical assay of NO synthase activity and Western blot analysis of eNOS protein content in penile tissue, were performed on eNOS-/- mice and wild-type controls. Combined intracavernosal carbachol administration and submaximal CN electrical stimulation raised the recorded ICP, elicited by CN electrical stimulation alone in wild-type mice (from 35.7 +/- 2.7 to 48.1 +/- 5.5 mm Hg, P < .05) but not in eNOS-/ - mice (from 54.9 +/- 6.3 to 51.0 +/- 9.5 mm Hg, not significant [NS]). Pretreatment with the nonselective nitric oxide synthase inhibitor nitro-L-arginine methyl ester (L-NAME; 100 mg intracavernosally) blocked electrically stimulated ICP responses in eNOS-/- mice to baseline levels (37.8 +/- 4.4 vs 12.7 +/- 4.0 mm Hg, P < .05). In penes of eNOS-/- mice, approximately 60% NO synthase activity of wild-type penis levels was retained (NS), and eNOS protein was absent. We concluded that eNOS-/- mice preserve erectile function on the basis of a noncholinergic but NO-dependent mechanism and that eNOS physiologically mediates penile erection under cholinergic stimulation. PMID:11780929

  10. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia.

    PubMed

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

    2003-11-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure. These results are consistent with the possibility of an incidental acquisition and transmission of P. jiroveci mutant types, either by person to person transmission or from an environmental source.

  11. Molecular cloning and in vitro expression of a silent phenoxazinone synthase gene from Streptomyces lividans.

    PubMed

    Madu, A C; Jones, G H

    1989-12-14

    Phenoxazinone synthase (PHS) catalyzes a step in actinomycin D biosynthesis in Streptomyces antibioticus. Two sequences from Streptomyces lividans that hybridize to the phs gene of S. antibioticus have been cloned in Escherichia coli K-12 using the plasmid pBR322. Although there was some similarity in the restriction maps of the two cloned fragments, neither insert appeared to be a direct subset of the other nor of the S. antibioticus phs gene. In vitro expression studies, in a streptomycete coupled transcription-translation system, showed that a 3.98-kb SphI fragment encoded a PHS-related protein. These observations provide additional support for the existence of silent genes for antibiotic production in streptomycetes.

  12. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  13. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  14. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  15. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.

    2008-01-01

    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  16. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    PubMed Central

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  17. Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family.

    PubMed

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three "Arabidopsis-like" subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of oilseeds

  18. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    SciTech Connect

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  19. Characterization of a non-reducing polyketide synthase gene from lichen Dirinaria applanata.

    PubMed

    Valarmathi, R; Hariharan, G N; Venkataraman, Gayatri; Parida, Ajay

    2009-04-01

    Lichens are known to produce a variety of secondary metabolites including polyketides that have diverse biological role(s). The biosynthesis of fungal polyketides is governed by type I polyketide synthases (PKS), enzymes with a multidomain structure, including the beta-ketoacyl synthase (KS), acyl transferase (AT), ketoreductase (KR), dehydratase (DH), enoyl reductase (ER) and acyl carrier protein (ACP) domains. Established soredial cultures of Dirinaria applanata (Fée) producing atranorin and divaricatic acid were used to characterize a polyketide synthase gene (DnPKS). A 743bp fragment corresponding to the ketosynthase domain (KS) was isolated using degenerate primers. Complete sequence information for DnPKS (8162bp) was obtained by walking in the 5'and 3' directions of the isolated KS domain using TAIL PCR. A translation of the DnPKS sequence identified the presence of KS, AT, two ACP and TE domains with eight intervening introns. TBLASTX analysis and comparison with other PKS sequences suggest that the coding region of DnPKS sequence is complete with the identification of putative start and stop codons and a stretch of 1226 upstream of the start codon corresponding to the putative promoter. This sequence shows the presence of putative binding sites for fungal transcription factors such as AflR, AreA and PacC. Southern blot analysis suggests that additional DnPKS-like genes may be present in the D. applanata genome. Additionally, expression of a DnPKS-like transcript was examined under different culture conditions and found to be down-regulated by sucrose and up-regulated by mannitol, UV and neutral pH. PMID:19427006

  20. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  1. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  2. Cloning of galactinol synthase gene from Ammopiptanthus mongolicus and its expression in transgenic Photinia serrulata plants.

    PubMed

    Song, Jian; Liu, Jing; Weng, Manli; Huang, Yanyan; Luo, Lei; Cao, Pengxiu; Sun, Haiwei; Liu, Jie; Zhao, Jinhong; Feng, Dianqi; Wang, Bin

    2013-01-15

    A cold induced galactinol synthase gene (AmGS) and its promoter sequence were identified and cloned from the cold-tolerant tree Ammopiptanthus mongolicus by using cDNA-AFLP, RACE-PCR and TAIL-PCR strategies combined with its expression pattern analysis after cold inducing treatment. Accession number of the AmGS gene in GenBank is DQ519361. The open reading frame (ORF) region of the AmGS gene is 987 nucleotides encoding for 328 amino acid residues and a stop codon. The genomic DNA sequence of AmGS gene contains 3 exons and 2 introns. Moreover, a variety of temporal gene expression patterns of AmGS was detected, which revealed the up-regulation of AmGS gene in stresses of cold, ABA and others. Then the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated transformation, and the transgenic plants exhibited higher cold-tolerance comparing with non-transformed plants.

  3. SUI-family genes encode phosphatidylserine synthases and regulate stem development in rice.

    PubMed

    Yin, Hengfu; Gao, Peng; Liu, Chengwu; Yang, Jun; Liu, Zhongchi; Luo, Da

    2013-01-01

    In vascular plants, the regulation of stem cell niche determines development of aerial shoot which consists of stems and lateral organs. Intercalary meristem (IM) controls internode elongation in rice and other grasses, however little attention has been paid to the underlying mechanism of stem cell maintenance. Here, we investigated the stem development in rice and showed that the Shortened Uppermost Internode 1 (SUI1) family of genes are pivotal for development of rice stems. We demonstrated that SUI-family genes regulate the development of IM for internode elongation and also the cell expansion of the panicle stem rachis in rice. The SUI-family genes encoded base-exchange types of phosphatidylserine synthases (PSSs), which possessed enzymatic activity in a yeast complementary assay. Overexpression of SUI1 and SUI2 caused outgrowths of internodes during vegetative development, and we showed that expression patterns of Oryza Sativa Homeobox 15 (OSH15) and Histone4 were impaired. Furthermore, genome-wide gene expression analysis revealed that overexpression and RNA knockdown of SUI-family genes affected downstream gene expression related to phospholipid metabolic pathways. Moreover, using Ultra-performance liquid chromatography-quadrupole time of flight-mass spectrometry, we analyzed PS contents in different genetic backgrounds of rice and showed that the quantity of very long chain fatty acids PS is affected by transgene of SUI-family genes. Our study reveals a new mechanism conveyed by the SUI1 pathway and provides evidence to link lipid metabolism with plant stem cell maintenance.

  4. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    PubMed

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  5. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    PubMed

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma.

  6. Transcriptional regulation of the genes encoding chitin and β-1,3-glucan synthases from Ustilago maydis.

    PubMed

    Robledo-Briones, Mariana; Ruiz-Herrera, José

    2012-07-01

    Transcriptional regulation of genes encoding chitin synthases (CHS) and β-1,3-glucan synthase (GLS) from Ustilago maydis was studied. Transcript levels were measured during the growth curve of yeast and mycelial forms, in response to ionic and osmotic stress, and during infection of maize plants. Expression of the single GLS gene was constitutive. In contrast, CHS genes expression showed differences depending on environmental conditions. Transcript levels were slightly higher in the mycelial forms, the highest levels occurring at the log phase. Ionic and osmotic stress induced alterations in the expression of CHS genes, but not following a defined pattern, some genes were induced and others repressed by the tested compounds. Changes in transcripts were more apparent during the pathogenic process. At early infection stages, only CHS6 gene showed significant transcript levels, whereas at the period of tumor formation CHS7 and CHS8 genes were also were induced.

  7. Tracking sesamin synthase gene expression through seed maturity in wild and cultivated sesame species--a domestication footprint.

    PubMed

    Pathak, N; Bhaduri, A; Bhat, K V; Rai, A K

    2015-09-01

    Sesamin and sesamolin are the major oil-soluble lignans present in sesame seed, having a wide range of biological functions beneficial to human health. Understanding sesame domestication history using sesamin synthase gene expression could enable delineation of the sesame putative progenitor. This report examined the functional expression of sesamin synthase (CYP81Q1) during capsule maturation (0-40 days after flowering) in three wild Sesamum species and four sesame cultivars. Among the cultivated accessions, only S. indicum (CO-1) exhibited transcript abundance of sesamin synthase along with high sesamin content similar to S. malabaricum, while the other cultivated sesame showed low expression. The sesamin synthase expression analysis, coupled with quantification of sesamin level, indicates that sesamin synthase was not positively favoured during domestication. The sesamin synthase expression pattern and lignan content, along with phylogenetic analysis suggested a close relationship of cultivated sesame and the wild species S. malabaricum. The high genetic identity between the two species S. indicum and S. malabaricum points towards the role of the putative progenitor S. malabaricum in sesame breeding programmes to broaden the genetic base of sesame cultivars. This study emphasises the need to investigate intraspecific and interspecific variation in the primary, secondary and tertiary gene pools to develop superior sesame genotypes.

  8. Insect attack and wounding induce traumatic resin duct development and gene expression of (-)-pinene synthase in Sitka spruce.

    PubMed

    McKay, S Ashley Byun; Hunter, William L; Godard, Kimberley-Ann; Wang, Shawn X; Martin, Diane M; Bohlmann, Jörg; Plant, Aine L

    2003-09-01

    Conifers possess inducible terpenoid defense systems. These systems are associated with the formation of traumatic resin ducts (TRD) and are underpinned by enhanced gene expression and activity of terpene synthases (TPS), enzymes responsible for oleoresin formation. We first determined that Sitka spruce (Picea sitchensis [Bong.] Carriere) had the capacity for TRD formation by mechanically wounding representative trees. We then proceeded to investigate whether the white pine weevil (Pissodes strobi Peck.), a stem-boring insect, can influence the expression of genes encoding monoterpene synthases (mono-tps) in Sitka spruce. We went on to compare this response with the effects of a simulated insect attack by drill wounding. A significant increase in mono-tps transcript level was observed in the leaders of lateral branches of weevil-attacked and mechanically wounded trees. In this study, weevils induced a more rapid enhancement of mono-tps gene expression. A full-length Sitka spruce mono-tps cDNA (PsTPS2) was isolated, expressed in Escherichia coli, and functionally identified as (-)-pinene synthase. The recombinant (-)-pinene synthase catalyzes the formation of (-)-alpha-pinene and (-)-beta-pinene, both of which are known constituents of stem oleoresin in Sitka spruce and increase in abundance after weevil attack. These data suggest that increased (-)-pinene synthase gene expression is an important element of the direct defense system deployed in Sitka spruce after insect attack.

  9. Metabolic changes of Brassica rapa transformed with a bacterial isochorismate synthase gene.

    PubMed

    Simoh, Sanimah; Linthorst, Huub J M; Lefeber, Alfons W M; Erkelens, Cornelis; Kim, Hye Kyong; Choi, Young Hae; Verpoorte, Robert

    2010-12-15

    Metabolome analysis by 1-dimensional proton nuclear magnetic resonance (¹H NMR) coupled with multivariate data analysis was carried out in Brassica rapa plants transformed with a gene encoding bacterial isochorismate synthase (ICS). Partial least square-discrimination analysis (PLS-DA) on selected signals suggested that the resonances that were dominant in the transgenic plants corresponded to a glucosinolate (neoglucobrassicin), phenylpropanoids (sinapoyl malate, feruloyl malate, caffeoyl malate), organic acids (succinic acid and fumaric acid) and sugars (α- and β-glucose). In contrast, amino acids alanine threonine, valine, leucine were dominant in the untransformed controls. In addition, HPLC data showed that the transgenic plant accumulated salicylic acid (SA) at significantly higher levels than the control plants, whereas the phylloquinone levels were not affected. The results suggest that the expression of the bacterial isochorismate synthase gene in B. rapa does not affect fluxes into pathways to other groups of secondary metabolites through competition for the same precursor. On the contrary, the biosynthesis of isochorismate-derived products (SA) seems to induce the competitive pathways via phenylalanine (phenylpropanoids) and tryptophan (IAA and indole glucosinolates).

  10. Primary structure of the dihydrofolate reductase-thymidylate synthase gene from Toxoplasma gondii.

    PubMed

    Roos, D S

    1993-03-25

    We have determined the primary genomic and cDNA sequences encoding the bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) enzyme of the protozoan parasite Toxoplasma gondii (dihydrofolate reductase, EC 1.5.1.3; thymidylate synthase EC 2.1.1.45). The DHFR-TS gene of T. gondii (strain RH) spans more than 6 kilobases of genomic DNA. Unlike the DHFR-TS genes of other protists, sequences encoding the Toxoplasma protein are interrupted by numerous intervening sequences. Analysis of processed T. gondii DHFR-TS cDNAs reveals a single open reading frame of 1830 nucleotides, predicting a 610-amino acid protein of molecular mass of 69 kilodaltons. Because its nucleotide composition and codon usage are roughly comparable to those observed in "higher" eukaryotes, the Toxoplasma DHFR-TS sequence is particularly useful for assessing evolutionary relationships between eukaryotic species. The predicted amino acid sequence for the DHFR-TS protein shows conservation of the major structural features identified in other DHFR and TS enzymes, while revealing certain differences which may be exploited for the design of novel antifolates for treatment of toxoplasmosis associated with AIDS.

  11. Cloning and Characterization of a Squalene Synthase Gene from the Chaga Medicinal Mushroom, Inonotus obliquus (Agaricomycetes).

    PubMed

    Zhang, Panpan; Cao, Xiaoying; Li, Changgen; Zheng, Zhujun; Yong, Sun; Jiang, Ji-Hong

    2016-01-01

    Squalene synthase catalyzes the condensation of 2 molecules of farnesyl diphosphate to produce squalene, the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. A squalene synthase gene, designated IoSQS, was isolated from Inonotus obliquus, a medicinal mushroom that produces a plethora of bioactive triterpenes. IoSQS complementary DNA was found to contain an open reading frame of 1476 bp, encoding a protein of 491 amino acids with a calculated molecular mass of 55.85 kDa. The IoSQS genomic DNA sequence consisted of 1813 bp and contained 4 exons and 3 introns. The restriction fragment polymorphisms revealed by Southern blot analysis suggested that IoSQS was a single-copy gene. Promoter analysis indicated that the 5' upstream region of IoSQS possessed various potential elements associated with physiological and environmental factors. The expression pattern of IoSQS in different stages and under methyl jasmonate treatment correlated with the accumulation of total triterpenoids and was consistent with the predicted results of the IoSQS promoter region. The N-terminal 466 residues of the hydrophilic sequence were expressed as a His-tagged protein in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. Squalene was detected in vitro in reaction mixture by high-performance liquid chromatography analysis. These results suggest that the IoSQS enzyme is involved in squalene production in I. obliquus. PMID:27649606

  12. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  13. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi.

    PubMed

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1-A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  14. [Mechanism of genuineness of Glycyrrhiza uralensis based on SNP of β-Amyrin synthase gene].

    PubMed

    Zang, Yi-mei; Li, Yan-peng; Qiao, Jing; Chen, Hong-hao; Liu, Chun-sheng

    2015-07-01

    β-Amyrin synthase (β-AS) genes of Glycyrrhiza uralensis from 6 different regions were analyzed by PCR-SSCP and sequenced, then the correlationship between β-AS SNP and regions of Glycyrrhiza uralensis were determined. According to the 1 coding single nucleotide polymorphism on the first exon of β-AS gene at 94 bp site, Glycyrrhiza uralensis could be divided into 3 genotypes. In these genotypes, the percentage of 94A type in genuine regions was much higher, and it had significant differences with the percentage in non-genuine regions (P < 0.001). The results of the experiment proved that different β-AS genotypes at 94 bp site from different regions may be one of the important reasons to result in the genuineness of Glycyrrhiza uralensis. PMID:26552155

  15. Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela.

    PubMed

    Urdaneta, L; Plowe, C; Goldman, I; Lal, A A

    1999-09-01

    The present study was designed to characterize mutations in dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) genes of Plasmodium falciparum in the Bolivar region of Venezuela, where high levels of clinical resistance to sulfadoxine-pyrimethamine (SP, Fansidar; F. Hoffman-La Roche, Basel, Switzerland) has been documented. We used a nested mutation-specific polymerase chain reaction and restriction digestion methods to measure 1) the prevalence of DHFR mutations at 16, 50, 51, 59, 108, and 164 codon positions, and 2) the prevalence of mutations in the 436, 437, 581, and 613 codon sites in DHPS gene. In the case of the DHFR gene, of the 54 parasite isolates analyzed, we detected the presence of Asn-108 and Ile-51 in 96% of the isolates and Arg-50 mutation in 64% of the isolates. Each of these mutations has been associated with high level of resistance to pyrimethamine. Only 2 samples (4%) showed the wild type Ser-108 mutation and none showed Thr-108 and Val-16 mutations that are specific for resistance to cycloguanil. In the case of DHPS gene, we found a mutation at position 437 (Gly) in 100% of the isolates and Gly-581 in 96% of the isolates. The simultaneous presence of mutations Asn-108 and Ile-51 in the DHFR gene and Gly-437 and Gly-581 in the DHPS gene in 96% of the samples tested suggested that a cumulative effect of mutations could be the major mechanism conferring high SP resistance in this area. PMID:10497990

  16. Glyphosate selected amplification of the 5-enolpyruvylshikimate-3-phosphate synthase gene in cultured carrot cells.

    PubMed

    Shyr, Y Y; Hepburn, A G; Widholm, J M

    1992-04-01

    CAR and C1, two carrot (Daucus carota L.) suspension cultures of different genotypes, were subjected to stepwise selection for tolerance to the herbicide glyphosate [(N-phosphonomethyl)glycine]. The specific activity of the target enzyme, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), as well as the mRNA level and copy number of the structural gene increased with each glyphosate selection step. Therefore, the tolerance to glyphosate is due to stepwise amplification of the EPSPS genes. During the amplification process, DNA rearrangement did not occur within the EPSPS gene of the CAR cell line but did occur during the selection step from 28 to 35 mM glyphosate for the C1 cell line, as determined by Southern hybridization of selected cell DNA following EcoRI restriction endonuclease digestion. Two cell lines derived from a previously selected glyphosate-tolerant cell line (PR), which also had undergone EPSPS gene amplification but have been maintained in glyphosate-free medium for 2 and 5 years, have lost 36 and 100% of the increased EPSPS activity, respectively. Southern blot analysis of these lines confirms that the amplified DNA is relatively stable in the absence of selection. These studies demonstrate that stepwise selection for glyphosate resistance reproducibly produces stepwise amplification of the EPSPS genes. The relative stability of this amplification indicates that the amplified genes are not extrachromosomal.

  17. Transcriptome analysis of potato leaves expressing the trehalose-6-phosphate synthase 1 gene of yeast.

    PubMed

    Kondrák, Mihály; Marincs, Ferenc; Kalapos, Balázs; Juhász, Zsófia; Bánfalvi, Zsófia

    2011-01-01

    Transgenic lines of the potato cultivar White Lady expressing the trehalose-6-phosphate synthase (TPS1) gene of yeast exhibit improved drought tolerance, but grow slower and have a lower carbon fixation rate and stomatal density than the wild-type. To understand the molecular basis of this phenomenon, we have compared the transcriptomes of wild-type and TPS1-transgenic plants using the POCI microarray containing 42,034 potato unigene probes. We show that 74 and 25 genes were up-, and down-regulated, respectively, in the mature source leaves of TPS1-transgenic plants when compared with the wild-type. The differentially regulated genes were assigned into 16 functional groups. All of the seven genes, which were assigned into carbon fixation and metabolism group, were up-regulated, while about 42% of the assigned genes are involved in transcriptional and post-transcriptional regulation. Expression of genes encoding a 14-3-3 regulatory protein, and four transcription factors were down-regulated in the TPS1-transgenic leaves. To verify the microarray results, we used RNA gel blot analysis to examine the expression of eight genes and found that the RNA gel blot and microarray data correlated in each case. Using the putative Arabidopsis orthologs of the assigned potato sequences we have identified putative transcription binding sites in the promoter region of the differentially regulated genes, and putative protein-protein interactions involving some of the up- and down-regulated genes. We have also demonstrated that starch content is lower, while malate, inositol and maltose contents are higher in the TPS1-transgenic than in the wild-type leaves. Our results suggest that a complex regulatory network, involving transcription factors and other regulatory proteins, underpins the phenotypic alterations we have observed previously in potato when expressing the TPS1 gene of yeast.

  18. Structural characterization of 15-hydroxytrichodiene, a sesquiterpenoid produced by transformed tobacco cell suspension cultures expressing a trichodiene synthase gene from Fusarium sporotrichioides.

    PubMed

    Zook, M; Johnson, K; Hohn, T; Hammerschmidt, R

    1996-12-01

    Tobacco (Nicotiana tabaccum) cell suspension cultures transformed with a gene encoding trichodiene synthase, a sesquiterpene synthase from the fungus Fusarium sporotrichioides, produced a novel sesquiterpenoid derived from the in vivo production of trichodiene. Mass and nuclear magnetic resonance spectroscopic analyses identified the new compound as 15-hydroxytrichodiene. The in vivo hydroxylation of trichodiene by transformant tobacco cell suspension cultures demonstrates that the introduction of a foreign sesquiterpene synthase gene can result in the production of novel sesquiterpenoid metabolites. PMID:8987907

  19. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes. PMID:24548412

  20. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  1. Protection of rabbit lungs from endotoxin injury by in vivo hyperexpression of the prostaglandin G/H synthase gene.

    PubMed Central

    Conary, J T; Parker, R E; Christman, B W; Faulks, R D; King, G A; Meyrick, B O; Brigham, K L

    1994-01-01

    A recombinant prostaglandin G/H (PGH) synthase gene has been expressed in vitro in bovine pulmonary artery endothelial cells and in vivo in rabbits by transfection with a plasmid using cationic liposomes. Transfection of bovine pulmonary artery endothelial cells with the PGH synthase cDNA resulted in increased intracellular PGH synthase protein (determined by Western blot analysis) and increased release of prostacyclin. Rabbits intravenously transfected with the PGH synthase gene had increased plasma levels of prostacyclin and PGE2, and their lungs produced increased amounts of the same eicosanoids. In an in situ, perfused preparation of PGH synthase transfected rabbit lungs, the pressor response to endotoxin was markedly attenuated. In addition, pulmonary edema and release of thromboxane B2 into the perfusate after endotoxin infusion were markedly decreased in transfected lungs compared to controls (animals transfected with a pCMV4 construct that did not contain a cDNA insert). The data suggest that augmented endogenous production of prostacyclin and PGE2, achieved by liposome-mediated gene transfer, protects the lungs from endotoxin. This may be caused in part by suppression of endotoxin-stimulated thromboxane B2 production. Modification of lipid mediator responses by in vivo transfection is a potential approach to the therapy of acute lung injury. Images PMID:8163682

  2. Association of thymidylate synthase gene with endometrial cancer risk in a Chinese population

    PubMed Central

    Xu, Wang-Hong; Long, Ji-Rong; Zheng, Wei; Ruan, Zhi-Xian; Cai, Qiuyin; Cheng, Jia-Rong; Zhao, Gen-Ming; Xiang, Yong-Bing; Shu, Xiao-Ou

    2009-01-01

    We comprehensively evaluated genetic variants in the thymidylate synthase (TYMS) gene in association with endometrial cancer risk in a population-based case-control study of 1,199 incident endometrial cancer cases and 1,212 age frequency-matched population controls. Exposure information was obtained via in-person interview and DNA samples (blood or buccal cell) were collected. Genotyping of 11 haplotype-tagging SNPs (htSNPs) for the TYMS gene plus the 5kb flanking regions was performed for 1,028 cases and 1,003 controls by using the Affymetrix MegAllele Targeted Genotyping System. Of eleven htSNPs identified, seven that are located in flanking regions of the TYMS gene are also in the ENOSF1 (rTS) gene. The SNP rs3819102, located in the 3′ flanking region of the TYMS gene and in an intron of the ENOSF1 gene, was associated with risk of endometrial cancer. The odds ratio (OR) for the CC genotype was 1.5 (95% confidence interval (CI) =1.0–2.2) compared to the TT genotype. Haplotype TTG in block 2 of the TYMS gene, which includes SNPs rs10502289, rs2298583, and rs2298581 (located in introns of the ENOSF1 gene), was associated with a marginally significant decrease in risk of endometrial cancer under the dominant model (OR=0.8, 95%CI=0.6–1.0). This study suggests that genetic polymorphisms in the TYMS or ENOSF1 genes may play a role in the development of endometrial cancer among Chinese women. PMID:19190136

  3. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    PubMed Central

    2012-01-01

    Background In plants, sucrose synthase (Sus) is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7) identified from diploid fiber cotton (Gossypium arboreum). Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development. PMID:22694895

  4. Plastid-expressed 5-enolpyruvylshikimate-3-phosphate synthase genes provide high level glyphosate tolerance in tobacco.

    PubMed

    Ye, G N; Hajdukiewicz, P T; Broyles, D; Rodriguez, D; Xu, C W; Nehra, N; Staub, J M

    2001-02-01

    Plastid transformation (transplastomic) technology has several potential advantages for biotechnological applications including the use of unmodified prokaryotic genes for engineering, potential high-level gene expression and gene containment due to maternal inheritance in most crop plants. However, the efficacy of a plastid-encoded trait may change depending on plastid number and tissue type. We report a feasibility study in tobacco plastids to achieve high-level herbicide resistance in both vegetative tissues and reproductive organs. We chose to test glyphosate resistance via over-expression in plastids of tolerant forms of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Immunological, enzymatic and whole-plant assays were used to prove the efficacy of three different prokaryotic (Achromobacter, Agrobacterium and Bacillus) EPSPS genes. Using the Agrobacterium strain CP4 EPSPS as a model we identified translational control sequences that direct a 10,000-fold range of protein accumulation (to >10% total soluble protein in leaves). Plastid-expressed EPSPS could provide very high levels of glyphosate resistance, although levels of resistance in vegetative and reproductive tissues differed depending on EPSPS accumulation levels, and correlated to the plastid abundance in these tissues. Paradoxically, higher levels of plastid-expressed EPSPS protein accumulation were apparently required for efficacy than from a similar nuclear-encoded gene. Nevertheless, the demonstration of high-level glyphosate tolerance in vegetative and reproductive organs using transplastomic technology provides a necessary step for transfer of this technology to other crop species.

