Science.gov

Sample records for 10 promoter element

  1. Escherichia coli RNA polymerase contacts outside the -10 promoter element are not essential for promoter melting.

    PubMed

    Niedziela-Majka, Anita; Heyduk, Tomasz

    2005-11-18

    We examined the relative affinity of model promoter constructs for binding Escherichia coli RNA polymerase (RNAP) holoenzyme. Model promoter constructs were designed to mimic DNA structures characteristic for different steps of transcription initiation. DNA duplexes in which a chemical cross-link was introduced just downstream from -10 hexamer to prevent DNA melting upon RNAP binding were used to mimic RNAP-promoter contacts in a closed complex. Fork junction DNA molecules with double-stranded/single-stranded junction between -11 and -10 position were used to study interactions of RNA polymerase with DNA in open complex. The -35 and -10 promoter regions were found to be equally important for the initial RNAP binding. The recognition of -35 promoter region was independent of structural context of the model promoter fragment. In contrast, free energy of RNAP binding to -10 hexamer was highly dependent on DNA structure. The relative importance of -10 region for sequence-specific interaction with the polymerase was the lowest for constructs mimicking closed complex and the highest for the constructs mimicking open complex. The relative importance of region -10 was also dependent on the presence of -35 consensus element indicating a communication between different DNA binding determinants of polymerase during open complex formation. Short double-stranded promoter fragments comprising only -35 and -10 or only -10 consensus elements underwent melting in a complex with polymerase indicating that the core of promoter melting activity of the polymerase is localized to a very small subset of all promoter-polymerase contacts. PMID:16169843

  2. Structural Basis for Promoter ;#8722;10 Element Recognition by the Bacterial RNA Polymerase [sigma] Subunit

    SciTech Connect

    Feklistov, Andrey; Darst, Seth A.

    2011-12-15

    The key step in bacterial promoter opening is recognition of the -10 promoter element (T-{sub 12}A-{sub 11}T-{sub 10}A-{sub 9}A-{sub 8}T{sub -7} consensus sequence) by the RNA polymerase {alpha} subunit. We determined crystal structures of {alpha} domain 2 bound to single-stranded DNA bearing -10 element sequences. Extensive interactions occur between the protein and the DNA backbone of every -10 element nucleotide. Base-specific interactions occur primarily with A{sub -11} and T{sub -7}, which are flipped out of the single-stranded DNA base stack and buried deep in protein pockets. The structures, along with biochemical data, support a model where the recognition of the -10 element sequence drives initial promoter opening as the bases of the nontemplate strand are extruded from the DNA double-helix and captured by {alpha}. These results provide a detailed structural basis for the critical roles of A{sub -11} and T{sub -7} in promoter melting and reveal important insights into the initiation of transcription bubble formation.

  3. Structural basis for promoter10 element recognition by the bacterial RNA polymerase σ subunit

    PubMed Central

    Feklistov, Andrey; Darst, Seth A.

    2011-01-01

    SUMMARY The key step in bacterial promoter opening is recognition of the -10 promoter element (T-12A-11T-10A-9A-8T-7 consensus sequence) by the RNA polymerase σ subunit. We determined crystal structures of σ domain 2 bound to single-stranded DNA bearing -10 element sequences. Extensive interactions occur between the protein and the DNA backbone of every -10 element nucleotide. Base-specific interactions occur primarily with A-11, and T-7, which are flipped out of the single-stranded DNA base-stack and buried deep in protein pockets. The structures, along with biochemical data, support a model where the recognition of the -10 element sequence drives initial promoter opening as the bases of the non-template strand are extruded from the DNA double-helix and captured by σ. These results provide a detailed structural basis for the critical roles of A-11 and T-7 in promoter melting, and reveal important insights into the initiation of transcription bubble formation. PMID:22136875

  4. Identification of an unknown promoter, OUTIIp, within the IS10R element.

    PubMed

    Martínez-García, Esteban; Navarro-Lloréns, Juana María; Tormo, Antonio

    2003-03-01

    A novel promoter in IS10R (OUTIIp) has been found in one of its ends in an inverted position relative to promoter pOUT. OUTIIp shows characteristics similar to those of rpoS-dependent promoters such as a gearbox expression pattern. It is under catabolite repression and positively regulated by ppGpp or conditioned media. This opens new challenges in IS10R transposition. PMID:12618473

  5. The Borrelia burgdorferi flaB promoter has an extended -10 element and includes a T-rich -35/-10 spacer sequence that is essential for optimal activity

    PubMed Central

    Gautam, Aarti; Hathaway, Marianne; Ramamoorthy, Ramesh

    2009-01-01

    In this study, we investigated the functional elements of the flaB promoter of Borrelia burgdorferi. Promoter function was examined in a high-passage variant of strain JD1 using a set of 5′ deletions and mutations within the flaB promoter. Expression from the modified flaB promoters was assayed using the gene for green fluorescent protein (gfp) as a reporter. Although the -35 element of the promoter stimulated promoter activity, its disruption did not negate expression. Sequence upstream of the -35 had no effect on expression. The -35/-10 spacer region composed of a T-rich sequence was critical for optimal promoter function. Surprisingly, a Cytosine at the -13 site was found to be more favorable for transcription compared to a Guanosine at the same site. Based on these results and other characteristics, we propose that the B. burgdorferi flaB promoter is an example of an extended -10 promoter. Further, the T-rich spacer is a key element of the flaB promoter that contributes to the abundance of the flagellar core protein in Borrelia species. PMID:19260969

  6. Mutational analysis of Escherichia coli σ28 and its target promoters reveal recognition of a composite −10 region, comprised of an “extended −10 motif” and a core-10 element

    PubMed Central

    Koo, Byoung-Mo; Rhodius, Virgil A.; Campbell, Elizabeth A.; Gross, Carol A.

    2009-01-01

    Summary σ28 controls the expression of flagella related genes and is the most widely distributed alternative σ factor, present in motile gram-positive and gram-negative bacteria. The distinguishing feature of σ28 promoters is a long −10 region (GCCGATAA). Despite the fact that the upstream GC is highly conserved, previous studies have not indicated a functional role for this motif. Here we examine the functional relevance of the GCCG motif and determine which residues in σ28 participate in its recognition. We find that the GCCG motif is a functionally important composite element. The upstream GC constitutes an extended −10 motif and is recognized by R91, a residue in Domain 3 of σ28. The downstream CG is the upstream edge of −10 region of the promoter; two residues in Region 2.4, D81 and R84, participate in its recognition. Consistent with their role in base-specific recognition of the promoter, R91, D81 and D84 are universally conserved in σ28 orthologues. σ28 is the second Group 3 σ shown to use an extended −10 region in promoter recognition, raising the possibility that other Group 3 σs will do so as well. PMID:19400790

  7. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 1 2013-10-01 2013-10-01 false Message elements. 10.420 Section 10.420... § 10.420 Message elements. A WEA Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time (with...

  8. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 1 2014-10-01 2014-10-01 false Message elements. 10.420 Section 10.420... § 10.420 Message elements. A WEA Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time (with...

  9. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  10. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 1 2011-10-01 2011-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  11. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 1 2012-10-01 2012-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  12. Transgenic Analysis of GFAP Promoter Elements

    PubMed Central

    Yeo, Sujeong; Bandyopadhyay, Susanta; Messing, Albee; Brenner, Michael

    2015-01-01

    Transcriptional regulation of the glial fibrillary acidic protein gene (GFAP) is of interest because of its astrocyte specificity and its upregulation in response to CNS injuries. We have used a transgenic approach instead of cell transfection to identify promoter elements of the human GFAP gene, since previous observations show that GFAP transcription is regulated differently in transfected cultured cells from in the mouse. We previously showed that block mutation of enhancer regions spanning from bp −1488 to −1434 (the C1.1 segment) and −1443 to −1399 (C1.2) resulted in altered patterns of expression and loss of astrocyte specificity, respectively. This analysis has now been extended upstream to bp −1612 to −1489 (the B region), which previously has been shown especially important for expression. Block mutation of each of four contiguous sequences, which together span the B region, each decreased the level of transgene activity by at least 50%, indicating that multiple sites contribute to the transcriptional activity in a cooperative manner. Several of the block mutations also altered the brain region pattern of expression, astrocyte specificity and/or the developmental time course. Transgenes were then analyzed in which mutations were limited to specific transcription factor binding sites in each of the 4 B block segments as well as in C1.1 and C1.2. Whereas mutation of the conserved consensus AP-1 site unexpectedly had little effect on transgene expression; NFI, SP1, STAT3, and NF-κB were identified as having important roles in regulating the strength of GFAP promoter activity and/or its astrocyte specificity. PMID:23832770

  13. ElemeNT: a computational tool for detecting core promoter elements.

    PubMed

    Sloutskin, Anna; Danino, Yehuda M; Orenstein, Yaron; Zehavi, Yonathan; Doniger, Tirza; Shamir, Ron; Juven-Gershon, Tamar

    2015-01-01

    Core promoter elements play a pivotal role in the transcriptional output, yet they are often detected manually within sequences of interest. Here, we present 2 contributions to the detection and curation of core promoter elements within given sequences. First, the Elements Navigation Tool (ElemeNT) is a user-friendly web-based, interactive tool for prediction and display of putative core promoter elements and their biologically-relevant combinations. Second, the CORE database summarizes ElemeNT-predicted core promoter elements near CAGE and RNA-seq-defined Drosophila melanogaster transcription start sites (TSSs). ElemeNT's predictions are based on biologically-functional core promoter elements, and can be used to infer core promoter compositions. ElemeNT does not assume prior knowledge of the actual TSS position, and can therefore assist in annotation of any given sequence. These resources, freely accessible at http://lifefaculty.biu.ac.il/gershon-tamar/index.php/resources, facilitate the identification of core promoter elements as active contributors to gene expression. PMID:26226151

  14. Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice

    PubMed Central

    Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun

    2015-01-01

    As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice. PMID:26655679

  15. In vivo Characterization of plant promoter element interaction using synthetic promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Short directly-repeated (DR) DNA enhancer elements of plant viral origin were analyzed for their ability, both individually and in combination, to influence in vivo transcription when inserted upstream from a minimal CaMV35S promoter. Synthetic promoters containing multiple copies and/or combinatio...

  16. Synthetic plan promoters as a tool for characterizing the function of individual promoter elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Short direct-repeat (DR) DNA enhancer elements from plant viral intergenic regions were analyzed for their ability, both individually and in combination, to influence transcription when inserted upstream from a minimal CaMV35S promoter. Synthetic promoters containing multiple copies and/or combinat...

  17. Epigenomic elements enriched in the promoters of autoimmunity susceptibility genes.

    PubMed

    Dozmorov, Mikhail G; Wren, Jonathan D; Alarcón-Riquelme, Marta E

    2014-02-01

    Genome-wide association studies have identified a number of autoimmune disease-susceptibility genes. Whether or not these loci share any regulatory or functional elements, however, is an open question. Finding such common regulators is of considerable research interest in order to define systemic therapeutic targets. The growing amount of experimental genomic annotations, particularly those from the ENCODE project, provide a wealth of opportunities to search for such commonalities. We hypothesized that regulatory commonalities might not only delineate a regulatory landscape predisposing to autoimmune diseases, but also define functional elements distinguishing specific diseases. We further investigated if, and how, disease-specific epigenomic elements can identify novel genes yet to be associated with the diseases. We evaluated transcription factors, histone modifications, and chromatin state data obtained from the ENCODE project for statistically significant over- or under-representation in the promoters of genes associated with Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), and Systemic Sclerosis (SSc). We identified BATF, BCL11A, IRF4, NFkB, PAX5, and PU.1 as transcription factors over-represented in SLE- and RA-susceptibility gene promoters. H3K4me1 and H3K4me2 epigenomic marks were associated with SLE susceptibility genes, and H3K9me3 was common to both SLE and RA. In contrast to a transcriptionally active signature in SLE and RA, SSc-susceptibility genes were depleted in activating epigenomic elements. Using epigenomic elements enriched in SLE and RA, we identified additional immune and B cell signaling-related genes with the same elements in their promoters. Our analysis suggests common and disease-specific epigenomic elements that may define novel therapeutic targets for controlling aberrant activation of autoimmune susceptibility genes. PMID:24213554

  18. In vivo characterization of plant promoter element interaction using synthetic promoters.

    PubMed

    Cazzonelli, Christopher Ian; Velten, Jeff

    2008-06-01

    Short directly-repeated (DR) DNA enhancer elements of plant viral origin were analyzed for their ability, both individually and in combination, to influence in vivo transcription when inserted upstream from a minimal CaMV35S promoter. Synthetic promoters containing multiple copies and/or combinations of DR cassettes were tested for their effect upon reporter gene (luciferase) expression using an Agrobacteria-based leaf-infiltration transient assay and within stably transformed plants (Nicotiana tabacum). Transgenic plants harboring constructs containing different numbers or combinations of DR cassettes were further tested to look for tissue-specific expression patterns and potential promoter response to the infiltration process employed during transient expression. Multimerization of DR elements produced enhancer activity that was in general additive, increasing reporter activity in direct proportion to the number of DR cassettes within the test promoter. In contrast, combinations of different DR cassettes often functioned synergistically, producing reporter enhancement markedly greater then the sum of the combined DR activities. Several of the DR constructs responded to Agrobacteria (lacking T-DNA) infiltration of transgenic leaves by an induction (2 elements) or reduction (1 element) in reporter activity. Combinations of DR cassettes producing the strongest enhancement of reporter activity were used to create two synthetic promoters (SynPro3 and SynPro5) that drive leaf reporter activities at levels comparable to the CaMV35S promoter. Characterization of these synthetic promoters in transformed tobacco showed strong reporter expression at all stages of development and in most tissues. The arrangement of DR elements within SynPro3 and SynPro5 appears to play a role in defining tissue-specificity of expression and/or Agrobacteria-infusion responsiveness. PMID:17653610

  19. Epigenetic regulation of transposable element derived human gene promoters.

    PubMed

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome. PMID:21215797

  20. Computational analysis of promoter elements and chromatin features in yeast.

    PubMed

    Wyrick, John J

    2012-01-01

    Regulatory elements in promoter sequences typically function as binding sites for transcription factor proteins and thus are critical determinants of gene transcription. There is growing evidence that chromatin features, such as histone modifications or nucleosome positions, also have important roles in transcriptional regulation. Recent functional genomics and computational studies have yielded extensive datasets cataloging transcription factor binding sites (TFBS) and chromatin features, such as nucleosome positions, throughout the yeast genome. However, much of this data can be difficult to navigate or analyze efficiently. This chapter describes practical methods for the visualization, data mining, and statistical analysis of yeast promoter elements and chromatin features using two Web-accessible bioinformatics databases: ChromatinDB and Ceres. PMID:22113279

  1. 27 CFR 10.24 - Sales promotion contests.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Sales promotion contests. 10.24 Section 10.24 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS COMMERCIAL BRIBERY Commercial Bribery § 10.24 Sales promotion...

  2. Synthetic promoter elements obtained by nucleotide sequence variation and selection for activity

    PubMed Central

    Edelman, Gerald M.; Meech, Robyn; Owens, Geoffrey C.; Jones, Frederick S.

    2000-01-01

    Eukaryotic transcriptional regulation in different cells involves large numbers and arrangements of cis and trans elements. To survey the number of cis regulatory elements that are active in different contexts, we have devised a high-throughput selection procedure permitting synthesis of active cis motifs that enhance the activity of a minimal promoter. This synthetic promoter construction method (SPCM) was used to identify >100 DNA sequences that showed increased promoter activity in the neuroblastoma cell line Neuro2A. After determining DNA sequences of selected synthetic promoters, database searches for known elements revealed a predominance of eight motifs: AP2, CEBP, GRE, Ebox, ETS, CREB, AP1, and SP1/MAZ. The most active of the selected synthetic promoters contain composites of a number of these motifs. Assays of DNA binding and promoter activity of three exemplary motifs (ETS, CREB, and SP1/MAZ) were used to prove the effectiveness of SPCM in uncovering active sequences. Up to 10% of 133 selected active sequences had no match in currently available databases, raising the possibility that new motifs and transcriptional regulatory proteins to which they bind may be revealed by SPCM. The method may find uses in constructing databases of active cis motifs, in diagnostics, and in gene therapy. PMID:10725347

  3. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 25 2011-07-01 2011-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  4. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 26 2013-07-01 2013-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  5. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 26 2012-07-01 2011-07-01 true Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  6. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 25 2014-07-01 2014-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  7. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  8. Endogenous 5-HT2C Receptors Phosphorylate the cAMP Response Element Binding Protein via Protein Kinase C-Promoted Activation of Extracellular-Regulated Kinases-1/2 in Hypothalamic mHypoA-2/10 Cells.

    PubMed

    Lauffer, Lisa; Glas, Evi; Gudermann, Thomas; Breit, Andreas

    2016-07-01

    Serotonin 5-HT2C receptors (5-HT2CR) activate Gq proteins and are expressed in the central nervous system (CNS). 5-HT2CR regulate emotion, feeding, reward, or cognition and may serve as promising drug targets to treat psychiatric disorders or obesity. Owing to technical difficulties in isolating cells from the CNS and the lack of suitable cell lines endogenously expressing 5-HT2CR, our knowledge about this receptor subtype in native environments is rather limited. The hypothalamic mHypoA-2/10 cell line was recently established and resembles appetite-regulating hypothalamic neurons of the paraventricular nucleus (PVN), where 5-HT2CR have been detected in vivo. Therefore, we tested mHypoA-2/10 cells for endogenous 5-HT2CR expression. Serotonin or the 5-HT2CR preferential agonist WAY-161,503 initiated cAMP response element (CRE)-dependent gene transcription with EC50 values of 15.5 ± 9.8 and 1.1 ± 0.9 nM, respectively. Both responses were blocked by two unrelated 5-HT2CR-selective antagonists (SB-242,084, RS-102,221) but not by a 5-HT2AR (EMD-281,014) or 5-HT2BR (RS-127,455) antagonists. By single-cell calcium imaging, we found that serotonin and WAY-161,503 induced robust calcium transients, which were also blunted by both 5-HT2CR antagonists. Additionally we revealed, first, that 5-HT2CR induced CRE activation via protein kinase C (PKC)-mediated engagement of extracellular-regulated kinases-1/2 and, second, that intrinsic activity of WAY-161,503 was in the range of 0.3-0.5 compared with serotonin, defining the frequently used 5-HT2CR agonist as a partial agonist of endogenous 5-HT2CR. In conclusion, we have shown that hypothalamic mHypoA-2/10 cells endogenously express 5-HT2CR and thus are the first cell line in which to analyze 5-HT2CR pharmacology, signaling, and regulation in its natural environment. PMID:27189964

  9. Socialization, Promotion, and Tenure: A 10-Year Study.

    ERIC Educational Resources Information Center

    Neisler, Otherine Johnson

    1999-01-01

    Longitudinally investigated the socialization, promotion, and tenure experiences of tenure-track Holmes Scholars, examining the entrance of older, second career minority scholars into a changing profession. Data from site visits, surveys, and interviews suggest that elements of the Holmes Scholarship Network enhance research productivity and…

  10. Promoter element arising from the fusion of standard BioBrick parts.

    PubMed

    Yao, Andrew I; Fenton, Timothy A; Owsley, Keegan; Seitzer, Phillip; Larsen, David J; Sit, Holly; Lau, Jennifer; Nair, Arjun; Tantiongloc, Justin; Tagkopoulos, Ilias; Facciotti, Marc T

    2013-02-15

    We characterize the appearance of a constitutive promoter element in the commonly used cI repressor-encoding BioBrick BBa_C0051. We have termed this promoter element pKAT. Full pKAT activity is created by the ordered assembly of sequences in BBa_C0051 downstream of the cI gene encoding the 11 amino acid LVA proteolytic degradation tag, a BioBrick standard double-TAA stop codon, a genetic barcode, and part of the RFC10 SpeI-XbaI BioBrick scar. Placing BBa_C0051 or other pKAT containing parts upstream of other functional RNA coding elements in a polycistronic context may therefore lead to the unintended transcription of the downstream elements. The frequent reuse of pKAT or pKAT-like containing basic parts in the Registry of Biological Parts has resulted in approximately 5% of registry parts encoding at least one instance of a predicted pKAT promoter located directly upstream of a ribosome binding site and ATG start codon. This example highlights that even seemingly simple modifications of a part's sequence (in this case addition of degradation tags and barcodes) may be sufficient to unexpectedly change the contextual behavior of a part and reaffirms the inherent challenge in carefully characterizing the behavior of standardized biological parts across a broad range of reasonable use scenarios. PMID:23656374

  11. Identification of an essential upstream element in the nopaline synthase promoter by stable and transient assays

    PubMed Central

    Ebert, Paul R.; Ha, Sam Bong; An, Gynheung

    1987-01-01

    We studied the fine structure of the nopaline synthase (nos) promoter, which is active constitutively in a wide range of plant tissues, by both transient and stable transformation expression analyses. 3′ and 5′ deletion fragments were linked to form a set of internal deletion and duplication mutants that scanned the nos promoter. These mutated promoters were linked to the gene for the marker chloramphenicol acetyltransferase (CATase) as a means to readily assay promoter strength. The stable transformation analysis revealed the functional importance of an extended CCAAT box region (-97 to -63). Deletion of an upstream region (-112 to -101) containing an octameric repeated element resulted in a reduction in promoter strength by a factor of 30. A further deletion (-119 to -101) disrupted a potential Z-DNA-forming element as well, totally eliminating promoter function. Thus, a 19-base deletion across a repeated octamer and a potential Z-DNA-forming element identifies an essential upstream activator in the nos promoter. Duplication of the upstream element tripled promoter activity. Electroporation-mediated transient analysis was unable to distinguish downstream promoter elements. However, the upstream element behaved similarly in both assays in that deletion of the entire upstream element resulted in no promoter activity and that duplication of the element significantly enhanced the promoter strength. PMID:16593869

  12. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 4 2013-01-01 2013-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  13. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 4 2012-01-01 2012-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  14. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 4 2014-01-01 2014-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  15. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  16. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 4 2011-01-01 2011-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  17. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Allocations System regulation (10 CFR part 217), which is part of the Federal Priorities and Allocations System”; and (e) A current copy of the Energy Priorities and Allocations System regulation (10 CFR part... 10 Energy 3 2014-01-01 2014-01-01 false Elements of an allocation order. 217.54 Section...

  18. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Allocations System regulation (10 CFR part 217), which is part of the Federal Priorities and Allocations System”; and (e) A current copy of the Energy Priorities and Allocations System regulation (10 CFR part... 10 Energy 3 2013-01-01 2013-01-01 false Elements of an allocation order. 217.54 Section...

  19. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Energy Priorities and Allocations System regulation at 10 CFR part 217. (2) If the rated order is placed... imminent hazard, as specified in EPAS Section 217.33(e), 10 CFR 217.33(e). ... 10 Energy 3 2014-01-01 2014-01-01 false Elements of a rated order. 217.32 Section 217.32...

  20. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Energy Priorities and Allocations System regulation at 10 CFR part 217. (2) If the rated order is placed... imminent hazard, as specified in EPAS Section 217.33(e), 10 CFR 217.33(e). ... 10 Energy 3 2013-01-01 2013-01-01 false Elements of a rated order. 217.32 Section 217.32...

  1. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Energy Priorities and Allocations System regulation at 10 CFR part 217. (2) If the rated order is placed... imminent hazard, as specified in EPAS Section 217.33(e), 10 CFR 217.33(e). ... 10 Energy 3 2012-01-01 2012-01-01 false Elements of a rated order. 217.32 Section 217.32...

  2. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Allocations System regulation (10 CFR part 217), which is part of the Federal Priorities and Allocations System”; and (e) A current copy of the Energy Priorities and Allocations System regulation (10 CFR part... 10 Energy 3 2012-01-01 2012-01-01 false Elements of an allocation order. 217.54 Section...

  3. Regulatory elements mediating transcription from the Drosophila melanogaster actin 5C proximal promoter.

    PubMed Central

    Chung, Y T; Keller, E B

    1990-01-01

    The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the proximal one of which controls constitutive synthesis of actin in all growing tissues. To locate regulatory elements required for constitutive activity of the proximal promoter, mutants of this promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. An essential regulatory element has been located 313 base pairs upstream from the cap site. Deletion of this element lowered expression to one-third of the wild-type level. The element has the sequence AAGTTGTAGTTG, as shown by protein-binding footprinting with the reagent methidiumpropyl-EDTA-Fe(II). This element is probably not a general one, since it was not detected in a search of the published 5'-flanking sequences of 27 Drosophila genes. In addition to this regulatory element, there are five GAGA elements in the actin 5C proximal promoter, some or all of which are essential for the promoter activity as shown by an in vivo competition assay. Although this promoter has no classical TATA element, there is an essential promoter region about 35 base pairs upstream from the cap site that could be a TATA surrogate. The promoter also shows sequences homologous to the alcohol dehydrogenase factor 1-binding site and to the core of the vertebrate serum response element, but mutations of these sites did not affect promoter activity in transient expression assays. Images PMID:2104658

  4. Identification of the core sequence elements in Penaeus stylirostris densovirus promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This manuscript describes the role of different core elements in the transcriptional activity of promoters in a marine parvovirus, Penaeus stylirostris densovirus (PstDNV) that infects shrimp. Although comprehensive information on the role of different elements in the promoters of several animal par...

  5. miR-10b promotes invasion by targeting HOXD10 in colorectal cancer

    PubMed Central

    WANG, YUNFENG; LI, ZHEN; ZHAO, XUHONG; ZUO, XIAOMING; PENG, ZHIHAI

    2016-01-01

    Studies have shown that homeobox D10 (HOXD10) is the target gene of microRNA-10b (miR-10b) and is closely associated with the inhibition of cell migration and invasion. Ras homolog family member C (RhoC) has been reported to promote tumor metastasis in various types of cancer. The effect of miR-10b on colorectal cancer (CRC) metastasis and the associated molecular mechanisms remain elusive. The present study aimed to investigate whether miR-10b could promote invasion by targeting HOXD10 in CRC by exploring the association between miR-10b and HOXD10 expression in CRC patients. The findings revealed that miR-10b levels were elevated in the CRC specimens and significantly correlated with advanced clinical stage and lymph node metastasis. In addition, HOXD10 was a direct target of miR-10b, and the increased expression of RhoC and downregulation of HOXD10 correlated with the increased expression level of miR-10b. HOXD10 protein level was also markedly attenuated in lymph node metastasis-positive tumor tissues compared with lymph node metastasis-free tumor tissues. These findings suggest that miR-10b may stimulate the upregulation of RhoC through targeting HOXD10, thus promoting the invasion and migration in CRC tumor. PMID:27347170

  6. Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

    PubMed

    Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

    2011-04-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

  7. Structural property of regulatory elements in human promoters

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2008-04-01

    The capacity of transcription factors to activate gene expression is encoded in the promoter sequences, which are composed of short regulatory motifs that function as transcription factor binding sites (TFBSs) for specific proteins. To the best of our knowledge, the structural property of TFBSs that controls transcription is still poorly understood. Rigidity is one of the important structural properties of DNA, and plays an important role in guiding DNA-binding proteins to the target sites efficiently. After analyzing the rigidity of 2897 TFBSs in 1871 human promoters, we show that TFBSs are generally more flexible than other genomic regions such as exons, introns, 3' untranslated regions, and TFBS-poor promoter regions. Furthermore, we find that the density of TFBSs is consistent with the average rigidity profile of human promoters upstream of the transcription start site, which implies that TFBSs directly influence the promoter structure. We also examine the local rigid regions probably caused by specific TFBSs such as the DNA sequence TATA(A/T)A(A/T) box, which may inhibit nucleosomes and thereby facilitate the access of transcription factors bound nearby. Our results suggest that the structural property of TFBSs accounts for the promoter structure as well as promoter activity.

  8. Reading Motivation: 10 Elements for Success. Motivational Strategies That Work!

    ERIC Educational Resources Information Center

    Gerbig, Kori M.

    2009-01-01

    Motivational processes are the foundation for coordinating cognitive goals and strategies in reading. Becoming an excellent, active reader involves attunement of motivational processes with cognitive and language processes in reading. This article presents K-12 strategies for motivating reading success. It describes 10 instructional elements that…

  9. The Sulfolobus initiator element is an important contributor to promoter strength.

    PubMed

    Ao, Xiang; Li, Yingjun; Wang, Fan; Feng, Mingxia; Lin, Yanxu; Zhao, Shumiao; Liang, Yunxiang; Peng, Nan

    2013-11-01

    Basal elements in archaeal promoters, except for putative initiator elements encompassing transcription start sites, are well characterized. Here, we employed the Sulfolobus araS promoter as a model to study the function of the initiator element (Inr) in archaea. We have provided evidence for the presence of a third core promoter element, the Sulfolobus Inr, whose action depends on a TATA box and the TFB recognition element (BRE). Substitution mutations in the araS Inr did not alter the location of the transcription start site. Using systematic mutagenesis, the most functional araS Inr was defined as +1 GAGAMK +6 (where M is A/C and K is G/T). Furthermore, WebLogo analysis of a subset of promoters with coding sequences for 5' untranslated regions (UTRs) larger than 4 nucleotides (nt) in Sulfolobus solfataricus P2 identified an Inr consensus that exactly matches the functional araS Inr sequence. Moreover, mutagenesis of 3 randomly selected promoters confirmed the Inr sequences to be important for basal promoter strength in the subgroup. Importantly, the result of the araS Inr being added to the Inr-less promoters indicates that the araS Inr, the core promoter element, is able to enhance the strength of Inr-less promoters. We infer that transcription factor B (TFB) and subunits of RNA polymerase bind the Inr to enhance promoter strength. Taken together, our data suggest that the presence or absence of an Inr on basal promoters is important for global gene regulation in Sulfolobus. PMID:24039266

  10. Histone deacetylase 10 promotes autophagy-mediated cell survival

    PubMed Central

    Oehme, Ina; Linke, Jan-Peter; Böck, Barbara C.; Milde, Till; Lodrini, Marco; Hartenstein, Bettina; Wiegand, Inga; Eckert, Christian; Roth, Wilfried; Kool, Marcel; Kaden, Sylvia; Gröne, Hermann-Josef; Schulte, Johannes H.; Lindner, Sven; Hamacher-Brady, Anne; Brady, Nathan R.; Deubzer, Hedwig E.; Witt, Olaf

    2013-01-01

    Tumor cells activate autophagy in response to chemotherapy-induced DNA damage as a survival program to cope with metabolic stress. Here, we provide in vitro and in vivo evidence that histone deacetylase (HDAC)10 promotes autophagy-mediated survival in neuroblastoma cells. We show that both knockdown and inhibition of HDAC10 effectively disrupted autophagy associated with sensitization to cytotoxic drug treatment in a panel of highly malignant V-MYC myelocytomatosis viral-related oncogene, neuroblastoma derived-amplified neuroblastoma cell lines, in contrast to nontransformed cells. HDAC10 depletion in neuroblastoma cells interrupted autophagic flux and induced accumulation of autophagosomes, lysosomes, and a prominent substrate of the autophagic degradation pathway, p62/sequestosome 1. Enforced HDAC10 expression protected neuroblastoma cells against doxorubicin treatment through interaction with heat shock protein 70 family proteins, causing their deacetylation. Conversely, heat shock protein 70/heat shock cognate 70 was acetylated in HDAC10-depleted cells. HDAC10 expression levels in high-risk neuroblastomas correlated with autophagy in gene-set analysis and predicted treatment success in patients with advanced stage 4 neuroblastomas. Our results demonstrate that HDAC10 protects cancer cells from cytotoxic agents by mediating autophagy and identify this HDAC isozyme as a druggable regulator of advanced-stage tumor cell survival. Moreover, these results propose a promising way to considerably improve treatment response in the neuroblastoma patient subgroup with the poorest outcome. PMID:23801752

  11. Histone deacetylase 10 promotes autophagy-mediated cell survival.

    PubMed

    Oehme, Ina; Linke, Jan-Peter; Böck, Barbara C; Milde, Till; Lodrini, Marco; Hartenstein, Bettina; Wiegand, Inga; Eckert, Christian; Roth, Wilfried; Kool, Marcel; Kaden, Sylvia; Gröne, Hermann-Josef; Schulte, Johannes H; Lindner, Sven; Hamacher-Brady, Anne; Brady, Nathan R; Deubzer, Hedwig E; Witt, Olaf

    2013-07-01

    Tumor cells activate autophagy in response to chemotherapy-induced DNA damage as a survival program to cope with metabolic stress. Here, we provide in vitro and in vivo evidence that histone deacetylase (HDAC)10 promotes autophagy-mediated survival in neuroblastoma cells. We show that both knockdown and inhibition of HDAC10 effectively disrupted autophagy associated with sensitization to cytotoxic drug treatment in a panel of highly malignant V-MYC myelocytomatosis viral-related oncogene, neuroblastoma derived-amplified neuroblastoma cell lines, in contrast to nontransformed cells. HDAC10 depletion in neuroblastoma cells interrupted autophagic flux and induced accumulation of autophagosomes, lysosomes, and a prominent substrate of the autophagic degradation pathway, p62/sequestosome 1. Enforced HDAC10 expression protected neuroblastoma cells against doxorubicin treatment through interaction with heat shock protein 70 family proteins, causing their deacetylation. Conversely, heat shock protein 70/heat shock cognate 70 was acetylated in HDAC10-depleted cells. HDAC10 expression levels in high-risk neuroblastomas correlated with autophagy in gene-set analysis and predicted treatment success in patients with advanced stage 4 neuroblastomas. Our results demonstrate that HDAC10 protects cancer cells from cytotoxic agents by mediating autophagy and identify this HDAC isozyme as a druggable regulator of advanced-stage tumor cell survival. Moreover, these results propose a promising way to considerably improve treatment response in the neuroblastoma patient subgroup with the poorest outcome. PMID:23801752

  12. Alignment between DQC's 10 Essential Elements & America COMPETES Act's 12 Elements

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    In 2005, the Data Quality Campaign (DQC) identified the "10 Essential Elements of a Statewide Longitudinal Data System" to provide a roadmap for state policymakers as they built statewide longitudinal data systems designed to collect, store, & use longitudinal data to improve student achievement & outcomes. In 2007, the federal America COMPETES…

  13. Positive and negative regulatory elements mediating transcription from the Drosophila melanogaster actin 5C distal promoter.

    PubMed Central

    Chung, Y T; Keller, E B

    1990-01-01

    The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the distal one of which controls synthesis of actin in a tissue- and developmental stage-specific manner. This very strong promoter has widely been used for expression of heterologous genes in cultured cells. To locate functional regulatory elements in this distal promoter, mutants of the promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. The results showed that the upstream end of the promoter extends to 522 bp from the transcription start site. In addition, there are two remote activating regions about 2 kb upstream. Between -522 and -379 are two regions that exert a strong negative effect. Downstream from these negative regions are at least six positive regions and a TATA element. The strongest positive determinant of the promoter was identified at -320 as AAAATGTG by footprinting and by a replacement experiment. When the relevant region was replaced by a synthetic sequence containing this element in a random context, the transient expression activity was restored. The sequence TGTATG located at -355 was also identified as a positive element by a similar replacement approach. Apparently the very high activity of this promoter is the result of the combined activities of multiple factors. Images PMID:2123290

  14. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    PubMed

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen. PMID:2017174

  15. Structure and Promoter Characterization of Aldo-Keto Reductase Family 1 B10 Gene

    PubMed Central

    Liu, Ziwen; Zhong, Linlin; Krishack, Paulette A; Robbins, Sarah; Cao, Julia X; Zhao, Yupei; Chung, Stephen; Cao, Deliang

    2009-01-01

    Aldo-keto reductase family 1 member B10 (AKR1B10) is overexpressed in human hepatocellular carcinoma, lung squamous carcinoma, and lung adenocarcinoma in smokers. Our recent studies have showed that AKR1B10 plays a critical role in the growth and proliferation of cancer cells by detoxifying reactive carbonyls and regulating fatty acid biosynthesis. However, little is known about the regulatory mechanisms of AKR1B10 expression. In this study, we determined the structure of AKR1B10 gene and characterized its promoter. The results demonstrated that AKR1B10 consists of 10 exons and 9 introns, stretching approximately 13.8 kb. A 5′-RACE study determined the transcriptional start site of AKR1B10 at 320 bp upstream of the ATG translational start codon. A TATA-like (TAATAA) and a CAAT box are present from −145 to −140 bp and −193 to −190 bp upstream of the transcriptional start site, respectively. Motif analysis recognized multiple putative oncogenic and tumor suppressor protein binding sites in the AKR1B10 promoter, including c-Ets-1, C/EBP, AP-1, and p53, but osmolytic response elements were not found. A -4,091 bp of the 5′-flanking fragment of the AKR1B10 gene was capable of driving GFP and luciferase reporter gene expression in HepG2 cells derived from human hepatocellular carcinoma; progressive 5′-deletions revealed that a −255 bp fragment possesses full promoter activity. PMID:19236911

  16. Quantitative Analysis of Cis-Regulatory Element Activity Using Synthetic Promoters in Transgenic Plants.

    PubMed

    Benn, Geoffrey; Dehesh, Katayoon

    2016-01-01

    Synthetic promoters, introduced stably or transiently into plants, are an invaluable tool for the identification of functional regulatory elements and the corresponding transcription factor(s) that regulate the amplitude, spatial distribution, and temporal patterns of gene expression. Here, we present a protocol describing the steps required to identify and characterize putative cis-regulatory elements. These steps include application of computational tools to identify putative elements, construction of a synthetic promoter upstream of luciferase, identification of transcription factors that regulate the element, testing the functionality of the element introduced transiently and/or stably into the species of interest followed by high-throughput luciferase screening assays, and subsequent data processing and statistical analysis. PMID:27557758

  17. Transcriptional activity of the transposable element Tn10 in the Salmonella typhimurium ilvGEDA operon.

    PubMed

    Blazey, D L; Burns, R O

    1982-08-01

    Polarity of Tn10 insertion mutations in the Salmonella typhimurium ilvGEDA operon depends on both the location and the orientation of the Tn10 element. One orientation of Tn10 insertions in ilvG and ilvE permits low-level expression of the downstream ilvEDA and ilvDA genes, respectively. Our analysis of Salmonella ilv recombinant plasmids shows that this residual ilv expression must result from Tn10-directed transcription and does not reflect the presence of internal promoters in the ilvGEDA operon, as was previously suggested. The opposite orientation of Tn10 insertion in ilvE prevents ilvDA expression, indicating that only one end of Tn10 is normally active in transcribing adjacent genes. Both orientations of Tn10 insertion in ilvD exert absolute polarity on ilvA expression. Expression of ilvA is known to be dependent on effective translation of ilvD, perhaps reflecting the lack of a ribosome binding site proximal to the ilvA sequence. Therefore, recognition of the ability of Tn10 to promote transcription of contiguous genes in the ilvGEDA operon apparently requires the presence of associated ribosome binding sites. PMID:6289328

  18. A developmentally regulated Caulobacter flagellar promoter is activated by 3' enhancer and IHF binding elements.

    PubMed Central

    Gober, J W; Shapiro, L

    1992-01-01

    The transcription of a group of flagellar genes is temporally and spatially regulated during the Caulobacter crescentus cell cycle. These genes all share the same 5' cis-regulatory elements: a sigma 54 promoter, a binding site for integration host factor (IHF), and an enhancer sequence, known as the ftr element. We have partially purified the ftr-binding proteins, and we show that they require the same enhancer sequences for binding as are required for transcriptional activation. We have also partially purified the Caulobacter homolog of IHF and demonstrate that it can facilitate in vitro integrase-mediated lambda recombination. Using site-directed mutagenesis, we provide the first demonstration that natural enhancer sequences and IHF binding elements that reside 3' to the sigma 54 promoter of a bacterial gene, flaNQ, are required for transcription of the operon, in vivo. The IHF protein and the ftr-binding protein is primarily restricted to the predivisional cell, the cell type in which these promoters are transcribed. flaNQ promoter expression is localized to the swarmer pole of the predivisional cell, as are other flagellar promoters that possess these regulatory sequences 5' to the start site. The requirement for an IHF binding site and an ftr-enhancer element in spatially transcribed flagellar promoters indicates that a common mechanism may be responsible for both temporal and polar transcription. Images PMID:1392079

  19. Identification of two novel shear stress responsive elements in rat angiotensin I converting enzyme promoter.

    PubMed

    Miyakawa, Ayumi Aurea; de Lourdes Junqueira, Maria; Krieger, José Eduardo

    2004-04-13

    Mechanical forces contribute to maintenance of cardiovascular homeostasis via the control of release and production of vasoactive substances. We demonstrated previously that shear stress decreases rat ACE activity and expression. Using a reporter gene approach and mutagenesis, we show now that the classic shear stress responsive element or SSRE (GAGACC) contained within 1,274 bp of this promoter is not functional in response to shear stress (15 dyn/cm2, 18 h) [for the wild-type ACE promoter (WLuc), static control (C) = 107 +/- 6.5%, shear stress (SS) = 65.9 +/- 9.4%, n = 8; for the promoter with the classic SSRE mutated (WSS-mut), C = 100 +/- 8.2%, SS = 60.2 +/- 5.2%, n = 10, respectively]. Analysis of progressive deletion mutants unraveled a 57-bp fragment, position -251 to -195, from the transcription start site, containing functional SSRE (for WLuc, C = 107 +/- 6.5%, SS = 65.9 +/- 9.4%, n = 8; for 378, C = 100 +/- 6.4%, SS = 60.4 +/- 4.3%, n = 11; for 251, C = 99.7 +/- 2.6%, SS = 63.2 +/- 5.5%, n = 7; for 194, C = 104.6 +/- 8.1%, SS = 92.4 +/- 6.9%, n = 9). This fragment responded to shear stress even in the context of a heterologous promoter. Finally, functional analysis of mutated candidate regulatory elements identified by gel shift, DNase I footprint, and conservation of aligned sequences revealed that only the double mutant (Barbie/GAGA-mut) but not isolated disruption of the Barbie (WBarbie-mut) or the GAGA (WGAGA-mut) prevented the shear-stress-induced response (for Barbie/GAGA-mut, C = 97.9 +/- 5%, SS = 99.4 +/- 7.2%, n = 6; for WBarbie-mut, C = 106.1 +/- 8.6%, SS = 65.9 +/- 9.4%, n = 6; for WGAGA-mut, C = 100.1 +/- 2.9%, SS = 66.7 +/- 1.6, n = 6;). Taken together, these data provide direct evidence for the new role of Barbie and GAGA boxes in mediating the shear-stress-induced downregulation of rat ACE expression and demonstrate that the classic SSRE (GAGACC) is not functional under the experimental conditions tested. PMID:14872008

  20. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements.

    PubMed

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S; Mitchell, Jennifer A; Luscombe, Nicholas M; Fraser, Peter

    2015-04-01

    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. PMID:25752748

  1. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements

    PubMed Central

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W.; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B.; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S.; Mitchell, Jennifer A.

    2015-01-01

    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. PMID:25752748

  2. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.

    PubMed

    Hariharan, N; Perry, R P

    1989-07-11

    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  3. Properties of the Translocatable Tetracycline-Resistance Element Tn10 in ESCHERICHIA COLI and Bacteriophage Lambda

    PubMed Central

    Kleckner, Nancy; Barker, David F.; Ross, Donald G.; Botstein, David

    1978-01-01

    A number of independent insertions into bacteriophage λ of the translocatable tetracycline-resistance element Tn10 have been isolated and characterized.—The physical positions and relative orientations of several such insertions were determined. Two independent insertions appear to lie in the same orientation at or very near the same site in the cI gene, and two more lie in opposite orientations at or near the same position in or near the rex gene.—Insertions in or near genes cI, rex, and cIII have been characterized genetically for their effects on expression of nearby genes. Tn10 appears to exert a polar effect on expression of distal genes when it is inserted within an operon, even when expression of that operon is under the influence of λ N-function. In addition, Tn10 insertions in rex appear to influence in some way expression of an "upstream" gene, cI.—Lambda derivatives carrying Tn10 give rise to spontaneously occurring, tetracycline-sensitive deletions at high frequencies. It is likely that formation of these deletions is promoted in some way by the Tn10 element.—Lambda::Tn10 phages carrying a Tn10 element that has undergone several successive cycles of translocation since its first isolation and characterization have been analyzed. The results confirm that Tn10 often retains its physical and functional integrity during many cycles of translocation.—Lambda derivatives carrying Tn10 have been used to generate insertions of Tn10 in the chromosome of Escherichia coli. This process is independent of recA function, and seems to be quite analogous to the translocation of Tn10 in Salmonella typhimurium as studied previously. PMID:365678

  4. HXT5 expression is under control of STRE and HAP elements in the HXT5 promoter.

    PubMed

    Verwaal, René; Arako, Megumi; Kapur, Rick; Verkleij, Arie J; Verrips, C Theo; Boonstra, Johannes

    2004-07-15

    Hexose transporter (Hxt) proteins transport glucose across the plasma membrane in the yeast Saccharomyces cerevisiae. Recently, we have shown that expression of HXT5 is regulated by the growth rate of the cells. Because gene expression is regulated by binding of specific transcription factors to regulatory elements in the promoters of genes, the presence of putative regulatory elements in the promoter of HXT5 was determined by computer-assisted analysis. This revealed the presence of two putative stress-responsive elements (STREs), one putative post-diauxic shift (PDS) element and two putative Hap2/3/4/5p (HAP) complex binding elements. The involvement of these elements was studied by using mutations in a HXT5 promoter-LacZ fusion construct. Growth during various conditions that result in low growth rates of yeast cells revealed that the STRE most proximal to the translation initiation site seemed to be involved in particular in regulation of HXT5 expression during growth at decreased growth rates. In addition, the HAP elements seemed to be required during growth on non-fermentable carbon sources. The PDS element and, to a lesser extent, the other STRE showed particular involvement in regulation of HXT5 expression during growth on ethanol. Finally, it was shown that the PKA pathway, which is known to be involved in expression of STRE-regulated genes, was also involved in regulation of HXT5 expression. A possible mechanism by which expression of HXT5 could be regulated by the transcriptional regulatory elements in the promoter is discussed. PMID:15282798

  5. Characterization of cis-acting elements residing in the chitinase promoter of Bacillus pumilus SG2.

    PubMed

    Heravi, K Morabbi; Shali, A; Naghibzadeh, N; Ahmadian, G

    2014-05-01

    Bacillus pumilus SG2 is a chitinolytic bacterium that produces two chitinases, namely ChiS and ChiL. The chiS and chiL genes are consecutively expressed under a common promoter. Regulation of the chiS and chiL genes is under the control of carbon catabolite repression (CCR) in B. pumilus. This study aimed to investigate the cis-acting elements of the chitinase promoter. For this purpose, we transferred the chiS gene along with its specific promoter to Bacillus subtilis as a host. Primer extension analysis revealed two transcription start sites located 287 and 65 bp upstream of the chiS start codon. The distal promoter was highly compatible with the consensus sequence of the σ(A)-type promoters in B. subtilis, whereas the proximal promoter sequence showed less similarity to the σ(A)-type consensus sequence. A catabolite responsive element (cre), which is required for CCR in Bacillus species, was found to be 136 to 123 bp upstream of the chiS start codon. Interestingly, this cre site was located upstream of the -35 of the proximal promoter and downstream of the distal promoter. Deletion of this cre site sequence rendered the chiS expression constitutive. PMID:24293243

  6. Substitution of Ribonucleotides in the T7 RNA Polymerase Promoter Element

    NASA Technical Reports Server (NTRS)

    McGinness, Kathleen E.; Joyce, Gerald F.

    2001-01-01

    A systematic analysis was carried out to examine the effects of ribonucleotide substitution at various locations within the promoter element for T7 RNA polymerase. Ribonucleotides could be introduced at most positions without significantly decreasing transcription efficiency. A critical window of residues that were intolerant of RNA substitution was defined for both the non-template and template strands of the promoter. These residues are involved in important contacts with the AT-rich recognition loop, specificity loop, and P-intercalating hairpin of the polymerase. These results highlight the malleability of T7 RNA polymerase in recognizing its promoter element and suggest that promoters with altered backbone conformations may be used in molecular biology applications that employ T7 RNA polymerase for in vitro transcription.

  7. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode-inducible synthetic promoters.

    PubMed

    Liu, Wusheng; Mazarei, Mitra; Peng, Yanhui; Fethe, Michael H; Rudis, Mary R; Lin, Jingyu; Millwood, Reginald J; Arelli, Prakash R; Stewart, Charles Neal

    2014-10-01

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co-expressed soybean genes that were selected from six reported microarray studies involving a compatible soybean-SCN interaction. A total of 116 overlapping motif regions (OMRs) were discovered bioinformatically that were identified by at least four out of seven bioinformatic tools. Using synthetic promoters, the inducibility of each OMR or motif itself was evaluated by co-localization of gain of function of an orange fluorescent protein reporter and the presence of SCN in transgenic soybean hairy roots. Among 16 OMRs detected from two experimentally confirmed SCN-inducible promoters, 11 OMRs (i.e. 68.75%) were experimentally confirmed to be SCN-inducible, leading to the discovery of 23 core motifs of 5- to 7-bp length, of which 14 are novel in plants. We found that a combination of the three best tools (i.e. SCOPE, W-AlignACE and Weeder) could detect all 23 core motifs. Thus, this strategy is a high-throughput approach for de novo motif discovery in soybean and offers great potential for novel motif discovery and synthetic promoter engineering for any plant and trait in crop biotechnology. PMID:24893752

  8. Functional elements in the minimal promoter of the human proton-coupled folate transporter

    SciTech Connect

    Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G.

    2009-10-09

    The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 and AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.

  9. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  10. Localisation of cis elements in the promoter of a wheat alpha-Amy2 gene.

    PubMed

    Huttly, A K; Phillips, A L; Tregear, J W

    1992-09-01

    A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid. PMID:1511136

  11. Genome-wide computational prediction and analysis of core promoter elements across plant monocots and dicots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcription initiation, essential to gene expression regulation, involves recruitment of basal transcription factors to the core promoter elements (CPEs). The distribution of currently known CPEs across plant genomes is largely unknown. This is the first large scale genome-wide report on the compu...

  12. Multiple control elements in the TRP1 promoter of Saccharomyces cerevisiae.

    PubMed Central

    Kim, S; Mellor, J; Kingsman, A J; Kingsman, S M

    1986-01-01

    The TRP1 promoter generates two groups of mRNAs, transcript I and transcript II. The difference in size between the largest and smallest mRNAs is about 200 base pairs. A series of one-sided and internal deletions were constructed in vitro throughout the TRP1 promoter, and the effect of each deletion on transcription was assessed by Northern blotting. We showed that 395 base pairs of the TRP1 promoter were sufficient for the normal transcription of all RNAs and that the promoter contained two control domains. The control domain for transcript I consisted of one positive element and one negative element, while the control domain for transcript II contained two positive elements. The negative element, mapped between -293 and -318, expression of transcript I. Two regions of transcript I. Two regions (-280 to -236 and -235 to -209) were required for accurate initiation of transcript I. Each region contained sequences homologous to known consensus sequences of the TATA box. Images PMID:3025648

  13. Coordinated transcription factor and promoter engineering to establish strong expression elements in Saccharomyces cerevisiae.

    PubMed

    Leavitt, John M; Tong, Alice; Tong, Joyce; Pattie, Jonathan; Alper, Hal S

    2016-07-01

    Gene expression requires the coordination of trans-acting factors and cis-DNA elements to initiate transcription. Here we present a coordinated approach that combines cis-acting element engineering with mutant trans-acting factors to engineer yeast promoters. Specifically, we first construct a hybrid promoter based on the ARO9 upstream region that exhibits high constitutive and inducible expression with respect to exogenous tryptophan. Next, we perform protein engineering to identify a mutant Aro80p that affords both high constitutive expression while retaining inducible traits. We then use this mutant trans-acting factor to drive expression and generate ultra-strong promoters with transcriptional output roughly 2 fold higher than TDH3 (GPD), one of the strongest promoters to-date. Finally, we used this element to construct a modular expression system capable of staged outputs resulting in a system with nearly 6-fold, 12-fold and 15-fold expression relative to the off-state. This work further highlights the potential of using endogenous transcription factors (including mutant factors) along with hybrid promoters to expand the yeast synthetic biology toolbox. PMID:27152757

  14. SMADs and FOXL2 synergistically regulate murine FSHbeta transcription via a conserved proximal promoter element.

    PubMed

    Tran, Stella; Lamba, Pankaj; Wang, Ying; Bernard, Daniel J

    2011-07-01

    Pituitary FSH regulates ovarian and testicular function. Activins stimulate FSHβ subunit (Fshb) gene transcription in gonadotrope cells, the rate-limiting step in mature FSH synthesis. Activin A-induced murine Fshb gene transcription in immortalized gonadotropes is dependent on homolog of Drosophila mothers against decapentaplegic (SMAD) proteins as well as the forkhead transcription factor FOXL2 (FOXL2). Here, we demonstrate that FOXL2 synergizes with SMAD2, SMAD3, and SMAD4 to stimulate murine Fshb promoter-reporter activity in heterologous cells. Moreover, SMAD3-induction of Fshb promoter activity or endogenous mRNA expression is dependent upon endogenous FOXL2 in homologous cells. FOXL2/SMAD synergy requires binding of both FOXL2 and SMAD3 or SMAD4 to DNA. Of three putative forkhead-binding elements identified in the murine Fshb promoter, only the most proximal is absolutely required for activin A induction of reporter activity in homologous cells. Additionally, mutations to the minimal SMAD-binding element adjacent to the proximal forkhead-binding element abrogate activin A or FOXL2/SMAD3 induction of reporter activity. In contrast, a mutation that impairs an adjacent PBX1/PREP1 (pre-B cell leukemia transcription factor 1-PBX/knotted-1 homeobox-1) binding site does not alter activin A-stimulated promoter activity in homologous cells. Collectively, these and previous data suggest a model in which activins stimulate formation of FOXL2-SMAD2/3/4 complexes, which bind to the proximal murine Fshb promoter to stimulate its transcription. Within these complexes, FOXL2 and SMAD3 or SMAD4 bind to adjacent cis-elements, with SMAD3 brokering the physical interaction with FOXL2. Because this composite response element is highly conserved, this suggests a general mechanism whereby activins may regulate and/or modulate Fshb transcription in mammals. PMID:21622537

  15. Identification and characterization of the retinoic acid response elements in the human RIG1 gene promoter

    SciTech Connect

    Jiang, S.-Y.; Wu, M.-S.; Chen, L.-M.; Hung, M.-W.; Lin, H.-E.; Chang, G.-G.; Chang, T.-C. . E-mail: tcchang@ndmctsgh.edu.tw

    2005-06-03

    The expression of retinoic acid-induced gene 1 (RIG1), a class II tumor suppressor gene, is induced in cells treated with retinoids. RIG1 has been shown to express ubiquitously and the increased expression of this gene appears to suppress cell proliferation. Recent studies also demonstrated that this gene may play an important role in cell differentiation and the progression of cancer. In spite of the remarkable regulatory role of this protein, the molecular mechanism of RIG1 expression induced by retinoids remains to be clarified. The present study was designed to study the molecular mechanism underlying the all-trans retinoic acid (atRA)-mediated induction of RIG1 gene expression. Polymerase chain reaction was used to generate a total of 10 luciferase constructs that contain various fragments of the RIG1 5'-genomic region. These constructs were then transfected into human gastric cancer SC-M1 and breast cancer T47D cells for transactivation analysis. atRA exhibited a significant induction in luciferase activity only through the -4910/-5509 fragment of the 5'-genomic region of RIG1 gene relative to the translation initiation site. Further analysis of this promoter fragment indicated that the primary atRA response region is located in between -5048 and -5403 of the RIG1 gene. Within this region, a direct repeat sequence with five nucleotide spacing, 5'-TGACCTctattTGCCCT-3' (DR5, -5243/-5259), and an inverted repeat sequence with six nucleotide spacing, 5'-AGGCCAtggtaaTGGCCT-3' (IR6, -5323/-5340), were identified. Deletion and mutation of the DR5, but not the IR6 element, abolished the atRA-mediated activity. Electrophoretic mobility shift assays with nuclear extract from atRA-treated cells indicated the binding of retinoic acid receptor (RAR) and retinoid X receptor (RXR) heterodimers specifically to this response element. In addition to the functional DR5, the region contains many other potential sequence elements that are required to maximize the at

  16. A retinoic acid receptor-specific element controls the retinoic acid receptor-beta promoter.

    PubMed

    Hoffmann, B; Lehmann, J M; Zhang, X K; Hermann, T; Husmann, M; Graupner, G; Pfahl, M

    1990-11-01

    The morphogen retinoic acid (RA) regulates gene transcription by interacting with specific nuclear receptors that recognize DNA sequences near responsive promoters. While much has recently been learned about the nuclear receptor proteins, little is known about the genes that are directly regulated by RA and their cis-acting response elements recognized by these receptors. Here we have analyzed the RA receptor-beta (RAR beta) gene promoter that is controlled by RA. We find that a RA-responsive element (RARE) is located adjacent to the TATA box. The RARE shows a direct repeat symmetry which is essential for its function. While thyroid hormone-responsive elements can also function as RAR response elements, we show here that this RARE is activated by endogenous RARs and RAR beta, but cannot be regulated by thyroid hormone receptors and other known nuclear receptors. In addition, we find that RAR gamma is a poor activator of this RARE. However, the response element is bound with high affinity by both RAR beta and RAR gamma as well as by thyroid hormone receptors. Thus, interaction between specific response elements and receptors is insufficient for gene activation. PMID:2177841

  17. Modular Finite Element Methods Library Version: 1.0

    2010-06-22

    MFEM is a general, modular library for finite element methods. It provides a variety of finite element spaces and bilinear/linear forms in 2D and 3D. MFEM also includes classes for dealing with various types of meshes and their refinement.

  18. Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1

    PubMed Central

    Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves

    2003-01-01

    The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be

  19. Functional characterization of the GDEP promoter and three enhancer elements in retinoblastoma and prostate cell lines.

    PubMed

    Cross, D S; Burmester, J K

    2008-01-01

    GDEP (gene differentially expressed in prostate cancer aka. PCAN1), a newly discovered gene with remarkable tissue specificity, is a promising candidate for regulatory analysis because it exhibits a high level of expression that is limited to two tissues, the retina and the prostate. As these two tissues have different origins and disparate functions it is likely that the regulatory mechanisms responsible for expression are not shared in their entirety. In addition, both the retina and prostate are prime targets for gene therapy. To date there have been no functional studies of the GDEP promoter. Therefore to understand tissue-specific expression of GDEP we constructed promoter expression constructs. To further characterize functional regulatory regions within the GDEP gene, we investigated potential regulatory components for tissue-specific expression in the 40 kb intron of this gene. We have identified a 1.5 kb prostate-specific promoter from the proximal region of the GDEP gene. A smaller 0.5 kb promoter exhibited minimal activity in the retinoblastoma cell line Y79, but not in the prostate cells tested. In addition we have investigated three enhancer elements located in the 40 kb intron of the GDEP gene. We identified two enhancer elements that increase reporter gene expression in prostate cell line LNCaP and one additional enhancer element that increases expression in the Y79 cell line approximately 8-fold making it a strong retinal-specific enhancer. PMID:18188713

  20. Building the Frequency Profile of the Core Promoter Element Patterns in the Three ChromHMM Promoter States at 200bp Intervals: A Statistical Perspective

    PubMed Central

    Lent, Heather; Lee, Kyung-Eun

    2015-01-01

    Recently, the Encyclopedia of DNA Elements (ENCODE) Analysis Working Group converted data from ChIP-seq analyses from the Broad Histone track into 15 corresponding chromatic maps that label sequences with different kinds of histone modifications in promoter regions. Here, we publish a frequency profile of the three ChromHMM promoter states, at 200-bp intervals, with particular reference to the existence of sequence patterns of promoter elements, GC-richness, and transcription starting sites. Through detailed and diligent analysis of promoter regions, researchers will be able to uncover new and significant information about transcription initiation and gene function. PMID:26865847

  1. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  2. Molecular cloning of a pathogen/wound-inducible PR10 promoter from Pinus monticola and characterization in transgenic Arabidopsis plants.

    PubMed

    Liu, Jun-Jun; Ekramoddoullah, Abul K M; Piggott, Nina; Zamani, Arezoo

    2005-05-01

    In Pinus monticola (Dougl. ex D. Don), the class ten pathogenesis-related (PR10) proteins comprise a family of multiple members differentially expressed upon pathogen infection and other environmental stresses. One of them, PmPR10-1.13, is studied here by investigating its transcriptional regulation in transgenic Arabidopsis plants. For functional analyses of the PmPR10-1.13 promoter, a 1,316-bp promoter fragment and three 5' deletions were translationally fused to the ss-glucuronidase (GUS) reporter gene. The 1,316-bp promoter-driven GUS activity first appeared in hypocotyls and cotyledons in 2- to 3-day-old seedlings. As transgenic plants grew, GUS activity was detected strongly in apical meristems, next in stems and leaves. No GUS activity was detected in roots and in reproductive tissues of flower organs. In adult plants, the PmPR10-1.13 promoter-directed GUS expression was upregulated following pathogen infection and by wounding treatment, which generally mimic the endogenous expression pattern in western white pine. Promoter analysis of 5' deletions demonstrated that two regions between -1,316 and -930, and between -309 and -100 were responsible for the wound responsiveness. By structural and functional comparisons with PmPR10-1.14 promoter, putative wound-responsive elements were potentially identified in the PmPR10-1.13 promoter. In conclusion, PmPR10-1.13 showed properties of a defence-responsive gene, being transcriptionally upregulated upon biotic and abiotic stresses. PMID:15609047

  3. Predicting the strength of UP-elements and full-length E. coli σE promoters

    PubMed Central

    Rhodius, Virgil A.; Mutalik, Vivek K.; Gross, Carol A.

    2012-01-01

    Predicting the location and strength of promoters from genomic sequence requires accurate sequenced-based promoter models. We present the first model of a full-length bacterial promoter, encompassing both upstream sequences (UP-elements) and core promoter modules, based on a set of 60 promoters dependent on σE, an alternative ECF-type σ factor. UP-element contribution, best described by the length and frequency of A- and T-tracts, in combination with a PWM-based core promoter model, accurately predicted promoter strength both in vivo and in vitro. This model also distinguished active from weak/inactive promoters. Systematic examination of promoter strength as a function of RNA polymerase (RNAP) concentration revealed that UP-element contribution varied with RNAP availability and that the σE regulon is comprised of two promoter types, one of which is active only at high concentrations of RNAP. Distinct promoter types may be a general mechanism for increasing the regulatory capacity of the ECF group of alternative σ's. Our findings provide important insights into the sequence requirements for the strength and function of full-length promoters and establish guidelines for promoter prediction and for forward engineering promoters of specific strengths. PMID:22156164

  4. Predicting the strength of UP-elements and full-length E. coli σE promoters.

    PubMed

    Rhodius, Virgil A; Mutalik, Vivek K; Gross, Carol A

    2012-04-01

    Predicting the location and strength of promoters from genomic sequence requires accurate sequenced-based promoter models. We present the first model of a full-length bacterial promoter, encompassing both upstream sequences (UP-elements) and core promoter modules, based on a set of 60 promoters dependent on σ(E), an alternative ECF-type σ factor. UP-element contribution, best described by the length and frequency of A- and T-tracts, in combination with a PWM-based core promoter model, accurately predicted promoter strength both in vivo and in vitro. This model also distinguished active from weak/inactive promoters. Systematic examination of promoter strength as a function of RNA polymerase (RNAP) concentration revealed that UP-element contribution varied with RNAP availability and that the σ(E) regulon is comprised of two promoter types, one of which is active only at high concentrations of RNAP. Distinct promoter types may be a general mechanism for increasing the regulatory capacity of the ECF group of alternative σ's. Our findings provide important insights into the sequence requirements for the strength and function of full-length promoters and establish guidelines for promoter prediction and for forward engineering promoters of specific strengths. PMID:22156164

  5. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Energy Program Conservation Elements D Appendix D to Part.... 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy conservation programs, certain key elements need to be present. The elements listed below must be...

  6. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Energy Program Conservation Elements D Appendix D to Part.... 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy conservation programs, certain key elements need to be present. The elements listed below must be...

  7. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy Program Conservation Elements D Appendix D to Part.... 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful energy conservation programs, certain key elements need to be present. The elements listed below must be...

  8. Effect of oxidative DNA damage in promoter elements on transcription factor binding.

    PubMed Central

    Ghosh, R; Mitchell, D L

    1999-01-01

    Reactive oxygen species produced by endogenous metabolic activity and exposure to a multitude of exogenous agents impact cells in a variety of ways. The DNA base damage 8-oxodeoxyguanosine (8-oxodG) is a prominent indicator of oxidative stress and has been well-characterized as a premutagenic lesion in mammalian cells and putative initiator of the carcinogenic process. Commensurate with the recent interest in epigenetic pathways of cancer causation we investigated how 8-oxodG alters the interaction between cis elements located on gene promoters and sequence-specific DNA binding proteins associated with these promoters. Consensus binding sequences for the transcription factors AP-1, NF-kappaB and Sp1 were modified site-specifically at guanine residues and electrophoretic mobility shift assays were performed to assess DNA-protein interactions. Our results indicate that whereas a single 8-oxodG was sufficient to inhibit transcription factor binding to AP-1 and Sp1 sequences it had no effect on binding to NF-kappaB, regardless of its position. We conclude from these data that minor alterations in base composition at a crucial position within some, but not all, promoter elements have the ability to disrupt transcription factor binding. The lack of inhibition by damaged NF-kappaB sequences suggests that DNA-protein contact sites may not be as determinative for stable p50 binding to this promoter as other, as yet undefined, structural parameters. PMID:10454620

  9. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    PubMed Central

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-01-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction. PMID:8760352

  10. Hypomethylation of proximal CpG motif of interleukin-10 promoter regulates its expression in human rheumatoid arthritis

    PubMed Central

    Fu, Li-hong; Ma, Chun-ling; Cong, Bin; Li, Shu-jin; Chen, Hai-ying; Zhang, Jing-ge

    2011-01-01

    Aim: The promoter of human interleukin-10 (IL10), a cytokine crucial for suppressing inflammation and regulating immune responses, contains an interspecies-conserved sequence with CpG motifs. The aim of this study was to investigate whether methylation of CpG motifs could regulate the expression of IL10 in rheumatoid arthritis (RA). Methods: Bioinformatic analysis was conducted to identify the interspecies-conserved sequence in human, macaque and mouse IL10 genes. Peripheral blood mononuclear cells (PBMCs) from 20 RA patients and 20 health controls were collected. The PBMCs from 6 patients were cultured in the presence or absence of 5-azacytidine (5 μmol/L). The mRNA and protein levels of IL10 were examined using RT-PCR and ELISA, respectively. The methylation of CpGs in the IL10 promoter was determined by pyrosequencing. Chromatin immunoprecipitation (ChIP) assays were performed to detect the cyclic AMP response element-binding protein (CREB)-DNA interactions. Results: One interspecies-conserved sequence was found within the IL10 promoter. The upstream CpGs at −408, −387, −385, and −355 bp were hypermethylated in PBMCs from both the RA patients and healthy controls. In contrast, the proximal CpG at −145 was hypomethylated to much more extent in the RA patients than in the healthy controls (P=0.016), which was correlated with higher IL10 mRNA and serum levels. In the 5-azacytidine-treated PBMCs, the CpG motifs were demethylated, and the expression levels of IL10 mRNA and protein was significantly increased. CHIP assays revealed increased phospho-CREB binding to the IL10 promoter. Conclusion: The methylation of the proximal CpGs in the IL10 promoter may regulate gene transcription in RA. PMID:21986577

  11. Synthetic Plant Promoters Containing Defined Regulatory Elements Provide Novel Insights into Pathogen- and Wound-Induced Signaling

    PubMed Central

    Rushton, Paul J.; Reinstädler, Anja; Lipka, Volker; Lippok, Bernadette; Somssich, Imre E.