  5. Intron-exon organization of the gene for the multifunctional animal fatty acid synthase.

    PubMed Central

    Amy, C M; Williams-Ahlf, B; Naggert, J; Smith, S

    1992-01-01

    The complete intron-exon organization of the gene encoding a multifunctional mammalian fatty acid synthase has been elucidated, and specific exons have been assigned to coding sequences for the component domains of the protein. The rat gene is interrupted by 42 introns and the sequences bordering the splice-site junctions universally follow the GT/AG rule. However, of the 41 introns that interrupt the coding region of the gene, 23 split the reading frame in phase I, 14 split the reading frame in phase 0, and only 4 split the reading frame in phase II. Remarkably, 46% of the introns interrupt codons for glycine. With only one exception, boundaries between the constituent enzymes of the multifunctional polypeptide coincide with the location of introns in the gene. The significance of the predominance of phase I introns, the almost uniformly short length of the 42 introns and the overall small size of the gene, is discussed in relation to the evolution of multifunctional proteins. Images PMID:1736293

  6. Acetohydroxyacid synthase activity and transcripts profiling reveal tissue-specific regulation of ahas genes in sunflower.

    PubMed

    Ochogavía, Ana C; Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana A; Nestares, Graciela

    2014-07-01

    Acetohydroxyacid synthase (AHAS) is the target site of several herbicides and catalyses the first step in the biosynthesis of branched chain amino acid. Three genes coding for AHAS catalytic subunit (ahas1, ahas2 and ahas3) have been reported for sunflower. The aim of this work was to study the expression pattern of ahas genes family and AHAS activity in sunflower (Helianthus annuus L.). Different organs (leaves, hypocotyls, roots, flowers and embryos) were evaluated at several developmental stages. The transcriptional profile was studied through RT-qPCR. The highest expression for ahas1 was shown in leaves, where all the induced and natural gene mutations conferring herbicide resistance were found. The maximal expression of ahas2 and ahas3 occurred in immature flowers and embryos. The highest AHAS activity was found in leaves and immature embryos. Correlation analysis among ahas gene expression and AHAS activity was discussed. Our results show that differences in ahas genes expression are tissue-specific and temporally regulated. Moreover, the conservation of multiple AHAS isoforms in sunflower seems to result from different expression requirements controlled by tissue-specific regulatory mechanisms at different developmental stages. PMID:24908515

  7. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

  8. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    PubMed Central

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  9. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice.

    PubMed

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  10. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    PubMed

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme.

  11. Molecular cloning, characterization, and overexpression of ERG7, the Saccharomyces cerevisiae gene encoding lanosterol synthase.

    PubMed Central

    Corey, E J; Matsuda, S P; Bartel, B

    1994-01-01

    We report the cloning, characterization, and overexpression of Saccharomyces cerevisiae ERG7, which encodes lanosterol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, lanosterol forming), EC 5.4.99.7], the enzyme responsible for the complex cyclization/rearrangement step in sterol biosynthesis. Oligonucleotide primers were designed corresponding to protein sequences conserved between Candida albicans ERG7 and the related Arabidopsis thaliana cycloartenol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, cycloartenol forming), EC 5.4.99.8]. A PCR product was amplified from yeast genomic DNA using these primers and was used to probe yeast libraries by hybridization. Partial-length clones homologous to the two known epoxysqualene mutases were isolated, but a full-length sequence was found neither in cDNA nor genomic libraries, whether in phage or plasmids. Two overlapping clones were assembled to make a functional reconstruction of the gene, which contains a 2196-bp open reading frame capable of encoding an 83-kDa protein. The reconstruction complemented the erg7 mutation when driven from either its native promoter or the strong ADH1 promoter. Images PMID:8134375

  12. Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Owens, Daniel K.; Alerding, Anne B.; Crosby, Kevin C.; Bandara, Aloka B.; Westwood, James H.; Winkel, Brenda S.J.

    2008-01-01

    The genome of Arabidopsis (Arabidopsis thaliana) contains five sequences with high similarity to FLAVONOL SYNTHASE1 (AtFLS1), a previously characterized flavonol synthase gene that plays a central role in flavonoid metabolism. This apparent redundancy suggests the possibility that Arabidopsis uses multiple isoforms of FLS with different substrate specificities to mediate the production of the flavonols, quercetin and kaempferol, in a tissue-specific and inducible manner. However, biochemical and genetic analysis of the six AtFLS sequences indicates that, although several of the members are expressed, only AtFLS1 encodes a catalytically competent protein. AtFLS1 also appears to be the only member of this group that influences flavonoid levels and the root gravitropic response in seedlings under nonstressed conditions. This study showed that the other expressed AtFLS sequences have tissue- and cell type-specific promoter activities that overlap with those of AtFLS1 and encode proteins that interact with other flavonoid enzymes in yeast two-hybrid assays. Thus, it is possible that these “pseudogenes” have alternative, noncatalytic functions that have not yet been uncovered. PMID:18467451

  13. Molecular cloning of the human leukotriene C4 synthase gene and assignment to chromosome 5q35.

    PubMed Central

    Bigby, T. D.; Hodulik, C. R.; Arden, K. C.; Fu, L.

    1996-01-01

    BACKGROUND: Cysteinyl leukotrienes (LT) are mediators involved in inflammatory and allergic disorders LTC4 synthase catalyzes the first committed step in the synthesis of these inflammatory mediators, and its cellular distribution appears to be unique. MATERIALS AND METHODS: A human genomic library was screened by polymerase chain reaction (PCR) with primers that were designed based on the reported cDNA sequence for the LTC4 synthase gene. The gene was identified in one clone by Southern blotting of restriction enzyme digests, subcloning of fragments containing regions of interest, and DNA sequencing of these subclones. The transcription initiation site was determined by primer extension analysis. Chromosome location was determined by fluorescent in situ hybridization and screening of somatic cell hybrids by PCR. RESULTS: The LTC4 synthase gene is approximately 2.5 kb in length, consisting of five exons (136, 100, 71, 82, and 257 bp, respectively) and four introns (1,447, 102, 84, and 230 bp, respectively). Transcription initiation occurs at a single site 78 bp upstream of the coding region. The 5'-flanking region contains neither a TATA nor a CAAT box. The first 1 kb of the 5'-flanking region, however, contains putative DNA binding motifs for SP-1, AP-1, AP-2, ets factors, and CREB/ATF. A STAT binding motif is present in the first intron. The LTC4 synthase gene is located in the distal region of the long arm of chromosome 5 in 5q35. CONCLUSIONS: The LTC4 synthase gene does not contain elements of a typical regulated gene and may therefore contain novel regulatory elements. This gene is also located in a region on chromosome 5 that appears to play a role in allergic and inflammatory disorders, such as asthma. Images FIG. 1 FIG. 5 FIG. 4 FIG. 6 PMID:8898379

  14. Disruption of Spodoptera exigua larval development by silencing chitin synthase gene A with RNA interference.

    PubMed

    Chen, X; Tian, H; Zou, L; Tang, B; Hu, J; Zhang, W

    2008-12-01

    RNA interference (RNAi) is a powerful tool for rapidly analyzing gene functions. However, little is known about the possible use of dsRNA/siRNA as a pest control method. Here, we demonstrate that dsRNA/siRNA can induce the silence of chitin synthase gene A (CHSA), which is an important gene for the growth and development of cuticles and trachea in beet armyworm, Spodoptera exigua. Based on the in vitro RNAi experiments in an insect cell line (Trichoplusia ni High 5), in vivo RNAi was performed by injecting synthesized dsRNA/siRNA into the 4th instar larvae of S. exigua. Significantly lower levels of CHSA transcripts were detected. In addition, the cuticle of these insects was disordered and the epithelial walls of larval trachea did not expand uniformly in injected individuals. Moreover, Injections significantly increased abnormalities relative to control larvae. These results highlighted the possibility of dsRNA/siRNA for gene function studies in lepidopteran insects and future pest control. PMID:18662430

  15. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    PubMed

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

  16. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    PubMed

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. PMID:26991299

  17. Molecular analysis of the poly(3-hydroxyalkanoate) synthase gene from a methylotrophic bacterium, Paracoccus denitrificans.

    PubMed Central

    Ueda, S; Yabutani, T; Maehara, A; Yamane, T

    1996-01-01

    A 3.6-kb EcoRI-SalI fragment of Paracoccus denitrificans DNA hybridized with a DNA probe carrying the poly(3-hydroxyalkanoate) (PHA) synthase gene (phaC) of Alcaligenes eutrophus. Nucleotide sequence analysis of this region showed the presence of a 1,872-bp open reading frame (ORF), which corresponded to a polypeptide with a molecular weight of 69,537. Upstream of the ORF, a promoter-like sequence was found. Escherichia coli carrying the fusion gene between lacZ and the ORF accumulated a level of poly(3-hydroxybutyrate) that was as much as 20 wt% of the cell dry weight in the presence of beta-ketothiolase and acetoacetylcoenzyme A reductase genes of A. eutrophus. The ORF was designated phaCPd. A plasmid vector carrying the phaCPd'-'lacZ fusion gene downstream of the promoter-like sequence expressed beta-galactosidase activity in P. denitrificans. When a multicopy and broad-host-range vector carrying the ORF along with the promoter-like sequence was introduced into P. denitrificans, the PHA content in the cells increased by twofold compared with cells carrying only a vector sequence. PMID:8550512

  18. Molecular analysis of the poly(3-hydroxyalkanoate) synthase gene from a methylotrophic bacterium, Paracoccus denitrificans.

    PubMed

    Ueda, S; Yabutani, T; Maehara, A; Yamane, T

    1996-02-01

    A 3.6-kb EcoRI-SalI fragment of Paracoccus denitrificans DNA hybridized with a DNA probe carrying the poly(3-hydroxyalkanoate) (PHA) synthase gene (phaC) of Alcaligenes eutrophus. Nucleotide sequence analysis of this region showed the presence of a 1,872-bp open reading frame (ORF), which corresponded to a polypeptide with a molecular weight of 69,537. Upstream of the ORF, a promoter-like sequence was found. Escherichia coli carrying the fusion gene between lacZ and the ORF accumulated a level of poly(3-hydroxybutyrate) that was as much as 20 wt% of the cell dry weight in the presence of beta-ketothiolase and acetoacetylcoenzyme A reductase genes of A. eutrophus. The ORF was designated phaCPd. A plasmid vector carrying the phaCPd'-'lacZ fusion gene downstream of the promoter-like sequence expressed beta-galactosidase activity in P. denitrificans. When a multicopy and broad-host-range vector carrying the ORF along with the promoter-like sequence was introduced into P. denitrificans, the PHA content in the cells increased by twofold compared with cells carrying only a vector sequence.

  19. Cloning and manipulation of the Escherichia coli cyclopropane fatty acid synthase gene: physiological aspects of enzyme overproduction.

    PubMed Central

    Grogan, D W; Cronan, J E

    1984-01-01

    Like many other eubacteria, cultures of Escherichia coli accumulate cyclopropane fatty acids (CFAs) at a well-defined stage of growth, due to the action of the cytoplasmic enzyme CFA synthase. We report the isolation of the putative structural gene, cfa, for this enzyme on an E. coli-ColE1 chimeric plasmid by the use of an autoradiographic colony screening technique. When introduced into a variety of E. coli strains, this plasmid, pLC18-11, induced corresponding increases in CFA content and CFA synthase activity. Subsequent manipulation of the cfa locus, facilitated by the insertion of pLC18-11 into a bacteriophage lambda vector, allowed genetic and physiological studies of CFA synthase in E. coli. Overproduction of this enzyme via multicopy cfa plasmids caused abnormally high levels of CFA in membrane phospholipid but no discernable growth perturbation. Infection with phage lambda derivatives bearing cfa caused transient overproduction of the enzyme, although pL-mediated expression of cfa could not be demonstrated in plasmids derived from such phages. CFA synthase specific activities could be raised to very high levels by using cfa runaway-replication plasmids. A variety of physiological factors were found to modulate the levels of CFA synthase in normal and gene-amplified cultures. These studies argue against several possible mechanisms for the temporal regulation of CFA formation. PMID:6325391

  20. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    SciTech Connect

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. )

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  1. Isolation of the Inositol Phosphoceramide Synthase Gene (AUR1) from Stress-Tolerant Yeast Pichia kudriavzevii.

    PubMed

    Yoo, Boung-Hyuk; Kim, Myoung-Dong

    2015-11-01

    This study is the first report of the entire nucleotide sequence of an inositol phosphoceramide synthase gene from the stress-tolerant yeast Pichia kudriavzevii (PkAUR1). Sequence analysis revealed an open reading frame that spans 1,443 bp and encodes a 480-amino-acid-residue protein with the highest sequence similarity (41.7%) to Aur1 from Spathaspora passalidarum. A phenotypic assay with transformed S. cerevisiae and P. kudriavzevii indicated that two amino acid residues, Phe166 and Gly249, play crucial roles in the resistance to aureobasidin A, which is consistent with previous reports for other fungal Aur1s. The GenBank Accession No. for PkAUR1 is KP729614. PMID:26323269

  2. Suppressors of trp1 fluorescence identify a new arabidopsis gene, TRP4, encoding the anthranilate synthase beta subunit.

    PubMed Central

    Niyogi, K K; Last, R L; Fink, G R; Keith, B

    1993-01-01

    Suppressors of the blue fluorescence phenotype of the Arabidopsis trp1-100 mutant can be used to identify mutations in genes involved in plant tryptophan biosynthesis. Two recessive suppressor mutations define a new gene, TRP4. The trp4 mutant and the trp1-100 mutant are morphologically normal and grow without tryptophan, whereas the trp4; trp1-100 double mutant requires tryptophan for growth. The trp4; trp1-100 double mutant does not segregate at expected frequencies in genetic crosses because of a female-specific defect in transmission of the double mutant genotype, suggesting a role for the tryptophan pathway in female gametophyte development. Genetic and biochemical evidence shows that trp4 mutants are defective in a gene encoding the beta subunit of anthranilate synthase (AS). Arabidopsis AS beta subunit genes were isolated by complementation of an Escherichia coli anthranilate synthase mutation. The trp4 mutation cosegregates with one of the genes, ASB1, located on chromosome 1. Sequence analysis of the ASB1 gene from trp4-1 and trp4-2 plants revealed different single base pair substitutions relative to the wild type. Anthranilate synthase alpha and beta subunit genes are regulated coordinately in response to bacterial pathogen infiltration. PMID:8400875

  3. Functional specialization of cellulose synthase genes of prokaryotic origin in chordate larvaceans.

    PubMed

    Sagane, Yoshimasa; Zech, Karin; Bouquet, Jean-Marie; Schmid, Martina; Bal, Ugur; Thompson, Eric M

    2010-05-01

    Extracellular matrices play important, but poorly investigated, roles in morphogenesis. Extracellular cellulose is central to regulation of pattern formation in plants, but among metazoans only tunicates are capable of cellulose biosynthesis. Cellulose synthase (CesA) gene products are present in filter-feeding structures of all tunicates and also regulate metamorphosis in the ascidian Ciona. Ciona CesA is proposed to have been acquired by lateral gene transfer from a prokaryote. We identified two CesA genes in the sister-class larvacean Oikopleura dioica. Each has a mosaic structure of a glycoslyltransferase 2 domain upstream of a glycosyl hydrolase family 6 cellulase-like domain, a signature thus far unique to tunicates. Spatial-temporal expression analysis revealed that Od-CesA1 produces long cellulose fibrils along the larval tail, whereas Od-CesA2 is responsible for the cellulose scaffold of the post-metamorphic filter-feeding house. Knockdown of Od-CesA1 inhibited cellulose production in the extracellular matrix of the larval tail. Notochord cells either failed to align or were misaligned, the tail did not elongate properly and tailbud embryos also exhibited a failure to hatch. Knockdown of Od-CesA2 did not elicit any of these phenotypes and instead caused a mild delay in pre-house formation. Phylogenetic analyses including Od-CesAs indicate that a single lateral gene transfer event from a prokaryote at the base of the lineage conferred biosynthetic capacity in all tunicates. Ascidians possess one CesA gene, whereas duplicated larvacean genes have evolved distinct temporal and functional specializations. Extracellular cellulose microfibrils produced by the pre-metamorphic Od-CesA1 duplicate have a role in notochord and tail morphogenesis.

  4. Nitric oxide synthase polymorphisms, gene expression and lung function in chronic obstructive pulmonary disease

    PubMed Central

    2013-01-01

    Background Due to the pleiotropic effects of nitric oxide (NO) within the lungs, it is likely that NO is a significant factor in the pathogenesis of chronic obstructive pulmonary disease (COPD). The aim of this study was to test for association between single nucleotide polymorphisms (SNPs) in three NO synthase (NOS) genes and lung function, as well as to examine gene expression and protein levels in relation to the genetic variation. Methods One SNP in each NOS gene (neuronal NOS (NOS1), inducible NOS (NOS2), and endothelial NOS (NOS3)) was genotyped in the Lung Health Study (LHS) and correlated with lung function. One SNP (rs1800779) was also analyzed for association with COPD and lung function in four COPD case–control populations. Lung tissue expression of NOS3 mRNA and protein was tested in individuals of known genotype for rs1800779. Immunohistochemistry of lung tissue was used to localize NOS3 expression. Results For the NOS3 rs1800779 SNP, the baseline forced expiratory volume in one second in the LHS was significantly higher in the combined AG + GG genotypic groups compared with the AA genotypic group. Gene expression and protein levels in lung tissue were significantly lower in subjects with the AG + GG genotypes than in AA subjects. NOS3 protein was expressed in the airway epithelium and subjects with the AA genotype demonstrated higher NOS3 expression compared with AG and GG individuals. However, we were not able to replicate the associations with COPD or lung function in the other COPD study groups. Conclusions Variants in the NOS genes were not associated with lung function or COPD status. However, the G allele of rs1800779 resulted in a decrease of NOS3 gene expression and protein levels and this has implications for the numerous disease states that have been associated with this polymorphism. PMID:24192154

  5. Endothelin-1 gene and endothelial nitric oxide synthase gene polymorphisms in adolescents with juvenile and obesity-associated hypertension.

    PubMed

    Baráth, A; Endreffy, E; Bereczki, Cs; Gellén, B; Szücs, B; Németh, I; Túri, S

    2007-03-01

    Hypertension is an increasing public health problem all over the world. Essential hypertension accounts for more than 90% of cases of hypertension. It is a complex genetic, environmental and demographic trait. New method in molecular biology has been proposed a number of candidate genes, but the linkage or association with hypertension has been problematic (lack of gene-gene and gene-environment interaction). It is well known that genetic influences are more important in younger hypertensives, because children are relatively free from the common environmental factors contributing to essential hypertension. The association studies compare genotype ferquencies of the candidate gene between patient groups and the controls, in pathways known to be involved in blood pressure regulation. This study examined three polymorphisms of these factors encoding genes (ET-1 G+5665T (Lys198Asn), endothelial nitric oxide synthase (eNOS) T-786C promoter polymorphism and 27-bp repeat polymorphism in intron 4) in adolescents with juvenile essential and obesity-associated hypertension. Significant differences were found in the G/T genotype of the ET-1 polymorphism in the hypertensive and obese+hypertensive patients (body mass index (BMI) > 30). A strong association was detected between the BMI and the polymorphism of the ET-1 gene. It seems that ET-1 gene polymorphism plays a role in the development of juvenile hypertension associated with obesity. Although no significant differences were seen in the case of the eNOS promoter polymorphism and the eNOS 4th intron 27-bp repeat polymorphism. It seems that eNOS may play a role, but this is not the main factor in the control of blood pressure; it is rather a fine regulator in this process. This study with adolescents facilitates an understanding of the genetic factors promoting juvenile hypertension and obesity. PMID:17444275

  6. Expression of terpene synthase genes associated with the formation of volatiles in different organs of Vitis vinifera.

    PubMed

    Matarese, Fabiola; Cuzzola, Angela; Scalabrelli, Giancarlo; D'Onofrio, Claudio

    2014-09-01

    Plants produce a plethora of volatile organic compounds (VOCs) which are important in determining the quality and nutraceutical properties of horticultural food products, including the taste and aroma of wine. Given that some of the most prevalent grape aroma constituents are terpenoids, we investigated the possible variations in the relative expression of terpene synthase (TPS) genes that depend on the organ. We thus analysed mature leaves, young leaves, stems, young stems, roots, rachis, tendrils, peduncles, bud flowers, flowers and berries of cv Moscato bianco in terms of their VOC content and the expression of 23 TPS genes. In terms of the volatile characterization of the organs by SPME/GC-MS analysis, flower buds and open flowers appeared to be clearly distinct from all the other organs analysed in terms of their high VOC concentration. Qualitatively detected VOCs clearly separated all the vegetative organs from flowers and berries, then the roots and rachis from other vegetative organs and flowers from berries, which confirms the specialization in volatile production among different organs. Our real-time RT-PCR results revealed that the majority of TPS genes analysed exhibited detectable transcripts in all the organs investigated, while only some were found to be expressed specifically in one or just a few organs. In most cases, we found that the known products of the in vitro assay of VvTPS enzymes corresponded well to the terpenes found in the organs in which the encoding gene was expressed, as in the case of (E)-β-caryophyllene synthases, α-terpineol synthase and α-farnesene synthase. In addition, we found groups of homologous TPS genes, such as (E)-β-caryophyllene and β-ocimene synthases, expressed distinctively in the various tissues. This thus confirmed the subfunctionalization events and a specialization on the basis of the organs in which they are mostly expressed.

  7. Expression of terpene synthase genes associated with the formation of volatiles in different organs of Vitis vinifera.

    PubMed

    Matarese, Fabiola; Cuzzola, Angela; Scalabrelli, Giancarlo; D'Onofrio, Claudio

    2014-09-01

    Plants produce a plethora of volatile organic compounds (VOCs) which are important in determining the quality and nutraceutical properties of horticultural food products, including the taste and aroma of wine. Given that some of the most prevalent grape aroma constituents are terpenoids, we investigated the possible variations in the relative expression of terpene synthase (TPS) genes that depend on the organ. We thus analysed mature leaves, young leaves, stems, young stems, roots, rachis, tendrils, peduncles, bud flowers, flowers and berries of cv Moscato bianco in terms of their VOC content and the expression of 23 TPS genes. In terms of the volatile characterization of the organs by SPME/GC-MS analysis, flower buds and open flowers appeared to be clearly distinct from all the other organs analysed in terms of their high VOC concentration. Qualitatively detected VOCs clearly separated all the vegetative organs from flowers and berries, then the roots and rachis from other vegetative organs and flowers from berries, which confirms the specialization in volatile production among different organs. Our real-time RT-PCR results revealed that the majority of TPS genes analysed exhibited detectable transcripts in all the organs investigated, while only some were found to be expressed specifically in one or just a few organs. In most cases, we found that the known products of the in vitro assay of VvTPS enzymes corresponded well to the terpenes found in the organs in which the encoding gene was expressed, as in the case of (E)-β-caryophyllene synthases, α-terpineol synthase and α-farnesene synthase. In addition, we found groups of homologous TPS genes, such as (E)-β-caryophyllene and β-ocimene synthases, expressed distinctively in the various tissues. This thus confirmed the subfunctionalization events and a specialization on the basis of the organs in which they are mostly expressed. PMID:25014656

  8. Primary structure of the gene encoding the bifunctional dihydrofolate reductase-thymidylate synthase of Leishmania major.

    PubMed Central

    Beverley, S M; Ellenberger, T E; Cordingley, J S

    1986-01-01

    We have determined the nucleotide sequence of the dihydrofolate reductase-thymidylate synthetase (DHFR-TS) gene of the protozoan parasite Leishmania major (dihydrofolate reductase, EC 1.5.1.3 and thymidylate synthase, EC 2.1.1.45). The DHFR-TS protein is encoded by a single 1560-base-pair open reading frame within genomic DNA, in contrast to vertebrate DHFRs or mouse and phage T4 TSs, which contain intervening sequences. Comparisons of the DHFR-TS sequence with DHFR and TS sequences of other organisms indicate that the order of enzymatic activities within the bifunctional polypeptide chain is DHFR followed by TS, the Leishmania bifunctional DHFR-TS evolved independently and not through a phage T4-related intermediate, and the rate of evolution of both the DHFR and TS domains has not detectably changed despite the acquisition of new functional properties by the bifunctional enzyme. The Leishmania gene is 86% G+C in the third codon position, in contrast to genes of the parasite Plasmodium falciparum, which exhibit an opposite bias toward A+T. The DHFR-TS locus is encoded within a region of DNA amplified in methotrexate-resistant lines, as previously proposed. PMID:3458220

  9. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    SciTech Connect

    Okamoto, Mitsuhiro . E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp; Nonaka, Yasuki; Takemori, Hiroshi; Doi, Junko

    2005-12-09

    11{beta}-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11{beta}-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression.

  10. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    PubMed Central

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen

    2016-01-01

    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  11. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    PubMed

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  12. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  13. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    SciTech Connect

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  14. Human molybdopterin synthase gene: genomic structure and mutations in molybdenum cofactor deficiency type B.

    PubMed Central

    Reiss, J; Dorche, C; Stallmeyer, B; Mendel, R R; Cohen, N; Zabot, M T

    1999-01-01

    Biosynthesis of the molybdenum cofactor (MoCo) can be divided into (1) the formation of a precursor and (2) the latter's subsequent conversion, by molybdopterin synthase, into the organic moiety of MoCo. These two steps are reflected by the complementation groups A and B and the two formally distinguished types of MoCo deficiency that have an identical phenotype. Both types of MoCo deficiency result in a pleiotropic loss of all molybdoenzyme activities and cause severe neurological damage. MOCS1 is defective in patients with group A deficiency and has been shown to encode two enzymes for early synthesis via a bicistronic transcript with two consecutive open reading frames (ORFs). MOCS2 encodes the small and large subunits of molybdopterin synthase via a single transcript with two overlapping reading frames. This gene was mapped to 5q and comprises seven exons. The coding sequence and all splice site-junction sequences were screened for mutations, in MoCo-deficient patients in whom a previous search for MOCS1 mutations had been negative. In seven of the eight patients whom we investigated, we identified MOCS2 mutations that, by their nature, are most likely responsible for the deficiency. Three different frameshift mutations were observed, with one of them found on 7 of 14 identified alleles. Furthermore, a start-codon mutation and a missense mutation of a highly conserved amino acid residue were found. The locations of the mutations confirm the functional role of both ORFs. One of the patients with identified MOCS2 mutations had been classified as type B, in complementation studies. These findings support the hypothetical mechanism, for both forms of MoCo deficiency, that formerly had been established by cell-culture experiments. PMID:10053004

  15. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea.

  16. Nonribosomal Peptide Synthase Gene Clusters for Lipopeptide Biosynthesis in Bacillus subtilis 916 and Their Phenotypic Functions

    PubMed Central

    Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu

    2014-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  17. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-12-22

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots.

  18. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    PubMed

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  19. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  20. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  1. Cellulose production and cellulose synthase gene detection in acetic acid bacteria.

    PubMed

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2015-02-01

    The ability of acetic acid bacteria (AAB) to produce cellulose has gained much industrial interest due to the physical and chemical characteristics of bacterial cellulose. The production of cellulose occurs in the presence of oxygen and in a glucose-containing medium, but it can also occur during vinegar elaboration by the traditional method. The vinegar biofilm produced by AAB on the air-liquid interface is primarily composed of cellulose and maintains the cells in close contact with oxygen. In this study, we screened for the ability of AAB to produce cellulose using different carbon sources in the presence or absence of ethanol. The presence of cellulose in biofilms was confirmed using the fluorochrome Calcofluor by microscopy. Moreover, the process of biofilm formation was monitored under epifluorescence microscopy using the Live/Dead BacLight Kit. A total of 77 AAB strains belonging to 35 species of Acetobacter, Komagataeibacter, Gluconacetobacter, and Gluconobacter were analysed, and 30 strains were able to produce a cellulose biofilm in at least one condition. This cellulose production was correlated with the PCR amplification of the bcsA gene that encodes cellulose synthase. A total of eight degenerated primers were designed, resulting in one primer pair that was able to detect the presence of this gene in 27 AAB strains, 26 of which formed cellulose.

  2. Ventilation and oxygenation induce endothelial nitric oxide synthase gene expression in the lungs of fetal lambs.

    PubMed Central

    Black, S M; Johengen, M J; Ma, Z D; Bristow, J; Soifer, S J

    1997-01-01

    At birth, ventilation and oxygenation immediately decrease pulmonary vascular resistance (PVR) and increase pulmonary blood flow (PBF); more gradual changes occur over the next several hours. Nitric oxide, produced by endothelial nitric oxide synthase (eNOS), mediates these gradual changes. To determine how ventilation and oxygenation affect eNOS gene expression, 12 fetal lambs were ventilated for 8 h without changing fetal descending aortic blood gases or pH (rhythmic distension) or with 100% oxygen (O2 ventilation). Vascular pressures and PBF were measured. Total RNA, protein, and tissue sections were prepared from lung tissue for RNase protection assays, Western blotting, and in situ hybridization. O2 ventilation increased PBF and decreased PVR more than rhythmic distension (P < 0.05). Rhythmic distension increased eNOS mRNA expression; O2 ventilation increased eNOS mRNA expression more and increased eNOS protein expression (P < 0.05). To define the mechanisms responsible for these changes, ovine fetal pulmonary arterial endothelial cells were exposed to 1, 21, or 95% O2 or to shear stress. 95% O2 increased eNOS mRNA and protein expression (P < 0.05). Shear stress increased eNOS mRNA and protein expression (P < 0.05). Increased oxygenation but more importantly increased PBF with increased shear stress induce eNOS gene expression and contribute to pulmonary vasodilation after birth. PMID:9294110

  3. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    PubMed

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  4. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  5. Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

    SciTech Connect

    Ge Shimei; Xie Baoen; Chen Sanfeng . E-mail: chensf@cau.edu.cn

    2006-03-10

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not exist in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.

  6. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed Central

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-01-01

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS. Images Fig. 2 PMID:7692452

  7. Endothelial nitric oxide synthase (eNOS) gene polymorphism in early term chronic allograft nephropathy.

    PubMed

    Yilmaz, E; Mir, S; Berdeli, A

    2009-12-01

    Chronic allograft nephropathy (CAN) is a complex phenomenon caused by underlying kidney disease with superimposed enviromental and genetic factors. CAN development begins with progressive renal microvascular injury. Endothelial cells play key roles in the regulation of vascular tone, permeability, and remodeling. A reduction in basal nitric oxide (NO) release as a result of genetic variation in endothelial NO synthase (eNOS) function may predispose to hypertension, thrombosis, vasospasm, and atherosclerosis, all contributing to the development of CAN. We analyzed the G894T mutation at exon 7 of the eNOS gene in relationship to CAN among 81 children with renal transplantations. The 20 patients who developed CAN underwent renal biopsies for histological confirmation. Proteinuria and hypertension were observed in CAN. We selected 173 healthy reference subjects. The G894T polymorphism of the eNOS gene was determined by PCR-restriction fragment-length polymorphism analysis. The group included 33 male and 48 female subjects who received 32 living-related grafts and 49 from deceased donors (DD) donors. Donor age (y) was 32.7 +/- 13.7 and the HLA A,B,DR mismatch number of the cadaveric cases was 3.5 +/- 0.79. The distribution of the genotypes were ENOS GG/GT/TT 48%, 33%, 19%, respectively. G-alleles frequency was 64.8%; T-allele frequency was 35.2%. ENOS G894T gene polymorphism did not seem to influence long-term renal allograft outcome. Recipient ENOS G894T gene polymorphism did not alter the risk of chronic allograft failure. Even if NO synthesis and bioactivity are influenced by this polymorphism, many vasoactive factors may have roles to suppress the advantageous effects of NO. PMID:20005399

  8. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria×ananassa)

    PubMed Central

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O.

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria×ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus. PMID:19443619

  9. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  10. Citrate synthase mutants of Agrobacterium are attenuated in virulence and display reduced vir gene induction.

    PubMed

    Suksomtip, Maneewan; Liu, Pu; Anderson, Tamara; Tungpradabkul, Sumalee; Wood, Derek W; Nester, Eugene W

    2005-07-01

    A citrate synthase (CS) deletion mutant of Agrobacterium tumefaciens C58 is highly attenuated in virulence. The identity of the mutant was initially determined from its amino acid sequence, which is 68% identical to Escherichia coli and 77% identical to Brucella melitensis. The mutant lost all CS enzymatic activity, and a cloned CS gene complemented a CS mutation in Sinorhizobium. The CS mutation resulted in a 10-fold reduction in vir gene expression, which likely accounts for the attenuated virulence. When a plasmid containing a constitutive virG [virG(Con)] locus was introduced into this mutant, the level of vir gene induction was restored to nearly wild-type level. Further, the virG(Con)-complemented CS mutant strain induced tumors that were similar in size and number to those induced by the parental strain. The CS mutation resulted in only a minor reduction in growth rate in a glucose-salts medium. Both the CS mutant and the virG(Con)-complemented CS strain displayed similar growth deficiencies in a glucose-salts medium, indicating that the reduced growth rate of the CS mutant could not be responsible for the attenuated virulence. A search of the genome of A. tumefaciens C58 revealed four proteins, encoded on different replicons, with conserved CS motifs. However, only the locus that when mutated resulted in an attenuated phenotype has CS activity. Mutations in the other three loci did not result in attenuated virulence and any loss of CS activity, and none were able to complement the CS mutation in Sinorhizobium. The function of these loci remains unknown. PMID:15995199

  11. Endothelial nitric oxide synthase gene polymorphism is associated with Legg-Calvé-Perthes disease

    PubMed Central

    ZHAO, YULONG; LIAO, SHIJIE; LU, RONGBIN; DANG, HAO; ZHAO, JINMIN; DING, XIAOFEI

    2016-01-01

    The aim of this study was to assess the association of 27-bp variable number tandem repeat (VNTR) polymorphism in intron 4 and G894T polymorphism in exon 7 of the endothelial nitric oxide synthase (eNOS) gene with Legg-Calvé-Perthes disease (LCPD), and to provide a scientific basis for further research into the pathogenic mechanism. A total of 80 patients with LCPD and 100 healthy subjects were recruited in this case-control study. The 27-bp VNTR and G894T polymorphisms of the eNOS gene were genotyped using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism, respectively, followed by agarose gel electrophoresis and DNA sequencing. Allelic and genotypic frequencies were computed in the two groups and subjected to statistical analysis. For the 27-bp VNTR polymorphism, individuals with LCPD showed a higher frequency of the ab genotype [27.5 vs. 14%; odds ratio (OR), 2.33; 95% confidence interval (CI), 1.10–4.92; P=0.024]. For the G894T polymorphism, the LCPD case group showed a higher frequency of the heterozygous genotype GT than the healthy control group (35 vs. 17%; OR, 2.67; 95% CI, 1.33–5.36; P=0.005). The results indicate that these eNOS gene polymorphisms may be a risk factor for LCPD. The 27-bp VNTR polymorphism in intron 4 and G894T polymorphism in exon 7 may be involved in the etiology of LCPD. PMID:27168827

  12. Role of the Tomato Non-Ripening Mutation in Regulating Fruit Quality Elucidated Using iTRAQ Protein Profile Analysis

    PubMed Central

    Yuan, Xin-Yu; Wang, Rui-Heng; Zhao, Xiao-Dan; Luo, Yun-Bo; Fu, Da-Qi

    2016-01-01

    Natural mutants of the Non-ripening (Nor) gene repress the normal ripening of tomato fruit. The molecular mechanism of fruit ripening regulation by the Nor gene is unclear. To elucidate how the Nor gene can affect ripening and fruit quality at the protein level, we used the fruits of Nor mutants and wild-type Ailsa Craig (AC) to perform iTRAQ (isobaric tags for relative and absolute quantitation) analysis. The Nor mutation altered tomato fruit ripening and affected quality in various respects, including ethylene biosynthesis by down-regulating the abundance of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO), pigment biosynthesis by repressing phytoene synthase 1 (PSY1), ζ-carotene isomerase (Z-ISO), chalcone synthase 1 (CHS1) and other proteins, enhancing fruit firmness by increasing the abundance of cellulose synthase protein, while reducing those of polygalacturonase 2 (PG2) and pectate lyase (PL), altering biosynthesis of nutrients such as carbohydrates, amino acids, and anthocyanins. Conversely, Nor mutation also enhanced the fruit’s resistance to some pathogens by up-regulating the expression of several genes associated with stress and defense. Therefore, the Nor gene is involved in the regulation of fruit ripening and quality. It is useful in the future as a means to improve fruit quality in tomato. PMID:27732677

  13. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  14. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

    PubMed Central

    Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  15. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  16. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    PubMed

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  17. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii.

    PubMed

    Awasthi, Praveen; Mahajan, Vidushi; Jamwal, Vijay Lakshmi; Kapoor, Nitika; Rasool, Shafaq; Bedi, Yashbir S; Gandhi, Sumit G

    2016-09-01

    Flavonoids are an important class of secondary metabolites that play various roles in plants such as mediating defense, floral pigmentation and plant-microbe interaction. Flavonoids are also known to possess antioxidant and antimicrobial activities. Coleus forskohlii (Willd.) Briq. (Lamiaceae) is an important medicinal herb with a diverse metabolic profile, including production of a flavonoid, genkwanin. However, components of the flavonoid pathway have not yet been studied in this plant. Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plant CHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it encodes a protein of 391 amino acids with a molecular weight of 42.75 kDa and pI 6.57. Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate (MeJA) strongly induced its expression. Total flavonoids content and antioxidant activity of C. forskohlii also got enhanced in response to MeJA, which correlated with increased CfCHS expression. Induction of CfCHS by MeJA suggest its involvement in production of flavonoids, providing protection from microbes during herbivory or mechanical wounding. Further, our in silico predictions and experimental data suggested that CfCHS may be posttranscriptionally regulated by miR34. PMID:27659336

  18. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    PubMed

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications. PMID:26428312

  19. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    PubMed

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications.

  20. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    PubMed

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes.

  1. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    PubMed

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding.

  2. Identification and Characterization of a Novel Trehalose Synthase Gene Derived from Saline-Alkali Soil Metagenomes

    PubMed Central

    Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn2+ and Hg2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficientcy (Kcat/Km) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis. PMID:24146994

  3. Cloning and sequence analysis of the Blumea balsamifera DC farnesyl diphosphate synthase gene.

    PubMed

    Pang, Y X; Guan, L L; Wu, L F; Chen, Z X; Wang, K; Xie, X L; Yu, F L; Chen, X L; Zhang, Y B; Jiang, Q

    2014-01-01

    Blumea balsamifera DC is a member of the Compositae family and is frequently used as traditional Chinese medicine. Blumea balsamifera is rich in monoterpenes, which possess a variety of pharmacological activities, such as antioxidant, anti-bacteria, and anti-viral activities. Farnesyl diphosphate synthase (FPS) is a key enzyme in the biosynthetic pathway of terpenes, playing an important regulatory role in plant growth, such as resistance and secondary metabolism. Based on the conserved oligo amino acid residues of published FPS genes from other higher plant species, a cDNA sequence, designated BbFPS, was isolated from B. balsamifera DC using polymerase chain reaction. The clones were an average of 1.6 kb and contained an open reading frame that predicted a polypeptide of 342 amino acids with 89.07% identity to FPS from other plants. The deduced amino acid sequence was dominated by hydrophobic regions and contained 2 highly conserved DDxxD motifs that are essential for proper functioning of FPS. Phylogenetic analysis indicated that FPS grouped with other composite families. Prediction of secondary structure and subcellular localization suggested that alpha helices made up 70% of the amino acids of the sequence. PMID:25501197

  4. Epidemiology and clinical relevance of Pneumocystis jirovecii Frenkel, 1976 dihydropteroate synthase gene mutations.

    PubMed

    Matos, O; Esteves, F

    2010-09-01

    A review was conducted to examine the published works that studied the prevalence of Pneumocystis jirovecii dihydropteroate synthase (DHPS) mutations in patients with P. jirovecii pneumonia (PcP), in develop and developing countries, and that focused the problem of the possible association of these mutations with exposure to sulpha or sulphone drugs and their influence in the PcP outcome. Studies conducted in United States of America presented higher P. jirovecii mutations rates, in comparison with European countries, and in developing countries, lower rates of DHPS mutations were reported, due to limited use of sulpha drugs. A significant association was reported between the use of sulpha or sulphone agents for PcP prophylaxis in HIV-infected patients and the presence of DHPS mutations. However these mutations were also detected in PcP patients who were not currently receiving sulpha or sulphone agents. The outcome and mortality of HIV-infected patients with PcP harbouring DHPS gene mutations were related primarily to the underlying severity of illness and the initial severity of PcP, more than to the presence of mutations.

  5. Acid Sphingomyelinase Gene Knockout Ameliorates Hyperhomocysteinemic Glomerular Injury in Mice Lacking Cystathionine-β-Synthase

    PubMed Central

    Boini, Krishna M.; Xia, Min; Abais, Justine M.; Xu, Ming; Li, Cai-xia; Li, Pin-Lan

    2012-01-01

    Acid sphingomyelinase (ASM) has been implicated in the development of hyperhomocysteinemia (hHcys)-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs) and Asm mouse gene by cross breeding Cbs+/− and Asm+/− mice. Given that the homozygotes of Cbs−/−/Asm−/− mice could not survive for 3 weeks. Cbs+/−/Asm+/+, Cbs+/−/Asm+/− and Cbs+/−/Asm−/− as well as their Cbs wild type littermates were used to study the role of Asm−/− under a background of Cbs+/− with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs+/−) mice with different copies of Asm gene compared to Cbs+/+ mice with different Asm gene copies. Cbs+/−/Asm+/+ mice had significantly increased renal Asm activity, ceramide production and O2.− level compared to Cbs+/+/Asm+/+, while Cbs+/−/Asm−/− mice showed significantly reduced renal Asm activity, ceramide production and O2.− level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs+/−/Asm−/− mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O2.− production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or

  6. Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei.

    PubMed

    So, Kum-Kang; Kim, Jung-Mi; Nguyen, Ngoc-Luong; Park, Jin-Ah; Kim, Beom-Tae; Park, Seung-Moon; Hwang, Ki-Jun; Kim, Dae-Hyuk

    2012-12-01

    In previous studies, the biological characteristics of the fungus Cladosporium phlei and its genetic manipulation by transformation were assessed to improve production of the fungal pigment, phleichrome, which is a fungal perylenequinone that plays an important role in the production of a photodynamic therapeutic agent. However, the low production of this metabolite by the wild-type strain has limited its application. Thus, we attempted to clone and characterize the genes that encode polyketide synthases (PKS), which are responsible for the synthesis of fungal pigments such as perylenequinones including phleichrome, elsinochrome and cercosporin. Thus, we performed genomic DNA PCR using 11 different combinations of degenerate primers targeting conserved domains including β-ketoacyl synthase and acyltransferase domains. Sequence comparison of the PCR amplicons revealed a high homology to known PKSs, and four different PKS genes showing a high similarity to three representative types of PKS genes were amplified. To obtain full-length PKS genes, an ordered gene library of a phleichrome-producing C. phlei strain (ATCC 36193) was constructed in a fosmid vector and 4800 clones were analyzed using a simple pyramidal arrangement system. This hierarchical clustering method combines the efficiency of PCR with enhanced specificity. Among the three representative types of PKSs, two reducing, one partially reducing, and one non-reducing PKS were identified. These genes were subsequently cloned, sequenced, and characterized. Biological characterization of these genes to determine their roles in phleichrome production is underway, with the ultimate aim of engineering this pathway to overproduce the desired substance.

  7. RNA interference-based gene silencing of phytoene synthase impairs growth, carotenoids, and plastid phenotype in Oncidium hybrid orchid.

    PubMed

    Liu, Jian-Xin; Chiou, Chung-Yi; Shen, Chin-Hui; Chen, Peng-Jen; Liu, Yao-Chung; Jian, Chin-Der; Shen, Xiao-Lan; Shen, Fu-Quan; Yeh, Kai-Wun

    2014-01-01

    Phytoene synthase (PSY) is the first rate-limiting regulatory enzyme in the carotenoid biosynthesis pathway. In order to modify the floral color pattern by reducing carotenoid contents, a phytoene synthase-RNAi construct was delivered into protocorm-like body (PLB) of Oncidium hybrid orchid. The transgenic orchids show down-regulated level of PSY and geranyl synthase gene. They displayed semi-dwarf phenotype and brilliant green leaves. The microscopic anatomy revealed development-arrested plastids with rare grana. The total carotenoid content was decreased and the efficiency of the photosynthetic electron transport was declined. The chlorophyll level and the expression of chlorophyll biosynthetic genes, such as OgGLUTR and OgCS were dramatically reduced. HPLC analysis showed that the endogenous level of gibberellic acid and abscisic acid in the dwarf transformants are 4-fold lower than in wild type plants. In addition, chilling tolerance of the transgenic Oncidium plants was reduced. The data showed that down-regulation of PSY resulted in alterations of gene expression in enzymes involved in many metabolic pathways, such as carotenoid, gibberellic acid, abscisic acid and chlorophyll biosynthetic pathway as well as causes predominant defects in plant growth and development. PMID:25221736

  8. Functional Analysis of the Phycomyces carRA Gene Encoding the Enzymes Phytoene Synthase and Lycopene Cyclase

    PubMed Central

    Sanz, Catalina; Velayos, Antonio; Álvarez, María Isabel; Benito, Ernesto P.; Eslava, Arturo P.

    2011-01-01

    Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism. PMID:21858003

  9. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    PubMed

    Tai, Deqiang; Tian, Ji; Zhang, Jie; Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  10. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  11. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  12. Expression of Sucrose Synthase Genes Involved in Enhanced Elongation of Pondweed (Potamogeton distinctus) Turions under Anoxia

    PubMed Central

    HARADA, TARO; SATOH, SHIGERU; YOSHIOKA, TOSHIHITO; ISHIZAWA, KIMIHARU

    2005-01-01

    • Background and Aims Overwintering buds (turions) of the monocot aquatic pondweed species (Potamogeton distinctus) are highly tolerant to anoxic stress. Sucrose metabolism accompanied by enhanced activity of sucrose synthase (SuSy) operates actively during anaerobic elongation of pondweed turions. The aim of this study is to isolate SuSy genes from the turions and to investigate their transcriptional changes in response to anoxia and other stimuli. • Methods SuSy genes were isolated from pondweed turions by PCR methods and transcript levels of SuSy genes were examined in response to anoxia, sugars and plant hormones. In addition, the effects of anoxia on SuSy activity were examined both in the soluble fraction and in the microsomal fraction. • Key Results cDNAs of two SuSy genes (PdSUS1 and PdSUS2) were cloned from pondweed turions. The levels of PdSUS1 transcripts increased under anoxia but did not with sugar treatments. Anoxia-stimulated elongation of turions was further enhanced by 2,4-dichlorophenoxyacetic acid (2,4-D) and suppressed by treatments with sorbitol, 2-deoxyglucose (2-dGlc) and abscisic acid (ABA). The levels of PdSUS1 transcripts were increased by 2,4-D and decreased by sorbitol under anoxia. The levels of PdSUS2 transcripts were not significantly affected by anoxia and any other treatments. SuSy activity of turions under anoxia was enhanced in the soluble fraction, but not in the microsomal fraction. • Conclusions Up-regulation of PdSUS1 transcription under anoxia may not be attributed to sugar starvation under anoxia. A positive correlation between stem elongation and the level of PdSUS1 transcripts was observed in turions treated with anoxic conditions, 2,4-D and sorbitol. The increase in SuSy activity in the cytosol may contribute to sugar metabolism and sustain stem elongation under anoxia. PMID:16033779

  13. Circular RNA of the human sphingomyelin synthase 1 gene: Multiple splice variants, evolutionary conservatism and expression in different tissues

    PubMed Central

    Filippenkov, Ivan B; Sudarkina, Olga Yu; Limborska, Svetlana A; Dergunova, Lyudmila V

    2015-01-01

    The human sphingomyelin synthase 1 gene (SGMS1) encodes an essential enzyme that is involved in the synthesis of sphingomyelin and diacylglycerol from phosphatidylcholine and ceramide. Among the products of SGMS1, we found new transcripts, circular RNAs (circRNAs), that contain sequences of the gene's 5′ untranslated region (5′UTR). Some of them include the gene's coding region and fragments of introns. An analysis of the abundance of circRNAs in human tissues showed that the largest transcripts were predominantly found in different parts of the brain. circRNAs of rat and mouse sphingomyelin synthase 1 orthologous genes were detected and are highly similar to the human SGMS1 gene transcripts. A quantitative analysis of the abundance of such transcripts also revealed their elevated amount in the brain. A computational analysis of sequences of human circRNAs showed their high potential of binding microRNAs (miRNAs), including the miRNAs that form complexes with Ago proteins and the mRNA of SGMS1. We assume that the circRNAs identified here participate in the regulation of the function of the SGMS1 gene in the brain. PMID:26274505

  14. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    NASA Technical Reports Server (NTRS)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  15. Absence of mutations associated with sulfa resistance in Pneumocystis carinii dihydropteroate synthase gene from non-human primates.

    PubMed

    Demanche, C; Guillot, J; Berthelemy, M; Petitt, T; Roux, P; Wakefield, A E

    2002-06-01

    The dihydropteroate synthase (DHPS) gene from Pneumocystis carinii isolated from non-human primates was amplified using a polymerase chain reaction (PCR) and sequenced to analyse point mutations associated with sulfa resistance. P. carinii DHPS gene amplification was obtained from eight lung samples from five New World primate species and one Old World primate species. None of the animals had been exposed to sulfa drugs and only the wild-type P. carinii DHPS sequence at codons 55 and 57 was observed. These data support the hypothesis that high rates of DHPS mutants in P. carinii f. sp. hominis have arisen with increased use of sulfa drugs for P. carinii pneumonia prophylaxis.

  16. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases.

    PubMed

    Lopez, J C; Ryan, S; Blankenship, R E

    1996-06-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  17. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    PubMed

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively).

  18. Analysis of THCA synthase gene expression in cannabis: a preliminary study by real-time quantitative PCR.

    PubMed

    Cascini, Fidelia; Passerotti, Stella; Boschi, Ilaria

    2013-09-10

    In this paper we describe analyses performed by Real-Time Reverse-Transcriptase Polymerase Chain Reaction (real-time RT-PCR) on RNA of 12 samples, carried out for forensic purposes to investigate a correlation between tetrahydrocannabinol (THC) concentration in Cannabis and the tetrahydrocannabinol acid synthase (THCAS) gene expression. Samples were obtained from an experimental cultivation of declared potency Cannabis variety seeds and from seizures. The Rubisco gene and the 26S ribosomal RNA gene were used as internal control genes for their constant expression and stability. As results we found minor gene expression in samples from leaves of young plants. Further, grouping results for cannabis samples with similar characteristics, we have found an increased relative expression in samples with the highest percentage of THC coming from seized sample and adult plants.

  19. Complete Genome Sequence of the Rhizobacterium Pseudomonas trivialis Strain IHBB745 with Multiple Plant Growth-Promoting Activities and Tolerance to Desiccation and Alkalinity

    PubMed Central

    Swarnkar, Mohit Kumar; Vyas, Pratibha; Rahi, Praveen; Thakur, Rishu; Thakur, Namika; Singh, Anil Kumar

    2015-01-01

    The complete genome sequence of 6.45 Mb is reported here for Pseudomonas trivialis strain IHBB745 (MTCC 5336), which is an efficient, stress-tolerant, and broad-spectrum plant growth-promoting rhizobacterium. The gene-coding clusters predicted the genes for phosphate solubilization, siderophore production, 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, indole-3-acetic acid (IAA) production, and stress response. PMID:26337878

  20. Complete Genome Sequence of the Rhizobacterium Pseudomonas trivialis Strain IHBB745 with Multiple Plant Growth-Promoting Activities and Tolerance to Desiccation and Alkalinity.