    2002-01-01

    Pathogen-inducible plant promoters contain multiple cis-acting elements, only some of which may contribute to pathogen inducibility. Therefore, we made defined synthetic promoters containing tetramers of only a single type of element and present evidence that a range of cis-acting elements (boxes W1, W2, GCC, JERE, S, Gst1, and D) can mediate local gene expression in planta after pathogen attack. The expression patterns of the promoters were monitored during interactions with a number of pathogens, including compatible, incompatible, and nonhost interactions. Interestingly, there were major differences in the inducibilities of the various promoters with the pathogens tested as well as differences in the speed of induction and in the basal expression levels. We also show that defense signaling is largely conserved across species boundaries at the cis-acting element level. Many of these promoters also direct local wound-induced expression, and this provides evidence for the convergence of resistance gene, nonhost, and wound responses at the level of the promoter elements. We have used these cis-acting elements to construct improved synthetic promoters and show the effects of varying the number, order, and spacing of such elements. These promoters are valuable additions to the study of signaling and transcriptional activation during plant–pathogen interactions. PMID:11971132

  12. Elements of Mathematics, Book 10: Groups and Rings.

    ERIC Educational Resources Information Center

    Exner, Robert; And Others

    One of 12 books developed for use with the core material (Book O) of the Elements of Mathematics Program, this text covers material well beyond the scope of the usual secondary mathematics sequences. These materials are designed for highly motivated students with strong verbal abilities; mathematical theories and ideas are developed through…

  13. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences. PMID:19231992

  14. Integrator element as a promoter of active learning in engineering teaching

    NASA Astrophysics Data System (ADS)

    Oliveira, Paulo C.; Oliveira, Cristina G.

    2014-03-01

    In this paper, we present a teaching proposal used in an Introductory Physics course to civil engineering students from Porto's Engineering Institute/Instituto Superior de Engenharia do Porto (ISEP). The proposal was born from the need to change students' perception and motivation for learning physics. It consists in the use of an integrator element, called the physics elevator project. This integrator element allows us to use, in a single project, all the content taught in the course and uses several active learning strategies. In this paper, we analyse this project as: (i) a clarifying element of the contents covered in the course; (ii) a promoter element of motivation and active participation in class and finally and (iii) a link between the contents covered in the course and the 'real world'. The data were collected by a questionnaire and interviews to students. From the data collected, it seems that the integrator element improves students' motivation towards physics and develops several skills that they consider to be important to their professional future. It also acts as a clarifying element and makes the connection between the physics that is taught and the 'real world'.

  15. Functional erythroid promoters created by interaction of the transcription factor GATA-1 with CACCC and AP-1/NFE-2 elements.

    PubMed Central

    Walters, M; Martin, D I

    1992-01-01

    We have investigated interactions between the erythroid transcription factor GATA-1 and factors binding two cis-acting elements commonly linked to GATA sites in erythroid control elements. GATA-1 is present at all stages of erythroid differentiation, is necessary for erythropoiesis, and binds sites in all erythroid control elements. However, minimal promoters containing GATA-1 sites are inactive when tested in erythroid cells. Based on this observation, two erythroid cis elements, here termed CACCC and AP-1/NFE-2, were linked to GATA sites in minimal promoters. None of the elements linked only to a TATA box created an active promoter, but GATA sites linked to either CACCC or AP-1/NFE-2 elements formed strong erythroid promoters. A mutation of T to C at position -175 in the gamma-globin promoter GATA site, associated with hereditary persistence of fetal hemoglobin (HPFH), increased expression of these promoters in both fetal and adult cells. A construct bearing the beta-globin CACCC element was more active in adult and less active in fetal erythroid cells, when compared with the gamma-globin CACCC element. These studies suggest that erythroid control elements are formed by the interactions of at least three transcription factors, none of which functions alone. Images PMID:1438231

  16. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  17. Differential Top10 promoter regulation by six tetracycline analogues in plant cells

    NASA Technical Reports Server (NTRS)

    Love, John; Allen, George C.; Gatz, Christiane; Thompson, William F.; Brown, C. S. (Principal Investigator)

    2002-01-01

    The effects of five tetracycline analogues, anhydrotetracycline, doxycycline, minocycline, oxytetracycline, and tetracycline, on Top10 promoter activity in NT1 tobacco tissue culture cells have been analysed. The concentration that repressed Top10 promoter activity, the level of transgene repression and the kinetics of transgene de-repression were determined for each analogue, and could not be predicted from in vitro binding affinity to the tetracycline repressor or from comparison with animal cells. Doxycycline had the most potent effect on the Top10 promoter and completely inhibited transgene expression at 4 nmol l(-1). Tetracycline was the most versatile of the analogues tested; tetracycline inhibited the Top10 promoter at 10 nmol l(-1) and was easily washed out to restore Top10-driven expression in 12-24 h. A study was also made of the suitability for plant research of a novel tetracycline analogue, GR33076X. In animal cells, GR33076X de-repressed Top10 promoter activity in the presence of inhibitory concentrations of anhydrotetracycline. In NT1, it is shown that GR 33076X can antagonize repression of the Top10 promoter in the presence of tetracycline, but not of anhydrotetracycline or of doxycycline. Different tetracycline analogues can therefore be used to regulate the Top10 promoter in plant cells and this property may be exploited in planning an optimum course of transgene regulation.

  18. The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element

    PubMed Central

    Cichocki, Frank; Hanson, Rebecca J.; Lenvik, Todd; Pitt, Michelle; McCullar, Valarie; Li, Hongchuan; Anderson, Stephen K.

    2009-01-01

    The killer cell immunoglobulin-like receptor (KIR) repertoire of natural killer (NK) cells determines their ability to detect infected or transformed target cells. Although epigenetic mechanisms play a role in KIR gene expression, work in the mouse suggests that other regulatory elements may be involved at specific stages of NK-cell development. Here we report the effects of the transcription factor c-Myc on KIR expression. c-Myc directly binds to, and promotes transcription from, a distal element identified upstream of most KIR genes. Binding of endogenous c-Myc to the distal promoter element is significantly enhanced upon interleukin-15 (IL-15) stimulation in peripheral blood NK cells and correlates with an increase in KIR transcription. In addition, the overexpression of c-Myc during NK-cell development promotes transcription from the distal promoter element and contributes to the overall transcription of multiple KIR genes. Our data demonstrate the significance of the 5′ promoter element upstream of the conventional KIR promoter region and support a model whereby IL-15 stimulates c-Myc binding at the distal KIR promoter during NK-cell development to promote KIR transcription. This finding provides a direct link between NK-cell activation signals and KIR expression required for acquisition of effector function during NK-cell education. PMID:18987359

  19. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Optional elements of State Energy Program plans. 420.17... Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities or... establishing State-level Energy Technology Commercialization Services Program as an optional element of...

  20. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Optional elements of State Energy Program plans. 420.17... Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities or... establishing State-level Energy Technology Commercialization Services Program as an optional element of...

  1. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Optional elements of State Energy Program plans. 420.17... Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities or... establishing State-level Energy Technology Commercialization Services Program as an optional element of...

  2. Avian retroviral RNA element promotes unspliced RNA accumulation in the cytoplasm.

    PubMed Central

    Ogert, R A; Lee, L H; Beemon, K L

    1996-01-01

    All retroviruses need mechanisms for nucleocytoplasmic export of their unspliced RNA and for maintenance of this RNA in the cytoplasm, where it is either translated to produce Gag and Pol proteins or packaged into viral particles. The complex retroviruses encode Rev or Rex regulatory proteins, which interact with cis-acting viral sequences to promote cytoplasmic expression of incompletely spliced viral RNAs. Since the simple retroviruses do not encode regulatory proteins, we proposed that they might contain cis-acting sequences that could interact with cellular Rev-like proteins. To test this possibility, we initially looked for a cis-acting sequence in avian retroviruses that could substitute for Rev and the Rev response element in human immunodeficiency virus type 1 expression constructs. A cis-acting element in the 3' untranslated region of Rous sarcoma virus (RSV) RNA was found to promote Rev-independent expression of human immunodeficiency virus type 1 Gag proteins. This element was mapped between RSV nucleotides 8770 and 8925 and includes one copy of the direct repeat (DR) sequences flanking the RSV src gene; similar activity was observed for the upstream DR. To address the function of this element in RSV, both copies of the DR sequence were deleted. Subsequently, each DR sequence was inserted separately back into this deleted construct. While the viral construct lacking both DR sequences failed to replicate, constructs containing either the upstream or downstream DR replicated well. In the absence of both DRs, Gag protein levels were severely diminished and cytoplasmic levels of unspliced viral RNA were significantly reduced; replacement of either DR sequence led to normal levels of Gag protein and cytoplasmic unspliced RNA. PMID:8648719

  3. Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and enhancer, each of which contains steroid receptor response elements.

    PubMed Central

    Blanchard, K L; Acquaviva, A M; Galson, D L; Bunn, H F

    1992-01-01

    Transcription of the human erythropoietin (Epo) gene is stimulated by exposure to hypoxia and/or cobalt in whole animals and in Hep3B cells. We have systematically investigated the promoter and 3' enhancer elements necessary for this induction by transient transfection of Hep3B cells. We define a promoter region of 53 bp and an enhancer region of 43 bp that confer hypoxia and cobalt inducibility. Each element gives rise to a 6- to 10-fold induction alone. In combination they produce a 50-fold induction after stimulation, similar to the 50- to 100-fold induction of the endogenous Epo gene. Two areas of DNA sequence homology are present in these regions. We demonstrate specific DNA-protein interactions in the enhancer and the ability of the promoter element to compete with these interactions in electrophoretic mobility shift assays. DNase I footprinting and methylation interference data further refine the cis-acting element in the 43-bp enhancer to a short region containing a direct repeat of a steroid/thyroid hormone receptor response element half-site separated by a 2-bp gap. Two half-site consensus sequences are also present in the 53-bp promoter. Site-specific mutation of the half-site sequences in the enhancer destroys the functional activity of the enhancer. Images PMID:1448072

  4. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  5. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.

    1988-04-01

    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  6. Transposable B2 SINE elements can provide mobile RNA polymerase II promoters.

    PubMed

    Ferrigno, O; Virolle, T; Djabari, Z; Ortonne, J P; White, R J; Aberdam, D

    2001-05-01

    Short interspersed elements (SINEs) are highly abundant components of mammalian genomes that are propagated by retrotransposition. SINEs are recognized as a causal agent of human disease and must also have had a profound influence in shaping eukaryotic genomes. The B2 SINE family constitutes approximately 0.7% of total mouse genomic DNA (ref. 2) and is also found at low abundance in humans. It resembles the Alu family in several respects, such as its mechanism of propagation. B2 SINEs are derived from tRNA and are transcribed by RNA polymerase (pol) III to generate short transcripts that are not translated. We find here, however, that one B2 SINE also carries an active pol II promoter located outside the tRNA region. Indeed, a B2 element is responsible for the production of a mouse Lama3 transcript. The B2 pol II promoters can be bound and stimulated by the transcription factor USF (for upstream stimulatory factor), as shown by transient transfection experiments. Moreover, this pol II activity does not preclude the pol III transcription necessary for retrotransposition. Dispersal of B2 SINEs by retrotransposition may therefore have provided numerous opportunities for creating regulated pol II transcription at novel genomic sites. This mechanism may have allowed the evolution of new transcription units and new genes. PMID:11326281

  7. Myc versus USF: discrimination at the cad gene is determined by core promoter elements.

    PubMed Central

    Boyd, K E; Farnham, P J

    1997-01-01

    Carbamoyl-phosphate synthase/aspartate carbamoyltransferase/dihydroorotase, which is encoded by the cad gene, is required for the first three rate-limiting steps of de novo pyrimidine biosynthesis. It has been previously demonstrated that cad transcription increases at the G1/S-phase boundary, as quiescent cells reenter the proliferative cell cycle. The growth-responsive element has been mapped to an E box at +65 in the hamster cad promoter. Using an in vivo UV cross-linking and immunoprecipitation assay, we show that Myc, Max, and upstream stimulatory factor (USF) bind to the chromosomal cad promoter. To determine whether binding of Myc-Max or USF is critical for cad growth regulation, we analyzed promoter constructs which contain mutations in the nucleotides flanking the E box. We demonstrate that altering nucleotides which flank the cad E box to sequences which decrease Myc-Max binding in vitro correlates with a loss of cad G1/S-phase transcriptional activation. This result supports the conclusion that binding of Myc-Max, but not USF, is essential for cad regulation. Our investigations demonstrate that the endogenous cad E box can be bound by more than one transcription factor, but growth-induced cad expression is achieved only by Myc. PMID:9111322

  8. PePPER: a webserver for prediction of prokaryote promoter elements and regulons

    PubMed Central

    2012-01-01

    Background Accurate prediction of DNA motifs that are targets of RNA polymerases, sigma factors and transcription factors (TFs) in prokaryotes is a difficult mission mainly due to as yet undiscovered features in DNA sequences or structures in promoter regions. Improved prediction and comparison algorithms are currently available for identifying transcription factor binding sites (TFBSs) and their accompanying TFs and regulon members. Results We here extend the current databases of TFs, TFBSs and regulons with our knowledge on Lactococcus lactis and developed a webserver for prediction, mining and visualization of prokaryote promoter elements and regulons via a novel concept. This new approach includes an all-in-one method of data mining for TFs, TFBSs, promoters, and regulons for any bacterial genome via a user-friendly webserver. We demonstrate the power of this method by mining WalRK regulons in Lactococci and Streptococci and, vice versa, use L. lactis regulon data (CodY) to mine closely related species. Conclusions The PePPER webserver offers, besides the all-in-one analysis method, a toolbox for mining for regulons, promoters and TFBSs and accommodates a new L. lactis regulon database in addition to already existing regulon data. Identification of putative regulons and full annotation of intergenic regions in any bacterial genome on the basis of existing knowledge on a related organism can now be performed by biologists and it can be done for a wide range of regulons. On the basis of the PePPER output, biologist can design experiments to further verify the existence and extent of the proposed regulons. The PePPER webserver is freely accessible at http://pepper.molgenrug.nl. PMID:22747501

  9. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  10. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  11. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  12. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  13. Identification of a stage selector element in the human gamma-globin gene promoter that fosters preferential interaction with the 5' HS2 enhancer when in competition with the beta-promoter.

    PubMed

    Jane, S M; Ney, P A; Vanin, E F; Gumucio, D L; Nienhuis, A W

    1992-08-01

    The erythroid-specific enhancer within hypersensitivity site 2 (HS2) of the human beta-globin locus control region is required for high level globin gene expression. We investigated interaction between HS2 and the gamma- and beta-promoters using reporter constructs in transient assays in human erythroleukemia (K562) cells. The beta-promoter, usually silent in K562 cells, was activated by HS2. This activity was abolished when a gamma-promoter was linked in cis. Analysis of truncation mutants suggested that sequences conveying the competitive advantage of the gamma-promoter for HS2 included those between positions -53 and -35 relative to the transcriptional start site. This sequence, when used to replace the corresponding region of the beta-promoter, increased beta-promoter activity 10-fold when linked to HS2. The modified beta-promoter was also capable of competing with a gamma-promoter modified internally in the -53 to -35 region, when the two promoters were linked to HS2 in a single plasmid. The corresponding sequences from the Galago gamma-promoter, a species which lacks fetal gamma-gene expression, were inactive in analogous assays. We have identified and partially purified a nuclear protein found in human (fetal stage) erythroleukemia cells, but present in much lower concentration in murine (adult stage) erythroleukemia cells, that binds the -53 to -35 sequence of the gamma-promoter. We speculate that this region of the gamma-promoter functions as a stage selector element in the regulation of hemoglobin switching in humans. PMID:1639067

  14. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  15. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes.

    PubMed

    Müller, Gerd A; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A; Engeland, Kurt

    2012-02-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G(0)/G(1). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G(0). Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G(0)/G(1), but also for activation in S, G(2) and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  16. Distal apolipoprotein C-III regulatory elements F to J act as a general modular enhancer for proximal promoters that contain hormone response elements. Synergism between hepatic nuclear factor-4 molecules bound to the proximal promoter and distal enhancer sites.

    PubMed

    Kardassis, D; Tzameli, I; Hadzopoulou-Cladaras, M; Talianidis, I; Zannis, V

    1997-01-01

    Transient transfection assays have shown that the distal apoC-III promoter segments that contain the regulatory elements F to J enhance the strength of the tandemly linked proximal apoA-I promoter 5- to 13-fold in hepatic (HepG2) cells. Activation in intestinal (CaCo-2) cells to levels comparable to those obtained in HepG2 cells requires a larger apoA-I promoter sequence that extends to nucleotide -1500 as well as the presence of hepatic nuclear factor-4 (HNF-4). The distal apoC-III regulatory elements can also enhance 4- to 8-fold the strength of the heterologous apoB promoter in HepG2 and CaCo-2 cells. Finally, these elements in the presence of HNF-4 enhance 14.5- to 18.5-fold the strength of the minimal adenovirus major late promoter linked to two copies of the hormone response element (HRE) AID of apoA-I in both HepG2 and CaCo-2 cells. In vitro mutagenesis of the promoter/enhancer cluster established that the enhancer activity is lost by a mutation in the HRE present in the 3' end of the regulatory element I (-736 to -714) and is reduced significantly by point mutations or deletions in one or more of the regulatory elements F to J of the apoC-III enhancer. The enhancer activity also requires the HREs of the proximal apoA-I promoter. The apoC-III enhancer can also restore the activity of the proximal apoA-I and apoB promoters that have been inactivated by mutations in CCAAT/enhancers binding protein binding sites, indicating that C/EBP may not participate in the synergistic activation of the promoter/enhancer cluster. The findings suggest that the regulatory elements F to J of the apoC-III promoter act as a general modular enhancer that can potentiate the strength of proximal promoters that contain HREs. Such potentiation in the HepG2 cells can be accounted for by synergistic interactions between HNF-4 or other nuclear hormone receptors bound to the proximal and distal HREs and SP1 or other factors bound to the apoC-III enhancer. Additional factors may be

  17. Interaction of basal positive and negative transcription elements controls repression of the proximal rat prolactin promoter in nonpituitary cells.

    PubMed Central

    Jackson, S M; Keech, C A; Williamson, D J; Gutierrez-Hartmann, A

    1992-01-01

    The proximal rat prolactin (rPRL) promoter contains three cell-specific elements, designated footprints I, III, and IV, which restrict rPRL gene expression to anterior pituitary lactotroph cells. Footprint II (-130 to -120) binds a factor, which we have termed F2F, present in pituitary and nonpituitary cell types. Here we demonstrate that a key role of the footprint II site is to inhibit rPRL promoter activity in nonpituitary cells, specifically, by interfering with the basal activating function of a vicinal element. Gene transfer analysis revealed 20-fold activation of the rPRL promoter in nonpituitary cell types when footprint II was either deleted or specifically mutated. Similar activation of the intact rPRL promoter was obtained by in vivo F2F titration studies. In GH4 rat pituitary cells, the footprint II inhibitory activity was masked by the redundant, positively acting cell-specific elements and was inhibitory only if the two upstream sites, footprints III and IV, were deleted. Deletion of the -112 to -80 region in the footprint II site-specific mutant background resulted in complete loss of rPRL promoter activity in both pituitary and nonpituitary cell types, mapping a basal activating element that is operative irrespective of cell type to this region. While the basal activating element imparted an activating function in a heterologous promoter assay, the footprint II sequence did not display any inherent repressor function and actually induced several minimal heterologous promoters. However, the inhibitory activity of the footprint II site was detected only if it was in context with the basal activating element. These data underscore the importance of ubiquitous activating and inhibitory factors in establishing cell-specific gene expression and further emphasize the complexity of the molecular mechanisms which restrict gene expression to specific cell types. We provide a novel paradigm to study rPRL promoter function and hormone responsiveness

  18. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa

    PubMed Central

    Liu, Shaoqing; Dong, Lei; Liu, Chunying; Song, Wenwen; Liu, Jingjing; Gai, Shupeng

    2016-01-01

    The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release. PMID:27228117

  19. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    PubMed

    Zhang, Yuxi; Sun, Tingzhao; Liu, Shaoqing; Dong, Lei; Liu, Chunying; Song, Wenwen; Liu, Jingjing; Gai, Shupeng

    2016-01-01

    The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release. PMID:27228117

  20. Phorbol 12-myristate 13-acetate promotes nuclear translocation of hepatic steroid response element binding protein-2.

    PubMed

    Wong, Tsz Yan; Tan, Yan Qin; Lin, Shu-Mei; Leung, Lai K

    2016-06-01

    Sterol regulatory element-binding protein (SREBP)-2 is a pivotal transcriptional factor in cholesterol metabolism. Factors interfering with the proper functioning of SREBP-2 potentially alter plasma lipid profiles. Phorbol 12-myristate 13-acetate (PMA), which is a common protein kinase C (PKC) activator, was shown to promote the post-translational processing and nuclear translocation of SREBP-2 in hepatic cells in the current study. Following SREBP-2 translocation, the transcripts of its target genes HMGCR and LDLR were upregulated as demonstrated by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay. Electrophoretic mobility shift assays (EMSA) also demonstrated an induced DNA-binding activity on the sterol response element (SRE) domain under PMA treatment. The increase of activated Srebp-2 without the concurrent induced mRNA expression was also observed in an animal model. As the expression of SREBP-2 was not increased by PMA, the activation of PKC was the focus of investigation. Specific PKC isozyme inhibition and overexpression supported that PKCβ was responsible for the promoting effect. Further studies showed that the mitogen-activated protein kinases (MAPKs) extracellular signal-regulated kinases (ERK) and c-Jun N-terminal kinases (JNK), but not 5' adenosine monophosphate-activated protein kinase (AMPK), were the possible downstream signaling proteins of PKCβ. In conclusion, this study illustrated that PKCβ increased SREBP-2 nuclear translocation in a pathway mediated by MEK/ERK and JNK, rather than the one dictated by AMPK. These results revealed a novel signaling target of PKCβ in the liver cells. PMID:27032751

  1. Structural basis for LIN54 recognition of CHR elements in cell cycle-regulated promoters

    PubMed Central

    Marceau, Aimee H.; Felthousen, Jessica G.; Goetsch, Paul D.; Iness, Audra N.; Lee, Hsiau-Wei; Tripathi, Sarvind M.; Strome, Susan; Litovchick, Larisa; Rubin, Seth M.

    2016-01-01

    The MuvB complex recruits transcription factors to activate or repress genes with cell cycle-dependent expression patterns. MuvB contains the DNA-binding protein LIN54, which directs the complex to promoter cell cycle genes homology region (CHR) elements. Here we characterize the DNA-binding properties of LIN54 and describe the structural basis for recognition of a CHR sequence. We biochemically define the CHR consensus as TTYRAA and determine that two tandem cysteine rich regions are required for high-affinity DNA association. A crystal structure of the LIN54 DNA-binding domain in complex with a CHR sequence reveals that sequence specificity is conferred by two tyrosine residues, which insert into the minor groove of the DNA duplex. We demonstrate that this unique tyrosine-mediated DNA binding is necessary for MuvB recruitment to target promoters. Our results suggest a model in which MuvB binds near transcription start sites and plays a role in positioning downstream nucleosomes. PMID:27465258

  2. Identification of regulatory elements in the AGT1 promoter of ale and lager strains of brewer's yeast.

    PubMed

    Vidgren, Virve; Kankainen, Matti; Londesborough, John; Ruohonen, Laura

    2011-08-01

    Agt1 is an interesting α-glucoside transporter for the brewing industry, as it efficiently transports maltotriose, a sugar often remaining partly unused during beer fermentation. It has been shown that on maltose the expression level of AGT1 is much higher in ale strains than in lager strains, and that glucose represses the expression, particularly in the ale strains. In the present study the regulatory elements of the AGT1 promoter of one ale and two lager strains were identified by computational methods. Promoter regions up to 1.9 kbp upstream of the AGT1 gene were sequenced from the three brewer's yeast strains and the laboratory yeast strain CEN.PK-1D. The promoter sequence of the laboratory strain was identical to the AGT1 promoter of strain S288c of the Saccharomyces Genome Database, whereas the promoter sequences of the industrial strains diverged markedly from the S288c strain. The AGT1 promoter regions of the ale and lager strains were for the most part identical to each other, except for one 22 bp deletion and two 94 and 95 bp insertions in the ale strain. Computational analyses of promoter elements revealed that the promoter sequences contained several Mig1- and MAL-activator binding sites, as was expected. However, some of the Mig1 and MAL-activator binding sites were located on the two insertions of the ale strain, and thus offered a plausible explanation for the different expression pattern of the AGT1 gene in the ale strains. Accordingly, functional analysis of A60 ale and A15 lager strain AGT1 promoters fused to GFP (encoding the green fluorescent protein) showed a significant difference in the ability of these two promoters to drive GFP expression. Under the control of the AGT1 promoter of the ale strain the emergence of GFP was strongly induced by maltose, whereas only a low level of GFP was detected with the construct carrying the AGT1 promoter of the lager strain. Thus, the extra MAL-activator binding element, present in the AGT1 promoter of

  3. 10 CFR 719.21 - What are the required elements of an engagement letter?

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 4 2011-01-01 2011-01-01 false What are the required elements of an engagement letter? 719.21 Section 719.21 Energy DEPARTMENT OF ENERGY CONTRACTOR LEGAL MANAGEMENT REQUIREMENTS Engagement Letters § 719.21 What are the required elements of an engagement letter? (a) The engagement letter...

  4. 10 CFR 719.21 - What are the required elements of an engagement letter?

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 4 2012-01-01 2012-01-01 false What are the required elements of an engagement letter? 719.21 Section 719.21 Energy DEPARTMENT OF ENERGY CONTRACTOR LEGAL MANAGEMENT REQUIREMENTS Engagement Letters § 719.21 What are the required elements of an engagement letter? (a) The engagement letter...

  5. 10 CFR 719.21 - What are the required elements of an engagement letter?

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 4 2013-01-01 2013-01-01 false What are the required elements of an engagement letter? 719.21 Section 719.21 Energy DEPARTMENT OF ENERGY CONTRACTOR LEGAL MANAGEMENT REQUIREMENTS Engagement Letters § 719.21 What are the required elements of an engagement letter? (a) The engagement letter...

  6. 10 CFR 719.21 - What are the required elements of an engagement letter?

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 4 2014-01-01 2014-01-01 false What are the required elements of an engagement letter? 719.21 Section 719.21 Energy DEPARTMENT OF ENERGY CONTRACTOR LEGAL MANAGEMENT REQUIREMENTS Engagement Letter § 719.21 What are the required elements of an engagement letter? (a) The engagement letter...

  7. 10 CFR 719.21 - What are the required elements of an engagement letter?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false What are the required elements of an engagement letter? 719.21 Section 719.21 Energy DEPARTMENT OF ENERGY CONTRACTOR LEGAL MANAGEMENT REQUIREMENTS Engagement Letters § 719.21 What are the required elements of an engagement letter? (a) The engagement letter...

  8. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 3 2011-01-01 2011-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  9. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  10. Casein Kinase 1 and Phosphorylation of Cohesin Subunit Rec11 (SA3) Promote Meiotic Recombination through Linear Element Formation

    PubMed Central

    Phadnis, Naina; Cipak, Lubos; Polakova, Silvia; Hyppa, Randy W.; Cipakova, Ingrid; Anrather, Dorothea; Karvaiova, Lucia; Mechtler, Karl

    2015-01-01

    Proper meiotic chromosome segregation, essential for sexual reproduction, requires timely formation and removal of sister chromatid cohesion and crossing-over between homologs. Early in meiosis cohesins hold sisters together and also promote formation of DNA double-strand breaks, obligate precursors to crossovers. Later, cohesin cleavage allows chromosome segregation. We show that in fission yeast redundant casein kinase 1 homologs, Hhp1 and Hhp2, previously shown to regulate segregation via phosphorylation of the Rec8 cohesin subunit, are also required for high-level meiotic DNA breakage and recombination. Unexpectedly, these kinases also mediate phosphorylation of a different meiosis-specific cohesin subunit Rec11. This phosphorylation in turn leads to loading of linear element proteins Rec10 and Rec27, related to synaptonemal complex proteins of other species, and thereby promotes DNA breakage and recombination. Our results provide novel insights into the regulation of chromosomal features required for crossing-over and successful reproduction. The mammalian functional homolog of Rec11 (STAG3) is also phosphorylated during meiosis and appears to be required for fertility, indicating wide conservation of the meiotic events reported here. PMID:25993311

  11. Overlap of Viviparous1 (VP1) and abscisic acid response elements in the Em promoter: G-box elements are sufficient but not necessary for VP1 transactivation.

    PubMed Central

    Vasil, V; Marcotte, W R; Rosenkrans, L; Cocciolone, S M; Vasil, I K; Quatrano, R S; McCarty, D R

    1995-01-01

    The relationship between promoter sequences that mediate Viviparous1 (VP1) transactivation and regulation by abscisic acid (ABA) in the wheat Em promoter was investigated using deletion analysis and directed mutagenesis. The Em1a G-box is strongly coupled to VP1 transactivation as well as to ABA regulation; however, the Em promoter includes additional components that can support VP1 transactivation without ABA responsiveness or synergism. Oligonucleotide tetramers of several G-box sequences, including Em1a, Em1b, and the dyad G-box element from the UV light-regulated parsley chalcone synthase gene, were sufficient to confer VP1 transactivation and the synergistic interaction with ABA to the -45 cauliflower mosaic virus 35S core promoter. These data suggest that VP1 can activate transcription through at least two classes of cis-acting sequences, including the G-box elements and the Sph regulatory motif found in the C1 promoter. The contrasting roles of these motifs in the Em and C1 promoters suggest a basis for the differential regulation of the corresponding genes by VP1. PMID:8589631

  12. KLF6 cooperates with NUR77 and SF1 to activate the human INSL3 promoter in mouse MA-10 leydig cells.

    PubMed

    Tremblay, Maxime A; Mendoza-Villarroel, Raifish E; Robert, Nicholas M; Bergeron, Francis; Tremblay, Jacques J

    2016-04-01

    Insulin-like 3 (INSL3), a Leydig cell-specific hormone, is essential for testis descent during foetal life and bone metabolism in adults. Despite its essential roles in male reproductive and bone health, very little is known regarding its transcriptional regulation in Leydig cells. To date, few transcription factors have been shown to activate INSL3 promoter activity: the nuclear receptors AR, NUR77, COUP-TFII and SF1. To identify additional regulators, we have isolated and performed a detailed analysis of a 1.1 kb human INSL3 promoter fragment. Through 5' progressive deletions and site-directed mutagenesis, we have mapped a 10 bp element responsible for about 80% of INSL3 promoter activity in Leydig cells. This element is identical to the CPE element of the placental-specific glycoprotein-5 (PSG5) promoter that is recognized by the developmental regulator Krüppel-like factor 6 (KLF6). Using PCR and western blotting, we found that KLF6 is expressed in several Leydig and Sertoli cell lines. Furthermore, immunohistochemistry on adult mouse testis revealed the presence of KLF6 in the nuclei of both Leydig and Sertoli cells. KLF6 binds to the 10 bp KLF element at -108 bp and activates the -1.1 kb human, but not the mouse, INSL3 promoter. KLF6-mediated activation of the human INSL3 promoter required an intact KLF element as well as Leydig/Sertoli-enriched factors because KLF6 did not stimulate the human INSL3 promoter activity in CV-1 fibroblast cells. Consistent with this, we found that KLF6 transcriptionally cooperates with NUR77 and SF1. Collectively, our results identify KLF6 as a regulator of human INSL3 transcription. PMID:26874000

  13. Heat shock stimulation of a tilapia heat shock protein 70 promoter is mediated by a distal element.

    PubMed Central

    Molina, A; Di Martino, E; Martial, J A; Muller, M

    2001-01-01

    We reported previously that a tilapia (Oreochromis mossambicus) heat shock protein 70 (HSP70) promoter is able to confer heat shock response on a reporter gene after transient expression both in cell culture and in microinjected zebrafish embryos. Here we present the first functional analysis of a fish HSP70 promoter, the tiHSP70 promoter. Using transient expression experiments in carp EPC (epithelioma papulosum cyprini) cells and in microinjected zebrafish embryos, we show that a distal heat shock response element (HSE1) at approx. -800 is predominantly responsible for the heat shock response of the tiHSP70 promoter. This element specifically binds an inducible transcription factor, most probably heat shock factor, and a constitutive factor. The constitutive complex is not observed with the non-functional, proximal HSE3 sequence, suggesting that both factors are required for the heat shock response mediated by HSE1. PMID:11368761

  14. Activation of matrix metalloproteinase-26 by HOXA10 promotes embryo adhesion in vitro.

    PubMed

    Jiang, Yue; Yan, Guijun; Zhang, Hui; Shan, Huizhi; Kong, Chengcai; Yan, Qiang; Xue, Bai; Diao, Zhenyu; Hu, Yali; Sun, Haixiang

    2014-03-14

    Successful embryonic implantation requires an effective maternal-embryonic molecular dialogue. However, the detailed mechanisms of epithelial-embryo adhesion remain poorly understood. Here, we report that matrix metalloproteinase-26 (MMP-26) is a novel downstream target gene of homeobox a 10 (HOXA10) in human endometrial cells. HOXA10 binds directly to a conserved TTAT unit (-442 to -439) located within the 5' regulatory region of the MMP-26 gene and regulates the expression and secretion of MMP-26 in a concentration-dependent manner. Moreover, the adenovirus-mediated overexpression of MMP-26 in Ishikawa cells markedly increased BeWo spheroid adhesion. An antibody blocking assay further demonstrated that the promotion of BeWo spheroid adhesion by HOXA10 and MMP-26 was significantly inhibited by pre-treatment with a specific antibody against MMP-26. These results demonstrate that the HOXA10-mediated expression of MMP-26 promotes embryo adhesion during the process of embryonic implantation. PMID:24565841

  15. Convergent transcription initiates from oppositely oriented promoters within the 5 prime end regions of Drosophila melanogaster F elements

    SciTech Connect

    Minchiotti, G. ); Di Nocera, P.P. )

    1991-10-01

    Drosophila melanogaster F elements are mobile, oligo(A)-terminated DNA sequences that likely propagate by the retrotranscription of RNA intermediates. Plasmids bearing DNA segments from the left-hand region of a full-length F element fused to the CAT gene were used as templates for transient expression assays in Drosophila Schneider II cultured cells. Protein and RNA analyses led to the identification of two promoters, F{sub in} and F{sub out}, that transcribe in opposite orientations. Analysis of the template activity of 3{prime} deletion derivatives indicates that the level of accumulation of F{sub in}RNA is also dependent upon the presence of sequences located within the +175 to +218 interval. The F{sub out} promoter drives transcription in the opposite orientation with respect to F{sub in}, F{sub out} transcripts initiate at nearby sites within the +92 to +102 interval. Sequences downstream of these multiple RNA start sites are not required for the activity of the F{sub out} promoter. Deletions knocking out the F{sub in} promoter do not impair F{sub out} transcription; conversely, initiation at the F{sub in} promoter still takes place in templates that lack the F{sub out} promoter. At a low level, both promoters are active in cultured cells.

  16. Interleukin 10 promoter region polymorphisms and susceptibility to advanced alcoholic liver disease

    PubMed Central

    Grove, J; Daly, A; Bassendine, M; Gilvarry, E; Day, C

    2000-01-01

    BACKGROUND—The factors determining why less than 10% of heavy drinkers develop advanced alcoholic liver disease (ALD) remain elusive, although genetic factors may be important. Interleukin 10 (IL-10) is an important cytokine with anti-inflammatory, anti-immune, and antifibrotic functions. Several polymorphisms have been identified in the IL-10 promoter and recent evidence suggests that some of these may have functional effects on IL-10 secretion.
AIMS—To test the hypothesis that IL-10 promoter region polymorphisms are associated with susceptibility to ALD.
METHODS—The allele frequencies for the two single base pair substitutions at positions −627 (C→A) and −1117 (A→G) in the IL-10 promoter were determined in 287 heavy drinkers with biopsy proved advanced ALD, 107 heavy drinkers with no evidence of liver disease or steatosis only on biopsy, and 227 local healthy volunteers.
RESULTS—At position −627, 50% of patients with advanced ALD had a least one A allele compared with 33% of controls (p<0.0001) and 34% of drinkers with no or mild disease (p=0.017). At position −1117, the slight excess of the A allele in drinkers with advanced disease was because of linkage disequilibrium between the A alleles at the two sites.
CONCLUSIONS—Among heavy drinkers, possession of the A allele at position −627 in the IL-10 promoter is associated with an increased risk of advanced liver disease. This is consistent with recent functional data that the −627*A allele is associated with low IL-10 expression which will favour inflammatory, immune mediated, and profibrotic mechanisms of alcohol related liver injury.


Keywords: ethyl alcohol; cirrhosis; interleukin 10; genetic polymorphism PMID:10716685

  17. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.

    PubMed

    Rushton, P J; Hooley, R; Lazarus, C M

    1992-09-01

    Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes. PMID:1511135

  18. Promotion

    PubMed Central

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed. PMID:24436683

  19. Sequences far downstream from the classical tRNA promoter elements bind RNA polymerase III transcription factors.

    PubMed Central

    Young, L S; Rivier, D H; Sprague, K U

    1991-01-01

    We have examined the interaction of transcription factors TFIIIC and TFIIID with a silkworm alanine tRNA gene. Previous functional analysis showed that the promoter for this gene is unusually large compared with the classical tRNA promoter elements (the A and B boxes) and includes sequences downstream from the transcription termination site. The goal of the experiments reported here was to determine which sequences within the full promoter make stable contacts with transcription factors. We show that when TFIIIC and TFIIID are combined, a complex is formed with the tRNA(Ala)C gene. Neither factor alone can form this complex. DNase I digestion of gene-factor complexes reveals that most of the tRNA(Ala)C promoter is in contact with factors. The protected region extends from -1 to at least +136 and includes both the A and B boxes and the previously identified downstream promoter sequences. Analysis of mutant promoters shows that sequence-specific contacts throughout the protected region are required for binding. The role of 3'-flanking sequences in transcription factor binding explains the contribution of these sequences to the tRNA(Ala)C promoter. We discuss the possibility that such sequences affect promoter strength in other tRNA genes. Images PMID:1996100

  20. Trace elements and lead isotopic composition of PM 10 in Lhasa, Tibet

    NASA Astrophysics Data System (ADS)

    Cong, Zhiyuan; Kang, Shichang; Luo, Chunling; Li, Qing; Huang, Jie; Gao, Shaopeng; Li, Xiangdong

    2011-11-01

    This paper presents the first detailed investigation on airborne trace metals and their potential major sources at Lhasa, the largest city in Tibetan Plateau (TP). The whole year PM 10 samples were collected during September 2007 and August 2008. The annual average concentration of PM 10 in Lhasa was 51.8 ± 42.5 μg m -3, lower than those of major Asian cities. Distinct seasonal patterns were observed in PM 10 concentration, with higher concentrations in winter, and lower in summer. The mean elemental concentrations were generally comparable with other urban areas, but significantly higher than those from a remote site in TP (i.e., Nam Co). Crustal elements, including Na, Mg, Al, K, Ca, Sc, Ti, V, Mn, Fe, As and Ba, had similar seasonal patterns in PM 10, while other elements, such as Cr, Co, Ni, Cu, Zn, and Cd, had less distinct seasonal variations, suggesting more anthropogenic inputs of the latter group. The result of principle component analysis (PCA) on trace elements demonstrated that fugitive dusts, traffic emissions and waste incineration activities were probably the major sources of anthropogenic metals in the atmosphere at Lhasa. The Pb isotopic compositions revealed that the metal was mainly originated from nature background with a minor contribution from the cement factory. The data obtained in this study can be useful for making pollution control strategies in the city, and also valuable for trace element studies in other environmental medium, such as snow, ice core, and lake sediments in the TP region.

  1. Far upstream element-binding protein 1 is a prognostic biomarker and promotes nasopharyngeal carcinoma progression

    PubMed Central

    Liu, Z-H; Hu, J-L; Liang, J-Z; Zhou, A-J; Li, M-Z; Yan, S-M; Zhang, X; Gao, S; Chen, L; Zhong, Q; Zeng, M-S

    2015-01-01

    Nasopharyngeal carcinoma (NPC) is a malignant epithelial tumor with tremendous invasion and metastasis capacities, and it has a high incidence in southeast Asia and southern China. Previous studies identified that far upstream element-binding protein 1 (FBP1), a transcriptional regulator of c-Myc that is one of the most frequently aberrantly expressed oncogenes in various human cancers, including NPC, is an important biomarker for many cancers. Our study aimed to investigate the expression and function of FBP1 in human NPC. Quantitative real-time RT-PCR (qRT-PCR), western blot and immunohistochemical staining (IHC) were performed in NPC cells and biopsies. Furthermore, the effect of FBP1 knockdown on cell proliferation, colony formation, side population tests and tumorigenesis in nude mice were measured by MTT, clonogenicity analysis, flow cytometry and a xenograft model, respectively. The results showed that the mRNA and protein levels of FBP1, which are positively correlated with c-Myc expression, were substantially higher in NPC than that in nasopharyngeal epithelial cells. IHC revealed that the patients with high FBP1 expression had a significantly poorer prognosis compared with the patients with low expression (P=0.020). In univariate analysis, high FBP1 and c-Myc expression predicted poorer overall survival (OS) and poorer progression-free survival. Multivariate analysis indicated that high FBP1 and c-Myc expression were independent prognostic markers. Knockdown of FBP1 reduced cell proliferation, clonogenicity and the ratio of side populations, as well as tumorigenesis in nude mice. These data indicate that FBP1 expression, which is closely correlated with c-Myc expression, is an independent prognostic factor and promotes NPC progression. Our results suggest that FBP1 can not only serve as a useful prognostic biomarker for NPC but also as a potential therapeutic target for NPC patients. PMID:26469968

  2. cis-acting elements that confer lung epithelial cell expression of the CC10 gene.

    PubMed

    Stripp, B R; Sawaya, P L; Luse, D S; Wikenheiser, K A; Wert, S E; Huffman, J A; Lattier, D L; Singh, G; Katyal, S L; Whitsett, J A

    1992-07-25

    To define cis-acting genetic elements responsible for cell-specific transcriptional regulation of the CC10 gene, DNA sequences spanning nucleotides -2338 to +49 of the rat CC10 gene were linked to a reporter gene coding for chloramphenicol acetyltransferase (CAT). In transient expression assays, CC10 sequences were capable of restricting CAT expression to a human lung adenocarcinoma cell line similar to pulmonary Clara cells. Transgenic mice harboring the hybrid RtCC10-CAT construct expressed high levels of CAT activity specifically within protein extracts of lung and trachea. Transcripts for the CAT reporter gene colocalized with those for the endogenous murine CC10 gene within the airways of transgenic mice. Functional analysis of deletion mutants identified stimulatory, inhibitory, and cell type-specific transcriptional regulatory elements. The results of gel retention and DNaseI protection assays suggest that a transcriptional stimulatory region located between -320 and -175, and a cell type-specific regulatory element located between -175 and +49, result from a series of protein-DNA interactions occurring at -220 to -205 and -128 to -86, respectively. Lung epithelial specific transcriptional regulatory elements described herein will be useful for expression of chimeric genes within epithelial cells lining the trachea, bronchi, and bronchioles of mice. PMID:1634515

  3. Identification of a functional antioxidant responsive element in the promoter of the Chinese hamster carbonyl reductase 3 (Chcr3) gene.

    PubMed

    Miura, Takeshi; Taketomi, Ayako; Nakabayashi, Toshikatsu; Nishinaka, Toru; Terada, Tomoyuki

    2015-07-01

    CHCR3, a member of the short-chain dehydrogenase/reductase superfamily, is a carbonyl reductase 3 enzyme in Chinese hamsters. Carbonyl reductase 3 in humans has been believed to involve the metabolism and/or pharmacokinetics of anthracycline drugs, and the mechanism underlying the gene regulation has been investigated. In this study, the nucleotide sequence of the Chcr3 promoter was originally determined, and its promoter activity was characterised. The proximal promoter region is TATA-less and GC-rich, similar to the promoter region of human carbonyl reductase 3. Cobalt stimulated the transcriptional activity of the Chcr3 gene. The results of a luciferase gene reporter assay demonstrated that cobalt-induced stimulation required an antioxidant responsive element. Forced expression of Nrf2, the transcription factor that binds to antioxidant responsive elements, enhanced the transcriptional activity of the Chcr3 gene. These results suggest that cobalt induces the expression of the Chcr3 gene via the Nrf2-antioxidant responsive element pathway. PMID:25677373

  4. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    PubMed

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. PMID:22389214

  5. Wnt-10b promotes differentiation of skin epithelial cells in vitro

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-03-31

    To evaluate the role of Wnt-10b in epithelial differentiation, we investigated the effects of Wnt-10b on adult mouse-derived primary skin epithelial cells (MPSEC). Recombinant Wnt-10b protein (rWnt-10b) was prepared using a gene engineering technique and MPSEC were cultured in its presence, which resulted in morphological changes from cuboidal to spindle-shaped and inhibited their proliferation. Further, involvement of the canonical Wnt signal pathway was also observed. MPSEC treated with rWnt-10b showed characteristics of the hair shaft and inner root sheath of the hair follicle, in results of Ayoub Shklar staining and immunocytochemistry. Further, the cells expressed mRNA for differentiated epithelial cells, including keratin 1, keratin 2, loricrin, mHa5, and mHb5, in association with a decreased expression of the basal cell marker keratin 5. These results suggest that Wnt-10b promotes the differentiation of MPSEC.

  6. Technical advance: stringent control of transgene expression in Arabidopsis thaliana using the Top10 promoter system

    NASA Technical Reports Server (NTRS)

    Love, J.; Scott, A. C.; Thompson, W. F.; Brown, C. S. (Principal Investigator)

    2000-01-01

    We show that the tightly regulated tetracycline-sensitive Top10 promoter system (Weinmann et al. Plant J. 1994, 5, 559-569) is functional in Arabidopsis thaliana. A pure breeding A. thaliana line (JL-tTA/8) was generated which expressed a chimeric fusion of the tetracycline repressor and the activation domain of Herpes simplex virus (tTA), from a single transgenic locus. Plants from this line were crossed with transgenics carrying the ER-targeted green fluorescent protein coding sequence (mGFP5) under control of the Top10 promoter sequence. Progeny from this cross displayed ER-targeted GFP fluorescence throughout the plant, indicating that the tTA-Top10 promoter interaction was functional in A. thaliana. GFP expression was repressed by 100 ng ml-1 tetracycline, an order of magnitude lower than the concentration used previously to repress expression in Nicotiana tabacum. Moreover, the level of GFP expression was controlled by varying the concentration of tetracycline in the medium, allowing a titred regulation of transgenic activity that was previously unavailable in A. thaliana. The kinetics of GFP activity were determined following de-repression of the Top10:mGFP5 transgene, with a visible ER-targeted GFP signal appearing from 24 to 48 h after de-repression.

  7. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... effectiveness of methods for manufacturing new energy technologies; (v) Assist small and start-up businesses in... 10 Energy 3 2010-01-01 2010-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula...

  8. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... effectiveness of methods for manufacturing new energy technologies; (v) Assist small and start-up businesses in... 10 Energy 3 2011-01-01 2011-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula...

  9. Positive feedback regulation between IL10 and EGFR promotes lung cancer formation

    PubMed Central

    Hsu, Tsung-I; Wang, Yi-Chang; Hung, Chia-Yang; Yu, Chun-Hui; Su, Wu-Chou; Chang, Wen-Chang; Hung, Jan-Jong

    2016-01-01

    The role of IL10 in the tumorigenesis of various cancer types is still controversial. Here, we found that increased IL10 levels are correlated with a poor prognosis in lung cancer patients. Moreover, IL10 levels were significantly increased in the lungs and serum of EGFRL858R- and Kras4bG12D-induced lung cancer mice, indicating that IL10 might facilitate lung cancer tumorigenesis. IL10 knockout in EGFRL858R and Kras4bG12D mice inhibited the development of lung tumors and decreased the levels of infiltrating M2 macrophages and tumor-promoting Treg lymphocytes. We also showed that EGF increases IL10 expression by enhancing IL10 mRNA stability, and IL10 subsequently activates JAK1/STAT3, Src, PI3K/Akt, and Erk signaling pathways. Interestingly, the IL10-induced recruitment of phosphorylated Src was critical for inducing EGFR through the activation of the JAK1/STAT3 pathway, suggesting that Src and JAK1 positively regulate each other to enhance STAT3 activity. Doxycycline-induced EGFRL858R mice treated with gefitinib and anti-IL10 antibodies exhibited poor tumor formation. In conclusion, IL10 and EGFR regulate each other through positive feedback, which leads to lung cancer formation. PMID:26956044

  10. Positive feedback regulation between IL10 and EGFR promotes lung cancer formation.

    PubMed

    Hsu, Tsung-I; Wang, Yi-Chang; Hung, Chia-Yang; Yu, Chun-Hui; Su, Wu-Chou; Chang, Wen-Chang; Hung, Jan-Jong

    2016-04-12

    The role of IL10 in the tumorigenesis of various cancer types is still controversial. Here, we found that increased IL10 levels are correlated with a poor prognosis in lung cancer patients. Moreover, IL10 levels were significantly increased in the lungs and serum of EGFRL858R- and Kras4bG12D-induced lung cancer mice, indicating that IL10 might facilitate lung cancer tumorigenesis. IL10 knockout in EGFRL858R and Kras4bG12D mice inhibited the development of lung tumors and decreased the levels of infiltrating M2 macrophages and tumor-promoting Treg lymphocytes. We also showed that EGF increases IL10 expression by enhancing IL10 mRNA stability, and IL10 subsequently activates JAK1/STAT3, Src, PI3K/Akt, and Erk signaling pathways. Interestingly, the IL10-induced recruitment of phosphorylated Src was critical for inducing EGFR through the activation of the JAK1/STAT3 pathway, suggesting that Src and JAK1 positively regulate each other to enhance STAT3 activity. Doxycycline-induced EGFRL858R mice treated with gefitinib and anti-IL10 antibodies exhibited poor tumor formation. In conclusion, IL10 and EGFR regulate each other through positive feedback, which leads to lung cancer formation. PMID:26956044

  11. Association of interleukin-10 promoter haplotypes with disease susceptibility and IL-10 levels in Mexican patients with systemic lupus erythematosus.

    PubMed

    Palafox-Sánchez, Claudia Azucena; Oregon-Romero, Edith; Salazar-Camarena, Diana Celeste; Valle, Yeminia Maribel; Machado-Contreras, Jesús René; Cruz, Alvaro; Orozco-López, Mariana; Orozco-Barocio, Gerardo; Vázquez-Del Mercado, Mónica; Muñoz-Valle, José Francisco

    2015-11-01

    Systemic lupus erythematosus (SLE) is the prototype autoimmune rheumatic disease. The etiology of this disease is incompletely understood; however, environmental factors and genetic predisposition are involved. Cytokine-mediated immunity plays a crucial role in the pathogenesis of SLE. We investigate the association of interleukin-10 (IL-10) promoter polymorphisms and their haplotypes in SLE patients from the western Mexico. One hundred and twenty-five SLE patients fulfilling the 1997 ACR criteria and 260 unrelated healthy subjects (HS), both Mexican mestizos, were genotyped for IL-10 -1082A>G, -819C>T, and -592C>A polymorphisms. Haplotypes were inferred using the expectation-maximization algorithm, then allele and haplotype distributions were compared between patients and HS, as well as patients with different clinical variables. We identified at -1082, -819, and -592 four predominant haplotypes ACC (43.70 % in patients vs 46.55 % in HS), ATA (21.45 vs 22.97 %), GCC (16.28 vs 14.21 %), and GTA (14.12 vs 14.12 %). The ATC haplotype was more frequent in SLE respect to HS, suggesting a risk effect (3.23 vs 1.05 %; OR 3.55, CI 1.14-11.11; p = 0.0293). SLE patient carriers of -592 CC genotype as well as the dominant model of inheritance showed higher sIL-10 respect to AA genotype, suggesting that -592 C allele is associated with increased production of the cytokine (p < 0.05). The ACC haplotype had higher IL-10 serum levels and higher values of Mexican version of the Systemic Lupus Erythematosus Disease Activity Index compared with the other haplotype carriers; however, no association was found regarding autoantibodies. Our data suggest that the IL-10 promoter haplotypes play an important role in the risk of developing SLE and influence the production of IL-10 in Mexican population. Nevertheless, further studies are required to analyze the expression of mRNA as well as to investigate the interacting epigenetic factors that could help to define the true contribution of

  12. IL10 Promoter Polymorphisms are Associated with Rheumatic Heart Disease in Saudi Arabian Patients.

    PubMed

    Abdallah, Atiyeh M; Alnuzha, Aisha; Al-Mazroea, Abdulhadi H; Eldardear, Amr E; AlSamman, Ala Y; Almohammadi, Yousef; Al-Harbi, Khalid M

    2016-01-01

    Rheumatic heart disease (RHD) is an inflammatory disease that develops following streptococcal infections. IL10 helps to balance immune responses to pathogens. IL10 polymorphisms have been associated with RHD, although results remain inconclusive. Our aim was to investigate the association between IL10 polymorphisms and RHD in Saudi Arabian patients. IL10 promoter polymorphisms (-1082A/G, -829C/T, and -592C/A) were genotyped in 118 RHD patients and 200 matched controls using the TaqMan allelic discrimination assay. There was a significant difference in IL10-1082 genotype frequency between patients and controls (p = 0.01). -1082G allele carriage (GG+GA vs AA) and the (-1082, -819, -592) GCC haplotype carriage were associated with an increased risk of RHD (p = 0.004, OR 2.1, 95% CIs 1.7-3.4 and p = 0.004, OR 2, 95% CIs 1.3-3.4, respectively). The ACC haplotype was associated with a decrease in RHD risk (p = 0.015, OR 0.6, 95% CIs 0.4-0.9). IL10 promoter polymorphisms may play an important role in the development of RHD and provide an opportunity for therapeutic stratification. PMID:26255050

  13. Wnt-10b secreted from lymphocytes promotes differentiation of skin epithelial cells

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-04-21

    Wnt-10b was originally isolated from lymphoid tissue and is known to be involved in a wide range of biological actions, while recently it was found to be expressed early in the development of hair follicles. However, few studies have been conducted concerning the role of Wnt-10b with the differentiation of skin epithelial cells. To evaluate its role in epithelial differentiation, we purified Wnt-10b from the supernatant of a concanavalin A-stimulated lymphocyte culture using an affinity column and investigated its effects on the differentiation of adult mouse-derived primary skin epithelial cells (MPSEC). MPSEC cultured with Wnt-10b showed morphological changes from cuboidal to spindle-shaped with inhibited proliferation, and also obtained characteristics of the hair shaft and inner root sheath of the hair follicle, represented by red-colored Ayoub Shklar staining, and reactions to AE-13 and AE-15 as seen with immunocytology. Further, RT-PCR analysis demonstrated the expression of mRNA for keratin 1, keratin 2, loricrin, mHa5, and mHb5, in association with a decreased expression of the basal cell marker keratin 5, in Wnt-10b-treated MPSEC. In addition, involvement of the canonical Wnt signal pathway was demonstrated by a TCF reporter (pTOPFLASH) assay. These results suggest that Wnt-10b promotes the differentiation of MPSEC and may play an important role in hair follicle development by promoting differentiation of epithelial cells.

  14. Mechanistic aspects of initiation and promotion in C3H/10T1/2 cells.

    PubMed

    Boreiko, C J

    1985-01-01

    The transformation of C3H/10T1/2 cells can be made to proceed through discrete stages of initiation and promotion. Studies of the effect of cell density upon focus formation in cultures treated with MNNG and TPA suggest that initiation by MNNG is due to a relatively infrequent, irreversible event induced by a single carcinogen treatment. In contrast, promotion appears to be a reversible process requiring multiple treatments with TPA over a protracted period of time. Some evidence suggests that promotion may entail the induction of phenotypic changes which impart a growth advantage to phenotypically unstable "initiated" cell populations. The actual cellular mechanism(s) for most of the phenomena observed in C3H/10T1/2 cultures have eluded precise definition and widely divergent hypotheses have been advanced to explain transformation, initiation, and promotion. Conceivably there are multiple mechanisms responsible for each of these phenomenon. Some agents may transform by a multistage mechanism whereas others may exert their effects in a more direct fashion. Some of the foci produced by promotion may be the result of simple selective processes, others the product of more complex inductive events. Variations would thus be expected between laboratories working with different protocols and agents. As demonstrated by the possible involvement of an MCA residue in transformation, it is also apparent that fundamental technical aspects of this conceptually simple cell transformation system are poorly understood. While it is natural to develop mechanistic models based on quantitative observations of transformation, a limited understanding of the basic cell culture variables which modulate both the induction and expression of transformation dictate that caution be exercised in extrapolating the significance of such models to in vivo carcinogenesis. PMID:4053071

  15. Disease-Regulated Gene Therapy with Anti-Inflammatory Interleukin-10 Under the Control of the CXCL10 Promoter for the Treatment of Rheumatoid Arthritis.

    PubMed

    Broeren, Mathijs G A; de Vries, Marieke; Bennink, Miranda B; Arntz, Onno J; Blom, Arjen B; Koenders, Marije I; van Lent, Peter L E M; van der Kraan, Peter M; van den Berg, Wim B; van de Loo, Fons A J

    2016-03-01

    Disease-inducible promoters for the treatment of rheumatoid arthritis (RA) have the potential to provide regulated expression of therapeutic proteins in arthritic joints. In this study, we set out to identify promoters of human genes that are upregulated during RA and are suitable to drive the expression of relevant amounts of anti-inflammatory interleukin (IL)-10. Microarray analysis of RA synovial biopsies compared with healthy controls yielded a list of 22 genes upregulated during RA. Of these genes, CXCL10 showed the highest induction in lipopolysaccharide-stimulated synovial cells. The CXCL10 promoter was obtained from human cDNA and cloned into a lentiviral vector carrying firefly luciferase to determine the promoter inducibility in primary synovial cells and in THP-1 cells. The promoter activation was strongest 8-12 hr after stimulation with the proinflammatory cytokine tumor necrosis factor (TNF)-α and was reinducible after 96 hr. In addition, the CXCL10 promoter showed a significant response to RA patient serum, compared with sera from healthy individuals. The luciferase gene was replaced with IL-10 to determine the therapeutic properties of the CXCL10p-IL10 lentiviral vector. Primary synovial cells transduced with CXCL10p-IL10 showed a great increase in IL-10 production after stimulation, which reduced the release of proinflammatory cytokines TNF-α and IL-1β. We conclude that the selected proximal promoter of the CXCL10 gene responds to inflammatory mediators present in the serum of patients with RA and that transduction with the lentiviral CXCL10p-IL10 vector reduces inflammatory cytokine production by primary synovial cells from patients with RA. CXCL10 promoter-regulated IL-10 overexpression can thus provide disease-inducible local gene therapy suitable for RA. PMID:26711533

  16. An interlaboratory comparison study on the measurement of elements in PM10

    NASA Astrophysics Data System (ADS)

    Yatkin, Sinan; Belis, Claudio A.; Gerboles, Michel; Calzolai, Giulia; Lucarelli, Franco; Cavalli, Fabrizia; Trzepla, Krystyna

    2016-01-01

    An inter-laboratory comparison study was conducted to measure elemental loadings on PM10 samples, collected in Ispra, a regional background/rural site in Italy, using three different XRF (X-ray Fluorescence) methods, namely Epsilon 5 by linear calibration, Quant'X by the standardless analysis, and PIXE (Particle Induced X-ray Emission) with linear calibration. A subset of samples was also analyzed by ICP-MS (Inductively Coupled Plasma-Mass Spectrometry). Several metrics including method detection limits (MDLs), precision, bias from a NIST standard reference material (SRM 2783) quoted values, relative absolute difference, orthogonal regression and the ratio of the absolute difference between the methods to claimed uncertainty were used to compare the laboratories. The MDLs were found to be comparable for many elements. Precision estimates were less than 10% for the majority of the elements. Absolute biases from SRM 2783 remained less than 20% for the majority of certified elements. The regression results of PM10 samples showed that the three XRF laboratories measured very similar mass loadings for S, K, Ti, Mn, Fe, Cu, Br, Sr and Pb with slopes within 20% of unity. The ICP-MS results confirmed the agreement and discrepancies between XRF laboratories for Al, K, Ca, Ti, V, Cu, Sr and Pb. The ICP-MS results are inconsistent with the XRF laboratories for Fe and Zn. The absolute differences between the XRF laboratories generally remained within their claimed uncertainties, showing a pattern generally consistent with the orthogonal regression results.

  17. Top 10 research questions to promote physical activity research in people with binge eating disorder.

    PubMed

    Vancampfort, Davy; Rosenbaum, Simon; Probst, Michel; Connaughton, Joanne; Du Plessis, Christy; Yamamoto, Taisei; Diedens, Jolien; Stubbs, Brendon

    2016-01-01

    Despite emerging evidence illustrating the benefits of physical activity for people with binge eating disorder, engaging this population in physical activity is challenging. The International Organization of Physical Therapists in Mental Health (IOPTMH) set out to summarize, appraise, and strengthen the direction of physical activity endeavors. This process led to the identification of 10 important research questions which are discussed. Addressing these 10 research questions is critical for developing evidence-based approaches for promoting and sustaining an active lifestyle in people with binge eating disorder. PMID:26694684

  18. The measurement of elemental abundances above 10 sup 15 eV at a lunar base

    SciTech Connect

    Swordy, S.P. )

    1990-03-15

    At {approx}10{sup 15} eV the slope of the energy spectrum of cosmic rays becomes significantly steeper than at lower energies. The measurement of relative elemental abundances at these energies is expected to provide a means to resolve the origin of this feature and greatly contribute to the understanding of the sources of cosmic rays. We describe a moon based detector for making well resolved elemental measurements at these energies using hadronic calorimetry. This detector is particularly well suited for a site on the lunar surface because there is no overlying layer of atmosphere and the large mass required can be provided by the lunar regolith.

  19. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes.

    PubMed

    Wang, Peixiang; Liu, Hang; Wang, Yu; Liu, Ou; Zhang, Jing; Gleason, Adenrele; Yang, Zhenrong; Wang, Hui; Shi, Anbing; Grant, Barth D

    2016-06-01

    EHBP-1 (Ehbp1) is a conserved regulator of endocytic recycling, acting as an effector of small GTPases including RAB-10 (Rab10). Here we present evidence that EHBP-1 associates with tubular endosomal phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2] enriched membranes through an N-terminal C2-like (NT-C2) domain, and define residues within the NT-C2 domain that mediate membrane interaction. Furthermore, our results indicate that the EHBP-1 central calponin homology (CH) domain binds to actin microfilaments in a reaction that is stimulated by RAB-10(GTP). Loss of any aspect of this RAB-10/EHBP-1 system in the C. elegans intestinal epithelium leads to retention of basolateral recycling cargo in endosomes that have lost their normal tubular endosomal network (TEN) organization. We propose a mechanism whereby RAB-10 promotes the ability of endosome-bound EHBP-1 to also bind to the actin cytoskeleton, thereby promoting endosomal tubulation. PMID:27272733

  20. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes

    PubMed Central

    Wang, Yu; Liu, Ou; Zhang, Jing; Gleason, Adenrele; Yang, Zhenrong; Wang, Hui; Shi, Anbing; Grant, Barth D.

    2016-01-01

    EHBP-1 (Ehbp1) is a conserved regulator of endocytic recycling, acting as an effector of small GTPases including RAB-10 (Rab10). Here we present evidence that EHBP-1 associates with tubular endosomal phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2] enriched membranes through an N-terminal C2-like (NT-C2) domain, and define residues within the NT-C2 domain that mediate membrane interaction. Furthermore, our results indicate that the EHBP-1 central calponin homology (CH) domain binds to actin microfilaments in a reaction that is stimulated by RAB-10(GTP). Loss of any aspect of this RAB-10/EHBP-1 system in the C. elegans intestinal epithelium leads to retention of basolateral recycling cargo in endosomes that have lost their normal tubular endosomal network (TEN) organization. We propose a mechanism whereby RAB-10 promotes the ability of endosome-bound EHBP-1 to also bind to the actin cytoskeleton, thereby promoting endosomal tubulation. PMID:27272733

  1. Functional analysis of the Arabidopsis PLDZ2 promoter reveals an evolutionarily conserved low-Pi-responsive transcriptional enhancer element

    PubMed Central

    Oropeza-Aburto, Araceli; Cruz-Ramírez, Alfredo; Acevedo-Hernández, Gustavo J.; Pérez-Torres, Claudia-Anahí; Caballero-Pérez, Juan; Herrera-Estrella, Luis

    2012-01-01

    Plants have evolved a plethora of responses to cope with phosphate (Pi) deficiency, including the transcriptional activation of a large set of genes. Among Pi-responsive genes, the expression of the Arabidopsis phospholipase DZ2 (PLDZ2) is activated to participate in the degradation of phospholipids in roots in order to release Pi to support other cellular activities. A deletion analysis was performed to identify the regions determining the strength, tissue-specific expression, and Pi responsiveness of this regulatory region. This study also reports the identification and characterization of a transcriptional enhancer element that is present in the PLDZ2 promoter and able to confer Pi responsiveness to a minimal, inactive 35S promoter. This enhancer also shares the cytokinin and sucrose responsive properties observed for the intact PLDZ2 promoter. The EZ2 element contains two P1BS motifs, each of which is the DNA binding site of transcription factor PHR1. Mutation analysis showed that the P1BS motifs present in EZ2 are necessary but not sufficient for the enhancer function, revealing the importance of adjacent sequences. The structural organization of EZ2 is conserved in the orthologous genes of at least eight families of rosids, suggesting that architectural features such as the distance between the two P1BS motifs are also important for the regulatory properties of this enhancer element. PMID:22210906

  2. Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes.

    PubMed

    Eyal, Y; Curie, C; McCormick, S

    1995-03-01

    Functional analyses previously identified minimal promoter regions required for maintaining high-level expression of the late anther tomato LAT52 and LAT59 genes in tomato pollen. Here, we now define elements that direct pollen specificity. We used a transient assay system consisting of two cell types that differentially express the LAT genes and both "loss-of-function" and "gain-of-function" approaches. Linker substitution mutants analyzed in the transient assay and in transgenic plants identified 30-bp proximal promoter regions of LAT52 and LAT59 that are essential for their expression in pollen and that confer pollen specificity when fused to the heterologous cauliflower mosaic virus 35S core promoter. In vivo competition experiments demonstrated that a common trans-acting factor interacts with the pollen specificity region of both LAT gene promoters and suggested that a common mechanism regulates their coordinate expression. Adjacent upstream elements, the 52/56 box in LAT52 and the 56/59 box in LAT59, are involved in modulating the level of expression in pollen. The 52/56 box may be a target for the binding of a member of the GT-1 transcription factor family. PMID:7734969

  3. Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes.