    PubMed

    Gulati, Arvind; Swarnkar, Mohit Kumar; Vyas, Pratibha; Rahi, Praveen; Thakur, Rishu; Thakur, Namika; Singh, Anil Kumar

    2015-01-01

    The complete genome sequence of 6.45 Mb is reported here for Pseudomonas trivialis strain IHBB745 (MTCC 5336), which is an efficient, stress-tolerant, and broad-spectrum plant growth-promoting rhizobacterium. The gene-coding clusters predicted the genes for phosphate solubilization, siderophore production, 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, indole-3-acetic acid (IAA) production, and stress response. PMID:26337878

  1. Characterization of GaWRKY1, a cotton transcription factor that regulates the sesquiterpene synthase gene (+)-delta-cadinene synthase-A.

    PubMed

    Xu, Yan-Hua; Wang, Jia-Wei; Wang, Shui; Wang, Jian-Ying; Chen, Xiao-Ya

    2004-05-01

    The cotton (+)-delta-cadinene synthase (CAD1), a sesquiterpene cyclase, catalyzes a branch-point step leading to biosynthesis of sesquiterpene phytoalexins, including gossypol. CAD1-A is a member of CAD1 gene family, and its promoter contains a W-box palindrome with two reversely oriented TGAC repeats, which are the proposed binding sites of WRKY transcription factors. We isolated several WRKY cDNAs from Gossypium arboreum. One of them, GaWRKY1, encodes a protein containing a single WRKY domain and a putative N-terminal Leu zipper. Similar to genes encoding enzymes of cotton sesquiterpene pathway, GaWRKY1 was down-regulated in a glandless cotton cultivar that contained much less gossypol. GaWRKY1 showed a temporal and spatial pattern of expression comparable to that of CAD1-A in various aerial organs examined, including sepal, stigma, anther, and developing seeds. In suspension cells, expression of both GaWRKY1 and CAD1-A genes and biosynthesis of sesquiterpene aldehydes were strongly induced by a fungal elicitor preparation and methyl jasmonate. GaWRKY1 interacted with the 3x W-box derived from CAD1-A promoter in yeast (Saccharomyces cerevisiae) one-hybrid system and in vitro. Furthermore, in transgenic Arabidopsis plants, overexpression of GaWRKY1 highly activated the CAD1-A promoter, and transient assay in tobacco (Nicotiana tabacum) leaves demonstrated that W-box was required for this activation. These results suggest that GaWRKY1 participates in regulation of sesquiterpene biosynthesis in cotton, and CAD1-A is a target gene of this transcription factor. PMID:15133151

  2. Impact of obesity and nitric oxide synthase gene G894T polymorphism on essential hypertension.

    PubMed

    Wrzosek, M; Sokal, M; Sawicka, A; Wlodarczyk, M; Glowala, M; Wrzosek, M; Kosior, M; Talalaj, M; Biecek, P; Nowicka, G

    2015-10-01

    Hypertension is a multifactorial disease caused by environmental, metabolic and genetic factors, but little is currently known on the complex interplay between these factors and blood pressure. The aim of the present study was to assess the potential impact of obesity, and angiotensin-converting enzyme (ACE) I/D polymorphism and endothelial nitric oxide synthase gene (NOS3) 4a/4b, G894T and -T786C variants on the essential hypertension. The study group consisted of 1,027 Caucasian adults of Polish nationality (45.5 ± 13.6 years old), of which 401 met the criteria for hypertension. Body weight, height and blood pressure were measured and data on self-reported smoking status were collected. Fasting blood glucose, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides were determined by standard procedures. The ACE I/D polymorphism and three polymorphisms in NOS3 gene (4a/4b, G894T, -T786C) were detected by the PCR method. Multivariable logistic regression demonstrated that age above 45 years, diabetes, dyslipidemia, smoking and male sex are important risk factors for hypertension and no significant influence of variants in ACE and NOS3 genes on this risk was recognized. Obese subjects had a 3.27-times higher risk (OR = 3.27, 95% CI: 2.37 - 4.52) of hypertension than non-obese, and in obese the NOS3 894T allele was associated with 1.37 fold higher risk of hypertension (P = 0.031). The distribution of NOS3 G894T genotypes supported the co-dominant (OR = 1.35, P = 0.034, Pfit = 0.435) or recessive (OR = 2.00, P = 0.046, Pfit = 0.286), but not dominant model of inheritance (P = 0.100). The study indicates that in obese NOS3 G894T polymorphism may enhance hypertension risk. However, in the presence of such strong risk factors as age, diabetes and smoking, the impact of this genetic variant seems to be attenuated. Further studies are needed to reveal the usefulness of G894T polymorphism in hypertension risk assessment in obese. PMID:26579574

  3. Impact of obesity and nitric oxide synthase gene G894T polymorphism on essential hypertension.

    PubMed

    Wrzosek, M; Sokal, M; Sawicka, A; Wlodarczyk, M; Glowala, M; Wrzosek, M; Kosior, M; Talalaj, M; Biecek, P; Nowicka, G

    2015-10-01

    Hypertension is a multifactorial disease caused by environmental, metabolic and genetic factors, but little is currently known on the complex interplay between these factors and blood pressure. The aim of the present study was to assess the potential impact of obesity, and angiotensin-converting enzyme (ACE) I/D polymorphism and endothelial nitric oxide synthase gene (NOS3) 4a/4b, G894T and -T786C variants on the essential hypertension. The study group consisted of 1,027 Caucasian adults of Polish nationality (45.5 ± 13.6 years old), of which 401 met the criteria for hypertension. Body weight, height and blood pressure were measured and data on self-reported smoking status were collected. Fasting blood glucose, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides were determined by standard procedures. The ACE I/D polymorphism and three polymorphisms in NOS3 gene (4a/4b, G894T, -T786C) were detected by the PCR method. Multivariable logistic regression demonstrated that age above 45 years, diabetes, dyslipidemia, smoking and male sex are important risk factors for hypertension and no significant influence of variants in ACE and NOS3 genes on this risk was recognized. Obese subjects had a 3.27-times higher risk (OR = 3.27, 95% CI: 2.37 - 4.52) of hypertension than non-obese, and in obese the NOS3 894T allele was associated with 1.37 fold higher risk of hypertension (P = 0.031). The distribution of NOS3 G894T genotypes supported the co-dominant (OR = 1.35, P = 0.034, Pfit = 0.435) or recessive (OR = 2.00, P = 0.046, Pfit = 0.286), but not dominant model of inheritance (P = 0.100). The study indicates that in obese NOS3 G894T polymorphism may enhance hypertension risk. However, in the presence of such strong risk factors as age, diabetes and smoking, the impact of this genetic variant seems to be attenuated. Further studies are needed to reveal the usefulness of G894T polymorphism in hypertension risk assessment in obese.

  4. Endothelial nitric oxide synthase gene intron4 VNTR polymorphism in patients with chronic kidney disease.

    PubMed

    Elshamaa, Manal F; Sabry, Samar; Badr, Ahmed; El-Ahmady, Mostafa; Elghoroury, Eman A; Thabet, Eman H; Kandil, Dina; Kamel, Solaf

    2011-09-01

    Nitric oxide production is reduced in renal disease, partially due to decreased endothelial nitric oxide production. Evidence indicates that nitric oxide deficiency contributes to cardiovascular events and progression of kidney damage. A polymorphism in intron 4 of the endothelial constitutive nitric oxide synthase (ecNOS) gene is a candidate gene in cardiovascular and renal diseases. We investigated a potential involvement of this polymorphism in chronic renal failure. A case-control study involved 78 children with chronic kidney disease (CKD) and 30 healthy controls. All participants were genotyped for the ecNOS4 polymorphism by the polymerase chain reaction (PCR). Dialyzed (maintenance hemodialysis) and conservative treatment children had significantly higher frequency of the aa genotype and ecNOS4a allele (P<0.05) compared with controls. The combined genotype aa+ab vs. bb comparison validated that a allele is a high-risk allele for end-stage renal disease (ESRD) (P<0.05). Serum nitric oxide level was found to be lower in carriers of the ecNOS 4a allele than in noncarriers (100.29±27.32 vs. 152.73±60.39 μmol/l, P=0.04). Interestingly, 85.95% of the ecNOS 4a allele ESRD patients were found hypertensive in comparison to the 60.67% patients of non noncarriers (bb genotype) (P=0.04). Also, 35.90% of the ecNOS 4a allele ESRD patients were found to have cardiovascular disease in comparison to the 5.13% patients of noncarriers (bb genotype) (P=0.01). On multiple linear regression analysis, a allele was independently associated with hypertension (P=0.03). There was a significantly higher frequency of the ecNOS4a allele carriers among CKD children, both on MHD and conservative treatment than in controls. This suggests that the ecNOS gene polymorphism may be associated with an increased risk of chronic renal failure. PMID:21519233

  5. Cloning and characterization of a novel gene that encodes (S)-beta-bisabolene synthase from ginger, Zingiber officinale.

    PubMed

    Fujisawa, Masaki; Harada, Hisashi; Kenmoku, Hiromichi; Mizutani, Satoru; Misawa, Norihiko

    2010-06-01

    Ginger, Zingiber officinale Roscoe, contains a fragrant oil mainly composed of sesquiterpenes and monoterpenes. We isolated a cDNA that codes for a sesquiterpene synthase from young rhizomes of ginger, Z. officinale Roscoe, Japanese cultivar "Kintoki". The cDNA, designated ZoTps1, potentially encoded a protein that comprised 550 amino acid residues and exhibited 49-53% identity with those of the sesquiterpene synthases already isolated from the genus Zingiber. Recombinant Escherichia coli cells, in which ZoTps1 was coexpressed along with genes for D-mevalonate utilization, resulted in the production of a sesquiterpene (S)-beta-bisabolene exclusively with a D-mevalonolactone supplement. This result indicated that ZoTps1 was the (S)-beta-bisabolene synthase gene in ginger. ZoTPS1 was suggested to catalyze (S)-beta-bisabolene formation with the conversion of farnesyl diphosphate to nerolidyl diphosphate followed by the cyclization between position 1 and 6 carbons. The ZoTps1 transcript was detected in young rhizomes, but not in leaves, roots and mature rhizomes of the ginger "Kintoki". PMID:20229191

  6. The maize An2 gene is induced by Fusarium attack and encodes an ent-copalyl diphosphate synthase.

    PubMed

    Harris, L J; Saparno, A; Johnston, A; Prisic, S; Xu, M; Allard, S; Kathiresan, A; Ouellet, T; Peters, R J

    2005-12-01

    Using the technique of differential display, a maize transcript was identified whose silk tissue expression is induced in the presence of the ear rot pathogen Fusarium graminearum. The 3445 nt transcript includes a 727 nt 5' untranslated leader with the potential for extensive secondary structure and represents the maize gene An2. An2 encodes a copalyl diphosphate synthase (CPS)-like protein with 60% amino acid sequence identity with the maize An1 gene product involved in gibberellin (GA) biosynthesis. Recombinant expression and functional analysis demonstrated that both AN1 and AN2 are ent-copalyl diphosphate (ent-CPP) synthases (ent-CPS). Notably, the presence of an additional ent-CPS gene is consistent with previous reports that maize GA biosynthesis can proceed in the absence of An1. In addition, northern blot analysis showed that An2 transcript levels were strongly up-regulated by Fusarium attack, with an increase in silk, husk and ear tip tissues as early as 6 h after inoculation of silk channels with spore suspensions of various Fusarium sp. Gene expression of a third maize CPS-like gene, Cpsl1, is not affected by Fusarium infection. The Fusarium-inducible nature of An2 is also consistent with a previous report that cell-free extracts from maize seedlings produce ent-CPP derived diterpenes in response to Fusarium infection. However, it is not known whether An2 is involved in defense-related secondary metabolism in addition to GA synthesis.

  7. Silencing of the ACC synthase gene ACACS2 causes delayed flowering in pineapple [Ananas comosus (L.) Merr.].

    PubMed

    Trusov, Yuri; Botella, José Ramón

    2006-01-01

    Flowering is a crucial developmental stage in the plant life cycle. A number of different factors, from environmental to chemical, can trigger flowering. In pineapple, and other bromeliads, it has been proposed that flowering is triggered by a small burst of ethylene production in the meristem in response to environmental cues. A 1-amino-cyclopropane-1-carboxylate synthase (ACC synthase) gene has been cloned from pineapple (ACACS2), which is induced in the meristem under the same environmental conditions that induce flowering. Two transgenic pineapple lines have been produced containing co-suppression constructs designed to down-regulate the expression of the ACACS2 gene. Northern analysis revealed that the ACACS2 gene was silenced in a number of transgenic plants in both lines. Southern hybridization revealed clear differences in the methylation status of silenced versus non-silenced plants by the inability of a methylation-sensitive enzyme to digest within the ACACS2 DNA extracted from silenced plants, indicating that methylation is the cause of the observed co-suppression of the ACACS2 gene. Flowering characteristics of the transgenic plants were studied under field conditions in South East Queensland, Australia. Flowering dynamics studies revealed significant differences in flowering behaviour, with transgenic plants exhibiting silencing showing a marked delay in flowering when compared with non-silenced transgenic plants and control non-transformed plants. It is argued that the ACACS2 gene is one of the key contributors towards triggering 'natural flowering' in mature pineapples under commercial field conditions.

  8. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis.

    PubMed

    Sundari, Balachandran Karpaga Raja; Dasgupta, Modhumita Ghosh

    2014-08-01

    Cellulose synthases (CesA) represent a group of β-1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  9. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    SciTech Connect

    Yoshigai, Emi; Machida, Toru; Okuyama, Tetsuya; Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota; Okumura, Tadayoshi; Ikeya, Yukinobu; Nishino, Hoyoku; Nishizawa, Mikio

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  10. Genomic organization and expression analysis of a farnesyl diphosphate synthase gene (FPPS2) in apples (Malus domestica Borkh.).

    PubMed

    Yuan, Kejun; Wang, Changjun; Xin, Li; Zhang, Anning; Ai, Chengxiang

    2013-07-25

    A farnesyl diphosphate synthase gene (FPPS2), which contains 11 introns and 12 exons, was isolated from the apple cultivar "White Winter Pearmain". When it was compared to our previously reported FPPS1, its each intron size was different, its each exon size was the same as that of FPPS1 gene, 30 nucleotide differences were found in its coding sequence. Based on these nucleotide differences, specific primers were designed to perform expression analysis; the results showed that it expressed in both fruit and leaf, its expression level was obviously lower than that of FPPS1 gene in fruit which was stored at 4°C for 5 weeks. This is the first report concerning two FPPS genes and their expression comparison in apples.

  11. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites.

  12. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites. PMID:27183792

  13. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    PubMed

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  14. The human TruB family of pseudouridine synthase genes, including the Dyskeratosis Congenita 1 gene and the novel member TRUB1.

    PubMed

    Zucchini, Cinzia; Strippoli, Pierluigi; Biolchi, Alessia; Solmi, Rossella; Lenzi, Luca; D'Addabbo, Pietro; Carinci, Paolo; Valvassori, Luisa

    2003-06-01

    A novel human gene denominated TruB pseudouridine (psi) synthase homolog 1 (E. coli) (approved symbol, TRUB1) has been identified and characterized. Spanning approximately 40 kb on chromosome 10 and including 8 exons, TRUB1 is the first described human ortholog of bacterial TruB/psi55, a gene involved in tRNA pseudouridinilation. TRUB1 gene encodes a 349-amino acid product, with a VFAVHKPKGPTSA box in positions 71-83 corresponding to motif I of the TruB family (probably involved in conserving protein structure). The TruB domain of TRUB1 lies between W104 and I255, and contains another short motif, GGTLDS AARGVLVV, including the highly conserved D residue that characterizes motif II (involved in uridine recognition and in catalytic function of psi synthases). Northern blot analysis revealed that TRUB1 mRNA is widely expressed in various human tissues (especially heart, skeletal muscle and liver). Phylogenetic analysis of the TruB domain revealed another human gene (approved symbol TRUB2) encoding a conserved TruB domain, located on human chromosome 9. Thus, the human TruB family includes at least three members: i.e. DKC1 (previously identified), TRUB1 and TRUB2. The TRUB1 and TRUB2 products could be the hitherto unidentified human tRNA psi synthases. Although TRUB1 is not highly similar to DKC1/dyskerin (whose mutations cause X-linked dyskeratosis congenita) and putatively affects tRNA rather than rRNA modification, it is the most similar human protein to dyskerin. Study of TRUB1 (and TRUB2) should facilitate understanding of the molecular mechanisms of RNA modification and the involvement of psi synthases in human pathology, including dyskeratosis-like diseases.

  15. Molecular and physiological evidence suggests the existence of a system II-like pathway of ethylene production in non-climacteric Citrus fruit.

    PubMed

    Katz, Ehud; Lagunes, Paulino Martinez; Riov, Joseph; Weiss, David; Goldschmidt, Eliezer E

    2004-06-01

    Mature citrus fruits, which are classified as non-climacteric, evolve very low amounts of ethylene during ripening but respond to exogenous ethylene by ripening-related pigment changes and accelerated respiration. In the present study we show that young citrus fruitlets attached to the tree produce high levels of ethylene, which decrease dramatically towards maturation. Upon harvest, fruitlets exhibited a climacteric-like rise in ethylene production, preceded by induction of the genes for 1-aminocyclopropane-1-carboxylate (ACC) synthase 1 (CsACS1), ACC oxidase 1 (CsACO1) and the ethylene receptor CsERS1. This induction was advanced and augmented by exogenous ethylene or propylene, indicating an autocatalytic system II-like ethylene biosynthesis. In mature, detached fruit, very low rates of ethylene production were associated with constitutive expression of the ACC synthase 2 (CsACS2) and ethylene receptor CsETR1 genes (system I). CsACS1 gene expression was undetectable at this stage, even following ethylene or propylene treatment, and CsERS1 gene expression remained constant, indicating that no autocatalytic response had occurred. The transition from system II-like behavior of young fruitlets to system I behavior appears to be under developmental control. PMID:15014996

  16. Molecular and physiological evidence suggests the existence of a system II-like pathway of ethylene production in non-climacteric Citrus fruit.

    PubMed

    Katz, Ehud; Lagunes, Paulino Martinez; Riov, Joseph; Weiss, David; Goldschmidt, Eliezer E

    2004-06-01

    Mature citrus fruits, which are classified as non-climacteric, evolve very low amounts of ethylene during ripening but respond to exogenous ethylene by ripening-related pigment changes and accelerated respiration. In the present study we show that young citrus fruitlets attached to the tree produce high levels of ethylene, which decrease dramatically towards maturation. Upon harvest, fruitlets exhibited a climacteric-like rise in ethylene production, preceded by induction of the genes for 1-aminocyclopropane-1-carboxylate (ACC) synthase 1 (CsACS1), ACC oxidase 1 (CsACO1) and the ethylene receptor CsERS1. This induction was advanced and augmented by exogenous ethylene or propylene, indicating an autocatalytic system II-like ethylene biosynthesis. In mature, detached fruit, very low rates of ethylene production were associated with constitutive expression of the ACC synthase 2 (CsACS2) and ethylene receptor CsETR1 genes (system I). CsACS1 gene expression was undetectable at this stage, even following ethylene or propylene treatment, and CsERS1 gene expression remained constant, indicating that no autocatalytic response had occurred. The transition from system II-like behavior of young fruitlets to system I behavior appears to be under developmental control.

  17. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    PubMed

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  18. Oxygen control of ethylene biosynthesis during seed development in Arabidopsis thaliana (L.) Heynh

    NASA Technical Reports Server (NTRS)

    Ramonell, K. M.; McClure, G.; Musgrave, M. E.

    2002-01-01

    An unforeseen side-effect on plant growth in reduced oxygen is the loss of seed production at concentrations around 25% atmospheric (50 mmol mol-1 O2). In this study, the model plant Arabidopsis thaliana (L.) Heynh. cv. 'Columbia' was used to investigate the effect of low oxygen on ethylene biosynthesis during seed development. Plants were grown in a range of oxygen concentrations (210 [equal to ambient], 160, 100, 50 and 25 mmol mol-1) with 0.35 mmol mol-1 CO2 in N2. Ethylene in full-sized siliques was sampled using gas chromatography, and viable seed production was determined at maturity. Molecular analysis of ethylene biosynthesis was accomplished using cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase in ribonuclease protection assays and in situ hybridizations. No ethylene was detected in siliques from plants grown at 50 and 25 mmol mol-1 O2. At the same time, silique ACC oxidase mRNA increased three-fold comparing plants grown under the lowest oxygen with ambient controls, whereas ACC synthase mRNA was unaffected. As O2 decreased, tissue-specific patterning of ACC oxidase and ACC synthase gene expression shifted from the embryo to the silique wall. These data demonstrate how low O2 modulates the activity and expression of the ethylene biosynthetic pathway during seed development in Arabidopsis.

  19. Physiological Roles of the β-Substituted Alanine Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Watanabe, Mutsumi; Kusano, Miyako; Oikawa, Akira; Fukushima, Atsushi; Noji, Masaaki; Saito, Kazuki

    2008-01-01

    The β-substituted alanine (Ala) synthase (Bsas) family in the large superfamily of pyridoxal 5′-phosphate-dependent enzymes comprises cysteine (Cys) synthase (CSase) [O-acetyl-serine (thiol) lyase] and β-cyano-Ala synthase (CASase) in plants. Nine genomic sequences encode putative Bsas proteins in Arabidopsis thaliana. The physiological roles of these Bsas isoforms in vivo were investigated by the characterization of T-DNA insertion mutants. Analyses of gene expression, activities of CSase and CASase, and levels of Cys and glutathione in the bsas mutants indicated that cytosolic Bsas1;1, plastidic Bsas2;1, and mitochondrial Bsas2;2 play major roles in Cys biosynthesis. Cytosolic Bsas1;1 has the most dominant contribution both in leaf and root, and mitochondrial Bsas2;2 plays a significant role in root. Mitochondrial Bsas3;1 is a genuine CASase. Nontargeted metabolome analyses of knockout mutants were carried out by a combination of gas chromatography time-of-flight mass spectrometry and capillary electrophoresis time-of-flight mass spectrometry. The level of γ-glutamyl-β-cyano-Ala decreased in the mutant bsas3;1, indicating the crucial role of Bsas3;1 in β-cyano-Ala metabolism in vivo. PMID:18024555

  20. Over-expression of a grape stilbene synthase gene in tomato induces parthenocarpy and causes abnormal pollen development.

    PubMed

    Ingrosso, Ilaria; Bonsegna, Stefania; De Domenico, Stefania; Laddomada, Barbara; Blando, Federica; Santino, Angelo; Giovinazzo, Giovanna

    2011-10-01

    A novel strategy to induce parthenocarpy in tomato fruits by the induction of resveratrol biosynthesis in flower tissues was exploited. Two transgenic tomato lines were considered: a higher resveratrol-producing (35SS) line, constitutively expressing a grape stilbene synthase cDNA, and a lower resveratrol-producing (LoxS) line, expressing stilbene synthase under a fruit-specific promoter. The expression of the stilbene synthase gene affected flavonoid metabolism in a different manner in the transgenic lines, and in one of these, the 35SS line, resulted in complete male sterility. Resveratrol was synthesised either in 35SS or LoxS tomato flowers, at an even higher extent (about 8-10 times) in the former line. We further investigated whether stilbene synthase expression may have resulted in impaired naringenin accumulation during flower development. In the 35SS flowers, naringenin was significantly impaired by about 50%, probably due to metabolic competition. Conversely, the amount of glycosylated flavonols increased in transgenic flowers, thereby excluding the diminished production of flavonols as a reason for parthenocarpy in tomato. We further investigated whether resveratrol synthesis may have resulted changes to pollen structure. Microscopic observations revealed the presence of few and abnormal flake-like pollen grains in 35SS flowers with no germination capability. Finally, the analysis of coumaric and ferulic acids, the precursors of lignin and sporopollenin biosynthesis, revealed significant depletion of these compounds, therefore suggesting an impairment in structural compounds as a reason for pollen ablation. These overall outcomes, to the best of our knowledge, reveal for the first time the major role displayed by resveratrol synthesis on parthenocarpy in tomato fruits. PMID:21843947

  1. Important roles of drought- and cold-inducible genes for galactinol synthase in stress tolerance in Arabidopsis thaliana.

    PubMed

    Taji, Teruaki; Ohsumi, Chieko; Iuchi, Satoshi; Seki, Motoaki; Kasuga, Mie; Kobayashi, Masatomo; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2002-02-01

    Raffinose family oligosaccharides (RFO) accumulating during seed development are thought to play a role in the desiccation tolerance of seeds. However, the functions of RFO in desiccation tolerance have not been elucidated. Here we examine the functions of RFO in Arabidopsis thaliana plants under drought- and cold-stress conditions, based on the analyses of function and expression of genes involved in RFO biosynthesis. Sugar analysis showed that drought-, high salinity- and cold-treated Arabidopsis plants accumulate a large amount of raffinose and galactinol, but not stachyose. Raffinose and galactinol were not detected in unstressed plants. This suggests that raffinose and galactinol are involved in tolerance to drought, high salinity and cold stresses. Galactinol synthase (GolS) catalyses the first step in the biosynthesis of RFO from UDP-galactose. We identified three stress-responsive GolS genes (AtGolS1, 2 and 3) among seven Arabidopsis GolS genes. AtGolS1 and 2 were induced by drought and high-salinity stresses, but not by cold stress. By contrast, AtGolS3 was induced by cold stress but not by drought or salt stress. All the GST fusion proteins of GST-AtGolS1, 2 and 3 expressed in Escherichia coli had galactinol synthase activities. Overexpression of AtGolS2 in transgenic Arabidopsis caused an increase in endogenous galactinol and raffinose, and showed reduced transpiration from leaves to improve drought tolerance. These results show that stress-inducible galactinol synthase plays a key role in the accumulation of galactinol and raffinose under abiotic stress conditions, and that galactinol and raffinose may function as osmoprotectants in drought-stress tolerance of plants.