    PubMed Central

    Eyal, Y; Curie, C; McCormick, S

    1995-01-01

    Functional analyses previously identified minimal promoter regions required for maintaining high-level expression of the late anther tomato LAT52 and LAT59 genes in tomato pollen. Here, we now define elements that direct pollen specificity. We used a transient assay system consisting of two cell types that differentially express the LAT genes and both "loss-of-function" and "gain-of-function" approaches. Linker substitution mutants analyzed in the transient assay and in transgenic plants identified 30-bp proximal promoter regions of LAT52 and LAT59 that are essential for their expression in pollen and that confer pollen specificity when fused to the heterologous cauliflower mosaic virus 35S core promoter. In vivo competition experiments demonstrated that a common trans-acting factor interacts with the pollen specificity region of both LAT gene promoters and suggested that a common mechanism regulates their coordinate expression. Adjacent upstream elements, the 52/56 box in LAT52 and the 56/59 box in LAT59, are involved in modulating the level of expression in pollen. The 52/56 box may be a target for the binding of a member of the GT-1 transcription factor family. PMID:7734969

  4. Monoallelic Loss of the Imprinted Gene Grb10 Promotes Tumor Formation in Irradiated Nf1+/- Mice

    PubMed Central

    Mroue, Rana; Huang, Brian; Braunstein, Steve; Firestone, Ari J.; Nakamura, Jean L.

    2015-01-01

    Imprinted genes are expressed from only one parental allele and heterozygous loss involving the expressed allele is sufficient to produce complete loss of protein expression. Genetic alterations are common in tumorigenesis but the role of imprinted genes in this process is not well understood. In earlier work we mutagenized mice heterozygous for the Neurofibromatosis I tumor suppressor gene (NF1) to model radiotherapy-associated second malignant neoplasms that arise in irradiated NF1 patients. Expression analysis of tumor cell lines established from our mouse models identified Grb10 expression as widely absent. Grb10 is an imprinted gene and polymorphism analysis of cell lines and primary tumors demonstrates that the expressed allele is commonly lost in diverse Nf1 mutant tumors arising in our mouse models. We performed functional studies to test whether Grb10 restoration or loss alter fundamental features of the tumor growth. Restoring Grb10 in Nf1 mutant tumors decreases proliferation, decreases soft agar colony formation and downregulates Ras signaling. Conversely, Grb10 silencing in untransformed mouse embryo fibroblasts significantly increased cell proliferation and increased Ras-GTP levels. Expression of a constitutively activated MEK rescued tumor cells from Grb10-mediated reduction in colony formation. These studies reveal that Grb10 loss can occur during in vivo tumorigenesis, with a functional consequence in untransformed primary cells. In tumors, Grb10 loss independently promotes Ras pathway hyperactivation, which promotes hyperproliferation, an early feature of tumor development. In the context of a robust Nf1 mutant mouse model of cancer this work identifies a novel role for an imprinted gene in tumorigenesis. PMID:26000738

  5. Hospital indoor PM10/PM2.5 and associated trace elements in Guangzhou, China.

    PubMed

    Wang, Xinhua; Bi, Xinhui; Sheng, Guoying; Fu, Jiamo

    2006-07-31

    PM10 and PM2.5 samples were collected in the indoor environments of four hospitals and their adjacent outdoor environments in Guangzhou, China during the summertime. The concentrations of 18 target elements in particles were also quantified. The results showed that indoor PM2.5 levels with an average of 99 microg m(-3) were significantly higher than outdoor PM2.5 standard of 65 microg m(-3) recommended by USEPA [United States Environmental Protection Agency. Office of Air and Radiation, Office of Air Quality Planning and Standards, Fact Sheet. EPA's Revised Particulate Matter Standards, 17, July 1997] and PM2.5 constituted a large fraction of indoor respirable particles (PM10) by an average of 78% in four hospitals. High correlation between PM2.5 and PM10 (R(2) of 0.87 for indoors and 0.90 for outdoors) suggested that PM2.5 and PM10 came from similar particulate emission sources. The indoor particulate levels were correlated with the corresponding outdoors (R(2) of 0.78 for PM2.5 and 0.67 for PM10), demonstrating that outdoor infiltration could lead to direct transportation into indoors. In addition to outdoor infiltration, human activities and ventilation types could also influence indoor particulate levels in four hospitals. Total target elements accounted for 3.18-5.56% of PM2.5 and 4.38-9.20% of PM10 by mass, respectively. Na, Al, Ca, Fe, Mg, Mn and Ti were found in the coarse particles, while K, V, Cr, Ni, Cu, Zn, Cd, Sn, Pb, As and Se existed more in the fine particles. The average indoor concentrations of total elements were lower than those measured outdoors, suggesting that indoor elements originated mainly from outdoor emission sources. Enrichment factors (EF) for trace element were calculated to show that elements of anthropogenic origins (Zn, Pb, As, Se, V, Ni, Cu and Cd) were highly enriched with respect to crustal composition (Al, Fe, Ca, Ti and Mn). Factor analysis was used to identify possible pollution source-types, namely street dust, road traffic

  6. Dietary-fat-induced taurocholic acid promotes pathobiont expansion and colitis in Il10-/- mice.

    PubMed

    Devkota, Suzanne; Wang, Yunwei; Musch, Mark W; Leone, Vanessa; Fehlner-Peach, Hannah; Nadimpalli, Anuradha; Antonopoulos, Dionysios A; Jabri, Bana; Chang, Eugene B

    2012-07-01

    The composite human microbiome of Western populations has probably changed over the past century, brought on by new environmental triggers that often have a negative impact on human health. Here we show that consumption of a diet high in saturated (milk-derived) fat, but not polyunsaturated (safflower oil) fat, changes the conditions for microbial assemblage and promotes the expansion of a low-abundance, sulphite-reducing pathobiont, Bilophila wadsworthia. This was associated with a pro-inflammatory T helper type 1 (T(H)1) immune response and increased incidence of colitis in genetically susceptible Il10(−/−), but not wild-type mice. These effects are mediated by milk-derived-fat-promoted taurine conjugation of hepatic bile acids, which increases the availability of organic sulphur used by sulphite-reducing microorganisms like B. wadsworthia. When mice were fed a low-fat diet supplemented with taurocholic acid, but not with glycocholic acid, for example, a bloom of B. wadsworthia and development of colitis were observed in Il10(−/−) mice. Together these data show that dietary fats, by promoting changes in host bile acid composition, can markedly alter conditions for gut microbial assemblage, resulting in dysbiosis that can perturb immune homeostasis. The data provide a plausible mechanistic basis by which Western-type diets high in certain saturated fats might increase the prevalence of complex immune-mediated diseases like inflammatory bowel disease in genetically susceptible hosts. PMID:22722865

  7. Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

    NASA Technical Reports Server (NTRS)

    Frudakis, T. N.; Wilt, F.

    1995-01-01

    The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

  8. Regulation of IL-10 by chondroitinase ABC promotes a distinct immune response following spinal cord injury.

    PubMed

    Didangelos, Athanasios; Iberl, Michaela; Vinsland, Elin; Bartus, Katalin; Bradbury, Elizabeth J

    2014-12-01

    Chondroitinase ABC (ChABC) has striking effects on promoting neuronal plasticity after spinal cord injury (SCI), but little is known about its involvement in other pathological mechanisms. Recent work showed that ChABC might also modulate the immune response by promoting M2 macrophage polarization. Here we investigate in detail the immunoregulatory effects of ChABC after SCI in rats. Initially, we examined the expression profile of 16 M1/M2 macrophage polarization markers at 3 h and 7 d postinjury. ChABC treatment had a clear effect on the immune signature after SCI. More specifically, ChABC increased the expression of the anti-inflammatory cytokine IL-10, accompanied by a reduction in the proinflammatory cytokine IL-12B in injured spinal tissue. These effects were associated with a distinct, IL-10-mediated anti-inflammatory response in ChABC-treated spinal cords. Mechanistically, we show that IL-10 expression is driven by tissue injury and macrophage infiltration, while the p38 MAPK is the central regulator of IL-10 expression in vivo. These findings provide novel insights into the effects of ChABC in the injured spinal cord and explain its immunoregulatory activity. PMID:25471580

  9. Chloramphenicol Selection of IS10 Transposition in the cat Promoter Region of Widely Used Cloning Vectors.

    PubMed

    González-Prieto, Coral; Agúndez, Leticia; Llosa, Matxalen

    2015-01-01

    The widely used pSU8 family of cloning vectors is based on a p15A replicon and a chloramphenicol acetyltransferase (cat) gene conferring chloramphenicol resistance. We frequently observed an increase in the size of plasmids derived from these vectors. Analysis of the bigger molecular species shows that they have an IS10 copy inserted at a specific site between the promoter and the cat open reading frame. Promoter activity from both ends of IS10 has been reported, suggesting that the insertion events could lead to higher CAT production. Insertions were observed in certain constructions containing inserts that could lead to plasmid instability. To test the possibility that IS10 insertions were selected as a response to chloramphenicol selection, we have grown these constructs in the presence of different amounts of antibiotic and we observed that insertions arise promptly under higher chloramphenicol selective pressure. IS10 is present in many E. coli laboratory strains, so the possibility of insertion in constructions involving cat-containing vectors should be taken into account. Using lower chloramphenicol concentrations could solve this problem. PMID:26375469

  10. Chloramphenicol Selection of IS10 Transposition in the cat Promoter Region of Widely Used Cloning Vectors

    PubMed Central

    González-Prieto, Coral; Agúndez, Leticia; Llosa, Matxalen

    2015-01-01

    The widely used pSU8 family of cloning vectors is based on a p15A replicon and a chloramphenicol acetyltransferase (cat) gene conferring chloramphenicol resistance. We frequently observed an increase in the size of plasmids derived from these vectors. Analysis of the bigger molecular species shows that they have an IS10 copy inserted at a specific site between the promoter and the cat open reading frame. Promoter activity from both ends of IS10 has been reported, suggesting that the insertion events could lead to higher CAT production. Insertions were observed in certain constructions containing inserts that could lead to plasmid instability. To test the possibility that IS10 insertions were selected as a response to chloramphenicol selection, we have grown these constructs in the presence of different amounts of antibiotic and we observed that insertions arise promptly under higher chloramphenicol selective pressure. IS10 is present in many E. coli laboratory strains, so the possibility of insertion in constructions involving cat-containing vectors should be taken into account. Using lower chloramphenicol concentrations could solve this problem. PMID:26375469

  11. Role of IL-10 -819(t/c) promoter polymorphism in preeclampsia.

    PubMed

    Sowmya, Sabnavis; Ramaiah, Aruna; Sunitha, Tella; Nallari, Pratibha; Jyothy, Akka; Venkateshwari, Ananthapur

    2014-08-01

    Preeclampsia is a severe complication of pregnancy characterized by an excessive maternal systemic inflammatory response with activation of both the innate and adaptive immune system. Interleukin-10 affects maternal intravascular inflammation, as well as endothelial dysfunction. The aim of the study was to investigate the association between IL-10 T-819 C polymorphism and preeclampsia. A total of 120 pregnant women with preeclampsia and 120 women with normal pregnancy attending the Gynecological Unit of Government Maternity Hospital, Petlaburz, Hyderabad, India, were considered for the present study. A standard amplification refractory mutation system (ARMS) PCR was carried out for genotyping of IL-10 T-819 C promoter polymorphism in all the participants. Genotypic distribution of the control and patient groups was compared with values predicted by the Hardy-Weinberg equilibrium using χ2 test. Odds ratios (OR) and their respective 95 % confidence intervals were used to measure the strength of association between IL-10 gene polymorphism and preeclampsia. The frequencies of IL-10 T-819 C genotypes, CC, CT, and TT, were 47.5, 28.3, and 24.2 % in women with preeclampsia and 20.8, 48.3, and 30.8 % in the controls, respectively. There is a significant difference in the distribution of genotypes and alleles of IL-10 T-819 C between the two groups (test power = 0.66). The present study suggests that the IL-10 T-819 C gene promoter polymorphism can be a major genetic regulator in the etiology of preeclampsia. PMID:24477695

  12. ACC interleukin-10 gene promoter haplotype as a breast cancer risk factor predictor among Jordanian females

    PubMed Central

    Atoum, Manar Fayiz

    2016-01-01

    Introduction Interleukin-10 (IL-10) is a multifactorial cytokine with a complex biological role in breast cancer. The aims of this study were to investigate any association between IL-10 gene promoter polymorphisms, 1082A>/G, −819T>C, and −592A>C, or haplotypes and breast cancer risk among Jordanian women and to evaluate any association between the most common haplotype with clinicopathological features of breast cancer. Patients and methods A total of 202 breast cancer patients and 210 age-matched healthy control subjects were genotyped for −1082A/G, −819T/C, and −592A/C single nucleotide polymorphisms in the promoter region of the IL-10 gene by polymerase chain reaction-restriction fragment length polymorphism. Study patients and control subjects were recruited from Prince Hamzah Hospital, Amman, Jordan (2012–2013). Ethical approval and signed consent forms were signed by all participants. DNA was extracted, and polymerase chain reaction fragments were amplified and restriction digested by MnII, MaeIII, and RsaI. Results This study showed no statistically significant difference between −1082A/G, −819T/C, and −592A/C IL-10 genotypes or alleles among breast cancer patients or controls. Four different haplotypes ATA, ACC, GTA, and ACA within the IL-10 promoter gene were determined among both breast cancer and control groups. The most frequent haplotype was ACC among breast cancer patients and controls (41.6% and 40.7%, respectively). No statistical differences in these haplotypes among breast cancer patients or controls were determined. Analysis of the most common ACC haplotype showed statistical difference in positive estrogen receptor (P=0.022), positive progesterone receptor (P=0.004), cancer grade (P=0.0001), and cancer stage (P=0.009) among the ACC haplotype compared to non-ACC haplotype. Conclusion To our knowledge, this is the first report studying the association of IL-10 haplotype with breast cancer risk events among Jordanian females. The

  13. Sal-like protein 2 upregulates p16 expression through a proximal promoter element

    PubMed Central

    Wu, Zhenghua; Cheng, Kebin; Shi, Lidan; Li, Zheqi; Negi, Hema; Gao, Guangwei; Kamle, Suchitra; Li, Dawei

    2015-01-01

    Sal-like protein 2 (Sall2), a homeotic transcription factor, is a putative tumor suppressor. We have previously shown that Sall2 activates the transcription of tumor suppressor gene p21 and suppresses tumorigenesis through cell cycle inhibition and induction of apoptosis. To investigate additional Sall2-regulated downstream genes, we analyzed the differences in mRNA expression profiles with and without exogenously expressed Sall2. We identified 1616 Sall2-responsive genes through gene expression arrays. Promoter-reporter assays of p16INK4A and several other tumor-related genes indicated that the Sall2 regulation of these promoters was not significantly different between the two major forms of Sall2 with alternative exon 1 or exon 1A. Additional analysis showed that Sall2-induced p16 promoter activation was Sall2 dose-dependent. Deletion and site-directed mutagenesis of the p16 promoter identified a consensus Sall2 binding site (GGGTGGG) proximal to the p16 transcription start site and was critical for p16 promoter activation. Finally, to confirm the significance of Sall2-activated p16 expression in cell cycle regulation, we co-transfected the SKOV3 cells with a Sall2 expression construct and a p16 minigene and also co-transfected the ES-2 cells with a Sall2 expression construct and the siRNA against p16 for flow cytometry analysis. Our results showed that Sall2 enhanced the p16 minigene blocking of cell cycle progression and p16 knockdown with siRNA abolished most of the Sall2 inhibition of cell cycle progression. These findings indicate that Sall2 targets multiple cell cycle regulators, including p16, through their promoters, adding knowledge to the understanding of Sall2 and p16 gene regulation, and how Sall2 deregulation may promote cancer formation. PMID:25580951

  14. The Calponin Family Member CHDP-1 Interacts with Rac/CED-10 to Promote Cell Protrusions

    PubMed Central

    Zhang, Jingyan; Liu, Jia-Jia; Wang, Yingchun; Ding, Mei

    2016-01-01

    Eukaryotic cells extend a variety of surface protrusions to direct cell motility. Formation of protrusions is mediated by coordinated actions between the plasma membrane and the underlying actin cytoskeleton. Here, we found that the single calponin homology (CH) domain-containing protein CHDP-1 induces the formation of cell protrusions in C. elegans. CHDP-1 is anchored to the cortex through its amphipathic helix. CHDP-1 associates through its CH domain with the small GTPase Rac1/CED-10, which is a key regulator of the actin cytoskeleton. CHDP-1 preferentially binds to the GTP-bound active form of the CED-10 protein and preserves the membrane localization of GTP-CED-10. Hence, by coupling membrane expansion to Rac1-mediated actin dynamics, CHDP-1 promotes the formation of cellular protrusions in vivo. PMID:27415421

  15. Wnt-10b, uniquely among Wnts, promotes epithelial differentiation and shaft growth

    SciTech Connect

    Ouji, Yukiteru Yoshikawa, Masahide; Moriya, Kei; Nishiofuku, Mariko; Matsuda, Ryosuke; Ishizaka, Shigeaki

    2008-03-07

    Although Wnts are expressed in hair follicles throughout life from embryo to adult, and considered to be critical for their development and maturation, their roles remain largely unknown. In the present study, we investigated the effects of Wnts (Wnt-3a, Wnt-5a, Wnt-10b, and Wnt-11) on epithelial cell differentiation using adult mouse-derived primary skin epithelial cell (MPSEC) cultures and hair growth using hair follicle organ cultures. Only Wnt-10b showed evident promotion of epithelial cell differentiation and hair shaft growth, in contrast to Wnt-3a, 5a, and 11. Our results suggest that Wnt-10b is unique and plays an important role in differentiation of epithelial cells in the hair follicle.

  16. The Calponin Family Member CHDP-1 Interacts with Rac/CED-10 to Promote Cell Protrusions.

    PubMed

    Guan, Liying; Ma, Xuehua; Zhang, Jingyan; Liu, Jia-Jia; Wang, Yingchun; Ding, Mei

    2016-07-01

    Eukaryotic cells extend a variety of surface protrusions to direct cell motility. Formation of protrusions is mediated by coordinated actions between the plasma membrane and the underlying actin cytoskeleton. Here, we found that the single calponin homology (CH) domain-containing protein CHDP-1 induces the formation of cell protrusions in C. elegans. CHDP-1 is anchored to the cortex through its amphipathic helix. CHDP-1 associates through its CH domain with the small GTPase Rac1/CED-10, which is a key regulator of the actin cytoskeleton. CHDP-1 preferentially binds to the GTP-bound active form of the CED-10 protein and preserves the membrane localization of GTP-CED-10. Hence, by coupling membrane expansion to Rac1-mediated actin dynamics, CHDP-1 promotes the formation of cellular protrusions in vivo. PMID:27415421

  17. Systematic identification of conserved regulatory elements in upstream promoter regions of the cattle genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cross-species DNA sequence comparison is the primary approach to discover regulatory elements by identifying highly conserved sequences due to evolutionary constraints. Previously, we reported that a systematic approach, combining position-specific weight matrixes (JASPAR) and phylogenetic footprint...

  18. Prediction of conserved regulatory elements in promoter regions of the cattle genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cross-species DNA sequence comparison is the primary approach to discover regulatory elements by identifying highly conserved sequences due to evolutionary constraints. Previously, we reported that a systematic approach, combining position-specific weight matrixes (JASPAR) and phylogenetic footprint...

  19. Invariant TAD Boundaries Constrain Cell-Type-Specific Looping Interactions between Promoters and Distal Elements around the CFTR Locus

    PubMed Central

    Smith, Emily M.; Lajoie, Bryan R.; Jain, Gaurav; Dekker, Job

    2016-01-01

    Three-dimensional genome structure plays an important role in gene regulation. Globally, chromosomes are organized into active and inactive compartments while, at the gene level, looping interactions connect promoters to regulatory elements. Topologically associating domains (TADs), typically several hundred kilobases in size, form an intermediate level of organization. Major questions include how TADs are formed and how they are related to looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb chromosome 7 region surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Furthermore, we find that these TAD boundaries are present irrespective of the expression and looping of genes located between them. In contrast, looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell-type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected, but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell-type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell-type-specific long-range interactions and gene regulation. PMID:26748519

  20. A multistep bioinformatic approach detects putative regulatory elements in gene promoters

    PubMed Central

    Bortoluzzi, Stefania; Coppe, Alessandro; Bisognin, Andrea; Pizzi, Cinzia; Danieli, Gian Antonio

    2005-01-01

    Background Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences. Genomic sequences of 1 Kb upstream of 91 genes differentially expressed and/or encoding proteins with relevant function in adult human retina were analyzed. Methodology and results were tested by analysing 1,000 groups of putatively unrelated sequences, randomly selected among 17,156 human gene promoters. When applied to a sample of human promoters, the method identified 279 putative motifs frequently occurring in retina promoters sequences. Most of them are localized in the proximal portion of promoters, less variable in central region than in lateral regions and similar to known regulatory sequences. COOP software and reference manual are freely available upon request to the Authors. Conclusion The approach described in this paper seems effective for identifying a tractable number of sequence motifs with putative regulatory role. PMID:15904489

  1. Interleukin 10 gene promoter polymorphisms in women with early-onset pre-eclampsia.

    PubMed

    Sowmya, S; Sri Manjari, K; Ramaiah, A; Sunitha, T; Nallari, P; Jyothy, A; Venkateshwari, A

    2014-11-01

    Pre-eclampsia is one of the most serious disorders of human pregnancy and T helper type 1 (Th1)/Th2 imbalance plays a major role in its aetiology. The Th2 cytokine, interleukin (IL)-10, plays a significant role in the maintenance of pregnancy. The present study is aimed at understanding the role of IL-10 promoter polymorphisms (-1082 G/A; -592 A/C and -819 C/T) and their haplotypes in early-onset pre-eclampsia. A total of 120 patients and an equal number of women with normal pregnancy, from Government Maternity Hospital, Petlaburz, Hyderabad, India, were considered for the present study. A standard amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) was carried out for genotyping followed by agarose gel electrophoresis. Appropriate statistical methods were applied to test for the significance of the results. It was found that the IL-10 -819 C allele (P = 0·003) and -592 A (P = 0·005) allele frequencies increased significantly in patients compared to controls. No significant difference was found with regard to -1082 promoter polymorphism. Haplotype analysis of the IL-10 single nucleotide polymorphisms (SNPs) revealed a significant association with ACC haplotype with a twofold increased risk in patients compared to controls. The frequencies of two common IL-10 haplotypes (GCC and ATA) did not show any significant difference. Further, the diplotype analysis revealed five genotypes: -1082A with -819C (P = 0·0016); -1082G with -819C (P = 0·0018); -819C with -592C (P = 0·001); -1082A with -592C (P = 0·032); and -1082G with -592C (P = 0·005) associated with the disease. These findings support the concept of contribution of IL-10 gene polymorphisms in the pathogenesis of early-onset pre-eclampsia. PMID:24962617

  2. Interleukin 10 gene promoter polymorphisms in women with early-onset pre-eclampsia

    PubMed Central

    Sowmya, S; Sri Manjari, K; Ramaiah, A; Sunitha, T; Nallari, P; Jyothy, A; Venkateshwari, A

    2014-01-01

    Pre-eclampsia is one of the most serious disorders of human pregnancy and T helper type 1 (Th1)/Th2 imbalance plays a major role in its aetiology. The Th2 cytokine, interleukin (IL)-10, plays a significant role in the maintenance of pregnancy. The present study is aimed at understanding the role of IL-10 promoter polymorphisms (−1082 G/A; −592 A/C and −819 C/T) and their haplotypes in early-onset pre-eclampsia. A total of 120 patients and an equal number of women with normal pregnancy, from Government Maternity Hospital, Petlaburz, Hyderabad, India, were considered for the present study. A standard amplification refractory mutation system–polymerase chain reaction (ARMS–PCR) was carried out for genotyping followed by agarose gel electrophoresis. Appropriate statistical methods were applied to test for the significance of the results. It was found that the IL-10 −819 C allele (P = 0·003) and −592 A (P = 0·005) allele frequencies increased significantly in patients compared to controls. No significant difference was found with regard to −1082 promoter polymorphism. Haplotype analysis of the IL-10 single nucleotide polymorphisms (SNPs) revealed a significant association with ACC haplotype with a twofold increased risk in patients compared to controls. The frequencies of two common IL-10 haplotypes (GCC and ATA) did not show any significant difference. Further, the diplotype analysis revealed five genotypes: −1082A with −819C (P = 0·0016); −1082G with −819C (P = 0·0018); −819C with −592C (P = 0·001); −1082A with −592C (P = 0·032); and −1082G with −592C (P = 0·005) associated with the disease. These findings support the concept of contribution of IL-10 gene polymorphisms in the pathogenesis of early-onset pre-eclampsia. PMID:24962617

  3. Direct, Interferon-Independent Activation of the CXCL10 Promoter by NF-κB and Interferon Regulatory Factor 3 during Hepatitis C Virus Infection

    PubMed Central

    Brownell, Jessica; Bruckner, Jacob; Wagoner, Jessica; Thomas, Emmanuel; Loo, Yueh-Ming; Gale, Michael; Liang, T. Jake

    2014-01-01

    Hepatitis C virus (HCV) infection of hepatocytes leads to transcriptional induction of the chemokine CXCL10, which is considered an interferon (IFN)-stimulated gene. However, we have recently shown that IFNs are not required for CXCL10 induction in hepatocytes during acute HCV infection. Since the CXCL10 promoter contains binding sites for several proinflammatory transcription factors, we investigated the contribution of these factors to CXCL10 transcriptional induction during HCV infection in vitro. Wild-type and mutant CXCL10 promoter-luciferase reporter constructs were used to identify critical sites of transcriptional regulation. The proximal IFN-stimulated response element (ISRE) and NF-κB binding sites positively regulated CXCL10 transcription during HCV infection as well as following exposure to poly(I·C) (a Toll-like receptor 3 [TLR3] stimulus) and 5′ poly(U) HCV RNA (a retinoic acid-inducible gene I [RIG-I] stimulus) from two viral genotypes. Conversely, binding sites for AP-1 and CCAAT/enhancer-binding protein β (C/EBP-β) negatively regulated CXCL10 induction in response to TLR3 and RIG-I stimuli, while only C/EBP-β negatively regulated CXCL10 during HCV infection. We also demonstrated that interferon-regulatory factor 3 (IRF3) is transiently recruited to the proximal ISRE during HCV infection and localizes to the nucleus in HCV-infected primary human hepatocytes. Furthermore, IRF3 activated the CXCL10 promoter independently of type I or type III IFN signaling. The data indicate that sensing of HCV infection by RIG-I and TLR3 leads to direct recruitment of NF-κB and IRF3 to the CXCL10 promoter. Our study expands upon current knowledge regarding the mechanisms of CXCL10 induction in hepatocytes and lays the foundation for additional mechanistic studies that further elucidate the combinatorial and synergistic aspects of immune signaling pathways. PMID:24257594

  4. Multiple cis Regulatory Elements Control RANTES Promoter Activity in Alveolar Epithelial Cells Infected with Respiratory Syncytial Virus

    PubMed Central

    Casola, Antonella; Garofalo, Roberto P.; Haeberle, Helene; Elliott, Todd F.; Lin, Rongtuan; Jamaluddin, Mohammad; Brasier, Allan R.

    2001-01-01

    Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part through its ability to induce chemokine synthesis in infected airway epithelial cells. RANTES (regulated upon activation, normally T-cell expressed and presumably secreted) is a CC chemokine which recruits and activates monocytes, lymphocytes, and eosinophils, all cell types present in the lung inflammatory infiltrate induced by RSV infection. In this study, we analyzed the mechanism of RSV-induced RANTES promoter activation in human type II alveolar epithelial cells (A549 cells). Promoter deletion and mutagenesis experiments indicate that RSV requires the presence of five different cis regulatory elements, located in the promoter fragment spanning from −220 to +55 nucleotides, corresponding to NF-κB, C/EBP, Jun/CREB/ATF, and interferon regulatory factor (IRF) binding sites. Although site mutations of the NF-κB, C/EBP, and CREB/AP-1 like sites reduce RSV-induced RANTES gene transcription to 50% or less, only mutations affecting IRF binding completely abolish RANTES inducibility. Supershift and microaffinity isolation assays were used to identify the different transcription factor family members whose DNA binding activity was RSV inducible. Expression of dominant negative mutants of these transcription factors further established their central role in virus-induced RANTES promoter activation. Our finding that the presence of multiple cis regulatory elements is required for full activation of the RANTES promoter in RSV-infected alveolar epithelial cells supports the enhanceosome model for RANTES gene transcription, which is absolutely dependent on binding of IRF transcription factors. The identification of regulatory mechanisms of RANTES gene expression is fundamental for rational design of inhibitors of RSV-induced lung inflammation. PMID:11413310

  5. On the benefits and challenges of a coordinated Validation and Quality Assessment of the GMES Service Element for Atmosphere (PROMOTE)

    NASA Astrophysics Data System (ADS)

    Rosalia Delgado Blanco, Maria; Lambert, Jean-Christopher; Skarlas, Pauline

    PROtocol MOniToring for the GMES Service Element for Atmosphere (PROMOTE) is an ESA- funded project delivering sustainable geo-spatial information services related to atmospheric ozone, surface UV exposure, air quality, climate change, and volcanic hazards to aviation. Services are based on ground-, airand satellite-based Earth observation data and on numerical models and assimilation systems. As a major step in the building of Global Monitoring of Environment and Security (GMES), a European contribution to the Global Earth Observation System of Systems (GEOSS), PROMOTE Services are to support informed decisions relevant to the nine Societal Benefit Areas addressed by GEOSS. GEOSS objectives of interoperability, sustainability, traceability and dedication to users are particular challenges that are addressed, among others, by the PROMOTE Validation Office. The first goal of this cross-cutting body is to ensure appropriate, user-driven quality assessment and validation of all PROMOTE services. Going beyond the classical validation of individual data products from a satellite or a model, the Validation Office verifies not only the "fitness for purpose" of all PROMOTE Products and Services against service specifications and user requirements, but also the "fitness for purpose" of the validation itself against user requirements, and generally coordinates validation activities at project level. A driving task under the responsibility of the Validation Office is to establish the PROMOTE Service Validation Protocol which sets the top-level definition of applicable standards and validation approaches for all constituents of the PROMOTE Service Portfolio. It is through the development and implementation of such a Validation Protocol, that the fitness for purpose of every product and service and of their validation can be assessed and sustained. At the same time, their compliance with high-level recommendations (e.g. GEO-CEOS Best Practices for Cal/Val) and regulations

  6. Fatty acid activated PPARγ promotes tumorigenicity of prostate cancer cells by up regulating VEGF via PPAR responsive elements of the promoter

    PubMed Central

    Forootan, Farzad S.; Forootan, Shiva S.; Gou, Xiaojun; Yang, Jin; Liu, Bichong; Chen, Danqing; Fayi, Majed Saad Al; Al-Jameel, Waseem; Rudland, Philip S.; Hussain, Syed A.; Ke, Youqiang

    2016-01-01

    In previous work, it is suggested that the excessive amount of fatty acids transported by FABP5 may facilitate the malignant progression of prostate cancer cells through a FABP5-PPARγ-VEGF signal transduction axis to increase angiogenesis. To further functionally characterise the FABP5-PPARγ-VEGF signal transduction pathway, we have, in this work, investigated the molecular mechanisms involved in its tumorigenicity promoting role in prostate cancer. Suppression of PPARγ in highly malignant prostate cancer cells produced a significant reduction (up to 53%) in their proliferation rate, invasiveness (up to 89%) and anchorage-independent growth (up to 94%) in vitro. Knockdown of PPARγ gene in PC3-M cells by siRNA significantly reduced the average size of tumours formed in nude mice by 99% and tumour incidence by 90%, and significantly prolonged the latent period by 3.5 fold. Results in this study combined with some previous results suggested that FABP5 promoted VEGF expression and angiogenesis through PPARγ which was activated by fatty acids transported by FABP5. Further investigations showed that PPARγ up-regulated VEGF expression through acting with the PPAR-responsive elements in the promoter region of VEGF gene in prostate cancer cells. Although androgen can modulate VEGF expression through Sp1/Sp3 binding site on VEGF promoter in androgen-dependent prostate cancer cells, this route, disappeared as the cells gradually lost their androgen dependency; was replaced by the FABP5-PPARγ-VEGF signalling pathway. These results suggested that the FABP5-PPARγ-VEGF signal transduction axis, rather than androgen modulated route, may be a more important novel therapeutic target for angiogenesis-suppression treatment of castration resistant prostate cancer. PMID:26814431

  7. Promoting Connectedness through Whole-School Approaches: Key Elements and Pathways of Influence

    ERIC Educational Resources Information Center

    Rowe, Fiona; Stewart, Donald

    2011-01-01

    Purpose: A comprehensive whole-school approach has emerged as a promising model for building connectedness in the school setting. The health-promoting school model, through its whole-school orientation and attention to the school organizational environment, identifies structures and processes that influence school connectedness. This paper aims to…

  8. Health promotion through self-care and community participation: Elements of a proposed programme in the developing countries

    PubMed Central

    Bhuyan, Khanindra Kumar

    2004-01-01

    areas in the developed countries. Elements of a programme for health promotion in the developing countries following key principles of self care and community participation are proposed. Demonstration programmes may be initiated to assess the feasibility and effectiveness of this programme before large scale implementation. PMID:15086956

  9. Identification of two candidate collecting duct cell-specific cis-acting elements in the Hoxb-7 promoter region.

    PubMed

    Plaisier, Emmanuelle; Ribes, David; Ronco, Pierre; Rossert, Jérome

    2005-02-14

    HOX genes encode highly conserved transcription factors responsible for developmental patterning and postnatal tissue homeostasis. Previous studies have shown that a 1.4-kb segment of the Hoxb-7 proximal promoter drives renal expression of reporter genes specifically in the ureteric bud and collecting ducts. In this study using stably transfected renal tubule cell lines, we have identified three short cis-acting sequences within this promoter segment that cooperate to induce high-level expression specifically in collecting duct cells. In addition to an inverted CCAAT box (-71/-67) that acts as an ubiquitous enhancer and binds the transcription factor CBF/NF-Y, two different cis-acting sequences, named CDSE-1 and CDSE-2 (for Collecting Duct Specific Element 1 and 2), allow collecting duct cell-specific promoter activation. CDSE-1 (-56/-34) is composed of two E-boxes separated by a 9-bp GC-rich sequence. Only the latter sequence enhances reporter gene expression specifically in collecting duct cells. CDSE-2 (-34/-13) contains sequence bears high homology with a segment of the Pax-2 promoter. CDSE-2 also conveys cell specificity but has no enhancer activity by itself. PMID:15716052

  10. Comparative Study on Serum Levels of 10 Trace Elements in Schizophrenia

    PubMed Central

    Yan, Lailai; Guo, Jing; Feng, Fangbo; Qiu, Jinyun; Wang, Jingyu

    2015-01-01

    The etiology and pathophysiology of schizophrenia remain obscure. This study explored the associations between schizophrenia risk and serum levels of 10 trace elements. A 1:1 matched case-control study was conducted and matched by age and sex. Blood samples were collected to determine the concentrations of nickel, molybdenum, arsenic, aluminum, chromium, manganese, selenium, copper, iron and zinc by an inductively coupled plasma-mass spectrometry. The conditional logistic regression model was used to analyze the associations between trace elements and schizophrenia risk. Totally 114 schizophrenia patients and 114 healthy controls were recruited in the study. The multivariate analysis demonstrated that copper≤0.97 μg/mL, selenium≤72 ng/mL and manganese>3.95 ng/mL were associated with an increased risk of schizophrenia. The study showed that lower levels of selenium, copper and higher levels of manganese were found in schizophrenia patients compared with healthy controls. PMID:26186003

  11. Investigation of Radar Propagation in Buildings: A 10 Billion Element Cartesian-Mesh FETD Simulation

    SciTech Connect

    Stowell, M L; Fasenfest, B J; White, D A

    2008-01-14

    In this paper large scale full-wave simulations are performed to investigate radar wave propagation inside buildings. In principle, a radar system combined with sophisticated numerical methods for inverse problems can be used to determine the internal structure of a building. The composition of the walls (cinder block, re-bar) may effect the propagation of the radar waves in a complicated manner. In order to provide a benchmark solution of radar propagation in buildings, including the effects of typical cinder block and re-bar, we performed large scale full wave simulations using a Finite Element Time Domain (FETD) method. This particular FETD implementation is tuned for the special case of an orthogonal Cartesian mesh and hence resembles FDTD in accuracy and efficiency. The method was implemented on a general-purpose massively parallel computer. In this paper we briefly describe the radar propagation problem, the FETD implementation, and we present results of simulations that used over 10 billion elements.

  12. Promoter Variants of the ADAM10 Gene and Their Roles in Temporal Lobe Epilepsy

    PubMed Central

    Tao, Hua; Zhao, Jianghao; Zhou, Xu; Ma, Zhonghua; Chen, Ying; Sun, Fuhai; Cui, Lili; Zhou, Haihong; Cai, Yujie; Chen, Yanyan; Zhao, Shu; Yao, Lifen; Zhao, Bin; Li, Keshen

    2016-01-01

    Previous evidence has indicated that downregulated ADAM10 gives rise to epileptic seizures in Alzheimer’s disease, and this study investigated the association of ADAM10 with temporal lobe epilepsy (TLE) from a genetic perspective. A total of 496 TLE patients and 528 healthy individuals were enrolled and genotyped for ADAM10 promoter variants (rs653765 G > A and rs514049 A > C). The alleles, genotypes, and haplotypes were then compared with clarify the association of these variants with TLE and their impacts upon age at onset, initial seizure types before treatments, and responses to drug treatments. In cohorts I, II, and I + II, the frequencies of the A allele and AA genotype at rs514049 were consistently increased in the cases compared with the controls (p = 0.020 and p = 0.009; p = 0.008 and p = 0.009; p = 0.000 and p = 0.000; q = 0.003 and q = 0.002, respectively). In contrast, the frequency of the AC haplotype (rs653765–rs514049) decreased in cohorts I + II (p = 0.013). Further analyses of the TLE patients indicated that the AA genotype functioned as a predisposing factor to drug-resistant TLE and the AC haplotype as a protective factor against generalized tonic–clonic seizures (GTCS) and drug-resistant TLE. This study is the first to demonstrate an association of the ADAM10 promoter variants with TLE. In particular, the AA genotype and AC haplotype showed their effects upon GTCS and drug-resistant TLE. PMID:27445971

  13. Promoting the Essential Elements of 4-H Youth Development through an Experiential Learning Model

    ERIC Educational Resources Information Center

    Meyer, Shelley; Jones, Kenneth R.

    2015-01-01

    The purpose of the project reported here was to apply Experiential Learning Theory to a context involving middle and high school aged youth while assessing the four concepts (belonging, mastery, independence, and generosity) in relation to the 4-H youth development essential elements. The conclusions of the project's evaluation suggest…

  14. Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase.

    PubMed

    Hata, Y; Kitamoto, K; Gomi, K; Kumagai, C; Tamura, G

    1992-08-01

    Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding beta-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter with those of A. oryzae amyB, encoding alpha-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. PMID:1339327

  15. Interleukin-10 Promoter Gene Polymorphisms and Susceptibility to Tuberculosis: A Meta-Analysis

    PubMed Central

    Gao, Xuan; Chen, Junjun; Tong, Zhongkai; Yang, Guangdie; Yao, Yinan; Xu, Fei; Zhou, Jianying

    2015-01-01

    Objective As an update to other recent meta-analyses, the purpose of this study was to explore whether interleukin-10 (IL-10) polymorphisms and their haplotypes contribute to tuberculosis (TB) susceptibility. Methods We searched for published case-control studies examining IL-10 polymorphisms and TB in PubMed, EMBASE, Cochrane Central Register of Controlled Trials (CENTRAL), Wanfang databases and the Chinese National Knowledge Infrastructure (CNKI). Odds ratios (ORs) with 95% confidence intervals (CIs) were used to calculate the strengths of the associations. Results A total of 28 studies comprising 8,242 TB patients and 9,666 controls were included in the present study. There were no significant associations between the -1082G/A, -819C/T, and -592A/C polymorphisms and TB in the pooled samples. Subgroup analyses revealed that the -819T allele was associated with an increased TB risk in Asians in all genetic models (T vs. C: OR=1.17, 95% CI=1.05-1.29, P=0.003; TT vs. CC: OR=1.37, 95% CI=1.09-1.72, P=0.006; CT+TT vs. CC: OR=1.33, 95% CI=1.09-1.63, P=0.006; TT vs. CT+CC: OR=1.17, 95% CI=1.02-1.35, P=0.03) and that the -592A/C polymorphism was significantly associated with TB in Europeans under two genetic models (A vs. C: OR=0.77, 95% CI=0.60-0.98, P=0.03; AA vs. CC: OR=0.53, 95% CI=0.30-0.95, P=0.03). Furthermore, the GCC IL-10 promoter haplotype was associated with an increased risk of TB (GCC vs. others: P=1.42, 95% CI=1.02-1.97, P=0.04). Subgroup analyses based on ethnicity revealed that the GCC haplotype was associated with a higher risk of TB in Europeans, whereas the ACC haplotype was associated with a lower TB risk in both Asians and Europeans. Conclusions This meta-analysis suggests that the IL-10-819T/C polymorphism is associated with the risk of TB in Asians and that the IL-10-592A/C polymorphism may be a risk factor for TB in Europeans. Furthermore, these data indicate that IL-10 promoter haplotypes play a vital role in the susceptibility to or protection

  16. Siderophore-promoted transfer of rare earth elements and iron from volcanic ash into glacial meltwater, river and ocean water

    NASA Astrophysics Data System (ADS)

    Bau, Michael; Tepe, Nathalie; Mohwinkel, Dennis

    2013-02-01

    The rare earth elements (REE) are a group of trace elements that have short marine residence times and that in river, lake and marine surface waters are typically associated with organic and inorganic particles. Explosive volcanic eruptions, such as the 2010 eruptions of Eyjafjallajökull volcano in Iceland, produce volcanic ash particles which can be an important source of iron and other nutrients for aquatic organisms. To become bioavailable, however, this iron needs to be solubilized by complexing agents, such as siderophores. A well-studied example of such a chelator is the biogenic siderophore desferrioxamin-B (DFOB). Based on results from incubation experiments with glacial meltwater-rich river waters from southern Iceland, which are rich in suspended volcanic ash and that had been incubated with and without DFOB, respectively, we here show that siderophores not only enhance the release of iron, but also promote the mobilization of REE from these particles. In the presence of DFOB, partial dissolution of volcanic ash (and presumably other lithic particles) produces a flux of dissolved REE into ambient waters, that is characterized by depletion of the light REE over the middle REE and by selective enrichment of cerium, due to the formation of dissolved Ce(IV)-DFOB complexes. In siderophore-rich environments, this siderophore-bound REE flux has the potential to modify the concentrations and distribution of the dissolved REE and of the isotopic composition of dissolved Nd in glacial meltwaters, river waters and seawater and might be a component of the boundary effects between shelf sediments and seawater, which are assumed to account for the “missing Nd flux” to seawater. Thermodynamic data further suggest that siderophore-promoted element mobilization could also be important for other polyvalent (trace) elements, such as Hf.

  17. A MAPT mutation in a regulatory element upstream of exon 10 causes frontotemporal dementia.

    PubMed

    Malkani, Roneil; D'Souza, Ian; Gwinn-Hardy, Katrina; Schellenberg, Gerard D; Hardy, John; Momeni, Parastoo

    2006-05-01

    We report here the genetic analysis of a newly ascertained kindred in which frontotemporal dementia occurs in an apparent autosomal dominant fashion, and in which a novel MAPT gene mutation co-segregates with disease. Sequencing the MAPT gene in affected individuals revealed a change in intron 9. This finding supports earlier studies on the effect of a splice-accepting element in inclusion of exon 10 in the MAPT transcript. This mutation sheds light on a novel mechanism by which over-expression of 4-repeat tau leads to disease. Based on our current findings, we propose a novel mechanism by which intronic mutations can lead to frontotemporal dementia. PMID:16503405

  18. Altering genomic integrity: heavy metal exposure promotes trans-posable element-mediated damage

    PubMed Central

    Morales, Maria E.; Servant, Geraldine; Ade, Catherine; Roy-Enge, Astrid M.

    2015-01-01

    Maintenance of genomic integrity is critical for cellular homeostasis and survival. The active transposable elements (TEs) composed primarily of three mobile element lineages LINE-1, Alu, and SVA comprise approximately 30% of the mass of the human genome. For the past two decades, studies have shown that TEs significantly contribute to genetic instability and that TE-caused damages are associated with genetic diseases and cancer. Different environmental exposures, including several heavy metals, influence how TEs interact with its host genome increasing their negative impact. This mini-review provides some basic knowledge on TEs, their contribution to disease and an overview of the current knowledge on how heavy metals influence TE-mediated damage. PMID:25774044

  19. The developmental activation of the chicken lysozyme locus in transgenic mice requires the interaction of a subset of enhancer elements with the promoter.

    PubMed Central

    Huber, M C; Jägle, U; Krüger, G; Bonifer, C

    1997-01-01

    The complete chicken lysozyme locus is expressed in a position independent fashion in macrophages of transgenic mice and forms the identical chromatin structure as observed with the endogenous gene in chicken cells. Individual lysozyme cis -regulatory elements reorganize their chromatin structure at different developmental stages. Accordingly, their activities are developmentally regulated, indicating a differential role of these elements in locus activation. We have shown previously that a subset of enhancer elements and the promoter are sufficient to activate transcription of the chicken lysozyme gene at the correct developmental stage. Here, we analyzed to which grade the developmentally controlled chromatin reorganizing capacity of cis -regulatory elements in the 5'-region of the chicken lysozyme locus is dependent on promoter elements, and we examined whether the lysozyme locus carries a dominant chromatin reorganizing element. To this end we generated transgenic mouse lines carrying constructs with a deletion of the lysozyme promoter. Expression of the transgene in macrophages is abolished, however, the chromatin reorganizing ability of the cis -regulatory elements is differentially impaired. Some cis -elements require the interaction with the promoter to stabilize transcription factor complexes detectable as DNase I hypersensitive sites in chromatin, whereas other elements reorganize their chromatin structure autonomously. PMID:9224598

  20. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences.

    PubMed Central

    Ch'ang, L Y; Yang, W K; Myer, F E; Yang, D M

    1989-01-01

    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenicol acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base-pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-bp inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs of the enhancer segment as well as the upstream LTR sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression. Further analyses using chimeric LTR constructs located the presence of a strong negative regulatory element within the region containing the 5' portion of the enhancer and the immediate upstream sequences in the MuLV-related LTRs. Images PMID:2542587

  1. Characterization of novel promoter and enhancer elements of the mouse homologue of the Dent disease gene, CLCN5, implicated in X-linked hereditary nephrolithiasis.

    PubMed

    Tanaka, K; Fisher, S E; Craig, I W

    1999-06-15

    The murine homologue of the human chloride channel gene, CLCN5, defects in which are responsible for Dent disease, has been cloned and characterized. We isolated the entire coding region of mouse Clcn5 cDNA and approximately 45 kb of genomic sequence embracing the gene. To study its transcriptional control, the 5' upstream sequences of the mouse Clcn5 gene were cloned into a luciferase reporter vector. Deletion analysis of 1.5 kb of the 5' flanking sequence defined an active promoter region within 128 bp of the putative transcription start site, which is associated with a TATA motif but lacks a CAAT consensus. Within this sequence, there is a motif with homology to a purine-rich sequence responsible for the kidney-specific promoter activity of the rat CLC-K1 gene, another member of the chloride-channel gene family expressed in kidney. An enhancer element that confers a 10- to 20-fold increase in the promoter activity of the mouse Clcn5 gene was found within the first intron. The organization of the human CLCN5 and mouse Clcn5 gene structures is highly conserved, and the sequence of the murine protein is 98% similar to that of human, with its highest expression seen in the kidney. This study thus provides the first identification of the transcriptional control region of, and the basis for an understanding of the regulatory mechanism that controls, this kidney-specific, chloride-channel gene. PMID:10373326

  2. Does STES-Oriented Science Education Promote 10th-Grade Students' Decision-Making Capability?

    NASA Astrophysics Data System (ADS)

    Levy Nahum, Tami; Ben-Chaim, David; Azaiza, Ibtesam; Herskovitz, Orit; Zoller, Uri

    2010-07-01

    Today's society is continuously coping with sustainability-related complex issues in the Science-Technology-Environment-Society (STES) interfaces. In those contexts, the need and relevance of the development of students' higher-order cognitive skills (HOCS) such as question-asking, critical-thinking, problem-solving and decision-making capabilities within science teaching have been argued by several science educators for decades. Three main objectives guided this study: (1) to establish "base lines" for HOCS capabilities of 10th grade students (n = 264) in the Israeli educational system; (2) to delineate within this population, two different groups with respect to their decision-making capability, science-oriented (n = 142) and non-science (n = 122) students, Groups A and B, respectively; and (3) to assess the pre-post development/change of students' decision-making capabilities via STES-oriented HOCS-promoting curricular modules entitled Science, Technology and Environment in Modern Society (STEMS). A specially developed and validated decision-making questionnaire was used for obtaining a research-based response to the guiding research questions. Our findings suggest that a long-term persistent application of purposed decision-making, promoting teaching strategies, is needed in order to succeed in affecting, positively, high-school students' decision-making ability. The need for science teachers' involvement in the development of their students' HOCS capabilities is thus apparent.

  3. Splicing promotes the nuclear export of β-globin mRNA by overcoming nuclear retention elements

    PubMed Central

    Akef, Abdalla; Lee, Eliza S.; Palazzo, Alexander F.

    2015-01-01

    Most current models of mRNA nuclear export in vertebrate cells assume that an mRNA must have specialized signals in order to be exported from the nucleus. Under such a scenario, mRNAs that lack these specialized signals would be shunted into a default pathway where they are retained in the nucleus and eventually degraded. These ideas were based on the selective use of model mRNA reporters. For example, it has been shown that splicing promotes the nuclear export of certain model mRNAs, such as human β-globin, and that in the absence of splicing, the cDNA-derived mRNA is retained in the nucleus and degraded. Here we provide evidence that β-globin mRNA contains an element that actively retains it in the nucleus and degrades it. Interestingly, this nuclear retention activity can be overcome by increasing the length of the mRNA or by splicing. Our results suggest that contrary to many current models, the default pathway for most intronless RNAs is to be exported from the nucleus, unless the RNA contains elements that actively promote its nuclear retention. PMID:26362019

  4. ZmbZIP91 regulates expression of starch synthesis-related genes by binding to ACTCAT elements in their promoters.

    PubMed

    Chen, Jiang; Yi, Qiang; Cao, Yao; Wei, Bin; Zheng, Lanjie; Xiao, Qianling; Xie, Ying; Gu, Yong; Li, Yangping; Huang, Huanhuan; Wang, Yongbin; Hou, Xianbin; Long, Tiandan; Zhang, Junjie; Liu, Hanmei; Liu, Yinghong; Yu, Guowu; Huang, Yubi

    2016-03-01

    Starch synthesis is a key process that influences crop yield and quality, though little is known about the regulation of this complex metabolic pathway. Here, we present the identification of ZmbZIP91 as a candidate regulator of starch synthesis via co-expression analysis in maize (Zea mays L.). ZmbZIP91 was strongly associated with the expression of starch synthesis genes. Reverse tanscription-PCR (RT-PCR) and RNA in situ hybridization indicated that ZmbZIP91 is highly expressed in maize endosperm, with less expression in leaves. Particle bombardment-mediated transient expression in maize endosperm and leaf protoplasts demonstrated that ZmbZIP91 could positively regulate the expression of starch synthesis genes in both leaves and endosperm. Additionally, the Arabidopsis mutant vip1 carried a mutation in a gene (VIP1) that is homologous to ZmbZIP91, displayed altered growth with less starch in leaves, and ZmbZIP91 was able to complement this phenotype, resulting in normal starch synthesis. A yeast one-hybrid experiment and EMSAs showed that ZmbZIP91 could directly bind to ACTCAT elements in the promoters of starch synthesis genes (pAGPS1, pSSI, pSSIIIa, and pISA1). These results demonstrate that ZmbZIP91 acts as a core regulatory factor in starch synthesis by binding to ACTCAT elements in the promoters of starch synthesis genes. PMID:26689855

  5. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    SciTech Connect

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In

    2008-04-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.

  6. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    PubMed Central

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-01-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. Images PMID:7935375

  7. Monitoring trace elements by nuclear techniques in PM10 and PM2.5

    NASA Astrophysics Data System (ADS)

    Freitas, M. Carmo; Almeida, S. Marta; Reis, Miguel A.; Oliveira, Orlando R.

    2003-06-01

    As part of a contract for air quality monitoring at an urban waste incinerator neighborhood, measurements of PM10 and PM2.5 are being routinely evaluated. Two samples are collected for 24 h at the weekend and a working day, using a Gent collector, which separates the particulate in two fractions: PM2.5 and PM2.5-10. Filters are polycarbonate Nuclepore, sized 47 mm, which, for analysis, are cut as: one half to be analyzed by instrumental neutron activation analysis (INAA) and one quarter for proton induced X-rays emission (PIXE). Both techniques are multielemental determining together around 25 chemical elements. Comparison of results is just possible for potassium, iron and zinc, which are compared in this work. A better agreement is obtained in PM2.5 suggesting a homogeneity trend. Fe and K compare quite well and Zn may show quite different results.

  8. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sha...

  9. MALAT1 long ncRNA promotes gastric cancer metastasis by suppressing PCDH10

    PubMed Central

    Qi, Ying; Ooi, Hong Sain; Wu, Jun; Chen, Jian; Zhang, Xiaoli; Tan, Sheng; Yu, Qing; Li, Yuan-Yuan; Kang, Yani; Li, Hua; Xiong, Zirui; Zhu, Tao; Liu, Bingya; Shao, Zhifeng; Zhao, Xiaodong

    2016-01-01

    EZH2, the catalytic component of polycomb repressive complex 2 (PRC2), is frequently overexpressed in human cancers and contributes to tumor initiation and progression, in part through transcriptional silencing of tumor suppressor genes. A number of noncoding RNAs (ncRNAs) recruit EZH2 to specific chromatin loci, where they modulate gene expression. Here, we used RNA immunoprecipitation sequencing (RIP-seq) to profile EZH2-associated transcripts in human gastric cancer cell lines. We identified 8,256 transcripts, including both noncoding and coding transcripts, some of which were derived from cancer-related loci. In particular, we found that long noncoding RNA (lncRNA) MALAT1 binds EZH2, suppresses the tumor suppressor PCDH10, and promotes gastric cellular migration and invasion. Our work thus provides a global view of the EZH2-associated transcriptome and offers new insight into the function of EZH2 in gastric tumorigenesis. PMID:26871474

  10. Evaluation of standardless EDXRF analysis for the determination of elements on PM10 loaded filters

    NASA Astrophysics Data System (ADS)

    Yatkin, S.; Gerboles, M.; Borowiak, A.

    2012-07-01

    Energy Dispersive X-ray Fluorescence (EDXRF) was compared to Inductively Coupled Plasma Mass Spectrometer (ICP-MS) for the measurements of elements (Mg, Al, Si, S, Cl, K, Ca, Ti, V, Cr, Fe, Co, Ni, Mn, Cu, Zn, As, Br, Sr, Pb, Mo, Cd, Sn and Sb) in particulate matter (PM10) collected on Teflon and two types of quartz filters at different sites. Two different methods of EDXRF analysis, linear calibration and standardless analysis, were studied. For the linear calibration, Pb, Mn, Fe, Cu, Ti and Zn were found to be site and filter type independent whereas Ca was only site independent. The site effect was evidenced for K, As, Ni, and V for quartz filter. The standardless EDXRF analysis showed better results than linear calibrations except for As, Co and V for Teflon filters and Cr and V for quartz filters. The measurement uncertainty of standardless EDXRF analysis was estimated by establishing a model equation. The measurement uncertainty estimated with this model equation was confirmed by field experiments provided that elemental masses exceeded observed thresholds. It was found that standardless EDXRF analysis is able to quantify most of the elements studied, particularly on Teflon filters rather than quartz filters. The standardless EDXRF analysis complies with the data quality objectives (DQO) of European Directives to measure Pb in PM10 for three types of filters, even at concentrations lower than limit values (LV). The detection limits (MDL) of standardless EDXRF analysis for measuring As and Cd were found to be insufficient to meet the legislative requirements. The MDL of Ni was sufficiently low for measurements; however, measurement uncertainties remained higher than the DQO at the lower concentrations than LV.

  11. Molecular Dissection of the Human Ubiquitin C Promoter Reveals Heat Shock Element Architectures with Activating and Repressive Functions.

    PubMed

    Crinelli, Rita; Bianchi, Marzia; Radici, Lucia; Carloni, Elisa; Giacomini, Elisa; Magnani, Mauro

    2015-01-01

    The promoter of the polyubiquitin C gene (UBC) contains putative heat shock elements (HSEs) which are thought to mediate UBC induction upon stress. However, the mapping and the functional characterization of the cis-acting determinants for its up-regulation have not yet been addressed. In this study, the sequence encompassing 916 nucleotides upstream of the transcription start site of the human UBC gene has been dissected by in silico, in vitro and in vivo approaches. The information derived from this analysis was used to study the functional role and the interplay of the identified HSEs in mediating the transcriptional activation of the UBC gene under conditions of proteotoxic stress, induced by the proteasome inhibitor MG132. Here we demonstrate that at least three HSEs, with different configurations, exist in the UBC promoter: two distal, residing within nucleotides -841/-817 and -715/-691, and one proximal to the transcription start site (nt -100/-65). All of them are bound by transcription factors belonging to the heat shock factor (HSF) family, as determined by bandshift, supershift and ChIP analyses. Site-directed mutagenesis of reporter constructs demonstrated that while the distal elements are involved in the up-regulation of UBC in response to proteasome inhibition, the proximal one appears rather to function as negative regulator of the stress-induced transcriptional activity. This is the first evidence that an HSE may exert a negative role on the transcription driven by other HSE motifs on the same gene promoter, highlighting a new level of complexity in the regulation of HSFs and in the control of ubiquitin levels. PMID:26317694

  12. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central

    2013-01-01

    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  13. Abscisic acid-induced gene expression in the liverwort Marchantia polymorpha is mediated by evolutionarily conserved promoter elements.

    PubMed

    Ghosh, Totan K; Kaneko, Midori; Akter, Khaleda; Murai, Shuhei; Komatsu, Kenji; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2016-04-01

    Abscisic acid (ABA) is a phytohormone widely distributed among members of the land plant lineage (Embryophyta), regulating dormancy, stomata closure and tolerance to environmental stresses. In angiosperms (Magnoliophyta), ABA-induced gene expression is mediated by promoter elements such as the G-box-like ACGT-core motifs recognized by bZIP transcription factors. In contrast, the mode of regulation by ABA of gene expression in liverworts (Marchantiophyta), representing one of the earliest diverging land plant groups, has not been elucidated. In this study, we used promoters of the liverwort Marchantia polymorpha dehydrin and the wheat Em genes fused to the β-glucuronidase (GUS) reporter gene to investigate ABA-induced gene expression in liverworts. Transient assays of cultured cells of Marchantia indicated that ACGT-core motifs proximal to the transcription initiation site play a role in the ABA-induced gene expression. The RY sequence recognized by B3 transcriptional regulators was also shown to be responsible for the ABA-induced gene expression. In transgenic Marchantia plants, ABA treatment elicited an increase in GUS expression in young gemmalings, which was abolished by simultaneous disruption of the ACGT-core and RY elements. ABA-induced GUS expression was less obvious in mature thalli than in young gemmalings, associated with reductions in sensitivity to exogenous ABA during gametophyte growth. In contrast, lunularic acid, which had been suggested to function as an ABA-like substance, had no effect on GUS expression. The results demonstrate the presence of ABA-specific response mechanisms mediated by conserved cis-regulatory elements in liverworts, implying that the mechanisms had been acquired in the common ancestors of embryophytes. PMID:26456006

  14. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar

    2003-01-01

    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  15. Two initiator-like elements are required for the combined activation of the human apolipoprotein C-III promoter by upstream stimulatory factor and hepatic nuclear factor-4.

    PubMed

    Pastier, Daniele; Lacorte, Jean-Marc; Chambaz, Jean; Cardot, Philippe; Ribeiro, Agnes

    2002-04-26

    Human apoC-III (-890/+24) promoter activity is strongly activated by hepatic nuclear factor (HNF)-4 through its binding to the proximal (-87/-72) element B. This site overlaps the binding site for an activity that we identified as the ubiquitously expressed upstream stimulatory factor (USF) (Ribeiro, A., Pastier, D., Kardassis, D., Chambaz, J., and Cardot, P. (1999) J. Biol. Chem. 274, 1216-1225). In the present study, we characterized the relationship between USF and HNF-4 in the activation of human apoC-III transcription. Although USF and HNF-4 binding to element B is mutually exclusive, co-transfection experiments in HepG2 cells surprisingly showed a combined effect of USF and HNF-4 in the transactivation of the (-890/+24) apoC-III promoter. This effect only requires the proximal region (-99/+24) of the apoC-III promoter and depends neither on USF binding to its cognate site in element B nor on a USF-dependent facilitation of HNF-4 binding to its site. By contrast, we found by electrophoretic mobility shift assay and footprinting analysis two USF low affinity binding sites, located within the proximal promoter at positions -58/-31 (element II) and -19/-4 (element I), which are homologous to initiator-like element sequence. Co-transfection experiments in HepG2 cells show that a mutation in element II reduces 2-fold the USF transactivation effect on the proximal promoter of apoC-III and that a mutation in element I inhibits the combined effect of USF and HNF-4. In conclusion, these initiator-like elements are directly involved in the transactivation of the apoC-III promoter by USF and are necessary to the combined effect between USF and HNF-4 for the apoC-III transcription. PMID:11839757

  16. Transcriptional Regulation of the Beta-Synuclein 5′-Promoter Metal Response Element by Metal Transcription Factor-1

    PubMed Central

    McHugh, Patrick C.; Wright, Josephine A.; Brown, David R.

    2011-01-01

    The progression of many human neurodegenerative disorders is associated with an accumulation of alpha-synuclein. Alpha-synuclein belongs to the homologous synuclein family, which includes beta-synuclein. It has been proposed that beta-synuclein may be a natural regulator of alpha-synuclein. Therefore controlling beta-synuclein expression may control the accumulation of alpha-synuclein and ultimately prevent disease progression. The regulation of synucleins is poorly understood. We investigated the transcriptional regulation of beta-synuclein, with the aim of identifying molecules that differentially control beta-synuclein expression levels. To investigate transcriptional regulation of beta-synuclein, we used reporter gene assays and bioinformatics. We identified a region −1.1/−0.6 kb upstream of the beta-synuclein translational start site to be a key regulatory region of beta-synuclein 5′-promoter activity in human dopaminergic cells (SH-SY5Y). Within this key promoter region we identified a metal response element pertaining to a putative Metal Transcription Factor-1 (MTF-1) binding site. We demonstrated that MTF-1 binds to this 5′-promoter region using EMSA analysis. Moreover, we showed that MTF-1 differentially regulates beta-synuclein promoter binding site, as well as beta-synuclein mRNA and protein expression. This effect of MTF-1 on expression was found to be specific to beta-synuclein when compared to alpha-synuclein. Understanding the regulation of synucleins and how they interact may point to molecular targets that could be manipulated for therapeutic benefit. In this study we showed that MTF-1 differentially controls the expression of beta-synuclein when compared to its homolog alpha-synuclein. This could potentially provide a novel targets or pathways for therapeutic intervention and/or treatment of synucleinopathies. PMID:21386983

  17. Small molecule screen for inhibitors of expression from canonical CREB response element-containing promoters

    PubMed Central

    Mitton, Bryan; Hsu, Katie; Dutta, Ritika; Tiu, Bruce C.; Cox, Nick; McLure, Kevin G.; Chae, Hee-Don; Smith, Mark; Eklund, Elizabeth A.; Solow-Cordero, David E.; Sakamoto, Kathleen M.

    2016-01-01

    The transcription factor CREB (cAMP Response Element Binding Protein) is an important determinant in the growth of Acute Myeloid Leukemia (AML) cells. CREB overexpression increases AML cell growth by driving the expression of key regulators of apoptosis and the cell cycle. Conversely, CREB knockdown inhibits proliferation and survival of AML cells but not normal hematopoietic cells. Thus, CREB represents a promising drug target for the treatment of AML, which carries a poor prognosis. In this study, we performed a high-throughput small molecule screen to identify compounds that disrupt CREB function in AML cells. We screened ∼114,000 candidate compounds from Stanford University's small molecule library, and identified 5 molecules that inhibit CREB function at micromolar concentrations, but are non-toxic to normal hematopoietic cells. This study suggests that targeting CREB function using small molecules could provide alternative approaches to treat AML. PMID:26840025

  18. Evaluating the association of interleukin-10 gene promoter -592 A/C polymorphism with lupus nephritis susceptibility

    PubMed Central

    Abdallah, Emad; Waked, Emam; Abdelwahab, Mahmoud A.

    2015-01-01

    Background Interleukin-10 (IL-10) is an important immunoregulatory cytokine. There are few studies evaluating the association between IL-10 and lupus nephritis (LN). The aim of this study was to evaluate the association of IL-10 gene promoter -592 A/C with LN susceptibility. Methods The study was conducted on 84 patients with systemic lupus erythematosus (SLE). Patients were divided into LN group (Group I, 48 patients) and non-LN group (Group II, 36 patients). The -592 A/C polymorphisms in IL-10 promoter gene were determined by polymerase chain reaction and restriction fragment length polymorphism in both groups. IL-10 was determined by enzyme-linked immunosorbent assay. Frequencies of the genotypes were compared between LN and non-LN patients and among LN patients with different pathologic classes. Results There was a significant increase in serum level of IL-10 (P = 0.001) in Group I compared with Group II and significant positive correlation between serum IL-10 and SLE disease activity index (r = 0.466, P = 0.001) in Group I. There were no significant differences in the distribution of the IL-10 gene promoter -592 A/C genotypes or the allele frequencies between Groups I and II. There was no significant difference between AC/CC and AA genotypes with SLE disease activity index, proteinuria, hematuria, anti-double-stranded DNA, and IL-10 in Group I. There was no significant difference in the distribution of AC and CC genotypes among different pathologic LN classes. Conclusion IL-10 suggested to play a role in pathogenesis and development of LN. However, the promoter -592 A/C of IL-10 gene suggested to be not associated with serum IL-10 levels or LN susceptibility. In addition, it appears that promoter -592 A/C of IL-10 gene not associated with LN activity or the pathologic classes of LN. PMID:27069855

  19. Temperature-dependence of open-complex formation at two Escherichia coli promoters with extended -10 sequences.

    PubMed Central

    Burns, H D; Belyaeva, T A; Busby, S J; Minchin, S D

    1996-01-01

    We have studied the formation of open complexes between purified RNA polymerase from Escherichia coli and DNA fragments carrying the galP1 promoter, a promoter with an extended -10 region. Unusually, these complexes are formed readily at low temperatures. This low-temperature opening is unaffected by deletions of either upstream or downstream promoter sequences. We conclude that low-temperature open-complex formation is due to specific base sequences in and just upstream of the extended -10 region. In contrast, open complexes are not formed at low temperatures with DNA fragments carrying the E. coli cysG promoter, which also has an extended -10 region. This demonstrates that an extended -10 sequence alone is not sufficient for low-temperature opening. Additionally, we report the temperature dependence of a hybrid galP1-cysG promoter, the related galP2 and galP3 promoters and a derivative of galP1 with an improved -10 hexamer sequence. PMID:8694780

  20. Vitamin D Responsive Elements within the HLA-DRB1 Promoter Region in Sardinian Multiple Sclerosis Associated Alleles

    PubMed Central

    Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola; Mura, Gioia; Rosatelli, Maria Cristina; Marrosu, Maria Giovanna

    2012-01-01

    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15∶01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15∶01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04∶05, *03∶01, *13∶01 and *15∶01 and non-MS-associated *16∶01, *01, *11, *07∶01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects). Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15∶01, *16∶01, *11 and in 45/73 *03∶01 and in heterozygous state in 28/73 *03∶01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13∶03, *04∶05 and *07∶01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04∶05 and *03∶01 alleles carrying the new mutated VDRE, while the *16∶01 and *03∶01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16∶01 and in the *15∶01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients. PMID:22848563

  1. A short, highly repetitive element in intron -1 of the human c-Ha-ras gene acts as a block to transcriptional readthrough by a viral promoter.