  2. Ectopic overexpression of the cell wall invertase gene CIN1 leads to dehydration avoidance in tomato.

    PubMed

    Albacete, Alfonso; Cantero-Navarro, Elena; Großkinsky, Dominik K; Arias, Cintia L; Balibrea, María Encarnación; Bru, Roque; Fragner, Lena; Ghanem, Michel E; González, María de la Cruz; Hernández, Jose A; Martínez-Andújar, Cristina; van der Graaff, Eric; Weckwerth, Wolfram; Zellnig, Günther; Pérez-Alfocea, Francisco; Roitsch, Thomas

    2015-02-01

    senescence-delaying hormone trans-zeatin and decreases in the senescence-inducing ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) in the leaves. Thus, cwInv critically functions at the integration point of metabolic, hormonal, and stress signals, providing a novel strategy to overcome drought-induced limitations to crop yield, without negatively affecting plant fitness under optimal growth conditions.

  3. Ectopic overexpression of the cell wall invertase gene CIN1 leads to dehydration avoidance in tomato

    PubMed Central

    Albacete, Alfonso; Cantero-Navarro, Elena; Großkinsky, Dominik K.; Arias, Cintia L.; Balibrea, María Encarnación; Bru, Roque; Fragner, Lena; Ghanem, Michel E.; González, María de la Cruz; Hernández, Jose A.; Martínez-Andújar, Cristina; van der Graaff, Eric; Weckwerth, Wolfram; Zellnig, Günther; Pérez-Alfocea, Francisco; Roitsch, Thomas

    2015-01-01

    the senescence-delaying hormone trans-zeatin and decreases in the senescence-inducing ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) in the leaves. Thus, cwInv critically functions at the integration point of metabolic, hormonal, and stress signals, providing a novel strategy to overcome drought-induced limitations to crop yield, without negatively affecting plant fitness under optimal growth conditions. PMID:25392479

  4. Ectopic overexpression of the cell wall invertase gene CIN1 leads to dehydration avoidance in tomato.

    PubMed

    Albacete, Alfonso; Cantero-Navarro, Elena; Großkinsky, Dominik K; Arias, Cintia L; Balibrea, María Encarnación; Bru, Roque; Fragner, Lena; Ghanem, Michel E; González, María de la Cruz; Hernández, Jose A; Martínez-Andújar, Cristina; van der Graaff, Eric; Weckwerth, Wolfram; Zellnig, Günther; Pérez-Alfocea, Francisco; Roitsch, Thomas

    2015-02-01

    senescence-delaying hormone trans-zeatin and decreases in the senescence-inducing ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) in the leaves. Thus, cwInv critically functions at the integration point of metabolic, hormonal, and stress signals, providing a novel strategy to overcome drought-induced limitations to crop yield, without negatively affecting plant fitness under optimal growth conditions. PMID:25392479

  5. Association between endothelial nitric oxide synthase gene polymorphism (-786T>C) and interleukin-6 in acute coronary syndrome.

    PubMed

    Piccoli, J C E; Manfredini, V; Faoro, D; Farias, F M; Bodanese, L C; Bogo, M R

    2014-04-01

    Atherosclerosis is morphologically an inflammatory disease, where endothelial dysfunction plays a key role in all the stages. The nitric oxide (NO) synthase 3 (NOS3) gene is responsible for the synthesis of endothelial NO synthase (eNOS) in humans and some genetic polymorphisms are considered "polymorphisms associated with risk" for the development of coronary artery diseases, such as acute coronary syndrome. Thus, the present study aimed to evaluate the influence of the -786T>C polymorphism of the eNOS gene on inflammatory and oxidative process. A prospective cohort study of 125 consecutive patients with clinical diagnosis of non-ST-elevation acute coronary syndromes was conducted. Patients were assessed using a standardized questionnaire. Blood samples were drawn to measure serum levels of high-sensitivity C-reactive protein, soluble CD40 ligand, interleukin-6 (IL-6), N-terminal prohormone of brain natriuretic peptide, immunoglobulin G antibodies against oxidized low-density lipoprotein. The genotypes for the -786T>C polymorphism in the 5'-flanking region of eNOS gene were determined. The -786C allele was found in 92 of 250 alleles (38.8%). No statistical association was observed between demographic and clinical characteristics and distribution of eNOS-786T>C polymorphism. We found that -786CC was associated with lower levels of IL-6. No significant differences were observed between the distribution of -786T>C polymorphism and other investigated markers.

  6. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    PubMed

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously.

  7. Discovery of bacterial polyhydroxyalkanoate synthase (PhaC)-encoding genes from seasonal Baltic Sea ice and cold estuarine waters.

    PubMed

    Pärnänen, Katariina; Karkman, Antti; Virta, Marko; Eronen-Rasimus, Eeva; Kaartokallio, Hermanni

    2015-01-01

    Polyhydroxyalkanoates (PHAs) are macromolecules produced by bacteria as means for storing carbon and energy in intracellular granules. PHAs have physical properties similar to those of plastics and have become of interest to industry as materials for environmentally friendly bioplastic production. There is an ongoing search for new PHA-producing bacterial strains and PHA-synthesizing enzymes tolerating extreme conditions to find ways of producing PHAs at cold temperatures and high solute concentrations. Moreover, the study of PHA producers in the sea-ice biome can aid in understanding the microbial ecology of carbon cycling in ice-associated ecosystems. In this study, PHA producers and PHA synthase genes were examined under the extreme environmental conditions of sea ice and cold seawater to find evidence of PHA production in an environment requiring adaptation to high salinity and cold temperatures. Sea ice and cold estuarine water samples were collected from the northern Baltic Sea and evidence of PHA production was gathered, using microscopy with Nile Blue A staining of PHA-granules and PCR assays detecting PHA-synthesis genes. The PHA granules and PHA synthases were found at all sampling locations, in both sea ice and water, and throughout the sampling period spanning over 10 years. Our study shows, for the first time, that PHA synthesis occurs in Baltic Sea cold-adapted bacteria in their natural environment, which makes the Baltic Sea and its cold environments an interesting choice in the quest for PHA-synthesizing bacteria and synthesis genes. PMID:25280551

  8. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

    PubMed Central

    Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

    2015-01-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  9. Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis.

    PubMed

    Cordero, Baldo F; Couso, Inmaculada; León, Rosa; Rodríguez, Herminia; Vargas, M Angeles

    2011-07-01

    The isolation and characterization of the phytoene synthase gene from the green microalga Chlorella zofingiensis (CzPSY), involved in the first step of the carotenoids biosynthetic pathway, have been performed. CzPSY gene encodes a polypeptide of 420 amino acids. A single copy of CzPSY has been found in C. zofingiensis by Southern blot analysis. Heterologous genetic complementation in Escherichia coli showed the ability of the predicted protein to catalyze the condensation of two molecules of geranylgeranyl pyrophosphate (GGPP) to form phytoene. Phylogenetic analysis has shown that the deduced protein forms a cluster with the rest of the phytoene synthases (PSY) of the chlorophycean microalgae studied, being very closely related to PSY of plants. This new isolated gene has been adequately inserted in a vector and expressed in Chlamydomonas reinhardtii. The overexpression of CzPSY in C. reinhardtii, by nuclear transformation, has led to an increase in the corresponding CzPSY transcript level as well as in the content of the carotenoids violaxanthin and lutein which were 2.0- and 2.2-fold higher than in untransformed cells. This is an example of manipulation of the carotenogenic pathway in eukaryotic microalgae, which can open up the possibility of enhancing the productivity of commercial carotenoids by molecular engineering. PMID:21519934

  10. Patterning of virus-infected Glycine max seed coat is associated with suppression of endogenous silencing of chalcone synthase genes.

    PubMed

    Senda, Mineo; Masuta, Chikara; Ohnishi, Shizen; Goto, Kazunori; Kasai, Atsushi; Sano, Teruo; Hong, Jin-Sung; MacFarlane, Stuart

    2004-04-01

    Most commercial Glycine max (soybean) varieties have yellow seeds because of loss of pigmentation in the seed coat. It has been suggested that inhibition of seed coat pigmentation in yellow G. max may be controlled by homology-dependent silencing of chalcone synthase (CHS) genes. Our analysis of CHS mRNA and short-interfering RNAs provide clear evidence that the inhibition of seed coat pigmentation in yellow G. max results from posttranscriptional rather than transcriptional silencing of the CHS genes. Furthermore, we show that mottling symptoms present on the seed coat of G. max plants infected with some viruses can be caused by suppression of CHS posttranscriptional gene silencing (PTGS) by a viral silencing suppressor protein. These results demonstrate that naturally occurring PTGS plays a key role in expression of a distinctive phenotype in plants and present a simple clear example of the elucidation of the molecular mechanism for viral symptom induction. PMID:15037735

  11. Analysis of the endothelial nitric oxide synthase gene as a modifier of the cerebral response to ischemia.

    PubMed

    Dutra, Ana Virginia; Lin, Hsiu-Fen; Juo, Suh-Hang Hank; Boyadjis, Melanie; Moussouttas, Michael; Reddy, P Leema; Grewal, Raji Paul

    2006-01-01

    We studied the endothelial nitric oxide synthase (eNOS or NOS-3) gene as a potential modifier of the cerebral response to ischemia by investigating the association of two common polymorphisms with ischemic stroke volume. We genotyped an intronic variable number tandem repeat and a single nucleotide polymorphism, G894T, in 132 patients with nonlacunar ischemic strokes in whom clinical data and stroke lesion volume were recorded. Our results show that all genotypes are in Hardy-Weinberg equilibrium. After adjustment of covariates, neither of the NOS-3 polymorphisms showed significant differences comparing the genotypes and mean stroke volume (analysis of variance). Our results do not suggest a major gene effect of the NOS-3 gene as a modifier of the cerebral response to ischemia. PMID:17904064

  12. Transcriptional profiling of canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) constitutively overexpressing a spermidine synthase gene.

    PubMed

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  13. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  14. "Macrophage" nitric oxide synthase is a glucocorticoid-inhibitable primary response gene in 3T3 cells.

    PubMed

    Gilbert, R S; Herschman, H R

    1993-10-01

    Both nitric oxide and prostaglandins are potent paracrine mediators of intercellular communication. An endotoxin-lipopolysaccharide (LPS) inducible form of nitric oxide synthase (mac-NOS) has recently been cloned from murine macrophages. An inducible prostaglandin synthase (TIS10/PGS-2), cloned from 3T3 cells, is also induced in LPS-activated macrophage. Because of the wide range of ligands that induce primary response genes in 3T3 cells, the ease of studying chimeric promoter constructs in 3T3 cells, and the importance of both nitric oxide and prostaglandins as paracrine mediators, we examined expression of mac-NOS in 3T3 cells. Tetradecanoyl phorbol-13-acetate (TPA), forskolin, platelet-derived growth factor, fibroblast growth factor, and serum all induce mac-NOS expression in Swiss 3T3 cells. Thus the mac-NOS gene can respond to a far wider range of inducers than previously suspected. mac-NOS is a primary response gene; cycloheximide does not block induction. TPA-induced mac-NOS and TIS10/PGS-2 mRNA accumulation patterns are similar. LPS is a potent inducer of mac-NOS in Swiss 3T3 cells but cannot induce TIS10/PGS-2. In contrast, v-src expression induces TIS10/PGS-2 message, but not iNOS message in a BALB/c 3T3 cell line containing a temperature-sensitive v-src gene. Dexamethasone (DEX) prevents induction of TIS10/PGS-2, but not most other primary response genes. DEX also blocks mac-NOS induction in Swiss 3T3 cells. The inducible TIS10/PGS-2 and mac-NOS genes, responsible for the production of two distinct paracrine agents, appear to share many regulatory features in 3T3 cells.

  15. The application of the mutated acetolactate synthase gene from rice as the selectable marker gene in the production of transgenic soybeans.

    PubMed

    Tougou, Makoto; Yamagishi, Noriko; Furutani, Noriyuki; Kaku, Koichiro; Shimizu, Tsutomu; Takahata, Yoshihito; Sakai, Jun-ichi; Kanematsu, Seiji; Hidaka, Soh

    2009-05-01

    We investigated selective culturing conditions for the production of transgenic soybeans. In this culturing system, we used the acetolactate synthase (ALS)-inhibiting herbicide-resistance gene derived from rice (Os-mALS gene) as a selectable marker gene instead of that derived from bacteria, which interfered with the cultivation and practical usage of transgenic crops. T(1) soybeans grown from one regenerated plant after selection of the ALS-targeting pyrimidinyl carboxy (PC) herbicide bispyribac-sodium (BS) exhibited herbicide resistance, and the introduction and expression of the Os-mALS gene were confirmed by genetic analysis. The selective culturing system promoted by BS herbicide, in which the Os-mALS gene was used as a selectable marker, was proved to be applicable to the production of transgenic soybeans, despite the appearance of escaped soybean plants that did not contain the Os-mALS transgene.

  16. mRNA Transcript Abundance during Plant Growth and the Influence of Li+ Exposure

    DOE PAGES

    Duff, M. C.; Kuhne, W. W.; Halverson, N. V.; Chang, C. -S.; Kitamura, E.; Hawthorn, L.; Martinez, N. E.; Stafford, C.; Milliken, C. E.; Caldwell, E. F.; et al

    2014-10-23

    Lithium (Li) toxicity in plants is, at a minimum, a function of Li+ concentration, exposure time, species and growth conditions. Most plant studies with Li+ focus on short-term acute exposures. This study examines short- and long-term effects of Li+ exposure in Arabidopsis with Li+ uptake studies and measured shoot mRNA transcript abundance levels in treated and control plants. Stress, pathogen-response and arabinogalactan protein genes were typically more up-regulated in older (chronic, low level) Li+-treatment plants and in the much younger plants from acute high-level exposures. The gene regulation behavior of high-level Li+ resembled prior studies due to its influence on:more » inositol synthesis, 1-aminocyclopropane-1-carboxylate synthases and membrane ion transport. In contrast, chronically-exposed plants had gene regulation responses that were indicative of pathogen, cold, and heavy-metal stress, cell wall degradation, ethylene production, signal transduction, and calcium-release modulation. Acute Li+ exposure phenocopies magnesium-deficiency symptoms and is associated with elevated expression of stress response genes that could lead to consumption of metabolic and transcriptional energy reserves and the dedication of more resources to cell development. In contrast, chronic Li+ exposure increases expression signal transduction genes. The identification of new Li+-sensitive genes and a gene-based “response plan” for acute and chronic Li+ exposure are delineated.« less

  17. mRNA Transcript abundance during plant growth and the influence of Li(+) exposure.

    PubMed

    Duff, M C; Kuhne, W W; Halverson, N V; Chang, C-S; Kitamura, E; Hawthorn, L; Martinez, N E; Stafford, C; Milliken, C E; Caldwell, E F; Stieve-Caldwell, E

    2014-12-01

    Lithium (Li) toxicity in plants is, at a minimum, a function of Li(+) concentration, exposure time, species and growth conditions. Most plant studies with Li(+) focus on short-term acute exposures. This study examines short- and long-term effects of Li(+) exposure in Arabidopsis with Li(+) uptake studies and measured shoot mRNA transcript abundance levels in treated and control plants. Stress, pathogen-response and arabinogalactan protein genes were typically more up-regulated in older (chronic, low level) Li(+)-treatment plants and in the much younger plants from acute high-level exposures. The gene regulation behavior of high-level Li(+) resembled prior studies due to its influence on: inositol synthesis, 1-aminocyclopropane-1-carboxylate synthases and membrane ion transport. In contrast, chronically-exposed plants had gene regulation responses that were indicative of pathogen, cold, and heavy-metal stress, cell wall degradation, ethylene production, signal transduction, and calcium-release modulation. Acute Li(+) exposure phenocopies magnesium-deficiency symptoms and is associated with elevated expression of stress response genes that could lead to consumption of metabolic and transcriptional energy reserves and the dedication of more resources to cell development. In contrast, chronic Li(+) exposure increases expression signal transduction genes. The identification of new Li(+)-sensitive genes and a gene-based "response plan" for acute and chronic Li(+) exposure are delineated.

  18. In vitro effect of nanosilver on gene expression of superoxide dismutases and nitric oxide synthases in chicken Sertoli cells.

    PubMed

    Hassanpour, H; Mirshokraei, P; Sadrabad, E Khalili; Dehkordi, A Esmailian; Layeghi, S; Afzali, A; Mohebbi, A

    2015-02-01

    To evaluate effects of different concentrations of nanosilver colloid on the cell culture of Sertoli cells, the proportion of lipid peroxidation, antioxidant capacity, nitric oxide (NO) production and genes expression of superoxide dismutases (SOD1 and SOD2) and nitric oxide synthases (eNOS and iNOS) were measured. Sertoli cells were incubated at concentrations of 25, 75 and 125 ppm nanosilver for 48 h. There was progressive lipid peroxidation in treatments according to increasing of nanosilver. Lipid peroxidation, as indicated by malondialdehyde levels, was significantly elevated by the highest concentration of silver colloid (125 ppm), although antioxidant capacity, as measured by ferric ion reduction, was unaffected. Nitrite, as an index of NO production was reduced only in 125 ppm of nanosilver. Expression of SOD1 gene was reduced in nanosilver-treated cells at all concentrations, whereas expression of SOD2 gene was reduced only in cells treated with 125 ppm nanosilver. Expression of iNOS gene was progressively increased with higher concentrations of nanosilver. Expression of eNOS gene was also increased in 125 ppm of nanosilver. In conclusion, toxic effects of nanosilver could be due to high lipid peroxidation and suppression of antioxidant mechanisms via reduced expression of SOD genes and increased expression of NOS genes.

  19. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants

    PubMed Central

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  20. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans.

    PubMed

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed.

  1. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    PubMed Central

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  2. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    PubMed Central

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  3. Methylation and Gene Expression Responses to Ethanol Feeding and Betaine Supplementation in the Cystathionine Beta Synthase-Deficient Mouse

    PubMed Central

    Medici, Valentina; Schroeder, Diane I.; Woods, Rima; LaSalle, Janine M.; Geng, Yongzhi; Shibata, Noreene M.; Peerson, Janet; Hodzic, Emir; Dayal, Sanjana; Tsukamoto, Hidekazu; Kharbanda, Kusum K.; Tillman, Brittany; French, Samuel W.; Halsted, Charles H.

    2014-01-01

    Background Alcoholic steatohepatitis (ASH) is caused in part by the effects of ethanol on hepatic methionine metabolism. Methods To investigate the phenotypic and epigenetic consequences of altered methionine metabolism in this disease, we studied the effects of 4-wk intragastric ethanol feeding with and without the methyl donor betaine in cystathionine beta synthase (CβS) heterozygous C57BL/6J mice. Results The histopathology of early ASH was induced by ethanol feeding and prevented by betaine supplementation, while ethanol feeding reduced and betaine supplementation maintained the hepatic methylation ratio of the universal methyl donor S-adenosylmethionine (SAM) to the methyltransferase inhibitor S-adenosylhomocysteine (SAH). MethylC-Seq genomic sequencing of heterozygous liver samples from each diet group found 2–4% reduced methylation in gene bodies but not promoter regions of all autosomes of ethanol fed mice, each of which were normalized in samples from mice fed the betaine supplemented diet. The transcript levels of inducible nitric oxide synthase (Nos2) and DNA methyltransferase 1 (Dnmt1) were increased, while those of peroxisome proliferator receptor-a (Pparα) were reduced in ethanol fed mice, and each was normalized in mice fed the betaine supplemented diet. DNA pyrosequencing of CβS heterozygous samples found reduced methylation in a gene body of Nos2 by ethanol feeding that was restored by betaine supplementation, and was correlated inversely with its expression and positively with SAM: SAH ratios. Conclusions The present studies have demonstrated relationships among ethanol induction of ASH with aberrant methionine metabolism that was associated with gene body DNA hypomethylation in all autosomes and was prevented by betaine supplementation. The data imply that ethanol-induced changes in selected gene transcript levels and hypomethylation in gene bodies during the induction of ASH is a result of altered methionine metabolism that can be reversed

  4. In vitro selection of transgenic sugarcane callus utilizing a plant gene encoding a mutant form of acetolactate synthase.

    PubMed

    van der Vyver, Christell; Conradie, Tobie; Kossmann, Jens; Lloyd, James

    2013-04-01

    Selection genes are routinely used in plant genetic transformation protocols to ensure the survival of transformed cells by limiting the regeneration of non-transgenic cells. In order to find alternatives to the use of antibiotics as selection agents, we followed a targeted approach utilizing a plant gene, encoding a mutant form of the enzyme acetolactate synthase, to convey resistance to herbicides. The sensitivity of sugarcane callus (Saccharum spp. hybrids, cv. NCo310) to a number of herbicides from the sulfonylurea and imidazolinone classes was tested. Callus growth was most affected by sulfonylurea herbicides, particularly 3.6 μg/l chlorsulfuron. Herbicide-resistant transgenic sugarcane plants containing mutant forms of a tobacco acetolactate synthase (als) gene were obtained following biolistic transformation. Post-bombardment, putative transgenic callus was selectively proliferated on MS medium containing 3 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D), 20 g/l sucrose, 0.5 g/l casein, and 3.6 μg/l chlorsulfuron. Plant regeneration and rooting was done on MS medium lacking 2,4-D under similar selection conditions. Thirty vigorously growing putative transgenic plants were successfully ex vitro-acclimatized and established under glasshouse conditions. Glasshouse spraying of putative transgenic plants with 100 mg/l chlorsulfuron dramatically decreased the amount of non-transgenic plants that had escaped the in vitro selection regime. PCR analysis showed that six surviving plants were als-positive and that five of these expressed the mutant als gene. This report is the first to describe a selection system for sugarcane transformation that uses a selectable marker gene of plant origin targeted by a sulfonylurea herbicide. PMID:23543883

  5. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    PubMed

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  6. Cloning of an anthocyanidin synthase gene homolog from blackcurrant (Ribes nigrum L.) and its expression at different fruit stages.

    PubMed

    Li, X-G; Wang, J; Yu, Z-Y

    2015-01-01

    Anthocyanidin synthase (ANS), a 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase, catalyzes the penultimate step in anthocyanin biosynthesis, from leucoanthocyanidins to anthocyanidins, the first colored compound in the anthocyanin pathway. In this study, a full-length, 1427-bp long cDNA named RnANS1, which is homologous to the anthocyanidin synthase gene, was cloned from blackcurrant using a homologous cloning strategy. RnANS1 is highly homologous to other plant ANS genes at both the nucleotide and amino acid sequence levels. The deduced protein contains domains conserved in the 2OG and Fe(II)-dependent oxygenase, and is phylogenetically closely related to Paeonia suffruticosa and Paeonia lactiflora. The expression of RnANS1 was upregulated during fruit maturation, and correlated with the accumulation of anthocyanins and soluble carbohydrates in the fruit. Further characterization of the structure and expression patterns of RnANS1 will clarify our understanding of anthocyanin biosynthesis in blackcurrant, and support the development of molecular approaches to manipulate anthocyanin production in this plant. PMID:25867421

  7. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    PubMed

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids.

  8. Rapid detection of mutations in the human-derived Pneumocystis carinii dihydropteroate synthase gene associated with sulfa resistance.

    PubMed

    Ma, L; Kovacs, J A

    2001-03-01

    Recent studies have shown that point mutations in the dihydropteroate synthase (DHPS) gene of human-derived Pneumocystis carinii are related to exposure to sulfa drugs and possibly represent the emergence of sulfa resistance. We developed a simple single-strand conformation polymorphism (SSCP) method to permit rapid detection of these mutations. With plasmid constructs, SSCP was able to detect as little as 10% of a minority population. The SSCP assay was compared to direct sequencing for typing the DHPS gene by examining 37 clinical isolates with known DHPS sequences and 41 clinical isolates with unknown DHPS sequences. The typing results were consistent between these two methods for all isolates except 11 in which mutations were detected by SSCP but not by direct sequencing. Sequencing of individual clones after subcloning confirmed the presence of mutations in a minority population as determined by SSCP. SSCP is a very simple and sensitive method for rapid identification of P. camii DHPS mutations.

  9. Environmental Stability of Seed Carbohydrate Profiles in Soybeans Containing Different Alleles of the Raffinose Synthase 2 (RS2) Gene.

    PubMed

    Bilyeu, Kristin D; Wiebold, William J

    2016-02-10

    Soybean [Glycine max (L.) Merr.] is important for the high protein meal used for livestock feed formulations. Carbohydrates contribute positively or negatively to the potential metabolizable energy in soybean meal. The positive carbohydrate present in soybean meal consists primarily of sucrose, whereas the negative carbohydrate components are the raffinose family of oligosaccharides (RFOs), raffinose and stachyose. Increasing sucrose and decreasing raffinose and stachyose are critical targets to improve soybean. In three recently characterized lines, variant alleles of the soybean raffinose synthase 2 (RS2) gene were associated with increased sucrose and decreased RFOs. The objective of this research was to compare the environmental stability of seed carbohydrates in soybean lines containing wild-type or variant alleles of RS2 utilizing a field location study and a date of planting study. The results define the carbohydrate variation in distinct regional and temporal environments using soybean lines with different alleles of the RS2 gene.

  10. [Influence of polymorphism's of endothelial nitric oxide synthase gene and polymorphism of NADPH oxidase gene on development of complications of arterial hypertension].

    PubMed

    Kuznetsova, T Iu; Gavrilov, D V; Dudanov, I P; Makarevich, P I; Balatskiĭ, A V; Samokhodskaia, L M; Parfenova, E V

    2008-01-01

    The aim of the study was to analyze the prevalence of polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene in patients with arterial hypertension (AH) and their influence on AH complications. The study included 272 AH patients, average age 50,7 years. The following analyses were performed: clinical analysis of the blood, general analysis of the urine, lipid spectrum, plasma electrolytes, creatinine, glucose, electrocardiography, echocardioscopy, examination of eye vessels, ultrasound examination of the carotid arteries, determination of microalbuminuria. The polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene were detected with two methods: polymerase chain reaction and restrictase reaction. The control group for Glu298Asp polymorphism detection included 102 healthy Russian donors aged 18 to 50 years. Genotypes prevalence in AH patients was as follows: GG 58,8%, GA 32,3%, AA 8,9%, and CC 48,2%, CT 44,9%, TT 6.9%. In the control group: GG 53%, GA 36%, AA 11% and CC 42%, CT 54%, TT 4%. These polymorphisms did not affect the incidence of complications, such as obliterating atherosclerosis of the lower extremity vessels, ischemic heart disease, and acute insufficiency of cerebral circulation, chronic heart failure, left ventricular hypertrophy, microalbuminuria, carotid arteries atherosclerosis. PMID:18429753

  11. Identification of a Polyketide Synthase Gene in the Synthesis of Phleichrome of the Phytopathogenic Fungus Cladosporium phlei.

    PubMed

    So, Kum-Kang; Chung, Yun-Jo; Kim, Jung-Mi; Kim, Beom-Tae; Park, Seung-Moon; Kim, Dae-Hyuk

    2015-12-01

    Phleichrome, a pigment produced by the phytopathogenic fungus Cladosporium phlei, is a fungal perylenequinone whose photodynamic activity has been studied intensively. To determine the biological function of phleichrome and to engineer a strain with enhanced production of phleichrome, we identified the gene responsible for the synthesis of phleichrome. Structural comparison of phleichrome with other fungal perylenequinones suggested that phleichrome is synthesized via polyketide pathway. We recently identified four different polyketide synthase (PKS) genes encompassing three major clades of fungal PKSs that differ with respect to reducing conditions for the polyketide product. Based on in silico analysis of cloned genes, we hypothesized that the non-reducing PKS gene, Cppks1, is involved in phleichrome biosynthesis. Increased accumulation of Cppks1 transcript was observed in response to supplementation with the application of synthetic inducer cyclo-(l-Pro-l-Phe). In addition, heterologous expression of the Cppks1 gene in Cryphonectria parasitica resulted in the production of phleichrome. These results provide convincing evidence that the Cppks1 gene is responsible for the biosynthesis of phleichrome.

  12. Expression of a nitric oxide degrading enzyme induces a senescence programme in Arabidopsis.

    PubMed

    Mishina, Tatiana E; Lamb, Chris; Zeier, Jürgen

    2007-01-01

    Nitric oxide (NO) has been proposed to act as a factor delaying leaf senescence and fruit maturation in plants. Here we show that expression of a NO degrading dioxygenase (NOD) in Arabidopsis thaliana initiates a senescence-like phenotype, an effect that proved to be more pronounced in older than in younger leaves. This senescence phenotype was preceded by a massive switch in gene expression in which photosynthetic genes were down-regulated, whereas many senescence-associated genes (SAGs) and the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene ACS6 involved in ethylene synthesis were up-regulated. External fumigation of NOD plants with NO as well as environmental conditions known to stimulate endogenous NO production attenuated the induced senescence programme. For instance, both high light conditions and nitrate feeding reduced the senescence phenotype and attenuated the down-regulation of photosynthetic genes as well as the up-regulation of SAGs. Treatment of plants with the cytokinin 6-benzylaminopurin (BAP) reduced the down-regulation of photosynthesis, although it had no consistent effect on SAG expression. Metabolic changes during NOD-induced senescence comprehended increases in salicylic acid (SA) levels, accumulation of the phytoalexin camalexin and elevation of leaf gamma-tocopherol contents, all of which occurred during natural senescence in Arabidopsis leaves as well. Moreover, NO fumigation delayed the senescence process induced by darkening individual Arabidopsis Columbia-0 (Col-0) leaves. Our data thus support the notion that NO acts as a negative regulator of leaf senescence.

  13. Transgenic analysis reveals LeACS-1 as a positive regulator of ethylene-induced shikonin biosynthesis in Lithospermum erythrorhizon hairy roots.

    PubMed

    Fang, Rongjun; Wu, Fengyao; Zou, Ailan; Zhu, Yu; Zhao, Hua; Zhao, Hu; Liao, Yonghui; Tang, Ren-Jie; Yang, Tongyi; Pang, Yanjun; Wang, Xiaoming; Yang, Rongwu; Qi, Jinliang; Lu, Guihua; Yang, Yonghua

    2016-03-01

    The phytohormone ethylene (ET) is a crucial signaling molecule that induces the biosynthesis of shikonin and its derivatives in Lithospermum erythrorhizon shoot cultures. However, the molecular mechanism and the positive regulators involved in this physiological process are largely unknown. In this study, the function of LeACS-1, a key gene encoding the 1-aminocyclopropane-1-carboxylic acid synthase for ET biosynthesis in L. erythrorhizon hairy roots, was characterized by using overexpression and RNA interference (RNAi) strategies. The results showed that overexpression of LeACS-1 significantly increased endogenous ET concentration and shikonin production, consistent with the up-regulated genes involved in ET biosynthesis and transduction, as well as the genes related to shikonin biosynthesis. Conversely, RNAi of LeACS-1 effectively decreased endogenous ET concentration and shikonin production and down-regulated the expression level of above genes. Correlation analysis showed a significant positive linear relationship between ET concentration and shikonin production. All these results suggest that LeACS-1 acts as a positive regulator of ethylene-induced shikonin biosynthesis in L. erythrorhizon hairy roots. Our work not only gives new insights into the understanding of the relationship between ET and shikonin biosynthesis, but also provides an efficient genetic engineering target gene for secondary metabolite production in non-model plant L. erythrorhizon.

  14. Endogenous, tissue-specific short interfering RNAs silence the chalcone synthase gene family in glycine max seed coats.

    PubMed

    Tuteja, Jigyasa H; Zabala, Gracia; Varala, Kranthi; Hudson, Matthew; Vodkin, Lila O

    2009-10-01

    Two dominant alleles of the I locus in Glycine max silence nine chalcone synthase (CHS) genes to inhibit function of the flavonoid pathway in the seed coat. We describe here the intricacies of this naturally occurring silencing mechanism based on results from small RNA gel blots and high-throughput sequencing of small RNA populations. The two dominant alleles of the I locus encompass a 27-kb region containing two perfectly repeated and inverted clusters of three chalcone synthase genes (CHS1, CHS3, and CHS4). This structure silences the expression of all CHS genes, including CHS7 and CHS8, located on other chromosomes. The CHS short interfering RNAs (siRNAs) sequenced support a mechanism by which RNAs transcribed from the CHS inverted repeat form aberrant double-stranded RNAs that become substrates for dicer-like ribonuclease. The resulting primary siRNAs become guides that target the mRNAs of the nonlinked, highly expressed CHS7 and CHS8 genes, followed by subsequent amplification of CHS7 and CHS8 secondary siRNAs by RNA-dependent RNA polymerase. Most remarkably, this silencing mechanism occurs only in one tissue, the seed coat, as shown by the lack of CHS siRNAs in cotyledons and vegetative tissues. Thus, production of the trigger double-stranded RNA that initiates the process occurs in a specific tissue and represents an example of naturally occurring inhibition of a metabolic pathway by siRNAs in one tissue while allowing expression of the pathway and synthesis of valuable secondary metabolites in all other organs/tissues of the plant.

  15. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    PubMed Central

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  16. Enhanced flux of substrates into polyamine biosynthesis but not ethylene in tomato fruit engineered with yeast S-adenosylmethionine decarboxylase gene.

    PubMed

    Lasanajak, Yi; Minocha, Rakesh; Minocha, Subhash C; Goyal, Ravinder; Fatima, Tahira; Handa, Avtar K; Mattoo, Autar K

    2014-03-01

    S-adenosylmethionine (SAM), a major substrate in 1-C metabolism is a common precursor in the biosynthetic pathways of polyamines and ethylene, two important plant growth regulators, which exhibit opposing developmental effects, especially during fruit ripening. However, the flux of various substrates including SAM into the two competing pathways in plants has not yet been characterized. We used radiolabeled (14)C-Arg, (14)C-Orn, L-[U-(14)C]Met, (14)C-SAM and (14)C-Put to quantify flux through these pathways in tomato fruit and evaluate the effects of perturbing these pathways via transgenic expression of a yeast SAM decarboxylase (ySAMDC) gene using the fruit ripening-specific promoter E8. We show that polyamines in tomato fruit are synthesized both from Arg and Orn; however, the relative contribution of Orn pathway declines in the later stages of ripening. Expression of ySAMDC reversed the ripening associated decline in spermidine (Spd) and spermine (Spm) levels observed in the azygous control fruit. About 2- to 3-fold higher levels of labeled-Spd in transgenic fruit (556HO and 579HO lines) expressing ySAMDC confirmed the enzymatic function of the introduced gene. The incorporation of L-[U-(14)C]Met into Spd, Spm, ethylene and 1-aminocyclopropane-1-carboxylic acid (ACC) was used to determine Met-flux into these metabolites. The incorporation of (14)C-Met into Spd/Spm declined during ripening of the control azygous fruit but this was reversed in fruits expressing ySAMDC. However, incorporation of (14)C-Met into ethylene or ACC during ripening was not altered by the expression of ySAMDC in the fruit. Taken together these results show that: (1) There is an inverse relationship between the production of higher polyamines and ethylene during fruit ripening, (2) the inverse relationship between higher polyamines and ethylene is modulated by ySAMDC expression in that the decline in Spd/Spm during fruit ripening can be reversed without significantly altering ethylene

  17. Identification and characterization of a class III chitin synthase gene of Moniliophthora perniciosa, the fungus that causes witches' broom disease of cacao.

    PubMed

    Souza, Catiane S; Oliveira, Bruno M; Costa, Gustavo G L; Schriefer, Albert; Selbach-Schnadelbach, Alessandra; Uetanabaro, Ana Paula T; Pirovani, Carlos P; Pereira, Gonçalo A G; Taranto, Alex G; Cascardo, Júlio Cézar de M; Góes-Neto, Aristóteles

    2009-08-01

    Chitin synthase (CHS) is a glucosyltransferase that converts UDP-N-acetylglucosamine into chitin, one of the main components of fungal cell wall. Class III chitin synthases act directly in the formation of the cell wall. They catalyze the conversion of the immediate precursor of chitin and are responsible for the majority of chitin synthesis in fungi. As such, they are highly specific molecular targets for drugs that can inhibit the growth and development of fungal pathogens. In this work, we have identified and characterized a chitin synthase gene of Moniliophthora perniciosa (Mopchs) by primer walking. The complete gene sequence is 3,443 bp, interrupted by 13 small introns, and comprises a cDNA with an ORF with 2,739 bp, whose terminal region was experimentally determined, encoding a protein with 913 aa that harbors all the motifs and domains typically found in class III chitin synthases. This is the first report on the characterization of a chitin synthase gene, its mature transcription product, and its putative protein in basidioma and secondary mycelium stages of M. perniciosa, a basidiomycotan fungus that causes witches' broom disease of cacao.

  18. Against All Odds: Trehalose-6-Phosphate Synthase and Trehalase Genes in the Bdelloid Rotifer Adineta vaga Were Acquired by Horizontal Gene Transfer and Are Upregulated during Desiccation

    PubMed Central

    Hespeels, Boris; Li, Xiang; Flot, Jean-François; Pigneur, Lise-Marie; Malaisse, Jeremy; Da Silva, Corinne; Van Doninck, Karine

    2015-01-01

    The disaccharide sugar trehalose is essential for desiccation resistance in most metazoans that survive dryness; however, neither trehalose nor the enzymes involved in its metabolism have ever been detected in bdelloid rotifers despite their extreme resistance to desiccation. Here we screened the genome of the bdelloid rotifer Adineta vaga for genes involved in trehalose metabolism. We discovered a total of four putative trehalose-6-phosphate synthase (TPS) and seven putative trehalase (TRE) gene copies in the genome of this ameiotic organism; however, no trehalose-6-phosphate phosphatase (TPP) gene or domain was detected. The four TPS copies of A. vaga appear more closely related to plant and fungi proteins, as well as to some protists, whereas the seven TRE copies fall in bacterial clades. Therefore, A. vaga likely acquired its trehalose biosynthesis and hydrolysis genes by horizontal gene transfers. Nearly all residues important for substrate binding in the predicted TPS domains are highly conserved, supporting the hypothesis that several copies of the genes might be functional. Besides, RNAseq library screening showed that trehalase genes were highly expressed compared to TPS genes, explaining probably why trehalose had not been detected in previous studies of bdelloids. A strong overexpression of their TPS genes was observed when bdelloids enter desiccation, suggesting a possible signaling role of trehalose-6-phosphate or trehalose in this process. PMID:26161530

  19. Against All Odds: Trehalose-6-Phosphate Synthase and Trehalase Genes in the Bdelloid Rotifer Adineta vaga Were Acquired by Horizontal Gene Transfer and Are Upregulated during Desiccation.

    PubMed

    Hespeels, Boris; Li, Xiang; Flot, Jean-François; Pigneur, Lise-Marie; Malaisse, Jeremy; Da Silva, Corinne; Van Doninck, Karine

    2015-01-01

    The disaccharide sugar trehalose is essential for desiccation resistance in most metazoans that survive dryness; however, neither trehalose nor the enzymes involved in its metabolism have ever been detected in bdelloid rotifers despite their extreme resistance to desiccation. Here we screened the genome of the bdelloid rotifer Adineta vaga for genes involved in trehalose metabolism. We discovered a total of four putative trehalose-6-phosphate synthase (TPS) and seven putative trehalase (TRE) gene copies in the genome of this ameiotic organism; however, no trehalose-6-phosphate phosphatase (TPP) gene or domain was detected. The four TPS copies of A. vaga appear more closely related to plant and fungi proteins, as well as to some protists, whereas the seven TRE copies fall in bacterial clades. Therefore, A. vaga likely acquired its trehalose biosynthesis and hydrolysis genes by horizontal gene transfers. Nearly all residues important for substrate binding in the predicted TPS domains are highly conserved, supporting the hypothesis that several copies of the genes might be functional. Besides, RNAseq library screening showed that trehalase genes were highly expressed compared to TPS genes, explaining probably why trehalose had not been detected in previous studies of bdelloids. A strong overexpression of their TPS genes was observed when bdelloids enter desiccation, suggesting a possible signaling role of trehalose-6-phosphate or trehalose in this process.

  20. Genome-Wide Identification and Evolution Analysis of Trehalose-6-Phosphate Synthase Gene Family in Nelumbo nucifera

    PubMed Central

    Jin, Qijiang; Hu, Xin; Li, Xin; Wang, Bei; Wang, Yanjie; Jiang, Hongwei; Mattson, Neil; Xu, Yingchun

    2016-01-01

    Trehalose-6-phosphate synthase (TPS) plays a key role in plant carbohydrate metabolism and the perception of carbohydrate availability. In the present work, the publicly available Nelumbo nucifera (lotus) genome sequence database was analyzed which led to identification of nine lotus TPS genes (NnTPS). It was found that at least two introns are included in the coding sequences of NnTPS genes. When the motif compositions were analyzed we found that NnTPS generally shared the similar motifs, implying that they have similar functions. The dN/dS ratios were always less than 1 for different domains and regions outside domains, suggesting purifying selection on the lotus TPS gene family. The regions outside TPS domain evolved relatively faster than NnTPS domains. A phylogenetic tree was constructed using all predicted coding sequences of lotus TPS genes, together with those from Arabidopsis, poplar, soybean, and rice. The result indicated that those TPS genes could be clearly divided into two main subfamilies (I-II), where each subfamily could be further divided into 2 (I) and 5 (II) subgroups. Analyses of divergence and adaptive evolution show that purifying selection may have been the main force driving evolution of plant TPS genes. Some of the critical sites that contributed to divergence may have been under positive selection. Transcriptome data analysis revealed that most NnTPS genes were predominantly expressed in sink tissues. Expression pattern of NnTPS genes under copper and submergence stress indicated that NNU_014679 and NNU_022788 might play important roles in lotus energy metabolism and participate in stress response. Our results can facilitate further functional studies of TPS genes in lotus. PMID:27746792

  1. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    PubMed

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. PMID:26232767

  2. Is a cysteine proteinase inhibitor involved in the regulation of petal wilting in senescing carnation (Dianthus caryophyllus L.) flowers?

    PubMed

    Sugawara, Hiroaki; Shibuya, Kenichi; Yoshioka, Toshihito; Hashiba, Teruyoshi; Satoh, Shigeru

    2002-03-01

    Senescence of carnation petals is accompanied by autocatalytic ethylene production and wilting of the petals; the former is caused by the expression of 1-aminocyclopropane-1-carboxylate (ACC) synthase and ACC oxidase genes and the latter is related to the expression of a cysteine proteinase (CPase) gene. CPase is probably responsible for the degradation of proteins, leading to the decomposition of cell components and resultant cell death during the senescence of petals. The carnation plant also has a gene for the CPase inhibitor (DC-CPIn) that is expressed abundantly in petals at the full opening stage of flowers. In the present study, DC-CPIn cDNA was cloned and expressed in E. coli. The recombinant DC-CPIn protein completely inhibited the activities of a proteinase (CPase) extracted from carnation petals and papain. Northern blot analysis showed that the mRNA for CPase (DC-CP1) accumulated in large amounts, whereas that for DC-CPIn disappeared, corresponding to the onset of petal wilting in flowers undergoing natural senescence and exogenous ethylene-induced senescence. Based on these findings, a role of DC-CPIn in the regulation of petal wilting is suggested; DC-CPIn acts as a suppressor of petal wilting, which probably functions to fine-tune petal wilting in contrast to coarse tuning, the up-regulation of CPase activity by gene expression.

  3. Bacterial lipopolysaccharide induction of the prostaglandin G/H synthase 2 gene causes thromboxane-dependent pulmonary hypertension in rabbits.

    PubMed

    Delong, P; O'Sullivan, M G; Huggins, E; Hubbard, C L; McCall, C

    1999-03-01

    Two genes encode proteins with prostaglandin G/H synthase (PGHS) activity. PGHS-1 is primarily a constitutively expressed gene, whereas inflammatory agents such as bacterial lipopolysaccharide (LPS) endotoxin rapidly induce the PGHS-2 gene in leukocytes. Both PGHS-1 and PGHS-2 are rate-limiting enzymes for the production of prostaglandins and thromboxane following release of arachidonic acid by phospholipases. We previously reported that LPS perfusion into the circulation of isolated perfused rabbit lung (IPL) results in thromboxane-dependent pulmonary hypertension and lung edema when the LPS-primed lung is subsequently stimulated with platelet activating factor (PAF) (J. Clin. Invest. 1990;85:1135). In this study, we showed that the mechanism by which LPS primes IPL for enhanced production of thromboxane and pulmonary hypertension in response to PAF depends on specific upregulation of the PGHS-2 gene in the rabbit lung. LPS perfusion of IPL induced PGHS-2 gene expression, which correlated with the conversion of free arachidonic acid to thromboxane-B2 (TXB2) and the onset of pulmonary hypertension. LPS-induced PGHS-2 expression, TXB2 release, and pulmonary hypertension were inhibited by actinomycin D (an inhibitor of transcription) and cycloheximide (an inhibitor of protein synthesis). The constitutively expressed PGHS-1 remained unchanged with LPS perfusion, and did not convert free arachidonic acid to TXB2, suggesting that PGHS-1 does not contribute to the induction of pulmonary hypertension by LPS. These studies reveal a pathogenic role for induction of PGHS-2 in lung injury.

  4. Suppression of the Barley uroporphyrinogen III synthase Gene by a Ds Activation Tagging Element Generates Developmental Photosensitivity[W

    PubMed Central

    Ayliffe, Michael A.; Agostino, Anthony; Clarke, Bryan C.; Furbank, Robert; von Caemmerer, Susanne; Pryor, Anthony J.

    2009-01-01

    Chlorophyll production involves the synthesis of photoreactive intermediates that, when in excess, are toxic due to the production of reactive oxygen species (ROS). A novel, activation-tagged barley (Hordeum vulgare) mutant is described that results from antisense suppression of a uroporphyrinogen III synthase (Uros) gene, the product of which catalyzes the sixth step in the synthesis of chlorophyll and heme. In homozygous mutant plants, uroporphyrin(ogen) I accumulates by spontaneous cyclization of hydroxyl methylbilane, the substrate of Uros. Accumulation of this tetrapyrrole intermediate results in photosensitive cell death due to the production of ROS. The efficiency of Uros gene suppression is developmentally regulated, being most effective in mature seedling leaves compared with newly emergent leaves. Reduced transcript accumulation of a number of nuclear-encoded photosynthesis genes occurs in the mutant, even under 3% light conditions, consistent with a retrograde plastid-nuclear signaling mechanism arising from Uros gene suppression. A similar set of nuclear genes was repressed in wild-type barley following treatment with a singlet oxygen-generating herbicide, but not by a superoxide generating herbicide, suggesting that the retrograde signaling apparent in the mutant is specific to singlet oxygen. PMID:19336693

  5. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance

    PubMed Central

    Faulkes, Christopher G.; Davies, Kalina T. J.; Rossiter, Stephen J.; Bennett, Nigel C.

    2015-01-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan—a key constituent of the extracellular matrix—that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  6. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance.

    PubMed

    Faulkes, Christopher G; Davies, Kalina T J; Rossiter, Stephen J; Bennett, Nigel C

    2015-05-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan--a key constituent of the extracellular matrix--that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade.

  7. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  8. Identification, characterization and functional analysis of a chitin synthase gene in the brown citrus aphid, Toxoptera citricida (Hemiptera, Aphididae).

    PubMed

    Shang, F; Xiong, Y; Xia, W-K; Wei, D-D; Wei, D; Wang, J-J

    2016-08-01

    Chitin synthase (CHS) is a crucial enzyme involved in the final step of the insect chitin biosynthetic pathway. In this study, we cloned the full-length cDNA sequence of a chitin synthase gene (TCiCHS) from the brown citrus aphid, Toxoptera citricida, an important citrus pest and the main vector of citrus tristeza virus worldwide. TCiCHS was expressed during the entire lifecycle and in all insect tissues examined. Expression was highest in first-second-instar nymphs, nymph-adult transitions and in the abdomen (6.7-fold higher than head). Embryos had a higher expression level than the integument. Fourth-instar nymphs were exposed to 5 and 500 mg/l concentrations of the chitin synthesis inhibitor diflubenzuron (DFB) for 48 h and had the highest mortality at the 500 mg/l concentration. The mRNA expression levels of TCiCHS were significantly enhanced upon the exposure of nymphs to both low and high DFB concentrations. Silencing of TCiCHS occurred through plant-mediated double-stranded RNA (dsRNA) feeding. Most dsRNA-fed nymphs were unable to moult to the next stage, and the expression of TCiCHS decreased 48% compared with controls. These results demonstrate that TCiCHS plays an important role in nymph to adult development, is possibly help identify molecular targets for To. citricida control. PMID:26991909

  9. Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus

    PubMed Central

    Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

    2016-01-01

    Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5′ UTR and 3′ UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE–PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress. PMID:27786294

  10. Thymidylate synthase and methylenetetrahy-drofolate reductase gene polymorphisms and gastric cancer susceptibility in a population of Northern Brazil.

    PubMed

    Araújo, M D; Borges, B N; Rodrigues-Antunes, S; Burbano, R M R; Harada, M L

    2015-01-01

    The folate metabolic pathway, which is involved in DNA synthesis and methylation, is associated with individual susceptibility to several diseases, including gastric tumors. In this study, we investigated four polymorphisms [thymidylate synthase enhancer region, single nucleotide polymorphism thymidylate synthase 5' (TS5'), TS3' untranslated region, and methylenetetrahydrofolate reductase (MTHFR) 677C> T] in 2 genes related to the folate pathway, TS and MTHFR, and their possible association with the risk gastric cancer development in a population from Pará state, Brazil. For the TS enhancer region, TS3' untranslated region, and single nucleotide polymorphism TS5' polymorphisms, no significant results were obtained. For the MTHFR 677C>T polymorphism, TT genotype carriers had a higher risk of developing tumors in the antrum (P = 0.19 vs CC and P = 0.02 vs CT) and intestine (odds ratio = 4.18, 95% confidence interval = 0.66-26.41; P = 0.252 vs CC and odds ratio = 2.25, 95% confidence interval = 0.32-15.75; P = 0.725 vs CT). Those carrying at least 1 T allele had an increased risk of lymph node metastasis (odds ratio = 3.00, 95% confidence interval = 0.88-10.12; P = 0.133). Our results suggest that polymorphisms in MTHFR affect the susceptibility to gastric tumors in the Brazilian population and may be a factor causing poor prognosis in such patients. PMID:26345936

  11. A case of primary selective hypoaldosteronism carrying three mutations in the aldosterone synthase (Cyp11b2) gene.

    PubMed

    Taranta, Anna; Bizzarri, Carla; Masotti, Andrea; Sciré, Giuseppe; Pampanini, Valentina; Cappa, Marco

    2012-05-25

    An infant with a clinical phenotype of early onset hypoaldosteronism has been screened for mutation analysis of the Cyp11b2 gene encoding aldosterone synthase enzyme. We have described a novel nonsense mutation in exon 3 (c.508C>T) that gave rise to a shorter protein (Q170X) and two known concurrent missense mutations (c.594A>C in exon 3 and c.1157T>C in exon 7) that led to substitution of glutamic acid for aspartic acid at amino acid position 198 (E198D) and of valine for alanine at amino acid position 386 (V386A). The father, who carried E198D plus V386A mutations, showed a fractional sodium excretion of 1.25% that was unmodified by dietary salt restriction, suggesting a mild haploinsufficiency. We examined by in silico analysis the effect of the mutations on the secondary and tertiary structures of aldosterone synthase to explain the inefficient enzymatic activity. The Q170X mutation produced a truncated protein, which was consequently associated with a loss of catalytic activity. As predicted by JPred web system and Dock 6.3 software, the concurrent expression of E198D and V386A mutations induced a significant secondary structure rearrangement and a shift of the heme group and the 18-hydroxycorticosterone substrate from their optimal placement.