    PubMed Central

    Lowndes, N F; Bushel, P; Mendelsohn, L; Wu, J; Yen, M Y; Allan, M

    1990-01-01

    We have identified a short, highly repetitive element within intron -1 of the human c-Ha-ras gene. This element was found to be transcribed in both orientations and to be homologous to heterogeneous nonpolyadenylated transcripts. The repetitive element blocked transcriptional readthrough from a strong upstream viral promoter but allowed unimpaired readthrough from the c-Has-ras promoter. We suggest that it may serve to prevent excessive transcription into the coding region of the gene under such circumstances as viral insertion. Images PMID:2201911

  2. Tight regulation of plant immune responses by combining promoter and suicide exon elements.

    PubMed

    Gonzalez, Tania L; Liang, Yan; Nguyen, Bao N; Staskawicz, Brian J; Loqué, Dominique; Hammond, Ming C

    2015-08-18

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive 'hypersensitive response' (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightly regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. Beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes. PMID:26138488

  3. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    SciTech Connect

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; Staskawicz, Brian J.; Loqué, Dominique; Hammond, Ming C.

    2015-07-02

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightly regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. In conclusion, beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes.

  4. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    DOE PAGESBeta

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; Staskawicz, Brian J.; Loqué, Dominique; Hammond, Ming C.

    2015-07-02

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightlymore » regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. In conclusion, beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes.« less

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  6. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    PubMed Central

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; Staskawicz, Brian J.; Loqué, Dominique; Hammond, Ming C.

    2015-01-01

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightly regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. Beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes. PMID:26138488

  7. BET-independent MLV-based Vectors Target Away From Promoters and Regulatory Elements

    PubMed Central

    El Ashkar, Sara; De Rijck, Jan; Demeulemeester, Jonas; Vets, Sofie; Madlala, Paradise; Cermakova, Katerina; Debyser, Zeger; Gijsbers, Rik

    2014-01-01

    Stable integration in the host genome renders murine leukemia virus (MLV)-derived vectors attractive tools for gene therapy. Adverse events in otherwise successful clinical trials caused by proto-oncogene activation due to vector integration hamper their application. MLV and MLV-based vectors integrate near strong enhancers, active promoters, and transcription start sites (TSS) through specific interaction of MLV integrase (IN) with the bromodomain and extra-terminal (BET) family of proteins, accounting for insertional mutagenesis. We identified a BET-interaction motif in the C-terminal tail of MLV IN conserved among gammaretroviruses. By deletion of this motif or a single point mutation (INW390A), BET-independent MLV (BinMLV) were engineered. BinMLV vectors carrying INW390A integrate at wild-type efficiency, with an integration profile that no longer correlates with BET chromatin distribution nor with the traditional markers of MLV integration. In particular, BinMLV vector integration associated less with oncogene TSS compared to the MLV vectors currently used in clinical trials. Together, these findings open perspectives to increase the biosafety of gammaretroviral vectors for gene therapy. PMID:25072693

  8. The transposon-like Correia elements encode numerous strong promoters and provide a potential new mechanism for phase variation in the meningococcus.

    PubMed

    Siddique, Azeem; Buisine, Nicolas; Chalmers, Ronald

    2011-01-01

    Neisseria meningitidis is the primary causative agent of bacterial meningitis. The genome is rich in repetitive DNA and almost 2% is occupied by a diminutive transposon called the Correia element. Here we report a bioinformatic analysis defining eight subtypes of the element with four distinct types of ends. Transcriptional analysis, using PCR and a lacZ reporter system, revealed that two ends in particular encode strong promoters. The activity of the strongest promoter is dictated by a recurrent polymorphism (Y128) at the right end of the element. We highlight examples of elements that appear to drive transcription of adjacent genes and others that may express small non-coding RNAs. Pair-wise comparisons between three meningococcal genomes revealed that no more than two-thirds of Correia elements maintain their subtype at any particular locus. This is due to recombinational class switching between elements in a single strain. Upon switching subtype, a new allele is available to spread through the population by natural transformation. This process may represent a hitherto unrecognized mechanism for phase variation in the meningococcus. We conclude that the strain-to-strain variability of the Correia elements, and the large number of strong promoters encoded by them, allows for potentially widespread effects within the population as a whole. By defining the strength of the promoters encoded by the eight subtypes of Correia ends, we provide a resource that allows the transcriptional effects of a particular subtype at a given locus to be predicted. PMID:21283790

  9. The Transposon-Like Correia Elements Encode Numerous Strong Promoters and Provide a Potential New Mechanism for Phase Variation in the Meningococcus

    PubMed Central

    Siddique, Azeem; Buisine, Nicolas; Chalmers, Ronald

    2011-01-01

    Neisseria meningitidis is the primary causative agent of bacterial meningitis. The genome is rich in repetitive DNA and almost 2% is occupied by a diminutive transposon called the Correia element. Here we report a bioinformatic analysis defining eight subtypes of the element with four distinct types of ends. Transcriptional analysis, using PCR and a lacZ reporter system, revealed that two ends in particular encode strong promoters. The activity of the strongest promoter is dictated by a recurrent polymorphism (Y128) at the right end of the element. We highlight examples of elements that appear to drive transcription of adjacent genes and others that may express small non-coding RNAs. Pair-wise comparisons between three meningococcal genomes revealed that no more than two-thirds of Correia elements maintain their subtype at any particular locus. This is due to recombinational class switching between elements in a single strain. Upon switching subtype, a new allele is available to spread through the population by natural transformation. This process may represent a hitherto unrecognized mechanism for phase variation in the meningococcus. We conclude that the strain-to-strain variability of the Correia elements, and the large number of strong promoters encoded by them, allows for potentially widespread effects within the population as a whole. By defining the strength of the promoters encoded by the eight subtypes of Correia ends, we provide a resource that allows the transcriptional effects of a particular subtype at a given locus to be predicted. PMID:21283790

  10. Aberrant Promoter Methylation of the Tumour Suppressor RASSF10 and Its Growth Inhibitory Function in Breast Cancer

    PubMed Central

    Richter, Antje M.; Walesch, Sara K.; Dammann, Reinhard H.

    2016-01-01

    Breast cancer is the most common cancer in women, with 1.7 million new cases each year. As early diagnosis and prognosis are crucial factors in cancer treatment, we investigated potential DNA methylation biomarkers of the tumour suppressor family Ras-association domain family (RASSF). Promoter hypermethylation of tumour suppressors leads to their inactivation and thereby promotes cancer development and progression. In this study we analysed the tumour suppressors RASSF1A and RASSF10. Our study shows that RASSF10 is expressed in normal breast but inactivated by methylation in breast cancer. We observed a significant inactivating promoter methylation of RASSF10 in primary breast tumours. RASSF10 is inactivated in 63% of primary breast cancer samples but only 4% of normal control breast tissue is methylated (p < 0.005). RASSF1A also shows high promoter methylation levels in breast cancer of 56% vs. 8% of normal tissue (p < 0.005). Interestingly more than 80% of breast cancer samples harboured a hypermethylation of RASSF10 and/or RASSF1A promoter. Matching samples exhibited a strong tumour specific promoter methylation of RASSF10 in comparison to the normal control breast tissue. Demethylation treatment of breast cancer cell lines MCF7 and T47D reversed RASSF10 promoter hypermethylation and re-established RASSF10 expression. In addition, we could show the growth inhibitory potential of RASSF10 in breast cancer cell lines MCF7 and T47D upon exogenous expression of RASSF10 by colony formation. We could further show, that RASSF10 induced apoptotic changes in MCF7 and T47D cells, which was verified by a significant increase in the apoptotic sub G1 fraction by 50% using flow cytometry for MCF7 cells. In summary, our study shows the breast tumour specific inactivation of RASSF10 and RASSF1A due to DNA methylation of their CpG island promoters. Furthermore RASSF10 was characterised by the ability to block growth of breast cancer cell lines by apoptosis induction. PMID

  11. Glucocorticoid and progestin receptors are differently involved in the cooperation with a structural element of the mouse mammary tumor virus promoter.

    PubMed Central

    Le Ricousse, S; Gouilleux, F; Fortin, D; Joulin, V; Richard-Foy, H

    1996-01-01

    We have previously characterized a regulatory element located between -294 and -200 within the mouse mammary tumor virus (MMTV) long terminal repeat (LTR). This element termed AA element cooperates with the glucocorticoid response elements (GREs) for glucocorticoid activation. Here we show that in a MMTV LTR wild type context, the deletion of this element significantly reduces both glucocorticoid and progestin activation of the promoter. Deletion of the two most distal GREs forces the glucocorticoid receptor (GR) and the progestin receptor (PR) to bind the same response elements and results in a dramatic decrease in the inducibility of the MMTV promoter by the two hormones. The simultaneous deletion of the two distal GREs and of the AA element abolishes completely the glucocorticoid-induced activation of the promoter. In contrast it restores a significant level of progestin-induced activation. This different effect of the double deletion on glucocorticoid- and progestin-induced MMTV promoter activation is not cell specific because it is also observed, and is even stronger, when either GR or PR is expressed in the same cell line (NIH 3T3). This is the first description of a mutated MMTV promoter that, although retaining GREs, is activated by progestins and not by glucocorticoids. This suggests a different functional cooperation between protein(s) interacting with the AA element and GR or PR. Cotransfections with constructs containing wild-type or mutated MMTV LTR with either PR lacking its C-terminal domain or GR/PR chimeras in which the N-terminal domains have been exchanged demonstrate that the N-terminal domains of the receptors specify the different behavior of GR and PR regarding the AA element. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8643531

  12. Draft Genome Sequence of Bacillus methylotrophicus FKM10, a Plant Growth-Promoting Rhizobacterium Isolated from Apple Rhizosphere

    PubMed Central

    Wang, Chengqiang; Hu, Xiuna; Liu, Kai; Hou, Qihui; Yang, Qianqian

    2016-01-01

    Bacillus methylotrophicus FKM10 is a strain of plant growth-promoting rhizobacterium with antimicrobial activity, which was isolated from apple rhizosphere. Here, we present the genome sequence of B. methylotrophicus FKM10. Two scaffolds were finally assembled, and several functional genes related to its antimicrobial activity were discovered. PMID:26868409

  13. Draft Genome Sequence of Bacillus methylotrophicus FKM10, a Plant Growth-Promoting Rhizobacterium Isolated from Apple Rhizosphere.

    PubMed

    Wang, Chengqiang; Hu, Xiuna; Liu, Kai; Hou, Qihui; Yang, Qianqian; Ding, Yanqin; Du, Binghai

    2016-01-01

    Bacillus methylotrophicus FKM10 is a strain of plant growth-promoting rhizobacterium with antimicrobial activity, which was isolated from apple rhizosphere. Here, we present the genome sequence of B. methylotrophicus FKM10. Two scaffolds were finally assembled, and several functional genes related to its antimicrobial activity were discovered. PMID:26868409

  14. FSHB promoter polymorphism within evolutionary conserved element is associated with serum FSH level in men

    PubMed Central

    Grigorova, Marina; Punab, Margus; Ausmees, Kristo; Laan, Maris

    2008-01-01

    BACKGROUND No polymorphisms affecting serum FSH levels have been described in the human FSHB gene. We have identified a potential regulatory single nucleotide polymorphism (SNP, rs10835638; G/T) 211 bp upstream from the FSHB mRNA transcription start-site, located within a highly conserved region among placental mammals. We aimed to determine the correlation of carrier status of rs10835638 alternative alleles with serum FSH level in men, and testicular and hormonal parameters. METHODS A quantitative genetic association study using a cohort of healthy men (n = 554; age 19.2 ± 1.7 years) visiting the Centre of Andrology, Tartu University Hospital, Estonia. RESULTS Rs10835638 (allele frequencies: G 87.6%, T 12.4%) was significantly associated with serum FSH level (analysis of variance: F = 13.0, P = 0.0016, df = 1; regression testing for a linear trend: P = 0.0003). Subjects with the GG genotype exhibited higher FSH levels (3.37 ± 1.79 IU/l, n = 423) compared with heterozygotes (2.84 ± 1.54 IU/l, n = 125) (P = 0.0005), the group of T-allele carriers (GT+TT, 2.78 ± 1.51 IU/l, n = 131) (P = 0.0005) and TT-homozygotes (2.02 ± 0.81 IU/L, n = 6) (P = 0.031). Rs10835638 was also associated with significant (P < 0.05) reduction in free testosterone index and testes volume, but increased semen volume, sex hormone-binding globulin, serum testosterone and estradiol. LH and inhibin-B levels did not differ significantly between groups. CONCLUSIONS The identification of a regulatory SNP in FSHB promoter paves the way to study the effect of constitutively low FSH on male health and fertility. As FSH contributes to follicular development and sex steroid production in women, the role of this FSHB variant in female reproductive success is still to be addressed. PMID:18567894

  15. Transcription of the Schizosaccharomyces pombe U2 gene in vivo and in vitro is directed by two essential promoter elements

    PubMed Central

    Zhou, Dewang; Lobo-Ruppert, Susan M.

    2001-01-01

    As compared to the metazoan small nuclear RNAs (snRNAs), relatively little is known about snRNA synthesis in unicellular organisms. We have analyzed the transcription of the Schizosaccharomyces pombe U2 snRNA gene in vivo and in the homologous in vitro system. Deletion and linker-scanning analyses show that the S.pombe U2 promoter contains at least two elements: the spUSE centered at –55, which functions as an activator, and a TATA box at –26, which is essential for basal transcription. These data point to a similar architecture among S.pombe, plant and invertebrate snRNA promoters. Factors recognizing the spUSE can be detected in whole cell extracts by DNase I footprinting and competition studies show that the binding of these factors correlates with transcriptional activity. Electrophoretic mobility shift assays and gel-filtration chromatography revealed a native molecular mass of ∼200 kDa for the spUSE binding activity. Two polypeptides of molecular masses 25 and 65 kDa were purified by virtue of their ability to specifically bind the spUSE. PMID:11353068

  16. In vivo promoter analysis on refeeding response of hepatic sterol regulatory element-binding protein-1c expression

    SciTech Connect

    Takeuchi, Yoshinori; Yahagi, Naoya; Nakagawa, Yoshimi; Matsuzaka, Takashi; Shimizu, Ritsuko; Sekiya, Motohiro; Iizuka, Yoko; Ohashi, Ken; Gotoda, Takanari; Yamamoto, Masayuki; Nagai, Ryozo; Kadowaki, Takashi; Yamada, Nobuhiro; Osuga, Jun-ichi; Shimano, Hitoshi

    2007-11-16

    Sterol regulatory element-binding protein (SREBP)-1c is the master regulator of lipogenic gene expression in liver. The mRNA abundance of SREBP-1c is markedly induced when animals are refed after starvation, although the regulatory mechanism is so far unknown. To investigate the mechanism of refeeding response of SREBP-1c gene expression in vivo, we generated a transgenic mouse model that carries 2.2 kb promoter region fused to the luciferase reporter gene. These transgenic mice exhibited refeeding responses of the reporter in liver and adipose tissues with extents essentially identical to those of endogenous SREBP-1c mRNA. The same results were obtained from experiments using adenovirus-mediated SREBP-1c-promoter-luciferase fusion gene transduction to liver. These data demonstrate that the regulation of SREBP-1c gene expression is at the transcription level, and that the 2.2 kb 5'-flanking region is sufficient for this regulation. Moreover, when these transgenic or adenovirus-infected mice were placed on insulin-depleted state by streptozotocin treatment, the reporter expression was upregulated as strongly as in control mice, demonstrating that this regulation is not dominated by serum insulin level. These mice are the first models to provide the mechanistic insight into the transcriptional regulation of SREBP-1c gene in vivo.

  17. Amino acid deprivation induces CREBZF/Zhangfei expression via an AARE-like element in the promoter.

    PubMed

    Zhang, Yani; Jin, Yaping; Williams, Tegan A; Burtenshaw, Sally M; Martyn, Amanda C; Lu, Rui

    2010-01-15

    CREBZF (also called ZF or Zhangfei) is a basic region-leucine zipper transcription factor that has been implicated in the herpesvirus infection cycle and related cellular processes. Since ATF4 is known to play a key role in cellular responses to various ER stresses as well as amino acid deprivation, we sought to examine the potential involvement of CREBZF in the amino acid response (AAR). We found that the CREBZF protein was induced by amino acid deprivation in the canine MDCK cells. We subsequently cloned a canine CREBZF promoter region (-1767bp to +1bp) that responds to amino acid limitation. Using deletion mapping and site-directed mutagenesis, we identified a 9-bp sequence 5'-ATTCACTCA-3' in the promoter (-1227 to -1219), deletion of which resulted in a complete loss of inducibility by amino acid deprivation. This sequence is similar to the known amino acid response elements (AAREs) found in other AAR-inducible genes, such as CHOP (C/EBP homologous protein, also known as GADD153). These results suggest that CREBZF may be an amino acid stress sensor. Considering the AARE-like sequence found in CREBZF and other similarities between CREBZF and CHOP, we postulate that CREBZF and CHOP may be two sensors that regulate different yet related signaling pathways governing the AAR. PMID:20026304

  18. Serum response element-like sequences of the human low density lipoprotein receptor promoter: possible regulation sites for sterol-independent transcriptional activation.

    PubMed

    Pak, Y K

    1996-02-01

    Serum factors stimulate low density lipoprotein receptor (LDLR) gene expression in HepG2 cells through sterol-independent pathways. Promoter element other than sterol regulatory element-1 (SRE-1) seems to be necessary. Protein binding activity of the human LDLR promoter fragment (550bp) beyond the SRE-1 was determined by DNase I footprint assay. Five different promoter regions were protected from DNase I digestion; -226 to -258, -291 to -304, -324 to -336, -360 to -373, and -521 to -528. The regions of -324 to -336 and -521 to -528 showed serum response element (SRE)-like consensus sequence of CC(A/T)6GG. Serum incubation affected the protection degree of the SRE-like elements, but 25-hydroxycholesterol did not. It is proposed, therefore, that the promoter region of -324 to -336 and/or -521 to -528 showed serum response elements, but 25-hydroxycholesterol did not. It is proposed, therefore, that the promoter region of -324 to -336 and/or -521 to -528 in human LDLR gene may be responsible for the rapid activation of the gene transcription by serum factor in a sterol-independent manner. PMID:8932516

  19. Cellular localization of the embryo-specific hybrid PRP from Zea mays, and characterization of promoter regulatory elements of its gene.

    PubMed

    Jose-Estanyol, M; Puigdomènech, P

    2012-10-01

    The expression, regulation and cellular localization of ZmHyPRP, a gene marker of embryo differentiation whose expression declines after ABA induction, was studied. ZmHyPRP is a proline-rich protein with a C-terminal domain having eight cysteines in a CM8 pattern. Transient expression in onion epidermal cells, transformed with a 2x35S::ZmHyPRP-GFP construction, indicated the protein is present in vesicles lining the membrane of the cell. The ZmHyPRP gene expression is under the control of classic promoter seed-specific regulatory elements such as Sph/RY and G-boxes, suggesting regulation by B3 and b-ZIP transcription factors. Promoter deletion analysis, by particle-bombardment transient transformation of maize immature embryos with serial deletions of the promoter fused to GUS, showed the presence of two negative regulatory elements, NE1 (-2070 to -1280) and NE2 (-232 to -178), in the ZmHyPRP promoter. By selective deletion or mutation of ZmHyPRP regulatory promoter elements we conclude that the promoter expression is attenuated by the NE2 element as well as by the G-box2 and the Sph1-2 box together with the G-box2. PMID:22915319

  20. Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.

    PubMed

    Bondurand, Nadége; Fouquet, Virginie; Baral, Viviane; Lecerf, Laure; Loundon, Natalie; Goossens, Michel; Duriez, Benedicte; Labrune, Philippe; Pingault, Veronique

    2012-09-01

    Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15-35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within known genes may have escaped previous screenings. Here, we searched for deletions within recently identified SOX10 regulatory sequences and describe the first characterization of a WS4 patient presenting with a large deletion encompassing three of these enhancers. Analysis of the breakpoint region suggests a complex rearrangement involving three Alu sequences that could be mediated by a FosTes/MMBIR replication mechanism. Taken together with recent reports, our results demonstrate that the disruption of highly conserved non-coding elements located within or at a long distance from the coding sequences of key genes can result in several neurocristopathies. This opens up new routes to the molecular dissection of neural crest disorders. PMID:22378281

  1. Polarity of the ecdysone receptor complex interaction with the palindromic response element from the hsp27 gene promoter.

    PubMed

    Niedziela-Majka, A; Kochman, M; Ozyhar, A

    2000-01-01

    The functional 20-hydroxyecdysone (20E) receptor is a heterodimer of two members of the nuclear hormone receptors superfamily; the product of the EcR (EcR) and of the ultraspiracle (Usp) genes. As most of the natural 20E-response elements are highly degenerated palindromes, we were interested in determining whether or not such asymmetric elements could dictate the defined orientation of the Usp/EcR complex. We have investigated interaction of EcR and Usp DNA-binding domains (EcRDBD and UspDBD, respectively) with the palindromic response element from the hsp27 gene promoter (hsp27pal). The hsp27pal half-sites contribute differently to the binding of the heterodimer components; the 5' half-site exhibits higher affinity for both DBDs than the 3' half-site. This observation, along with data demonstrating that UspDBD exhibits approximate fourfold higher affinity to the 5' half-site than EcRDBD, suggest that UspDBD locates the EcRDBD/UspDBD heterocomplex in the defined orientation (5'-UspDBD-EcRDBD-3') on the hsp27pal sequence. The binding polarity onto hsp27pal is accompanied by different contribution of the UspDBD and EcRDBD C-terminal sequences to the DNA-binding and heterocomplex formation. This is supported by finding that deletion of the C-terminal of EcRDBD region corresponding to the putative A-helix severely decreased binding of the EcRDBD to the hsp27pal. In contrast, UspDBD in which corresponding residues were deleted exhibited the same hsp27pal binding pattern as the wild type UspDBD. Additional truncation comprising the putative T-box, resulted in a reduced binding of the mutated UspDBD. This truncation however, still allowed effective EcRDBD/UspDBD heterodimer formation. Finally we demonstrated that perfect palindromes, composed of two hsp27pal 5' half-sites (or of the related sequence) contain all of the structural information necessary for the anisotropic UspDBD/EcRDBD heterocomplex formation. However, the perfect palindromes bind isolated homomeric DBDs

  2. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.

    PubMed

    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K

    2015-09-25

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  3. Sigma factor selectivity in Borrelia burgdorferi: RpoS recognition of the ospE/ospF/elp promoters is dependent on the sequence of the -10 region.

    PubMed

    Eggers, Christian H; Caimano, Melissa J; Radolf, Justin D

    2006-03-01

    Members of the ospE/ospF/elp lipoprotein gene families of Borrelia burgdorferi, the Lyme disease agent, are transcriptionally upregulated in response to the influx of blood into the midgut of an infected tick. We recently have demonstrated that despite the high degree of similarity between the promoters of the ospF (P(ospF)) and ospE (P(ospE)) genes of B. burgdorferi strain 297, the differential expression of ospF is RpoS-dependent, while ospE is controlled by sigma(70). Herein we used wild-type and RpoS-deficient strains of B. burgdorferi and Escherichia coli to analyse transcriptional reporters consisting of a green fluorescent protein (gfp) gene fused to P(ospF), P(ospE), or two hybrid promoters in which the -10 regions of P(ospF) and P(ospE) were switched [P(ospF ) ((E - 10)) and P(ospE) ((F - 10)) respectively]. We found that the P(ospF)-10 region is both necessary and sufficient for RpoS-dependent recognition in B. burgdorferi, while sigma(70) specificity for P(ospE) is dependent on elements outside of the -10 region. In E. coli, sigma factor selectivity for these promoters was much more permissive, with expression of each being primarily due to sigma(70). Alignment of the sequences upstream of each of the ospE/ospF/elp genes from B. burgdorferi strains 297 and B31 revealed that two B31 ospF paralogues [erpK (BBM38) and erpL (BBO39)] have -10 regions virtually identical to that of P(ospF). Correspondingly, expression of gfp reporters based on the erpK and erpL promoters was RpoS-dependent. Thus, the sequence of the P(ospF)-10 region appears to serve as a motif for RpoS recognition, the first described for any B. burgdorferi promoter. Taken together, our data support the notion that B. burgdorferi utilizes sequence differences at the -10 region as one mechanism for maintaining the transcriptional integrity of RpoS-dependent and -independent genes activated at the onset of tick feeding. PMID:16553889

  4. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

    PubMed

    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R

    1995-11-01

    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  5. HIV-1 and Human PEG10 Frameshift Elements Are Functionally Distinct and Distinguished by Novel Small Molecule Modulators

    PubMed Central

    Sleebs, Brad E.; Lackovic, Kurt; Parisot, John P.; Moss, Rebecca M.; Crowe-McAuliffe, Caillan; Mathew, Suneeth F.; Edgar, Christina D.; Kleffmann, Torsten; Tate, Warren P.

    2015-01-01

    Frameshifting during translation of viral or in rare cases cellular mRNA results in the synthesis of proteins from two overlapping reading frames within the same mRNA. In HIV-1 the protease, reverse transcriptase, and integrase enzymes are in a second reading frame relative to the structural group-specific antigen (gag), and their synthesis is dependent upon frameshifting. This ensures that a strictly regulated ratio of structural proteins and enzymes, which is critical for HIV-1 replication and viral infectivity, is maintained during protein synthesis. The frameshift element in HIV-1 RNA is an attractive target for the development of a new class of anti HIV-1 drugs. However, a number of examples are now emerging of human genes using −1 frameshifting, such as PEG10 and CCR5. In this study we have compared the HIV-1 and PEG10 frameshift elements and shown they have distinct functional characteristics. Frameshifting occurs at several points within each element. Moreover, frameshift modulators that were isolated by high-throughput screening of a library of 114,000 lead-like compounds behaved differently with the PEG10 frameshift element. The most effective compounds affecting the HIV-1 element enhanced frameshifting by 2.5-fold at 10 μM in two different frameshift reporter assay systems. HIV-1 protease:gag protein ratio was affected by a similar amount in a specific assay of virally-infected cultured cell, but the modulation of frameshifting of the first-iteration compounds was not sufficient to show significant effects on viral infectivity. Importantly, two compounds did not affect frameshifting with the human PEG10 element, while one modestly inhibited rather than enhanced frameshifting at the human element. These studies indicate that frameshift elements have unique characteristics that may allow targeting of HIV-1 and of other viruses specifically for development of antiviral therapeutic molecules without effect on human genes like PEG10 that use the same

  6. The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element.

    PubMed Central

    Ye, J; Cippitelli, M; Dorman, L; Ortaldo, J R; Young, H A

    1996-01-01

    Our group has previously reported that the nuclear factor Yin-Yang 1 (YY1), a ubiquitous DNA-binding protein, is able to interact with a silencer element (BE) in the gamma interferon (IFN-gamma) promoter region. In this study, we demonstrated that YY1 can directly inhibit the activity of the IFN-gamma promoter by interacting with multiple sites in the promoter. In cotransfection assays, a YY1 expression vector significantly inhibited IFN-gamma promoter activity. Mutation of the YY1 binding site in the native IFN-gamma promoter was associated with an increase in the IFN-gamma promoter activity. Analysis of the DNA sequences of the IFN-gamma promoter revealed a second functional YY1 binding site (BED) that overlaps with an AP1 binding site. In this element, AP1 enhancer activity was suppressed by YY1. Since the nuclear level of YY1 does not change upon cell activation, our data support a model that the nuclear factor YY1 acts to suppress basal IFN-gamma transcription by interacting with the promoter at multiple DNA binding sites. This repression can occur through two mechanisms: (i) cooperation with an as-yet-unidentified AP2-like repressor protein and (ii) competition for DNA binding with the transactivating factor AP1. PMID:8756632

  7. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ..., including Safeguards Information designated as Safeguards Information-Modified Handling as defined in 10 CFR... required by 10 CFR 73.22(b) or 73.23(b). (l) Tribal official or the Tribal official's designated... history records checks and other elements of background checks for designated categories of...

  8. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ..., including Safeguards Information designated as Safeguards Information-Modified Handling as defined in 10 CFR... required by 10 CFR 73.22(b) or 73.23(b). (l) Tribal official or the Tribal official's designated... history records checks and other elements of background checks for designated categories of...

  9. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ..., including Safeguards Information designated as Safeguards Information-Modified Handling as defined in 10 CFR... required by 10 CFR 73.22(b) or 73.23(b). ... history records checks and other elements of background checks for designated categories of...

  10. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ..., including Safeguards Information designated as Safeguards Information-Modified Handling as defined in 10 CFR... required by 10 CFR 73.22(b) or 73.23(b). ... history records checks and other elements of background checks for designated categories of...

  11. Complex organization of promoter and enhancer elements regulate the tissue- and developmental stage-specific expression of the Drosophila melanogaster Gld gene.

    PubMed Central

    Keplinger, B L; Guo, X; Quine, J; Feng, Y; Cavener, D R

    2001-01-01

    The Drosophila melanogaster Gld gene has multiple and diverse developmental and physiological functions. We report herein that interactions among proximal promoter elements and a cluster of intronically located enhancers and silencers specify the complex regulation of Gld that underlies its diverse functions. Gld expression in nonreproductive tissues is largely determined by proximal promoter elements with the exception of the embryonic labium where Gld is activated by an enhancer within the first intron. A nuclear protein, GPAL, has been identified that binds the Gpal elements in the proximal promoter region. Regulation of Gld in the reproductive organs is particularly complex, involving interactions among the Gpal proximal promoter elements, a unique TATA box, three distinct enhancer types, and one or more silencer elements. The three somatic reproductive organ enhancers each activate expression in male and female pairs of reproductive organs. One of these pairs, the male ejaculatory duct and female oviduct, are known to be developmentally homologous. We report evidence that the other two pairs of organs are developmentally homologous as well. A comprehensive model to explain the full developmental regulation of Gld and its evolution is presented. PMID:11156990

  12. Tissue-specific binding of testis nuclear proteins to a sequence element within the promoter of the testis-specific histone H1t gene.

    PubMed

    Grimes, S R; Wolfe, S A; Koppel, D A

    1992-08-01

    The rat histone H1t gene is transcribed only in testis germinal cells. This testis-specific chromosomal protein is first synthesized during spermatogenesis in pachytene spermatocytes and the entire complement of testis histones is replaced during the midspermatid stage of spermiogenesis by positively charged transition nuclear proteins TP1 and TP2. Mobility shift assays conducted using crude nuclear protein extracts from different tissues and an 18-bp DNA sequence element within the H1t promoter as a probe reveal binding only with nuclear proteins from testis. The binding is specifically competed with an excess of the same unlabeled DNA fragment but not with heterologous competitors. A larger oligonucleotide corresponding to the same sequence element plus 18 bp of the adjacent downstream H1/CCAAT element binds nuclear proteins from all tissues tested, but a unique low mobility band is formed only with testis extracts. Protein-DNA crosslinking experiments reveal that two major polypeptides with molecular weights of approximately 13 and 30 kDa bind to the 18-bp H1t promoter sequence element. This strong correlation between the tissue where the H1t gene is transcribed and the presence of testis-specific nuclear proteins that bind to a sequence element within the testis histone H1t promoter supports the possibility that these DNA-binding proteins may participate in formation of an active transcription initiation complex with the testis H1t promoter. PMID:1632632

  13. CCA initiation boxes without unique promoter elements support in vitro transcription by three viral RNA-dependent RNA polymerases.

    PubMed Central

    Yoshinari, S; Nagy, P D; Simon, A E; Dreher, T W

    2000-01-01

    It has previously been observed that the only specific requirement for transcriptional initiation on viral RNA in vitro by the RNA-dependent RNA polymerase (RdRp) of turnip yellow mosaic virus is the CCA at the 3' end of the genome. We now compare the abilities of this RdRp, turnip crinkle virus RdRp, and Qbeta replicase, an enzyme capable of supporting the complete viral replication cycle in vitro, to transcribe RNA templates containing multiple CCA boxes but lacking specific viral sequences. Each enzyme is able to initiate transcription from several CCA boxes within these RNAs, and no special reaction conditions are required for these activities. The transcriptional yields produced from templates comprised of multiple CCA or CCCA repeats relative to templates derived from native viral RNA sequences vary between 2:1 and 0.1:1 for the different RdRps. Control of initiation by such redundant sequences presents a challenge to the specificity of viral transcription and replication. We identify 3'-preferential initiation and sensitivity to structural presentation as two specificity mechanisms that can limit initiation among potential CCA initiation sites. These two specificity mechanisms are used to different degrees by the three RdRps. The finding that three viral RdRps representing two of the three supergroups within the positive-strand RNA viral RdRp phylogeny support substantial transcription in the absence of unique promoters suggests that this phenomenon may be common among positive-strand viruses. A framework is presented arguing that replication of viral RNA in the absence of unique promoter elements is feasible. PMID:10836791

  14. Quantification of 10 elements in human cerebrospinal fluid from chronic pain patients with and without spinal cord stimulation.

    PubMed

    Korvela, Marcus; Lind, Anne-Li; Wetterhall, Magnus; Gordh, Torsten; Andersson, Marit; Pettersson, Jean

    2016-09-01

    Neuropathic pain affects 1-10% of the general population and is caused by a lesion or disease of the somatosensory nervous system. Spinal cord stimulation (SCS), a method where implanted electrodes stimulate the spinal cord, has been successfully used to treat drug-resistant neuropathic pain, but the mechanism of action is largely unknown. Studies show that SCS changes the protein levels in CSF (cerebrospinal fluid) of pain patients. Several neurological conditions have been shown to alter the elemental composition of CSF. Therefore changes in the levels of ions and trace elements in the CSF may correspond to SCS use. This study used ICP-MS (Inductively coupled plasma mass spectrometry) and ICP-AES (Inductively coupled plasma atomic emission spectroscopy) to quantify 10 elements in CSF from chronic neuropathic pain patients using SCS. The element concentrations in CSF from patients with SCS treatment on/off, were measured. No effect on the element concentrations in CSF from treatment with SCS could be detected. Also, the elemental concentrations in pooled CSF from patients without chronic neuropathic pain was determined and compared to the patients using SCS. The concentration of the elements Ca, Sr, Na, K, P, Mg and Ti were, significantly higher in patients compared to the CSF-control. PMID:27473826

  15. Binding of transcription factors to Presenilin 1 and 2 promoter cis-acting elements varies during the development of mouse cerebral cortex.

    PubMed

    Kumar, Ashish; Thakur, M K

    2016-08-15

    Previously, we reported differential expression of Presenilin (PS)1 and 2 and epigenetic modifications of their gene promoter in the cerebral cortex of mice during development. We identified the crucial role of DNA methylation and H3K9/14 acetylation in stage specific PS expression during brain development. Interestingly, we noted differential DNA methylation in putative binding sites of transcription factors considered pivotal for brain development. This prompted us to study the binding of transcription factors to cis-acting elements of PS1 and PS2 promoter in the cerebral cortex of mice during development. In-silico analysis revealed various cis-acting elements of PS1 and PS2 promoter and their putative transcription factors. We selected those cis-acting elements that were proven by wet lab experiments to interact with the transcription factors crucial for brain development. Electrophoretic mobility shift assay revealed that the binding of nuclear proteins to PS1 promoter cis-acting elements like HSF-1, Cdx1, Ets-1 and Sp1 significantly increased at embryonic day (E) 12.5, postnatal day (P) 45 and 20 weeks (w) as compared to P0. The binding pattern of these factors correlated well with the PS1 expression profile, indicating their cumulative influence on PS1 gene transcription. For PS2 promoter, the binding of Nkx2.2 and HFH-2 was high at prenatal stages (E12.5 and E18.5) while that of Cdx1 and NF-κB was maximum at postnatal stages (P45 and 20w). Taken together, our study shows that the binding of HSF-1, Cdx1, Ets-1 and Sp1 to PS1 promoter and that of Nkx2.2, HFH-2, Cdx1 and NF-κB to PS2 promoter regulate their differential expression during brain development. PMID:27177724

  16. A 83-dB SFDR 10-MHz Bandwidth Continuous-Time Delta-Sigma Modulator Employing a One-Element-Shifting Dynamic Element Matching

    NASA Astrophysics Data System (ADS)

    Ninh, Hong Phuc; Miyahara, Masaya; Matsuzawa, Akira

    This paper considers a simple type of Dynamic Element Matching (DEM), Clocked Averaging (CLA) method referred to as one-element-shifting (OES) and its effectiveness for the implementation of high spurious-free dynamic range (SFDR) multi-bit Delta-Sigma modulators (DSMs). Generic DEM techniques are successful at suppressing the mismatch error and increasing the SFDR of data converters. However, they will induce additional glitch energy in most cases. Some recent DEM methods achieve improvements in minimizing glitch energy but sacrificing their effects in harmonic suppression due to mismatches. OES technique discussed in this paper can suppress the effect of glitch while preserving the reduction of element mismatch effects. Hence, this approach achieves better SFDR performance over the other published DEM methods. With this OES, a 3rd order, 10MHz bandwidth continuous-time DSM is implemented in 90nm CMOS process. The measured SFDR attains 83dB for a 10MHz bandwidth. The measurement result also shows that OES improves the SFDR by higher than 10dB.

  17. The HIV-1 Rev response element (RRE) adopts alternative conformations that promote different rates of virus replication

    PubMed Central

    Sherpa, Chringma; Rausch, Jason W.; Le Grice, Stuart F.J.; Hammarskjold, Marie-Louise; Rekosh, David

    2015-01-01

    The HIV Rev protein forms a complex with a 351 nucleotide sequence present in unspliced and incompletely spliced human immunodeficiency virus (HIV) mRNAs, the Rev response element (RRE), to recruit the cellular nuclear export receptor Crm1 and Ran-GTP. This complex facilitates nucleo-cytoplasmic export of these mRNAs. The precise secondary structure of the HIV-1 RRE has been controversial, since studies have reported alternative structures comprising either four or five stem-loops. The published structures differ only in regions that lie outside of the primary Rev binding site. Using in-gel SHAPE, we have now determined that the wt NL4-3 RRE exists as a mixture of both structures. To assess functional differences between these RRE ‘conformers’, we created conformationally locked mutants by site-directed mutagenesis. Using subgenomic reporters, as well as HIV replication assays, we demonstrate that the five stem-loop form of the RRE promotes greater functional Rev/RRE activity compared to the four stem-loop counterpart. PMID:25855816

  18. IFN-gamma AU-rich element removal promotes chronic IFN-gamma expression and autoimmunity in mice

    PubMed Central

    Hodge, Deborah L.; Berthet, Cyril; Coppola, Vincenzo; Kastenmüller, Wolfgang; Buschman, Matthew D.; Schaughency, Paul M.; Shirota, Hidekazu; Scarzello, Anthony J.; Subleski, Jeff J.; Anver, Miriam R.; Ortaldo, John R.; Lin, Fanching; Reynolds, Della A.; Sanford, Michael E.; Kaldis, Philipp; Tessarollo, Lino; Klinman, Dennis M.; Young, Howard A.

    2014-01-01

    We generated a mouse model with a 162 nt AU-rich element (ARE) region deletion in the 3′ untranslated region (3′UTR) of the interferon-gamma (IFN-γ) gene that results in chronic circulating serum IFN-γ levels. Mice homozygous for the ARE deletion (ARE-Del) −/− present both serologic and cellular abnormalities typical of patients with systemic lupus erythematosus (SLE). ARE-Del−/− mice display increased numbers of pDCs in bone marrow and spleen. Addition of IFN-γ to Flt3-ligand (Flt3L) treated in vitro bone marrow cultures results in a 2-fold increase in pDCs with concurrent increases in IRF8 expression. Marginal zone B (MZB) cells and marginal zone macrophages (MZMs) are absent in ARE-Del−/− mice. ARE-Del+/− mice retain both MZB cells and MZMs and develop no or mild autoimmunity. However, low dose clodronate treatment in ARE-Del+/− mice specifically eliminates MZMs and promotes anti-DNA antibody development and glomerulonephritis. Our findings demonstrate the consequences of a chronic IFN-γ milieu on B220+ cell types and in particular the impact of MZB cell loss on MZM function in autoimmunity. Furthermore, similarities between disease states in ARE-Del−/− mice and SLE patients suggest that IFN-γ may not only be a product of SLE but may be critical for disease onset and progression. PMID:24583068

  19. Finite Element Analysis and Test Correlation of a 10-Meter Inflation-Deployed Solar Sail

    NASA Technical Reports Server (NTRS)

    Sleight, David W.; Michii, Yuki; Lichodziejewski, David; Derbes, Billy; Mann. Troy O.; Slade, Kara N.; Wang, John T.

    2005-01-01

    Under the direction of the NASA In-Space Propulsion Technology Office, the team of L Garde, NASA Jet Propulsion Laboratory, Ball Aerospace, and NASA Langley Research Center has been developing a scalable solar sail configuration to address NASA's future space propulsion needs. Prior to a flight experiment of a full-scale solar sail, a comprehensive phased test plan is currently being implemented to advance the technology readiness level of the solar sail design. These tests consist of solar sail component, subsystem, and sub-scale system ground tests that simulate the vacuum and thermal conditions of the space environment. Recently, two solar sail test articles, a 7.4-m beam assembly subsystem test article and a 10-m four-quadrant solar sail system test article, were tested in vacuum conditions with a gravity-offload system to mitigate the effects of gravity. This paper presents the structural analyses simulating the ground tests and the correlation of the analyses with the test results. For programmatic risk reduction, a two-prong analysis approach was undertaken in which two separate teams independently developed computational models of the solar sail test articles using the finite element analysis software packages: NEiNastran and ABAQUS. This paper compares the pre-test and post-test analysis predictions from both software packages with the test data including load-deflection curves from static load tests, and vibration frequencies and mode shapes from vibration tests. The analysis predictions were in reasonable agreement with the test data. Factors that precluded better correlation of the analyses and the tests were uncertainties in the material properties, test conditions, and modeling assumptions used in the analyses.

  20. Comprehensive analysis of regulatory elements of the promoters of rice sulfate transporter gene family and functional characterization of OsSul1;1 promoter under different metal stress.

    PubMed

    Kumar, Smita; Asif, Mehar Hasan; Chakrabarty, Debasis; Tripathi, Rudra Deo; Dubey, Rama Shanker; Trivedi, Prabodh Kumar

    2015-01-01

    Adverse environmental conditions including heavy metal stress impose severe effects on the plant growth and development limiting productivity and yield. Studies demonstrated that changes in genome-wide expression modulate various biochemical processes and molecular components in response to heavy metal stress in plants. Some of the key components involved in such a regulation are the transcription initiation machinery, nucleotide sequence of promoters and presence of cis-acting elements. Therefore, identification of the putative cis-acting DNA sequences involved in gene regulation and functional characterization of promoters are important steps in understanding response of plants to heavy metal stress. In this study, comprehensive analysis of the proximal promoters of members of rice sulfate transporter gene family which is an essential component of stress response has been carried out. Analysis suggests presence of various common stress related cis-acting elements in the promoters of members of this gene family. In addition, transcriptional regulation of the arsenic-responsive high affinity sulfate transporter, OsSul1;1, has been studied through development of Arabidopsis transgenic lines expressing reporter gene encoding β-glucuronidase under the control of OsSul1;1 promoter. Analysis of the transgenic lines suggests differential response of the OsSul1;1 promoter to various heavy metals as well as other abiotic stresses. PMID:25807334

  1. Comprehensive analysis of regulatory elements of the promoters of rice sulfate transporter gene family and functional characterization of OsSul1;1 promoter under different metal stress

    PubMed Central

    Kumar, Smita; Asif, Mehar Hasan; Chakrabarty, Debasis; Tripathi, Rudra Deo; Dubey, Rama Shanker; Trivedi, Prabodh Kumar

    2015-01-01

    Adverse environmental conditions including heavy metal stress impose severe effects on the plant growth and development limiting productivity and yield. Studies demonstrated that changes in genome-wide expression modulate various biochemical processes and molecular components in response to heavy metal stress in plants. Some of the key components involved in such a regulation are the transcription initiation machinery, nucleotide sequence of promoters and presence of cis-acting elements. Therefore, identification of the putative cis-acting DNA sequences involved in gene regulation and functional characterization of promoters are important steps in understanding response of plants to heavy metal stress. In this study, comprehensive analysis of the proximal promoters of members of rice sulfate transporter gene family which is an essential component of stress response has been carried out. Analysis suggests presence of various common stress related cis-acting elements in the promoters of members of this gene family. In addition, transcriptional regulation of the arsenic-responsive high affinity sulfate transporter, OsSul1;1, has been studied through development of Arabidopsis transgenic lines expressing reporter gene encoding β-glucuronidase under the control of OsSul1;1 promoter. Analysis of the transgenic lines suggests differential response of the OsSul1;1 promoter to various heavy metals as well as other abiotic stresses. PMID:25807334

  2. The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters.

    PubMed

    Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene

    2015-10-15

    Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. PMID:26384563

  3. Dissection of recognition determinants of Escherichia coli σ32 suggests a composite −10 region with an ‘extended −10’ motif and a core −10 element

    PubMed Central

    Koo, Byoung-Mo; Rhodius, Virgil A.; Campbell, Elizabeth A.; Gross, Carol A.

    2015-01-01

    Summary σ32 controls expression of heat shock genes in Escherichia coli and is widely distributed in proteobacteria. The distinguishing feature of σ32 promoters is a long −10 region (CCCCATNT) whose tetra-C motif is important for promoter activity. Using alanine-scanning mutagenesis of σ32 and in vivo and in vitro assays, we identified promoter recognition determinants of this motif. The most downstream C (−13) is part of the −10 motif; our work confirms and extends recognition determinants of −13C. Most importantly, our work suggests that the two upstream Cs (−16, −15) constitute an ‘extended −10’ recognition motif that is recognized by K130, a residue universally conserved in β- and γ-proteobacteria. This residue is located in the α-helix of σDomain 3 that mediates recognition of the extended −10 promoter motif in other δs. K130 is not conserved in α- and δ-/εproteobacteria and we found that σ32 from the α-proteobacterium Caulobacter crescentus does not need the extended −10 motif for high promoter activity. This result supports the idea that K130 mediates extended −10 recognition. σ32 is the first Group 3σ shown to use the ‘extended −10’ recognition motif. PMID:19400791

  4. The wheat HMW-glutenin 1Dy10 gene promoter controls endosperm expression in Brachypodium distachyon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The grass species Brachypodium distachyon has emerged as a model system for the study of gene structure and function in temperate cereals. As a first demonstration of the utility of Brachypodium to study wheat gene promoter function, we transformed it with a T-DNA that included the GUS reporter gene...

  5. Raspberry ketone promotes the differentiation of C3H10T1/2 stem cells into osteoblasts.

    PubMed

    Takata, Tomoyo; Morimoto, Chie

    2014-03-01

    The decrease in the bone mass associated with osteoporosis caused by ovariectomy, aging, and other conditions is accompanied by an increase in bone marrow adipose tissue. The balance between osteoblasts and adipocytes is influenced by a reciprocal relationship. The development of modalities to promote local/systemic bone formation by inhibiting bone marrow adipose tissue is important in the treatment of fractures or metabolic bone diseases such as osteoporosis. In this study, we examined whether raspberry ketone [4-(4-hydroxyphenyl)butan-2-one; RK], which is one of the major aromatic compounds of red raspberry and exhibits anti-obesity action, could promote osteoblast differentiation in C3H10T1/2 stem cells. Confluent C3H10T1/2 stem cells were treated for 6 days with 10-100 μg/mL of RK in culture medium containing 10 nM all-trans-retinoic acid (ATRA) or 300 ng/mL recombinant human bone morphogenetic protein (rhBMP)-2 protein as an osteoblast-differentiating agent. RK in the presence of ATRA increased alkaline phosphatase (ALP) activity in a dose-dependent manner. RK in the presence of rhBMP-2 also increased ALP activity. RK in the presence of ATRA also increased the levels of mRNAs of osteocalcin, α1(I) collagen, and TGF-βs (TGF-β1, TGF-β2, and TGF-β3) compared with ATRA only. RK promoted the differentiation of C3H10T1/2 stem cells into osteoblasts. However, RK did not affect the inhibition of early-stage adipocyte differentiation. Our results suggest that RK enhances the differentiation of C3H10T1/2 stem cells into osteoblasts, and it may promote bone formation by an action unrelated to adipocyte differentiation. PMID:24404978

  6. Promotion of hair follicle development and trichogenesis by Wnt-10b in cultured embryonic skin and in reconstituted skin

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-06-30

    We previously showed that Wnt-10b promoted the differentiation of primary skin epithelial cells (MPSEC) toward hair shaft and inner root sheath of the hair follicle (IRS) cells in vitro. In the present study, we found that Wnt-10b promotes the development of hair follicles using a culture of mouse embryonic skin tissue and trichogenesis using a reconstitution experiment with nude mice. Hair follicle development was observed in skin taken from mouse embryos on embryonic day 10.5 following a 2-day culture with recombinant Wnt-10b (rWnt-10b), however, not without rWnt-10b. Brown hair growth was observed at the site of reconstituted skin in Balb/c nude mice where dermal fibroblasts and keratinocytes, derived from C3H/HeN new born mice, were transplanted with Wnt-10b-producing COS cells (Wnt-COS). Without the co-transplantation of Wnt-COS, no hair growth was observed. Our results suggest an important role of Wnt-10b in the initiation of hair follicle development and following trichogenesis.

  7. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  8. Identification of a key regulatory element for the basal activity of the human insulin-like growth factor II gene promoter P3.

    PubMed Central

    Rietveld, L E; Holthuizen, P E; Sussenbach, J S

    1997-01-01

    Transcription of the human insulin-like growth factor II (IGF-II) gene is under the control of four promoters (P1-P4) that are differentially active during growth and development. Promoter 3 (P3) is the most active promoter during fetal development as well as in most adult tissues. P3 is also the most active promoter in tumour tissues and cell lines expressing IGF-II. Transient transfections of HeLa and Hep3B cells with truncated promoter constructs revealed that the region between -289 and -183 relative to the transcription start site supports basal promoter activity in both cell lines. Footprint experiments showed that the region between positions -192 and -172 (P3-4) is the only element bound by nuclear proteins. P3-4 is bound by five proteins, of which three proteins (proteins 3, 4 and 5) bind specifically and are expressed at the same levels in HeLa and Hep3B cells. Electrophoretic mobility shift assays and differential footprint experiments revealed the presence of two protein-binding regions within the P3-4 element. Proteins 4 and 5 bind box A (-193 to -188), whereas box B (-183 to -172) is bound by protein 3. From transcription experiments in vitro it can be concluded that Box A is essential for P3 activity. Box A is part of a region 11 dG residues long and is protected by proteins 4 and 5 that bind a contiguous set of six dG residues. DNA-binding of proteins 4 and 5 to box A requires the presence of Zn2+ ions. Thus structural and functional analysis reveals that the P3-4 element is a key regulatory element of P3 that contains two separate binding sites for proteins essential for the basal activity of IGF-II P3. PMID:9581544

  9. An Annotated Reference Guide to the Finite-Element Interface Specification Version 1.0

    SciTech Connect

    Alan B. Williams; Ivan J. Otero; Kyran D. Mish; Lee M. Tayor; Robert L. Clay

    1999-04-01

    The Finite-Element Interface (FEI) specification provides a layered abstraction that permits finite-element analysis codes to utilize various linear-algebra solution packages with minimal concern for the internal details of the solver modules. Alternatively, this interface can be viewed as a way for solver developers to provide solution services to finite-element clients without having to embed finite-element abstractions within their solver libraries. The purpose of this document is to provide some level of documentation between the bare interface specification itself, which consists only of C/C++ header files, and the full documentation suite that supports the interface definition by providing considerable detail as to its design and implementation. This document primarily provides the ''how'' of calling the interface member functions, so that programmers can readily learn how to utilize the interface implementation without having to consider all the details contained in the interface's definition, design, and motivation. The interface specification is presented three times in this document, each time with an increasing level of detail. The first presentation provides a general overview of the calling sequence, in order to acquaint the programmer with a basic introduction to how the interface is used to ''train'' the underlying solver software on the particular finite-element problem that is to be solved. The second pass through the interface definition provides considerable detail on each method, including specific considerations as to the structure of the underlying data, and an exposition of potential pitfalls that may occur as a byproduct of either the finite-element modeling process, or of the use of the associated interface implementation. Finally, a third description of the interface is given implicitly via the discussion of sample problems that provide concrete examples of the use of the finite-element interface.

  10. Atmospheric wet and dry deposition of trace elements at 10 sites in Northern China

    NASA Astrophysics Data System (ADS)

    Pan, Y. P.; Wang, Y. S.

    2015-01-01

    Atmospheric deposition is considered to be a major process that removes pollutants from the atmosphere and an important source of nutrients and contaminants for ecosystems. Trace elements (TEs), especially toxic metals deposited on plants and into soil or water, can cause substantial damage to the environment and human health due to their transfer and accumulation in food chains. Despite public concerns, quantitative knowledge of metal deposition from the atmosphere to ecosystems remains scarce. To advance our understanding of the spatiotemporal variations in the magnitudes, pathways, compositions and impacts of atmospherically deposited TEs, precipitation (rain and snow) and dry-deposited particles were collected simultaneously at 10 sites in Northern China from December 2007 to November 2010. The measurements showed that the wet and dry depositions of TEs in the target areas were orders of magnitude higher than previous observations within and outside China, generating great concern over the potential risks. The spatial distribution of the total (wet plus dry) deposition flux was consistent with that of the dry deposition, with a significant decrease from industrial and urban areas to suburban, agricultural and rural sites, while the wet deposition exhibited less spatial variation. In addition, the seasonal variation of wet deposition was also different from that of dry deposition, although they were both governed by the precipitation and emission patterns. For the majority of TEs that exist as coarse particles, dry deposition dominated the total flux at each site. This was not the case for potassium, nickel, arsenic, lead, zinc, cadmium, selenium, silver and thallium, for which the relative importance between wet and dry deposition fluxes varied by site. Whether wet deposition is the major atmospheric cleansing mechanism for the TEs depends on the size distribution of the particles. We found that atmospheric inputs of copper, lead, zinc, cadmium, arsenic and

  11. Alternative promoters and repetitive DNA elements define the species-dependent tissue-specific expression of the FMO1 genes of human and mouse

    PubMed Central

    Shephard, Elizabeth A.; Chandan, Pritpal; Stevanovic-Walker, Milena; Edwards, Mina; Phillips, Ian R.

    2007-01-01

    In humans, expression of the FMO1 (flavin-containing mono-oxygenase 1) gene is silenced postnatally in liver, but not kidney. In adult mouse, however, the gene is active in both tissues. We investigated the basis of this species-dependent tissue-specific transcription of FMO1. Our results indicate the use of three alternative promoters. Transcription of the gene in fetal human and adult mouse liver is exclusively from the P0 promoter, whereas in extra-hepatic tissues of both species, P1 and P2 are active. Reporter gene assays showed that the proximal P0 promoters of human (hFMO1) and mouse (mFmo1) genes are equally effective. However, sequences upstream (−2955 to −506) of the proximal P0 of mFmo1 increased reporter gene activity 3-fold, whereas hFMO1 upstream sequences (−3027 to −541) decreased reporter gene activity by 75%. Replacement of the upstream sequence of human P0 with the upstream sequence of mouse P0 increased activity of the human proximal P0 8-fold. Species-specific repetitive elements are present immediately upstream of the proximal P0 promoters. The human gene contains five LINE (long-interspersed nuclear element)-1-like elements, whereas the mouse gene contains a poly A region, an 80-bp direct repeat, an LTR (long terminal repeat), a SINE (short-interspersed nuclear element) and a poly T tract. The rat and rabbit FMO1 genes, which are expressed in adult liver, lack some (rat) or all (rabbit) of the elements upstream of mouse P0. Thus silencing of FMO1 in adult human liver is due apparently to the presence upstream of the proximal P0 of L1 (LINE-1) elements rather than the absence of retrotransposons similar to those found in the mouse gene. PMID:17547558

  12. GAP-43 promoter elements in transgenic zebrafish reveal a difference in signals for axon growth during CNS development and regeneration.

    PubMed

    Udvadia, A J; Köster, R W; Skene, J H

    2001-04-01

    A pivotal event in neural development is the point at which differentiating neurons become competent to extend long axons. Initiation of axon growth is equally critical for regeneration. Yet we have a limited understanding of the signaling pathways that regulate the capacity for axon growth during either development or regeneration. Expression of a number of genes encoding growth associated proteins (GAPs) accompanies both developmental and regenerative axon growth and has led to the suggestion that the same signaling pathways regulate both modes of axon growth. We have tested this possibility by asking whether a promoter fragment from a well characterized GAP gene, GAP-43, is sufficient to activate expression in both developing and regenerating neurons. We generated stable lines of transgenic zebrafish that express green fluorescent protein (GFP) under regulation of a 1 kb fragment of the rat GAP-43 gene, a fragment that contains a number of evolutionarily conserved elements. Analysis of GFP expression in these lines confirms that the rat 1 kb region can direct growth-associated expression of the transgene in differentiating neurons that extend long axons. Furthermore, this region supports developmental down-regulation of transgene expression which, like the endogenous gene, coincides with neuronal maturation. Strikingly, these same sequences are insufficient for directing expression in regenerating neurons. This finding suggests that signaling pathways regulating axon growth during development and regeneration are not the same. While these results do not exclude the possibility that pathways involved in developmental axon growth are also active in regenerative growth, they do indicate that signaling pathway(s) controlling activation of the GAP-43 gene after CNS injury differ in at least one key component from the signals controlling essential features of developmental axon growth. PMID:11245583

  13. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Relief from fingerprinting, identification and criminal history records checks and other elements of background checks for designated categories of individuals. 73.59 Section 73.59 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF PLANTS AND MATERIALS Physical Protection...

  14. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... the integrity of completed fuel pins (or rods). This item typically includes equipment for: (i)...

  15. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... the integrity of completed fuel pins (or rods). This item typically includes equipment for: (i)...

  16. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... the integrity of completed fuel pins (or rods). This item typically includes equipment for: (i)...

  17. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... the integrity of completed fuel pins (or rods). This item typically includes equipment for: (i)...

  18. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... the integrity of completed fuel pins (or rods). This item typically includes equipment for: (i)...

  19. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail: yingzhu@whu.edu.cn; Wu Jianguo . E-mail: wu9988@vip.sina.com

    2007-04-06

    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  20. Transcriptional induction of the mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a composite major late transcription factor/antioxidant response element and metal response promoter elements.

    PubMed Central

    Dalton, T; Palmiter, R D; Andrews, G K

    1994-01-01

    Synthesis of metallothionein-I (MT-I) and heme oxygenase mRNAs is rapidly and transiently induced by H2O2 in mouse hepatoma cells (Hepa) and this effect is blocked by catalase. Menadione, which generates free radicals, also induces these mRNAs. Deletion mutagenesis revealed that a region between -42 and -153 in the mouse MT-I promoter was essential for induction of a CAT reporter gene. A multimer of a 16 bp sequence (-101 to -86) that includes an antioxidant response element and overlapping adenovirus major late transcription factor binding site elevated basal expression and allowed induction by H2O2 when inserted upstream of a minimal promoter. However, deletion of this region (-100 to -89) from the intact MT-I promoter (-153) did not completely eliminate response. Multiple copies of a metal response element also permitted response to H2O2. These results suggest that induction of MT-I gene transcription by H2O2 is mediated by at least two different elements within the proximal MT-I gene promoter and suggest a previously undescribed function of the MRE. Induction of MT gene transcription by ROS and the subsequent scavenging of ROS by the MT peptide is reminiscent of the metal regulatory loop and is consistent with the hypothesized protective functions of MT. Images PMID:7800494

  1. Air quality in urban parking garages (PM10, major and trace elements, PAHs): Instrumental measurements vs. active moss biomonitoring

    NASA Astrophysics Data System (ADS)

    Vuković, Gordana; Aničić Urošević, Mira; Razumenić, Ivana; Kuzmanoski, Maja; Pergal, Miodrag; Škrivanj, Sandra; Popović, Aleksandar

    2014-03-01

    This study was performed in four parking garages in downtown of Belgrade with the aim to provide multi-pollutant assessment. Concentrations of 16 US EPA priority PAHs and Al, Ba, Ca, Cd, Co, Cr, Cu, Fe, K, Mg, Mn, Na, Ni, Pb, Sr and Zn were determined in PM10 samples. The carcinogenic health risk of employees' occupational exposure to heavy metals (Cd, Cr, Ni and Pb) and PAHs (B[a]A, Cry, B[b]F, B[k]F, B[a]P and DB[ah]A) was estimated. A possibility of using Sphagnum girgensohnii moss bags for monitoring of trace element air pollution in semi-enclosed spaces was evaluated as well. The results showed that concentrations of PM10, Cd, Ni and B[a]P exceeded the EU Directive target values. Concentration of Zn, Ba and Cu were two orders of magnitude higher than those measured at different urban sites in European cities. Cumulative cancer risk obtained for heavy metals and PAHs was 4.51 × 10-5 and 3.75 × 10-5 in M and PP, respectively; upper limit of the acceptable US EPA range is 10-4. In the moss, higher post-exposure than pre-exposure (background) element concentrations was observed. In comparison with instrumental monitoring data, similar order of abundances of the most elements in PM10 and moss samples was found. However, using of the S. girgensohnii moss bag technique in indoor environments needs further justification.

  2. cis-Acting elements within the Candida albicans ERG11 promoter mediate the azole response through transcription factor Upc2p.

    PubMed

    Oliver, Brian G; Song, Jia L; Choiniere, Jake H; White, Theodore C

    2007-12-01

    The azole antifungal drugs are used to treat infections caused by Candida albicans and other fungi. These drugs interfere with the biosynthesis of ergosterol, the major sterol in fungal cells, by inhibiting an ergosterol biosynthetic enzyme, lanosterol 14 alpha-demethylase, encoded by the ERG11 gene. In vitro, these drugs as well as other ergosterol biosynthesis inhibitors increase ERG11 mRNA expression by activation of the ERG11 promoter. The signal for this activation most likely is the depletion of ergosterol, the end product of the pathway. To identify cis-acting regulatory elements that mediate this activation, ERG11 promoter fragments have been fused to the luciferase reporter gene from Renilla reniformis. Promoter deletions and linker scan mutations localized the region important for azole induction to a segment from bp -224 to -251 upstream of the start codon, specifically two 7-bp sequences separated by 13 bp. These sequences form an imperfect inverted repeat. The region is recognized by the transcription factor Upc2p and functions as an enhancer of transcription, as it can be placed upstream of a heterologous promoter in either direction, resulting in the azole induction of that promoter. The promoter constructs are not azole inducible in the upc2/upc2 homozygous deletion, demonstrating that Upc2p controls the azole induction of ERG11. These results identify an azole-responsive enhancer element (ARE) in the ERG11 promoter that is controlled by the Upc2p transcription factor. No other ARE is present in the promoter. Thus, this ARE and Upc2p are necessary and sufficient for azole induction of ERG11. PMID:17951521

  3. DEC2-E4BP4 Heterodimer Represses the Transcriptional Enhancer Activity of the EE Element in the Per2 Promoter.

    PubMed

    Tanoue, Shintaro; Fujimoto, Katsumi; Myung, Jihwan; Hatanaka, Fumiyuki; Kato, Yukio; Takumi, Toru

    2015-01-01

    The circadian oscillation of clock gene expression in mammals is based on the interconnected transcriptional/translational feedback loops of Period (Per) and Bmal1. The Per feedback loop initiates transcription through direct binding of the BMAL1-CLOCK (NPAS2) heterodimer to the E-box of the Per2 promoter region. Negative feedback of PER protein on this promoter subsequently represses transcription. Other circadian transcription regulators, particularly E4BP4 and DEC2, regulate the amplitude and phase of Per2 expression rhythms. Moreover, a direct repeat of E-box-like (EE) elements in the Per2 promoter is required for its cell-autonomous circadian rhythm. However, the detailed mechanism for repression of the two core sequences of the EE element in the Per2 promoter region is unknown. Here, we show that E4BP4 binds to the Per2 EE element with DEC2 to repress transcription and identify the DEC2-E4BP4 heterodimer as a key repressor of the tightly interlocked Per2 feedback loop in the mammalian circadian oscillator. Our results suggest an additional modulatory mechanism for tuning of the phase of cell-autonomous Per2 gene expression cycling. PMID:26257703

  4. DEC2–E4BP4 Heterodimer Represses the Transcriptional Enhancer Activity of the EE Element in the Per2 Promoter

    PubMed Central

    Tanoue, Shintaro; Fujimoto, Katsumi; Myung, Jihwan; Hatanaka, Fumiyuki; Kato, Yukio; Takumi, Toru

    2015-01-01

    The circadian oscillation of clock gene expression in mammals is based on the interconnected transcriptional/translational feedback loops of Period (Per) and Bmal1. The Per feedback loop initiates transcription through direct binding of the BMAL1–CLOCK (NPAS2) heterodimer to the E-box of the Per2 promoter region. Negative feedback of PER protein on this promoter subsequently represses transcription. Other circadian transcription regulators, particularly E4BP4 and DEC2, regulate the amplitude and phase of Per2 expression rhythms. Moreover, a direct repeat of E-box-like (EE) elements in the Per2 promoter is required for its cell-autonomous circadian rhythm. However, the detailed mechanism for repression of the two core sequences of the EE element in the Per2 promoter region is unknown. Here, we show that E4BP4 binds to the Per2 EE element with DEC2 to repress transcription and identify the DEC2–E4BP4 heterodimer as a key repressor of the tightly interlocked Per2 feedback loop in the mammalian circadian oscillator. Our results suggest an additional modulatory mechanism for tuning of the phase of cell-autonomous Per2 gene expression cycling. PMID:26257703

  5. An AP-1 binding site in the enhancer/core element of the HIV-1 promoter controls the ability of HIV-1 to establish latent infection.