  12. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    PubMed

    Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

    2014-01-01

    Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

  13. Effect of nitric oxide on ethylene synthesis and softening of banana fruit slice during ripening.

    PubMed

    Cheng, Guiping; Yang, En; Lu, Wangjin; Jia, Yongxia; Jiang, Yueming; Duan, Xuewu

    2009-07-01

    The effects of nitric oxide (NO) on ethylene synthesis and softening of ripening-initiated banana slice were investigated. Fruit firmness, color, and contents of starch and acid-soluble pectin (ASP) were measured. In addition, ethylene production, 1-aminocyclopropane-1-carboxylic acid (ACC) content, expression and activities of ACC synthase (ACS) and ACC oxidase (ACO), and activities of cell-wall-modifying enzymes, polygalacturonase (PG), pectin methylesterase (PME), and endo-beta-1,4-glucanase, were analyzed. Application of NO reduced ethylene production, inhibited degreening of the peel and delayed softening of the pulp. The decrease of ethylene production was associated with the reduction in the activity of ACO and the expression of the MA-ACO1 gene. Moreover, the NO-treated fruit showed a lower expression of the MA-ACS1 gene but higher ACS activity and ACC content. In addition, NO treatment decreased the activities of PG, PME, and endo-beta-1,4-glucanase and maintained higher contents of ASP and starch, which may account for the delay of softening. We proposed that the inhibition of ACO activity and transcription of gene MA-ACO1 by NO resulted in decreased ethylene synthesis and the delay of ripening of banana slice. PMID:19534461

  14. Characterization of Ethylene Biosynthesis Associated with Ripening in Banana Fruit1

    PubMed Central

    Liu, Xuejun; Shiomi, Shinjiro; Nakatsuka, Akira; Kubo, Yasutaka; Nakamura, Reinosuke; Inaba, Akitsugu

    1999-01-01

    We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

  15. Ripening-associated ethylene biosynthesis in tomato fruit is autocatalytically and developmentally regulated

    PubMed Central

    Yokotani, Naoki; Nakano, Ryohei; Imanishi, Shunsuke; Nagata, Masayasu; Inaba, Akitsugu; Kubo, Yasutaka

    2009-01-01

    To investigate the regulatory mechanism(s) of ethylene biosynthesis in fruit, transgenic tomatoes with all known LeEIL genes suppressed were produced by RNA interference engineering. The transgenic tomato exhibited ethylene insensitivity phenotypes such as non-ripening and the lack of the triple response and petiole epinasty of seedlings even in the presence of exogenous ethylene. Transgenic fruit exhibited a low but consistent increase in ethylene production beyond 40 days after anthesis (DAA), with limited LeACS2 and LeACS4 expression. 1-Methylcyclopropene (1-MCP), a potent inhibitor of ethylene perception, failed to inhibit the limited increase in ethylene production and expression of the two 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) genes in the transgenic fruit. These results suggest that ripening-associated ethylene (system 2) in wild-type tomato fruit consists of two parts: a small part regulated by a developmental factor through the ethylene-independent expression of LeACS2 and LeACS4 and a large part regulated by an autocatalytic system due to the ethylene-dependent expression of the same genes. The results further suggest that basal ethylene (system 1) is less likely to be involved in the transition to system 2. Even if the effect of system 1 ethylene is eliminated, fruit can show a small increase in ethylene production due to unknown developmental factors. This increase would be enough for the stimulation of autocatalytic ethylene production, leading to fruit ripening. PMID:19605457

  16. Cloning and Characterization of a Flavonol Synthase Gene from Scutellaria baicalensis

    PubMed Central

    Kim, Yeon Bok; Kim, KwangSoo; Kim, YeJi; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  17. Cloning and expression of sesquiterpene synthase genes from lettuce (Lactuca sativa L.).

    PubMed

    Bennett, Mark H; Mansfield, John W; Lewis, Mervyn J; Beale, Michael H

    2002-06-01

    Sesquiterpenoid lactones (SLs) from lettuce (Lactuca sativa L.) include constitutive components of latex such as lactucin and the induced phytoalexin, lettucenin A. A redundant primer strategy was used to recover two full length cDNA clones (LTC1 and LTC2) encoding sesquiterpene synthases from a cDNA library derived from seedlings with the red spot disorder, which accumulate phytoalexins. Recombinant enzymes produced from LTC1 and LTC2 in Escherichia coli catalysed the cyclisation of farnesyl diphosphate to germacrene A, potentially an early step in the biosynthesis of SLs. RT-PCR analysis showed LTC1 and LTC2 were expressed constitutively in roots, hypocotyls and true leaves but not in cotyledons. Expression in cotyledons was induced by challenge with the downy mildew pathogen Bremia lactucae in the disease resistant cultivar Diana. Southern hybridisation experiments showed that LTC1 and LTC2 were not part of a multigene family. The germacrene A synthases provide targets for modified expression to generate beneficial modifications to the SL profile in lettuce. PMID:12031443

  18. Expression of the inducible nitric oxide synthase gene in diaphragm and skeletal muscle.

    PubMed

    Thompson, M; Becker, L; Bryant, D; Williams, G; Levin, D; Margraf, L; Giroir, B P

    1996-12-01

    Nitric oxide (NO) is a pluripotent molecule that can be secreted by skeletal muscle through the activity of the neuronal constitutive isoform of NO synthase. To determine whether skeletal muscle and diaphragm might also express the macrophage-inducible form of NO synthase (iNOS) during provocative states, we examined tissue from mice at serial times after intravenous administration of Escherichia coli endotoxin. In these studies, iNOS mRNA was strongly expressed in the diaphragm and skeletal muscle of mice 4 h after intravenous endotoxin and was significantly diminished by 8 h after challenge. Induction of iNOS mRNA was followed by expression of iNOS immunoreactive protein on Western immunoblots. Increased iNOS activity was demonstrated by conversion of arginine to citrulline. Immunochemical analysis of diaphragmatic explants exposed to endotoxin in vitro revealed specific iNOS staining in myocytes, in addition to macrophages and endothelium. These results may be important in understanding the pathogenesis of respiratory pump failure during septic shock, as well as skeletal muscle injury during inflammation or metabolic stress.

  19. Cloning and characterization of a flavonol synthase gene from Scutellaria baicalensis.

    PubMed

    Kim, Yeon Bok; Kim, KwangSoo; Kim, Yeji; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  20. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum.

    PubMed

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-08-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase.

  1. Sequence variation of chalcone synthase gene in a spontaneous white-flower mutant of Chinese cabbage-pak-choi.

    PubMed

    Jiang, Ming; Cao, Jiashu

    2008-12-01

    A spontaneous white-flower mutant of Chinese cabbage-pak-choi (Brassica campestris ssp. chinenesis, syn. B. rapa ssp. chinenesis) was found in our test fields, and all the plant characters except flower color were identical with wild type ones. We hypothesized that a mutational event had occurred in the gene coding for chalcone synthase (CHS), the key enzyme of flavonoid biosynthesis pathway. Two genes, later designated BcCHS and BcCHS-wf, were isolated from wild type and mutant Chinese cabbage-pak-choi, respectively, using gene-specific primer pairs. Comparison of the genomic sequences revealed two mutations in BcCHS-wf, both with A to G transitions, one at position +37 bp and the other at +970 bp. Both nucleotide substitutions occurred in AGA codes for arginine into GGA for glycin at residue +13 and into AGC coding for serine at residue +229, respectively. Homologous genes of BcCHS were isolated from another four cruciferous plants, though there were some differences among the genomic and deduced amino acid sequences, the mutation locus of the mutant, as we called it, were identical to the wild type Chinese cabbage-pak-choi.

  2. Saccharomyces cerevisiae has a single glutamate synthase gene coding for a plant-like high-molecular-weight polypeptide.

    PubMed Central

    Cogoni, C; Valenzuela, L; González-Halphen, D; Olivera, H; Macino, G; Ballario, P; González, A

    1995-01-01

    Purification of the glutamate synthase (GOGAT) enzyme from Saccharomyces cerevisiae showed that it is an oligomeric enzyme composed of three identical 199-kDa subunits. The GOGAT structural gene was isolated by screening a yeast genomic library with a yeast PCR probe. This probe was obtained by amplification with degenerate oligonucleotides designed from conserved regions of known GOGAT genes. The derived amino-terminal sequence of the GOGAT gene was confirmed by direct amino-terminal sequence analysis of the purified protein of 199 kDa. Northern (RNA) analysis allowed the identification of an mRNA of about 7 or 8 kb. An internal fragment of the GOGAT gene was used to obtain null GOGAT mutants completely devoid of GOGAT activity. The results show that S. cerevisiae has a single NADH-GOGAT enzyme, consisting of three 199-kDa monomers, that differs from the one found in prokaryotic microorganisms but is similar to those found in other eukaryotic organisms such as alfalfa. PMID:7836314

  3. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    PubMed Central

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  4. The significance and effect of tandem repeats within the Mycobacterium tuberculosis leuA gene on alpha-isopropylmalate synthase.

    PubMed

    Chanchaem, Wimon; Palittapongarnpim, Prasit

    2008-09-01

    The 57-bp tandem repeats located in the Mycobacterium tuberculosis leuA gene code for the alpha-isopropylmalate synthase (alpha-IPMS). It is unique to this pathogen. It was previously demonstrated that the leuA-coding sequence Rv3710, containing the tandem repeats, can be translated to an active alpha-IPMS. The objective of the present study was to investigate the significance and effect of the two 57-bp tandem repeats upon gene expression and the general properties of alpha-IPMS. The putative M. tuberculosis H37Rv leuA gene with and without the tandem repeats was cloned by PCR and expressed in an Escherichia coli host. The enzyme product was studied for general properties, comparing that from a native leuA gene containing two repeats and that from the 57-bp tandem repeats deletion mutant. Upon deletion of the two 57-bp tandem repeats, the expression level of leuA from M. tuberculosis H37Rv was comparable with that of the native form. The general properties of the two types of enzymes were similar. They were both functional with the same range of optimal temperature and optimal pH for activity and with similar enzyme stability. Deletion of the repeats had no detectable effect on leuA expression level or the general properties of the enzyme product. PMID:18647358

  5. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    PubMed Central

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-01-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  6. Prodigiosin induces the proapoptotic gene NAG-1 via glycogen synthase kinase-3beta activity in human breast cancer cells.

    PubMed

    Soto-Cerrato, Vanessa; Viñals, Francesc; Lambert, James R; Kelly, Julie A; Pérez-Tomás, Ricardo

    2007-01-01

    Prodigiosin (2-methyl-3-pentyl-6-methoxyprodigiosene) is a bacterial metabolite that has anticancer and antimetastatic properties. However, the molecular mechanisms responsible for these abilities are not fully understood. Gene expression profiling of the human breast cancer cell line MCF-7 treated with prodigiosin was analyzed by cDNA array technology. The majority of the significantly modified genes were related to apoptosis, cell cycle, cellular adhesion, or transcription regulation. The dramatic increase of the nonsteroidal anti-inflammatory drug-activated gene 1 (NAG-1) made this gene an interesting candidate regarding the possible mechanism by which prodigiosin induces cytotoxicity in MCF-7 cells. Our results show that prodigiosin triggers accumulation of the DNA-damage response tumor-suppressor protein p53 but that NAG-1 induction was independent of p53 accumulation. Moreover, prodigiosin caused AKT dephosphorylation and glycogen synthase kinase-3beta (GSK-3beta) activation, which correlated with NAG-1 expression. Prodigiosin-induced apoptosis was recovered by inhibiting GSK-3beta, which might be due, at least in part, to the blockade of the GSK-3beta-dependent up-regulation of death receptors 4 and 5 expression. These findings suggest that prodigiosin-mediated GSK-3beta activation is a key event in regulating the molecular pathways that trigger the apoptosis induced by this anticancer agent.

  7. Association between allelic variation at the Phytoene synthase 1 gene and yellow pigment content in the wheat grain.

    PubMed

    Zhang, W; Dubcovsky, J

    2008-03-01

    A better understanding of the genetic factors controlling grain yellow pigment content (GYPC) is important for both pasta (high GYPC) and bread wheat (low GYPC) quality improvement. Quantitative trait loci (QTL) for GYPC have been mapped repeatedly on the distal regions of chromosome arms 7AL and 7BL in wheat, and the Phytoene synthase 1 (PSY-1) gene located in this region has been proposed as a candidate gene. We show here that PSY-E1, the tall wheatgrass orthologue, is completely linked to differences in GYPC, and that selection for white endosperm mutants in recombinant lines carrying this gene resulted in the identification of a mutation in a conserved amino acid of PSY-E1. These results, together with the association between GYPC and allelic differences in PSY-1 in hexaploid wheat, suggest that this gene plays an important role in the determination of GYPC. However, a second white endosperm mutant previously mapped to chromosome arm 7EL showed no mutations in PSY-E1 suggesting the existence of additional gene(s) affecting GYPC in this chromosome region. This hypothesis was further supported by the mapping of QTL for GYPC on 7AL proximal to PSY-1 in a cross between pasta wheat varieties UC1113 and Kofa. Interestingly, the Kofa PSY-B1 allele showed unusually high levels of polymorphisms as a result of a conversion event involving the PSY-A1 allele. In summary, our results support the hypothesis that allelic differences in PSY-1 and at least one additional gene in the distal region of the long arm of homoeologous group 7L are associated with differences in GYPC. PMID:18193186

  8. A peculiar VNTR in the cystathionine β-synthase gene is a risk factor for Down Syndrome.

    PubMed

    Salemi, M; Barone, C; Romano, C; Salluzzo, M G; Giambirtone, M; Morale, M C; Calogero, A E; Grillo, L; Bosco, P; Romano, C

    2015-01-01

    In the present study, we analysed a 31bp variable number of tandem repeats (VNTR) of the cystathionine ß-synthase (CBS) gene in 427 subjects: 127 patients with Down syndrome (DS) and in 60 of their mothers; 172 age-and sex-matched controls and in 68 of their mothers. A significant statistical difference in the distribution of the 21 repeat allele was found comparing mothers of subjects with DS versus mothers of children without DS (χ2= 4.166; P = 0.0413; Table 2). Since CBS 21 repeats allele carriers show a decrease of CBS enzyme activity possibly leading to lower intracellular glutathione concentration, these results could be explained by a higher not disjunction probability of chromosome 21 in oocytes, due to poor antioxidative protection against reactive oxygen species (ROS) toxic activity.

  9. Production of a freeze-thaw-stable potato starch by antisense inhibition of three starch synthase genes.

    PubMed

    Jobling, Stephen A; Westcott, Roger J; Tayal, Akash; Jeffcoat, Roger; Schwall, Gerhard P

    2002-03-01

    The use of unmodified starches in frozen foods is severely limited by the undesirable textural changes that occur after freezing and thawing. Retrogradation of glucan chains leads to syneresis, a separation of the starch gel and water phases. Stabilization of the starch structure is normally achieved by chemical modification to prevent these changes from occurring. We have now created a freeze-thaw-stable potato starch by alteration of starch composition and structure by genetic modification. An amylose-free starch with short-chain amylopectin was produced by simultaneous antisense downregulation of three starch synthase genes. This starch is extremely freeze-thaw-stable and shows no syneresis even after five freeze-thaw cycles. The use of this starch has potential for environmental and consumer benefits because its production requires no chemical modification.

  10. Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC)

    PubMed Central

    Johnson, G.; Ayers, M.; McClure, S. C. C.; Richardson, S. E.; Tellier, R.

    2003-01-01

    Several Bartonella species have now been implicated as human pathogens. The recovery of these fastidious organisms in the clinical microbiology laboratory remains difficult, and current methods are still relatively insensitive. Thus, the bartonellae are good candidates for detection by PCR. We have developed a PCR assay which uses a single primer pair targeting the riboflavin synthase gene (ribC) and detected six Bartonella species that have been implicated in human disease, B. henselae, B. quintana, B. bacilliformis, B. clarridgeiae, B. elizabethae, and B. vinsonii subsp. berkhoffii. Species identification is achieved simply by restriction enzyme digestion of the amplicon. This PCR assay appears to be specific for the Bartonella genus because it failed to amplify DNA from several other bacterial species. PMID:12624031

  11. Overexpression of erg20 gene encoding farnesyl pyrophosphate synthase has contrasting effects on activity of enzymes of the dolichyl and sterol branches of mevalonate pathway in Trichoderma reesei.

    PubMed

    Piłsyk, Sebastian; Perlińska-Lenart, Urszula; Górka-Nieć, Wioletta; Graczyk, Sebastian; Antosiewicz, Beata; Zembek, Patrycja; Palamarczyk, Grażyna; Kruszewska, Joanna S

    2014-07-10

    The mevalonate pathway is the most diverse metabolic route resulting in the biosynthesis of at least 30,000 isoprenoid compounds, many of which, such as sterols or dolichols, are indispensable for living cells. In the filamentous fungus Trichoderma of major biotechnological interest isoprenoid metabolites are also involved in the biocontrol processes giving the mevalonate pathway an additional significance. On the other hand, little is known about genes coding for enzymes of the mevalonate pathway in Trichoderma. Here, we present cloning and functional analysis of the erg20 gene from Trichoderma reesei coding for farnesyl pyrophosphate (FPP) synthase (EC 2.5.1.10), an enzyme located at the branching point of the mevalonate pathway. Expression of the gene in a thermosensitive erg20-2 mutant of Saccharomyces cerevisiae impaired in the FPP synthase activity suppressed the thermosensitive phenotype. The same gene overexpressed in T. reesei significantly enhanced the FPP synthase activity and also stimulated the activity of cis-prenyltransferase, an enzyme of the dolichyl branch of the mevalonate pathway. Unexpectedly, the activity of squalene synthase from the other, sterol branch, was significantly decreased without, however, affecting ergosterol level.

  12. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    PubMed

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast. PMID:24951963

  13. Differential methylation of the gene encoding myo-inositol 3-phosphate synthase (Isyna1) in rat tissues

    PubMed Central

    Seelan, Ratnam S; Pisano, M Michele; Greene, Robert M; Casanova, Manuel F; Parthasarathy, Ranga N

    2011-01-01

    Aims Myo-inositol levels are frequently altered in several brain disorders. Myo-inositol 3-phosphate synthase, encoded by the Isyna1 gene, catalyzes the synthesis of myo-inositol in cells. Very little is known about the mechanisms regulating Isyna1 expression in brain and other tissues. In this study, we have examined the role of DNA methylation in regulating Isyna1 expression in rat tissues. Materials & methods Transfection analysis using in vitro methylated promoter constructs, Southern blot analysis of genomic DNA from various tissues digested with a methylation-sensitive enzyme and CpG methylation profiling of genomic DNA from different tissues were used to determine differential methylation of Isyna1 in tissues. Transfection analysis using plasmids harboring mutated CpG residues in the 5’-upstream region of Isyna1 was used to identify critical residues mediating promoter activity. Results The −700 bp to −500 bp region (region 1) of Isyna1 exhibited increased methylation in brain cortex compared with other tissues; it also exhibited sex-specific methylation differences between matched male and female brain cortices. Mutation analysis identified one CpG residue in region 1 necessary for promoter activity in neuronal cells. A tissue-specific differentially methylated region (T-DMR) was found to be localized between +450 bp and +650 bp (region 3). This DMR was comparatively highly methylated in spleen, moderately methylated in brain cortex and poorly methylated in testis, consistent with mRNA levels observed in these tissues. Conclusion Rat Isyna1 exhibits tissue-specific DNA methylation. Brain DNA was uniquely methylated in the 5’-upstream region and displayed gender specificity. A T-DMR was identified within the gene body of Isyna1. These findings suggest that Isyna1 is regulated, in part, by DNA methylation and that significant alterations in methylation patterns during development could have a major impact on inositol phosphate synthase expression in

  14. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    PubMed Central

    2012-01-01

    Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS), the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita). Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−)-(E)-β-caryophyllene (MrTPS1), (+)-germacrene A (MrTPS3), (E)-β-ocimene (MrTPS4) and (−)-germacrene D (MrTPS5). A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−)-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+)-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils. PMID:22682202

  15. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    PubMed Central

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS) that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS). The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3), functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP), while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP) and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP). Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes. PMID:25784918

  16. Anthropogenic increase in carbon dioxide compromises plant defense against invasive insects

    SciTech Connect

    Zavala, J.; Casteel, C.; DeLucia, E.; Berenbaum, M.

    2008-04-01

    Elevated levels of atmospheric carbon dioxide (CO{sub 2}), a consequence of anthropogenic global change, can profoundly affect the interactions between crop plants and insect pests and may promote yet another form of global change: the rapid establishment of invasive species. Elevated CO{sub 2} increased the susceptibility of soybean plants grown under field conditions to the invasive Japanese beetle (Popillia japonica) and to a variant of western corn rootworm (Diabrotica virgifera virgifera) resistant to crop rotation by down-regulating gene expression related to defense signaling [lipoxygenase 7 (lox7), lipoxygenase 8 (lox8), and 1-aminocyclopropane-1-carboxylate synthase (acc-s)]. The down-regulation of these genes, in turn, reduced the production of cysteine proteinase inhibitors (CystPIs), which are specific deterrents to coleopteran herbivores. Beetle herbivory increased CystPI activity to a greater degree in plants grown under ambient than under elevated CO{sub 2}. Gut cysteine proteinase activity was higher in beetles consuming foliage of soybeans grown under elevated CO{sub 2} than in beetles consuming soybeans grown in ambient CO{sub 2}, consistent with enhanced growth and development of these beetles on plants grown in elevated CO{sub 2}. These findings suggest that predicted increases in soybean productivity under projected elevated CO{sub 2} levels may be reduced by increased susceptibility to invasive crop pests.

  17. Ethylene-mediated enhancement of apical hook formation in etiolated Arabidopsis thaliana seedlings is gibberellin dependent.

    PubMed

    Vriezen, Wim H; Achard, Patrick; Harberd, Nicholas P; Van Der Straeten, Dominique

    2004-02-01

    Dark-grown Arabidopsis seedlings develop an apical hook by differential elongation and division of hypocotyl cells. This allows the curved hypocotyl to gently drag the apex, which is protected by the cotyledons, upwards through the soil. Several plant hormones are known to be involved in hook development, including ethylene, which causes exaggeration of the hook. We show that gibberellins (GAs) are also involved in this process. Inhibition of GA biosynthesis with paclobutrazol (PAC) prevented hook formation in wild-type (WT) seedlings and in constitutive ethylene response (ctr)1-1, a mutant that exhibits a constitutive ethylene response. In addition, a GA-deficient mutant (ga1-3) did not form an apical hook in the presence of the ethylene precursor 1-aminocyclopropane-1-carboxylate (ACC). Analysis of transgenic Arabidopsis seedlings expressing a green fluorescent protein (GFP)-repressor of ga1-3 (RGA) fusion protein suggested that ACC inhibits cell elongation in the apical hook by inhibition of GA signaling. A decreased feedback of GA possibly causes an induction of GA biosynthesis based upon the expression of genes encoding copalyl diphosphate synthase (CPS; GA1) and GA 2-oxidase (AtGA2ox1). Furthermore, expression of GASA1, a GA-response gene, suggests that differential cell elongation in the apical hook might be a result of differential GA-sensitivity.

  18. Multilayered Regulation of Ethylene Induction Plays a Positive Role in Arabidopsis Resistance against Pseudomonas syringae.

    PubMed

    Guan, Rongxia; Su, Jianbin; Meng, Xiangzong; Li, Sen; Liu, Yidong; Xu, Juan; Zhang, Shuqun

    2015-09-01

    Ethylene, a key phytohormone involved in plant-pathogen interaction, plays a positive role in plant resistance against fungal pathogens. However, its function in plant bacterial resistance remains unclear. Here, we report a detailed analysis of ethylene induction in Arabidopsis (Arabidopsis thaliana) in response to Pseudomonas syringae pv tomato DC3000 (Pst). Ethylene biosynthesis is highly induced in both pathogen/microbe-associated molecular pattern (PAMP)-triggered immunity and effector-triggered immunity (ETI), and the induction is potentiated by salicylic acid (SA) pretreatment. In addition, Pst actively suppresses PAMP-triggered ethylene induction in a type III secretion system-dependent manner. SA potentiation of ethylene induction is dependent mostly on MITOGEN-ACTIVATED PROTEIN KINASE6 (MPK6) and MPK3 and their downstream ACS2 and ACS6, two type I isoforms of 1-aminocyclopropane-1-carboxylic acid synthases (ACSs). ACS7, a type III ACS whose expression is enhanced by SA pretreatment, is also involved. Pst expressing the avrRpt2 effector gene (Pst-avrRpt2), which is capable of triggering ETI, induces a higher level of ethylene production, and the elevated portion is dependent on SALICYLIC ACID INDUCTION DEFICIENT2 and NONEXPRESSER OF PATHOGENESIS-RELATED GENE1, two key players in SA biosynthesis and signaling. High-order ACS mutants with reduced ethylene induction are more susceptible to both Pst and Pst-avrRpt2, demonstrating a positive role of ethylene in plant bacterial resistance mediated by both PAMP-triggered immunity and ETI.

  19. New Insights into the Protein Turnover Regulation in Ethylene Biosynthesis.

    PubMed

    Yoon, Gyeong Mee

    2015-07-01

    Biosynthesis of the phytohormone ethylene is under tight regulation to satisfy the need for appropriate levels of ethylene in plants in response to exogenous and endogenous stimuli. The enzyme 1-aminocyclopropane-1-carboxylic acid synthase (ACS), which catalyzes the rate-limiting step of ethylene biosynthesis, plays a central role to regulate ethylene production through changes in ACS gene expression levels and the activity of the enzyme. Together with molecular genetic studies suggesting the roles of post-translational modification of the ACS, newly emerging evidence strongly suggests that the regulation of ACS protein stability is an alternative mechanism that controls ethylene production, in addition to the transcriptional regulation of ACS genes. In this review, recent new insight into the regulation of ACS protein turnover is highlighted, with a special focus on the roles of phosphorylation, ubiquitination, and novel components that regulate the turnover of ACS proteins. The prospect of cross-talk between ethylene biosynthesis and other signaling pathways to control turnover of the ACS protein is also considered.