    PubMed

    Duverger, Alexandra; Wolschendorf, Frank; Zhang, Mingce; Wagner, Fredric; Hatcher, Brandon; Jones, Jennifer; Cron, Randall Q; van der Sluis, Renee M; Jeeninga, Rienk E; Berkhout, Ben; Kutsch, Olaf

    2013-02-01

    Following integration, HIV-1 in most cases produces active infection events; however, in some rare instances, latent infection events are established. The latter have major clinical implications, as latent infection allows the virus to persist despite antiretroviral therapy. Both the cellular factors and the viral elements that potentially determine whether HIV-1 establishes active or latent infection events remain largely elusive. We detail here the contribution of different long terminal repeat (LTR) sequences for the establishment of latent HIV-1 infection. Using a panel of full-length replication-competent virus constructs that reflect naturally occurring differences of HIV-1 subtype-specific LTRs and targeted LTR mutants, we found the primary ability of HIV-1 to establish latent infection in this system to be controlled by a four-nucleotide (nt) AP-1 element just upstream of the NF-κB element in the viral promoter. Deletion of this AP-1 site mostly deprived HIV-1 of the ability to establish latent HIV-1 infection. Extension of this site to a 7-nt AP-1 sequence massively promoted latency establishment, suggesting that this promoter region represents a latency establishment element (LEE). Given that these minimal changes in a transcription factor binding site affect latency establishment to such large extent, our data support the notion that HIV-1 latency is a transcription factor restriction phenomenon. PMID:23236059

  6. An AP-1 Binding Site in the Enhancer/Core Element of the HIV-1 Promoter Controls the Ability of HIV-1 To Establish Latent Infection

    PubMed Central

    Duverger, Alexandra; Wolschendorf, Frank; Zhang, Mingce; Wagner, Fredric; Hatcher, Brandon; Jones, Jennifer; Cron, Randall Q.; van der Sluis, Renee M.; Jeeninga, Rienk E.; Berkhout, Ben

    2013-01-01

    Following integration, HIV-1 in most cases produces active infection events; however, in some rare instances, latent infection events are established. The latter have major clinical implications, as latent infection allows the virus to persist despite antiretroviral therapy. Both the cellular factors and the viral elements that potentially determine whether HIV-1 establishes active or latent infection events remain largely elusive. We detail here the contribution of different long terminal repeat (LTR) sequences for the establishment of latent HIV-1 infection. Using a panel of full-length replication-competent virus constructs that reflect naturally occurring differences of HIV-1 subtype-specific LTRs and targeted LTR mutants, we found the primary ability of HIV-1 to establish latent infection in this system to be controlled by a four-nucleotide (nt) AP-1 element just upstream of the NF-κB element in the viral promoter. Deletion of this AP-1 site mostly deprived HIV-1 of the ability to establish latent HIV-1 infection. Extension of this site to a 7-nt AP-1 sequence massively promoted latency establishment, suggesting that this promoter region represents a latency establishment element (LEE). Given that these minimal changes in a transcription factor binding site affect latency establishment to such large extent, our data support the notion that HIV-1 latency is a transcription factor restriction phenomenon. PMID:23236059

  7. Disruption of a novel regulatory element in the erythroid-specific promoter of the human PKLR gene causes severe pyruvate kinase deficiency.

    PubMed

    van Wijk, Richard; van Solinge, Wouter W; Nerlov, Claus; Beutler, Ernest; Gelbart, Terri; Rijksen, Gert; Nielsen, Finn C

    2003-02-15

    We established the molecular basis for pyruvate kinase (PK) deficiency in a white male patient with severe nonspherocytic hemolytic anemia. The paternal allele exhibited the common PKLR cDNA sequence (c.) 1529G>A mutation, known to be associated with PK deficiency. On the maternal allele, 3 in cis mutations were identified in the erythroid-specific promoter region of the gene: one deletion of thymine -248 and 2 single nucleotide substitutions, nucleotide (nt) -324T>A and nt -83G>C. Analysis of the patient's RNA demonstrated the presence of only the 1529A allele, indicating severely reduced transcription from the allele linked to the mutated promoter region. Transfection of promoter constructs into erythroleukemic K562 cells showed that the most upstream -324T>A and -248delT mutations were nonfunctional polymorphisms. In contrast, the -83G>C mutation strongly reduced promoter activity. Site-directed mutagenesis of the promoter region revealed the presence of a putative regulatory element (PKR-RE1) whose core binding motif, CTCTG, is located between nt -87 and nt -83. Electrophoretic mobility shift assay using K562 nuclear extracts indicated binding of an as-yet-unidentified trans-acting factor. This novel element mediates the effects of factors necessary for regulation of pyruvate kinase gene expression during red cell differentiation and maturation. PMID:12393511

  8. Sperm-specific expression of angiotensin-converting enzyme (ACE) is mediated by a 91-base-pair promoter containing a CRE-like element.

    PubMed Central

    Howard, T; Balogh, R; Overbeek, P; Bernstein, K E

    1993-01-01

    The gene encoding the testis isozyme of angiotensin-converting enzyme (testis ACE) is one example of the many genes expressed uniquely during spermatogenesis. This protein is expressed by developing germ cells late in their development and results from the activation of a sperm-specific promoter that is located within intron 12 of the gene encoding the somatic isozyme of ACE. In vitro transcription, DNase footprinting, gel shift assays, and transgenic mouse studies have been used to define the minimal testes ACE promoter and to characterize DNA-protein interactions mediating germ cell-specific expression. These studies show that proper cell- and stage-specific expression of testis ACE requires only a small portion of the immediate upstream sequence extending to -91. A critical motif within this core promoter is a cyclic AMP-responsive element sequence that interacts with a testis-specific transactivating factor. Since this putative cyclic AMP-responsive element has been conserved within the testis ACE promoters of different species and is found at the same site in other genes that are expressed specifically in the testis, it may provide a common mechanism for the recognition of sperm-specific promoters. Images PMID:8380220

  9. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    PubMed

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen. PMID:19428678

  10. In vivo identification of promoter elements and transcription factors mediating activation of hepatic HMG-CoA reductase by T{sub 3}

    SciTech Connect

    Boone, Lindsey R.; Niesen, Melissa I.; Jaroszeski, Mark; Ness, Gene C.

    2009-07-31

    The promoter elements and transcription factors necessary for triiodothyronine (T{sub 3}) induction of hepatic HMG-CoA reductase (HMGR) were investigated by transfecting rat livers with wild type and mutant HMGR promoter-luciferase constructs using in vivo electroporation. Mutations in the sterol response element (SRE), nuclear factor-y (NF-Y) site, and the newly identified upstream transcription factor-2 (USF-2) site essentially abolished the T{sub 3} response. Chromatin immunoprecipitation (ChIP) analysis demonstrated that T{sub 3} treatment caused a 4-fold increase in in vivo binding of USF-2 to the HMGR promoter. Co-transfection of the wild type HMGR promoter with siRNAs to USF-2, SREBP-2, or NF-Y nearly abolished the T{sub 3} induction, as measured by promoter activity. These data provide in vivo evidence for functional roles for USF-2, SREBP-2, and NF-Y in mediating the T{sub 3}-induction of hepatic HMGR transcription.

  11. NF-Y and USF1 transcription factor binding to CCAAT box and E-box elements activates the CP27 promoter

    PubMed Central

    Ito, Yoshihiro; Zhang, Youbin; Dangaria, Smit; Luan, Xianghong; Diekwisch, Thomas G.H.

    2010-01-01

    The maintenance and differentiation of embryonic stem cells (ES cells) depends on the regulation of gene expression through the coordinated binding of transcription factors to regulatory promoter elements. One of the genes involved in embryonic development is the chromatin factor CP27. Previously, we have shown that NF-Y interacted with the CP27 proximal promoter CCAAT-box. Here we report that CP27 gene expression in mouse ES cells is controlled by CCAAT and E-box cis-acting regulatory elements and their corresponding transcription factors NF-Y and USF1. Specifically, USF1 interacts with the E-box of the CP27 proximal promoter and NF-Y interacts with the CCAAT box. NF-Y and USF1 also interacted with each other and activated the CP27 promoter in a synergistic fashion. Together, these studies demonstrate that gene expression of the chromatin factor CP27 is regulated through the interaction of the transcription factors NF-Y and USF1 with the CP27 proximal promoter. PMID:21078375

  12. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    PubMed Central

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  13. Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

    PubMed Central

    Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

    2015-01-01

    Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

  14. 9,10-Phenanthrenequinone promotes secretion of pulmonary aldo-keto reductases with surfactant.

    PubMed

    Matsunaga, Toshiyuki; Haga, Mariko; Watanabe, Gou; Shinoda, Yuhki; Endo, Satoshi; Kajiwara, Yu; Tanaka, Hiroyuki; Inagaki, Naoki; El-Kabbani, Ossama; Hara, Akira

    2012-02-01

    9,10-Phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust particles, induces apoptosis via the generation of reactive oxygen species (ROS) because of 9,10-PQ redox cycling. We have found that intratracheal infusion of 9,10-PQ facilitates the secretion of surfactant into rat alveolus. In the cultured rat lung, treatment with 9,10-PQ results in an increase in a lower-density surfactant by ROS generation through redox cycling of the quinone. The surfactant contains aldo-keto reductase (AKR) 1C15, which reduces 9,10-PQ and the enzyme level in the surfactant increases on treatment with 9,10-PQ suggesting an involvement of AKR1C15 in the redox cycling of the quinone. In six human cell types (A549, MKN45, Caco2, Hela, Molt4 and U937) only type II epithelial A549 cells secrete three human AKR1C subfamily members (AKR1C1, AKR1C2 and AKR1C3) with the surfactant into the medium; this secretion is highly increased by 9,10-PQ treatment. Using in vitro enzyme inhibition analysis, we have identified AKR1C3 as the most abundantly secreted AKR1C member. The AKR1C enzymes in the medium efficiently reduce 9,10-PQ and initiate its redox cycling accompanied by ROS production. The exposure of A549 cells to 9,10-PQ provokes viability loss, which is significantly protected by the addition of the AKR1C3 inhibitor and antioxidant enzyme and by the removal of the surfactants from the culture medium. Thus, the AKR1C enzymes secreted in pulmonary surfactants probably participate in the toxic mechanism triggered by 9,10-PQ. PMID:22281686

  15. Glycogen synthase kinase-3 controls IL-10 expression in CD4+ effector T-cell subsets through epigenetic modification of the IL-10 promoter

    PubMed Central

    Hill, Elaine V; Ng, T H Sky; Burton, Bronwen R; Oakley, Charly M; Malik, Karim; Wraith, David C

    2015-01-01

    The serine/threonine kinase glycogen synthase kinase-3 (GSK3) plays an important role in balancing pro- and anti-inflammatory cytokines. We have examined the role of GSK3 in production of IL-10 by subsets of CD4+ T helper cells. Treatment of naive murine CD4+ T cells with GSK3 inhibitors did not affect their production of IL-10. However, treatment of Th1 and Th2 cells with GSK3 inhibitors dramatically increased production of IL-10. GSK3 inhibition also led to upregulation of IL-10 among Th1, Th2, and Th17 subsets isolated from human blood. The encephalitogenic potential of GSK3 inhibitor treated murine Th1 cells was significantly reduced in adoptive transfer experiments by an IL-10-dependent mechanism. Analysis of the murine IL-10 promoter in response to inhibition of GSK3 in Th1 cells showed modification to a transcriptionally active state indicated by changes in histone H3 acetylation and methylation. Additionally, GSK3 inhibition increased expression of the transcription factors c-Maf, Nfil3, and GATA3, correlating with the increase in IL-10. These findings are important in the context of autoimmune disease since they show that it is possible to reprogram disease-causing cells through GSK3 inhibition. PMID:25627813

  16. High-affinity homologous peptide nucleic acid probes for targeting a quadruplex-forming sequence from a MYC promoter element.

    PubMed

    Roy, Subhadeep; Tanious, Farial A; Wilson, W David; Ly, Danith H; Armitage, Bruce A

    2007-09-18

    Guanine-rich DNA and RNA sequences are known to fold into secondary structures known as G-quadruplexes. Recent biochemical evidence along with the discovery of an increasing number of sequences in functionally important regions of the genome capable of forming G-quadruplexes strongly indicates important biological roles for these structures. Thus, molecular probes that can selectively target quadruplex-forming sequences (QFSs) are envisioned as tools to delineate biological functions of quadruplexes as well as potential therapeutic agents. Guanine-rich peptide nucleic acids have been previously shown to hybridize to homologous DNA or RNA sequences forming PNA-DNA (or RNA) quadruplexes. For this paper we studied the hybridization of an eight-mer G-rich PNA to a quadruplex-forming sequence derived from the promoter region of the MYC proto-oncogene. UV melting analysis, fluorescence assays, and surface plasmon resonance experiments reveal that this PNA binds to the MYC QFS in a 2:1 stoichiometry and with an average binding constant Ka = (2.0 +/- 0.2) x 10(8) M(-1) or Kd = 5.0 nM. In addition, experiments carried out with short DNA targets revealed a dependence of the affinity on the sequence of bases in the loop region of the DNA. A structural model for the hybrid quadruplex is proposed, and implications for gene targeting by G-rich PNAs are discussed. PMID:17718513

  17. CD226 ligation protects against EAE by promoting IL-10 expression via regulation of CD4+ T cell differentiation

    PubMed Central

    Chen, Kun; Zhang, Chunmei; Song, Chaojun; Fang, Liang; Xu, Zhuwei; Yang, Kun; Jin, Boquan; Wang, Qintao; Chen, Lihua

    2016-01-01

    Treatment targeting CD226 can ameliorate experimental autoimmune encephalomyelitis (EAE), the widely accepted model of MS. However, the mechanisms still need to be elucidated. Here we showed that CD226 blockage by anti-CD226 blocking mAb LeoA1 efficiently promoted IL-10 production in human peripheral blood monocytes (PBMC) or in mixed lymphocyte culture (MLC) system, significantly induced the CD4+IL-10+ T cell differentiation while suppressing the generation of Th1 and Th17. Furthermore, CD226 pAb administration in vivo reduced the onset of EAE in mice by promoting IL-10 production and regulating T cell differentiation. Concomitantly, the onset and severity of EAE were reduced and the serum IL-10 expression levels were increased in CD226 knockout mice than that in control mice when both received EAE induction. These novel findings confirmed that CD226 played a pivotal role in mediating autoimmune diseases such as EAE. Furthermore, to our knowledge, we show for the first time that IL-10 is an important contributor in the inhibitory effects of CD226 ligation on EAE. PMID:26942885

  18. A 3.7 kb Fragment of the Mouse Scn10a Gene Promoter Directs Neural Crest But Not Placodal Lineage EGFP Expression in a Transgenic Animal

    PubMed Central

    Lu, Van B.; Ikeda, Stephen R.

    2015-01-01

    Under physiological conditions, the voltage-gated sodium channel Nav1.8 is expressed almost exclusively in primary sensory neurons. The mechanism restricting Nav1.8 expression is not entirely clear, but we have previously described a 3.7 kb fragment of the Scn10a promoter capable of recapitulating the tissue-specific expression of Nav1.8 in transfected neurons and cell lines (Puhl and Ikeda, 2008). To validate these studies in vivo, a transgenic mouse encoding EGFP under the control of this putative sensory neuron specific promoter was generated and characterized in this study. Approximately 45% of dorsal root ganglion neurons of transgenic mice were EGFP-positive (mean diameter = 26.5 μm). The majority of EGFP-positive neurons bound isolectin B4, although a small percentage (∼10%) colabeled with markers of A-fiber neurons. EGFP expression correlated well with the presence of Nav1.8 transcript (95%), Nav1.8-immunoreactivity (70%), and TTX-R INa (100%), although not all Nav1.8-expressing neurons expressed EGFP. Several cranial sensory ganglia originating from neurogenic placodes, such as the nodose ganglion, failed to express EGFP, suggesting that additional regulatory elements dictate Scn10a expression in placodal-derived sensory neurons. EGFP was also detected in discrete brain regions of transgenic mice. Quantitative PCR and Nav1.8-immunoreactivity confirmed Nav1.8 expression in the amygdala, brainstem, globus pallidus, lateral and paraventricular hypothalamus, and olfactory tubercle. TTX-R INa recorded from EGFP-positive hypothalamic neurons demonstrate the usefulness of this transgenic line to study novel roles of Nav1.8 beyond sensory neurons. Overall, Scn10a-EGFP transgenic mice recapitulate the majority of the Nav1.8 expression pattern in neural crest-derived sensory neurons. PMID:25995484

  19. FEHMN 1.0: Finite element heat and mass transfer code; Revision 1

    SciTech Connect

    Zyvoloski, G.; Dash, Z.; Kelkar, S.

    1992-05-01

    A computer code is described which can simulate non-isothermal multi-phase multicomponent flow in porous media. It is applicable to natural-state studies of geothermal systems and groundwater flow. The equations of heat and mass transfer for multiphase flow in porous and permeable media are solved sing the finite element method. The permeability and porosity of the medium are allowed to depend on pressure and temperature. The code also has provisions for movable air and water phases and noncoupled tracers; that is, tracer solutions that do not affect the heat and mass transfer solutions. The tracers can be passive or reactive. The code can simulate two-dimensional, two-dimensional radial, or three-dimensional geometries. A summary of the equations in the model and the numerical solution procedure are provided in this report. A user`s guide and sample problems are also included. The FEHMN (Finite Element Heat and Mass Nuclear) code, described in this report, is a version of FEHM (Finite Element Heat and Mass, Zyvoloski et al., 1988) developed for the Yucca Mountain Site Characterization Project (YMP). The main use of FEHMN will be to assist in the understanding of flow fields in the saturated zone below the potential Yucca Mountain repository.

  20. Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene.

    PubMed Central

    Salero, Enrique; Giménez, Cecilio; Zafra, Francisco

    2003-01-01

    We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter. The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library. Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated. Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element. The retarded complexes contained USF1, as deduced from competition and supershift assays. Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50%. Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box. The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells. Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells. These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. PMID:12444925

  1. Klf10 regulates odontoblast differentiation and mineralization via promoting expression of dentin matrix protein 1 and dentin sialophosphoprotein genes

    PubMed Central

    Chen, Zhuo; Li, Wentong; Wang, Han; Wan, Chunyan; Luo, Daoshu; Deng, Shuli

    2016-01-01

    Klf10, a member of the Krüppel-like family of transcription factors, is critical for osteoblast differentiation, bone formation and mineralization. However, whether Klf10 is involved in odontoblastic differentiation and tooth development has not been determined. In this study, we investigate the expression patterns of Klf10 during murine tooth development in vivo and its role in odontoblastic differentiation in vitro. Klf10 protein was expressed in the enamel organ and the underlying mesenchyme, ameloblasts and odontoblasts at early and later stages of murine molar formation. Furthermore, the expression of Klf10, Dmp1, Dspp and Runx2 was significantly elevated during the process of mouse dental papilla mesenchymal differentiation and mineralization. The overexpression of Klf10 induced dental papilla mesenchymal cell differentiation and mineralization as detected by alkaline phosphatase staining and alizarin red S assay. Klf10 additionally up-regulated the expression of odontoblastic differentiation marker genes Dmp1, Dspp and Runx2 in mouse dental papilla mesenchymal cells. The molecular mechanism of Klf10 in controlling Dmp1 and Dspp expression is thus to activate their regulatory regions in a dosage-dependent manner. Our results suggest that Klf10 is involved in tooth development and promotes odontoblastic differentiation via the up-regulation of Dmp1 and Dspp transcription. PMID:26310138

  2. Ubiquitin-conjugating enzyme UbcH10 promotes gastric cancer growth and is a potential biomarker for gastric cancer.

    PubMed

    Yang, Mengxuan; Qu, Yingying; Shi, Rongliang; Wu, Xubo; Su, Chang; Hu, Zhiqiu; Chang, Qimeng; Liu, Shaoqun; Pan, Gaofeng; Lei, Ming; Xie, Fubo; Tu, Shiwei; Tao, Weikang; Zhou, He; Hu, Gang; Zhang, Ziping

    2016-08-01

    Gastric cancer is a fatal disease and the availability of early diagnostic methods is limited. There is an urgent need to identify effective targets for early diagnosis and therapeutics. UbcH10 is a ubiquitin-conjugating enzyme with high expression in various types of cancers. In the present study, several gastric tumor cell lines with high or low expression of UbcH10 were exploited to study the role of UbcH10 in gastric cancer. Knockdown of UbcH10 expression using siRNA in gastric cancer cell lines with high expression of UbcH10 resulted in reduced proliferation, increased cisplatin-induced apoptosis and reduced serum-induced ERK, Akt and p38 phosphorylation signaling. In agreement, overexpression of UbcH10 in gastric cancer cell lines with low expression of UbcH10 led to enhanced cell proliferation and resistance to cisplatin-induced apoptosis. Most importantly, IHC analyses showed that the UbcH10 protein was expressed at a high level in most patient gastric cancer tissues, but was absent in adjacent mesenchyme tissues. These data suggest that UbcH10 may promote gastric cancer growth and can serve as a biomarker for diagnosis or as a target for novel therapeutics in gastric cancer. PMID:27349176

  3. Klf10 regulates odontoblast differentiation and mineralization via promoting expression of dentin matrix protein 1 and dentin sialophosphoprotein genes.

    PubMed

    Chen, Zhuo; Li, Wentong; Wang, Han; Wan, Chunyan; Luo, Daoshu; Deng, Shuli; Chen, Hui; Chen, Shuo

    2016-02-01

    Klf10, a member of the Krüppel-like family of transcription factors, is critical for osteoblast differentiation, bone formation and mineralization. However, whether Klf10 is involved in odontoblastic differentiation and tooth development has not been determined. In this study, we investigate the expression patterns of Klf10 during murine tooth development in vivo and its role in odontoblastic differentiation in vitro. Klf10 protein was expressed in the enamel organ and the underlying mesenchyme, ameloblasts and odontoblasts at early and later stages of murine molar formation. Furthermore, the expression of Klf10, Dmp1, Dspp and Runx2 was significantly elevated during the process of mouse dental papilla mesenchymal differentiation and mineralization. The overexpression of Klf10 induced dental papilla mesenchymal cell differentiation and mineralization as detected by alkaline phosphatase staining and alizarin red S assay. Klf10 additionally up-regulated the expression of odontoblastic differentiation marker genes Dmp1, Dspp and Runx2 in mouse dental papilla mesenchymal cells. The molecular mechanism of Klf10 in controlling Dmp1 and Dspp expression is thus to activate their regulatory regions in a dosage-dependent manner. Our results suggest that Klf10 is involved in tooth development and promotes odontoblastic differentiation via the up-regulation of Dmp1 and Dspp transcription. PMID:26310138

  4. An impairment of long distance SOX10 regulatory elements underlies isolated Hirschsprung disease.

    PubMed

    Lecerf, Laure; Kavo, Anthula; Ruiz-Ferrer, Macarena; Baral, Viviane; Watanabe, Yuli; Chaoui, Asma; Pingault, Veronique; Borrego, Salud; Bondurand, Nadege

    2014-03-01

    A deletion encompassing several SOX10 enhancers was recently identified in a patient presenting with Waardenburg syndrome type 4 (WS4), which is defined as a combination of Hirschsprung disease (HSCR, intestinal aganglionosis) and WS (deafness and pigmentation defects). The expression patterns of some of the known SOX10 enhancers in animal models led to the speculation that endophenotypes of WS4 may be linked to mutations within some of these sequences. The present study investigated deletions and point mutations within four SOX10 enhancers in 144 unexplained isolated HSCR cases. One deletion and two point mutations affecting binding sites for known neural crest transcription factors were identified. In vitro functional analysis revealed that the first point mutation disrupts autoregulation by SOX10, whereas the second affects AP2a and SOX10 synergistic activity. The present findings suggest that the mutations within SOX10 enhancers contribute to isolated HSCR. PMID:24357527

  5. Dietary fat-induced taurocholic acid production promotes pathobiont and colitis in IL-10−/− mice

    PubMed Central

    Devkota, Suzanne; Wang, Yunwei; Musch, Mark; Leone, Vanessa; Fehlner-Peach, Hannah; Nadimpalli, Anuradha; Antonopoulos, Dionysios A.; Jabri, Bana; Chang, Eugene B.

    2012-01-01

    The composite human microbiome of Western populations has likely changed over the past century, brought on by new environmental triggers that often have a negative impact on human health1. Here we show that consumption of a diet high in saturated (milk derived)-fat (MF), but not polyunsaturated (safflower oil)-fat (PUFA), changes the conditions for microbial assemblage and promotes expansion of a low abundance, sulfite-reducing pathobiont, Bilophila wadsworthia2. This was associated with a pro-inflammatory TH1 immune response and increased incidence of colitis in genetically susceptible IL-10−/−, but not wild type mice. These effects are mediated by MF-promoted taurine-conjugation of hepatic bile acids, which increases the availability of organic sulfur used by sulfite-reducing microbes like B. wadsworthia. When mice were fed a low-fat (LF) diet supplemented with taurocholic, but not with glycocholic acid, for example, a bloom of B. wadsworthia and development of colitis were observed in IL10−/− mice. Together these data show that dietary fats, by promoting changes in host bile acid composition, can dramatically alter conditions for gut microbial assemblage, resulting in dysbiosis that can perturb immune homeostasis. The data provide a plausible mechanistic basis by which Western type diets high in certain saturated fats might increase the prevalence of complex immune-mediated diseases like inflammatory bowel diseases in genetically susceptible hosts. PMID:22722865

  6. A cis-element with mixed G-quadruplex structure of NPGPx promoter is essential for nucleolin-mediated transactivation on non-targeting siRNA stress

    PubMed Central

    Wei, Pei-Chi; Wang, Zi-Fu; Lo, Wen-Ting; Su, Mei-I; Shew, Jin-Yuh; Chang, Ta-Chau; Lee, Wen-Hwa

    2013-01-01

    We reported that non-targeting siRNA (NT-siRNA) stress induces non-selenocysteine containing phospholipid hydroperoxide glutathione peroxidase (NPGPx) expression to cooperate with exoribonuclease XRN2 for releasing the stress [Wei,P.C., Lo,W.T., Su,M.I., Shew,J.Y. and Lee,W.H. (2011) Non-targeting siRNA induces NPGPx expression to cooperate with exoribonuclease XRN2 for releasing the stress. Nucleic Acids Res., 40, 323–332]. However, how NT-siRNA stress inducing NPGPx expression remains elusive. In this communication, we showed that the proximal promoter of NPGPx contained a mixed G-quadruplex (G4) structure, and disrupting the structure diminished NT-siRNA induced NPGPx promoter activity. We also demonstrated that nucleolin (NCL) specifically bonded to the G4-containing sequences to replace the originally bound Sp1 at the NPGPx promoter on NT-siRNA stress. Consistently, overexpression of NCL further increased NPGPx promoter activity, whereas depletion of NCL desensitized NPGPx promoter to NT-siRNA stress. These results suggest that the cis-element with mixed G4 structure at the NPGPx promoter plays an essential role for its transactivation mediated by NCL to release cells from NT-siRNA stress. PMID:23241391

  7. A cis-element with mixed G-quadruplex structure of NPGPx promoter is essential for nucleolin-mediated transactivation on non-targeting siRNA stress.

    PubMed

    Wei, Pei-Chi; Wang, Zi-Fu; Lo, Wen-Ting; Su, Mei-I; Shew, Jin-Yuh; Chang, Ta-Chau; Lee, Wen-Hwa

    2013-02-01

    We reported that non-targeting siRNA (NT-siRNA) stress induces non-selenocysteine containing phospholipid hydroperoxide glutathione peroxidase (NPGPx) expression to cooperate with exoribonuclease XRN2 for releasing the stress [Wei,P.C., Lo,W.T., Su,M.I., Shew,J.Y. and Lee,W.H. (2011) Non-targeting siRNA induces NPGPx expression to cooperate with exoribonuclease XRN2 for releasing the stress. Nucleic Acids Res., 40, 323-332]. However, how NT-siRNA stress inducing NPGPx expression remains elusive. In this communication, we showed that the proximal promoter of NPGPx contained a mixed G-quadruplex (G4) structure, and disrupting the structure diminished NT-siRNA induced NPGPx promoter activity. We also demonstrated that nucleolin (NCL) specifically bonded to the G4-containing sequences to replace the originally bound Sp1 at the NPGPx promoter on NT-siRNA stress. Consistently, overexpression of NCL further increased NPGPx promoter activity, whereas depletion of NCL desensitized NPGPx promoter to NT-siRNA stress. These results suggest that the cis-element with mixed G4 structure at the NPGPx promoter plays an essential role for its transactivation mediated by NCL to release cells from NT-siRNA stress. PMID:23241391

  8. Study on ambient concentrations of PM 10, PM 10-2.5, PM 2.5 and gaseous pollutants. Trace elements and chemical speciation of atmospheric particulates

    NASA Astrophysics Data System (ADS)

    Dongarrà, G.; Manno, E.; Varrica, D.; Lombardo, M.; Vultaggio, M.

    2010-12-01

    This study provides the first comprehensive report on mass concentrations of particulate matter of various sizes, inorganic and organic gas concentrations monitored at three sampling sites in the city of Palermo (Sicily, Italy). It also provides information on the water-soluble species and trace elements. A total of 2054 PM 10 (1333) and PM 2.5 (721) daily measurements were collected from November 2006 to February 2008. The highest mass concentrations were observed at the urban stations, average values being about two times higher than those at the suburban (control) site. Time variations in PM 10 and also PM 10-2.5 were observed at the urban stations, the highest concentrations being measured in autumn and winter. CO, NOx, NO 2, benzene, toluene and o-xylene concentrations peaked in autumn and winter, a pattern similar to those recorded for PM 10 and PM 10-2.5 mass levels, indicating the importance of traffic emissions in urban air pollution. 91% and 51% of the benzene measurements exceeded the limit of 5 μg m -3 at the two urban monitoring sites. Trace elements (As, Ba, Cr, Cu, Mo, Pb, Sb) suspected of being introduced into the atmosphere mainly by anthropogenic activities, were highly enriched with respect to local soil. Results indicate that a large fraction of PM 10 (31-47% in weight) and PM 2.5 (29% in weight) is made up of water-soluble ions. Ammonium sulphate and nitrate particles accounted for 14-29 wt% of particulate matter mass concentrations. Crustal and marine components, combined, account for 41% and 49% in PM 2.5 and PM 10, respectively. The calculated deficits in Cl - and NH 4+ ions suggest that a proportion of these ions are lost, via the formation of gaseous NH 4Cl or HCl and NH 3.

  9. The UPC2 promoter in Candida albicans contains two cis-acting elements that bind directly to Upc2p, resulting in transcriptional autoregulation.

    PubMed

    Hoot, Samantha J; Brown, Ryan P; Oliver, Brian G; White, Theodore C

    2010-09-01

    In Candida albicans, ergosterol biosynthetic genes, including ERG11, which encodes the target of azole antifungal drugs, are regulated by the transcriptional regulator Upc2p. To initially characterize the promoter of the UPC2 gene, 5' rapid amplification of cDNA ends was used to identify two transcriptional initiation sites upstream of the ATG codon. The regions within the UPC2 promoter required for azole regulation of the UPC2 promoter were then identified using nested deletions fused to a luciferase reporter which were tested for azole inducibility in wild-type (WT) and upc2Delta/upc2Delta strains. Two distinct regions important for azole induction were identified: a Upc2p-dependent region (UDR) between bp -450 and -350 upstream of the ATG codon and a Upc2p-independent region (UIR) between bp -350 and -250 upstream of the ATG codon. Within the UDR, loss or mutation of the sterol response element (SRE), so named because of homology to the Saccharomyces cerevisiae Upc2p binding site, resulted in a decrease in both basal and induced expression in the WT strain but did not affect azole inducibility in the upc2Delta/upc2Delta deletion strain. Gel shift analyses using the DNA binding domain of Upc2p confirmed binding of the protein to two SRE-related sequences within the UPC2 promoter, with strongest binding to the UDR SRE. Detailed gel shift analyses of the UDR SRE shows that Upc2p binds to a bipartite element within the UPC2 promoter, including the previously identified SRE and a new, adjacent element, the short direct repeat (SDR), with partial homology to the SRE. PMID:20656915

  10. ALU repeats in promoters are position-dependent co-response elements (coRE) that enhance or repress transcription by dimeric and monomeric progesterone receptors.

    PubMed

    Jacobsen, Britta M; Jambal, Purevsuren; Schittone, Stephanie A; Horwitz, Kathryn B

    2009-07-01

    We have conducted an in silico analysis of progesterone response elements (PRE) in progesterone receptor (PR) up-regulated promoters. Imperfect inverted repeats, direct repeats, and half-site PRE are widespread, not only in PR-regulated, but also in non-PR-regulated and random promoters. Few resemble the commonly used palindromic PRE with three nucleotide (nt) spacers. We speculated that PRE may be necessary but insufficient to control endogenous PR-dependent transcription. A search for PRE partners identified a highly conserved 234-nt sequence invariably located within 1-2 kb of transcription start sites. It resembles ALU repeats and contains binding sites for 11 transcription factors. The 234-nt sequence of the PR-regulated 8-oxoguanine DNA glycosylase promoter was cloned in the forward or reverse orientation in front of zero, one, or two inverted repeat PRE, and one or tandem PRE half-sites, driving luciferase. Under these conditions the 234-nt sequence functions as a co-response element (coRE). From the PRE or tandem half-sites, the reverse coRE is a strong activator of PR and glucocorticoid receptor-dependent transcription. The forward coRE is a powerful repressor. The prevalence of PRE half-sites in natural promoters suggested that PR monomers regulate transcription. Indeed, dimerization-domain mutant PR monomers were stronger transactivators than wild-type PR on PRE or tandem half-sites. This was repressed by the forward coRE. We propose that in natural promoters the coRE functions as a composite response element with imperfect PRE and half-sites to present variable, orientation-dependent transcription factors for interaction with nearby PR. PMID:19372234

  11. Molecular basis of the recognition of the ap65-1 gene transcription promoter elements by a Myb protein from the protozoan parasite Trichomonas vaginalis.

    PubMed

    Jiang, Ingjye; Tsai, Chen-Kun; Chen, Sheng-Chia; Wang, Szu-Huan; Amiraslanov, Imamaddin; Chang, Chi-Fon; Wu, Wen-Jin; Tai, Jung-Hsiang; Liaw, Yen-Chywan; Huang, Tai-Huang

    2011-11-01

    Iron-inducible transcription of the ap65-1 gene in Trichomonas vaginalis involves at least three Myb-like transcriptional factors (tvMyb1, tvMyb2 and tvMyb3) that differentially bind to two closely spaced promoter sites, MRE-1/MRE-2r and MRE-2f. Here, we defined a fragment of tvMyb2 comprising residues 40-156 (tvMyb2₄₀₋₁₅₆) as the minimum structural unit that retains near full binding affinity with the promoter DNAs. Like c-Myb in vertebrates, the DNA-free tvMyb2₄₀₋₁₅₆ has a flexible and open conformation. Upon binding to the promoter DNA elements, tvMyb2₄₀₋₁₅₆ undergoes significant conformational re-arrangement and structure stabilization. Crystal structures of tvMyb2₄₀₋₁₅₆ in complex with promoter element-containing DNA oligomers showed that 5'-a/gACGAT-3' is the specific base sequence recognized by tvMyb2₄₀₋₁₅₆, which does not fully conform to that of the Myb binding site sequence. Furthermore, Lys⁴⁹, which is upstream of the R2 motif (amino acids 52-102) also participates in specific DNA sequence recognition. Intriguingly, tvMyb2₄₀₋₁₅₆ binds to the promoter elements in an orientation opposite to that proposed in the HADDOCK model of the tvMyb1₃₅₋₁₄₁/MRE-1-MRE-2r complex. These results shed new light on understanding the molecular mechanism of Myb-DNA recognition and provide a framework to study the molecular basis of transcriptional regulation of myriad Mybs in T. vaginalis. PMID:21771861

  12. A Preliminary Report on X-Ray Photoabsorption Coefficients andAtomic Scattering Factors for 92 Elements in the 10-10,000 eVRegion

    SciTech Connect

    Henke, B.L.; Davis, J.C.; Gullikson, E.M.; Perera, R.C.C.

    1988-11-01

    Based on currently available photoabsorption measurements and recent theoretical calculations by Doolen and Liberman (Physica Scripta 36, 77 (1987)), a revised (from ADNDT 27, 1 (1982)) best-fit determination of the photoabsorption cross sections is presented here for the elements Z=1 to Z=92 in the 10-10,000 eV range. The photoabsorption data used include those described in the Lockheed and DOE listings of research abstracts for the past ten years and those which have been recently added to the comprehensive NBS Measured Data Base (NBSIR 86-3461, Hubbell et al.). The best-fit curves are compared with both the compilation of measurements and the calculations by Doolen and Liberman. Using the photoabsorption curves, the atomic scattering factors have been calculated for the energy range 50-10,000 eV and are also presented in this report.

  13. Tyk2 negatively regulates adaptive Th1 immunity by mediating IL-10 signaling and promoting IFN-gamma-dependent IL-10 reactivation.

    PubMed

    Shaw, Michael H; Freeman, Gordon J; Scott, Mark F; Fox, Barbara A; Bzik, David J; Belkaid, Yasmine; Yap, George S

    2006-06-15

    The Jak, Tyk2, is activated in response to IL-12 and IFN-alphabeta and promotes IFN-gamma production by Th1-type CD4 cells. Mice deficient in Tyk2 function have been previously shown to be resistant to autoimmune arthritis and septic shock but are acutely susceptible to opportunistic pathogens such as Toxoplasma gondii. In this study, we show that Tyk2, in addition to mediating the biological effects of IL-12 and IFN-alphabeta, is an important regulator for the signaling and expression of the immunosuppressive cytokine IL-10. In the absence of Tyk2, Ag-reactive CD4 cells exhibit impaired IL-10 synthesis following rechallenge of T. gondii vaccine-primed mice. The impaired IL-10 reactivation leads to unopposed antimicrobial effector mechanisms which results in a paradoxically superior protection of immune Tyk2(-/-) mice against virulent T. gondii challenge. We further demonstrate that Tyk2 indirectly controls CD4 IL-10 reactivation by signaling for maximal IFN-gamma secretion. The unexpected role of IFN-gamma in mediating IL-10 reactivation by Th1 cells provides compelling evidence that conditions driving Th1 responses establish a negative feedback loop, which will ultimately lead to its autoregulation. Thus, Tyk2 can be viewed as a dual-function Jak, mediating both pro and anti-inflammatory cytokine responses. PMID:16751369

  14. Role of Heme Oxygenase, Leptin, Coenzyme Q10 and Trace Elements in Pre-eclamptic Women.

    PubMed

    Abo-Elmatty, Dina M; Badawy, Ehsan A; Hussein, Jihan S; Elela, Somaya Abo; Megahed, Hoda A

    2012-10-01

    The objective of this study to evaluate heme oxygenase (COHb), leptin and coenzyme Q10 (CoQ10) in pre-eclamptic women. Also Zinc, copper, Iron, total iron binding capacity, Ferritin and uric acid were assessed. 120 female subjects were included in this study. They were divided into, 60 female with normal pregnancy attending the outpatient clinic, 60 pre-eclamptic patients were recruited from obstetrics and gynaecology department El-kasr El-Aini hospital. The results showed that in pre-eclampatic group, leptin level was significantly increased while COHb and CoQ10 was significantly decreased. It is concluded that hemeoxygenase, leptin and coenzyme CoQ10 can be considered as new markers for prediction of pre-eclampsia. PMID:24082464

  15. Promoting a Functional Physical Self-Concept in Physical Education: Evaluation of a 10-Week Intervention

    ERIC Educational Resources Information Center

    Schmidt, Mirko; Valkanover, Stefan; Roebers, Claudia; Conzelmann, Achim

    2013-01-01

    Most physical education intervention studies on the positive effect of sports on self-concept development have attempted to "increase" schoolchildren's self-concept without taking the "veridicality" of the self-concept into account. The present study investigated whether a 10-week intervention in physical education would…

  16. Reduction of TIP30 in esophageal squamous cell carcinoma cells involves promoter methylation and microRNA-10b

    SciTech Connect

    Dong, Wenjie; Shen, Ruizhe; Cheng, Shidan

    2014-10-31

    Highlights: • TIP30 expression is frequently suppressed in ESCC. • TIP30 was hypermethylated in ESCC. • Reduction of TIP30 was significantly correlated with LN metastasis. • miR-10b is a direct regulator of TIP30. - Abstract: TIP30 is a putative tumor suppressor that can promote apoptosis and inhibit angiogenesis. However, the role of TIP30 in esophageal squamous cell carcinoma (ESCC) biology has not been investigated. Immunohistochemistry was used to investigate the expression of TIP30 in 70 ESCC. Hypermethylation of TIP30 was evaluated by the methylation specific PCR (MSP) method in ESCC (tumor and paired adjacent non-tumor tissues). Lost expression of TIP30 was observed in 50 of 70 (71.4%) ESCC. 61.4% (43 of 70) of primary tumors analyzed displayed TIP30 hypermethylation, indicating that this aberrant characteristic is common in ESCC. Moreover, a statistically significant inverse association was found between TIP30 methylation status and expression of the TIP30 protein in tumor tissues (p = 0.001). We also found that microRNA-10b (miR-10b) targets a homologous DNA region in the 3′untranslated region of the TIP30 gene and represses its expression at the transcriptional level. Reporter assay with 3′UTR of TIP30 cloned downstream of the luciferase gene showed reduced luciferase activity in the presence of miR-10b, providing strong evidence that miR-10b is a direct regulator of TIP30. These results suggest that TIP30 expression is regulated by promoter methylation and miR-10b in ESCC.

  17. Trace elements in striped dolphins (Stenella coeruleoalba) from the Eastern Mediterranean: A 10-years perspective.

    PubMed

    Shoham-Frider, Efrat; Goffman, Oz; Harlavan, Yehudit; Kress, Nurit; Morick, Danny; Roditi-Elasar, Mia; Shefer, Edna; Kerem, Dan

    2016-08-15

    Concentrations of Hg, Se, Cd, Cu, Zn, Fe, Mn and As, in kidney, liver, muscle and blubber from 7 specimens of Stenella coeruleoalba, stranded along the Israeli Mediterranean coast (IMC) from 2006 to 2011 (2011-series) were determined and compared to previous data on S. coeruleoalba from the IMC (2001-series). No differences were observed in essential and toxic elements concentrations, between the two series, except for hepatic Mn which was higher in the latter. Hg/Se molar ratios in blubber, kidney and liver increased linearly with log Hg concentrations, while muscle was more heterogenic in this respect. Means (±SD) of hepatic Hg concentrations (134±89 and 181±200mgkg(-1), from the 2011 and 2001 series, respectively) were similar to that found in 2007-2009 specimens from Spain, possibly reflecting the relatively high natural background levels of mercury in the Mediterranean Sea. PMID:27210566

  18. Association of Epstein-Barr virus antibody titers with a human IL-10 promoter polymorphism in Japanese women

    PubMed Central

    Yasui, Yutaka; Hamajima, Nobuyuki; Nakamura, Tsuneya; El-Din, Noha Sharaf; Tajima, Kazuo; Potter, John D

    2008-01-01

    Background Multiple sclerosis (MS) risk, over 10-fold higher in Western than in Asian countries, is associated with elevated IgG antibody titers against Epstein-Barr viral capcid antigen (anti-EBVCA IgG titers). Given the 84% homology of the open reading frame BCRF1 of Epstein-Barr virus (EBV) to human interleukin 10 (hIL-10) and the remarkable Caucasian-vs.-Asian population differences in hIL-10 gene promoter polymorphisms, this strong association of MS risk with anti-EB-VCA IgG titers may be explained by the genetic variations in the hIL-10 gene. Methods We evaluated anti-EB-VCA IgG titers in association with a single nucleotide polymorphism (SNP) in the promoter of hIL-10 at position -819 (hIL-10 T-819C) in a cross-sectional survey of 241 Japanese. Anti-EB-VCA IgG titer and its elevation (≥ 1:160) were evaluated, stratified by sex and hIL-10 T-819C genotype. Results The cytosine-allele frequencies at hIL-10 T-819C were 32.9% in women and 30.9% in men. These are consistent with the published reports of Japanese and Chinese, but substantially lower than those of Caucasians (> 70%). In women, the proportion with elevated anti-EB-VCA IgG titers (≥ 1:160) increased appreciably from 53.7% in the T/T genotype group to 66.7% in the T/C group and to 83.3% in the C/C group (P-trend = 0.037). The titers did not differ by the hIL-10 T-819C genotype in men. Conclusion Anti-EB-VCA IgG titers may increase with the number of cytosine alleles at hIL-10 T-819C in women. This observed gender specific association in Japanese warrants further investigation, especially in Western populations with high MS risk. PMID:18318911

  19. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    PubMed

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-01

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression. PMID:25234594

  20. A novel pairwise comparison method for in silico discovery of statistically significant cis-regulatory elements in eukaryotic promoter regions: application to Arabidopsis.

    PubMed

    Shamloo-Dashtpagerdi, Roohollah; Razi, Hooman; Aliakbari, Massumeh; Lindlöf, Angelica; Ebrahimi, Mahdi; Ebrahimie, Esmaeil

    2015-01-01

    Cis regulatory elements (CREs), located within promoter regions, play a significant role in the blueprint for transcriptional regulation of genes. There is a growing interest to study the combinatorial nature of CREs including presence or absence of CREs, the number of occurrences of each CRE, as well as of their order and location relative to their target genes. Comparative promoter analysis has been shown to be a reliable strategy to test the significance of each component of promoter architecture. However, it remains unclear what level of difference in the number of occurrences of each CRE is of statistical significance in order to explain different expression patterns of two genes. In this study, we present a novel statistical approach for pairwise comparison of promoters of Arabidopsis genes in the context of number of occurrences of each CRE within the promoters. First, using the sample of 1000 Arabidopsis promoters, the results of the goodness of fit test and non-parametric analysis revealed that the number of occurrences of CREs in a promoter sequence is Poisson distributed. As a promoter sequence contained functional and non-functional CREs, we addressed the issue of the statistical distribution of functional CREs by analyzing the ChIP-seq datasets. The results showed that the number of occurrences of functional CREs over the genomic regions was determined as being Poisson distributed. In accordance with the obtained distribution of CREs occurrences, we suggested the Audic and Claverie (AC) test to compare two promoters based on the number of occurrences for the CREs. Superiority of the AC test over Chi-square (2×2) and Fisher's exact tests was also shown, as the AC test was able to detect a higher number of significant CREs. The two case studies on the Arabidopsis genes were performed in order to biologically verify the pairwise test for promoter comparison. Consequently, a number of CREs with significantly different occurrences was identified between

  1. Protein factors in Blastocladiella emersonii cell extracts recognize similar sequence elements in the promoters of the genes encoding cAMP-dependent protein kinase subunits.

    PubMed

    de Oliveira, J C; Marques, M V; Gomes, S L

    1997-08-01

    Blastocladiella emersonii contains a single cAMP-dependent protein kinase (PKA), which is similar to the mammalian type II isoforms. Its activity is regulated during development by changes in the levels of the catalytic (C) and regulatory (R) subunits, which occur in parallel with changes in levels of the corresponding mRNAs, suggesting coordinate transcriptional control of the expression of both subunits. Both R and C mRNA levels are low in vegetative cells, rise sharply during sporulation and decrease to basal levels again after germination. To investigate sequence elements common to both Blastocladiella R and C gene promoters, which might be involved in the coordinate regulation of these genes, their 5'-flanking regions were analyzed by gel mobility shift and DNase I footprinting assays. We determined that different DNA-protein complexes are generated when fragments of the R and C gene promoters are incubated with extracts from cells expressing (sporulating cells) or not expressing (vegetative cells) both subunits, and competition experiments suggested that similar protein factors bind to both promoters. DNase I footprinting experiments have indicated that a sequence common to both R and C promoters, and similar to mammalian E-boxes, binds factors present in extracts from vegetative and sporulating cells, whereas sequences flanking the E-boxes in both promoters showed a change in the pattern of DNase I digestion only when the vegetative cell extract was used. This result suggests that the composition of the protein complexes binding to these regions changes during sporulation. PMID:9294034

  2. FEHMN 1.0: Finite element heat and mass transfer code

    SciTech Connect

    Zyvoloski, G.; Dash, Z.; Kelkar, S.

    1991-04-01

    A computer code is described which can simulate non-isothermal multiphase multicomponent flow in porous media. It is applicable to natural-state studies of geothermal systems and ground-water flow. The equations of heat and mass transfer for multiphase flow in porous and permeable media are solved using the finite element method. The permeability and porosity of the medium are allowed to depend on pressure and temperature. The code also has provisions for movable air and water phases and noncoupled tracers; that is, tracer solutions that do not affect the heat and mass transfer solutions. The tracers can be passive or reactive. The code can simulate two-dimensional, two-dimensional radial, or three-dimensional geometries. A summary of the equations in the model and the numerical solution procedure are provided in this report. A user`s guide and sample problems are also included. The main use of FEHMN will be to assist in the understanding of flow fields in the saturated zone below the proposed Yucca Mountain Repository. 33 refs., 27 figs., 12 tabs.

  3. Retrotransposons and their recognition of pol II promoters: a comprehensive survey of the transposable elements from the complete genome sequence of Schizosaccharomyces pombe.

    PubMed

    Bowen, Nathan J; Jordan, I King; Epstein, Jonathan A; Wood, Valerie; Levin, Henry L

    2003-09-01

    The complete DNA sequence of the genome of Schizosaccharomyces pombe provides the opportunity to investigate the entire complement of transposable elements (TEs), their association with specific sequences, their chromosomal distribution, and their evolution. Using homology-based sequence identification, we found that the sequenced strain of S. pombe contained only one family of full-length transposons. This family, Tf2, consisted of 13 full-length copies of a long terminal repeat (LTR) retrotransposon. We found that LTR-LTR recombination of previously existing transposons had resulted in extensive populations of solo LTRs. These included 35 solo LTRs of Tf2, as well as 139 solo LTRs from other Tf families. Phylogenetic analysis of solo Tf LTRs reveals that Tf1 and Tf2 were the most recently active elements within the genome. The solo LTRs also served as footprints for previous insertion events by the Tf retrotransposons. Analysis of 186 genomic insertion events revealed a close association with RNA polymerase II promoters. These insertions clustered in the promoter-proximal regions of genes, upstream of protein coding regions by 100 to 400 nucleotides. The association of Tf insertions with pol II promoters was very similar to the preference previously observed for Tf1 integration. We found that the recently active Tf elements were absent from centromeres and pericentromeric regions of the genome containing tandem tRNA gene clusters. In addition, our analysis revealed that chromosome III has twice the density of insertion events compared to the other two chromosomes. Finally we describe a novel repetitive sequence, wtf, which was also preferentially located on chromosome III, and was often located near solo LTRs of Tf elements. PMID:12952871

  4. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila

    PubMed Central

    Burke, Thomas W.; Kadonaga, James T.

    1997-01-01

    We analyzed the function of the downstream promoter element (DPE), a distinct 7-nucleotide core promoter element that is ∼30 nucleotides downstream of the transcription start site of many TATA-box-deficient (TATA-less) promoters in Drosophila. There is a strict requirement for spacing between the Inr and DPE motifs, as an increase or decrease of 3 nucleotides in the distance between the Inr and DPE causes a seven- to eightfold reduction in transcription as well as a significant reduction in the binding of purified TFIID. These results suggest a specific and somewhat rigid interaction of TFIID with the Inr and DPE sequences. Photo-cross-linking analysis of purified TFIID with a TATA-less DPE-containing promoter revealed specific cross-linking of dTAFII60 and dTAFII40 to the DPE, with a higher efficiency of cross-linking to dTAFII60 than to dTAFII40. These data, combined with the previously well-characterized interactions between the two TAFs and their homology to histones H4 and H3, suggest that a dTAFII60–dTAFII40 heterotetramer binds to the DPE. Human and Drosophila transcription factors exhibit essentially the same requirements for DPE sequence and for Inr–DPE spacing. In addition, the TATA-less promoter of the human interferon regulatory factor-1 (IRF-1) gene contains a DPE that is important for transcriptional activity both in vitro and in cultured cells. Hence, these studies provide evidence for a direct role of TAFs in basal transcription of TATA-less DPE-containing genes and collectively indicate that the DPE is, in many respects, a downstream counterpart to the TATA box that is present in Drosophila to humans. PMID:9367984

  5. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

    PubMed

    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2016-05-10

    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. PMID:26995610

  6. HEAP---An instrument to measure the elemental abundances above 10 sup 15 eV at a lunar base

    SciTech Connect

    Swordy, S.P. )

    1990-03-20

    At {approx}10{sup 15} eV the slope of the energy spectrum of cosmic rays becomes significantly steeper than at lower energies. The measurement of relative elemental abundances at these energies is expected to provide a means to resolve the origin of this feature and greatly contribute to the understanding of the sources of cosmic rays at high energies. We describe a moon based detector, HEAP, for making well-resolved elemental measurements at these energies using hadronic calorimetry. This detector is particularly well suited for a site on the lunar surface because there is no overlying layer of atmosphere and the large mass required can be provided by the lunar regolith.

  7. A bidirectional promoter reporter vector for the analysis of the p53/WDR79 dual regulatory element.

    PubMed

    Polson, Amanda; Durrett, Emily; Reisman, David

    2011-09-01

    Analysis of numerous genomes has identified a class of regulatory regions that contain a head-to-head arrangement (5' to 5') on opposite strands of DNA. Often these regulatory regions have fewer than 1000 base pairs separating their corresponding transcription start sites and have been termed as being "bidirectional". This bidirectional arrangement and the divergent gene pairs under the control of these regulatory regions appear to be a common feature within genomes. Establishing methods to study these bidirectional transcriptional promoters, and understanding how they are regulated will allow researchers to gain more insight into the roles that divergent transcription plays in the expression and maintenance of protein coding genes. Recently, the p53 tumor suppressor gene was shown to have a bidirectional gene partner, WDR79. The transcription start sites (TSSs) of human and murine p53 and WDR79 genes are separated by approximately 800 and 930bp, respectively, in a head-to-head fashion, and fit the criteria of what is designated to be a putative bidirectional regulatory region. However, further testing is needed to demonstrate that the region between these genes contains a functional bidirectional promoter. Here, we have developed a bidirectional reporter vector, termed pLucRLuc, to study the transcriptional output of each promoter. This bidirectional reporter vector will allow researchers to determine the output of transcripts mediated by the bidirectional promoters. By focusing our studies on the transcriptional regulation of p53 and its bidirectional gene partner, WDR79, we hope to elucidate key factors that can control and regulate the expression of the p53 and WDR79 genes. Here, we demonstrate that pLucRLuc is a vector capable of expressing reporter genes under the control of bidirectional promoters in multiple human and murine cell lines and that the regulatory region upstream of the p53 and WDR79 TSSs is a bidirectional promoter controlled by common

  8. An Instrument to Measure Elemental Energy Spectra of Cosmic Ray Nuclei Up to 10(exp 16) eV

    NASA Technical Reports Server (NTRS)

    Adams, J.; Bashindzhagyan, G.; Chilingarian, A.; Drury, L.; Egorov, N.; Golubkov,S.; Korotkova, N.; Panasyuk, M.; Podorozhnyi, D.; Procqureur, J.

    2000-01-01

    A longstanding goal of cosmic ray research is to measure the elemental energy spectra of cosmic rays up to and through the "knee" (approx. equal to 3 x 10 (exp 15) eV. It is not currently feasible to achieve this goal with an ionization calorimeter because the mass required to be deployed in Earth orbit is very large (at least 50 tonnes). An alternative method will be presented. This is based on measuring the primary particle energy by determining the angular distribution of secondaries produced in a target layer using silicon microstrip detector technology. The proposed technique can be used over a wide range of energies (10 (exp 11)- 10 (exp 16) eV) and gives an energy resolution of 60% or better. Based on this technique, a design for a new lightweight instrument with a large aperture (KLEM) will be described.

  9. Concentrations and source apportionment of PM10 and associated major and trace elements in the Rhodes Island, Greece.

    PubMed

    Argyropoulos, Georgios; Manoli, Evangelia; Kouras, Athanasios; Samara, Constantini

    2012-08-15

    Ambient concentrations of PM(10) and associated major and trace elements were measured over the cold and the warm season of 2007 at two sites located in the Rhodes Island (Greece), in Eastern Mediterranean, aimed at source apportionment by Chemical Mass Balance (CMB) receptor modeling. Source chemical profiles, necessary in CMB modeling, were obtained for a variety of emission sources that could possibly affect the study area, including sea spray, geological material, soot emissions from the nearby oil-fuelled thermal power plant, and other anthropogenic activities, such as vehicular traffic, residential oil combustion, wood burning, and uncontrolled open-air burning of agricultural biomass and municipal waste. Source apportionment of PM(10) and elemental components was carried out by employing an advanced CMB version, the Robotic Chemical Mass Balance model (RCMB). Vehicular emissions were found to be major PM(10) contributor accounting, on average, for 36.8% and 31.7% during the cold period, and for 40.9% and 39.2% in the warm period at the two sites, respectively. The second largest source of ambient PM(10), with minor seasonal variation, was secondary sulfates (mainly ammonium and calcium sulfates), with total average contribution around 16.5% and 18% at the two sites. Soil dust was also a remarkable source contributing around 22% in the warm period, whereas only around 10% in the cold season. Soot emitted from the thermal power plant was found to be negligible contributor to ambient PM(10) (<1%), however it appeared to appreciably contribute to the ambient V and Ni (11.3% and 5.1%, respectively) at one of the sites during the warm period, when electricity production is intensified. Trajectory analysis did not indicate any transport of Sahara dust; on the contrary, long range transport of soil dust from arid continental regions of Minor Asia and of biomass burning aerosol from the countries surrounding the Black Sea was considered possible. PMID:22705902

  10. Transcription activities of human papillomavirus type 11 E6 promoter-proximal elements in raft and submerged cultures of foreskin keratinocytes.

    PubMed Central

    Zhao, W; Chow, L T; Broker, T R

    1997-01-01

    Human papillomaviruses (HPVs) replicate only in differentiated squamous epithelia in warts and in epithelial raft cultures grown at the medium-air interface. Virus-encoded and host transcription factors are thought to be responsible for repressing the viral enhancer and promoter located within the upstream regulatory region (URR) in the undifferentiated basal and parabasal cells while up-regulating their activities in the differentiated spinous cells. Using recombinant retroviruses, we acutely transduced neonatal foreskin keratinocytes (PHKs) with a lacZ reporter gene driven by the wild-type URR of the low-risk HPV type 11 or by a URR with individual mutations in seven promoter-proximal elements, some of which have not been characterized previously. Beta-galactosidase activities were detected in the submerged, proliferating PHKs and also in the differentiated spinous cells, but not in the steady-state proliferating basal cells, of stratified raft cultures. In particular, mutation of an Oct1, an Sp1, or a previously unknown promoter-proximal AP1 site severely reduced the reporter activity, whereas mutation of either of two NF1 sites flanking the Oct1 site had no effect. These results demonstrate changes in cellular transcription factor profiles under different culture conditions and begin to characterize the naturally differentiation-dependent activation of the URR. They provide one molecular explanation for the patterns of HPV expression in warts and help validate epithelial raft cultures as an important experimental system for genetic dissection of HPV regulatory elements. PMID:9343243

  11. The use of olive-mill waste compost to promote the plant vegetation cover in a trace-element-contaminated soil.

    PubMed

    Pardo, Tania; Martínez-Fernández, Domingo; Clemente, Rafael; Walker, David J; Bernal, M Pilar

    2014-01-01

    The applicability of a mature compost as a soil amendment to promote the growth of native species for the phytorestoration of a mine-affected soil from a semi-arid area (SE Spain), contaminated with trace elements (As, Cd, Cu, Mn, Pb and Zn), was evaluated in a 2-year field experiment. The effects of an inorganic fertiliser were also determined for comparison. Bituminaria bituminosa was the selected native plant since it is a leguminous species adapted to the particular local pedoclimatic conditions. Compost addition increased total organic-C concentrations in soil with respect to the control and fertiliser treatments, maintained elevated available P concentrations throughout the duration of the experiment and stimulated soil microbial biomass, while trace elements extractability in the soil was rather low due to the calcareous nature of the soil and almost unaltered in the different treatments. Tissue concentrations of P and K in B. bituminosa increased after the addition of compost, associated with growth stimulation. Leaf Cu concentration was also increased by the amendments, although overall the trace elements concentrations can be considered non-toxic. In addition, the spontaneous colonisation of the plots by a total of 29 species of 15 different families at the end of the experiment produced a greater vegetation cover, especially in plots amended with compost. Therefore, the use of compost as a soil amendment appears to be useful for the promotion of a vegetation cover and the phytostabilisation of moderately contaminated soils under semi-arid conditions. PMID:23868726

  12. S-S Synapsis during Class Switch Recombination Is Promoted by Distantly Located Transcriptional Elements and Activation-Induced Deaminase

    PubMed Central

    Wuerffel, Robert; Wang, Lili; Grigera, Fernando; Manis, John; Selsing, Erik; Perlot, Thomas; Alt, Frederick W.; Cogne, Michel; Pinaud, Eric; Kenter, Amy L.

    2016-01-01

    SUMMARY Molecular mechanisms underlying synapsis of activation-induced deaminase (AID)-targeted S regions during class switch recombination (CSR) are poorly understood. By using chromosome conformation capture techniques, we found that in B cells, the Eμ and 3′Eα enhancers were in close spatial proximity, forming a unique chromosomal loop configuration. B cell activation led to recruitment of the germline transcript (GLT) promoters to the Eμ:3′Eα complex in a cytokine-dependent fashion. This structure facilitated S-S synapsis because Sμ was proximal to Eμ and a downstream S region was corecruited with the targeted GLT promoter to Eμ:3′Eα. We propose that GLT promoter association with the Eμ:3′Eα complex creates an architectural scaffolding that promotes S-S synapsis during CSR and that these interactions are stabilized by AID. Thus, the S-S synaptosome is formed as a result of the self-organizing transcription system that regulates GLT expression and may serve to guard against spurious chromosomal translocations. PMID:17980632

  13. Recognition of distinct HLA-DQA1 promoter elements by a single nuclear factor containing Jun and Fos or antigenically related proteins.

    PubMed Central

    Neve Ombra, M; Autiero, M; DeLerma Barbaro, A; Barretta, R; Del Pozzo, G; Guardiola, J

    1993-01-01

    The activity of MHC class II promoters depends upon conserved regulatory signals one of which, the extended X-box, contains in its X2 subregion a sequence related to the cAMP response element, CRE and to the TPA response element, TRE. Accordingly, X2 is recognized by the AP-1 factor and by other c-Jun or c-Fos containing heterodimers. We report that the X-box dependent promoter activity of the HLA-DQA1 gene is down-modulated by an array of DNA elements each of which represented twice either in an invertedly or directly repeated orientation. In this frame, we describe a nuclear binding factor, namely DBF, promiscuously interacting with two of these additional signals, delta and sigma, and with a portion of the X-box, namely the X-core, devoid of X2. The presence of a single factor recognizing divergent DNA sequences was indicated by the finding that these activities were co-eluted from a heparin-Sepharose column and from DNA affinity columns carrying different DNA binding sites as ligands. Competition experiments made with oligonucleotides representing wild type and mutant DNA elements showed that each DNA element specifically inhibited the binding of the others, supporting the contention that DBF is involved in recognition of different targets. Furthermore, we found that DBF also exhibits CRE/TRE binding activity and that this activity can be competed out by addition of an excess of sigma, delta and X-core oligonucleotides. Anti-Jun peptide and anti-Fos peptide antibodies blocked not only the binding activity of DBF, but also its X-core and sigma binding; this blockade was removed by the addition of the Jun or Fos peptides against which the antibodies had been raised. In vitro synthesized Jun/Fos was able to bind to all these boxes, albeit with seemingly different affinities. The cooperativity of DBF interactions may explain the modulation of the X-box dependent promoter activity mediated by the accessory DNA elements described here. Images PMID:8493100

  14. Trace element partitioning between majoritic garnet and silicate melt at 10-17 GPa: Implications for deep mantle processes

    NASA Astrophysics Data System (ADS)

    Corgne, Alexandre; Armstrong, Lora S.; Keshav, Shantanu; Fei, Yingwei; McDonough, William F.; Minarik, William G.; Moreno, Karen

    2012-09-01

    Melting experiments were performed on a silica-rich peridotite composition at 10-17 GPa to determine majoritic garnet-melt partition coefficients (D) for major and trace elements. Our results show that D for many elements, including Na, Sc, Y and rare earth elements (REE), varies significantly with increasing pressure or proportion of majorite component. Lu and Sc become incompatible at 17 GPa, with D decreasing from 1.5 at 10 GPa to 0.9 at 17 GPa. As predicted from lattice strain, log D for isovalent cations entering the large site of majoritic garnet exhibits a near-parabolic dependence on ionic radius. Our data are used to refine a previously published predictive model for garnet-melt partitioning of trivalent cations, which suffered from a lack of calibration in the 10-20 GPa range. Our results suggest that Archean Al-depleted komatiites from Barberton (South Africa) may have been generated by partial melting of dry peridotite at depths between 200 and 400 km. We also speculate that transition zone diamonds from Kankan (Guinea), which contain inclusions of majoritic garnet, may have formed from the partial reduction of CO2-rich magmas that subsequently transported them to the surface. This hypothesis would provide an explanation for the REE patterns of majoritic garnet trapped within these diamonds, including Eu anomalies. Finally, we show that segregation of majoritic garnet-bearing cumulates during crystallisation of a deep Martian magma ocean could lead to a variety of Lu/Hf and Sm/Nd ratios depending on pressure, leading to a range of ɛ143Nd and ɛ176Hf isotope signatures for potential mantle sources of Martian rocks.

  15. STAT5a promotes the transcription of mature mmu-miR-135a in 3T3-L1 cells by binding to both miR-135a-1 and miR-135a-2 promoter elements.

    PubMed

    Wei, Xiajie; Cheng, Xiaoyan; Peng, Yongdong; Zheng, Rong; Chai, Jin; Jiang, Siwen

    2016-08-01

    Despite extensive research on the role of miR-135a in biological processes, very little attention has been paid to the regulation of its transcription. We have previously reported that miR-135a suppresses 3T3-L1 preadipocyte differentiation and adipogenesis by directly targeting the adenomatous polyposis coli (APC) gene and activating the canonical Wnt/β-catenin signaling pathway, but the regulatory elements that regulate the expression of the two isoforms of miR-135a (miR-135a-1 and miR-135a-2) remain poorly understood. Here, by using deletion analysis, we predicted two binding sites (-874/-856 and -2020/-2002) for the transcription factor Signal Transducers and Activators of Transcription 5a (STAT5a) within the core promoters of miR-135a-1 and miR-135a-2 (-1128/-556 and -2264/-1773), and the subsequent site-directed mutagenesis indicated that the two STAT5a binding sites regulated the activity of the miR-135a-1 and miR-135a-2 promoters. The binding of STAT5a to the miR-135a-1/2 core promoters in vitro and in cell culture was identified by electrophoretic mobility shift assays (EMSA) and chromatin immunoprecipitation (ChIP) assays. Overexpression and RNAi knockdown of STAT5a showed that the transcription factor regulated the endogenous miR-135a expression. Additionally, The expression time frame of STAT5a and APC indicated a potential negative feedback between them. In sum, the overall results from this study indicate that STAT5a regulates miR-135a transcription by binding to both miR-135a-1 and miR135a-2 promoter elements and the findings provide novel insights into the molecular regulatory mechanisms of miR-135a during adipogenesis. PMID:27276245

  16. Novel core promoter elements in the oomycete pathogen Phytophthora infestans and their influence on expression detected by genome-wide analysis

    PubMed Central

    2013-01-01

    Background The core promoter is the region flanking the transcription start site (TSS) that directs formation of the pre-initiation complex. Core promoters have been studied intensively in mammals and yeast, but not in more diverse eukaryotes. Here we investigate core promoters in oomycetes, a group within the Stramenopile kingdom that includes important plant and animal pathogens. Prior studies of a small collection of genes proposed that oomycete core promoters contain a 16 to 19 nt motif bearing an Initiator-like sequence (INR) flanked by a novel sequence named FPR, but this has not been extended to whole-genome analysis. Results We used expectation maximization to find over-represented motifs near TSSs of Phytophthora infestans, the potato blight pathogen. The motifs corresponded to INR, FPR, and a new element found about 25 nt downstream of the TSS called DPEP. TATA boxes were not detected. Assays of DPEP function by mutagenesis were consistent with its role as a core motif. Genome-wide searches found a well-conserved combined INR+FPR in only about 13% of genes after correcting for false discovery, which contradicted prior reports that INR and FPR are found together in most genes. INR or FPR were found alone near TSSs in 18% and 7% of genes, respectively. Promoters lacking the motifs had pyrimidine-rich regions near the TSS. The combined INR+FPR motif was linked to higher than average mRNA levels, developmentally-regulated transcription, and functions related to plant infection, while DPEP and FPR were over-represented in constitutively-expressed genes. The INR, FPR, and combined INR+FPR motifs were detected in other oomycetes including Hyaloperonospora arabidopsidis, Phytophthora sojae, Pythium ultimum, and Saprolegnia parasitica, while DPEP was found in all but S. parasitica. Only INR seemed present in a non-oomycete stramenopile. Conclusions The absence of a TATA box and presence of novel motifs show that the oomycete core promoter is diverged from that of

  17. Constitutive, light-responsive and circadian clock-responsive factors compete for the different l box elements in plant light-regulated promoters.

    PubMed

    Borello, U; Ceccarelli, E; Giuliano, G

    1993-10-01

    The l box is a conserved regulatory motif which is found upstream of plant genes (rbcS, cab and nia) whose transcription is regulated by light and the circadian clock. Gel retardation and UV cross-linking assays were used to resolve two different groups of I box binding factors (IBFs) in tomato nuclear extracts. Active components of the first group (IBF-1) recognize the l box of the light-responsive rbcS promoter; one factor within this group, IBF-1a, also recognizes the adjacent G box, which has been shown previously to bind a different class of plant transcription factors, the G box binding factors (GBFs). To the limit of experimental resolution, IBF-1a and GBF compete for the same nucleotides on the G box. Nevertheless, these two activities are biochemically and immunologically distinct. The relative abundance of IBF-1a shows a vast decrease in dark-adapted plants. Factors in the second group (IBF-2), recognize the l box of the nia promoter, which is regulated both by light and the circadian clock; one factor within this group, IBF-2a, also binds the l box of a second promoter showing similar regulation, the cab promoter. The IBF-2a binding sites on the cab and nia promoters show extensive homology to a circadian clock-responsive promoter element from wheat. The abundance of IBF-2a is diurnally regulated and shows a dramatic induction around the onset of the light period. Transfer of the plants in continuous darkness demonstrates that this induction is under the control of a circadian clock.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8252065

  18. p53 regulates the transcription of its Delta133p53 isoform through specific response elements contained within the TP53 P2 internal promoter.

    PubMed

    Marcel, V; Vijayakumar, V; Fernández-Cuesta, L; Hafsi, H; Sagne, C; Hautefeuille, A; Olivier, M; Hainaut, P

    2010-05-01

    The tumor suppressor p53 protein is activated by genotoxic stress and regulates genes involved in senescence, apoptosis and cell-cycle arrest. Nine p53 isoforms have been described that may modulate suppressive functions of the canonical p53 protein. Among them, Delta133p53 lacks the 132 proximal residues and has been shown to modulate p53-induced apoptosis and cell-cycle arrest. Delta133p53 is expressed from a specific mRNA, p53I4, driven by an alternative promoter P2 located between intron 1 and exon 5 of TP53 gene. Here, we report that the P2 promoter is regulated in a p53-dependent manner. Delta133p53 expression is increased in response to DNA damage by doxorubicin in p53 wild-type cell lines, but not in p53-mutated cells. Chromatin immunoprecipitation and luciferase assays using P2 promoter deletion constructs indicate that p53 binds functional response elements located within the P2 promoter. We also show that Delta133p53 does not bind specifically to p53 consensus DNA sequence in vitro, but competes with wild-type p53 in specific DNA-binding assays. Finally, we report that Delta133p53 counteracts p53-dependent growth suppression in clonogenic assays. These observations indicate that Delta133p53 is a novel target of p53 that may participate in a negative feedback loop controlling p53 function. PMID:20190805

  19. Identification of a functional estrogen-responsive enhancer element in the promoter 2 of PRDM2 gene in breast cancer cell lines.

    PubMed

    Abbondanza, Ciro; De Rosa, Caterina; D'Arcangelo, Andrea; Pacifico, Marianna; Spizuoco, Clorinda; Piluso, Giulio; Di Zazzo, Erika; Gazzerro, Patrizia; Medici, Nicola; Moncharmont, Bruno; Puca, Giovanni Alfredo

    2012-03-01

    The retinoblastoma protein-interacting zinc-finger (RIZ) gene, also known as PRDM2, encodes two protein products, RIZ1 and RIZ2, differing for the presence of a 202 aa domain, called PR domain, at the N-terminus of the RIZ1 molecule. While the histone H3 K9 methyltransferase activity of RIZ1 is associated with the negative control of cell proliferation, no information is currently available on either expression regulation of the RIZ2 form or on its biological activity. RIZ proteins act as ER co-activators and promote optimal estrogen response in female reproductive tissues. In estrogen-responsive cells, 17-β estradiol modulates RIZ gene expression producing a shift in the balanced expression of the two forms. Here, we demonstrate that an estrogen-responsive element (ERE) within the RIZ promoter 2 is regulated in a ligand-specific manner by ERα, through both the AF1 and AF2 domains. The pattern of ERα binding, histone H4 acetylation, and histone H3 cyclical methylation of lysine 9 was comparable to other estrogen-regulated promoters. Association of topoisomerase IIβ with the RIZ promoter 2 confirmed the transcriptional activation induced by estrogen. We hypothesize that RIZ2, acting as a negative regulator of RIZ1 function, mediates the proliferative effect of estrogen through regulation of survival and differentiation gene expression. PMID:21503890

  20. Isolation of pig mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene promoter: characterization of a peroxisome proliferator-responsive element.

    PubMed Central

    Ortiz, J A; Mallolas, J; Nicot, C; Bofarull, J; Rodríguez, J C; Hegardt, F G; Haro, D; Marrero, P F

    1999-01-01

    Low expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene during development correlates with an unusually low hepatic ketogenic capacity and lack of hyperketonaemia in piglets. Here we report the isolation and characterization of the 5' end of the pig mitochondrial HMG-CoA synthase gene. The 581 bp region proximal to the transcription start site permits transcription of a reporter gene, confirming the function of the promoter. The pig mitochondrial HMG-CoA synthase promoter is trans-activated by the peroxisomal proliferator-activated receptor (PPAR), and a functional response element for PPAR (PPRE) has been localized in the promoter region. Pig PPRE is constituted by an imperfect direct repeat (DR-1) and a downstream sequence, both of which are needed to confer PPAR-sensitivity to a thymidine kinase promoter and to form complexes with PPAR.retinoid X receptor heterodimers. A role of PPAR trans-activation in starvation-associated induction of gene expression is suggested. PMID:9882632

  1. Sterol regulatory element binding protein-1 (SREBP-1)c promoter: Characterization and transcriptional regulation by mature SREBP-1 and liver X receptor α in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Wang, H P; Wang, H; Zhang, T Y; Tian, H B; Yao, D W; Loor, J J

    2016-02-01

    Sterol regulatory element binding protein-1 (SREBP-1) is a key transcription factor that regulates lipogenesis in rodent liver. Two isoforms (SREBP-1a and SREBP-1c) of SREBP-1 are transcribed by an alternative promoter on the same gene (SREBF1), and the isoforms differ only in their first exon. Although the regulatory effects of SREBP-1 on lipid and milk fat synthesis have received much attention in ruminants, SREBP-1c promoter and its regulatory mechanisms have not been characterized in the goat. In the present study, we cloned and sequenced a 2,012-bp fragment of the SREBP-1c 5'-flanking region from goat genomic DNA. A luciferase reporter assay revealed that SREBP-1c is transcriptionally activated by the liver X receptor α (LXRα) agonist T0901317, and is decreased by SREBP-1 small interfering (si)RNA. A 5' deletion analysis revealed a core promoter region located -395 to +1 bp upstream of the transcriptional start site (TSS). Site-directed mutagenesis of LXRα binding elements (LXRE1 and LXRE2) and sterol regulatory elements (SRE1 and SRE2) revealed that the full effects of T 4506585 require the presence of both LXRE and SRE. We also characterized a new SRE (SRE1) and demonstrated a direct role of SREBP-1 (auto-loop regulation) in maintaining its basal transcription activity. Results suggest that goat SREBP-1c gene is transcriptionally regulated by mature SREBP-1 (auto-loop circuit regulation) and LXRα in goat mammary epithelial cells. PMID:26709176

  2. Cis-element of the rice PDIL2-3 promoter is responsible for inducing the endoplasmic reticulum stress response.

    PubMed

    Takahashi, Hideyuki; Wang, Shuyi; Hayashi, Shimpei; Wakasa, Yuhya; Takaiwa, Fumio

    2014-05-01

    A protein disulfide isomerase (PDI) family oxidoreductase, PDIL2-3, is involved in endoplasmic reticulum (ER) stress responses in rice. We identified a critical cis-element required for induction of the ER stress response. The activation of PDIL2-3 in response to ER stress strongly depends on the IRE1-OsbZIP50 signaling pathway. PMID:24315532

  3. Estrogen response element and the promoter context of the human and mouse lactoferrin genes influence estrogen receptor alpha-mediated transactivation activity in mammary gland cells.

    PubMed

    Stokes, Kenya; Alston-Mills, Brenda; Teng, Christina

    2004-10-01

    A critical step in estrogen action is the recognition of estrogen responsive elements (EREs) by liganded estrogen receptor. Our current studies were designed to determine whether an extended estrogen response element half-site (ERRE) contributes to the differential estrogen responses of the human and mouse lactoferrin overlapping chicken ovalbumin upstream promoter/ERE sequences (estrogen response modules, ERMs) in the context of their natural promoters. Transient transfections of MCF-7 cells show that liganded estrogen receptor alpha (ERalpha) activates transcription of the human lactoferrin ERM fourfold higher than the mouse lactoferrin ERM in the context of their natural promoters. Since the ERRE of the human lactoferrin gene naturally occurs 18 bp upstream from the ERM and is absent in the mouse lactoferrin gene promoter, we created a chimeric mouse lactoferrin CAT reporter, which now encodes the ERRE in the identical location as in the human lactoferrin gene. The addition of the ERRE in the mouse lactoferrin gene rendered this reporter extremely responsive to estrogen stimulation. Using limited protease digestions and electrophoretic mobility shift assays, we showed that the binding and protease sensitivity of ERalpha bound to the mouse ERM with or without the ERRE, differed. Importantly, occupancy of additional nuclear receptors at the ERRE may contribute to ERalpha binding and activation. Furthermore, the presence of ERRE influences the selectivity of coactivators in liganded ERalpha-mediated transcriptional activity. When the receptor is bound to human and mouse plus genes, which contain the ERRE, steroid receptor coactivator (SRC)-2 was preferred, while SRC-1 and SRC-3 coactivators selectively enhanced the mouse lactoferrin gene activity. Moreover, peroxisome proliferator activated receptor-gamma coactivator-1 (PGC-1alpha) and PGC-1-related estrogen receptor coactivator (PERC) robustly increase the transcriptional function of ERalpha in the presence of the

  4. Functional analysis of the human annexin A5 gene promoter: a downstream DNA element and an upstream long terminal repeat regulate transcription.

    PubMed Central

    Carcedo, M T; Iglesias, J M; Bances, P; Morgan, R O; Fernandez, M P

    2001-01-01

    Human annexin A5 is a ubiquitous protein implicated in diverse signal transduction processes associated with cell growth and differentiation, and its gene regulation is an important component of this function. Promoter transcriptional activity was determined for a wide 5' portion of the human annexin A5 gene, from bp -1275 to +79 relative to the most 5' of several discrete transcription start points. Transfection experiments carried out in HeLa cells identified the segment from bp -202 to +79 as the minimal promoter conferring optimal transcriptional activity. Two canonical Sp1 sites in the immediate 5' flanking region of a CpG island were required for significant transcription. Strong repressive activity in the distal promoter region between bp -717 to -1153 was attributed to the presence of an endogenous retroviral long terminal repeat, homologous with long terminal repeat 47B. The downstream sequence from bp position +31 to +79 in untranslated exon 1 was also essential for transcription, as its deletion from any of the plasmid constructs abolished activity in transfection assays. Electrophoretic mobility-shift assays, Southwestern-blot analysis and affinity chromatography were used to identify a protein doublet of relative molecular mass 35 kDa that bound an octanucleotide palindromic sequence in exon 1. The DNA cis-element resembled an E-box, but did not bind higher molecular mass transcription factors, such as upstream stimulatory factor or activator protein 4. The discovery of a downstream element crucial for annexin A5 gene transcription, and its interaction with a potentially novel transcription factor or complex, may provide a clue to understanding the initiation of transcription by TATA-less, multiple start site promoters. PMID:11368787

  5. Oligoesculin fraction induces anti-tumor effects and promotes immune responses on B16-F10 mice melanoma.

    PubMed

    Mokdad Bzeouich, Imen; Mustapha, Nadia; Sassi, Aicha; Ghedira, Kamel; Ghoul, Mohamed; Chebil, Latifa; Luis, José; Chekir-Ghedira, Leila

    2016-08-01

    Laccase was used to enzymatically polymerize esculin. Oligoesculin fraction was obtained after ultrafiltration through a 5-kDa membrane. Several studies have been carried out to prove the effectiveness of natural substances such as immunomodulators to promote the anti-cancer activity in situ. The purpose of our report was to explore whether the anti-tumor potential of the oligoesculin fraction in vitro and in vivo is linked to its immunological mechanisms in melanoma-bearing mice. We revealed that oligoesculin fraction reduced B16-F10 proliferation and migration in vitro in a dose-related manner. Moreover, melanin synthesis and tyrosinase activity were inhibited in these melanoma cells in a concentration-dependent way. The anti-tumor potential of oligoesculin fraction was also assessed in vivo. Our results showed that intraperitoneal administration of oligoesculin fraction, at 50 mg/kg body weight (b.w.) for 21 days, reduced tumor size and weight with percentages of inhibition of 94 and 87 %, respectively. Oligoesculin fraction was effective in promoting lysosomal activity and nitric oxide (NO) production by peritoneal macrophages in tumor-implanted mice. In addition, the activities of natural killer (NK), cytotoxic T lymphocytes, and macrophages were significantly enhanced by oligoesculin fraction. These findings suggested that this polymer with its anti-tumor and immunomodulatory properties could be used for the treatment of melanoma. PMID:26960691

  6. Analysis of the zebrafish sox9b promoter: Identification of elements that recapitulate organ-specific expression of sox9b.

    PubMed

    Burns, Felipe R; Lanham, Kevin A; Xiong, Kong M; Gooding, Alex J; Peterson, Richard E; Heideman, Warren

    2016-03-10

    The SRY-related high-mobility box 9 (SOX9) gene is expressed in many different tissues. To better understand the DNA elements that control tissue-specific expression, we cloned and sequenced a 2.5 kb fragment lying 5' to the zebrafish sox9b gene transcriptional start site. Three regions of this clone contained stable secondary structures that hindered cloning, sequencing, and amplification. This segment and smaller fragmentswere inserted 5' of an EGFP reporter and transgenic fish were raised with the different reporters. Reporter expression was also observed in embryos directly injected with the constructs to transiently express the reporter. Heart expression required only a very short 5' sequence, as a 0.6 kb sox9b fragment produced reporter expression in heart in transgenic zebrafish, and transient experiments showed heart expression from a minimal sox9b promoter region containing a conserved TATA box and an EGR2 element (-74/+29 bp). Reporter expression in transgenic skeletal muscle was consistently lower than in other tissues. Jaw, brain, and notochord expression was strong with the full-length clone, but was dramatically reduced as the size of the fragment driving the reporter decreased from approximately 1.8 to 0.9 kb. The 2.5 kb region 5' of the sox9b contained 7 conserved non-coding elements (CNEs) that included putative hypoxia inducible factor 1α (HIF1α), CAAT box (CCAAT), early growth response protein 2 (EGR2), and core promoter elements. While a synthetic fragment containing all 7 CNEs produced some degree of reporter expression in muscle, jaw, heart and brain, the degree of reporter expression was considerably lower than that produced by the full length clone. These results can account for the tissue-specific expression of sox9b in the developing zebrafish. PMID:26721460

  7. Inferring regulatory elements from a whole genome. An analysis of Helicobacter pylori sigma(80) family of promoter signals.

    PubMed

    Vanet, A; Marsan, L; Labigne, A; Sagot, M F

    2000-03-24

    Helicobacter pylori is adapted to life in a unique niche, the gastric epithelium of primates. Its promoters may therefore be different from those of other bacteria. Here, we determine motifs possibly involved in the recognition of such promoter sequences by the RNA polymerase using a new motif identification method. An important feature of this method is that the motifs are sought with the least possible assumptions about what they may look like. The method starts by considering the whole genome of H. pylori and attempts to infer directly from it a description for a family of promoters. Thus, this approach differs from searching for such promoters with a previously established description. The two algorithms are based on the idea of inferring motifs by flexibly comparing words in the sequences with an external object, instead of between themselves. The first algorithm infers single motifs, the second a combination of two motifs separated from one another by strictly defined, sterically constrained distances. Besides independently finding motifs known to be present in other bacteria, such as the Shine-Dalgarno sequence and the TATA-box, this approach suggests the existence in H. pylori of a new, combined motif, TTAAGC, followed optimally 21 bp downstream by TATAAT. Between these two motifs, there is in some cases another, TTTTAA or, less frequently, a repetition of TTAAGC separated optimally from the TATA-box by 12 bp. The combined motif TTAAGCx(21+/-2)TATAAT is present with no errors immediately upstream from the only two copies of the ribosomal 23 S-5 S RNA genes in H. pylori, and with one error upstream from the only two copies of the ribosomal 16 S RNA genes. The operons of both ribosomal RNA molecules are strongly expressed, representing an encouraging sign of the pertinence of the motifs found by the algorithms. In 25 cases out of a possible 30, the combined motif is found with no more than three substitutions immediately upstream from ribosomal proteins, or

  8. Constitutive transcription of the osteocalcin gene in osteosarcoma cells is reflected by altered protein-DNA interactions at promoter regulatory elements.

    PubMed Central

    Bortell, R; Owen, T A; Shalhoub, V; Heinrichs, A; Aronow, M A; Rochette-Egly, C; Lutz, Y; Stein, J L; Lian, J B; Stein, G S

    1993-01-01

    The bone-specific osteocalcin (OC) gene is transcribed only after completion of proliferation in normal diploid calvarial-derived osteoblasts during extracellular matrix mineralization. In contrast, the OC gene is expressed constitutively in both proliferating and nonproliferating ROS 17/2.8 osteosarcoma cells. To address molecular mechanisms associated with these tumor-related modifications in transcriptional control, we examined sequence-specific interactions of transactivation factors at key basal and hormone-responsive elements in the OC gene promoter. In ROS 17/2.8 cells compared to normal diploid osteoblasts, the absence of a stringent requirement for cessation of proliferation to support both induction of OC transcription and steroid hormone-mediated transcriptional modulation is reflected by modifications in transcription factor binding at (i) the two primary basal regulatory elements, the OC box (which contains a CCAAT motif as a central core) and the TATA/glucocorticoid-responsive element domain, and (ii) the vitamin D-responsive element. Particularly striking are two forms of the vitamin D receptor complex that are present in proliferating osteoblasts and osteosarcoma cells. Both forms of the complex are sensitive to vitamin D receptor antibody and retinoic X receptor antibody. After the down-regulation of proliferation, only the lower molecular weight complex is found in normal diploid osteoblasts. Both forms of the complex are present in nonproliferating ROS 17/2.8 cells with increased representation of the complex exhibiting reduced electrophoretic mobility that is phosphorylation-dependent. Images Fig. 3 Fig. 5 Fig. 6 PMID:8460137

  9. Psoriasis mutations disrupt CARD14 autoinhibition promoting BCL10-MALT1-dependent NF-κB activation.

    PubMed

    Howes, Ashleigh; O'Sullivan, Paul A; Breyer, Felix; Ghose, Ashavari; Cao, Li; Krappmann, Daniel; Bowcock, Anne M; Ley, Steven C

    2016-06-15

    Inherited and de novo mutations in the CARD14 gene promote the development of psoriasis, an inflammatory disease of the skin. Caspase recruitment domain-containing protein 14 (CARD14) is a member of the CARMA protein family that includes the structurally related CARD11 adaptor that mediates NF-κB activation by antigen receptors. We investigated the mechanism by which CARD14 mutation in psoriasis activates NF-κB. In contrast with wild-type CARD14, CARD14(E138A) and CARD14(G117S) psoriasis mutants interacted constitutively with BCL10 and MALT1, and triggered BCL10- and MALT1-dependent activation of NF-κB in keratinocytes. These alterations disrupted the inhibitory effect of the CARD14 linker region (LR) on NF-κB activation by facilitating BCL10 binding. Therefore, psoriasis mutations activated CARD14 by a mechanism analogous to oncogenic CARD11 mutations in non-Hodgkin B cell lymphomas. CARD14(E138A) also stimulated MALT1 paracaspase activity and activated both ERK1/2 and p38α MAP kinases. Inhibition of MALT1 with mepazine reduced CARD14(E138A)-induced expression of specific psoriasis-associated transcripts in keratinocytes. Our results establish the mechanism whereby gain-of-function CARD14 variants, which induce psoriatic disease in affected individuals, activate pro-inflammatory signalling. PMID:27071417

  10. Slc10a2-null mice uncover colon cancer-promoting actions of endogenous fecal bile acids.

    PubMed

    Raufman, Jean-Pierre; Dawson, Paul A; Rao, Anuradha; Drachenberg, Cinthia B; Heath, Jonathon; Shang, Aaron C; Hu, Shien; Zhan, Min; Polli, James E; Cheng, Kunrong

    2015-10-01

    Although epidemiological evidence in humans and bile acid feeding studies in rodents implicate bile acids as tumor promoters, the role of endogenous bile acids in colon carcinogenesis remains unclear. In this study, we exploited mice deficient in the ileal apical sodium-dependent bile acid transporter (ASBT, encoded by SLC10A2) in whom fecal bile acid excretion is augmented more than 10-fold. Wild-type and Asbt-deficient (Slc10a2 (-/-) ) male mice were treated with azoxymethane (AOM) alone to examine the development of aberrant crypt foci, the earliest histological marker of colon neoplasia and a combination of AOM and dextran sulfate sodium to induce colon tumor formation. Asbt-deficient mice exhibited a 54% increase in aberrant crypt foci, and 70 and 59% increases in colon tumor number and size, respectively. Compared to littermate controls, Asbt-deficient mice had a striking, 2-fold increase in the number of colon adenocarcinomas. Consistent with previous studies demonstrating a role for muscarinic and epidermal growth factor receptor signaling in bile acid-induced colon neoplasia, increasing bile acid malabsorption was associated with M3 muscarinic and epidermal growth factor receptor expression, and activation of extracellular signal-related kinase, a key post-receptor signaling molecule. PMID:26210740

  11. A genome-wide cis-regulatory element discovery method based on promoter sequences and gene co-expression networks

    PubMed Central

    2013-01-01

    Background Deciphering cis-regulatory networks has become an attractive yet challenging task. This paper presents a simple method for cis-regulatory network discovery which aims to avoid some of the common problems of previous approaches. Results Using promoter sequences and gene expression profiles as input, rather than clustering the genes by the expression data, our method utilizes co-expression neighborhood information for each individual gene, thereby overcoming the disadvantages of current clustering based models which may miss specific information for individual genes. In addition, rather than using a motif database as an input, it implements a simple motif count table for each enumerated k-mer for each gene promoter sequence. Thus, it can be used for species where previous knowledge of cis-regulatory motifs is unknown and has the potential to discover new transcription factor binding sites. Applications on Saccharomyces cerevisiae and Arabidopsis have shown that our method has a good prediction accuracy and outperforms a phylogenetic footprinting approach. Furthermore, the top ranked gene-motif regulatory clusters are evidently functionally co-regulated, and the regulatory relationships between the motifs and the enriched biological functions can often be confirmed by literature. Conclusions Since this method is simple and gene-specific, it can be readily utilized for insufficiently studied species or flexibly used as an additional step or data source for previous transcription regulatory networks discovery models. PMID:23368633

  12. Suppression of grp78 core promoter element-mediated stress induction by the dbpA and dbpB (YB-1) cold shock domain proteins.

    PubMed Central

    Li, W W; Hsiung, Y; Wong, V; Galvin, K; Zhou, Y; Shi, Y; Lee, A S

    1997-01-01

    The highly conserved grp78 core promoter element plays an important role in the induction of grp78 under diverse stress signals. Previous studies have established a functional region in the 3' half of the core (stress-inducible change region [SICR]) which exhibits stress-inducible changes in stressed nuclei. The human transcription factor YY1 is shown to bind the SICR and transactivate the core element under stress conditions. Here we report that expression library screening with the core element has identified two new core binding proteins, YB-1 and dbpA. Both proteins belong to the Y-box family of proteins characterized by an evolutionarily conserved DNA binding motif, the cold shock domain (CSD). In contrast to YY1, which binds only double-stranded SICR, the Y-box/CSD proteins much prefer the lower strand of the SICR. The Y-box proteins can repress the inducibility of the grp78 core element mediated by treatment of cells with A23187, thapsigargin, and tunicamycin. In gel shift assays, YY1 binding to the core element is inhibited by either YB-1 or dbpA. A yeast interaction trap screen using LexA-YY1 as a bait and a HeLa cell cDNA-acid patch fusion library identified YB-1 as a YY1-interacting protein. In cotransfection experiments, the Y-box proteins antagonize the YY1-mediated enhancement of transcription directed by the grp78 core in stressed cells. Thus, the CSD proteins may be part of the stress signal transduction mechanism in the mammalian system. PMID:8972186

  13. Calspermin gene transcription is regulated by two cyclic AMP response elements contained in an alternative promoter in the calmodulin kinase IV gene.

    PubMed Central

    Sun, Z; Sassone-Corsi, P; Means, A R

    1995-01-01

    The transcript for the high-affinity Ca2+/calmodulin-binding protein calspermin is generated from the gene encoding Ca2+/calmodulin-dependent protein kinase IV only in postmeiotic germ cells during spermatogenesis. We demonstrate that this testis-specific calspermin transcript can be produced in heterologous cells by utilization of a promoter located in an intron of the calmodulin (CaM) kinase IV gene. Critical motifs within this promoter are two cyclic AMP response element (CRE)-like sequences located about -70 and -50 bp upstream of the transcriptional initiation site. Both CRE motifs are footprinted by the authentic testis-specific transcriptional activator CREM tau or by CREM tau present in adult testis nuclear extract. Whereas a 2.1-kb DNA fragment containing the calspermin promoter is inactive when transfected into NIH 3T3 cells, activity can be restored by cotransfection of CREM tau and protein kinase A or CaM kinase IV but not CaM kinase II alpha. Restoration of activity is greatly reduced by mutation of the two CRE motifs. Since CRE-like motifs have been identified in many genes uniquely expressed in postmeiotic germ cells, which contain abundant CREM tau protein, we suggest that CREM tau may function as one transcription factor responsible for the expression of postmeiotic germ cell-specific genes. PMID:7799965

  14. p53 and Cell Cycle Dependent Transcription of kinesin family member 23 (KIF23) Is Controlled Via a CHR Promoter Element Bound by DREAM and MMB Complexes

    PubMed Central

    Quaas, Marianne; Hoffmann, Saskia; Knörck, Arne; Gumhold, Catalina; Rother, Karen

    2013-01-01

    The microtubule-dependent molecular motor KIF23 (Kinesin family member 23) is one of two components of the centralspindlin complex assembled during late stages of mitosis. Formation of this complex is known as an essential step for cytokinesis. Here, we identified KIF23 as a new transcriptional target gene of the tumor suppressor protein p53. We showed that p53 reduces expression of KIF23 on the mRNA as well as the protein level in different cell types. Promoter reporter assays revealed that this repression results from downregulation of KIF23 promoter activity. CDK inhibitor p21WAF1/CIP1 was shown to be necessary to mediate p53-dependent repression. Furthermore, we identified the highly conserved cell cycle genes homology region (CHR) in the KIF23 promoter to be strictly required for p53-dependent repression as well as for cell cycle-dependent expression of KIF23. Cell cycle- and p53-dependent regulation of KIF23 appeared to be controlled by differential binding of DREAM and MMB complexes to the CHR element. With this study, we describe a new mechanism for transcriptional regulation of KIF23. Considering the strongly supporting function of KIF23 in cytokinesis, its p53-dependent repression may contribute to the prevention of uncontrolled cell growth. PMID:23650552

  15. A cis-acting element in the promoter of human ether à go-go 1 potassium channel gene mediates repression by calcitriol in human cervical cancer cells.

    PubMed

    Cázares-Ordoñez, V; González-Duarte, R J; Díaz, L; Ishizawa, M; Uno, S; Ortíz, V; Ordoñez-Sánchez, M L; Makishima, M; Larrea, F; Avila, E

    2015-02-01

    The human ether à go-go 1 potassium channel (hEAG1) is required for cell cycle progression and proliferation of cancer cells. Inhibitors of hEAG1 activity and expression represent potential therapeutic drugs in cancer. Previously, we have shown that hEAG1 expression is downregulated by calcitriol in a variety of cancer cells. Herein, we provided evidence on the regulatory mechanism involved in such repressive effect in cells derived from human cervical cancer. Our results indicate that repression by calcitriol occurs at the transcriptional level and involves a functional negative vitamin D response element (nVDRE) E-box type in the hEAG1 promoter. The described mechanism in this work implies that a protein complex formed by the vitamin D receptor-interacting repressor, the vitamin D receptor, the retinoid X receptor, and the Williams syndrome transcription factor interact with the nVDRE in the hEAG1 promoter in the absence of ligand. Interestingly, all of these transcription factors except the vitamin D receptor-interacting repressor are displaced from hEAG1 promoter in the presence of calcitriol. Our results provide novel mechanistic insights into calcitriol mode of action in repressing hEAG1 gene expression. PMID:25495694

  16. Characterization of trace elements and ions in PM 10 and PM 2.5 emitted from animal confinement buildings

    NASA Astrophysics Data System (ADS)

    Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S.

    2011-12-01

    Chemical characterization of PM emanating from animal confinement buildings can provide essential information for receptor modeling-based PM source apportionment as well as health effects assessment. In this study, PM 10 and PM 2.5 samples were collected from twelve swine (farrowing, gestation, weaning, and finishing) and six poultry (layer hen and tom turkey) confinement buildings in the U.S. Midwest and their inorganic composition, in terms of trace elements and ions, was investigated. A total of 23 species were identified and quantified, including Al, B, Ba, Ca, Co, Cr, Cu, Fe, K, Mg, Mn, Na, Ni, P, S, Si, Sr, Ti, Zn, Cl -, NO 3-, SO 42- and NH 4+. The total mass fraction of identified species was typically less than 16%. NH 4+ was detected in low contents (<1% wt.) in collected PM samples, suggesting that the majority of NH 3-N emissions were in gas form and the formation of NH 4+-containing secondary aerosols is insignificant in animal confinement buildings. Several multivariate analysis tools prevalent in ecology research were implemented for examining variability in PM inorganic compositions. Results showed that PM inorganic composition varied significantly with animal building type. Seasons had no significant effect on PM 10 and a significant but weak effect on PM 2.5 inorganic compositions. Compared to PM 10 samples, PM 2.5 samples from different types of animal confinement buildings were more similar in inorganic composition.

  17. Elemental characterization of PM10, PM2.5 and PM1 in the town of Genoa (Italy).

    PubMed

    Ariola, V; D'Alessandro, A; Lucarelli, F; Marcazzan, G; Mazzei, F; Nava, S; Garcia-Orellana, I; Prati, P; Valli, G; Vecchi, R; Zucchiatti, A

    2006-01-01

    The particulate matter (PM) concentration and composition, the PM10, PM2.5, PM1 fractions, were studied in the urban area of Genoa, a coastal town in the northwest of Italy. Two instruments, the continuous monitor TEOM and the sequential sampler PARTISOL, were operated almost continuously on the same site from July 2001 to September 2004. Samples collected by PARTISOL were weighted to obtain PM concentration and then analysed by PIXE (particle induced X-ray emission) and by ED-XRF (energy dispersion X-ray fluorescence), obtaining concentrations for elements from Na to Pb. Some of the filters used in the TEOM microbalance were analysed by ED-XRF to calculate Pb concentration values averaged over 7-30 d periods. PMID:15982708

  18. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    SciTech Connect

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia . E-mail: patrizia.mancini@uniroma1.it

    2007-05-15

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10.

  19. Identification of a novel interleukin-6 response element containing an Ets-binding site and a CRE-like site in the junB promoter.

    PubMed Central

    Nakajima, K; Kusafuka, T; Takeda, T; Fujitani, Y; Nakae, K; Hirano, T

    1993-01-01

    Interleukin-6 (IL-6) activation of the immediate-early gene junB has been shown to require both a tyrosine kinase and an unknown 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H7)-sensitive pathway. Here we report the identification and characterization of an IL-6 immediate-early response element in the junB promoter (designated JRE-IL6) in HepG2 cells. The JRE-IL6 element, located at -149 to -124, contains two DNA motifs, an Ets-binding site (EBS) (CAGGAAGC) and a CRE-like site (TGACGCGA). Functional studies using variously mutated JRE-IL6 elements showed that both motifs were necessary and sufficient for IL-6 response of the promoter. The EBS of the JRE-IL6 element (JEBS) appears to bind a protein in the Ets family or a related protein which could also form a major complex with the EBSs of the murine sarcoma virus long terminal repeat or human T-cell leukemia virus type 1 long terminal repeat. The CRE-like site appears to weakly bind multiple CREB-ATF family proteins. Despite the similarity in the structure between the JRE-IL6 element and the polyomavirus enhancer PyPEA3, composed of an EBS and an AP1-binding site and known to be activated by a variety of oncogene signals, JRE-IL6 could not be activated by activated Ha-Ras, Raf-1, or 12-O-tetradecanoylphorbol-13-acetate. We show that IL-6 activates JRE-IL6 through an H7-sensitive pathway that does not involve protein kinase C, cyclic AMP-dependent kinase, Ca(2+)- or calmodulin-dependent kinases, Ras, Raf-1, or NF-IL6 (C/EBP beta). The combination of JEBS and the CRE-like site appears to form the basis for the selective and efficient response of JRE-IL6 to IL-6 signals, but not to signals generated by activated Ha-Ras, Raf-1, or protein kinase C. Images PMID:8386318

  20. Specific binding of nuclear proteins to a bifunctional promoter element upstream of the H1/AC box of the testis-specific histone H1t gene.

    PubMed

    Wolfe, Steven A; Grimes, Sidney R

    2003-06-01

    The testis-specific histone H1t gene is transcribed exclusively in primary spermatocytes during spermatogenesis. Studies with transgenic mice show that 141 base pairs (bp) of the H1t proximal promoter accompanied with 800 bp of downstream sequence are sufficient for tissue-specific transcription. Nuclear proteins from testis and pachytene spermatocytes produce footprints spanning the region covering the repressor element (RE) from 100 to 125 nucleotides upstream of the H1t transcriptional initiation site. Only testis nuclear proteins bind to the 5'-end of the element and produce a unique, low-mobility complex in electrophoretic mobility shift assays. This testis complex is distinct from the complex formed by a repressor protein derived from several cell lines that binds to the 3'-end of the element. The testis complex band is formed when using nuclear proteins from primary spermatocytes, where the H1t gene is transcribed, and band intensity drops 70%-80% when using nuclear proteins from early spermatids, where H1t gene transcription ceases. Protein-DNA cross-linking experiments using testis nuclear proteins produce electrophoretic bands of 59, 52, and 50 kDa on SDS/PAGE gels. PMID:12606375

  1. Functional analysis of the promoter of the mitochondrial phosphate carrier human gene: identification of activator and repressor elements and their transcription factors

    PubMed Central

    2005-01-01

    The phosphate carrier (PiC) catalyses the import of phosphate into mitochondria where it is needed for ATP synthesis. We have analysed the 5′-flanking region of the human PiC gene and found that it has a single transcriptional initiation site and lacks a TATA box. Through deletion analysis of the −1213/−25 nt region, we identified an activation domain (−223/−25) and an inhibition domain (−1017/−814). The most effective promoter activity in transfected HeLa cells corresponded to the region containing putative binding sites for Sp1 (−163/−142; where Sp1 stands for stimulating protein-1) and CREB (−138/−116; where CREB stands for cAMP-response-element-binding protein). These DNA sequences were active in gel-shift assays in the presence of HeLa cell nuclear extracts or recombinant Sp1 and CREB respectively. Forskolin increased PiC promoter activity via the CREB site. Both footprinting and transfection of deletion constructs of the inhibition region (−1017/−814) showed that PiC silencer activity extends over 25 nt (−943/−919), which specifically binds two proteins present in HeLa cell nuclear extracts. These transcription factors were purified by DNA affinity, analysed by MS and identified as p54nrb/NonO (nuclear RNA binding protein) and PSF (protein-associated splicing factor). The PiC silencer region cloned in front of the ferritin promoter conferred a strong inhibition to the heterologous promoter. These findings may provide insight into control of PiC gene expression in different cell types and under different growth conditions. To our knowledge, this is the first study to analyse the regulation of the PiC gene expression in any cell. PMID:15984930

  2. The different positioning of the proximal sequence element in the Xenopus RNA polymerase II and III snRNA promoters is a key determinant which confers RNA polymerase III specificity.

    PubMed Central

    Lescure, A; Carbon, P; Krol, A

    1991-01-01

    We and others have previously described the TATA motif as a major determinant for Pol III specificity of the U6 promoter. Surprisingly, however, the data documented here show that the sole introduction of a TATA sequence into a U1 Pol II snRNA gene is not sufficient to confer Pol III transcription. Rather, this promoter element can mediate optimal Pol III transcription only if the PSE, the second promoter element, is shifted 4 bp upstream of the position it occupies in Pol II snRNA genes. As a result, the PSE-TATA-start site spacing introduced into the U1 Pol II gene is identical to that of the U6 gene and is strictly required to produce properly initiated Pol III transcripts. Thus, Pol II and Pol III PSEs, although similar in sequence, are not positionally equivalent. Competitive experiments raise the possibility that vertebrate U6 genes contain other, as yet unidentified, promoter elements. Images PMID:2011518

  3. Effective leadership, teamwork and mentoring--essential elements in promoting generational cohesion in the nursing workforce and retaining nurses.

    PubMed

    Nelsey, Lorraine; Brownie, Sonya

    2012-01-01

    Despite recent increases in nurse recruitment in Australia, the current nursing workforce is still below the predicted numbers for the future demands. The combination of an ageing workforce, high nursing staff turnover and an inability to attract and retain nurses is eroding the capacity of the health care sector to appropriately respond to the care needs of the community. Currently, the nursing workforce may have as many as four generations working together. Differences in employment needs and values, work ethics, attitudes towards authority, and professional aspirations, contribute to some of the cross-generational problems that emerge and the turnover of nursing staff. Strategies to improve the retention rates of nurses need to focus on building a cohesive workforce by utilising the strengths and skill sets that characterise different generations of nurses, and creating the conditions in which nurses across all generations feel supported and valued. The aim of this article is to explain how effective leadership, teamwork and mentoring can assist efforts to promote generational cohesion and address the decline in the number of nurses in the workforce. PMID:23362605

  4. An extracellular matrix response element in the promoter of the LpS1 genes of the sea urchin Lytechinus pictus.

    PubMed

    Seid, C A; Ramachandran, R K; George, J M; Govindarajan, V; González-Rimbau, M F; Flytzanis, C N; Tomlinson, C R

    1997-08-01

    The extracellular matrix (ECM) has been shown to play an important role in development and tissue-specific gene expression, yet the mechanism by which genes receive signals from the ECM is poorly understood. The aboral ectoderm-specific LpS1-alpha and -beta genes of Lytechinus pictus , members of the Spec gene family, provide an excellent model system to study ECM- mediated gene regulation. Disruption of the ECM by preventing collagen deposition using the lathrytic agent beta-aminopropionitrile (BAPN) inhibits LpS1 gene transcription. LpS1 transcription resumes after removal of BAPN and subsequent collagen reformation. Using a chloramphenicol acetyltransferase (CAT) reporter gene assay, we show that a 125 bp region of the LpS1-beta promoter from -108 to +17 contains an ECM response element (ECM RE). Insertion of the 125 bp region into the promoter of the metallothionein gene of L. pictus, a gene unaffected by ECM disruption, caused the fused promoter to become ECM dependent. As with the endogenous LpS1 genes, CAT activity directed by the fused LpS1-beta promoter resumed in embryos recovered from ECM disruption. A mutation in a cis -acting element called the proximal G-string, which lies in the 125 bp region, caused CAT activity levels in ECM-disrupted embryos to equal that of the wild-type LpS1-bet apromoter in ECM-intact embryos. These results suggest that the intact ECM normally transmits signals to inhibit repressor activity at the proximal G-string in aboral ectoderm cells. Consistent with these results were our findings which showed that in addition to expression in the aboral ectoderm, the proximal G-string mutation caused expression of the CAT gene in oral ectoderm cells. These studies suggested that the proximal G-string serves as a binding site for negative regulation of the LpS1 genes in oral ectoderm during development. We also examined trans -acting factors binding the proximal G-string following ECM disruption. Band shift gels revealed a predominant

  5. An extracellular matrix response element in the promoter of the LpS1 genes of the sea urchin Lytechinus pictus.

    PubMed Central

    Seid, C A; Ramachandran, R K; George, J M; Govindarajan, V; González-Rimbau, M F; Flytzanis, C N; Tomlinson, C R

    1997-01-01

    The extracellular matrix (ECM) has been shown to play an important role in development and tissue-specific gene expression, yet the mechanism by which genes receive signals from the ECM is poorly understood. The aboral ectoderm-specific LpS1-alpha and -beta genes of Lytechinus pictus , members of the Spec gene family, provide an excellent model system to study ECM- mediated gene regulation. Disruption of the ECM by preventing collagen deposition using the lathrytic agent beta-aminopropionitrile (BAPN) inhibits LpS1 gene transcription. LpS1 transcription resumes after removal of BAPN and subsequent collagen reformation. Using a chloramphenicol acetyltransferase (CAT) reporter gene assay, we show that a 125 bp region of the LpS1-beta promoter from -108 to +17 contains an ECM response element (ECM RE). Insertion of the 125 bp region into the promoter of the metallothionein gene of L. pictus, a gene unaffected by ECM disruption, caused the fused promoter to become ECM dependent. As with the endogenous LpS1 genes, CAT activity directed by the fused LpS1-beta promoter resumed in embryos recovered from ECM disruption. A mutation in a cis -acting element called the proximal G-string, which lies in the 125 bp region, caused CAT activity levels in ECM-disrupted embryos to equal that of the wild-type LpS1-bet apromoter in ECM-intact embryos. These results suggest that the intact ECM normally transmits signals to inhibit repressor activity at the proximal G-string in aboral ectoderm cells. Consistent with these results were our findings which showed that in addition to expression in the aboral ectoderm, the proximal G-string mutation caused expression of the CAT gene in oral ectoderm cells. These studies suggested that the proximal G-string serves as a binding site for negative regulation of the LpS1 genes in oral ectoderm during development. We also examined trans -acting factors binding the proximal G-string following ECM disruption. Band shift gels revealed a predominant

  6. Stress hormones promote growth of B16-F10 melanoma metastases: an interleukin 6- and glutathione-dependent mechanism

    PubMed Central

    2013-01-01

    Background Interleukin (IL)-6 (mainly of tumor origin) activates glutathione (GSH) release from hepatocytes and its interorgan transport to B16-F10 melanoma metastatic foci. We studied if this capacity to overproduce IL-6 is regulated by cancer cell-independent mechanisms. Methods Murine B16-F10 melanoma cells were cultured, transfected with red fluorescent protein, injected i.v. into syngenic C57BL/6J mice to generate lung and liver metastases, and isolated from metastatic foci using high-performance cell sorting. Stress hormones and IL-6 levels were measured by ELISA, and CRH expression in the brain by in situ hybridization. DNA binding activity of NF-κB, CREB, AP-1, and NF-IL-6 was measured using specific transcription factor assay kits. IL-6 expression was measured by RT-PCR, and silencing was achieved by transfection of anti-IL-6 small interfering RNA. GSH was determined by HPLC. Cell death analysis was distinguished using fluorescence microscopy, TUNEL labeling, and flow cytometry techniques. Statistical analyses were performed using Student’s t test. Results Plasma levels of stress-related hormones (adrenocorticotropin hormone, corticosterone, and noradrenaline) increased, following a circadian pattern and as compared to non-tumor controls, in mice bearing B16-F10 lung or liver metastases. Corticosterone and noradrenaline, at pathophysiological levels, increased expression and secretion of IL-6 in B16-F10 cells in vitro. Corticosterone- and noradrenaline-induced transcriptional up-regulation of IL-6 gene involves changes in the DNA binding activity of nuclear factor-κB, cAMP response element-binding protein, activator protein-1, and nuclear factor for IL-6. In vivo inoculation of B16-F10 cells transfected with anti-IL-6-siRNA, treatment with a glucocorticoid receptor blocker (RU-486) or with a β-adrenoceptor blocker (propranolol), increased hepatic GSH whereas decreased plasma IL-6 levels and metastatic growth. Corticosterone, but not NORA, also induced

  7. IL-3 and CSF-1 Interact to Promote Generation of CD11c+ IL-10-Producing Macrophages

    PubMed Central

    Sheng, Kuo-Ching; Herrero, Lara J.; Taylor, Adam; Hapel, Andrew J.; Mahalingam, Suresh

    2014-01-01

    Unraveling the mechanisms of hematopoiesis regulated by multiple cytokines remains a challenge in hematology. IL-3 is an allergic cytokine with the multilineage potential, while CSF-1 is produced in the steady state with restricted lineage coverage. Here, we uncovered an instructive role of CSF-1 in IL-3-mediated hematopoiesis. CSF-1 significantly promoted IL-3-driven CD11c+ cell expansion and dampened basophil and mast cell generation from C57BL/6 bone marrow. Further studies indicated that the CSF-1/CSF-1R axis contributed significantly to IL-3-induced CD11c+ cell generation through enhancing c-Fos-associated monopoiesis. CD11c+ cells induced by IL-3 or IL-3/CSF-1 were competent in cellular maturation and endocytosis. Both IL-3 and IL-3/CSF-1 cells lacked classical dendritic cell appearance and resembled macrophages in morphology. Both populations produced a high level of IL-10, in addition to IL-1, IL-6 and TNFα, in response to LPS, and were relatively poor T cell stimulators. Collectively, these findings reveal a role for CSF-1 in mediating the IL-3 hematopoietic pathway through monopoiesis, which regulates expansion of CD11c+ macrophages. PMID:24743235

  8. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium. PMID:20640386

  9. Organic and elemental carbon associated to PM10 and PM 2.5 at urban sites of northern Greece.

    PubMed

    Samara, Constantini; Voutsa, Dimitra; Kouras, Athanasios; Eleftheriadis, Kostas; Maggos, Thomas; Saraga, D; Petrakakis, M

    2014-02-01

    Organic carbon (OC) and elemental carbon (EC) concentrations, associated to PM10 and PM2.5 particle fractions, were concurrently determined during the warm and the cold months of the year (July-September 2011 and February-April 2012, respectively) at two urban sites in the city of Thessaloniki, northern Greece, an urban-traffic site (UT) and an urban-background site (UB). Concentrations at the UT site (11.3 ± 5.0 and 8.44 ± 4.08 14 μg m(-3) for OC10 and OC2.5 vs. 6.56 ± 2.14 and 5.29 ± 1.54 μg m(-3) for EC10 and EC2.5) were among the highest values reported for urban sites in European cities. Significantly lower concentrations were found at the UB site for both carbonaceous species, particularly for EC (6.62 ± 4.59 and 5.72 ± 4.36 μg m(-3) for OC10 and OC2.5 vs. 0.93 ± 0.61 and 0.69 ± 0.39 μg m(-3) for EC10 and EC2.5). Despite that, a negative UT-UB increment was frequently evidenced for OC2.5 and PM2.5 in the cold months possibly indicative of emissions from residential wood burning at the urban-background site. At both sites, cconcentrations of OC fractions were significantly higher in the cold months; on the contrary, EC fractions at the UT site were prominent in the warm season suggesting some influence from maritime emissions in the nearby harbor area. Secondary organic carbon, being estimated using the EC tracer method and seasonally minimum OC/EC ratios, was found to be an appreciable component of particle mass particularly in the cold season. The calculated secondary contributions to OC ranged between 35 and 59 % in the PM10 fraction, with relatively higher values in the PM2.5 fraction (39-61 %). The source origin of carbonaceous species was investigated by means of air parcel back trajectories, satellite fire maps, and concentration roses. A local origin was mainly concluded for OC and EC with limited possibility for long range transport of biomass (agricultural waste) burning aerosol. PMID:23979848

  10. IL-10 Promotes Neurite Outgrowth and Synapse Formation in Cultured Cortical Neurons after the Oxygen-Glucose Deprivation via JAK1/STAT3 Pathway

    PubMed Central

    Chen, Hongbin; Lin, Wei; Zhang, Yixian; Lin, Longzai; Chen, Jianhao; Zeng, Yongping; Zheng, Mouwei; Zhuang, Zezhong; Du, Houwei; Chen, Ronghua; Liu, Nan

    2016-01-01

    As a classic immunoregulatory and anti-inflammatory cytokine, interleukin-10 (IL-10) provides neuroprotection in cerebral ischemia in vivo or oxygen-glucose deprivation (OGD)-induced injury in vitro. However, it remains blurred whether IL-10 promotes neurite outgrowth and synapse formation in cultured primary cortical neurons after OGD injury. In order to evaluate its effect on neuronal apoptosis, neurite outgrowth and synapse formation, we administered IL-10 or IL-10 neutralizing antibody (IL-10NA) to cultured rat primary cortical neurons after OGD injury. We found that IL-10 treatment activated the Janus kinase 1 (JAK1)/signal transducers and activators of transcription 3 (STAT3) signaling pathway. Moreover, IL-10 attenuated OGD-induced neuronal apoptosis by down-regulating the Bax expression and up-regulating the Bcl-2 expression, facilitated neurite outgrowth by increasing the expression of Netrin-1, and promoted synapse formation in cultured primary cortical neurons after OGD injury. These effects were partly abolished by JAK1 inhibitor GLPG0634. Contrarily, IL-10NA produced opposite effects on the cultured cortical neurons after OGD injury. Taken together, our findings suggest that IL-10 not only attenuates neuronal apoptosis, but also promotes neurite outgrowth and synapse formation via the JAK1/STAT3 signaling pathway in cultured primary cortical neurons after OGD injury. PMID:27456198

  11. Rhodobacter capsulatus nifA1 Promoter: High-GC −10 Regions in High-GC Bacteria and the Basis for Their Transcription

    PubMed Central

    Richard, Cynthia L.; Tandon, Animesh; Kranz, Robert G.

    2004-01-01

    It was previously shown that the Rhodobacter capsulatus NtrC enhancer-binding protein activates the R. capsulatus housekeeping RNA polymerase but not the Escherichia coli RNA polymerase at the nifA1 promoter. We have tested the hypothesis that this activity is due to the high G+C content of the −10 sequence. A comparative analysis of R. capsulatus and other α-proteobacterial promoters with known transcription start sites suggests that the G+C content of the −10 region is higher than that for E. coli. Both in vivo and in vitro results obtained with nifA1 promoters with −10 and/or −35 variations are reported here. A major conclusion of this study is that α-proteobacteria have evolved a promiscuous sigma factor and core RNA polymerase that can transcribe promoters with high-GC −10 regions in addition to the classic E. coli Pribnow box. To facilitate studies of R. capsulatus transcription, we cloned and overexpressed all of the RNA polymerase subunits in E. coli, and these were reconstituted in vitro to form an active, recombinant R. capsulatus RNA polymerase with properties mimicking those of the natural polymerase. Thus, no additional factors from R. capsulatus are necessary for the recognition of high-GC promoters or for activation by R. capsulatus NtrC. The addition of R. capsulatus σ70 to the E. coli core RNA polymerase or the use of −10 promoter mutants did not facilitate R. capsulatus NtrC activation of the nifA1 promoter by the E. coli RNA polymerase. Thus, an additional barrier to activation by R. capsulatus NtrC exists, probably a lack of the proper R. capsulatus NtrC-E. coli RNA polymerase (protein-protein) interaction(s). PMID:14729700

  12. A tissue-specific repressor in the sea urchin embryo of Lytechinus pictus binds the distal G-string element in the LpS1-beta promoter.

    PubMed

    Seid, C A; Sater, A K; Falzone, R L; Tomlinson, C R

    1996-06-01

    LpS1 RNA transcripts and proteins are expressed exclusively in the aboral ectoderm of the embryo in the sea urchin Lytechinus pictus. We have characterized the LpS1-beta promoter to identify the cis-acting elements that may be involved in the aboral ectoderm-specific expression of the LpS1-beta gene. The distal G-string site, composed of six contiguous guanine deoxynucleotides located at -721 to -726, was analyzed. A mutation at the distal G-string caused over a two-fold increase in reporter chloramphenicol acetyltransferase gene activity and inappropriate expression of reporter green fluorescent protein in nonaboral ectoderm cells in L. pictus embryos. These results suggest that the proteins that bind the distal G-string act as a spatial repressor in the nonaboral ectoderm cells of the developing embryo. PMID:8672248

  13. The role of promoter cis-element, mRNA capping, and ROS in the repression and salt-inducible expression of AtSOT12 in Arabidopsis

    PubMed Central

    Chen, Jinhua; Wang, Bangshing; Chung, Jung-Sung; Chai, Haoxi; Liu, Chunlin; Ruan, Ying; Shi, Huazhong

    2015-01-01

    Inducible gene expression is a gene regulatory mechanism central to plant response to environmental cues. The inducible genes are often repressed under normal growth conditions while their expression levels are significantly elevated by conditions such as abiotic stresses. Induction of gene expression requires both cis-acting DNA elements and trans-acting proteins that are modulated through signal transduction pathways. Here we report several molecular events that affect salt induced expression of the Arabidopsis AtSOT12 gene. Promoter deletion analysis revealed that DNA elements residing in the 5′ UTR are required for the salt induced expression of AtSOT12. Cytosine methylation in the promoter was low and salt stress slightly increased the DNA methylation level, suggesting that DNA methylation may not contribute to AtSOT12 gene repression. Co-transcriptional processing of AtSOT12 mRNA including capping and polyadenylation site selection was also affected by salt stress. The percentage of capped mRNA increased by salt treatment, and the polyadenylation sites were significantly different before and after exposure to salt stress. The expression level of AtSOT12 under normal growth conditions was markedly higher in the oxi1 mutant defective of reactive oxygen species (ROS) signaling than in the wild type. Moreover, AtSOT12 transcript level was elevated by treatments with DPI and DMTU, two chemicals preventing ROS accumulation. These results suggest that repression of AtSOT12 expression may require physiological level of ROS and ROS signaling. PMID:26594223

  14. Effect of local and long-range transport emissions on the elemental composition of PM 10-2.5 and PM 2.5 in Beirut

    NASA Astrophysics Data System (ADS)

    Saliba, Najat A.; Kouyoumdjian, Hovig; Roumié, Mohamad

    The elemental composition of PM 10-2.5 and PM 2.5 were studied in winter, summer, stormy and non-stormy dates during a period extending from February 2004 till January 2005, in a populated area of Beirut. Results of PIXE analysis and enrichment factor (E.F.) calculation, using Si as a reference of crustal material, showed that crustal elements (E.F.<10) like Si, Ca, K, Ti, Mn and Fe were more abundant in PM 10-2.5 while enriched elements (E.F.>10) like S, Cu, Zn and Pb predominated in PM 2.5. In PM 10-2.5, concentrations of crustal elements increased during stormy episodes, all time high Ca concentrations were due to the abundance of calcite and limestone rocks in Lebanon, and increased Cl levels correlated with marine air masses. In PM 2.5, sulfur concentrations were more prominent in the summer due to the enhancement of photochemical reactions. Sources of sulfur were attributed to local, sea-water and long-range transport from Eastern Europe, with the latter being the most predominate. Anthropogenic elements like Cu and Zn were generated from worn brakes and tires in high traffic density area and spikes of Pb were directly linked to a southerly wind originated from Egypt and/or Israel as determined by the air trajectory HYSPLIT model. In brief, elemental variations depended on the regional variability of the transport pattern and the different removal rates of aerosols.

  15. A calmodulin like EF hand protein positively regulates oxalate decarboxylase expression by interacting with E-box elements of the promoter

    PubMed Central

    Kamthan, Ayushi; Kamthan, Mohan; Kumar, Avinash; Sharma, Pratima; Ansari, Sekhu; Thakur, Sarjeet Singh; Chaudhuri, Abira; Datta, Asis

    2015-01-01

    Oxalate decarboxylase (OXDC) enzyme has immense biotechnological applications due to its ability to decompose anti-nutrient oxalic acid. Flammulina velutipes, an edible wood rotting fungus responds to oxalic acid by induction of OXDC to maintain steady levels of pH and oxalate anions outside the fungal hyphae. Here, we report that upon oxalic acid induction, a calmodulin (CaM) like protein-FvCaMLP, interacts with the OXDC promoter to regulate its expression. Electrophoretic mobility shift assay showed that FvCamlp specifically binds to two non-canonical E-box elements (AACGTG) in the OXDC promoter. Moreover, substitutions of amino acids in the EF hand motifs resulted in loss of DNA binding ability of FvCamlp. F. velutipes mycelia treated with synthetic siRNAs designed against FvCaMLP showed significant reduction in FvCaMLP as well as OXDC transcript pointing towards positive nature of the regulation. FvCaMLP is different from other known EF hand proteins. It shows sequence similarity to both CaMs and myosin regulatory light chain (Cdc4), but has properties typical of a calmodulin, like binding of 45Ca2+, heat stability and Ca2+ dependent electrophoretic shift. Hence, FvCaMLP can be considered a new addition to the category of unconventional Ca2+ binding transcriptional regulators. PMID:26455820

  16. MuLV-related endogenous retroviral elements and Flt3 participate in aberrant end-joining events that promote B-cell leukemogenesis

    PubMed Central

    Johnson, Radia M.; Papp, Eniko; Grandal, Ildiko; Kowalski, Paul E.; Nutter, Lauryl; Wong, Raymond C.C.; Joseph-George, Ann M.; Danska, Jayne S.; Guidos, Cynthia J.

    2014-01-01

    During V(D)J recombination of immunoglobulin genes, p53 and nonhomologous end-joining (NHEJ) suppress aberrant rejoining of DNA double-strand breaks induced by recombinase-activating genes (Rags)-1/2, thus maintaining genomic stability and limiting malignant transformation during B-cell development. However, Rag deficiency does not prevent B-cell leukemogenesis in p53/NHEJ mutant mice, revealing that p53 and NHEJ also suppress Rag-independent mechanisms of B-cell leukemogenesis. Using several cytogenomic approaches, we identified a novel class of activating mutations in Fms-like tyrosine kinase 3 (Flt3), a receptor tyrosine kinase important for normal hematopoiesis in Rag/p53/NHEJ triple-mutant (TM) B-cell leukemias. These mutant Flt3 alleles were created by complex genomic rearrangements with Moloney leukemia virus (MuLV)-related endogenous retroviral (ERV) elements, generating ERV-Flt3 fusion genes encoding an N-terminally truncated mutant form of Flt3 (trFlt3) that was transcribed from ERV long terminal repeats. trFlt3 protein lacked most of the Flt3 extracellular domain and induced ligand-independent STAT5 phosphorylation and proliferation of hematopoietic progenitor cells. Furthermore, expression of trFlt3 in p53/NHEJ mutant hematopoietic progenitor cells promoted development of clinically aggressive B-cell leukemia. Thus, repetitive MuLV-related ERV sequences can participate in aberrant end-joining events that promote development of aggressive B-cell leukemia. PMID:24888589

  17. A sugar beet chlorophyll a/b binding protein promoter void of G-box like elements confers strong and leaf specific reporter gene expression in transgenic sugar beet

    PubMed Central

    Stahl, Dietmar J; Kloos, Dorothee U; Hehl, Reinhard

    2004-01-01

    Background Modification of leaf traits in sugar beet requires a strong leaf specific promoter. With such a promoter, expression in taproots can be avoided which may otherwise take away available energy resources for sugar accumulation. Results Suppression Subtractive Hybridization (SSH) was utilized to generate an enriched and equalized cDNA library for leaf expressed genes from sugar beet. Fourteen cDNA fragments corresponding to thirteen different genes were isolated. Northern blot analysis indicates the desired tissue specificity of these genes. The promoters for two chlorophyll a/b binding protein genes (Bvcab11 and Bvcab12) were isolated, linked to reporter genes, and transformed into sugar beet using promoter reporter gene fusions. Transient and transgenic analysis indicate that both promoters direct leaf specific gene expression. A bioinformatic analysis revealed that the Bvcab11 promoter is void of G-box like regulatory elements with a palindromic ACGT core sequence. The data indicate that the presence of a G-box element is not a prerequisite for leaf specific and light induced gene expression in sugar beet. Conclusions This work shows that SSH can be successfully employed for the identification and subsequent isolation of tissue specific sugar beet promoters. These promoters are shown to drive strong leaf specific gene expression in transgenic sugar beet. The application of these promoters for expressing resistance improving genes against foliar diseases is discussed. PMID:15579211

  18. Engagement and Nonusage Attrition With a Free Physical Activity Promotion Program: The Case of 10,000 Steps Australia

    PubMed Central

    Vandelanotte, Corneel; Kirwan, Morwenna

    2015-01-01

    Background Data from controlled trials indicate that Web-based interventions generally suffer from low engagement and high attrition. This is important because the level of exposure to intervention content is linked to intervention effectiveness. However, data from real-life Web-based behavior change interventions are scarce, especially when looking at physical activity promotion. Objective The aims of this study were to (1) examine the engagement with the freely available physical activity promotion program 10,000 Steps, (2) examine how the use of a smartphone app may be helpful in increasing engagement with the intervention and in decreasing nonusage attrition, and (3) identify sociodemographic- and engagement-related determinants of nonusage attrition. Methods Users (N=16,948) were grouped based on which platform (website, app) they logged their physical activity: Web only, app only, or Web and app. Groups were compared on sociodemographics and engagement parameters (duration of usage, number of individual and workplace challenges started, and number of physical activity log days) using ANOVA and chi-square tests. For a subsample of users that had been members for at least 3 months (n=11,651), Kaplan-Meier survival curves were estimated to plot attrition over the first 3 months after registration. A Cox regression model was used to determine predictors of nonusage attrition. Results In the overall sample, user groups differed significantly in all sociodemographics and engagement parameters. Engagement with the program was highest for Web-and-app users. In the subsample, 50.00% (5826/11,651) of users stopped logging physical activity through the program after 30 days. Cox regression showed that user group predicted nonusage attrition: Web-and-app users (hazard ratio=0.86, 95% CI 0.81-0.93, P<.001) and app-only users (hazard ratio=0.63, 95% CI 0.58-0.68, P<.001) showed a reduced attrition risk compared to Web-only users. Further, having a higher number of

  19. Dental pain among 10–15 year old children attending oral health promoting schools: A cross-sectional study

    PubMed Central

    Saheer, Abdul; Kousalya, Pallavi Swami; Raju, Rekha; Gubbihal, Radha

    2015-01-01

    Introduction: Dental pain is a major public health problem and one of the consequences of oral diseases which requires significant adjustments in life management leading to decreased quality of life. Objective: To assess prevalence of dental pain and its impact on daily life and to explore its relationship with oral health behavior and clinical oral status among 10-15 year old school children attending oral health promoting schools. Method: This cross sectional study was conducted in 6 schools serving low -middle socio economic strata in Bangalore, India. A total of 1237 children were surveyed for history of dental pain during past 3 month. Participants who reported dental pain completed self-reported oral health behaviour and Child dental pain questionnaire. Clinical oral examination included assessment of dental caries, periodontal status. Data was analyzed using t - test, Chi-square test, ANOVA and Regression Analysis. Results: Prevalence of dental pain was 15.6% (n = 194). Among children with pain, 17%, 43% and 40% reported mild, moderate and severe pain. Impact on daily activities was reported by 66%. Mean DMFT and DMFS was 1.80 and 2.11 Mean deft and defs was 2.47 and 3.41. Multiple logistic regression revealed that severity and impact of dental pain was associated with gender, frequency of tooth brushing, consumption of sweets and deciduous dental caries experience. Conclusion: Prevalence of Dental pain is associated with brushing behavior, consumption of sweets and deciduous dental caries experience, showing need for further attention to these conditions and a need to strengthen preventive and therapeutic dental services. PMID:26942112

  20. Postproliferative transcription of the rat osteocalcin gene is reflected by vitamin D-responsive developmental modifications in protein-DNA interactions at basal and enhancer promoter elements.

    PubMed Central

    Owen, T A; Bortell, R; Shalhoub, V; Heinrichs, A; Stein, J L; Stein, G S; Lian, J B

    1993-01-01

    In the osteocalcin (OC) gene promoter, both independent positive and negative regulatory elements, as well as others with contiguous [TATA/glucocorticoid-responsive elements (GRE)] or overlapping [TATA/GRE, vitamin D-responsive enhancer elements (VDRE)/AP-1, and OC box/AP-1] domains, are sites for modifications in protein-DNA interactions. In the present studies, we have examined nuclear protein extracts from fetal rat calvarial cells that undergo a developmental sequence of bone cell differentiation. Our results demonstrate modifications in protein-DNA interactions that relate to the developmental stages of the osteoblast and support developmental regulation of OC gene transcription. Basal expression of the OC gene is associated with sequence-specific protein-DNA interactions at the OC box, VDRE, and TATA/GRE box. Distinct differences are observed in proliferating osteoblasts, where the OC gene is not transcribed compared to postproliferative, differentiated osteoblasts that transcribe the OC gene. Furthermore, the protein-DNA complexes that reflect hormonal control are also developmentally regulated, mediating both the transcriptionally active and repressed states of the OC gene. For example, in proliferating osteoblasts, a vitamin D receptor-antibody-sensitive complex is formed that is different from the DNA binding complex induced by vitamin D postproliferatively when the OC gene is transcribed. Mutational analysis of the steroid hormone binding domain and the overlapping AP-1 site at the VDRE supports mutually exclusive occupancy by Fos-Jun heterodimers and vitamin D receptor. Such protein-DNA interactions at the VDRE are consistent with repression of competency for vitamin D-mediated transcriptional enhancement in proliferating osteoblasts expressing high levels of Fos and Jun. Images PMID:8381969

  1. Measurement of proton production cross sections of (sup 10)Be and (sup 26)Al from elements found in lunar rocks

    NASA Technical Reports Server (NTRS)

    Sisterson, J. M.; Kim, K.; Englert, P. A. J.; Caffee, M.; Jull, A. J. T.; Donahue, D. J.; McHargue, L.; Castaneda, C.; Vincent, J.; Reedy, R. C.

    1996-01-01

    Cosmic rays penetrate the lunar surface and interact with the lunar rocks to produce both radionuclides and stable nuclides. Production depth profiles for long-lived radionuclides produce in lunar rocks are measured using Accelerator Mass Spectrometry (AMS). For a particular radionuclide these production depth profiles can be interpreted to give an estimate for the solar proton flux over a time period characterized by the half life of the radionuclide under study. This analysis is possible if and only if all the cross sections for the interactions of all cosmic ray particles with all elements found in lunar rocks are well known. In practice, the most important cross sections needed are the proton production cross sections, because 98% of solar cosmic rays and (similar to)87% of galactic cosmic rays are protons. The cross sections for the production of long-lived radionuclides were very difficult to measure before the development of AMS and only in recent years has significant progress been made in determining these essential cross sections. Oxygen and silicon are major constituents of lunar rocks. We have reported already C-14 production cross sections from O and Si for proton energies 25-500 MeV, and O(p,x)(sup 10)Be from 58 160 MeV[6]. Here we present new measurements for the cross sections O(p,x)Be-10,O(p,x)Be-7, Si(p,x)Be-7,Si(p,x)Al-26, and Si(p,x)Na-22 from approximately 30 - 500 MeV.

  2. Association Between IL-10 Gene Promoter Polymorphisms (-592 A/C, -819 T/C, -1082 A/G) and Susceptibility to HBV Infection in an Iranian Population

    PubMed Central

    Moudi, Bita; Heidari, Zahra; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad; Metanat, Malihe; Khosravi, Soheila; Farrokh, Parisa

    2016-01-01

    Background IL-10 can play a vital role in immune response against HBV. Three biallelic SNPs from the transcription start site control the transcription of the IL-10 gene. An association between susceptibility to HBV and IL-10 polymorphisms has been suggested in patients with HBV infection. Objectives The present study was designed to study the association between polymorphisms in interleukin-10 (-1082 A/G, -819 T/C and -592 A/C) promoter gene and chronic hepatitis B virus (HBV) infection. Patients and Methods 221 chronically infected patients and 200 healthy control subjects were enrolled in the study. Three biallelic (-1082 A/G, -819 T/C and -592 A/C) polymorphisms in the IL-10 promoter gene were determined by PCR-RFLP method. Results Persistent HBV infection was associated with IL-10-1082 AG (P = 0.001) and GG (P = 0.004) genotypes and G (P = 0.000) allele. IL-10-819 T/C and -592 A/C genotype and allele frequencies did not show any correlation with the risk of chronic hepatitis B infection. Conclusions These results suggest that polymorphisms in interleukin-10 gene promoter influence clinical outcome of HBV infection and susceptibility to HBV infection. PMID:27148384

  3. PSMD10/gankyrin induces autophagy to promote tumor progression through cytoplasmic interaction with ATG7 and nuclear transactivation of ATG7 expression.

    PubMed

    Luo, Tao; Fu, Jing; Xu, An; Su, Bo; Ren, Yibing; Li, Ning; Zhu, Junjie; Zhao, Xiaofang; Dai, Rongyang; Cao, Jie; Wang, Bibo; Qin, Wenhao; Jiang, Jinhua; Li, Juan; Wu, Mengchao; Feng, Gensheng; Chen, Yao; Wang, Hongyang

    2016-08-01

    Although autophagy is most critical for survival of cancer cells, especially in fast-growing tumors, the mechanism remains to be fully characterized. Herein we report that PSMD10/gankyrin promotes autophagy in hepatocellular carcinoma (HCC) in response to starvation or stress through 2 complementary routes. PSMD10 was physically associated with ATG7 in the cytoplasm, and this association was enhanced by initial nutrient deprivation. Subsequently, PSMD10 translocated into the nucleus and bound cooperatively with nuclear HSF1 (heat shock transcription factor 1) onto the ATG7 promoter, upregulated ATG7 expression in the advanced stage of starvation. Intriguingly, the type of PSMD10-mediated autophagy was independent of the proteasome system, although PSMD10 has been believed to be an indispensable chaperone for assembly of the 26S proteasome. A significant correlation between PSMD10 expression and ATG7 levels was detected in human HCC biopsies, and the combination of these 2 parameters is a powerful predictor of poor prognosis. The median survival of sorafenib-treated HCC patients with high expression of PSMD10 was much shorter than those with low expression of PSMD10. Furthermore, PSMD10 augmented autophagic flux to resist sorafenib or conventional chemotherapy, and inhibition of autophagy suppressed PSMD10-mediated resistance. We conclude that these results present a novel mechanism involving modulation of ATG7 by PSMD10 in sustaining autophagy, promoting HCC cell survival against starvation or chemotherapy. Targeting of PSMD10 might therefore be an attractive strategy in HCC treatment by suppressing autophagy and inducing HCC cell sensitivity to drugs. PMID:25905985

  4. PSMD10/gankyrin induces autophagy to promote tumor progression through cytoplasmic interaction with ATG7 and nuclear transactivation of ATG7 expression

    PubMed Central

    Luo, Tao; Fu, Jing; Xu, An; Su, Bo; Ren, Yibing; Li, Ning; Zhu, Junjie; Zhao, Xiaofang; Dai, Rongyang; Cao, Jie; Wang, Bibo; Qin, Wenhao; Jiang, Jinhua; Li, Juan; Wu, Mengchao; Feng, Gensheng; Chen, Yao; Wang, Hongyang

    2016-01-01

    ABSTRACT Although autophagy is most critical for survival of cancer cells, especially in fast-growing tumors, the mechanism remains to be fully characterized. Herein we report that PSMD10/gankyrin promotes autophagy in hepatocellular carcinoma (HCC) in response to starvation or stress through 2 complementary routes. PSMD10 was physically associated with ATG7 in the cytoplasm, and this association was enhanced by initial nutrient deprivation. Subsequently, PSMD10 translocated into the nucleus and bound cooperatively with nuclear HSF1 (heat shock transcription factor 1) onto the ATG7 promoter, upregulated ATG7 expression in the advanced stage of starvation. Intriguingly, the type of PSMD10-mediated autophagy was independent of the proteasome system, although PSMD10 has been believed to be an indispensable chaperone for assembly of the 26S proteasome. A significant correlation between PSMD10 expression and ATG7 levels was detected in human HCC biopsies, and the combination of these 2 parameters is a powerful predictor of poor prognosis. The median survival of sorafenib-treated HCC patients with high expression of PSMD10 was much shorter than those with low expression of PSMD10. Furthermore, PSMD10 augmented autophagic flux to resist sorafenib or conventional chemotherapy, and inhibition of autophagy suppressed PSMD10-mediated resistance. We conclude that these results present a novel mechanism involving modulation of ATG7 by PSMD10 in sustaining autophagy, promoting HCC cell survival against starvation or chemotherapy. Targeting of PSMD10 might therefore be an attractive strategy in HCC treatment by suppressing autophagy and inducing HCC cell sensitivity to drugs. PMID:25905985

  5. Activation of dioxin response element (DRE)-associated genes by benzo(a)pyrene 3,6-quinone and benzo(a)pyrene 1,6-quinone in MCF-10A human mammary epithelial cells

    SciTech Connect

    Burchiel, Scott W. . E-mail: SBurchiel@salud.unm.edu; Thompson, Todd A.; Lauer, Fredine T.; Oprea, Tudor I.

    2007-06-01

    Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known as electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress-associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1), PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor-associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion.

  6. MicroRNA-10b promotes nucleus pulposus cell proliferation through RhoC-Akt pathway by targeting HOXD10 in intervetebral disc degeneration.

    PubMed

    Yu, Xin; Li, Zheng; Shen, Jianxiong; Wu, William K K; Liang, Jinqian; Weng, Xisheng; Qiu, Guixing

    2013-01-01

    Aberrant proliferation of nucleus pulposus cell is implicated in the pathogenesis of intervertebral disc degeneration. Recent findings revealed that microRNAs, a class of small noncoding RNAs, could regulate cell proliferation in many pathological conditions. Here, we showed that miR-10b was dramatically upregulated in degenerative nucleus pulposus tissues when compared with nucleus pulposus tissues isolated from patients with idiopathic scoliosis. Moreover, miR-10b levels were associated with disc degeneration grade and downregulation of HOXD10. In cultured nucleus pulposus cells, miR-10b overexpression stimulated cell proliferation with concomitant translational inhibition of HOXD10 whereas restored expression of HOXD10 reversed the mitogenic effect of miR-10b. MiR-10b-mediated downregulation of HOXD10 led to increased RhoC expression and Akt phosphorylation. Either knockdown of RhoC or inhibition of Akt abolished the effect of miR-10b on nucleus pulposus cell proliferation. Taken together, aberrant miR-10b upregulation in intervertebral disc degeneration could contribute to abnormal nucleus pulposus cell proliferation through derepressing the RhoC-Akt pathway by targeting HOXD10. Our study also underscores the potential of miR-10b and the RhoC-Akt pathway as novel therapeutic targets in intervertebral disc degeneration. PMID:24376640

  7. MicroRNA-10b Promotes Nucleus Pulposus Cell Proliferation through RhoC-Akt Pathway by Targeting HOXD10 in Intervetebral Disc Degeneration

    PubMed Central

    Shen, Jianxiong; Wu, William K. K.; Liang, Jinqian; Weng, Xisheng; Qiu, Guixing

    2013-01-01

    Aberrant proliferation of nucleus pulposus cell is implicated in the pathogenesis of intervertebral disc degeneration. Recent findings revealed that microRNAs, a class of small noncoding RNAs, could regulate cell proliferation in many pathological conditions. Here, we showed that miR-10b was dramatically upregulated in degenerative nucleus pulposus tissues when compared with nucleus pulposus tissues isolated from patients with idiopathic scoliosis. Moreover, miR-10b levels were associated with disc degeneration grade and downregulation of HOXD10. In cultured nucleus pulposus cells, miR-10b overexpression stimulated cell proliferation with concomitant translational inhibition of HOXD10 whereas restored expression of HOXD10 reversed the mitogenic effect of miR-10b. MiR-10b-mediated downregulation of HOXD10 led to increased RhoC expression and Akt phosphorylation. Either knockdown of RhoC or inhibition of Akt abolished the effect of miR-10b on nucleus pulposus cell proliferation. Taken together, aberrant miR-10b upregulation in intervertebral disc degeneration could contribute to abnormal nucleus pulposus cell proliferation through derepressing the RhoC-Akt pathway by targeting HOXD10. Our study also underscores the potential of miR-10b and the RhoC-Akt pathway as novel therapeutic targets in intervertebral disc degeneration. PMID:24376640

  8. Anthropogenic platinum group element (Pt, Pd, Rh) concentrations in PM10 and PM2.5 from Kolkata, India.

    PubMed

    Diong, Huey Ting; Das, Reshmi; Khezri, Bahareh; Srivastava, Bijayen; Wang, Xianfeng; Sikdar, Pradip K; Webster, Richard D

    2016-01-01

    This study investigates platinum group elements (PGEs) in the breathable (PM10) and respirable (PM2.5) fractions of air particulates from a heavily polluted Indian metro city. The samples were collected from traffic junctions at the heart of the city and industrial sites in the suburbs during winter and monsoon seasons of 2013-2014. PGE concentrations were determined by inductively coupled plasma-mass spectrometry (ICP-MS). The PGE concentrations in the samples from traffic junctions are within the range of 2.7-111 ng/m(3) for Pd, 0.86-12.3 ng/m(3) for Pt and 0.09-3.13 ng/m(3) for Rh, and from industrial sites are within the range of 3.12-32.3 ng/m(3) for Pd, 0.73-7.39 ng/m(3) for Pt and 0.1-0.69 ng/m(3) for Rh. Pt concentrations were lower in the monsoon compared to winter while Pd concentrations increased during monsoon and Rh stayed relatively unaffected across seasons. For all seasons and locations, concentrations of Pd > Pt > Rh, indicating dominance of Pd-containing exhaust converters. Most of the PGEs were concentrated in the PM2.5 fraction. A strong correlation (R ≥ 0.62) between the PGEs from traffic junction indicates a common emission source viz. catalytic converters, whereas a moderate to weak correlation (R ≤ 0.5) from the industrial sites indicate mixing of different sources like coal, raw materials used in the factories and automobile. A wider range of Pt/Pd, Pt/Rh and Pd/Rh ratios measured in the traffic junction possibly hint towards varying proportions of PGEs used for catalyst productions in numerous rising and established car brands. PMID:27536525

  9. Characterization of particulate, metallic elements of TSP, PM(2.5) and PM(2.5-10) aerosols at a farm sampling site in Taiwan, Taichung.

    PubMed

    Fang, Guor-Cheng; Chang, Cheng-Nan; Chu, Chia-Chium; Wu, Yuh-Shen; Fu, Peter Pi-Cheng; Yang, I-Lin; Chen, Ming-Hsiang

    2003-06-01

    Atmospheric aerosol particles and metallic concentrations were monitored at the Experimental Farm of Tunghai University (EFTU) sampling site in this study. Total suspended particulate matter (TSP) was collected by using a PS-1 sampler at the farm-sampling site, in central Taiwan, from July 2001 to April 2002. At the same time, PM(2.5) and PM(2.5-10) were also measured with a Universal sampler from January 2002 to April 2002. Only subjects with the most complete data records on TSP sampling (N=43) and PM(10) sampling (N=23) were used in this analysis. Taichung Industrial Park, Taichung Kang Road (traffic) and a Hospital Incinerator surround the Experimental Farm of Tunghai University. Atmospheric concentrations of metallic elements were analyzed by a flame atomic absorption spectrophotometer (AA-680/G). The results indicated that the metallic elements Mg, Cu and Mn were the largest components in the TSP fraction; the metallic elements Fe and Cd were the largest composition in the PM(2.5-10) fraction; however, the metallic elements Pb, Zn, Cr and Ni were the largest abundance in the PM(2.5) fraction. The atmospheric metallic elements in the TSP, PM(2.5) and PM(2.5-10) fractions came different emission sources, such as soil, traffic, industry and resuspended particles. PMID:12738209

  10. The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.

    PubMed

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y

    2013-11-01

    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. PMID:23856420

  11. The Upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia

    PubMed Central

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D.; Mansfield, Brian C.; Chou, Janice Y.

    2013-01-01

    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. PMID:23856420

  12. The CpG Island Encompassing the Promoter and First Exon of Human DNMT3L Gene Is a PcG/TrX Response Element (PRE)

    PubMed Central

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K.; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis. PMID:24743422

  13. Single-molecule studies reveal that DEAD box protein DDX1 promotes oligomerization of HIV-1 Rev on the Rev response element.

    PubMed

    Robertson-Anderson, Rae M; Wang, Jun; Edgcomb, Stephen P; Carmel, Andrew B; Williamson, James R; Millar, David P

    2011-07-29

    Oligomeric assembly of Rev on the Rev response element (RRE) is essential for the nuclear export of unspliced and singly spliced human immunodeficiency virus type 1 viral mRNA transcripts. Several host factors, including the human DEAD box protein DDX1, are also known to be required for efficient Rev function. In this study, spontaneous assembly and dissociation of individual Rev-RRE complexes in the presence or absence of DDX1 were observed in real time via single-molecule total internal reflection fluorescence microscopy. Binding of up to eight fluorescently labeled Rev monomers to a single RRE molecule was visualized, and the event frequencies and corresponding binding and dissociation rates for the different Rev-RRE stoichiometries were determined. The presence of DDX1 eliminated a second kinetic phase present during the initial Rev binding step, attributed to nonproductive nucleation events, resulting in increased occurrence of higher-order Rev-RRE stoichiometries. This effect was further enhanced upon the addition of a non-hydrolyzable ATP analog (adenylyl-imidophosphate), whereas ADP had no effect beyond that of DDX1 alone. Notably, the first three Rev monomer binding events were accelerated in the presence of DDX1 and adenylyl-imidophosphate, while the dissociation rates remained unchanged. Measurements performed across a range of DDX1 concentrations suggest that DDX1 targets Rev rather than the RRE to promote oligomeric assembly. Moreover, DDX1 is able to restore the oligomerization activity of a Rev mutant that is otherwise unable to assemble on the RRE beyond a monomeric complex. Taken together, these results suggest that DDX1 acts as a cellular cofactor by promoting oligomerization of Rev on the RRE. PMID:21763499

  14. Far upstream element-binding protein 1 (FUBP1) is a potential c-Myc regulator in esophageal squamous cell carcinoma (ESCC) and its expression promotes ESCC progression.

    PubMed

    Yang, Lei; Zhu, Jun-Ya; Zhang, Jian-Guo; Bao, Bo-Jun; Guan, Cheng-Qi; Yang, Xiao-Jing; Liu, Yan-Hua; Huang, Yue-Jiao; Ni, Run-Zhou; Ji, Li-Li

    2016-03-01

    The human far upstream element (FUSE) binding protein 1 (FUBP1) belongs to an ancient family which is required for proper regulation of the c-Myc proto-oncogene. Although c-Myc plays an important role in development of various carcinomas, the relevance of FUBP1 and their contribution to esophageal squamous cell carcinoma (ESCC) development remain unclear. In this study, we aimed to investigate the relationship between FUBP1 and c-Myc as well as their contribution to ESCC development. Western blot and immunohistochemical analyses were performed to evaluate FUBP1 expression. Coimmunoprecipitation analysis was performed to explore the correlation between FUBP1 and c-Myc in ESCC. In addition, the role of FUBP1 in ESCC proliferation was studied in ESCC cells through knocking FUBP1 down. The regulation of FUBP1 on proliferation was confirmed by Cell Counting Kit-8 (CCK-8) assay, flow cytometric assays, and clone formation assays. The expressions of FUBP1 and c-Myc were both upregulated in ESCC tissues. In addition to correlation between expression of FUBP1 and tumor grade, we also confirmed the correlation of FUBP1, c-Myc, and Ki-67 expression by twos. Moreover, upregulation of FUBP1 and c-Myc in ESCC was associated with poor survival. FUBP1 was confirmed to activate c-Myc in ESCC tissues and cells. FUBP1 was demonstrated to promote proliferation of ESCC cells. Moreover, downregulation of both FUBP1 and c-Myc was confirmed to inhibit proliferation of ESCC cells. Our results indicated that FUBP1 may potentially stimulate c-Myc expression in ESCC and its expression may promote ESCC progression. PMID:26490982

  15. Kerb and urban increment of highly time-resolved trace elements in PM10, PM2.5 and PM1.0 winter aerosol in London during ClearfLo 2012

    NASA Astrophysics Data System (ADS)

    Visser, S.; Slowik, J. G.; Furger, M.; Zotter, P.; Bukowiecki, N.; Dressler, R.; Flechsig, U.; Appel, K.; Green, D. C.; Tremper, A. H.; Young, D. E.; Williams, P. I.; Allan, J. D.; Herndon, S. C.; Williams, L. R.; Mohr, C.; Xu, L.; Ng, N. L.; Detournay, A.; Barlow, J. F.; Halios, C. H.; Fleming, Z. L.; Baltensperger, U.; Prévôt, A. S. H.

    2015-03-01

    Ambient concentrations of trace elements with 2 h time resolution were measured in PM10-2.5, PM2.5-1.0 and PM1.0-0.3 size ranges at kerbside, urban background and rural sites in London during winter 2012. Samples were collected using rotating drum impactors (RDIs) and subsequently analysed with synchrotron radiation-induced X-ray fluorescence spectrometry (SR-XRF). Quantification of kerb and urban increments (defined as kerb-to-urban and urban-to-rural concentration ratios, respectively), and assessment of diurnal and weekly variability provided insight into sources governing urban air quality and the effects of urban micro-environments on human exposure. Traffic-related elements yielded the highest kerb increments, with values in the range of 10.4 to 16.6 for SW winds (3.3-6.9 for NE) observed for elements influenced by brake wear (e.g. Cu, Sb, Ba) and 5.7 to 8.2 for SW (2.6-3.0 for NE) for other traffic-related processes (e.g. Cr, Fe, Zn). Kerb increments for these elements were highest in the PM10-2.5 mass fraction, roughly twice that of the PM1.0-0.3 fraction. These elements also showed the highest urban increments (~ 3.0), although no difference was observed between brake wear and other traffic-related elements. All elements influenced by traffic exhibited higher concentrations during morning and evening rush hours, and on weekdays compared to weekends, with the strongest trends observed at the kerbside site, and additionally enhanced by winds coming directly from the road, consistent with street canyon effects. Elements related to mineral dust (e.g. Al, Si, Ca, Sr) showed significant influences from traffic-induced resuspension, as evidenced by moderate kerb (3.4-5.4 for SW, 1.7-2.3 for NE) and urban (~ 2) increments and increased concentrations during peak traffic flow. Elements related to regional transport showed no significant enhancement at kerb or urban sites, with the exception of PM10-2.5 sea salt (factor of up to 2), which may be influenced by

  16. Identification of the tapetum/microspore-specific promoter of the pathogenesis-related 10 gene and its regulation in the anther of Lilium longiflorum.

    PubMed

    Hsu, Ssu-Wei; Liu, Ming-Che; Zen, Kuo-Chang; Wang, Co-Shine

    2014-02-01

    A tapetum/microspore-specific pathogenesis-related (PR) 10 gene was previously identified in lily (Lilium longiflorum Thunb.) anthers. In situ hybridization and RNA blot analysis indicated that the lily PR10 genes are expressed specifically and differentially in the tapetum of the anther wall and in microspores during anther development. The accumulation of PR10 transcripts was exogenously induced by gibberellic acid (GA) and was suppressed by ethylene. Studies using inhibitors of GA and ethylene revealed that the lily PR10 is modulated by an antagonistic interaction between GA and ethylene. The treatment of norbornadien, an ethylene inhibitor, caused the tapetum to become densely cytoplasmic and highly polarized, whereas uniconazole, an inhibitor of GA biosynthesis, arrested tapetal development to a status close to that of control. The expression of the lily PR10g promoter in transgenic Arabidopsis was determined using the β-glucuronidase (GUS) reporter gene indicated that the decisive fragment required for anther specificity is located -1183 bp to -880 bp upstream of the transcription start site. The PR10gPro::barnase transgenic lines exhibited complete male sterility because of the disruption of the tapetum and the deformation of microspore/pollen. The anther specificity of lily PR10 highlights the importance of the tapetum/microspore-specific PR10g promoter for future biotechnological and agricultural applications. PMID:24388523

  17. Effect of Rotating Magnetic Field (RMF) on Segregation of Solute Elements in CuNi10Fe1Mn Alloy Hollow Billet

    NASA Astrophysics Data System (ADS)

    Yan, Zhiming; Jin, Wenzhong; Li, Tingju

    2012-09-01

    The effect of rotating magnetic field (RMF) on macro/microsegregation of solute elements is investigated experimentally, and a comprehensive three-dimensional mathematical model is built, and the finite element package ANSYS® is employed to calculate the distribution of temperature and liquid fraction along the radial direction in horizontal continuous casting of CuNi10Fe1Mn alloy hollow billet. The results show that RMF makes the temperature field and liquid fraction uniform. The original inhomogeneous columnar grain macrostructure turns into homogeneous equiaxed grain structure, and the macro/microsegregation of Ni, Fe, and Mn elements are restrained effectively with the application of RMF. Moreover, the action mechanism of RMF is discussed to explain its effect on improving the distribution of solute elements.

  18. Cyclic AMP responsive element-binding protein promotes renal cell carcinoma proliferation probably via the expression of spindle and kinetochore-associated protein 2

    PubMed Central

    Zhuang, Haihui; Meng, Xiangyu; Li, Yanyuan; Wang, Xue; Huang, Shuaishuai; Liu, Kaitai; Hehir, Michael; Fang, Rong; Jiang, Lei; Zhou, Jeff X.; Wang, Ping; Ren, Yu

    2016-01-01

    Emerging evidence shows that the aberrantly expressed cyclic AMP responsive element-binding protein (CREB) is associated with tumor development and progression in several cancers. Spindle and kinetochore-associated protein 2 (SKA2) is essential for regulating the progress of mitosis. In this study, we evaluate in vitro and in vivo the functional relationship between CREB and SKA2 in renal cell carcinoma (RCC). Suppressing and replenishing CREB levels were used to manipulate SKA2 expression, observing the effects on RCC cell lines. Computational prediction and ChIP assay identified that CREB targeted ska2 by binding its CRE sequence in the human genome. Overexpression of CREB reversed the inhibited cell growth following siSKA2 treatment, and reduced the number of cells holding in mitosis. Decreased expression of CREB suppressed RCC cell growth and xenograft tumor formation, accompanied by reduced expression of SKA2. In RCC tumor samples from patients, mRNA for SKA2 were plotted near those of CREB in each sample, with significantly increased immunohistochemical staining of higher SKA2 and CREB in the higher TNM stages. The study adds evidence that CREB, a tumor oncogene, promotes RCC proliferation. It probably achieves this by increasing SKA2 expression. PMID:26824422

  19. A novel SNP in a vitamin D response element of the CYP24A1 promoter reduces protein binding, transactivation, and gene expression.

    PubMed

    Roff, Alanna; Wilson, Robin Taylor

    2008-11-01

    The active form of vitamin D (1alpha,25(OH)(2)D(3)) is known to have antiproliferative effects and has been implicated in cancers of the colon, breast, and prostate. These cancers occur more frequently among African Americans than Caucasians, and individuals with African ancestry are known to have approximately twofold lower levels of serum vitamin D (25(OH)D) compared with individuals of European ancestry. However, epidemiological studies of the vitamin D receptor (VDR) have shown inconsistent associations with cancer risk, suggesting that differences in other genes in the pathway may be important. We sought to identify functionally significant polymorphic variants in CYP24A1, a gene that is highly inducible by 1alpha,25(OH)(2)D(3) and that encodes the primary catabolic enzyme in the pathway. Here we report the identification of six novel SNPs in the human CYP24A1 promoter, including one at nucleotide -279 occurring within the distal vitamin D response element (VDRE2). Our experiments demonstrate that the VDRE2 variant results in decreased protein binding and transactivation in vitro, and reduced expression of CYP24A1 in cultured primary human lymphocytes provides evidence for an effect in vivo. This variant was only observed in our African American population, and represents a first step toward understanding differences in disease risk among racial/ethnic groups. PMID:18824104

  20. Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor. beta. 1 and by the retinoblastoma gene product

    SciTech Connect

    Pietenpol, J.A.; Stein, R.W.; Moses, H.L. ); Muenger, K.; Howley, P.M. )

    1991-11-15

    Previous studies have shown that transforming growth factor {beta}1 (TGF-{beta}1) inhibition of keratinocyte proliferation involves suppression of c-myc transcription, and indirect evidence has suggested that the retinoblastoma gene product (pRB) may be involved in this process. In this study, transient expression of pRB in skin keratinocytes was shown to repress transcription of the human c-myc promoter region was required for regulation by both TGF-{beta}1 and pRB. These sequences, termed the TGF-{beta} control element (TCE), lie between positions {minus}86 and {minus}63 relative to the P1 transcription start site. Oligonucleotides containing the TCE bound to several nuclear factors in mobility-shift assays using extracts from cells with or without normal pRB. Binding of some factors was inhibited by TGF-{beta}1 treatment of TGF-{beta}-sensitive but not TGF-{beta}-insensitive cells. These data indicate that pRB can suppress c-myc transcription and growth inhibition.

  1. Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    SciTech Connect

    Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju; Liao, Yi-Ji; Lin, Sheng; Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin; Mai, Shi-Juan; Xie, Dan

    2011-12-20

    Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  2. Activation of the rat renin promoter by HOXD10.PBX1b.PREP1, Ets-1, and the intracellular domain of notch.

    PubMed

    Pan, Li; Glenn, Sean T; Jones, Craig A; Gross, Kenneth W

    2005-05-27

    Renin gene expression is subject to complex developmental and tissue-specific regulation. A comparison of the promoter sequences of the human, rat, and mouse renin genes has revealed a highly conserved sequence homologous to the DNA recognition sequence for CBF1 (CSL/RBP-Jkappa/Su(H)/LAG1/RBPSUH). Electrophoretic mobility shift assays document that As4.1 cell nuclear protein complex binding to the putative rat renin CBF1-binding site (-175 to -168 bp) contains CBF1. Transient transfection analyses in COS-7 cells further document that a CBF1-VP16 fusion protein and the intracellular domain of Notch1 robustly activate a promoter containing multiple copies of the rat renin CBF1-binding site. An Ets-binding site (-143 to -138 bp) has also been identified in the rat renin promoter by sequence comparisons and electrophoretic mobility shift assays. Transcription factor Ets-1 is capable of activating the rat renin promoter through the Ets-binding site. Mutation of the CBF-binding site significantly increases transcriptional activity of the rat renin promoter in Calu-6 and COS-7 cells but not in As4.1 cells, whereas mutation of the Ets-binding site reduces promoter activity of the rat renin gene in all three cell lines. Finally, we show that the intracellular domain of Notch1, Ets-1, and HOXD10.PBX1b.PREP1 activate the rat renin promoter cooperatively in COS-7 cells. These results strongly suggest that the renin gene is a downstream target of the Notch signaling pathway. PMID:15792957

  3. Matrix Metalloproteinase-10 Promotes Kras-Mediated Bronchio-Alveolar Stem Cell Expansion and Lung Cancer Formation

    PubMed Central

    Regala, Roderick P.; Justilien, Verline; Walsh, Michael P.; Weems, Capella; Khoor, Andras; Murray, Nicole R.; Fields, Alan P.

    2011-01-01

    Matrix metalloproteinase 10 (MMP-10; stromelysin 2) is a member of a large family of structurally related matrix metalloproteinases, many of which have been implicated in tumor progression, invasion and metastasis. We recently identified Mmp10 as a gene that is highly induced in tumor-initiating lung bronchioalveolar stem cells (BASCs) upon activation of oncogenic Kras in a mouse model of lung adenocarcinoma. However, the potential role of Mmp10 in lung tumorigenesis has not been addressed. Here, we demonstrate that Mmp10 is overexpressed in lung tumors induced by either the smoke carcinogen urethane or oncogenic Kras. In addition, we report a significant reduction in lung tumor number and size after urethane exposure or genetic activation of oncogenic Kras in Mmp10 null (Mmp10−/−) mice. This inhibitory effect is reflected in a defect in the ability of Mmp10-deficient BASCs to expand and undergo transformation in response to urethane or oncogenic Kras in vivo and in vitro, demonstrating a role for Mmp10 in the tumor-initiating activity of Kras-transformed lung stem cells. To determine the potential relevance of MMP10 in human cancer we analyzed Mmp10 expression in publicly-available gene expression profiles of human cancers. Our analysis reveals that MMP10 is highly overexpressed in human lung tumors. Gene set enhancement analysis (GSEA) demonstrates that elevated MMP10 expression correlates with both cancer stem cell and tumor metastasis genomic signatures in human lung cancer. Finally, Mmp10 is elevated in many human tumor types suggesting a widespread role for Mmp10 in human malignancy. We conclude that Mmp10 plays an important role in lung tumor initiation via maintenance of a highly tumorigenic, cancer-initiating, stem-like cell population, and that Mmp10 expression is associated with stem-like, highly metastatic genotypes in human lung cancers. These results indicate that Mmp10 may represent a novel therapeutic approach to target lung cancer stem cells

  4. Kerb and urban increment of highly time-resolved trace elements in PM10, PM2.5 and PM1.0 winter aerosol in London during ClearfLo 2012

    NASA Astrophysics Data System (ADS)

    Visser, S.; Slowik, J. G.; Furger, M.; Zotter, P.; Bukowiecki, N.; Dressler, R.; Flechsig, U.; Appel, K.; Green, D. C.; Tremper, A. H.; Young, D. E.; Williams, P. I.; Allan, J. D.; Herndon, S. C.; Williams, L. R.; Mohr, C.; Xu, L.; Ng, N. L.; Detournay, A.; Barlow, J. F.; Halios, C. H.; Fleming, Z. L.; Baltensperger, U.; Prévôt, A. S. H.

    2014-06-01

    Ambient concentrations of trace elements with 2 h time resolution were measured in PM10-2.5, PM2.5-1.0 and PM1.0-0.3 size ranges at kerbside, urban background and rural sites in London during winter 2012. Samples were collected using rotating drum impactors (RDIs) and subsequently analysed with synchrotron radiation-induced X-ray fluorescence spectrometry (SR-XRF). Quantification of kerb and urban increments (defined as kerb-to-urban and urban-to-rural concentration ratios, respectively), and assessment of diurnal and weekly variability provided insight into sources governing urban air quality and the effects of urban micro-environments on human exposure. Traffic-related elements yielded the highest kerb increments, with values in the range of 11.6 to 18.5 for SW winds (3.6-9.4 for NE) observed for elements influenced by brake wear (e.g. Cu, Sb, Ba) and 5.6 to 8.0 for SW (2.6-6.5 for NE) for other traffic-related processes (e.g. Cr, Fe, Zn). Kerb increments for these elements were highest in the PM10-2.5 mass fraction, roughly 3 times that of the PM1.0-0.3 fraction. These elements also showed the highest urban increments (∼3.0), although no difference was observed between brake wear and other traffic-related elements. Traffic-related elements exhibited higher concentrations during morning and evening rush hour, and on weekdays compared to weekends, with the strongest trends observed at the kerbside site, and additionally enhanced by winds coming directly from the road, consistent with street canyon effects. Elements related to mineral dust (e.g. Al, Ca, Sr) showed significant influences from traffic-induced resuspension, as evidenced by moderate kerb (2.0-4.1 for SW, 1.4-2.1 for NE) and urban (1.7-2.3) increments and increased concentrations during peak traffic flow. Elements related to regional transport showed no significant enhancement at kerb or urban sites, with the exception of PM10-2.5 sea salt (factor of 1.5-2.0), which may be influenced by traffic

  5. Uranyl mediated photofootprinting reveals strong E. coli RNA polymerase--DNA backbone contacts in the +10 region of the DeoP1 promoter open complex.

    PubMed Central

    Jeppesen, C; Nielsen, P E

    1989-01-01

    Employing a newly developed uranyl photofootprinting technique (Nielsen et al. (1988) FEBS Lett. 235, 122), we have analyzed the structure of the E. coli RNA polymerase deoP1 promoter open complex. The results show strong polymerase DNA backbone contacts in the -40, -10, and most notably in the +10 region. These results suggest that unwinding of the -12 to +3 region of the promoter in the open complex is mediated through polymerase DNA backbone contacts on both sides of this region. The pattern of bases that are hyperreactive towards KMnO4 or uranyl within the -12 to +3 region furthermore argues against a model in which this region is simply unwound and/or single stranded. The results indicate specific protein contacts and/or a fixed DNA conformation within the -12 to +3 region. Images PMID:2503811

  6. Selective catalytic reduction of sulfur dioxide to elemental sulfur. Quarterly technical progress report No. 10, October 1994--December 1994

    SciTech Connect

    Liu, W.; Flytzani-Stephanopoulos, M.; Sarofim, A.F.

    1995-03-01

    Elemental sulfur recovery from SO{sub 2}-containing gas stream is highly attractive as it produces a salable product and no waste. However, commercially available schemes are complex and involve multi-stage reactors, such as, most notably in the Resox (reduction of SO{sub 2} with coke) and Claus plant (reaction of SO{sub 2} with H{sub 2}S over catalyst). This project will investigate a cerium oxide catalyst for the single stage selective reduction of SO{sub 2} to elemental sulfur by a reductant, such as carbon monoxide. Cerium oxide has been identified in recent work at MIT as a superior catalyst for SO{sub 2} reduction by CO to elemental sulfur because its high activity and high selectivity to sulfur over COS over a wide temperature range (400-650{degrees}C). The detailed kinetic and parametric studies of SO{sub 2} reduction planned in this work over various CeO{sub 2}-formulations will provide the necessary basis for development of a very simplified process, namely that of a single-stage elemental sulfur recovery scheme from variable concentration gas streams. The potential cost- and energy-efficiency benefits from this approach cannot be overstated. A first apparent application is treatment of a regenerator off-gases in power plants using regenerative flue gas desulfurization. Such a simple catalytic converter may offer the long-sought {open_quotes}Claus-alternative{close_quotes} for coal-fired power plant applications.

  7. Hepatic and renal concentrations of 10 trace elements in crocodiles (Crocodylus niloticus) in the Kafue and Luangwa rivers in Zambia.

    PubMed

    Almli, Bjørn; Mwase, Maxwell; Sivertsen, Tore; Musonda, Mike M; Flåøyen, Arne

    2005-01-20

    Hepatic and renal concentrations of the elements arsenic, cadmium, cobalt, copper, lead, manganese, mercury, molybdenum, selenium and zinc were determined in samples collected from four crocodiles from the Kafue River, Kafue National Park and five crocodiles from the Luangwa River, Luangwa National Park, Zambia. The concentrations of the essential elements were similar to those reported in other vertebrates. Arsenic and cadmium concentrations were low (medians below 0.05 microg As/g and below 0.16 microg Cd/g, wet wt.). Mercury and lead concentrations were several orders of magnitude higher (medians up to 3.7 microg Hg/g, and up to 8.7 microg Pb/g, all wet wt.) than in hippopotami from the same rivers, probably as a result of food-chain biomagnification. Judging by the results obtained in this study, pollution from the mining activity around the Kafue River drainage area in the Copperbelt region has not significantly influenced the trace element concentrations in tissues of the crocodiles in the Kafue National Park. The trace element concentrations measured may serve as reference values in future studies on crocodilians. PMID:15626380

  8. Best Short Stories. Middle Level. 10 Stories for Young Adults--With Lessons for Teaching the Basic Elements of Literature.

    ERIC Educational Resources Information Center

    Harris, Raymond

    This workbook contains ten short stories by modern masters aimed at young adult readers, with each story followed by a concise lesson on a basic element of literature (such as plot, setting, or mood) clearly illustrated in the story. Some of the authors represented in the book are John Updike, Isaac Bashevis Singer, Carson McCullers, and Ray…

  9. Net-b, a Ras-insensitive factor that forms ternary complexes with serum response factor on the serum response element of the fos promoter.

    PubMed

    Giovane, A; Sobieszczuk, P; Ayadi, A; Maira, S M; Wasylyk, B

    1997-10-01

    The Ras signalling pathway targets transcription factors such as the ternary complex factors that are recruited by the serum response factor to form complexes on the serum response element (SRE) of the fos promoter. We have identified a new ternary complex factor, Net-b. We report the features of the net gene and show that it produces several splice variants, net-b and net-c. net-b RNA and protein are expressed in a variety of tissues and cell lines. net-c RNA is expressed at low levels, and the protein was not detected, raising the possibility that it is a cryptic splice variant. We have studied the composition of ternary complexes that form on the SRE of the fos promoter with extracts from fibroblasts (NIH 3T3) cultured under various conditions and pre-B cells (70Z/3) before and after differentiation with lipopolysaccharide (LPS). The fibroblast complexes contain mainly Net-b followed by Sap1 and Elk1. Net-b complexes, as well as Sap1 and Elk1, are induced by epidermal growth factor (EGF) stimulation of cells cultured in low serum. Pre-B-cell complexes contain mainly Sap1, with less of Net-b and little of Elk1. There is little change upon LPS-induced differentiation compared to the increase with EGF in fibroblasts. We have also found that Net-b is a nuclear protein that constitutively represses transcription. Net-b is not activated by Ras signalling, in contrast to Net, Sap1a, and Elk1. We have previously reported that down-regulation of Net proteins with antisense RNA increases SRE activity. The increase in SRE activity is observed at low serum levels and is even greater after serum stimulation, showing that the SRE is under negative regulation by Net proteins and the level of repression increases during induction. Net-b, the predominant factor in ternary complexes in fibroblasts, may both keep the activity of the SRE low in the absence of strong inducing conditions and rapidly shut the activity off after stimulation. PMID:9315625

  10. Net-b, a Ras-insensitive factor that forms ternary complexes with serum response factor on the serum response element of the fos promoter.

    PubMed Central

    Giovane, A; Sobieszczuk, P; Ayadi, A; Maira, S M; Wasylyk, B

    1997-01-01

    The Ras signalling pathway targets transcription factors such as the ternary complex factors that are recruited by the serum response factor to form complexes on the serum response element (SRE) of the fos promoter. We have identified a new ternary complex factor, Net-b. We report the features of the net gene and show that it produces several splice variants, net-b and net-c. net-b RNA and protein are expressed in a variety of tissues and cell lines. net-c RNA is expressed at low levels, and the protein was not detected, raising the possibility that it is a cryptic splice variant. We have studied the composition of ternary complexes that form on the SRE of the fos promoter with extracts from fibroblasts (NIH 3T3) cultured under various conditions and pre-B cells (70Z/3) before and after differentiation with lipopolysaccharide (LPS). The fibroblast complexes contain mainly Net-b followed by Sap1 and Elk1. Net-b complexes, as well as Sap1 and Elk1, are induced by epidermal growth factor (EGF) stimulation of cells cultured in low serum. Pre-B-cell complexes contain mainly Sap1, with less of Net-b and little of Elk1. There is little change upon LPS-induced differentiation compared to the increase with EGF in fibroblasts. We have also found that Net-b is a nuclear protein that constitutively represses transcription. Net-b is not activated by Ras signalling, in contrast to Net, Sap1a, and Elk1. We have previously reported that down-regulation of Net proteins with antisense RNA increases SRE activity. The increase in SRE activity is observed at low serum levels and is even greater after serum stimulation, showing that the SRE is under negative regulation by Net proteins and the level of repression increases during induction. Net-b, the predominant factor in ternary complexes in fibroblasts, may both keep the activity of the SRE low in the absence of strong inducing conditions and rapidly shut the activity off after stimulation. PMID:9315625

  11. A ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies.

    PubMed

    Grefen, Christopher; Donald, Naomi; Hashimoto, Kenji; Kudla, Jörg; Schumacher, Karin; Blatt, Michael R

    2010-10-01

    Fluorescent tagging of proteins and confocal imaging techniques have become methods of choice in analysing the distributions and dynamic characteristics of proteins at the subcellular level. In common use are a number of strategies for transient expression that greatly reduce the preparation time in advance of imaging, but their applications are limited in success outside a few tractable species and tissues. We previously developed a simple method to transiently express fluorescently-tagged proteins in Arabidopsis root epidermis and root hairs. We describe here a set of Gateway-compatable vectors with fluorescent tags incorporating the ubiqutin-10 gene promoter (P(UBQ10) ) of Arabidopsis that gives prolonged expression of the fluorescently-tagged proteins, both in tobacco and Arabidopsis tissues, after transient transformation, and is equally useful in generating stably transformed lines. As a proof of principle, we carried out transformations with fluorescent markers for the integral plasma membrane protein SYP121, a member of the SNARE family of vesicle-trafficking proteins, and for DHAR1, a cytosolic protein that facilitates the scavenging of reactive oxygen species. We also carried out transformations with SYP121 and its interacting partner, the KC1 K(+) channel, to demonstrate the utility of the methods in bimolecular fluorescence complementation (BiFC). Transient transformations of Arabidopsis using Agrobacterium co-cultivation methods yielded expression in all epidermal cells, including root hairs and guard cells. Comparative studies showed that the P(UBQ10) promoter gives similar levels of expression to that driven by the native SYP121 promoter, faithfully reproducing the characteristics of protein distributions at the subcellular level. Unlike the 35S-driven construct, expression under the P(UBQ10) promoter remained elevated for periods in excess of 2 weeks after transient transformation. This toolbox of vectors and fluorescent tags promises significant

  12. Cyprinid Herpesvirus 3 Il10 Inhibits Inflammatory Activities of Carp Macrophages and Promotes Proliferation of Igm+ B Cells and Memory T Cells in a Manner Similar to Carp Il10.

    PubMed

    Piazzon, M Carla; Wentzel, Annelieke S; Tijhaar, Edwin J; Rakus, Krzysztof Ł; Vanderplasschen, Alain; Wiegertjes, Geert F; Forlenza, Maria

    2015-10-15

    Cyprinid herpesvirus 3 (CyHV-3) is the causative agent of a lethal disease of carp and encodes for an Il10 homolog (ORF134). Our previous studies with a recombinant ORF134-deleted strain and the derived revertant strain suggested that cyprinid herpesvirus 3 Il10 (CyHV-3 Il10 [cyhv3Il10]) is not essential for viral replication in vitro, or virulence in vivo. In apparent contrast, cyhv3Il10 is one of the most abundant proteins of the CyHV-3 secretome and is structurally very similar to carp Il10 and also human IL10. To date, studies addressing the biological activity of cyhv3Il10 on cells of its natural host have not been performed. To address the apparent contradiction between the presence of a structurally conserved Il10 homolog in the genome of CyHV-3 and the lack of a clear phenotype in vivo using recombinant cyhv3Il10-deleted viruses, we used an in vitro approach to investigate in detail whether cyhv3Il10 exerts any biological activity on carp cells. In this study, we provide direct evidence that cyhv3Il10 is biologically active and, similarly to carp Il10, signals via a conserved Stat3 pathway modulating immune cells of its natural host, carp. In vitro, cyhv3Il10 deactivates phagocytes with a prominent effect on macrophages, while also promoting proliferation of Igm(+) B cells and memory T cells. Collectively, this study demonstrates a clear biological activity of cyhv3Il10 on cells of its natural host and indicates that cyhv3Il10 is a true viral ortholog of carp Il10. Furthermore, to our knowledge, this is the first report on biological activities of a nonmammalian viral Il10 homolog. PMID:26371255

  13. CHCHD10 mutations promote loss of mitochondrial cristae junctions with impaired mitochondrial genome maintenance and inhibition of apoptosis.

    PubMed

    Genin, Emmanuelle C; Plutino, Morgane; Bannwarth, Sylvie; Villa, Elodie; Cisneros-Barroso, Eugenia; Roy, Madhuparna; Ortega-Vila, Bernardo; Fragaki, Konstantina; Lespinasse, Françoise; Pinero-Martos, Estefania; Augé, Gaëlle; Moore, David; Burté, Florence; Lacas-Gervais, Sandra; Kageyama, Yusuke; Itoh, Kie; Yu-Wai-Man, Patrick; Sesaki, Hiromi; Ricci, Jean-Ehrland; Vives-Bauza, Cristofol; Paquis-Flucklinger, Véronique

    2016-01-01

    CHCHD10-related diseases include mitochondrial DNA instability disorder, frontotemporal dementia-amyotrophic lateral sclerosis (FTD-ALS) clinical spectrum, late-onset spinal motor neuropathy (SMAJ), and Charcot-Marie-Tooth disease type 2 (CMT2). Here, we show that CHCHD10 resides with mitofilin, CHCHD3 and CHCHD6 within the "mitochondrial contact site and cristae organizing system" (MICOS) complex. CHCHD10 mutations lead to MICOS complex disassembly and loss of mitochondrial cristae with a decrease in nucleoid number and nucleoid disorganization. Repair of the mitochondrial genome after oxidative stress is impaired in CHCHD10 mutant fibroblasts and this likely explains the accumulation of deleted mtDNA molecules in patient muscle. CHCHD10 mutant fibroblasts are not defective in the delivery of mitochondria to lysosomes suggesting that impaired mitophagy does not contribute to mtDNA instability. Interestingly, the expression of CHCHD10 mutant alleles inhibits apoptosis by preventing cytochrome c release. PMID:26666268

  14. GTP Hydrolysis of TC10 Promotes Neurite Outgrowth through Exocytic Fusion of Rab11- and L1-Containing Vesicles by Releasing Exocyst Component Exo70

    PubMed Central

    Fujita, Akane; Koinuma, Shingo; Yasuda, Sayaka; Nagai, Hiroyuki; Kamiguchi, Hiroyuki; Wada, Naoyuki; Nakamura, Takeshi

    2013-01-01

    The use of exocytosis for membrane expansion at nerve growth cones is critical for neurite outgrowth. TC10 is a Rho family GTPase that is essential for specific types of vesicular trafficking to the plasma membrane. Recent studies have shown that TC10 and its effector Exo70, a component of the exocyst tethering complex, contribute to neurite outgrowth. However, the molecular mechanisms of the neuritogenesis-promoting functions of TC10 remain to be established. Here, we propose that GTP hydrolysis of vesicular TC10 near the plasma membrane promotes neurite outgrowth by accelerating vesicle fusion by releasing Exo70. Using Förster resonance energy transfer (FRET)-based biosensors, we show that TC10 activity at the plasma membrane decreased at extending growth cones in hippocampal neurons and nerve growth factor (NGF)-treated PC12 cells. In neuronal cells, TC10 activity at vesicles was higher than its activity at the plasma membrane, and TC10-positive vesicles were found to fuse to the plasma membrane in NGF-treated PC12 cells. Therefore, activity of TC10 at vesicles is presumed to be inactivated near the plasma membrane during neuronal exocytosis. Our model is supported by functional evidence that constitutively active TC10 could not rescue decrease in NGF-induced neurite outgrowth induced by TC10 depletion. Furthermore, TC10 knockdown experiments and colocalization analyses confirmed the involvement of Exo70 in TC10-mediated trafficking in neuronal cells. TC10 frequently resided on vesicles containing Rab11, which is a key regulator of recycling pathways and implicated in neurite outgrowth. In growth cones, most of the vesicles containing the cell adhesion molecule L1 had TC10. Exocytosis of Rab11- and L1-positive vesicles may play a central role in TC10-mediated neurite outgrowth. The combination of this study and our previous work on the role of TC10 in EGF-induced exocytosis in HeLa cells suggests that the signaling machinery containing TC10 proposed here may be

  15. Monocyte- and Neutrophil-Derived CXCL10 Impairs Efficient Control of Blood-Stage Malaria Infection and Promotes Severe Disease.

    PubMed

    Ioannidis, Lisa J; Nie, Catherine Q; Ly, Ann; Ryg-Cornejo, Victoria; Chiu, Chris Y; Hansen, Diana S

    2016-02-01

    CXCL10, or IFN-γ-inducible protein 10, is a biomarker associated with increased risk for Plasmodium falciparum-mediated cerebral malaria (CM). Consistent with this, we have previously shown that CXCL10 neutralization or genetic deletion alleviates brain intravascular inflammation and protects Plasmodium berghei ANKA-infected mice from CM. In addition to organ-specific effects, the absence of CXCL10 during infection was also found to reduce parasite biomass. To identify the cellular sources of CXCL10 responsible for these processes, we irradiated and reconstituted wild-type (WT) and CXCL10(-/-) mice with bone marrow from either WT or CXCL10(-/-) mice. Similar to CXCL10(-/-) mice, chimeras unable to express CXCL10 in hematopoietic-derived cells controlled infection more efficiently than WT controls. In contrast, expression of CXCL10 in knockout mice reconstituted with WT bone marrow resulted in high parasite biomass levels, higher brain parasite and leukocyte sequestration rates, and increased susceptibility to CM. Neutrophils and inflammatory monocytes were identified as the main cellular sources of CXCL10 responsible for the induction of these processes. The improved control of parasitemia observed in the absence of CXCL10-mediated trafficking was associated with a preferential accumulation of CXCR3(+)CD4(+) T follicular helper cells in the spleen and enhanced Ab responses to infection. These results are consistent with the notion that some inflammatory responses elicited in response to malaria infection contribute to the development of high parasite densities involved in the induction of severe disease in target organs. PMID:26718341

  16. Chicken ovalbumin upstream promoter-transcription factor interacts with estrogen receptor, binds to estrogen response elements and half-sites, and inhibits estrogen-induced gene expression.

    PubMed

    Klinge, C M; Silver, B F; Driscoll, M D; Sathya, G; Bambara, R A; Hilf, R

    1997-12-12

    Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) was identified as a low abundance protein in bovine uterus that co-purified with estrogen receptor (ER) in a ligand-independent manner and was separated from the ER by its lower retention on estrogen response element (ERE)-Sepharose. In gel mobility shift assays, COUP-TF bound as an apparent dimer to ERE and ERE half-sites. COUP-TF bound to an ERE half-site with high affinity, Kd = 1.24 nM. In contrast, ER did not bind a single ERE half-site. None of the class II nuclear receptors analyzed, i.e. retinoic acid receptor, retinoid X receptor, thyroid receptor, peroxisome proliferator-activated receptor, or vitamin D receptor, were constituents of the COUP-TF.DNA binding complex detected in gel mobility shift assays. Direct interaction of COUP-TF with ER was indicated by GST "pull-down" and co-immunoprecipitation assays. The nature of the ER ligand influenced COUP-TF-ERE half-site binding. When ER was liganded by the antiestrogen 4-hydroxytamoxifen (4-OHT), COUP-TF-half-site interaction decreased. Conversely, COUP-TF transcribed and translated in vitro enhanced the ERE binding of purified estradiol (E2)-liganded ER but not 4-OHT-liganded ER. Co-transfection of ER-expressing MCF-7 human breast cancer cells with an expression vector for COUP-TFI resulted in a dose-dependent inhibition of E2-induced expression of a luciferase reporter gene under the control of three tandem copies of EREc38. The ability of COUP-TF to bind specifically to EREs and half-sites, to interact with ER, and to inhibit E2-induced gene expression suggests COUP-TF regulates ER action by both direct DNA binding competition and through protein-protein interactions. PMID:9395481

  17. Spatial/Temporal Variations of Elemental Carbon, Organic Carbon, and Trace Elements in PM10 and the Impact of Land-Use Patterns on Community Air Pollution in Paterson, NJ

    PubMed Central

    Yu, Chang Ho; Fan, Zhi-Hua; Meng, Qingyu; Zhu, Xianlei; Korn, Leo; Bonanno, Linda J.

    2014-01-01

    An urban community PM10 (particulate matter ≤ 10 μm in aerodynamic diameter) air pollution study was conducted in Paterson, NJ, a mixed land-use community that is interspersed with industrial, commercial, mobile, and residential land-use types. This paper examines (1) the spatial/temporal variation of PM10, elemental carbon (EC), organic carbon (OC), and nine elements; and (2) the impact of land-use type on those variations. Air samples were collected from three community-oriented locations in Paterson that attempted to capture industrial, commercial, and mobile source-dominated emissions. Sampling was conducted for 24 hr every 6 days from November 2005 through December 2006. Samples were concurrently collected at the New Jersey Department of Environmental Protection-designated air toxics background site in Chester, NJ. PM10 mass, EC, OC, and nine elements (Ca, Cu, Fe, Pb, Mn, Ni, S, Ti, and Zn) that had more than 50% of samples above detection and known sources or are toxic were selected for spatial/temporal analysis in this study. The concentrations of PM10, EC, OC, and eight elements (except S) were significantly higher in Paterson than in Chester (P < 0.05). The concentrations of these elements measured in Paterson were also found to be higher during winter than the other three seasons (except S), and higher on weekdays than on weekends (except Pb). The concentrations of EC, Cu, Fe, and Zn at the commercial site in Paterson were significantly higher than the industrial and mobile sites; however, the other eight species were not significantly different within the city (P > 0.05). These results indicated that anthropogenic sources of air pollution were present in Paterson. The source apportionment confirmed the impact of vehicular and industrial emissions on the PM10 ambient air pollution in Paterson. The multiple linear regression analysis showed that categorical land-use type was a significant predictor for all air pollution levels, explaining up to 42% of

  18. Mass concentration and elemental composition of indoor PM 2.5 and PM 10 in University rooms in Thessaloniki, northern Greece

    NASA Astrophysics Data System (ADS)

    Gemenetzis, Panagiotis; Moussas, Panagiotis; Arditsoglou, Anastasia; Samara, Constantini

    The mass concentration and the elemental composition of PM 2.5 and PM 10 were measured in 40 rooms (mainly offices or mixed office-lab rooms, and photocopying places) of the Aristotle University of Thessaloniki, northern Greece. A total of 27 major, minor and trace elements were determined by ED-XRF analysis. The PM 2.5/PM 10 concentration ratios averaged 0.8±0.2, while the corresponding elemental ratios ranged between 0.4±0.2 and 0.9±0.2. The concentrations of PM 2.5 and PM 10 were significantly higher (by 70% and 50%, respectively) in the smokers' rooms compared to the non-smokers' places. The total elemental concentrations were also higher in the smokers' rooms (11.5 vs 8.2 μg m -3 for PM 2.5, and 10.3 vs 7.6 μg m -3 for PM 2.5-10). Fine particle concentrations (PM 2.5) were found to be quite proportional to smoking strength. On the contrary, the two environments exhibited similar coarse (PM 2.5-10) particle fractions not related to the number of cigarettes smoked. A slight decrease of particle concentrations with increasing the floor level was also observed, particularly for PM 2.5, suggesting that high-level floors are less impacted by near ground-level sources like traffic emissions. Finally, the removal efficiency of air purification systems was evaluated.

  19. CCR10 regulates balanced maintenance and function of resident regulatory and effector T cells to promote immune homeostasis in skin

    PubMed Central

    Xia, Mingcan; Hu, Shaomin; Fu, Yaoyao; Jin, Wensen; Yi, Qiyi; Matsui, Yurika; Yang, Jie; McDowell, Mary Ann; Sarkar, Surojit; Kalia, Vandana; Xiong, Na

    2014-01-01

    Background CCR10 and CCL27 are the most skin-specific chemokine receptor/ligand pair implicated in skin allergy and inflammatory diseases including atopic dermatitis and psoriasis. This pair is thought to regulate migration and/or maintenance of skin T cells and suggested as therapeutic targets for treatment of skin diseases. However, the functional importance of CCR10/CCL27 in vivo remains elusive. Objective We sought to determine expression and function of CCR10 in different subsets of skin T cells under both homeostatic and inflammatory conditions to gain a mechanistic insight into potential roles of CCR10 during skin inflammation. Methods Using heterozygous and homozygous CCR10-knockout/EGFP-knockin mice, we assessed expression of CCR10 on regulatory and effector T cells of healthy and inflamed skin induced by chemicals, pathogens and auto-reactive T cells. In addition, we assessed the effect of CCR10-knockout on the maintenance and functions of different T cells and inflammatory status in the skin during different phases of the immune response. Results CCR10 expression is preferentially induced on memory-like skin-resident T cells and their progenitors for their maintenance in homeostatic skin but not expressed on most skin-infiltrating effector T cells during inflammation. In CCR10-knockout mice, the imbalanced presence and dysregulated function of resident regulatory and effector T cells result in over-reactive and prolonged innate and memory responses in the skin, leading to increased clearance of Leishmamia infection in the skin. Conclusion CCR10 is a critical regulator of skin immune homeostasis. PMID:24767879

  20. NAD+ regulates Treg cell fate and promotes allograft survival via a systemic IL-10 production that is CD4+ CD25+ Foxp3+ T cells independent

    PubMed Central

    Elkhal, Abdallah; Rodriguez Cetina Biefer, Hector; Heinbokel, Timm; Uehara, Hirofumi; Quante, Markus; Seyda, Midas; Schuitenmaker, Jeroen M.; Krenzien, Felix; Camacho, Virginia; de la Fuente, Miguel A.; Ghiran, Ionita; Tullius, Stefan G.

    2016-01-01

    CD4+ CD25+ Foxp3+ Tregs have been shown to play a central role in immune homeostasis while preventing from fatal inflammatory responses, while Th17 cells have traditionally been recognized as pro-inflammatory mediators implicated in a myriad of diseases. Studies have shown the potential of Tregs to convert into Th17 cells, and Th17 cells into Tregs. Increasing evidence have pointed out CD25 as a key molecule during this transdifferentiation process, however molecules that allow such development remain unknown. Here, we investigated the impact of NAD+ on the fate of CD4+ CD25+ Foxp3+ Tregs in-depth, dissected their transcriptional signature profile and explored mechanisms underlying their conversion into IL-17A producing cells. Our results demonstrate that NAD+ promotes Treg conversion into Th17 cells in vitro and in vivo via CD25 cell surface marker. Despite the reduced number of Tregs, known to promote homeostasis, and an increased number of pro-inflammatory Th17 cells, NAD+ was able to promote an impressive allograft survival through a robust systemic IL-10 production that was CD4+ CD25+ Foxp3+ independent. Collectively, our study unravels a novel immunoregulatory mechanism of NAD+ that regulates Tregs fate while promoting allograft survival that may have clinical applications in alloimmunity and in a wide spectrum of inflammatory conditions. PMID:26928119

  1. Acceptability of condom promotion and distribution among 10–19 year-old adolescents in Mpwapwa and Mbeya rural districts, Tanzania

    PubMed Central

    2012-01-01

    Background The HIV/AIDS pandemic remains a leading challenge for global health. Although condoms are acknowledged for their key role on preventing HIV transmission, low and inappropriate use of condoms persists in Tanzania and elsewhere in Africa. This study assesses factors affecting acceptability of condom promotion and distribution among adolescents in Mpwapwa and Mbeya rural districts of Tanzania. Methods Data were collected in 2011 as part of a larger cross-sectional survey on condom use among 10–19 year-olds in Mpwapwa and Mbeya rural districts of Tanzania using a structured questionnaire. Associations between acceptability of condom promotion and distribution and each of the explanatory variables were tested using Chi Square. Multivariate logistic regression model was used to examine independent predictors of the acceptability of condom promotion and distribution using STATA (11) statistical software at 5% significance level. Results Mean age of the 1,327 adolescent participants (50.5% being males) was 13.5 years (SD = 1.4). Acceptance of condom promotion and distribution was found among 37% (35% in Mpwapwa and 39% in Mbeya rural) of the adolescents. Being sexually active and aged 15–19 was the strongest predictor of the acceptability of condom promotion and distribution (OR = 7.78, 95% CI 4.65-12.99). Others were; not agreeing that a condom is effective in preventing transmissions of STIs including HIV (OR = 0.34, 95% CI 0.20-0.56), being a resident of Mbeya rural district (OR = 1.67, 95% CI 1.28-2.19), feeling comfortable being seen by parents/guardians holding/buying condoms (OR = 2.20, 95% CI 1.40-3.46) and living with a guardian (OR = 1.48, 95% CI 1.08-2.04). Conclusion Acceptability of condom promotion and distribution among adolescents in Mpwapwa and Mbeya rural is low. Effect of sexual activity on the acceptability of condom promotion and distribution is age-dependent and was the strongest. Feeling comfortable being

  2. P04.10PREDICTIVE VALUE OF MGMT PROMOTER METHYLATION QUANTITATIVE ASSESSMENT IN GLIOBLASTOMA, WHICH OPTIMAL CUT-POINT?

    PubMed Central

    de Saint-Denis, T.; Lerhun, E.; Ramirez, C.; Devos, P.; Maurage, C.A.; Dubois, F.; Reyns, N.; Escande, F.

    2014-01-01

    BACKGROUND: The methylation in the promoter region of the MGMT gene encoding the DNA repair protein O6-methyl guanine-DNA methyl transferase is a predictive marker for benefit from alkylating agent therapy and a prognostic factor in glioblastoma. Pyrosequencing-based assessement of MGMT promoter status is of particularly interest, but analytical methods and cut-points may varied from one center to another. We intend to establish a correlation between quantitative methylation of MGMT promoter values and overall survival (OS) or progression-free survival (PFS). METHODS: The clinical and biological data of 159 newly diagnosed glioblastoma recruited in Lille University Hospital between 2008 and 2011 were retrospectively collected. For the patients, the methylation status has been assessed by pyrosequencing on 5 CpG islands. Statistical analyses were performed using SAS software V9.3. RESULTS: Median age of the patients was 61 years. Sixty three patients were male. Of 159 patients, 156 underwent a surgery (40,4% of complete resection), 3 patients were diagnosed only by biopsies. 123 received concomitant radiotherapy and temozolomide and adjuvant temozolomide. The median PFS and the median OS were 9,9 and 15,9. The most significant cut-off methylation determined on 5 sites mean methylaion value was 12% for both predictive and pronostic evaluations. Site 1 methylation status was the best predictive value for both PFS and OS compared to the other CpG islands. On this site 1, a >3% methylation status was a significant predictive factor for reponse to standard treatment for PFS and a >25% site 1 methylation status was a strong pronostic factor for 2 years survival (OS) (47%). CONCLUSIONS: Even a low MGMT methylation (>3%) status on selected CpG site can already be a predictive factor for response to treatment in glioblastoma and allow us to reduce the cut-off values. Highest methylations status are correlated with the longest overall survival and therefore confirm the

  3. Human Bladder Uroepithelial Cells Synergize with Monocytes to Promote IL-10 Synthesis and Other Cytokine Responses to Uropathogenic Escherichia coli

    PubMed Central

    Duell, Benjamin L.; Carey, Alison J.; Dando, Samantha J.; Schembri, Mark A.; Ulett, Glen C.

    2013-01-01

    Urinary tract infections are a major source of morbidity for women and the elderly, with Uropathogenic Escherichia coli (UPEC) being the most prevalent causative pathogen. Studies in recent years have defined a key anti-inflammatory role for Interleukin-10 (IL-10) in urinary tract infection mediated by UPEC and other uropathogens. We investigated the nature of the IL-10-producing interactions between UPEC and host cells by utilising a novel co-culture model that incorporated lymphocytes, mononuclear and uroepithelial cells in histotypic proportions. This co-culture model demonstrated synergistic IL-10 production effects between monocytes and uroepithelial cells following infection with UPEC. Membrane inserts were used to separate the monocyte and uroepithelial cell types during infection and revealed two synergistic IL-10 production effects based on contact-dependent and soluble interactions. Analysis of a comprehensive set of immunologically relevant biomarkers in monocyte-uroepithelial cell co-cultures highlighted that multiple cytokine, chemokine and signalling factors were also produced in a synergistic or antagonistic fashion. These results demonstrate that IL-10 responses to UPEC occur via multiple interactions between several cells types, implying a complex role for infection-related IL-10 during UTI. Development and application of the co-culture model described in this study is thus useful to define the degree of contact dependency of biomarker production to UPEC, and highlights the relevance of histotypic co-cultures in studying complex host-pathogen interactions. PMID:24155979

  4. Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

    PubMed

    Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

    2008-12-01

    Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1. PMID:19008385

  5. A Two-dimensional finite-element model study of backwater and flow distribution at the I-10 crossing of the Pearl River near Slidell, Louisiana

    USGS Publications Warehouse

    Lee, J.K.; Froelich, D.C.; Gilbert, J.J.; Wiche, G.J.

    1982-01-01

    A two-dimensional finite-element surface-water flow modeling system was used to study the effect of Interstate Highway 10 on water-surface elevations and flow distribution during the flood on the Pearl River on April 2, 1980, near Slidell, La. A finite-element network was designed to represent the topography and vegetative cover of the study reach. Hydrographic data collected for the 1980 flood were used to calibrate the flow model. The finite-element network was then modified to represent conditions prior to roadway construction, and the hydraulic impact of I-10 was determined by comparing ' before ' and ' after ' results. Upstream from the roadway, maximum backwater at the west edge of the flood plain (1.5 ft) is greater than maximum backwater at the east edge (1.1 ft). Backwater ranging from 0.6 to 0.2 ft. extends more than a mile downstream from the Pearl River bridge opening in I-10 at the east edge of the flood plain, and drawdown of 0.2 ft. or more occurs along approximately 2 miles of the west edge of the flood plain downstream from I-10. The capability of the modeling system to simulate the significant features of steady-state flow in a complicated multi-channel river-flood-plain system with variable topography and vegetative was successfully demonstrated in this study. (USGS)

  6. p53 can repress transcription of cell cycle genes through a p21WAF1/CIP1-dependent switch from MMB to DREAM protein complex binding at CHR promoter elements

    PubMed Central

    Quaas, Marianne; Müller, Gerd A.; Engeland, Kurt

    2012-01-01

    The tumor suppressor p53 plays an important role in cell cycle arrest by downregulating transcription. Many genes repressed by p53 code for proteins with functions in G₂/M. A large portion of these genes is controlled by cell cycle-dependent elements (CDE) and cell cycle genes homology regions (CHR) in their promoters. Cyclin B2 is an example of such a gene, with a function at the transition from G₂ to mitosis. We find that p53-dependent downregulation of cyclin B2 promoter activity is dependent on an intact CHR element. In the presence of high levels of p53 or p21WAF1/CIP1, protein binding to the CHR switches from MMB to DREAM complex by shifting MuvB core-associated proteins from B-Myb to E2F4/DP1/p130. The results suggest a model for p53-dependent transcriptional repression by which p53 directly activates p21WAF1/CIP1. The inhibitor then prevents further phosphorylation of p130 by cyclin-dependent kinases. The presence of hypophosphorylated pocket proteins shifts the equilibrium for complex formation from MMB to DREAM. In the case of promoters that do not hold CDE or E2F elements, binding of DREAM and MMB solely relies on a CHR site. Thus, p53 can repress target genes indirectly through CHR elements. PMID:23187802

  7. In vivo and in vitro analysis of the human tissue-type plasminogen activator gene promoter in neuroblastomal cell lines: evidence for a functional upstream kappaB element.

    PubMed

    Lux, W; Klobeck, H-G; Daniel, P B; Costa, M; Medcalf, R L; Schleuning, W-D

    2005-05-01

    Besides its well-established role in wound healing and fibrinolysis, tissue-type plasminogen activator (t-PA) has been shown to contribute to cognitive processes and memory formation within the central nervous system, and to promote glutamate receptor-mediated excitotoxicity. The t-PA gene is expressed and regulated in neuronal cells but the regulatory transcriptional processes directing this expression are still poorly characterized. We have used DNase I-hypersensitivity mapping and in vivo foot printing to identify putative regulatory elements and transcription factor binding sites in two human neuroblastomal (KELLY and SK-N-SH) and one human glioblastomal (SNB-19) cell lines. Hypersensitive sites were found in the proximal promoter region of all cell lines, and within the first exon for KELLY and SNB-19 cells. Mapping of methylation-protected residues in vivo detected a cluster of protected residues corresponding to a cAMP response element (CRE) and Sp1 sites in the proximal promoter previously shown to be essential for basal expression in other cell types. Protected residues were also found at other sites, notably a kappaB element at position bp -3081 to -3072 that was partly protected in KELLY and SNB-19 cells. Analysis of transfected reporter constructs in KELLY and SNB-19 cells confirmed that this particular element is functionally significant in the transactivation of the t-PA promoter in both cell types. This study defines, by in vivo and in vitro methods, a previously undescribed kappaB site in the t-PA gene promoter that influences t-PA expression in neuronal cells. PMID:15869598

  8. Lactobacillus reuteri promotes Helicobacter hepaticus-associated typhlocolitis in gnotobiotic B6.129P2-IL-10(tm1Cgn) (IL-10(-/-) ) mice.

    PubMed

    Whary, Mark T; Taylor, Nancy S; Feng, Yan; Ge, Zhongming; Muthupalani, Suresh; Versalovic, James; Fox, James G

    2011-06-01

    To model inflammatory bowel disease, we assessed infection with Helicobacter hepaticus 3B1 (ATCC 51449) and a potential probiotic Lactobacillus reuteri (ATCC PTA-6475) in gnotobiotic B6.129P2-IL-10(tm1Cgn) (IL-10(-/-) ) mice. No typhlocolitis developed in germ-free controls (n=21) or in L. reuteri (n=8) or H. hepaticus (n=18) mono-associated mice for 20 weeks post-infection. As positive controls, three specific pathogen-free IL-10(-/-) mice dosed with H. hepaticus developed severe typhlocolitis within 11 weeks. Because L. reuteri PTA-6475 has anti-inflammatory properties in vitro, it was unexpected to observe significant typhlocolitis (P<0·0001) in mice that had been infected with L. reuteri followed in 1 week by H. hepaticus (n=16). The H. hepaticus colonization was not affected through 20 weeks post-infection but L. reuteri colonization was lower in co-infected compared with L. reuteri mono-associated mice at 8-11 weeks post-infection (P<0·05). Typhlocolitis was associated with an increased T helper type 1 serum IgG2c response to H. hepaticus in co-infected mice compared with H. hepaticus mono-associated mice (P<0·005) and similarly, mRNA expression in caecal-colonic tissue was elevated at least twofold for chemokine ligands and pro-inflammatory interleukin-1α (IL-1α), IL-1β, IL-12 receptor, tumour necrosis factor-α and inducible nitric oxide synthase. Anti-inflammatory transforming growth factor-β, lactotransferrin, peptidoglycan recognition proteins, Toll-like receptors 4, 6, 8 and particularly 9 gene expression, were also elevated only in co-infected mice (P<0·05). These data support that the development of typhlocolitis in H. hepaticus-infected IL-10(-/-) mice required co-colonization with other microbiota and in this study, required only L. reuteri. Although the effects other microbiota may have on H. hepaticus virulence properties remain speculative, further investigations using this gnotobiotic model are now possible. PMID:21426337

  9. Evaluation of elemental status of ancient human bone samples from Northeastern Hungary dated to the 10th century AD by XRF

    NASA Astrophysics Data System (ADS)

    János, I.; Szathmáry, L.; Nádas, E.; Béni, A.; Dinya, Z.; Máthé, E.

    2011-11-01

    The present study is a multielemental analysis of bone samples belonging to skeletal individuals originating from two contemporaneous (10th century AD) cemeteries (Tiszavasvári Nagy-Gyepáros and Nagycserkesz-Nádasibokor sites) in Northeastern Hungary, using the XRF analytical technique. Emitted X-rays were detected in order to determine the elemental composition of bones and to appreciate the possible influence of the burial environment on the elemental content of the human skeletal remains. Lumbar vertebral bodies were used for analysis. Applying the ED(P)XRF technique concentration of the following elements were determined: P, Ca, K, Na, Mg, Al, Cl, Mn, Fe, Zn, Br and Sr. The results indicated post mortem mineral exchange between the burial environment (soil) and bones (e.g. the enhanced levels of Fe and Mn) and referred to diagenetic alteration processes during burials. However, other elements such as Zn, Sr and Br seemed to be accumulated during the past life. On the basis of statistical analysis, clear separation could not be observed between the two excavation sites in their bone elemental concentrations which denoted similar diagenetic influences, environmental conditions. The enhanced levels of Sr might be connected with the past dietary habits, especially consumption of plant food.

  10. Assessment of air quality in preschool environments (3-5 years old children) with emphasis on elemental composition of PM10 and PM2.5.

    PubMed

    Oliveira, Marta; Slezakova, Klara; Delerue-Matos, Cristina; Pereira, Maria Carmo; Morais, Simone

    2016-07-01

    This study evaluated concentrations of main air pollutants in a Portuguese preschool (indoors/outdoors) environment, with emphasis on elemental characterization of different PM fractions, and estimated risks for the pupils (aged 3-5 years). With exception to total volatile organic compounds, levels of PM10, PM2.5, CO, CO2, and formaldehyde were below legislative guidelines. Calcium, sodium, aluminium, and potassium were the most abundant elements in indoor PM (82-84% of the analysed content) resulting mainly from crustal sources. Carcinogenic elements (1-2% of the indoor analysed content) were mostly PM2.5-bound (83-91%). Indoor-to-outdoor ratios of individual elements indicated contributions of indoor origin and from penetration of outdoor emissions indoors; trace metals were associated with ambient anthropogenic emissions (namely traffic). Non-carcinogenic and carcinogenic risks from overall preschool exposure were acceptable for children; for adults carcinogenic risks exceeded (4-11 times) the USEPA recommend value of 10(-6), being 8-40 times higher than for children. PMID:27112725

  11. FELIX-1.0: A finite element solver for the time dependent generator coordinate method with the Gaussian overlap approximation

    NASA Astrophysics Data System (ADS)

    Regnier, D.; Verrière, M.; Dubray, N.; Schunck, N.

    2016-03-01

    We describe the software package FELIX that solves the equations of the time-dependent generator coordinate method (TDGCM) in N-dimensions (N ≥ 1) under the Gaussian overlap approximation. The numerical resolution is based on the Galerkin finite element discretization of the collective space and the Crank-Nicolson scheme for time integration. The TDGCM solver is implemented entirely in C++. Several additional tools written in C++, Python or bash scripting language are also included for convenience. In this paper, the solver is tested with a series of benchmarks calculations. We also demonstrate the ability of our code to handle a realistic calculation of fission dynamics.

  12. FELIX-1.0: A finite element solver for the time dependent generator coordinate method with the Gaussian overlap approximation

    SciTech Connect

    Regnier, D.; Verriere, M.; Dubray, N.; Schunck, N.

    2015-11-30

    In this study, we describe the software package FELIX that solves the equations of the time-dependent generator coordinate method (TDGCM) in NN-dimensions (N ≥ 1) under the Gaussian overlap approximation. The numerical resolution is based on the Galerkin finite element discretization of the collective space and the Crank–Nicolson scheme for time integration. The TDGCM solver is implemented entirely in C++. Several additional tools written in C++, Python or bash scripting language are also included for convenience. In this paper, the solver is tested with a series of benchmarks calculations. We also demonstrate the ability of our code to handle a realistic calculation of fission dynamics.

  13. Lymphoid-Tissue-Resident Commensal Bacteria Promote Members of the IL-10 Cytokine Family to Establish Mutualism.

    PubMed

    Fung, Thomas C; Bessman, Nicholas J; Hepworth, Matthew R; Kumar, Nitin; Shibata, Naoko; Kobuley, Dmytro; Wang, Kelvin; Ziegler, Carly G K; Goc, Jeremy; Shima, Tatsuichiro; Umesaki, Yoshinori; Sartor, R Balfour; Sullivan, Kaede V; Lawley, Trevor D; Kunisawa, Jun; Kiyono, Hiroshi; Sonnenberg, Gregory F

    2016-03-15

    Physical separation between the mammalian immune system and commensal bacteria is necessary to limit chronic inflammation. However, selective species of commensal bacteria can reside within intestinal lymphoid tissues of healthy mammals. Here, we demonstrate that lymphoid-tissue-resident commensal bacteria (LRC) colonized murine dendritic cells and modulated their cytokine production. In germ-free and antibiotic-treated mice, LRCs colonized intestinal lymphoid tissues and induced multiple members of the IL-10 cytokine family, including dendritic-cell-derived IL-10 and group 3 innate lymphoid cell (ILC3)-derived IL-22. Notably, IL-10 limited the development of pro-inflammatory Th17 cell responses, and IL-22 production enhanced LRC colonization in the steady state. Furthermore, LRC colonization protected mice from lethal intestinal damage in an IL-10-IL-10R-dependent manner. Collectively, our data reveal a unique host-commensal-bacteria dialog whereby selective subsets of commensal bacteria interact with dendritic cells to facilitate tissue-specific responses that are mutually beneficial for both the host and the microbe. PMID:26982365

  14. Grb10 Promotes Lipolysis and Thermogenesis by Phosphorylation-dependent Feedback Inhibition of mTORC1

    PubMed Central

    Liu, Meilian; Bai, Juli; He, Sijia; Villarreal, Ricardo; Hu, Derong; Zhang, Chuntao; Yang, Xin; Liang, Huiyun; Slaga, Thomas; Yu, Yonghao; Zhou, Zhiguang; Blenis, John; Scherer, Philipp E.; Dong, Lily Q.; Liu, Feng

    2014-01-01

    Summary Identification of key regulators of lipid metabolism and thermogenic functions has important therapeutic implications for the current obesity and diabetes epidemic. Here we show that Grb10, a newly identified direct substrate of mechanistic/mammalian target of rapamycin (mTOR), is expressed highly in brown adipose tissue, and its expression in white adipose tissue is markedly induced by cold exposure. In adipocytes, mTOR-mediated phosphorylation at Ser501/503 switches the binding preference of Grb10 from the insulin receptor to raptor, leading to the dissociation of raptor from mTOR and down-regulation of mTOR complex 1 (mTORC1) signaling. Fat-specific disruption of Grb10 increased mTORC1 signaling in adipose tissues, suppressed lipolysis, and reduced thermogenic function. The effects of Grb10 deficiency on lipolysis and thermogenesis were diminished by rapamycin administration in vivo. Our study has uncovered a novel feedback mechanism regulating mTORC1 signaling in adipose tissues and identified Grb10 as a key regulator of adiposity, thermogenesis, and energy expenditure. PMID:24746805

  15. Source Apportionment and Elemental Composition of PM2.5 and PM10 in Jeddah City, Saudi Arabia

    PubMed Central

    Khodeir, Mamdouh; Shamy, Magdy; Alghamdi, Mansour; Zhong, Mianhua; Sun, Hong; Costa, Max; Chen, Lung-Chi; Maciejczyk, Polina

    2014-01-01

    This paper presents the first comprehensive investigation of PM2.5 and PM10 composition and sources in Saudi Arabia. We conducted a multi-week multiple sites sampling campaign in Jeddah between June and September, 2011, and analyzed samples by XRF. The overall mean mass concentration was 28.4 ± 25.4 μg/m3 for PM2.5 and 87.3 ± 47.3 μg/m3 for PM10, with significant temporal and spatial variability. The average ratio of PM2.5/PM10 was 0.33. Chemical composition data were modeled using factor analysis with varimax orthogonal rotation to determine five and four particle source categories contributing significant amount of for PM2.5 and PM10 mass, respectively. In both PM2.5 and PM10 sources were (1) heavy oil combustion characterized by high Ni and V; (2) resuspended soil characterized by high concentrations of Ca, Fe, Al, and Si; and (3) marine aerosol. The two other sources in PM2.5 were (4) Cu/Zn source; (5) traffic source identified by presence of Pb, Br, and Se; while in PM10 it was a mixed industrial source. To estimate the mass contributions of each individual source category, the CAPs mass concentration was regressed against the factor scores. Cumulatively, resuspended soil and oil combustion contributed 77 and 82% mass of PM2.5 and PM10, respectively. PMID:24634602

  16. A G-string positive cis-regulatory element in the LpS1 promoter binds two distinct nuclear factors distributed non-uniformly in Lytechinus pictus embryos.

    PubMed

    Xiang, M; Lu, S Y; Musso, M; Karsenty, G; Klein, W H

    1991-12-01

    The LpS1 alpha and beta genes of Lytechinus pictus are activated at the late cleavage stage of embryogenesis, with LpS1 mRNAs accumulating only in lineages contributing to aboral ectoderm. We had shown previously that 762 bp of 5' flanking DNA from the LpS1 beta gene was sufficient for proper temporal and aboral ectoderm specific expression. In the present study, we identified a strong positive cis-regulatory element at -70 bp to -75 bp in the LpS1 beta promoter with the sequence (G)6 and a similar, more distal cis-element at -721 bp to -726 bp. The proximal 'G-string' element interacted with two nuclear factors, one specific to ectoderm and one to endoderm/mesoderm nuclear extracts, whereas the distal G-string element interacted only with the ectoderm factor. The ectoderm and endoderm/mesoderm G-string factors were distinct based on their migratory behavior in electrophoretic mobility shift assays, binding site specificities, salt optima and EDTA sensitivity. The proximal G-string element shared homology with a binding site for the mammalian transcription factor IF1, a protein that binds to negative cis-regulatory elements in the mouse alpha 1(I) and alpha 2(I) collagen gene promoters. Competition experiments using wild-type and mutant oligonucleotides indicated that the ectoderm G-string factor and IF1 have similar recognition sites. Partially purified IF1 specifically bound to an oligonucleotide containing the proximal G-string of LpS1 beta. From our results, we suggest that the ectoderm G-string factor, a member of the G-rich DNA-binding protein family, activates the LpS1 gene in aboral ectoderm cells by binding to the LpS1 promoter at the proximal G-string site. PMID:1811948

  17. Enacting Dialogue: The Impact of Promoting Philosophy for Children on the Literate Thinking of Identified Poor Readers, Aged 10

    ERIC Educational Resources Information Center

    Jenkins, Philip; Lyle, Sue

    2010-01-01

    The Philosophy for Children in Schools Project (P4CISP) is a research project to monitor and evaluate the impact of Philosophy for Children (P4C) on classroom practices. In this paper the impact of P4C on the thinking skills of four children aged 10 is examined. Standardised tests indicated the children had below-average reading ages. The pupils…

  18. Activation of murine invariant NKT cells promotes susceptibility to candidiasis by IL-10 induced modulation of phagocyte antifungal activity.

    PubMed

    Haraguchi, Norihiro; Kikuchi, Norihiro; Morishima, Yuko; Matsuyama, Masashi; Sakurai, Hirofumi; Shibuya, Akira; Shibuya, Kazuko; Taniguchi, Masaru; Ishii, Yukio

    2016-07-01

    Invariant NKT (iNKT) cells play an important role in a variety of antimicrobial immune responses due to their ability to produce high levels of immune-modulating cytokines. Here, we investigated the role of iNKT cells in host defense against candidiasis using Jα18-deficient mice (Jα18(-/-) ), which lack iNKT cells. Jα18(-/-) mice were more resistant to the development of lethal candidiasis than wild-type (WT) mice. In contrast, treatment of WT mice with the iNKT cell activating ligand α-galactosylceramide markedly enhanced their mortality after infection with Candida albicans. Serum IL-10 levels were significantly elevated in WT mice in response to infection with C. albicans. Futhermore, IL-10 production increased after in vitro coculture of peritoneal macrophages with iNKT cells and C. albicans. The numbers of peritoneal macrophages, the production of IL-1β and IL-18, and caspase-1 activity were also significantly elevated in Jα18(-/-) mice after infection with C. albicans. The adoptive transfer of iNKT cells or exogenous administration of IL-10 into Jα18(-/-) reversed susceptibility to candidiasis to the level of WT mice. These results suggest that activation of iNKT cells increases the initial severity of C. albicans infection, most likely mediated by IL-10 induced modulation of macrophage antifungal activity. PMID:27151377

  19. Interleukin-10 deficiency impairs regulatory T cell-derived neuropilin-1 functions and promotes Th1 and Th17 immunity

    PubMed Central

    Wang, Shimin; Gao, Xiang; Shen, Guobo; Wang, Wei; Li, Jingyu; Zhao, Jingyi; Wei, Yu-Quan; Edwards, Carl K.

    2016-01-01

    Regulatory T cells (Tregs) expand in peripheral lymphoid organs and can produce immunosuppressive cytokines to support tumor growth. IL-10 abrogation efficiently induces Treg formation but dampens tumoral neuropilin-1 (Nrp-1) Treg signaling, which simultaneously augments Th1 and Th17 immunity. These effects are associated with the plasticity and stability of Tregs and effector T cell functions that can limit tumorigenesis. Within the tumor microenvironment, there appears to be a “mutual antagonism” between immunoenhancement and immunosuppression mechanisms, eventually leading to decreased metastasis. In contrast, tumor progression is paralleled by a reduction in Nrp-1-producing Tregs controlled by the IL-10 and TGF-β1 levels. However, Th1, Th17 and Treg immunity is primarily regulated by IL-10 or Nrp-1 and not TGF-β1 except when combined with IL-10. These results emphasize the important implications for the therapeutic use of Tregs. The number of Treg cells must be maintained in a healthy and dynamic homeostatic range to prevent malignant diseases. Moreover, Treg-mediated immunosuppression can be limited by reducing tumor-derived Treg Nrp-1 levels. PMID:27075020

  20. Role of estrogen receptor ligand and estrogen response element sequence on interaction with chicken ovalbumin upstream promoter transcription factor (COUP-TF).

    PubMed

    Klinge, C M

    1999-11-01

    Estrogen-responsive genes are regulated by altering the balance of estrogen receptor (ER) interaction with transcription activators and inhibitors. Here we examined the role of ER ligand on ER interaction with the Chicken Ovalbumin Upstream Promoter Transcription Factor (COUP-TF) orphan nuclear receptor. COUP-TF binding to half-site estrogen response elements (EREs) was increased by the addition of estradiol (E2) -liganded ER (E2-ER), but not by ER liganded with the antiestrogens 4-hydroxytamoxifen (4-OHT-ER) or tamoxifen aziridine (TAz-ER). ER did not bind to single half-sites. Conversely, COUP-TF enhanced the ERE binding of purified E2-ER, but did not affect TAz-ER-ERE binding. In contrast, only antiestrogens enhanced direct interaction between ER and COUP-TF as assessed by GST pull-down assays. Identical results were obtained using either purified bovine or recombinant human ERalpha. Co-immunoprecipitation assays showed that ER and COUP-TF interact in extracts from MCF-7 and ERalpha-transfected MDA-MB-231 cells. Here we document that ER ligand impacts COUP-TF-ER interaction. COUP-TF interaction is mediated by the DNA binding and ligand-binding domains of ER. We suggest that changes in ER conformation induced by DNA binding reduce ER-COUP-TF interaction. Transient transfection of human MCF-7 breast cancer cells with a COUP-TFI expression vector repressed E2-induced luciferase reporter gene expression from single or multiple tandem copies of a consensus ERE. COUP-TFI stimulated 4-OHT-induced luciferase activity from a minimal ERE. Alone, COUP-TFI increased transcription from ERE half-sites or a single ERE in a sequence-dependent manner. These data provide evidence that the ERE sequence and its immediate flanking regions influence whether COUP-TF enhances, inhibits, or has no effect on ER ligand-induced ERE reporter gene expression and that COUP-TFI activates gene transcription from ERE half-sites. We suggest that COUP-TFI plays a role in mitigating estrogen

  1. Loss of the repressor REST in uterine fibroids promotes aberrant G protein-coupled receptor 10 expression and activates mammalian target of rapamycin pathway

    PubMed Central

    Varghese, Binny V.; Koohestani, Faezeh; McWilliams, Michelle; Colvin, Arlene; Gunewardena, Sumedha; Kinsey, William H.; Nowak, Romana A.; Nothnick, Warren B.; Chennathukuzhi, Vargheese M.

    2013-01-01

    Uterine fibroids (leiomyomas) are the most common tumors of the female reproductive tract, occurring in up to 77% of reproductive-aged women, yet molecular pathogenesis remains poorly understood. A role for atypically activated mammalian target of rapamycin (mTOR) pathway in the pathogenesis of uterine fibroids has been suggested in several studies. We identified that G protein-coupled receptor 10 [GPR10, a putative signaling protein upstream of the phosphoinositide 3-kinase–protein kinase B/AKT–mammalian target of rapamycin (PI3K/AKT–mTOR) pathway] is aberrantly expressed in uterine fibroids. The activation of GPR10 by its cognate ligand, prolactin releasing peptide, promotes PI3K–AKT–mTOR pathways and cell proliferation specifically in cultured primary leiomyoma cells. Additionally, we report that RE1 suppressing transcription factor/neuron-restrictive silencing factor (REST/NRSF), a known tumor suppressor, transcriptionally represses GPR10 in the normal myometrium, and that the loss of REST in fibroids permits GPR10 expression. Importantly, mice overexpressing human GPR10 in the myometrium develop myometrial hyperplasia with excessive extracellular matrix deposition, a hallmark of uterine fibroids. We demonstrate previously unrecognized roles for GPR10 and its upstream regulator REST in the pathogenesis of uterine fibroids. Importantly, we report a unique genetically modified mouse model for a gene that is misexpressed in uterine fibroids. PMID:23284171

  2. FELIX-1.0: A finite element solver for the time dependent generator coordinate method with the Gaussian overlap approximation

    DOE PAGESBeta

    Regnier, D.; Verriere, M.; Dubray, N.; Schunck, N.

    2015-11-30

    In this study, we describe the software package FELIX that solves the equations of the time-dependent generator coordinate method (TDGCM) in NN-dimensions (N ≥ 1) under the Gaussian overlap approximation. The numerical resolution is based on the Galerkin finite element discretization of the collective space and the Crank–Nicolson scheme for time integration. The TDGCM solver is implemented entirely in C++. Several additional tools written in C++, Python or bash scripting language are also included for convenience. In this paper, the solver is tested with a series of benchmarks calculations. We also demonstrate the ability of our code to handle amore » realistic calculation of fission dynamics.« less

  3. Transformer 2β (Tra2β/SFRS10) positively regulates the progression of NSCLC via promoting cell proliferation.

    PubMed

    Ji, Lili; Ni, Tingting; Shen, Yanbo; Xue, Qun; Liu, Yifei; Chen, Buyou; Cui, Xuefan; Lv, Liting; Yu, Xiafei; Cui, Yuan; Lu, Xiaoning; Chen, Jie; Mao, Guoxin; Wang, Yuchan

    2014-10-01

    Transformer 2β (Tra2β), a member of the serine/arginine-rich-like protein family, is an important RNA-binding protein involved in alternative splice. Deregulation of Tra2β has been observed in several cancers. However, the detailed role of Tra2β in non-small cell lung cancer (NSCLC) has not been elucidated. In this study, the contribution of Tra2β to NSCLC development was investigated. On histological level, the expression of Tra2β was determined by Western and immunohistochemistry assays. It demonstrated that Tra2β was expressed higher in NSCLC tumor tissues compared with adjacent non-tumor tissues. In addition to confirm the association of Tra2β expression with histological differentiation and clinical stage (p < 0.05), we also confirmed significant positive correlation between the expression level of Tra2β and that of Ki67 (p < 0.05, r = 0.446) by Spearman rank correlation test. Moreover, high expression of Tra2β predicted poor prognosis by Kaplan-Meier survival analysis. And Tra2β among with other clinicopathologic variables was an independent prognostic indicator for patients' overall survival by multivariate analysis. On cellular level, Tra2β expression was demonstrated to promote proliferation of NSCLC cells through a series of assays, including serum starvation and release assay, Western blot assay and flow cytometry analysis. Moreover, knockdown of Tra2β was confirmed to inhibit proliferation and to induce apoptosis of NSCLC cells through flow cytometry analysis, western analysis, cell counting kit-8 assay and Tunnel assay. Our results indicated that Tra2β was involved in the tumorigenesis of NSCLC and might be a potential therapeutic target of NSCLC. PMID:24952301

  4. Effect of the third element on the structure of liquid Mg65Cu25Y10 alloy

    NASA Astrophysics Data System (ADS)

    Liu, Dan; Zhu, Xun Ming; Qin, Jing Yu; Duan, Jun Peng; Wang, Ai Min; Gu, Ting Kun

    2016-08-01

    The liquid structures of Mg65Cu25Y10 and its three homologous binary liquid alloys are investigated via ab initio molecular dynamics in the present work. The chemical and topological environments in all four liquid alloys are analyzed using pair distribution function, coordination number, and the Voronoi polyhedron. It shows that the Cu atoms play significant role in deciding the chemical and topological short-range orders of the Mg65Cu25Y10 liquid alloy. The Voronoi polyhedra in the ternary liquid alloy illustrate less varieties and longer lifetime. Moreover, the diffusion coefficients are decreased significantly in the ternary liquid alloys according to the mean square displacements. All above offer a deeper insight into how the three species work in the Mg65Cu25Y10 liquid alloy.

  5. 1,10-Phenanthroline promotes copper complexes into tumor cells and induces apoptosis by inhibiting the proteasome activity.

    PubMed

    Zhang, Zhen; Bi, Caifeng; Schmitt, Sara M; Fan, Yuhua; Dong, Lili; Zuo, Jian; Dou, Q Ping

    2012-12-01

    Indole-3-acetic acid and indole-3-propionic acid, two potent natural plant growth hormones, have attracted attention as promising prodrugs in cancer therapy. Copper is known to be a cofactor essential for tumor angiogenesis. We have previously reported that taurine, L-glutamine, and quinoline-2-carboxaldehyde Schiff base copper complexes inhibit cell proliferation and proteasome activity in human cancer cells. In the current study, we synthesized two types of copper complexes, dinuclear complexes and ternary complexes, to investigate whether a certain structure could easily carry copper into cancer cells and consequently inhibit tumor proteasome activity and induce apoptosis. We observed that ternary complexes binding with 1,10-phenanthroline are more potent proteasome inhibitors and apoptosis inducers than dinuclear complexes in PC-3 human prostate cancer cells. Furthermore, the ternary complexes potently inhibit proteasome activity before induction of apoptosis in MDA-MB-231 human breast cancer cells, but not in nontumorigenic MCF-10A cells. Our results suggest that copper complexes binding with 1,10-phenanthroline as the third ligand could serve as potent, selective proteasome inhibitors and apoptosis inducers in tumor cells, and that the ternary complexes may be good potential anticancer drugs. PMID:23053530

  6. Expression of the Myosin Heavy Chain IIB Gene in Porcine Skeletal Muscle: The Role of the CArG-Box Promoter Response Element

    PubMed Central

    Brown, David M.; Brameld, John M.; Parr, Tim

    2014-01-01

    Due to its similarity to humans, the pig is increasingly being considered as a good animal model for studying a range of human diseases. Despite their physiological similarities, differential expression of the myosin heavy chain (MyHC) IIB gene (MYH4) exists in the skeletal muscles of these species, which is associated with a different muscle phenotype. The expression of different MyHC isoforms is a critical determinant of the contractile and metabolic characteristics of the muscle fibre. We aimed to elucidate whether a genomic mechanism was responsible for the drastically different expression of MYH4 between pigs and humans, thus improving our understanding of the pig as a model for human skeletal muscle research. We utilized approximately 1 kb of the MYH4 promoter from a domestic pig and a human (which do and do not express MYH4, respectively) to elucidate the role of the promoter sequence in regulating the high expression of MYH4 in porcine skeletal muscle. We identified a 3 bp genomic difference within the proximal CArG and E-box region of the MYH4 promoter of pigs and humans that dictates the differential activity of these promoters during myogenesis. Subtle species-specific genomic differences within the CArG-box region caused differential protein-DNA interactions at this site and is likely accountable for the differential MYH4 promoter activity between pigs and humans. We propose that the genomic differences identified herein explain the differential activity of the MYH4 promoter of pigs and humans, which may contribute to the differential expression patterns displayed in these otherwise physiologically similar mammals. Further, we report that both the pig and human MYH4 promoters can be induced by MyoD over-expression, but the capacity to activate the MYH4 promoter is largely influenced by the 3 bp difference located within the CArG-box region of the proximal MYH4 promoter. PMID:25469802

  7. Identification of a negative response element in the human inducible nitric-oxide synthase (hiNOS) promoter: The role of NF-κB-repressing factor (NRF) in basal repression of the hiNOS gene

    PubMed Central

    Feng, Xuesheng; Guo, Zhong; Nourbakhsh, Mahtab; Hauser, Hansjorg; Ganster, Ray; Shao, Lifang; Geller, David A.

    2002-01-01

    Although nuclear factor (NF)-κB plays a central role in mediating cytokine-stimulated human inducible nitric-oxide synthase (hiNOS) gene transcription, very little is known about the factors involved in silencing of the hiNOS promoter. NF-κB-repressing factor (NRF) interacts with a specific negative regulatory element (NRE) to mediate transcriptional repression of certain NF-κB responsive genes. By sequence comparison with the IFN-β and IL-8 promoters, we identified an NRE in the hiNOS promoter located at −6.7 kb upstream. In A549 and HeLa human cells, constitutive NRF mRNA expression is detected by RT-PCR. Gel shift assay showed constitutive NRF binding to the hiNOS NRE. Mutation of the −6.7-kb NRE site in the hiNOS promoter resulted in loss of NRF binding and increased basal but not cytokine-stimulated hiNOS transcription in promoter transfection experiments. Interestingly, overexpression of NRF suppressed both basal and cytokine-induced hiNOS promoter activity that depended on an intact cis-acting NRE motif. By using stably transformed HeLa cells with the tetracycline on/off expression system, reduction of cellular NRF by expressing antisense NRF increased basal iNOS promoter activity and resulted in constitutive iNOS mRNA expression. These data demonstrate that the transacting NRF protein is involved in constitutive silencing of the hiNOS gene by binding to a cis-acting NRE upstream in the hiNOS promoter. PMID:12381793

  8. Interleukin-10 conjugated electrospun polycaprolactone (PCL) nanofibre scaffolds for promoting alternatively activated (M2) macrophages around the peripheral nerve in vivo.

    PubMed

    Potas, Jason R; Haque, Farhia; Maclean, Francesca L; Nisbet, David R

    2015-05-01

    Macrophages play a key role in tissue regeneration following peripheral nerve injury by preparing the surrounding parenchyma for regeneration, however, they can be damaging if the response is excessive. Interleukin 10 (IL-10) is a cytokine that promotes macrophages toward an anti-inflammatory/wound healing state (M2 phenotype). The bioactive half-life of IL-10 is dependent on the cellular microenvironment and ranges from minutes to hours in vivo. Our objective was to extend the in vivo bioavailability and bioactivity of IL-10 by attaching the protein onto nanofibrous scaffolds and demonstrating increased expression levels of M2 macrophages when placed around healthy intact peripheral nerves. IL-10 was adsorbed and covalently bound to electrospun poly(ε-caprolactone) (PCL) nanofibrous scaffolds. In vivo bioavailability and bioactivity of IL-10 was confirmed by wrapping IL-10 conjugated nanofibres around the sciatic nerves of Wistar rats and quantifying M2 macrophages immunohistochemically double labelled with ED1 and either arginase 1 or CD206. IL-10 remained immobilised to PCL scaffolds for more than 120 days when stored in phosphate buffered saline at room temperature and for up to 14d ays when implanted around the sciatic nerve. IL-10 conjugated nanofibres successfully induced macrophage polarisation towards the M2 activated state within the scaffold material as well as the adjacent tissue surrounding the nerve. PCL biofunctionalised nanofibres are useful for manipulating the cellular microenvironment. Materials such as these could potentially lead to new therapeutic strategies for nervous tissue injuries as well as provide novel investigative tools for biological research. PMID:25837415

  9. SEM in situ MiniCantilever Beam Bending of U-10Mo/Zr/Al Fuel Elements

    SciTech Connect

    Mook, William; Baldwin, Jon K.; Martinez, Ricardo M.; Mara, Nathan A.

    2014-06-16

    In this work, the fracture behavior of Al/Zr and Zr/dU-10Mo interfaces was measured via the minicantilever bend technique. The energy dissipation rates were found to be approximately 3.7-5 mj/mm2 and 5.9 mj/mm2 for each interface, respectively. It was found that in order to test the Zr/U-10Mo interface, location of the hinge of the cantilever was a key parameter. While this test could be adapted to hot cell use through careful alignment fixturing and measurement of crack lengths with an optical microscope (as opposed to SEM, which was used here out of convenience), machining of the cantilevers via MiniMill in such a way as to locate the interfaces at the cantilever hinge, as well as proper placement of a femtosecond laser notch will continue to be key challenges in a hot cell environment.

  10. Cosmic-ray elemental abundances from 1 to 10 GeV per amu for boron through nickel

    NASA Technical Reports Server (NTRS)

    Dwyer, Robert; Meyer, Peter

    1987-01-01

    The relative abundances of cosmic-ray nuclei in the charge range boron through nickel over the energy range 1-10 GeV per amu were measured with a balloon-borne detector. The instrument consists of a scintillation and Cerenkov counter telescope with a multiwire proportional chamber hodoscope and has been flown in four high-altitude balloon flights. Good charge resolution (sigma = 0.2 charge units at iron) and high statistical accuracy have been achieved. These data are used to derive the energy dependence of the leakage path length using the leaky box model of propagation and confinement in the galaxy. This energy dependence is found to be best fit by lambda = E(tot) exp -n, where n = 0.49 + or - 0.06 over 1-10 GeV per amu. Relative abundances at the source are consistent with an energy-independent composition.

  11. Paleo-ocean chemistry records in marine opal: Implications for fluxes of trace elements, cosmogenic nuclides ( 10Be and 26Al), and biological productivity

    NASA Astrophysics Data System (ADS)

    Lal, D.; Charles, C.; Vacher, L.; Goswami, J. N.; Jull, A. J. T.; McHargue, L.; Finkel, R. C.

    2006-07-01

    Here, we provide evidence suggesting that marine (diatom) opal contains not only a high fidelity record of dissolved oceanic concentrations of cosmic ray-produced radionuclides, 10Be and 26Al, but also a record of temporal variations in a large number of trace elements such as Ti, Fe, Zn and Mn. This finding is derived from measurements in purified biogenic opal that can be separated from detrital materials using a newly developed technique based on surface charge characteristics. Initial results from a sediment core taken near the present-day position of the Antarctic Polar Front (ODP Site 1093) show dramatic changes in the intrinsic concentrations of, Be, Al, Ti, Fe, Mn and Zn in the opal assemblages during the past ˜140 kyr BP. The results imply appreciable climatically controlled fluctuations in the level of bioreactive trace elements. The time series of total Be, Al, Ti, Fe and 10Be in the sediment core are all well correlated with each other and with dust records in the polar ice cores. The observations suggest that a significant flux of these trace metals to oceans is contributed by the aeolian dust, in this case, presumably from the Patagonia. This observation also allows determination of fluxes of dust-contributed 10Be to the Antarctica ice sheets. However, our data show that the relationships among the various metals are not perfectly linear. During periods of higher dissolved concentrations of trace elements (indicated by Fe and Ti) the relative concentrations of bioreactive elements, Be, Al, Mn and Zn are decreased. By contrast, the Fe/Zn and Fe/Mn ratios decrease significantly during each transition from cold to warm periods. The relative behavior could be consistent with any of the following processes: (i) enhanced biological productivity due to greater supply of the bioreactive elements (e.g. Zn) during cold periods (ii) increased biological and inorganic scavenging of particle active elements (e.g. Be and Al) during early interglacial periods (iii

  12. The association of three promoter polymorphisms in interleukin-10 gene with the risk for colorectal cancer and hepatocellular carcinoma: A meta-analysis

    PubMed Central

    Shi, Yan-Hui; Zhao, Dong-Mei; Wang, Yue-Fei; Li, Xue; Ji, Man-Ru; Jiang, Dan-Na; Xu, Bai-Ping; Zhou, Li; Lu, Chang-Zhu; Wang, Bin

    2016-01-01

    Mounting evidence supports a potent inhibitory role of interleukin-10 (IL-10) in tumor carcinogenesis, angiogenesis and metastasis. This meta-analysis was designed to examine the association of three promoter polymorphisms (−592C > A, −819C > T and −1082G > A) in IL-10 gene with the risk for colorectal cancer and hepatocellular carcinoma. Qualification assessment and data collection were completed by two authors independently. The random-effects model using the DerSimonian and Laird method was fitted by the STATA software. Twenty-five articles involving 5933 cases and 9724 controls were meta-analyzed. Overall comparisons of the mutant alleles (−592A, −819T and −1082A) of three promoter polymorphisms with alternative wild alleles failed to reveal any statistical significance for both colorectal cancer and hepatocellular carcinoma (P > 0.05), and the likelihood of heterogeneity was low (I2 < 50%). For −592C > A polymorphism, a significant risk for colorectal cancer was identified when analysis was restricted to East Asians (odds ratio or OR = 1.41, 95% confidence interval or CI: 1.18–1.68, P < 0.001) and retrospective studies (OR = 1.23, 95% CI: 1.09–1.39, P = 0.001). As weighed by the Egger’s test and the fill-and-trim method, there was a low probability of publication bias for all studied polymorphisms. Our findings collectively suggest that the −592C > A polymorphism in IL-10 gene might be a susceptibility locus for colorectal cancer in East Asians. PMID:27489033

  13. The cyst nematode effector protein 10A07 targets and recruits host posttranslational machinery to mediate its nuclear trafficking and to promote parasitism in Arabidopsis.

    PubMed

    Hewezi, Tarek; Juvale, Parijat S; Piya, Sarbottam; Maier, Tom R; Rambani, Aditi; Rice, J Hollis; Mitchum, Melissa G; Davis, Eric L; Hussey, Richard S; Baum, Thomas J

    2015-03-01

    Plant-parasitic cyst nematodes synthesize and secrete effector proteins that are essential for parasitism. One such protein is the 10A07 effector from the sugar beet cyst nematode, Heterodera schachtii, which is exclusively expressed in the nematode dorsal gland cell during all nematode parasitic stages. Overexpression of H. schachtii 10A07 in Arabidopsis thaliana produced a hypersusceptible phenotype in response to H. schachtii infection along with developmental changes reminiscent of auxin effects. The 10A07 protein physically associates with a plant kinase and the IAA16 transcription factor in the cytoplasm and nucleus, respectively. The interacting plant kinase (IPK) phosphorylates 10A07 at Ser-144 and Ser-231 and mediates its trafficking from the cytoplasm to the nucleus. Translocation to the nucleus is phosphorylation dependent since substitution of Ser-144 and Ser-231 by alanine resulted in exclusive cytoplasmic accumulation of 10A07. IPK and IAA16 are highly upregulated in the nematode-induced syncytium (feeding cells), and deliberate manipulations of their expression significantly alter plant susceptibility to H. schachtii in an additive fashion. An inactive variant of IPK functioned antagonistically to the wild-type IPK and caused a dominant-negative phenotype of reduced plant susceptibility. Thus, exploitation of host processes to the advantage of the parasites is one mechanism by which cyst nematodes promote parasitism of host plants. PMID:25715285

  14. Genetic, epidemiological and biological analysis of interleukin-10 promoter single-nucleotide polymorphisms suggests a definitive role for -819C/T in leprosy susceptibility.

    PubMed

    Pereira, A C; Brito-de-Souza, V N; Cardoso, C C; Dias-Baptista, I M F; Parelli, F P C; Venturini, J; Villani-Moreno, F R; Pacheco, A G; Moraes, M O

    2009-03-01

    Leprosy is a complex infectious disease influenced by genetic and environmental factors. The genetic contributing factors are considered heterogeneous and several genes have been consistently associated with susceptibility like PARK2, tumor necrosis factor (TNF), lymphotoxin-alpha (LTA) and vitamin-D receptor (VDR). Here, we combined a case-control study (374 patients and 380 controls), with meta-analysis (5 studies; 2702 individuals) and biological study to test the epidemiological and physiological relevance of the interleukin-10 (IL-10) genetic markers in leprosy. We observed that the -819T allele is associated with leprosy susceptibility either in the case-control or in the meta-analysis studies. Haplotypes combining promoter single-nucleotide polymorphisms also implicated a haplotype carrying the -819T allele in leprosy susceptibility (odds ratio (OR)=1.40; P=0.01). Finally, we tested IL-10 production in peripheral blood mononuclear cells stimulated with Mycobacterium leprae antigens and found that -819T carriers produced lower levels of IL-10 when compared with non-carriers. Taken together, these data suggest that low levels of IL-10 during the disease outcome can drive patients to a chronic and unprotective response that culminates with leprosy. PMID:19110537

  15. The Cyst Nematode Effector Protein 10A07 Targets and Recruits Host Posttranslational Machinery to Mediate Its Nuclear Trafficking and to Promote Parasitism in Arabidopsis

    PubMed Central

    Hewezi, Tarek; Juvale, Parijat S.; Piya, Sarbottam; Maier, Tom R.; Rambani, Aditi; Rice, J. Hollis; Mitchum, Melissa G.; Davis, Eric L.; Hussey, Richard S.; Baum, Thomas J.

    2015-01-01

    Plant-parasitic cyst nematodes synthesize and secrete effector proteins that are essential for parasitism. One such protein is the 10A07 effector from the sugar beet cyst nematode, Heterodera schachtii, which is exclusively expressed in the nematode dorsal gland cell during all nematode parasitic stages. Overexpression of H. schachtii 10A07 in Arabidopsis thaliana produced a hypersusceptible phenotype in response to H. schachtii infection along with developmental changes reminiscent of auxin effects. The 10A07 protein physically associates with a plant kinase and the IAA16 transcription factor in the cytoplasm and nucleus, respectively. The interacting plant kinase (IPK) phosphorylates 10A07 at Ser-144 and Ser-231 and mediates its trafficking from the cytoplasm to the nucleus. Translocation to the nucleus is phosphorylation dependent since substitution of Ser-144 and Ser-231 by alanine resulted in exclusive cytoplasmic accumulation of 10A07. IPK and IAA16 are highly upregulated in the nematode-induced syncytium (feeding cells), and deliberate manipulations of their expression significantly alter plant susceptibility to H. schachtii in an additive fashion. An inactive variant of IPK functioned antagonistically to the wild-type IPK and caused a dominant-negative phenotype of reduced plant susceptibility. Thus, exploitation of host processes to the advantage of the parasites is one mechanism by which cyst nematodes promote parasitism of host plants. PMID:25715285

  16. Muscle-specific activity of the skeletal troponin I promoter requires interaction between upstream regulatory sequences and elements contained within the first transcribed exon.

    PubMed Central

    Nikovits, W; Mar, J H; Ordahl, C P

    1990-01-01

    Expression of the skeletal troponin I (sTnI) gene is regulated transcriptionally in a muscle-specific fashion. We show here that the region of the sTnI gene between -160 and +61 (relative to the transcription initiation site) is able to direct expression of the bacterial chloramphenicol acetyltransferase (CAT) gene is muscle cultures at a level approximately 100 times higher than in fibroblast cultures. RNA analysis demonstrated that transcription of the CAT gene was initiated at the same site as transcription of the endogenous sTnI gene and that CAT activity levels were approximately proportional to CAT mRNA levels. Deletion analysis demonstrated that the region between nucleotides -160 and -40 contained sequences essential for full promoter activity. Surprisingly, 3' deletion analysis indicated that the first exon (-6 to +61) of the sTnI gene was also required for full activity of the sTnI promoter in skeletal muscle cells. Chimeric promoter experiments, in which segments of the sTnI and the herpes simplex virus thymidine kinase promoter were interchanged, indicated that reconstitution of a muscle-specific promoter required inclusion of both the upstream and exon I regions of the sTnI gene. Exon I, and the region immediately upstream, showed DNase protection over sequence motifs related to those found in other genes, including the tar region of human immunodeficiency virus type 1. These results demonstrate that expression of the sTnI promoter in embryonic skeletal muscle cells requires complex interaction between two separate promoter regions, one of which resides within the first 61 transcribed nucleotides of the gene. Images PMID:2355914

  17. An element in the alpha1-tubulin promoter is necessary for retinal expression during optic nerve regeneration but not after eye injury in the adult zebrafish.

    PubMed

    Senut, Marie-Claude; Gulati-Leekha, Abhilasha; Goldman, Daniel

    2004-09-01

    We have shown previously that a 1.696 kb upstream fragment of the goldfish alpha1-tubulin promoter was capable of driving green fluorescent protein (GFP) expression in the developing and regenerating zebrafish CNS in a pattern closely mimicking the endogenous alpha1-tubulin gene. Comparison of fish and rat alpha1-tubulin promoters identified a 64 bp region with a conserved repetitive homeodomain (HD) consensus sequence core (TAAT) and a nearby basic helix-loop-helix binding E-box sequence (CANNTG), which led us to speculate that it could be of importance for regulating alpha1-tubulin gene transcription. To address this issue, we examined the ability of deletion mutants of the 1.696 kb promoter to drive expression of GFP in zebrafish retinal cells under normal conditions and after injury. Interestingly, although wild-type 1.696 kb and mutant promoters, lacking the E-box and/or HD sequences, exhibited rather similar patterns of GFP expression in the developing retina, significant differences were noticed in the mature retina. First, although the 1.696 kb promoter directed transgene expression to retinal neurons and progenitor cells, the activity of mutant promoters was drastically reduced. Second, we found that the E-box and HD sequences were necessary for transgene reinduction during optic nerve regeneration, but were not as important for transgene expression in regenerating retinal neurons after eye injury. In this latter lesion model, remarkably, both 1.696 kb and mutant promoters targeted GFP expression to Müller glia-like cells, some of which re-entered the cell cycle. These new findings will be useful for identifying the molecular signals necessary for successful CNS regeneration. PMID:15342733

  18. Hahb-10, a sunflower homeobox-leucine zipper gene, is regulated by light quality and quantity, and promotes early flowering when expressed in Arabidopsis.

    PubMed

    Rueda, Eva C; Dezar, Carlos A; Gonzalez, Daniel H; Chan, Raquel L

    2005-12-01

    Homeodomain-leucine zipper proteins constitute a family of transcription factors found only in plants. Expression patterns of the sunflower homeobox-leucine zipper gene Hahb-10 (Helianthus annuus homeobox-10), that belongs to the HD-Zip II subfamily, were analysed. Northern blots showed that Hahb-10 is expressed primarily in mature leaves, although expression is clearly detectable in younger leaves and also in stems. Considerably higher expression levels were detected in etiolated seedlings compared with light-grown seedlings. Induction of Hahb-10 expression was observed when seedlings were subjected to treatment with gibberellins. Transgenic Arabidopsis thaliana plants that express Hahb-10 under the 35S cauliflower mosaic virus promoter show special phenotypic characteristics such as darker cotyledons and planar leaves. A reduction in the life cycle of about 25% allowing earlier seed collection was also observed, and this phenomenon is clearly related to a shortened flowering time. When the number of plants per pot increased, the difference in developmental rate between transgenic and non-transformed individuals became larger. After gibberellin treatment, the relative difference in life cycle duration was considerably reduced. Several light-regulated genes have been tested as possible target genes of Hahb-10. One of them, PsbS, shows a different response to illumination conditions in transgenic plants compared with the response in wild-type plants while the other genes behave similarly in both genotypes. We propose that Hahb-10 functions in a signalling cascade(s) that control(s) plant responses to light quality and quantity, and may also be involved in gibberellin transduction pathways. PMID:16215272

  19. Functional cyclic AMP response element in the breast cancer resistance protein (BCRP/ABCG2) promoter modulates epidermal growth factor receptor pathway- or androgen withdrawal-mediated BCRP/ABCG2 transcription in human cancer cells.

    PubMed

    Xie, Yi; Nakanishi, Takeo; Natarajan, Karthika; Safren, Lowell; Hamburger, Anne W; Hussain, Arif; Ross, Douglas D

    2015-03-01

    Phosphorylated cyclic-AMP (cAMP) response element binding protein (p-CREB) is a downstream effector of a variety of important signaling pathways. We investigated whether the human BCRP promoter contains a functional cAMP response element (CRE). 8Br-cAMP, a cAMP analogue, increased the activity of a BCRP promoter reporter construct and BCRP mRNA in human carcinoma cells. Epidermal growth factor receptor (EGFR) pathway activation also led to an increase in p-CREB and in BCRP promoter reporter activity via two major downstream EGFR signaling pathways: the phosphotidylinositol-3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. EGF treatment increased the phosphorylation of EGFR, AKT, ERK and CREB, while simultaneously enhancing BCRP mRNA and functional protein expression. EGF-stimulated CREB phosphorylation and BCRP induction were diminished by inhibition of EGFR, PI3K/AKT or RAS/MAPK signaling. CREB silencing using RNA interference reduced basal levels of BCRP mRNA and diminished the induction of BCRP by EGF. Chromatin immunoprecipitation assays confirmed that a putative CRE site on the BCRP promoter bound p-CREB by a point mutation of the CRE site abolished EGF-induced stimulation of BCRP promoter reporter activity. Furthermore, the CREB co-activator, cAMP-regulated transcriptional co-activator (CRTC2), is involved in CREB-mediated BCRP transcription: androgen depletion of LNCaP human prostate cancer cells increased both CREB phosphorylation and CRTC2 nuclear translocation, and enhanced BCRP expression. Silencing CREB or CRTC2 reduced basal BCRP expression and BCRP induction under androgen-depletion conditions. This novel CRE site plays a central role in mediating BCRP gene expression in several human cancer cell lines following activation of multiple cancer-relevant signaling pathways. PMID:25615818

  20. A novel phase variation mechanism in the meningococcus driven by a ligand-responsive repressor and differential spacing of distal promoter elements.

    PubMed

    Metruccio, Matteo M E; Pigozzi, Eva; Roncarati, Davide; Berlanda Scorza, Francesco; Norais, Nathalie; Hill, Stuart A; Scarlato, Vincenzo; Delany, Isabel

    2009-12-01

    Phase variable expression, mediated by high frequency reversible changes in the length of simple sequence repeats, facilitates adaptation of bacterial populations to changing environments and is frequently important in bacterial virulence. Here we elucidate a novel phase variable mechanism for NadA, an adhesin and invasin of Neisseria meningitidis. The NadR repressor protein binds to operators flanking the phase variable tract and contributes to the differential expression levels of phase variant promoters with different numbers of repeats likely due to different spacing between operators. We show that IHF binds between these operators, and may permit looping of the promoter, allowing interaction of NadR at operators located distally or overlapping the promoter. The 4-hydroxyphenylacetic acid, a metabolite of aromatic amino acid catabolism that is secreted in saliva, induces NadA expression by inhibiting the DNA binding activity of the repressor. When induced, only minor differences are evident between NadR-independent transcription levels of promoter phase variants and are likely due to differential RNA polymerase contacts leading to altered promoter activity. Our results suggest that NadA expression is under both stochastic and tight environmental-sensing regulatory control, both mediated by the NadR repressor, and may be induced during colonization of the oropharynx where it plays a major role in the successful adhesion and invasion of the mucosa. Hence, simple sequence repeats in promoter regions may be a strategy used by host-adapted bacterial pathogens to randomly switch between expression states that may nonetheless still be induced by appropriate niche-specific signals. PMID:20041170

  1. Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P-4501A1 gene.

    PubMed Central

    Imataka, H; Sogawa, K; Yasumoto, K; Kikuchi, Y; Sasano, K; Kobayashi, A; Hayami, M; Fujii-Kuriyama, Y

    1992-01-01

    The cDNAs for two DNA binding proteins of BTE, a GC box sequence in the promoter region of the P-450IA1(CYP1A1) gene, have been isolated from a rat liver cDNA library by using the BTE sequence as a binding probe. While one is for the rat equivalent to human Sp1, the other encodes a primary structure of 244 amino acids, a novel DNA binding protein designated BTEB. Both proteins contain a zinc finger domain of Cys-Cys/His-His motif that is repeated three times with sequence similarity of 72% to each other, otherwise they share little or no similarity. The function of BTEB was analysed by transfection of plasmids expressing BTEB and/or Sp1 with appropriate reporter plasmids into a monkey cell line CV-1 and compared with Sp1. BTEB and Sp1 activated the expression of genes with repeated GC box sequences in promoters such as the simian virus 40 early promoter and the human immunodeficiency virus-1 long terminal repeat promoter. In contrast, BTEB repressed the activity of a promoter containing BTE, a single GC box of the CYP1A1 gene that is stimulated by Sp1. When the BTE sequence was repeated five times, however, BTEB turned out to be an activator of the promoter. RNA blot analysis showed that mRNAs for BTEB and Sp1 were expressed in all tissues tested, but their concentrations varied independently in tissues. The former mRNA was rich in the brain, kidney, lung and testis, while the latter was relatively abundant in the thymus and spleen.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1356762

  2. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    SciTech Connect

    Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori . E-mail: aaohta@mail.ecc.u-tokyo.ac.jp

    2005-04-01

    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism.

  3. Donor treatment with pegylated G-CSF augments the generation of IL-10-producing regulatory T cells and promotes transplantation tolerance.

    PubMed

    Morris, Edward S; MacDonald, Kelli P A; Rowe, Vanessa; Johnson, Diana H; Banovic, Tatjana; Clouston, Andrew D; Hill, Geoffrey R

    2004-05-01

    We investigated whether the protection from graft-versus-host disease (GVHD) afforded by donor treatment with granulocyte colony-stimulating factor (G-CSF) could be enhanced by dose escalation. Donor treatment with human G-CSF prevented GVHD in the B6 --> B6D2F1 murine model in a dose-dependent fashion, and murine G-CSF provided equivalent protection from GVHD at 10-fold lower doses. Donor pretreatment with a single dose of pegylated G-CSF (peg-G-CSF) prevented GVHD to a significantly greater extent than standard G-CSF (survival, 75% versus 11%, P <.001). Donor T cells from peg-G-CSF-treated donors failed to proliferate to alloantigen and inhibited the responses of control T cells in an interleukin 10 (IL-10)-dependent fashion in vitro. T cells from peg-G-CSF-treated IL-10(-/-) donors induced lethal GVHD; T cells from peg-G-CSF-treated wild-type (wt) donors promoted long-term survival. Whereas T cells from peg-G-CSF wt donors were able to regulate GVHD induced by T cells from control-treated donors, T cells from G-CSF-treated wt donors and peg-G-CSF-treated IL-10(-/-) donors did not prevent mortality. Thus, peg-G-CSF is markedly superior to standard G-CSF for the prevention of GVHD following allogeneic stem cell transplantation (SCT), due to the generation of IL-10-producing regulatory T cells. These data support prospective clinical trials of peg-G-CSF-mobilized allogeneic blood SCT. PMID:14726406

  4. A Conserved C-terminal Element in the Yeast Doa10 and Human MARCH6 Ubiquitin Ligases Required for Selective Substrate Degradation.

    PubMed

    Zattas, Dimitrios; Berk, Jason M; Kreft, Stefan G; Hochstrasser, Mark

    2016-06-01

    Specific proteins are modified by ubiquitin at the endoplasmic reticulum (ER) and are degraded by the proteasome, a process referred to as ER-associated protein degradation. In Saccharomyces cerevisiae, two principal ER-associated protein degradation ubiquitin ligases (E3s) reside in the ER membrane, Doa10 and Hrd1. The membrane-embedded Doa10 functions in the degradation of substrates in the ER membrane, nuclear envelope, cytoplasm, and nucleoplasm. How most E3 ligases, including Doa10, recognize their protein substrates remains poorly understood. Here we describe a previously unappreciated but highly conserved C-terminal element (CTE) in Doa10; this cytosolically disposed 16-residue motif follows the final transmembrane helix. A conserved CTE asparagine residue is required for ubiquitylation and degradation of a subset of Doa10 substrates. Such selectivity suggests that the Doa10 CTE is involved in substrate discrimination and not general ligase function. Functional conservation of the CTE was investigated in the human ortholog of Doa10, MARCH6 (TEB4), by analyzing MARCH6 autoregulation of its own degradation. Mutation of the conserved Asn residue (N890A) in the MARCH6 CTE stabilized the normally short lived enzyme to the same degree as a catalytically inactivating mutation (C9A). We also report the localization of endogenous MARCH6 to the ER using epitope tagging of the genomic MARCH6 locus by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated genome editing. These localization and CTE analyses support the inference that MARCH6 and Doa10 are functionally similar. Moreover, our results with the yeast enzyme suggest that the CTE is involved in the recognition and/or ubiquitylation of specific protein substrates. PMID:27068744

  5. Simultaneous Determination of 10 Ultratrace Elements in Infant Formula, Adult Nutritionals, and Milk Products by ICP/MS After Pressure Digestion: Single-Laboratory Validation.

    PubMed

    Dubascoux, Stephane; Nicolas, Marine; Rime, Celine Fragniere; Payot, Janique Richoz; Poitevin, Eric

    2015-01-01

    A single-laboratory validation (SLV) is presented for the simultaneous determination of 10 ultratrace elements (UTEs) including aluminum (Al), arsenic (As), cadmium (Cd), cobalt (Co), chromium (Cr), mercury (Hg), molybdenum (Mo), lead (Pb), selenium (Se), and tin (Sn) in infant formulas, adult nutritionals, and milk based products by inductively coupled plasma (ICP)/MS after acidic pressure digestion. This robust and routine multielemental method is based on several official methods with modifications of sample preparation using either microwave digestion or high pressure ashing and of analytical conditions using ICP/MS with collision cell technology. This SLV fulfills AOAC method performance criteria in terms of linearity, specificity, sensitivity, precision, and accuracy and fully answers most international regulation limits for trace contaminants and/or recommended nutrient levels established for 10 UTEs in targeted matrixes. PMID:26268978

  6. Source apportionment by PMF on elemental concentrations obtained by PIXE analysis of PM10 samples collected at the vicinity of lignite power plants and mines in Megalopolis, Greece

    NASA Astrophysics Data System (ADS)

    Manousakas, M.; Diapouli, E.; Papaefthymiou, H.; Migliori, A.; Karydas, A. G.; Padilla-Alvarez, R.; Bogovac, M.; Kaiser, R. B.; Jaksic, M.; Bogdanovic-Radovic, I.; Eleftheriadis, K.

    2015-04-01

    Particulate matter (PM) is an important constituent of atmospheric pollution especially in areas under the influence of industrial emissions. Megalopolis is a small city of 10,000 inhabitants located in central Peloponnese in close proximity to three coal opencast mines and two lignite fired power plants. 50 PM10 samples were collected in Megalopolis during the years 2009-11 for elemental and multivariate analysis. For the elemental analysis PIXE was used as one of the most effective techniques in APM analytical characterization. Altogether, the concentrations of 22 elements (Z = 11-33), whereas Black Carbon was also determined for each sample using a reflectometer. Factorization software was used (EPA PMF 3.0) for source apportionment analysis. The analysis revealed that major emission sources were soil dust 33% (7.94 ± 0.27 μg/m3), biomass burning 19% (4.43 ± 0.27 μg/m3), road dust 15% (3.63 ± 0.37 μg/m3), power plant emissions 13% (3.01 ± 0.44 μg/m3), traffic 12% (2.82 ± 0.37 μg/m3), and sea spray 8% (1.99 ± 0.41 μg/m3). Wind trajectories have suggested that metals associated with emission from the power plants came mainly from west and were connected with the locations of the lignite mines located in this area. Soil resuspension, road dust and power plant emissions increased during the warm season of the year, while traffic/secondary, sea spray and biomass burning become dominant during the cold season.

  7. A 9 bp cis-element in the promoters of class I small heat shock protein genes on chromosome 3 in rice mediates L-azetidine-2-carboxylic acid and heat shock responses

    PubMed Central

    Guan, Jiahn-Chou; Yeh, Ching-Hui; Lin, Ya-Ping; Ke, Yi-Ting; Chen, Ming-Tse; You, Jia-Wen; Liu, Yi-Hsin; Lu, Chung-An; Wu, Shaw-Jye; Lin, Chu-Yung

    2010-01-01

    In rice, the class I small heat shock protein (sHSP-CI) genes were found to be selectively induced by L-azetidine-2-carboxylic acid (AZC) on chromosome 3 but not chromosome 1. Here it is shown that a novel cis-responsive element contributed to the differential regulation. By serial deletion and computational analysis, a 9 bp putative AZC-responsive element (AZRE), GTCCTGGAC, located between nucleotides –186 and –178 relative to the transcription initiation site of Oshsp17.3 was revealed. Deletion of this putative AZRE from the promoter abolished its ability to be induced by AZC. Moreover, electrophoretic mobility shift assay (EMSA) revealed that the AZRE interacted specifically with nuclear proteins from AZC-treated rice seedlings. Two AZRE–protein complexes were detected by EMSA, one of which could be competed out by a canonical heat shock element (HSE). Deletion of the AZRE also affected the HS response. Furthermore, transient co-expression of the heat shock factor OsHsfA4b with the AZRE in the promoter of Oshsp17.3 was effective. The requirement for the putative AZRE for AZC and HS responses in transgenic Arabidopsis was also shown. Thus, AZRE represents an alternative form of heat HSE, and its interaction with canonical HSEs through heat shock factors may be required to respond to HS and AZC. PMID:20643810

  8. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  9. Ty1 Integrase Interacts with RNA Polymerase III-specific Subcomplexes to Promote Insertion of Ty1 Elements Upstream of Polymerase (Pol) III-transcribed Genes.

    PubMed

    Cheung, Stephanie; Ma, Lina; Chan, Patrick H W; Hu, Hui-Lan; Mayor, Thibault; Chen, Hung-Ta; Measday, Vivien

    2016-03-18

    Retrotransposons are eukaryotic mobile genetic elements that transpose by reverse transcription of an RNA intermediate and are derived from retroviruses. The Ty1 retrotransposon of Saccharomyces cerevisiae belongs to the Ty1/Copia superfamily, which is present in every eukaryotic genome. Insertion of Ty1 elements into the S. cerevisiae genome, which occurs upstream of genes transcribed by RNA Pol III, requires the Ty1 element-encoded integrase (IN) protein. Here, we report that Ty1-IN interacts in vivo and in vitro with RNA Pol III-specific subunits to mediate insertion of Ty1 elements upstream of Pol III-transcribed genes. Purification of Ty1-IN from yeast cells followed by mass spectrometry (MS) analysis identified an enrichment of peptides corresponding to the Rpc82/34/31 and Rpc53/37 Pol III-specific subcomplexes. GFP-Trap purification of multiple GFP-tagged RNA Pol III subunits from yeast extracts revealed that the majority of Pol III subunits co-purify with Ty1-IN but not two other complexes required for Pol III transcription, transcription initiation factors (TF) IIIB and IIIC. In vitro binding studies with bacterially purified RNA Pol III proteins demonstrate that Rpc31, Rpc34, and Rpc53 interact directly with Ty1-IN. Deletion of the N-terminal 280 amino acids of Rpc53 abrogates insertion of Ty1 elements upstream of the hot spot SUF16 tRNA locus and abolishes the interaction of Ty1-IN with Rpc37. The Rpc53/37 complex therefore has an important role in targeting Ty1-IN to insert Ty1 elements upstream of Pol III-transcribed genes. PMID:26797132

  10. Functional analysis of basic transcription element (BTE)-binding protein (BTEB) 3 and BTEB4, a novel Sp1-like protein, reveals a subfamily of transcriptional repressors for the BTE site of the cytochrome P4501A1 gene promoter.

    PubMed Central

    Kaczynski, Joanna A; Conley, Abigail A; Fernandez Zapico, Martin; Delgado, Sharon M; Zhang, Jin-San; Urrutia, Raul

    2002-01-01

    The Sp1-like family of transcription factors is emerging as an integral part of the cellular machinery involved in the control of gene expression. Members of this family of proteins contain three highly homologous C-terminal zinc-finger motifs that bind GC-rich sequences found in the promoters of a diverse number of genes, such as the basic transcription element (BTE) in the promoter of the carcinogen-metabolizing cytochrome P4501A1 (CYP1A1) gene. In the present study, we report the molecular and functional characterization of BTE-binding protein (BTEB) 4, a novel ubiquitously expressed member of the Sp1-like proteins family. This protein represents a new homologue of BTEB1, originally described as a regulator of the BTE site in the CYP1A1 gene promoter. Similarly to the recently described BTEB3, we demonstrate that the N-terminal region of BTEB4 directly represses transcription and binds the co-repressor mSin3A. In addition, we show that the C-terminal zinc-finger domain of BTEB4 binds specifically the BTE site of the CYP1A1 promoter, similar to BTEB1 and BTEB3. Also, we show that both BTEB3 and BTEB4 repress the CYP1A1 gene promoter via the BTE site in HepG2 and BxPC3 cells. Thus the identification of this protein expands the repertoire of BTEB-like members of the Sp1-like protein family involved in transcriptional repression. Furthermore, our results demonstrate that the BTEB subfamily can repress the CYP1A1 gene promoter via the BTE site. PMID:12036432

  11. Elemental characterization and source apportionment of PM10 and PM2.5 in the western coastal area of central Taiwan.

    PubMed

    Hsu, Chin-Yu; Chiang, Hung-Che; Lin, Sheng-Lun; Chen, Mu-Jean; Lin, Tzu-Yu; Chen, Yu-Cheng

    2016-01-15

    This study investigated seasonal variations in PM10 and PM2.5 mass and associated trace metal concentrations in a residential area in proximity to the crude oil refinery plants and industrial parks of central Taiwan. Particle measurements were conducted during winter, spring and summer in 2013 and 2014. Twenty-six trace metals in PM10 and PM2.5 were analyzed using ICP-MS. Multiple approaches of the backward trajectory model, enrichment factor (EF), Lanthanum enrichment and positive matrix fraction (PMF) were used to identify potential sources of particulate metals. Mean concentrations of PM10 in winter, spring and summer were 76.4 ± 22.6, 33.2 ± 9.9 and 37.4 ± 17.0 μg m(-3), respectively, while mean levels of PM2.5 in winter, spring and summer were 47.8 ± 20.0, 23.9 ± 11.2 and 16.3 ± 8.2 μg m(-3), respectively. The concentrations of carcinogenic metals (Ni, As and adjusted Cr(VI)) in PM10 and PM2.5 exceeded the guideline limits published by WHO. The result of EF analysis confirmed that Mo, Sb, Cd, Zn, Mg, Cr, As, Pb, Cu, Ni and V were attributable to anthropogenic emission. PMF analysis demonstrated that trace metals in PM10 and PM2.5 were from the similar sources, such as coal combustion, oil combustion and traffic-related emission, except for soil dust and crustal element emissions only observed in PM10 and secondary aluminum smelter only observed in PM2.5. Considering health-related particulate metals, the traffic-related emission and coal combustion for PM10 and PM2.5, respectively, are important to control for reducing potential carcinogenic risk. The results could aid efforts to clarify the impact of source-specific origins on human health. PMID:26473714

  12. Identification of conserved regulatory elements in upstream promoter regions of mammals at relaxed thresholds by comparative genomics - a case study using PEPCK

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Comparative genomics is the primary method to discover regulatory elements by identifying conserved sequences due to evolutionary constraints by cross-species genome comparison. Except for the most conserved and prominent