  20. MPK3/MPK6 are involved in iron deficiency-induced ethylene production in Arabidopsis

    PubMed Central

    Ye, Lingxiao; Li, Lin; Wang, Lu; Wang, Shoudong; Li, Sen; Du, Juan; Zhang, Shuqun; Shou, Huixia

    2015-01-01

    Iron (Fe) is an essential micronutrient that participates in various biological processes important for plant growth. Ethylene production induced by Fe deficiency plays important roles in plant tolerance to stress induced by Fe deficiency. However, the activation and regulatory mechanisms of 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) genes in this response are not clear. In this study, we demonstrated that Fe deficiency increased the abundance of ACS2, ACS6, ACS7, and ACS11 transcripts in both leaves and roots as well as the abundance of ACS8 transcripts in leaves and ACS9 transcripts in roots. Furthermore, we investigated the role of mitogen-activated protein kinase 3 and 6 (MPK3/MPK6)-regulated ACS2/6 activation in Fe deficiency-induced ethylene production. Our results showed that MPK3/MPK6 transcript abundance and MPK3/MPK6 phosphorylation are elevated under conditions of Fe deficiency. Furthermore, mpk3 and mpk6 mutants show a lesser induction of ethylene production under Fe deficiency and a greater sensitivity to Fe deficiency. Finally, in mpk3, mpk6, and acs2 mutants under conditions of Fe deficiency, induction of transcript expression of the Fe-deficiency response genes FRO2, IRT1, and FIT is partially compromised. Taken together, our results suggest that the MPK3/MPK6 and ACS2 are part of the Fe starvation-induced ethylene production signaling pathway. PMID:26579185

  1. Galactinol synthase gene of Coptis japonica is involved in berberine tolerance.

    PubMed

    Takanashi, Kojiro; Shitan, Nobukazu; Sugiyama, Akifumi; Kamimoto, Yoshihisa; Hamamoto, Masafumi; Iwaki, Tomoko; Takegawa, Kaoru; Yazaki, Kazufumi

    2008-02-01

    Many plant secondary metabolites show strong biological activities and are potentially also toxic to plants, while plants producing such active compounds are usually insensitive to their own metabolites, suggesting that they have species-specific detoxification mechanisms. In order to clarify the detoxification mechanism of alkaloids, we used cultured cells of Coptis japonica, which are capable of producing a yellow benzylisoquinoline alkaloid, berberine, and accumulate it in the vacuole. Unlike other plant cells that do not produce berberine, C. japonica shows strong tolerance to this alkaloid. We established a fission yeast strain that was sensitive to berberine and performed functional screening using a C. japonica cDNA library. One cDNA clone, which conferred clear berberine tolerance, encoded galactinol synthase (CjGolS). The possible role of CjGolS in berberine tolerance is discussed.

  2. Cloning and heterologous expression of Plasmodium ovale dihydrofolate reductase-thymidylate synthase gene

    PubMed Central

    Tirakarn, Srisuda; Riangrungroj, Pinpunya; Kongsaeree, Palangpon; Imwong, Mallika; Yuthavong, Yongyuth; Leartsakulpanich, Ubolsree

    2012-01-01

    Plasmodial bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) is a validated antimalarial drug target. In this study, expression of the putative dhfr-ts of Plasmodium ovale rescued the DHFR chemical knockout and a TS null bacterial strain, demonstrating its DHFR and TS catalytic functions. PoDHFR-TS was expressed in Escherichia coli BL21 (DE3) and affinity purified by Methotrexate Sepharose column. Biochemical and enzyme kinetics characterizations indicated that PoDHFR-TS is similar to other plasmodial enzymes, albeit with lower catalytic activity but better tolerance of acidic pH. Importantly, the PoDHFR from Thai isolate EU266602 remains sensitive to the antimalarials pyrimethamine and cycloguanil, in contrast to P. falciparum and P. vivax isolates where resistance to these drugs is widespread. PMID:22234170

  3. Structure Conservation and Differential Expression of Farnesyl Diphosphate Synthase Genes in Euphorbiaceous Plants

    PubMed Central

    Guo, Dong; Li, Hui-Liang; Peng, Shi-Qing

    2015-01-01

    Farnesyl diphosphate synthase (FPS) is a key enzyme of isoprenoids biosynthesis. However, knowledge of the FPSs of euphorbiaceous species is limited. In this study, ten FPSs were identified in four euphorbiaceous plants. These FPSs exhibited similar exon/intron structure. The deduced FPS proteins showed close identities and exhibited the typical structure of plant FPS. The members of the FPS family exhibit tissue expression patterns that vary among several euphorbiaceous plant species under normal growth conditions. The expression profiles reveal spatial and temporal variations in the expression of FPSs of different tissues from Euphorbiaceous plants. Our results revealed wide conservation of FPSs and diverse expression in euphorbiaceous plants during growth and development. PMID:26389894

  4. Transforming growth factor beta differentially modulates the inducible nitric oxide synthase gene in distinct cell types.

    PubMed

    Gilbert, R S; Herschman, H R

    1993-08-31

    Nitric oxide is a mediator of paracrine cell signalling. An inducible form of nitric oxide synthase (iNOS) is expressed in macrophages and in Swiss 3T3 cells. Transforming growth factor beta (TGF-beta) is a cytokine that modulates many cellular functions. We find that TGF-beta cannot induce iNOS mRNA expression, either in macrophage cell lines or in Swiss 3T3 cells. However, TGF-beta attenuates lipopolysaccharide induction of iNOS mRNA in macrophages. In contrast, TGF-beta enhances iNOS induction by phorbol ester, serum or lipopolysaccharide in 3T3 cells. Thus TGF-beta can inhibit or augment iNOS mRNA induction in response to primary inducers, depending on the cell type in question.

  5. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  6. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation.

  7. The orphan nuclear receptor, steroidogenic factor 1, regulates neuronal nitric oxide synthase gene expression in pituitary gonadotropes.

    PubMed

    Wei, Xueying; Sasaki, Masayuki; Huang, Hui; Dawson, Valina L; Dawson, Ted M

    2002-12-01

    Steroidogenic factor 1 (SF-1), an essential nuclear receptor, plays key roles in steroidogenic cell function within the adrenal cortex and gonads. It also contributes to reproductive function at all three levels of the hypothalamic-pituitary-gonadal axis. SF-1 regulates genes in the steroidogenic pathway, such as LHbeta, FSHbeta, and steroid hydroxylase. Abundant evidence suggests that nitric oxide (NO) has an important role in the control of reproduction due to its ability to control GnRH secretion from the hypothalamus and the preovulatory LH surge in pituitary gonadotropes. Recently, we cloned and characterized the promoter of mouse neuronal NO synthase (nNOS). nNOS is localized at all three levels of the hypothalamic-pituitary-gonadal axis to generate NO. We find that its major promoter resides at exon 2 in the pituitary gonadotrope alphaT3-1 cell line and that there is a nuclear hormone receptor binding site in this region, to which SF-1 can bind and regulate nNOS transcription. Mutation of the nuclear hormone receptor binding site dramatically decreases basal promoter activity and abolishes SF-1 responsiveness. A dominant negative of SF-1, in which the transactivation (AF-2) domain of SF-1 was deleted, inhibits nNOS exon 2 promoter activity. Dosage-sensitive reversal- adrenal hypoplasia congenita critical region on the X chromosome, gene 1 (DAX-1), which colocalizes and interferes with SF-1 actions in multiple cell lineages, negatively modulates SF-1 regulation of nNOS transcription. These findings demonstrate that mouse nNOS gene expression is regulated by the SF-1 gene family in pituitary gonadotropes. nNOS, a member of the cytochrome p450 gene family, could be one of the downstream effector genes, which mediates SF-1's reproductive function and developmental patterning.

  8. Evolution and Functional Insights of Different Ancestral Orthologous Clades of Chitin Synthase Genes in the Fungal Tree of Life

    PubMed Central

    Li, Mu; Jiang, Cong; Wang, Qinhu; Zhao, Zhongtao; Jin, Qiaojun; Xu, Jin-Rong; Liu, Huiquan

    2016-01-01

    Chitin synthases (CHSs) are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III) was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc) identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene family in the fungal

  9. Epistatic interaction and functional compensation between the two tissue- and cell-specific sucrose synthase genes in maize.

    PubMed Central

    Chourey, P S; Taliercio, E W

    1994-01-01

    A tissue-specific epistatic mode of gene interaction was observed between molecularly homologous genes Sh1 and Sus1 (hereafter, Sh and Sus), encoding the sucrose synthase (SS) isozymes, SS1 and SS2, respectively. In Sh Sus genotype, both SS genes were expressed simultaneously and approximately equally in young seedlings; however, only the Sus-encoded SS2 protein was seen in the developing embryos. By contrast, the mutant sus genotype, lacking detectable levels of the SS2 protein in various tissues tested, showed expression of the Sh locus as judged by the detection of the SS1 protein in such embryos. Ectopic expression in embryos was seen from two separate Sh alleles, Sh-W22 and Sh'-5 (a revertant allele derived upon Ds excision from sh-m5933). In each case, the Sh expression at the protein level in embryos was unique to genotypes with the mutant sus gene. Based on the observed lack of phenotypic change in the sus mutant, we suggest that the ectopic expression of the Sh in otherwise Sus-specific tissues leads to functional compensation. There was no epistatic interaction of Sh and Sus at the RNA level as SS1 transcripts were detectable in both Sus and sus embryos. Thus, embryo specificity between the two SS genes was determined at posttranscriptional or at translational level of control. We surmise on the basis of these data that metabolic regulatory controls seem to override the normal constraints of tissue and cell specificity of the nonallelic isozyme genes to maintain efficient use of the pathways. Images PMID:8058735

  10. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI) gene detected in Acinetobacter baumannii

    PubMed Central

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Mansouri, Shahla

    2016-01-01

    Background and Objectives: In present study we aimed to clone the luxI gene encoding N-acyl-homoserine synthase detected in clinical isolates of Acinetobacter baumannii and study its expression in Escherichia coli transformants. Materials and Methods: Four A. baumannii hospital strains which demonstrated strong biofilm activity were selected in this investigation. The presence of luxI gene was detected using PCR technique. Purified PCR product DNA was initially cloned into pTG19 and transformed to E. coli DH5α. The gene was then recovered from agarose gel and ligated by T4 DNA ligase into pET28a expression vector using NdeI and XhoI enzymes. pET28a + luxI was transformed into E. coli BL21 (DE3). The luxI putative gene was further detected in the transformants by colony PCR. Expression of the luxI gene in the recombinant E. coli BL21 cells was studied by quantitative real time PCR (qRT-PCR) and the presence of N-acylhomoserine lactone (AHL) was checked by colorimetric assay and Fourier Transform Infra-Red (FT-IR) spectroscopy. Results: We successfully cloned AHL gene from A. baumannii strain 23 to pET28a expression vector. There was four fold increases in expression of luxI in the transformants (P ≤ 0.05). It was found that, strain 23 and the transformants showed highest amount of AHL activity (OD = 1.524). The FT-IR analysis indicated stretching C=O bond of the lactone ring and primary amides (N=H) at 1764.69 cm−1 and 1659.23 cm−1 respectively. Conclusion: From above results we concluded that, luxI in A. baumannii is indeed responsible for AHL production and not regulation and pET28a vector allows efficient AHL expression in E. coli BL21 transformants. PMID:27307980

  11. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  12. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  13. Bioinformatic comparisons and tissue expression of the neuronal nitric oxide synthase (nNOS) gene from the red drum (Sciaenops ocellatus).

    PubMed

    Zhou, Libin; Bai, Ru; Tian, Jianxiao; Liu, Xiaochun; Lu, Danqi; Zhu, Pei; Liu, Yun; Zeng, Lujiao; Luo, Wenna; Zhang, Yong; Wang, Anli

    2009-10-01

    The full length cDNA sequence for neuronal nitric oxide synthase (nNOS) gene from red drum (Sciaenops ocellatus) has been cloned, subjected to bioinformatic analysis, and examined for expression in different tissues. Red drum nNOS showed high identity to nNOS of mammals and other fish species. Notably, a unique 7-aa insertion was found in the important catalytic sites of the NO synthase domain, possibly affecting the function of red drum nNOS. Furthermore, this nNOS was expressed not only in brain but also in most of the internal organs including liver, intestine, spleen, head kidney and thymus. PMID:19647082

  14. Increase in the astaxanthin synthase gene (crtS) dose by in vivo DNA fragment assembly in Xanthophyllomyces dendrorhous

    PubMed Central

    2013-01-01

    Background Xanthophyllomyces dendrorhous is a basidiomycetous yeast that is relevant to biotechnology, as it can synthesize the carotenoid astaxanthin. However, the astaxanthin levels produced by wild-type strains are low. Although different approaches for promoting increased astaxanthin production have been attempted, no commercially competitive results have been obtained thus far. A promising alternative to facilitate the production of carotenoids in this yeast involves the use of genetic modification. However, a major limitation is the few available molecular tools to manipulate X. dendrorhous. Results In this work, the DNA assembler methodology that was previously described in Saccharomyces cerevisiae was successfully applied to assemble DNA fragments in vivo and integrate these fragments into the genome of X. dendrorhous by homologous recombination in only one transformation event. Using this method, the gene encoding astaxanthin synthase (crtS) was overexpressed in X. dendrorhous and a higher level of astaxanthin was produced. Conclusions This methodology could be used to easily and rapidly overexpress individual genes or combinations of genes simultaneously in X. dendrorhous, eliminating numerous steps involved in conventional cloning methods. PMID:24103677

  15. Functional characterization of the three genes encoding 1-deoxy-D-xylulose 5-phosphate synthase in maize.

    PubMed

    Cordoba, Elizabeth; Porta, Helena; Arroyo, Analilia; San Román, Carolina; Medina, Luis; Rodríguez-Concepción, Manuel; León, Patricia

    2011-03-01

    The 1-deoxy-D-xylulose 5-phosphate synthase (DXS) enzyme catalyses the first biosynthetic step of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. In plants the MEP pathway is involved in the synthesis of the common precursors to the plastidic isoprenoids, isopentenyl diphosphate and dimethylallyl diphosphate, in plastids. DXS is recognized as limiting this pathway and is a potential target for manipulation to increase various isoprenoids such as carotenoids. In Zea mays three dxs genes exist that encode plastid-targeted functional enzymes. Evidence is provided that these genes represent phylogenetically distinctive clades conserved among plants preceding monocot-dicot divergence. There is differential accumulation for each dxs gene transcript, during development and in response to external signals such as light. At the protein level, the analysis demonstrates that in Z. mays, DXS protein is feedback regulated in response to the inhibition of the pathway flow. The results support that the multilevel regulation of DXS activity is conserved in evolution.

  16. Molecular cloning and functional characterization of Catharanthus roseus hydroxymethylbutenyl 4-diphosphate synthase gene promoter from the methyl erythritol phosphate pathway.

    PubMed

    Ginis, Olivia; Courdavault, Vincent; Melin, Céline; Lanoue, Arnaud; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Courtois, Martine; Oudin, Audrey

    2012-05-01

    The Madagascar periwinkle produces monoterpenoid indole alkaloids (MIA) of high interest due to their therapeutical values. The terpenoid moiety of MIA is derived from the methyl erythritol phosphate (MEP) and seco-iridoid pathways. These pathways are regarded as the limiting branch for MIA biosynthesis in C. roseus cell and tissue cultures. In previous studies, we demonstrated a coordinated regulation at the transcriptional and spatial levels of genes from both pathways. We report here on the isolation of the 5'-flanking region (1,049 bp) of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene from the MEP pathway. To investigate promoter transcriptional activities, the HDS promoter was fused to GUS reporter gene. Agrobacterium-mediated transformation of young tobacco leaves revealed that the cloned HDS promoter displays a tissue-specific GUS staining restricted to the vascular region of the leaves and limited to a part of the vein that encompasses the phloem in agreement with the previous localization of HDS transcripts in C. roseus aerial organs. Further functional characterizations in stably or transiently transformed C. roseus cells allowed us to identify the region that can be consider as the minimal promoter and to demonstrate the induction of HDS promoter by several hormonal signals (auxin, cytokinin, methyljasmonate and ethylene) leading to MIA production. These results, and the bioinformatic analysis of the HDS 5'-region, suggest that the HDS promoter harbours a number of cis-elements binding specific transcription factors that would regulate the flux of terpenoid precursors involved in MIA biosynthesis.

  17. Analysis of 6-pyruvyl tetrahydropterin synthase, a target gene product of su(s) suppressor in Drosophila

    SciTech Connect

    Yim, J.J.; Park, Y.S.; Kim, J.H.; Jacobson, K.B. . Dept. of Microbiology; Oak Ridge National Lab., TN )

    1989-01-01

    Of the 20 suppressor mutants listed in Drosophila, su(s){sup 2} has been studied for the biochemical characterization of the suppression. In su(s){sup 2} suppression, some mutants at vermilion (v, 1-33.0), sable (s, 1-43.0), speck (sp, 2-107.0), and purple (pr, 2-54.5) are suppressible by mutants at the suppressor of sable (su(s)) locus. There have been many reports of suppression mechanism studies in purple led to purple loci. The biochemical studies in purple led to in vitro demonstration of a su(s){sup +} gene product as a negative effector against suppressed purple PPH{sub 4} synthase, which has been also demonstrated in the gene product of vermilion more recently. Both studies led to a proposal for a posttranslational mechanism in which the su(s){sup +} gene produces a substance that interferes with the function of the target enzymes from the purple and vermilion mutant. In contrast to the transcriptional regulation of the su(s) locus the posttranslational mechanism is based on qualitative differences between wild and suppressed enzyme. Therefore this investigation was to determine if any quantitative or qualitative differences exist between the mutant and wild type target enzymes. 7 refs., 4 figs.

  18. Expression pattern of (+)-delta-cadinene synthase genes and biosynthesis of sesquiterpene aldehydes in plants of Gossypium arboreum L.

    PubMed

    Tan, X P; Liang, W Q; Liu, C J; Luo, P; Heinstein, P; Chen, X Y

    2000-03-01

    The cotton (+)-delta-cadinene synthase, a sesquiterpene cyclase, is encoded by a complex gene family which, based on homology, can be divided into two subfamilies: cad1-A and cad1-C. Southern blots revealed several members of the cad1-C subfamily, and a single member of the cad1-A subfamily, in the diploid Gossypium arboreum genome. One of the cad1-C genes, cad1-C3, was isolated from this species. According to reverse transcriptase-polymerase chain reaction, transcripts of both cad1-C and cad1-A genes appeared in roots from the second day post germination and in 1-d-old cotyledons, whereas the transcription levels were too low to be detected in the hypocotyls. Initially, sesquiterpene cyclase activities were found to be high in the seedlings, then dropped in aerial organs but increased in roots during development. Sesquiterpene aldehyde contents followed the same pattern. In fully developed plants, the transcripts of cad1-C were detected in stems, leaves and pericarps, as well as in the sepals and petals 3 d before anthesis, but not at the day of anthesis. In contrast, cad1-A transcripts were not detected in any of these aerial organs. The sesquiterpene aldehyde contents increased in petals but decreased in sepals after anthesis. Treatment of G. arboreum stems with a Verticillium dahliae elicitor-preparation activated cad1-A transcription, but a significant level of cad1-C transcripts was detected both before and after elicitation. In G. hirsutum cv. GL-5, a glandless cultivar, the cad1-C gene was activated by the same fungal elicitor, followed by the synthesis of the sesquiterpene cyclase, and accumulation of sesquiterpene aldehydes. The cad1 gene expression during development and in response to elicitation, as well as the spatial and temporal pattern of sesquiterpene biosynthesis, constitute a chemical defense machinery in cotton plants. PMID:10787059

  19. Endothelial nitric oxide synthase gene intron 4, 27 bp repeat polymorphism and essential hypertension in the Kazakh Chinese population.

    PubMed

    Deng, Fengmei; Hu, Qinghua; Tang, Bin; He, Fang; Guo, Shuxia; Chen, Jiang; Li, Feng; Wu, Xuehua; Zhang, Jun; Zhang, Huimin; Zhao, Juan; Zhong, Hua; He, Ling; Li, Jun; Zhang, Le; Wang, Shuren

    2007-05-01

    To investigate the relationship between 27 bp repeat polymorphism in intron 4 in the endothelial nitric oxide synthase (eNOS4) gene and essential hypertension in the Kazakh Chinese population, 151 patients with essential hypertension and 138 healthy people were selected from the Boertonggu countryside of Shawan region in the Xinjiang uygur autonomous region of China in 2006. The polymorphism of eNOS in the two groups was detected with polymerase chain reaction assays and the genotype frequencies in each group were calculated following the Hardy-Weinberg law. Four and five tandem 27 bp repeats were designated as "a" and "b", respectively. It was found that the frequencies of b/b, b/a and a/a genotypes of the eNOS4 gene were 84.06%, 15.22% and 0.72% in the control group, and 81.46%, 15.89% and 2.65% in the hypertension group, respectively. The frequencies of gene "a" and "b" were 91.67% and 8.33% in the control group and 89.40% and 10.60% in the hypertension group, respectively. It was found that plasma eNOS activity was not associated with genotypes and alleles of eNOS gene. Plasma eNOS activity in the hypertension group was significantly decreased compared with the control group (P<0.01). The results suggest that eNOS4 gene polymorphisms are unlikely to be the major genetic susceptibility factors for essential hypertension in the Xinjiang Kazakh population. However, a positive association between plasma eNOS activity and essential hypertension has been revealed. PMID:17492127

  20. Cloning of the Nocardia corallina polyhydroxyalkanoate synthase gene and production of poly-(3-hydroxybutyrate-co-3-hydroxyhexanoate) and poly-(3-hydroxyvalerate-co-3-hydroxyheptanoate).

    PubMed

    Hall, B; Baldwin, J; Rhie, H G; Dennis, D

    1998-07-01

    The polyhydroxyalkanoate (PHA) synthase gene (phaCNc) from Nocardia corallina was identified in a lambda library on a 6-kb BamHI fragment. A 2.8-kb XhoII subfragment was found to contain the intact PHA synthase. This 2.8-kb fragment was subjected to DNA sequencing and was found to contain the coding region for the PHA synthase and a small downstream open reading frame of unknown function. On the basis of DNA sequence, phaCNc is closest in homology to the PHA synthases (phaCPaI and phaCPaII) of Pseudomonas aeruginosa (approximately 41% identity and 55% similarity). The 2.8-kb XhoII fragment containing phaCNc was subcloned into broad host range mobilizable plasmids and transferred into Escherichia coli, Klebsiella aerogenes (both containing a plasmid bearing phaA and phaB from Ralstonia eutropha), and PHA-negative strains of R. eutropha and Pseudomonas putida. The recombinant strains were grown on various carbon sources and the resulting polymers were analyzed. In these strains, the PHA synthase from N. corallina was able to mediate the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) containing high levels of 3-hydroxyhexanoate when grown on hexanoate and larger even-chain fatty acids and poly(3-hydroxyvalerate-co-3-hydroxyheptanoate) containing high levels of 3-hydroxyheptanoate when grown on heptanoate or larger odd-chain fatty acids.

  1. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    PubMed Central

    Vasudevan, R; Ismail, P; Jaafar, NI; Mohamad, NA; Etemad, E; Wan Aliaa, WS; Eshkor, S

    2014-01-01

    The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR) polymorphism of the endothelial nitric oxide synthase (eNOS) gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R) in Malaysian end-stage renal disease (ESRD) subjects. A total of 150 ESRD patients were recruited from the National Kidney Foundation’s (NKF)dialysis centers in Malaysia and compared with 150 normal healthy individuals. Genomic DNA was extracted from buccal cells of all the subjects. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was carried out to amplify the products and the restricted fragments were separated by agarose gel electrophoresis. Statistical analyses were carried out using software where a level of p <0.05 was considered to be statistically significant. The genotypic and allelic frequencies of the B2R gene (c.181C>T, 4b/a) and eNOS gene (c.894G>T) polymorphisms were not statistically significant (p >0.05) when compared to the control subjects. The B2R and eNOS gene polymorphisms may not be considered as genetic susceptibility markers for Malaysian ESRD subjects. PMID:25741213

  2. Analysis of human bradykinin receptor gene and endothelial nitric oxide synthase gene polymorphisms in end-stage renal disease among malaysians.

    PubMed

    Vasudevan, R; Ismail, P; Jaafar, Ni; Mohamad, Na; Etemad, E; Wan Aliaa, Ws; Eshkor, S

    2014-06-01

    The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR) polymorphism of the endothelial nitric oxide synthase (eNOS) gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R) in Malaysian end-stage renal disease (ESRD) subjects. A total of 150 ESRD patients were recruited from the National Kidney Foundation's (NKF)dialysis centers in Malaysia and compared with 150 normal healthy individuals. Genomic DNA was extracted from buccal cells of all the subjects. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was carried out to amplify the products and the restricted fragments were separated by agarose gel electrophoresis. Statistical analyses were carried out using software where a level of p <0.05 was considered to be statistically significant. The genotypic and allelic frequencies of the B2R gene (c.181C>T, 4b/a) and eNOS gene (c.894G>T) polymorphisms were not statistically significant (p >0.05) when compared to the control subjects. The B2R and eNOS gene polymorphisms may not be considered as genetic susceptibility markers for Malaysian ESRD subjects. PMID:25741213

  3. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity.

  4. Molecular cloning and differential expression analysis of a squalene synthase gene from Dioscorea zingiberensis, an important pharmaceutical plant.

    PubMed

    Ye, Yun; Wang, Runfa; Jin, Liang; Shen, Junhao; Li, Xiaotong; Yang, Ting; Zhou, Mengzhuo; Yang, Zhifan; Chen, Yongqin

    2014-09-01

    Diosgenin is a steroid derived from cholesterol in plants and used as a typical initial intermediate for synthesis of numerous steroidal drugs in the world. Commercially, this compound is extracted mainly from the rhizomes or tubers of some Dioscorea species. Squalene synthase (SQS: EC 2.5.1.21) catalyzes the condensation of two molecules of farnesyl diphosphate to form squalene, the first committed step for biosynthesis of plant sterols including cholesterol, and is thought to play an important role in diosgenin biosynthesis. A full-length cDNA of a putative squalene synthase gene was cloned from D. zingiberensis and designated as DzSQS (Genbank Accession Number KC960673). DzSQS was contained an open reading frame of 1,230 bp encoding a polypeptide of 409 amino acids with a predicted molecular weight of 46 kDa and an isoelectric point of 6.2. The deduced amino acid sequence of DzSQS shared over 70 % sequence identity with those of SQSs from other plants. The truncated DzSQS in which 24 amino acids were deleted from the carboxy terminus was expressed in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. Quantitative real-time PCR analysis revealed that DzSQS was expressed from highest to lowest order in mature leaves, newly-formed rhizomes, young leaves, young stems, and two-year-old rhizomes of D. zingiberensis.

  5. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea.

    PubMed

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  6. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger