Science.gov

Sample records for 10 promoter element

  1. Mutational analysis of Escherichia coli σ28 and its target promoters reveal recognition of a composite −10 region, comprised of an “extended −10 motif” and a core-10 element

    PubMed Central

    Koo, Byoung-Mo; Rhodius, Virgil A.; Campbell, Elizabeth A.; Gross, Carol A.

    2009-01-01

    Summary σ28 controls the expression of flagella related genes and is the most widely distributed alternative σ factor, present in motile gram-positive and gram-negative bacteria. The distinguishing feature of σ28 promoters is a long −10 region (GCCGATAA). Despite the fact that the upstream GC is highly conserved, previous studies have not indicated a functional role for this motif. Here we examine the functional relevance of the GCCG motif and determine which residues in σ28 participate in its recognition. We find that the GCCG motif is a functionally important composite element. The upstream GC constitutes an extended −10 motif and is recognized by R91, a residue in Domain 3 of σ28. The downstream CG is the upstream edge of −10 region of the promoter; two residues in Region 2.4, D81 and R84, participate in its recognition. Consistent with their role in base-specific recognition of the promoter, R91, D81 and D84 are universally conserved in σ28 orthologues. σ28 is the second Group 3 σ shown to use an extended −10 region in promoter recognition, raising the possibility that other Group 3 σs will do so as well. PMID:19400790

  2. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 1 2014-10-01 2014-10-01 false Message elements. 10.420 Section 10.420... § 10.420 Message elements. A WEA Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time (with...

  3. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 1 2012-10-01 2012-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  4. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 1 2011-10-01 2011-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  5. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 1 2013-10-01 2013-10-01 false Message elements. 10.420 Section 10.420... § 10.420 Message elements. A WEA Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time (with...

  6. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  7. Protein binding elements in the human beta-polymerase promoter.

    PubMed Central

    Englander, E W; Wilson, S H

    1990-01-01

    The core promoter for human DNA polymerase beta contains discrete binding sites for mammalian nuclear proteins, as revealed by DNasel footprinting and gel mobility shift assays. Two sites correspond to sequences identical with the Sp1 factor binding element, and a third site includes an eight residue palindromic sequence, TGACGTCA, known as the CRE element of several cAMP responsive promoters; the 5 to 10 residues flanking this palindrome on each side have no apparent sequence homology with known elements in other promoters. Nuclear extract from a variety of tissues and cells were examined; these included rat liver and testes and cultured cells of human and hamster origin. The DNasel footprint is strong over and around the palindromic element for each of the extracts and is equivalent in size (approximately 22 residues); footprinting over the Sp1 binding sites is seen also. Two potential tissue-specific binding sites, present in liver but not in testes, were found corresponding to residues -13 to -10 and +33 to +48, respectively. Protein binding to the palindromic element was confirmed by an electrophoretic mobility shift assay with the core promoter as probe. Binding specificity of the 22 residue palindromic element, as revealed by oligonucleotide competition, is different from that of AP-1 binding element. Controlled proteolysis with trypsin was used to study structural properties of proteins forming the mobility shift bands. Following digestion with trypsin, most of the palindrome binding activity of each extract corresponded to a sharp, faster migrating band, potentially representing a DNA binding domain of the palindrome binding protein. Images PMID:2315044

  8. Soybean GH3 promoter contains multiple auxin-inducible elements.

    PubMed Central

    Liu, Z B; Ulmasov, T; Shi, X; Hagen, G; Guilfoyle, T J

    1994-01-01

    The soybean GH3 gene is transcriptionally induced in a wide variety of tissues and organs within minutes after auxin application. To determine the sequence elements that confer auxin inducibility to the GH3 promoter, we used gel mobility shift assays, methylation interference, deletion analysis, linker scanning, site-directed mutagenesis, and gain-of-function analysis with a minimal cauliflower mosaic virus 35S promoter. We identified at least three sequence elements within the GH3 promoter that are auxin inducible and can function independently of one another. Two of these elements are found in a 76-bp fragment, and these consist of two independent 25- and 32-bp auxin-inducible elements. Both of these 25- and 32-bp auxin-inducible elements contain the sequence TGTCTC just upstream of an AATAAG. An additional auxin-inducible element was found upstream of the 76-bp auxin-inducible fragment; this can function independently of the 76-bp fragment. Two TGA-box or Hex-like elements (TGACGTAA and TGACGTGGC) in the promoter, which are strong binding sites for proteins in plant nuclear extracts, may also elevate the level of auxin inducibility of the GH3 promoter. The multiple auxin-inducible elements within the GH3 promoter contribute incrementally to the overall level of auxin induction observed with this promoter. PMID:8038604

  9. Elements Involved In Promoting Eosinophilic Gastrointestinal Disorders

    PubMed Central

    Shukla, Anshi; Mishra, Akanksha; Venkateshaiah, Sathisha Upparahalli; Manohar, Murli; Mahadevappa, Chandrashekara Puthanapura; Mishra, Anil

    2015-01-01

    review, we have discussed the key elements that are critical in the disease initiation, progression, pathogenesis and important for future diagnostic and therapeutic interventions for EGID. PMID:27840774

  10. Functional redundancy of octamer elements in the mouse mammary tumor virus promoter.

    PubMed Central

    Huang, M; Lee, J W; Peterson, D O

    1993-01-01

    The promoter of mouse mammary tumor virus contains three overlapping sequence elements related to the octamer consensus (ATGCAAAT) that are largely contained within two 10 bp direct repeats (CTTATGTAAA) separated by a 2 bp spacer between 60 and 39 relative to the start of transcription. Gel electrophoresis mobility shift competition assays demonstrate that the most distal of these octamer-related elements is recognized by a protein that also binds to the most proximal element, while the central octamer-related element is not efficiently recognized. Transient transfection assays with altered promoters reveal that the portion of the 10 bp repeat that is not related to the octamer consensus appears not to be important for transcription. The distal and proximal octamer-related elements are, at least to some extent, functionally redundant. Complete deletion of one element has little or no effect on promoter activity so long as certain spacing constraints among remaining promoter elements are maintained. Systematic variation of such spacing reveals a cyclic effect on promoter activity corresponding to the periodicity of Bform DNA, suggesting functional interactions between proteins bound to adjacent sites. Images PMID:8255781

  11. Regulatory elements of the Staphylococcus aureus protein A (Spa) promoter.

    PubMed

    Gao, Jinxin; Stewart, George C

    2004-06-01

    Staphylococcal protein A (Spa) is an important virulence factor of Staphylococcus aureus. Transcription of the spa determinant occurs during the exponential growth phase and is repressed when the cells enter the postexponential growth phase. Regulation of spa expression has been found to be complicated, with regulation involving multiple factors, including Agr, SarA, SarS, SarT, Rot, and MgrA. Our understanding of how these factors work on the spa promoter to regulate spa expression is incomplete. To identify regulatory sites within the spa promoter, analysis of deletion derivatives of the promoter in host strains deficient in one or more of the regulatory factors was undertaken, and several critical features of spa regulation were revealed. The transcriptional start sites of spa were determined by primer extension. The spa promoter sequences were subcloned in front of a promoterless chloramphenicol acetyltransferase reporter gene. Various lengths of spa truncations with the same 3' end were constructed, and the resultant plasmids were transduced into strains with different regulatory genetic backgrounds. Our results identified upstream promoter sequences necessary for Agr system regulation of spa expression. The cis elements for SarS activity, an activator of spa expression, and for SarA activity, a repressor of spa expression, were identified. The well-characterized SarA consensus sequence on the spa promoter was found to be insufficient for SarA repression of the spa promoter. Full repression required the presence of a second consensus site adjacent to the SarS binding site. Sequences directly upstream of the core promoter sequence were found to stimulate transcription.

  12. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 25 2011-07-01 2011-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  13. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 25 2014-07-01 2014-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  14. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 26 2012-07-01 2011-07-01 true Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  15. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 26 2013-07-01 2013-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  16. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  17. Positive and negative elements regulate a melanocyte-specific promoter.

    PubMed Central

    Lowings, P; Yavuzer, U; Goding, C R

    1992-01-01

    Melanocytes are specialized cells residing in the hair follicles, the eye, and the basal layer of the human epidermis whose primary function is the production of the pigment melanin, giving rise to skin, hair, and eye color. Melanogenesis, a process unique to melanocytes that involves the processing of tyrosine by a number of melanocyte-specific enzymes, including tyrosinase and tyrosinase-related protein 1 (TRP-1), occurs only after differentiation from the melanocyte precursor, the melanoblast. In humans, melanogenesis is inducible by UV irradiation, with melanin being transferred from the melanocyte in the epidermis to the surrounding keratinocytes as protection from UV-induced damage. Excessive exposure to UV, however, is the primary cause of malignant melanoma, an increasingly common and highly aggressive disease. As an initial approach to understanding the regulation of melanocyte differentiation and melanocyte-specific transcription, we have isolated the gene encoding TRP-1 and examined the cis- and trans-acting factors required for cell-type-specific expression. We find that the TRP-1 promoter comprises both positive and negative regulatory elements which confer efficient expression in a TRP-1-expressing, pigmented melanoma cell line but not in NIH 3T3 or JEG3 cells and that a minimal promoter extending between -44 and +107 is sufficient for cell-type-specific expression. Assays for DNA-protein interactions coupled with extensive mutagenesis identified three factors, whose binding correlated with the function of two positive and one negative regulatory element. One of these factors, termed M-box-binding factor 1, binds to an 11-bp motif, the M box, which acts as a positive regulatory element both in TRP-1-expressing and -nonexpressing cell lines, despite being entirely conserved between the melanocyte-specific tyrosinase and TRP-1 promoters. The possible mechanisms underlying melanocyte-specific gene expression are discussed. Images PMID:1321344

  18. 27 CFR 10.24 - Sales promotion contests.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Sales promotion contests. 10.24 Section 10.24 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS COMMERCIAL BRIBERY Commercial Bribery § 10.24 Sales promotion...

  19. DBTGR: a database of tunicate promoters and their regulatory elements.

    PubMed

    Sierro, Nicolas; Kusakabe, Takehiro; Park, Keun-Joon; Yamashita, Riu; Kinoshita, Kengo; Nakai, Kenta

    2006-01-01

    The high similarity of tunicates and vertebrates during their development coupled with the transparency of tunicate larvae, their well-studied cell lineages and the availability of simple and efficient transgenesis methods makes of this subphylum an ideal system for the investigation of vertebrate physiological and developmental processes. Recently, the sequencing of two different Ciona genomes has lead to the identification of numerous genes. In order to better understand the regulation of these genes, a database was created containing information on regulation of tunicate genes collected from literature. It includes for instance information regarding the minimal promoter length, the transcription factors involved and their binding sites, as well as the localization of the gene expression. Additionally, binding sites for characterized transcription factors were predicted based on published in vitro recognition sites. Comparison of the promoters of homologous genes in different species is also provided to allow identification of conserved cis elements. At the time of writing, information about 184 promoters, containing 73 identified binding sites and >2000 newly predicted binding sites is available. This database is accessible at http://dbtgr.hgc.jp.

  20. Functional elements of the steroid hormone-responsive promoter of mouse mammary tumor virus.

    PubMed Central

    Toohey, M G; Lee, J W; Huang, M; Peterson, D O

    1990-01-01

    Transcription from the promoter of mouse mammary tumor virus is subject to induction by several classes of steroid hormones as well as to repression by a negative regulatory element present in the long terminal repeats of proviral DNA. In order to characterize the functional elements of the promoter that in some way must respond to these regulatory signals, a number of promoter mutations were constructed, including a set of linker-scanning mutations across the entire promoter region. Analysis of these mutated promoters with a transient-transfection assay defined at least three mutation-sensitive promoter elements that are required for both basal and hormone-induced transcription. One mutation-sensitive region contains a TATA element located at approximately position -30 with respect to the start of transcription. A second mutation-sensitive region contains two 10-base-pair direct repeats located between positions -60 and -38, within which are embedded three copies of octamer-related sequences; complete disruption of this region of the promoter leads to a more severe decrease in transcription than do any of the linker-scanning mutations, suggesting that the repeated sequences may be at least partially functionally redundant. Gel electrophoresis mobility shift assays were used to demonstrate specific binding of a nuclear protein to this region of the promoter. A third mutation-sensitive region contains a binding site for nuclear factor 1 (NF-1) located between positions -77 and -63. Site-directed mutations in the NF-1-binding site which increase the apparent affinity of NF-1 for the promoter in vitro do not decrease the hormone dependence of transcription, suggesting that transcriptional activation mediated by steroid hormone-receptor complexes cannot be explained by facilitation or stabilization of the interaction of promoter sequences with NF-1 and consistent with the idea that binding of NF-1 is not rate determining in transcription from the mouse mammary tumor

  1. Analysis of core promoter sequences located downstream from the TATA element in the hsp70 promoter from Drosophila melanogaster.

    PubMed

    Wu, C H; Madabusi, L; Nishioka, H; Emanuel, P; Sypes, M; Arkhipova, I; Gilmour, D S

    2001-03-01

    TFIID recognizes multiple sequence elements in the hsp70 promoter of Drosophila. Here, we investigate the function of sequences downstream from the TATA element. A mutation in the initiator was identified that caused an eightfold reduction in binding of TFIID and a fourfold reduction in transcription in vitro. Another mutation in the +24 to +29 region was somewhat less inhibitory, but a mutation in the +14 to +19 region had essentially no effect. The normal promoter and the mutants in the initiator and the +24 to +29 region were transformed into flies by P element-mediated transformation. The initiator mutation reduced expression an average of twofold in adult flies, whereas the mutation in the +24 to +29 region had essentially no effect. In contrast, a promoter combining the two mutations was expressed an average of sixfold less than the wild type. The results suggest that the initiator and the +24 to +29 region could serve overlapping functions in vivo. Protein-DNA cross-linking was used to identify which subunits of TFIID contact the +24 to +29 region and the initiator. No specific subunits were found to cross-link to the +24 to +29 region. In contrast, the initiator cross-linked exclusively to dTAF230. Remarkably, dTAF230 cross-links approximately 10 times more efficiently to the nontranscribed strand than to the transcribed strand at the initiator.

  2. Identification and characterization of a critical CP2-binding element in the human interleukin-4 promoter.

    PubMed

    Casolaro, V; Keane-Myers, A M; Swendeman, S L; Steindler, C; Zhong, F; Sheffery, M; Georas, S N; Ono, S J

    2000-11-24

    Expression of cytokine genes in T cells is thought to result from a complex network of antigen- and mitogen-activated transcriptional regulators. CP2, a factor homologous to Drosophila Elf-1 and previously found to be a critical regulator of several viral and cellular genes in response to developmental signals, is rapidly activated in T helper (Th) cells in response to mitogenic stimulation. Here we show that overexpression of CP2 enhances interleukin (IL)-4 promoter-driven chloramphenicol acetyltransferase expression, while repressing IL-2 promoter activity, in transiently transfected Jurkat cells. A CP2-protected element, partially overlapping the nuclear factor of activated T cell-binding P2 sequence, was required for IL-4 promoter activation in CP2-overexpressing Jurkat cells. This CP2-response element is the site of a cooperative interaction between CP2 and an inducible heteromeric co-factor(s). Mutation of conserved nucleotide contacts within the CP2-response element prevented CP2 binding and significantly reduced constitutive and induced IL-4 promoter activity. Expression of a CP2 mutant lacking the Elf-1-homology region of the DNA-binding domain inhibited IL-4 promoter activity in a dominant negative fashion in transiently transfected Jurkat cells. Moreover, overexpressed CP2 markedly enhanced, while its dominant negative mutant consistently suppressed, expression of the endogenous IL-4 gene in the murine Th2 cell line D10. Taken together, these findings point to CP2 as a critical IL-4 transactivator in Th cells.

  3. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Elements of a rated order. 217.32 Section 217.32 Energy DEPARTMENT OF ENERGY OIL ENERGY PRIORITIES AND ALLOCATIONS SYSTEM Placement of Rated Orders § 217.32 Elements of a rated order. Each rated order must include: (a) The appropriate priority rating (e.g. DO-F1...

  4. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  5. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Elements of a rated order. 217.32 Section 217.32 Energy DEPARTMENT OF ENERGY OIL ENERGY PRIORITIES AND ALLOCATIONS SYSTEM Placement of Rated Orders § 217.32 Elements of a rated order. Each rated order must include: (a) The appropriate priority rating (e.g. DO-F1...

  6. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Elements of an allocation order. 217.54 Section 217.54 Energy DEPARTMENT OF ENERGY OIL ENERGY PRIORITIES AND ALLOCATIONS SYSTEM Allocation Actions § 217.54 Elements of an allocation order. Each allocation order must include: (a) A detailed description of...

  7. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Elements of an allocation order. 217.54 Section 217.54 Energy DEPARTMENT OF ENERGY OIL ENERGY PRIORITIES AND ALLOCATIONS SYSTEM Allocation Actions § 217.54 Elements of an allocation order. Each allocation order must include: (a) A detailed description of...

  8. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 4 2014-01-01 2014-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  9. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Elements of an allocation order. 217.54 Section 217.54 Energy DEPARTMENT OF ENERGY OIL ENERGY PRIORITIES AND ALLOCATIONS SYSTEM Allocation Actions § 217.54 Elements of an allocation order. Each allocation order must include: (a) A detailed description of...

  10. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Elements of a rated order. 217.32 Section 217.32 Energy DEPARTMENT OF ENERGY OIL ENERGY PRIORITIES AND ALLOCATIONS SYSTEM Placement of Rated Orders § 217.32 Elements of a rated order. Each rated order must include: (a) The appropriate priority rating (e.g. DO-F1...

  11. Alpha3, a transposable element that promotes host sexual reproduction.

    PubMed

    Barsoum, Emad; Martinez, Paula; Aström, Stefan U

    2010-01-01

    Theoretical models predict that selfish DNA elements require host sex to persist in a population. Therefore, a transposon that induces sex would strongly favor its own spread. We demonstrate that a protein homologous to transposases, called alpha3, was essential for mating type switch in Kluyveromyces lactis. Mutational analysis showed that amino acids conserved among transposases were essential for its function. During switching, sequences in the 5' and 3' flanking regions of the alpha3 gene were joined, forming a DNA circle, showing that alpha3 mobilized from the genome. The sequences encompassing the alpha3 gene circle junctions in the mating type alpha (MATalpha) locus were essential for switching from MATalpha to MATa, suggesting that alpha3 mobilization was a coupled event. Switching also required a DNA-binding protein, Mating type switch 1 (Mts1), whose binding sites in MATalpha were important. Expression of Mts1 was repressed in MATa/MATalpha diploids and by nutrients, limiting switching to haploids in low-nutrient conditions. A hairpin-capped DNA double-strand break (DSB) was observed in the MATa locus in mre11 mutant strains, indicating that mating type switch was induced by MAT-specific DSBs. This study provides empirical evidence for selfish DNA promoting host sexual reproduction by mediating mating type switch.

  12. α3, a transposable element that promotes host sexual reproduction

    PubMed Central

    Barsoum, Emad; Martinez, Paula; Åström, Stefan U.

    2010-01-01

    Theoretical models predict that selfish DNA elements require host sex to persist in a population. Therefore, a transposon that induces sex would strongly favor its own spread. We demonstrate that a protein homologous to transposases, called α3, was essential for mating type switch in Kluyveromyces lactis. Mutational analysis showed that amino acids conserved among transposases were essential for its function. During switching, sequences in the 5′ and 3′ flanking regions of the α3 gene were joined, forming a DNA circle, showing that α3 mobilized from the genome. The sequences encompassing the α3 gene circle junctions in the mating type α (MATα) locus were essential for switching from MATα to MATa, suggesting that α3 mobilization was a coupled event. Switching also required a DNA-binding protein, Mating type switch 1 (Mts1), whose binding sites in MATα were important. Expression of Mts1 was repressed in MATa/MATα diploids and by nutrients, limiting switching to haploids in low-nutrient conditions. A hairpin-capped DNA double-strand break (DSB) was observed in the MATa locus in mre11 mutant strains, indicating that mating type switch was induced by MAT-specific DSBs. This study provides empirical evidence for selfish DNA promoting host sexual reproduction by mediating mating type switch. PMID:20008928

  13. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode inducible synthetic promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co...

  14. Identification of the core sequence elements in Penaeus stylirostris densovirus promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This manuscript describes the role of different core elements in the transcriptional activity of promoters in a marine parvovirus, Penaeus stylirostris densovirus (PstDNV) that infects shrimp. Although comprehensive information on the role of different elements in the promoters of several animal par...

  15. Identification of previously unrecognized common elements in eukaryotic promoters. A ribosomal RNA gene initiator element for RNA polymerase I.

    PubMed

    Radebaugh, C A; Gong, X; Bartholomew, B; Paule, M R

    1997-02-07

    A new ribosomal RNA promoter element with a functional role similar to the RNA polymerase II initiator (Inr) was identified. This sequence, which we dub the ribosomal Inr (rInr) is unusually conserved, even in normally divergent RNA polymerase I promoters. It functions in the recruitment of the fundamental, TATA-binding protein (TBP)-containing transcription factor, TIF-IB. All upstream elements of the exceptionally strong Acanthamoeba castellanii ribosomal RNA core promoter, to within 6 base pairs of the transcription initiation site (tis), can be deleted without loss of specific transcription initiation. Thus, the A. castellanii promoter can function in a manner similar to RNA polymerase II TATA-less promoters. Sequence-specific photo-cross-linking localizes a 96-kDa subunit of TIF-IB and the second largest RNA polymerase I subunit (A133) to the rInr sequence. A185 also photo-cross-links when polymerase is stalled at +7.

  16. [Construction and preliminary applications of a Saccharomyces cerevisiae detection plasmid using for screening promoter elements].

    PubMed

    Wang, Zhi-Fang; Wang, Zhi-Biao; Li, Li-Na; Jian-Mei, A N; Wang-Wei; Cheng, Ke-Di; Kong, Jian-Qiang

    2013-02-01

    Synthetic biology of natural products is the design and construction of new biological systems by transferring a metabolic pathway of interest products into a chassis. Large-scale production of natural products is achieved by coordinate expression of multiple genes involved in genetic pathway of desired products. Promoters are cis-elements and play important roles in the balance of the metabolic pathways controlled by multiple genes by regulating gene expression. A detection plasmid of Saccharomyces cerevisiae was constructed based on DsRed-Monomer gene encoding for a red fluorescent protein. This plasmid was used for screening the efficient promoters applying for multiple gene-controlled pathways. First of all, eight pairs of primers specific to DsRed-Monomer gene were synthesized. The rapid cloning of DsRed-Monomer gene was performed based on step-by-step extension of a short region of the gene through a series of PCR reactions. All cloned sequences were confirmed by DNA sequencing. A vector named pEASYDs-M containing full-length DsRed-Monomer gene was constructed and was used as the template for the construction of S. cerevisiae expression vector named for pYeDP60-Ds-M. pYeDP60-Ds-M was then transformed into S. cerevisiae for heterologous expression of DsRed-Monomer gene. SDS-PAGE, Western blot and fluorescence microscopy results showed that the recombinant DsRed-Monomer protein was expressed successfully in S. cerevisiae. The well-characterized DsRed-Monomer gene was then cloned into a yeast expression vector pGBT9 to obtain a promoter detection plasmid pGBT9Red. For determination efficacy of pGBT9Red, six promoters (including four inducible promoters and two constitutive promoters) were cloned by PCR from the S. cerevisiae genome, and cloned into pGBT9Red by placing upstream of DsRed-Monomer gene, separately. The fluorescence microscopy results indicated that the six promoters (GAL1, GAL2, GAL7, GAL10, TEF2 and PGK1) can regulate the expression of Ds

  17. A gene-type-specific enhancer regulates the carbamyl phosphate synthetase I promoter by cooperating with the proximal GAG activating element.

    PubMed Central

    Goping, I S; Lamontagne, S; Shore, G C; Nguyen, M

    1995-01-01

    The rat carbamyl phosphate synthetase I gene is expressed in two cell types: hepatocytes and epithelial cells of the intestinal mucosa. The proximal promoter contains a single activating element, GAG, two repressor elements (sites I and III) and an anti-repressor element (site II). Although these elements together exhibit the potential for complex regulation, they are unable to confer tissue-specific promoter activity. Here we have identified a cell-type-specific enhancer that lies 10 kilobases upstream of the promoter. Unexpectedly, the enhancer also functioned in a gene-type-specific manner. The enhancer stimulated promoter activity exclusively through the proximal GAG element. Abrogation of GAG, either directly by mutation of GAG or indirectly by sites I and III repressors, abolished enhancer activation. Conversely, activation of the heterologous thymidine kinase promoter by the enhancer required the introduction of GAG. The requirement for GAG, therefore, functions to constrain the enhancer to a specific target promoter. PMID:7784176

  18. Structural property of regulatory elements in human promoters

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2008-04-01

    The capacity of transcription factors to activate gene expression is encoded in the promoter sequences, which are composed of short regulatory motifs that function as transcription factor binding sites (TFBSs) for specific proteins. To the best of our knowledge, the structural property of TFBSs that controls transcription is still poorly understood. Rigidity is one of the important structural properties of DNA, and plays an important role in guiding DNA-binding proteins to the target sites efficiently. After analyzing the rigidity of 2897 TFBSs in 1871 human promoters, we show that TFBSs are generally more flexible than other genomic regions such as exons, introns, 3' untranslated regions, and TFBS-poor promoter regions. Furthermore, we find that the density of TFBSs is consistent with the average rigidity profile of human promoters upstream of the transcription start site, which implies that TFBSs directly influence the promoter structure. We also examine the local rigid regions probably caused by specific TFBSs such as the DNA sequence TATA(A/T)A(A/T) box, which may inhibit nucleosomes and thereby facilitate the access of transcription factors bound nearby. Our results suggest that the structural property of TFBSs accounts for the promoter structure as well as promoter activity.

  19. Cooperation between structural elements in hormono-regulated transcription from the mouse mammary tumor virus promoter.

    PubMed Central

    Gouilleux, F; Sola, B; Couette, B; Richard-Foy, H

    1991-01-01

    The mouse mammary tumor virus (MMTV) promoter is under the control of several types of regulatory agents. The proximal promoter within the long terminal repeat (LTR), from -200 to the CAP site and its regulation by steroid hormones have been extensively studied. However the precise role of sequences located upstream of this region remain unclear. We have constructed MMTV LTR deletion mutants coupled to the luciferase reporter gene and assayed their activities after transient transfection into transformed mammary epithelial cells (34i) and immortalized fibroblasts (NIH-3T3). In the absence of hormone, the MMTV promoter is almost silent, and deletions in the LTR have no significant effect on basal activity. In the presence of hormone, deletions spanning from the 5'-end to -455 have only slight effects on luciferase levels. In contrast, deletion of the region spanning from -450 to -201 leads to a dramatic decrease in transcription. A substantial decrease, more marked in 34i cells, is also clear when 90bp between -290 and -201 are deleted. At least one element cooperating positively with the glucocorticoid response element (GRE) is present between -223 and -201, as supported by the results of substitution mutation experiments. In 34i cell line, dexamethasone stimulates the MMTV LTR transcriptional activity to a level comparable to that of SV40. In contrast, in NIH-3T3 cells, MMTV promoter inducibility is weak. This results from a glucocorticoid receptor content 10-fold lower in NIH-3T3 cells than in 34i cells. Transfection of a glucocorticoid receptor expression plasmid allows recovery of a high inducibility of the MMTV promoter. This was true with all the MMTV LTR mutants studied here and suggests that NIH-3T3 cells possess all the factors necessary to cooperate with the steroid hormone in order to achieve a high transcriptional activity. PMID:1851294

  20. Assay and characterization of a strong promoter element from B. subtilis.

    PubMed

    Zhang, Ai-Ling; Liu, Hui; Yang, Ming-Ming; Gong, Yue-Sheng; Chen, Hong

    2007-03-02

    A new strong promoter fragment isolated from Bacillus subtilis was identified and characterized. Using the heat stable beta-galactosidase as reporter, the promoter fragment exhibited high expression strength both in Escherichia coli and B. subtilis. The typical prokaryotic promoter conservation regions were found in the promoter fragment and the putative promoter was identified as the control element of yxiE gene via sequencing assay and predication of promoter. To further verify and characterize the cloned strong promoter, the putative promoter was sub-cloned and the beta-Gal directed by the promoters was high-level expressed both in E. coli and B. subtilis. By means of the isolated promoter, an efficient expression system was developed in B. subtilis and the benefit and usefulness was demonstrated through expression of three heterologous and homogenous proteins. Thus, we identified a newly strong promoter of B. subtilis and provided a robust expression system for genetic engineering of B. subtilis.

  1. Alignment between DQC's 10 Essential Elements & America COMPETES Act's 12 Elements

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    In 2005, the Data Quality Campaign (DQC) identified the "10 Essential Elements of a Statewide Longitudinal Data System" to provide a roadmap for state policymakers as they built statewide longitudinal data systems designed to collect, store, & use longitudinal data to improve student achievement & outcomes. In 2007, the federal America COMPETES…

  2. Modularization of genetic elements promotes synthetic metabolic engineering.

    PubMed

    Qi, Hao; Li, Bing-Zhi; Zhang, Wen-Qian; Liu, Duo; Yuan, Ying-Jin

    2015-11-15

    In the context of emerging synthetic biology, metabolic engineering is moving to the next stage powered by new technologies. Systematical modularization of genetic elements makes it more convenient to engineer biological systems for chemical production or other desired purposes. In the past few years, progresses were made in engineering metabolic pathway using synthetic biology tools. Here, we spotlighted the topic of implementation of modularized genetic elements in metabolic engineering. First, we overviewed the principle developed for modularizing genetic elements and then discussed how the genetic modules advanced metabolic engineering studies. Next, we picked up some milestones of engineered metabolic pathway achieved in the past few years. Last, we discussed the rapid raised synthetic biology field of "building a genome" and the potential in metabolic engineering.

  3. HDAC10 promotes lung cancer proliferation via AKT phosphorylation

    PubMed Central

    Wang, Zhantong; Wang, Hsin-tzu; Duan, Baoyu; Ye, Dan; Wang, Chenxin; Jing, Ruiqi; Leng, Ye; Xi, Jiajie; Chen, Wen; Wang, Guiying; Jia, Wenwen; Zhu, Songcheng; Kang, Jiuhong

    2016-01-01

    Histone deacetylase 10 (HDAC10) is a member of the class II HDACs, and its role in cancer is emerging. In this study, we found that HDAC10 is highly expressed in lung cancer tissues. It resides mainly in the cytoplasm of lung cancer cells but resides in the nucleus of adjacent normal cells. Further examinations revealed that HDAC10 resides in the cytoplasm in multiple lung cancer cell lines, including the A549, H358 and H460 cell lines, but mainly resides in the nucleus of normal lung epithelial 16HBE cells. A leucine-rich motif, R505L506L507C508V509A510L511, was identified as its nuclear localization signal (NLS), and a mutant (Mut-505-511) featuring mutations to A at each of its original R and L positions was found to be nuclear-localization defective. Functional analysis revealed that HDAC10 promoted lung cancer cell growth and that its knockdown induced cell cycle arrest and apoptosis. Mechanistic studies showed that HDAC10 knockdown significantly decreased the phosphorylation of AKT at Ser473 and that AKT expression significantly rescued the cell cycle arrest and apoptosis elicited by HDAC10 knockdown. A co-immunoprecipitation assay suggested that HDAC10 interacts with AKT and that inhibition of HDAC10 activity decreases its interaction with and phosphorylation of AKT. Finally, we confirmed that HDAC10 promoted lung cancer proliferation in a mouse model. Our study demonstrated that HDAC10 localizes and functions in the cytoplasm of lung cancer cells, thereby underscoring its potential role in the diagnosis and treatment of lung cancer. PMID:27449083

  4. A novel upstream element compensates for an ineffectual octamer motif in an immunoglobulin V kappa promoter.

    PubMed Central

    Atchison, M L; Delmas, V; Perry, R P

    1990-01-01

    The octamer (or dc/cd) motif is considered to be a critical component of all immunoglobulin (Ig) promoters. Although the sequence of this motif is highly conserved among most Ig promoters, there are some notable examples in which efficiently expressed Ig genes contain divergent octamers with base substitutions that are demonstrably deleterious when tested with heterologous proximal promoter elements. To elucidate the mechanisms that enable these naturally occurring Ig genes to cope with divergent octamers, we analyzed two such promoters with regard to their ability to interact with relevant transcription factors. We found that the divergent octamer in the kappa O germline promoter strongly binds both Oct-1 and Oct-2 factors, presumably because of compensatory contributions by flanking DNA sequences. A more surprising result was obtained with the V kappa 19 promoter. In this case, the divergent octamer is a very weak Oct factor binding site and, without help from another upstream element, is inadequate for efficient promoter function. This additional element, termed kappa Y because of its high pyrimidine content (CTTCCTTA), serves as a binding site for a novel lymphoid-specific factor. When the divergent V kappa 19 octamer was converted to a strong Oct factor binding site by a single point mutation, the need for kappa Y was obviated. Interestingly, VH promoters that contain the same divergent octamer also contain an upstream element that is very similar to kappa Y. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:2120037

  5. Microsatellite Tandem Repeats Are Abundant in Human Promoters and Are Associated with Regulatory Elements

    PubMed Central

    Sawaya, Sterling; Bagshaw, Andrew; Buschiazzo, Emmanuel; Kumar, Pankaj; Chowdhury, Shantanu; Black, Michael A.; Gemmell, Neil

    2013-01-01

    Tandem repeats are genomic elements that are prone to changes in repeat number and are thus often polymorphic. These sequences are found at a high density at the start of human genes, in the gene’s promoter. Increasing empirical evidence suggests that length variation in these tandem repeats can affect gene regulation. One class of tandem repeats, known as microsatellites, rapidly alter in repeat number. Some of the genetic variation induced by microsatellites is known to result in phenotypic variation. Recently, our group developed a novel method for measuring the evolutionary conservation of microsatellites, and with it we discovered that human microsatellites near transcription start sites are often highly conserved. In this study, we examined the properties of microsatellites found in promoters. We found a high density of microsatellites at the start of genes. We showed that microsatellites are statistically associated with promoters using a wavelet analysis, which allowed us to test for associations on multiple scales and to control for other promoter related elements. Because promoter microsatellites tend to be G/C rich, we hypothesized that G/C rich regulatory elements may drive the association between microsatellites and promoters. Our results indicate that CpG islands, G-quadruplexes (G4) and untranslated regulatory regions have highly significant associations with microsatellites, but controlling for these elements in the analysis does not remove the association between microsatellites and promoters. Due to their intrinsic lability and their overlap with predicted functional elements, these results suggest that many promoter microsatellites have the potential to affect human phenotypes by generating mutations in regulatory elements, which may ultimately result in disease. We discuss the potential functions of human promoter microsatellites in this context. PMID:23405090

  6. Role of TATA-element in transcription from glucocorticoid receptor-responsive model promoters.

    PubMed Central

    Wieland, S; Schatt, M D; Rusconi, S

    1990-01-01

    Transcription activation properties of the rat glucocorticoid receptor (GR) on minimal, TATA-box containing or depleted promoters have been tested. We show that a cluster of Glucocorticoid Responsive Elements (GRE), upon activation by the GR, is sufficient to mediate abundant RNA-polymerase II transcription. We find that in absence of a bona fide TATA-element transcription initiates at a distance of 45-55bp from the activated GRE cluster with a marked preference for sequences homologous to the initiator element (Inr). Analyzing defined, bi-directional transcription units we demonstrate that the apparent reduction of specific transcription in strong, TATA-depleted promoters, is mainly due to loss of short-range promoter polarization. The implications for long-range promoter/enhancer communication mechanisms are also discussed. Images PMID:2402438

  7. Positive and negative regulatory elements mediating transcription from the Drosophila melanogaster actin 5C distal promoter.

    PubMed Central

    Chung, Y T; Keller, E B

    1990-01-01

    The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the distal one of which controls synthesis of actin in a tissue- and developmental stage-specific manner. This very strong promoter has widely been used for expression of heterologous genes in cultured cells. To locate functional regulatory elements in this distal promoter, mutants of the promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. The results showed that the upstream end of the promoter extends to 522 bp from the transcription start site. In addition, there are two remote activating regions about 2 kb upstream. Between -522 and -379 are two regions that exert a strong negative effect. Downstream from these negative regions are at least six positive regions and a TATA element. The strongest positive determinant of the promoter was identified at -320 as AAAATGTG by footprinting and by a replacement experiment. When the relevant region was replaced by a synthetic sequence containing this element in a random context, the transient expression activity was restored. The sequence TGTATG located at -355 was also identified as a positive element by a similar replacement approach. Apparently the very high activity of this promoter is the result of the combined activities of multiple factors. Images PMID:2123290

  8. Regulatory elements involved in the bidirectional activity of an immunoglobulin promoter.

    PubMed Central

    Doyen, N; Dreyfus, M; Rougeon, F

    1989-01-01

    We show that the promoter from the mouse VH441 heavy-chain immunoglobulin gene, when present on plasmids transiently introduced into myeloma cells, promotes transcription bidirectionally, due to the presence on both strands of TATA-like sequences bracketing the highly conserved decanucleotide element. The two divergent promoters compete for the transcriptional machinery, their relative strength ultimately reflecting the likeness of the two TATA boxes to the consensus sequence. Moreover, their relative activity is also strongly influenced by certain point mutations within the distally located heavy-chain enhancer. The bearing of these results on current concepts of promoter function is discussed. Images PMID:2494644

  9. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements

    PubMed Central

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W.; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B.; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S.; Mitchell, Jennifer A.

    2015-01-01

    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. PMID:25752748

  10. Several different upstream promoter elements can potentiate transactivation by the BPV-1 E2 protein.

    PubMed Central

    Ham, J; Dostatni, N; Arnos, F; Yaniv, M

    1991-01-01

    The enhancer and upstream promoter regions of RNA polymerase II transcribed genes modulate the rate of transcription initiation and establish specific patterns of gene expression. Both types of region consist of clusters of DNA binding sites for nuclear proteins. To determine how efficiently the same factor can activate transcription when acting as an enhancer or promoter factor, we have studied transactivation by the BPV-1 E2 protein, a papillomavirus transcriptional regulator. By cotransfecting a BPV-1 E2 expression vector and a series of reporter plasmids containing well-defined chimeric promoters we have found that whilst E2 can strongly stimulate complex promoters such as that of the HSV tk gene, it does not efficiently activate constructions containing only a TATA box and initiation site. We show that insertion of upstream promoter elements, but not of spacer DNA, between E2 binding sites and the TATA box greatly increases E2 activation. This effect was observed with more than one type of upstream promoter element, is not related to the strength of the promoter and is unlikely to result from co-operative DNA binding by E2 and the transcription factors tested. These results would suggest that E2 has the properties of an enhancer rather than promoter factor and that in certain cases promoter and enhancer factors may affect different steps in the process of transcriptional activation. Images PMID:1655407

  11. Rare earth elements--a new generation of growth promoters for pigs?

    PubMed

    He, M L; Rambeck, W A

    2000-01-01

    The present study which includes two feeding experiments was performed to investigate a possible performance enhancing effect of rare earth elements (REF) in piglets. This performance enhancing effect has been described in the Chinese literature for a long time, however, it was never tested under "western conditions". In the first feeding experiment 72 piglets at a mean BW of 7.3 kg were allotted to a control and to 4 REE groups at different levels of lanthanum chloride or an REE mixture containing mainly chlorides of lanthanum, cerium and praseodymium. The experimental period lasted 5 weeks. Positive effects of REE were found on body weight gain as well as on feed conversion ratio of the piglets. Compared to the control group, the daily weight gain was improved by 2 to 5% and feed conversion was better by up to 7%. These effects were, however, not significant. In the second feeding experiment, piglets (mean BW 17.3 kg) were fed for 8 weeks with a similar REE mixture. Significant positive effects of REE were found on both body weight gain and on feed conversion ratio by 19% and 10%, respectively. This is the first time that a performance enhancing effect of REE in pigs under western feeding conditions has been shown. Since the use of antibiotics as growth promoters in animal feed has been restricted in the European Union recently, rare earth elements might be of interest as new, safe and inexpensive alternative performance enhancers.

  12. Structure and Promoter Characterization of Aldo-Keto Reductase Family 1 B10 Gene

    PubMed Central

    Liu, Ziwen; Zhong, Linlin; Krishack, Paulette A; Robbins, Sarah; Cao, Julia X; Zhao, Yupei; Chung, Stephen; Cao, Deliang

    2009-01-01

    Aldo-keto reductase family 1 member B10 (AKR1B10) is overexpressed in human hepatocellular carcinoma, lung squamous carcinoma, and lung adenocarcinoma in smokers. Our recent studies have showed that AKR1B10 plays a critical role in the growth and proliferation of cancer cells by detoxifying reactive carbonyls and regulating fatty acid biosynthesis. However, little is known about the regulatory mechanisms of AKR1B10 expression. In this study, we determined the structure of AKR1B10 gene and characterized its promoter. The results demonstrated that AKR1B10 consists of 10 exons and 9 introns, stretching approximately 13.8 kb. A 5′-RACE study determined the transcriptional start site of AKR1B10 at 320 bp upstream of the ATG translational start codon. A TATA-like (TAATAA) and a CAAT box are present from −145 to −140 bp and −193 to −190 bp upstream of the transcriptional start site, respectively. Motif analysis recognized multiple putative oncogenic and tumor suppressor protein binding sites in the AKR1B10 promoter, including c-Ets-1, C/EBP, AP-1, and p53, but osmolytic response elements were not found. A -4,091 bp of the 5′-flanking fragment of the AKR1B10 gene was capable of driving GFP and luciferase reporter gene expression in HepG2 cells derived from human hepatocellular carcinoma; progressive 5′-deletions revealed that a −255 bp fragment possesses full promoter activity. PMID:19236911

  13. Substitution of Ribonucleotides in the T7 RNA Polymerase Promoter Element

    NASA Technical Reports Server (NTRS)

    McGinness, Kathleen E.; Joyce, Gerald F.

    2001-01-01

    A systematic analysis was carried out to examine the effects of ribonucleotide substitution at various locations within the promoter element for T7 RNA polymerase. Ribonucleotides could be introduced at most positions without significantly decreasing transcription efficiency. A critical window of residues that were intolerant of RNA substitution was defined for both the non-template and template strands of the promoter. These residues are involved in important contacts with the AT-rich recognition loop, specificity loop, and P-intercalating hairpin of the polymerase. These results highlight the malleability of T7 RNA polymerase in recognizing its promoter element and suggest that promoters with altered backbone conformations may be used in molecular biology applications that employ T7 RNA polymerase for in vitro transcription.

  14. The yeast his3 promoter contains at least two distinct elements.

    PubMed

    Struhl, K

    1982-12-01

    Phenotypic analysis of 65 mutations indicates that the yeast his3 promoter is composed of at least two separate regions of DNA. Each is necessary, but neither is sufficient for wild-type levels of his3 expression. Deletion mutations that destroy either promoter element express his3 poorly or not at all. The upstream element is located between 112 and 155 base pairs before the site of transcriptional initiation (nucleotides -112 to -155). A comparison of derivatives strongly suggests that the downstream element maps somewhere between nucleotides -32 and -52 and includes a sequence between nucleotides -45 and -52. This location coincides with sequences conserved before most eukaryotic genes(the TATA box region). By using derivatives in which his3 sequences are replaced by a small fragment of coliphage M13 DNA, three properties of the his3 promoter were established. First, his3 TATA box deletions fail to express his3 because they lack specific sequences and not because they disrupt spacing relationships between other sequences. Second, the TATA box region can be replaced functionally by the one orientation of the M13 DNA fragment that contains a TATA-like sequence. Third, the distance between the two elements (normally 90 base pairs) can be varied between 40 and 160 base pairs without markedly affecting promoter function. These results strongly suggest that yeast RNA polymerase II, unlike its Escherichia coli counterpart, does not bind simultaneously to both promoter elements, and they add further support to the view that the upstream element is not part of a transcriptionally competent binding site. This ability of the his3 upstream promotor element to act at a long and variable distance is similar to properties of viral enhancer sequences and is reminiscent of position effects in yeast.

  15. Characterization of cis-acting elements residing in the chitinase promoter of Bacillus pumilus SG2.

    PubMed

    Heravi, K Morabbi; Shali, A; Naghibzadeh, N; Ahmadian, G

    2014-05-01

    Bacillus pumilus SG2 is a chitinolytic bacterium that produces two chitinases, namely ChiS and ChiL. The chiS and chiL genes are consecutively expressed under a common promoter. Regulation of the chiS and chiL genes is under the control of carbon catabolite repression (CCR) in B. pumilus. This study aimed to investigate the cis-acting elements of the chitinase promoter. For this purpose, we transferred the chiS gene along with its specific promoter to Bacillus subtilis as a host. Primer extension analysis revealed two transcription start sites located 287 and 65 bp upstream of the chiS start codon. The distal promoter was highly compatible with the consensus sequence of the σ(A)-type promoters in B. subtilis, whereas the proximal promoter sequence showed less similarity to the σ(A)-type consensus sequence. A catabolite responsive element (cre), which is required for CCR in Bacillus species, was found to be 136 to 123 bp upstream of the chiS start codon. Interestingly, this cre site was located upstream of the -35 of the proximal promoter and downstream of the distal promoter. Deletion of this cre site sequence rendered the chiS expression constitutive.

  16. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  17. Thyroid hormone receptors bind to the promoter of the mouse histone H10 gene and modulate its transcription.

    PubMed Central

    Bauer-Hofmann, R; Alonso, A

    1995-01-01

    It has been shown that the mouse histone H10 promoter contains a DNA element, composed of a direct repeat of the sequence GGTGACC separated by 7 nt, which is able to bind retinoic acid receptors and to modulate transcription of reporter genes following treatment with retinoic acid. We have now investigated whether this DNA motif is also responsive to thyroid hormone. We co-transfected CV-1 monkey kidney cells with chloramphenicol acetyltransferase (CAT) expression plasmids containing either 740 bp of the H10 wild-type promoter or five copies of the repeat element cloned in front of the thymidine kinase promoter and expression vectors for human thyroid hormone receptors (TRs) alpha or beta and retinoid X receptor alpha (RXR alpha). Treatment of transfected cells with triiodothyronine led to a dose-dependent increase in CAT activity. Transfection experiments with increasing amounts of expression vectors for either TR alpha or RXR alpha resulted in up to 6-fold enhancement of CAT transcription. Furthermore, point mutations within the half-sites of the response element of the H10 promoter, as well as deletions within the interspace region, lowered CAT activity to 60-80% of that of the wild-type control. Electrophoretic mobility shift assays showed that the repeat element was able to form retarded complexes with TR alpha homodimers, as well as with TR alpha-RXR alpha heterodimers. Our results suggest that thyroid hormone receptors are involved in the regulation of mouse histone H10 expression. Images PMID:8559662

  18. Identification of the functional elements in the promoter region of human DNA topoisomerase IIIbeta gene.

    PubMed

    Cho, Young Hoon; Park, Jee Young; Han, Sang Youp; Chung, In Kwon

    2004-09-17

    In this study, we have isolated and characterized the promoter region of the human DNA topoisomerase IIIbeta (hTOP3beta) gene. The 5' RACE assay showed a short exon 1 encoding only the 35-bp untranslated region and suggested the presence of multiple transcription initiation sites. The hTOP3beta gene promoter lacks a canonical TATA box or initiation element and is moderately high in GC content. Transient expression of a luciferase reporter gene under the control of serially deleted 5'-flanking sequence identified an activator element between -141 and -119 upstream of the transcription initiation site and a second regulatory element between -91 and -71. On the basis of scanning mutations of triple nucleotides, we demonstrated that a 5'GGAACC3' element between -117 and -112 plays a critical role in the up-regulation of the basal transcription activity. Changing the 5'GGAACC3' sequence leads to markedly reduced promoter activity. Gel mobility shift assays revealed that the 5'GGAACC3' element is required for DNA binding by the transcription factor complex. These observations lead to the conclusion that the positive regulatory region including the 5'GGAACC3' core element is essential for efficient expression of the hTOP3beta gene as well as for the binding of as yet unidentified regulatory factor(s).

  19. Multiple promoter elements govern expression of the human ornithine decarboxylase gene in colon carcinoma cells.

    PubMed Central

    Moshier, J A; Osborne, D L; Skunca, M; Dosescu, J; Gilbert, J D; Fitzgerald, M C; Polidori, G; Wagner, R L; Friezner Degen, S J; Luk, G D

    1992-01-01

    Overexpression of the ornithine decarboxylase (ODC) gene may be important to the development and maintenance of colonic neoplasms, as well as tumors in general. In this study, we examined the promoter elements governing constitutive expression of the human ODC gene in HCT 116 human colon carcinoma cells and, for comparison, K562 human erythro-leukemia cells. It was determined by functional analysis that the promoter elements responsible reside within the 378 bp immediately upstream from the transcription start site. Within this sequence, there are at least three regions that modulate the efficiency of the ODC promoter cooperatively. Both DNA bandshift and footprint assays demonstrated all three regions to be rich in sites that bind to nuclear proteins isolated from HCT 116 and K562 cells; the protein binding pattern of non-transformed, diploid fibroblasts was found to be much less complex. Several of the protein binding sequences have little or no homology to common regulatory elements. We suggest that the constitutive activity of the ODC gene in HCT 116 colon carcinoma cells, and perhaps transformed cells in general, involves a complex interaction of multiple regulatory sequences and their associated nuclear proteins. Finally, the saturation of the promoter in these transformed cell lines suggests that high levels of protein binding in the ODC promoter may contribute to elevated constitutive expression of this gene. Images PMID:1598217

  20. The glucose-6-phosphatase catalytic subunit gene promoter contains both positive and negative glucocorticoid response elements.

    PubMed

    Vander Kooi, Beth T; Onuma, Hiroshi; Oeser, James K; Svitek, Christina A; Allen, Shelley R; Vander Kooi, Craig W; Chazin, Walter J; O'Brien, Richard M

    2005-12-01

    Glucose-6-phosphatase catalyzes the final step in the gluconeogenic and glycogenolytic pathways. Glucocorticoids stimulate glucose-6-phosphatase catalytic subunit (G6Pase) gene transcription and studies performed in H4IIE hepatoma cells demonstrate the presence of a glucocorticoid response unit (GRU) in the proximal G6Pase promoter. In vitro deoxyribonuclease I footprinting analyses show that the glucocorticoid receptor binds to three glucocorticoid response elements (GREs) in the -231 to -129 promoter region and transfection results indicate all three contribute to glucocorticoid induction of G6Pase gene transcription. Furthermore, binding sites for hepatocyte nuclear factor-1 and -4, CRE binding factors, and FKHR (FOXO1a) are required for the full glucocorticoid response. Chromatin immunoprecipitation assays show that dexamethasone treatment stimulates glucocorticoid receptor and FKHR binding to the endogenous G6Pase promoter. Surprisingly, although glucocorticoids stimulate G6Pase gene transcription, deoxyribonuclease I footprinting and transfection analyses demonstrate the presence of a negative GRE and an associated negative accessory factor element in the -271 to -225 promoter region, which inhibit the glucocorticoid response. This appears to be the first report of a promoter that contains both positive and negative GREs, which function within the same cellular environment. We hypothesize that targeted signaling to the negative accessory element within the GRU may provide tight regulation of the glucocorticoid stimulation.

  1. Drosophila gypsy insulator and yellow enhancers regulate activity of yellow promoter through the same regulatory element.

    PubMed

    Melnikova, Larisa; Kostuchenko, Margarita; Silicheva, Margarita; Georgiev, Pavel

    2008-04-01

    There is ample evidence that the enhancers of a promoterless yellow locus in one homologous chromosome can activate the yellow promoter in the other chromosome where the enhancers are inactive or deleted, which is indicative of a high specificity of the enhancer-promoter interaction in yellow. In this paper, we have found that the yellow sequence from -100 to -69 is essential for stimulation of the heterologous eve (TATA-containing) and white (TATA-less) promoters by the yellow enhancers from a distance. However, the presence of this sequence is not required when the yellow enhancers are directly fused to the heterologous promoters or are activated by the yeast GAL4 activator. Unexpectedly, the same promoter proximal region defines previously described promoter-specific, long-distance repression of the yellow promoter by the gypsy insulator on the mod(mdg4) ( u1 ) background. These finding suggest that proteins bound to the -100 to -69 sequence are essential for communication between the yellow promoter and upstream regulatory elements.

  2. Human intron-encoded AluACA RNAs and telomerase RNA share a common element promoting RNA accumulation

    PubMed Central

    Ketele, Amandine; Kiss, Tamás; Jády, Beáta E.

    2016-01-01

    ABSTRACT Mammalian cells express hundreds of intron-encoded box H/ACA RNAs which fold into a common hairpin-hinge-hairpin-tail structure, interact with 4 evolutionarily conserved proteins, dyskerin, Nop10, Nhp2 and Gar1, and function mainly in RNA pseudouridylation. The human telomerase H/ACA RNA (hTR) directs telomeric DNA synthesis and it carries a 5′-terminal domain encompassing the telomeric template sequence. The primary hTR transcript is synthesized from an independent gene by RNA polymerase II and undergoes 3′ end processing controlled by the 3′-terminal H/ACA domain. The apical stem-loop of the 3′ hairpin of hTR carries a unique biogenesis-promoting element, the BIO motif that promotes hTR processing and RNP assembly. AluACA RNAs represent a distinct class of human H/ACA RNAs; they are processed from intronic Alu repetitive sequences. As compared to canonical H/ACA RNAs, the AluACA RNAs carry unusually short or long 5′ hairpins and generally, they accumulate at low levels. Here, we demonstrate that the suboptimal 5′ hairpins are responsible for the weak expression of AluACA RNAs. We also show that AluACA RNAs frequently carry a processing/stabilization element that is structurally and functionally indistinguishable from the hTR BIO motif. Both hTR and AluACA biogenesis-promoting elements are located in the terminal stem-loop of the 3′-terminal H/ACA hairpin, they show perfect structural conservation and are functionally interchangeable in in vivo RNA processing reactions. Our results demonstrate that the BIO motif, instead of being confined to hTR, is a more general H/ACA RNP biogenesis-facilitating element that can also promote processing/assembly of intron-encoded AluACA RNPs. PMID:27726486

  3. Elements of Mathematics, Book 10: Groups and Rings.

    ERIC Educational Resources Information Center

    Exner, Robert; And Others

    One of 12 books developed for use with the core material (Book O) of the Elements of Mathematics Program, this text covers material well beyond the scope of the usual secondary mathematics sequences. These materials are designed for highly motivated students with strong verbal abilities; mathematical theories and ideas are developed through…

  4. Identification of a minimal promoter element of the mouse epidermal growth factor gene.

    PubMed Central

    Pascall, J C; Brown, K D

    1997-01-01

    We have previously generated a transgenic mouse line (EGF/Tag) in which simian virus 40 (SV40) T-antigen expression is directed by the mouse epidermal growth factor (EGF) gene promoter. In these mice, cellular hyperproliferation is observed in the submaxillary gland associated with SV40 T-antigen expression. In addition, SV40 T-antigen-expressing tumours of prostatic origin are seen. We have now derived immortalized cell lines from these tissues and have used the cells to perform a functional analysis of the EGF gene promoter. Cells were transfected with EGF promoter/reporter constructs, and an element located between 51 and 35 bases upstream of the EGF mRNA start site required for basal activity of the promoter was identified. Electrophoretic mobility-shift analysis suggests that three proteins bind to this region, one of which is either Sp1 or a closely related protein. PMID:9210411

  5. Positive and negative functional interactions between promoter elements from different classes of RNA polymerase III-transcribed genes.

    PubMed Central

    Parry, H D; Mattaj, I W

    1990-01-01

    Consensus tRNA gene promoter elements, A and B boxes, were introduced into the coding sequence of a Xenopus U6 gene. Combinations in which A and B boxes were coupled to wild-type or mutant U6 promoters were made. In this way information about both the functions of individual promoter elements and functional relationships between different classes of RNA polymerase III promoter element were obtained. Mutants in which the U6 PSE was non-functional were rescued by the presence of a B box, indicating a degree of functional relationship between these two elements. Moreover, the B box acted to increase the transcriptional activity and competitive strength of the wild-type U6 promoter. In contrast, no evidence was obtained to suggest that a tRNA A box can interact productively with U6 promoter elements in the absence of a B box. Data obtained suggest that the U6 PSE functions as an 'adaptor', being necessary to enable the basal U6 promoter to respond to upstream enhancement. Certain combinations of U6 and tRNA promoter elements are shown to be mutually antagonistic by a mechanism which is likely to involve blockage of transcription initiation. In summary, the U6 and tRNA promoters are shown to consist of functionally related, but distinct, promoter elements whose interactions shed new light on their normal roles in transcription. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:2323333

  6. Promoter elements required for developmental expression of the maize Adh1 gene in transgenic rice.

    PubMed Central

    Kyozuka, J; Olive, M; Peacock, W J; Dennis, E S; Shimamoto, K

    1994-01-01

    To define the regions of the maize alcohol dehydrogenase 1 (Adh1) promoter that confer tissue-specific expression, a series of 5' promoter deletions and substitution mutations were linked to the Escherichia coli beta-glucuronidase A (uidA) reporter gene and introduced into rice plants. A region between -140 and -99 not only conferred anaerobically inducible expression in the roots of transgenic plants but was also required for expression in the root cap, embryo, and in endosperm under aerobic conditions. GC-rich (GC-1, GC-2, and GC-3) or GT-rich (GT-1 and GT-2) sequence motifs in this region were necessary for expression in these tissues, as they were in anaerobic expression. Expression in the root cap under aerobic conditions required all the GC- and GT-rich motifs. The GT-1, GC-1, GC-2, and GC-3 motifs, and to a lesser extent the GT-2 motif, were also required for anaerobic responsiveness in rice roots. All elements except the GC-3 motif were needed for endosperm-specific expression. The GC-2 motif and perhaps the GT-1 motif appeared to be the only elements required for high-level expression in the embryos of rice seeds. Promoter regions important for shoot-, embryo-, and pollen-specific expression were proximal to -99, and nucleotides required for shoot-specific expression occurred between positions -72 and -43. Pollen-specific expression required a sequence element outside the promoter region, between +54 and +106 of the untranslated leader, as well as a silencer element in the promoter between -72 and -43. PMID:8061518

  7. Epigenomic Elements Analyses for Promoters Identify ESRRG as a New Susceptibility Gene for Obesity-related Traits

    PubMed Central

    Dong, Shan-Shan; Guo, Yan; Zhu, Dong-Li; Chen, Xiao-Feng; Wu, Xiao-Ming; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2016-01-01

    OBJECTIVES With ENCODE epigenomic data and results from published genome-wide association studies (GWASs), we aimed to find regulatory signatures of obesity genes and discover novel susceptibility genes. METHODS Obesity genes were obtained from public GWASs databases and their promoters were annotated based on the regulatory elements information. Significantly enriched or depleted epigenomic elements in the promoters of obesity genes were evaluated and all human genes were then prioritized according to the existence of the selected elements to predict new candidate genes. Top ranked genes were subsequently applied to validate their associations with obesity-related traits in three independent in-house GWASs samples. RESULTS We identified RAD21 and EZH2 as over-represented, STAT2 and IRF3 as depleted transcription factors. Histone modification of H3K9me3 and chromatin state segmentation of “poised promoter” and “repressed” were overrepresented. All genes were prioritized and we selected the top five genes for validation at population level. Combined results from the three GWASs samples, rs7522101 in ESRRG remained significantly associated with BMI after multiple testing corrections (P = 7.25 × 10−5). It was also associated with β-cell function (P = 1.99 × 10−3) and fasting glucose level (P < 0.05) in the meta-analyses of glucose and insulin-related traits consortium (MAGIC) dataset. CONCLUSIONS In summary, we identified epigenomic characteristics for obesity genes and suggested ESRRG as a novel obesity susceptibility gene. PMID:27113491

  8. Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula.

    PubMed

    Bucsenez, M; Rüping, B; Behrens, S; Twyman, R M; Noll, G A; Prüfer, D

    2012-09-01

    The sieve element occlusion (SEO) gene family includes several members that are expressed specifically in immature sieve elements (SEs) in the developing phloem of dicotyledonous plants. To determine how this restricted expression profile is achieved, we analysed the SE-specific Medicago truncatula SEO-F1 promoter (PMtSEO-F1) by constructing deletion, substitution and hybrid constructs and testing them in transgenic tobacco plants using green fluorescent protein as a reporter. This revealed four promoter regions, each containing cis-regulatory elements that activate transcription in SEs. One of these segments also contained sufficient information to suppress PMtSEO-F1 transcription in the phloem companion cells (CCs). Subsequent in silico analysis revealed several candidate cis-regulatory elements that PMtSEO-F1 shares with other SEO promoters. These putative sieve element boxes (PSE boxes) are promising candidates for cis-regulatory elements controlling the SE-specific expression of PMtSEO-F1.

  9. Characterization of sequence elements from Malvastrum yellow vein betasatellite regulating promoter activity and DNA replication

    PubMed Central

    2012-01-01

    Background Many monopartite begomoviruses are associated with betasatellites, but only several promoters from which were isolated and studied. In this study, the βC1 promoter from Malvastrum yellow vein betasatellite (MYVB) was characterized and important sequence elements were identified to modulate promoter activity and replication of MYVB. Results A 991 nucleotide (nt) fragment upstream of the translation start site of the βC1 open reading frame of MYVB and a series of deletions within this fragment were constructed and fused to the β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes, respectively. Agrobacterium-mediated transient expression assays showed that the 991 nt fragment was functional and that a 28 nt region (between −390 nt and −418 nt), which includes a 5′UTR Py-rich stretch motif, was important for promoter activity. Replication assays using Nicotiana benthamiana leaf discs and whole plants showed that deletion of the 5′UTR Py-rich stretch impaired viral satellite replication in the presence of the helper virus. Transgenic assays demonstrated that the 991 nt fragment conferred a constitutive expression pattern in transgenic tobacco plants and that a 214 nt fragment at the 3'-end of this sequence was sufficient to drive this expression pattern. Conclusion Our results showed that the βC1 promoter of MYVB displayed a constitutive expression pattern and a 5′UTR Py-rich stretch motif regulated both βC1 promoter activity and MYVB replication. PMID:23057573

  10. Integrator element as a promoter of active learning in engineering teaching

    NASA Astrophysics Data System (ADS)

    Oliveira, Paulo C.; Oliveira, Cristina G.

    2014-03-01

    In this paper, we present a teaching proposal used in an Introductory Physics course to civil engineering students from Porto's Engineering Institute/Instituto Superior de Engenharia do Porto (ISEP). The proposal was born from the need to change students' perception and motivation for learning physics. It consists in the use of an integrator element, called the physics elevator project. This integrator element allows us to use, in a single project, all the content taught in the course and uses several active learning strategies. In this paper, we analyse this project as: (i) a clarifying element of the contents covered in the course; (ii) a promoter element of motivation and active participation in class and finally and (iii) a link between the contents covered in the course and the 'real world'. The data were collected by a questionnaire and interviews to students. From the data collected, it seems that the integrator element improves students' motivation towards physics and develops several skills that they consider to be important to their professional future. It also acts as a clarifying element and makes the connection between the physics that is taught and the 'real world'.

  11. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences.

  12. Cruciform-extruding regulatory element controls cell-specific activity of the tyrosine hydroxylase gene promoter.

    PubMed Central

    Kim, E L; Peng, H; Esparza, F M; Maltchenko, S Z; Stachowiak, M K

    1998-01-01

    Tyrosine hydroxylase (TH) is expressed specifically in catecholaminergic cells. We have identified a novel regulatory sequence in the upstream region of the bovine TH gene promoter formed by a dyad symmetry element (DSE1;-352/-307 bp). DSE1 supports TH promoter activity in TH-expressing bovine adrenal medulla chromaffin (BAMC) cells and inhibits promoter activity in non-expressing TE671 cells. DNase I footprinting of relaxed TH promoter DNA showed weak binding of nuclear BAMC cell proteins to a short sequence in the right DSE1 arm. In BAMC cells, deletion of the right arm markedly reduced the expression of luciferase from the TH promoter. However, deletion of the left DSE1 arm or its reversed orientation (RevL) also inactivated the TH promoter. In supercoiled TH promoter, DSE1 assumes a cruciform-like conformation i.e., it binds cruciform-specific 2D3 antibody, and S1 nuclease-cleavage and OsO4-modification assays have identified an imperfect cruciform extruded by the DSE1. DNase I footprinting of supercoiled plasmid showed that cruciformed DSE1 is targeted by nuclear proteins more efficiently than the linear duplex isomer and that the protected site encompasses the left arm and center of DSE1. Our results suggest that the disruption of intrastrand base-pairing preventing cruciform formation and protein binding to DSE1 is responsible for its inactivation in DSE1 mutants. DSE1 cruciform may act as a target site for activator (BAMC cells) and repressor (TE671) proteins. Its extrusion emerges as a novel mechanism that controls cell-specific promoter activity. PMID:9512554

  13. A negative element in the downstream region of the Rice tungro bacilliform virus promoter is orientation- and position-independent and is active with heterologous promoters.

    PubMed

    Purkayastha, Arunima; Sharma, Shweta; Dasgupta, Indranil

    2010-10-01

    The promoter of an Indian isolate of the pararetrovirus Rice tungro bacilliform virus (RTBV-WB) contains a negative element downstream of the transcription start site (TSS), between nucleotide residues +58 and +195 (Mathur and Dasgupta, 2007). To further characterize the element, we show, by using transient gus reporter gene assays in the cells of onion peel, rice calli and Arabidopsis leaves, that it down-regulates heterologous promoters CaMV35S and Maize ubiquitin. Quantitative measurements of transient GUS activity indicated more than 90% inhibition of reporter gene expression by the negative element. We also show, by reversing the orientation of the element downstream and by placing it in a position upstream to a constitutively expressing RTBV promoter, that the negative element is orientation- and position-independent, pointing towards its activity at the transcriptional and not post-transcriptional level.

  14. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  15. The DAL7 promoter consists of multiple elements that cooperatively mediate regulation of the gene's expression.

    PubMed Central

    Yoo, H S; Cooper, T G

    1989-01-01

    Expression of the allantoin system genes in Saccharomyces cerevisiae is induced by allophanate or its analog, oxalurate. This work provides evidence for the involvement of distinct types of cis-acting elements in the induction process. The first element was found to have the properties of an upstream activation sequence (UAS). This element was localized to a 16-base-pair (bp) DNA fragment containing a short 5-bp sequence that occurred repeatedly in the upstream region of DAL7. When present in two or more copies, the 16-bp fragment supported high-level beta-galactosidase production in a CYC1-lacZ expression vector; there was, however, no response to the allantoin pathway inducer. The second element had the properties of a negatively acting element or upstream repression sequence (URS). This element was localized to a 16-bp DNA fragment containing an 8-bp sequence that was repeated four times in the upstream region of DAL7. A fragment containing the 8-bp repeated sequence placed adjacent to the UAS-containing fragment mediated inhibition of the ability of the UAS to support lacZ expression regardless of whether inducer was present. A third element, designated an upstream induction sequence (UIS), was required for response to inducer. The UIS was localized to a small DNA fragment containing an approximately 10-bp sequence that was repeated twice in the upstream region of DAL7. When a fragment containing the 10-bp repeated sequence was placed adjacent to these UAS and URS elements, the construction (UIS-UAS-URS) supported normal oxalurate-mediated induction of beta-galactosidase synthesis. These data are consistent with the suggestion that multiple, cis-acting elements participate in the induction process. Images PMID:2552287

  16. The conserved lymphokine element-0 in the IL5 promoter binds to a high mobility group-1 protein.

    PubMed

    Marrugo, J; Marsh, D G; Ghosh, B

    1996-10-01

    The conserved lymphokine elements-0 (CLE0) in the IL5 promoter is essential for the expression of IL-5. Here, we report the cloning and expression of a cDNA encoding a novel CLE0-binding protein, CLEBP-1 from a mouse Th2 clone, D10.G4.1. Interestingly, it was found that the CLEBP1 cDNA sequence was almost identical to the sequences of known high mobility group-1 (HMG1) cDNAs. When expressed as a recombinant fusion protein in Escherichia coli, CLEBP-1 was shown to bind to the IL5-CLE0 element in electrophoretic mobility-shift assays (EMSA) and southwestern blot analysis. The CLEBP-1 fusion protein cross-reacts with and-HMG-1/2 in Western blot analysis. It also binds to the CLE0 elements of IL4, GMCSF and GCSF genes. CLEBP-1 and closely related HMG-1 and HMG-2 proteins may play key roles in facilitating the expression of the lymphokine genes that contain CLE0 elements.

  17. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.

    PubMed

    Zhang, Ning; McHale, Leah K; Finer, John J

    2016-01-01

    Introns, especially the first intron in the 5' untranslated region (5'UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  18. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters

    PubMed Central

    Zhang, Ning; McHale, Leah K.; Finer, John J.

    2016-01-01

    Introns, especially the first intron in the 5’ untranslated region (5’UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement. PMID:27806110

  19. cis-acting elements involved in photoregulation of an oat phytochrome promoter in rice.

    PubMed Central

    Bruce, W B; Quail, P H

    1990-01-01

    Phytochrome negatively regulates the transcription of its own phyA genes. High levels of Pfr, the active, far-red-light absorbing form of phytochrome, repress phyA transcription; low Pfr levels result in derepression. We have utilized microprojectile-mediated gene transfer to identify regions of an oat phyA3 gene involved in this autoregulation. Chimeric constructs containing various deletion and sequence substitution mutants of the oat phyA3 gene fused to a chloramphenicol acetyltransferase reporter (phyA3/CAT) have been introduced into etiolated rice seedlings by particle bombardment. Low Pfr concentrations induce high phyA3/CAT expression, whereas high Pfr represses activity to near basal levels. Removal of phyA3 sequences 3' to the transcription start site reduces expression about fivefold, suggesting that intron 1 of the phyA3 gene may be required for high activity. The degree of high-Pfr-imposed repression is unaffected by any of a series of deletions or sequence substitutions in the phyA3 promoter, thus providing no evidence of any Pfr-activated negative elements. In contrast, 5' and internal deletions identify a minimum of three major positive promoter elements, designated PE1 [-381 base pairs (bp) to -348 bp], PE2 (-635 bp to -489 bp), and PE3 (-110 bp to -76 bp) that are necessary for high-level expression in low-Pfr cells. The data indicate that PE1 and PE2 are functionally redundant, but that PE3 is required in conjunction with either PE1 or PE2 for activity. PE3 contains a sequence element that is highly conserved between monocot phyA promoters, indicative of a critical role in phyA expression. PMID:2152109

  20. 10 Ways to Promote a Culture of Literacy

    ERIC Educational Resources Information Center

    Gilmore, Barry

    2017-01-01

    Barry Gilmore, a principal at Hutchinson School in Memphis, Tennessee, has set out to create a culture of literacy at his school. In this article, he outlines 10 steps for fostering such an environment. Among other recommendations: publicly celebrate reading, create channels for booksharing, read and write across content areas, value disciplinary…

  1. Differential Top10 promoter regulation by six tetracycline analogues in plant cells

    NASA Technical Reports Server (NTRS)

    Love, John; Allen, George C.; Gatz, Christiane; Thompson, William F.; Brown, C. S. (Principal Investigator)

    2002-01-01

    The effects of five tetracycline analogues, anhydrotetracycline, doxycycline, minocycline, oxytetracycline, and tetracycline, on Top10 promoter activity in NT1 tobacco tissue culture cells have been analysed. The concentration that repressed Top10 promoter activity, the level of transgene repression and the kinetics of transgene de-repression were determined for each analogue, and could not be predicted from in vitro binding affinity to the tetracycline repressor or from comparison with animal cells. Doxycycline had the most potent effect on the Top10 promoter and completely inhibited transgene expression at 4 nmol l(-1). Tetracycline was the most versatile of the analogues tested; tetracycline inhibited the Top10 promoter at 10 nmol l(-1) and was easily washed out to restore Top10-driven expression in 12-24 h. A study was also made of the suitability for plant research of a novel tetracycline analogue, GR33076X. In animal cells, GR33076X de-repressed Top10 promoter activity in the presence of inhibitory concentrations of anhydrotetracycline. In NT1, it is shown that GR 33076X can antagonize repression of the Top10 promoter in the presence of tetracycline, but not of anhydrotetracycline or of doxycycline. Different tetracycline analogues can therefore be used to regulate the Top10 promoter in plant cells and this property may be exploited in planning an optimum course of transgene regulation.

  2. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.

    1988-04-01

    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  3. The activity of interleukin-4 receptor alpha-chain promoter is regulated by a GT box element.

    PubMed

    Dorado, Beatriz; Martín-Saavedra, Francisco M; Jerez, María J; Ballester, Sara

    2006-04-01

    Interleukin-4 receptor (IL-4R) is the cell surface complex through which interleukin-4 (IL-4) signals exert its critical biological effects. The alpha-chain of IL-4R is responsible for the high affinity binding of IL-4. In this report, is characterized, the 5' untranslated flanking region of murine IL-4Ralpha gene in the Th2 clone D10.G4.1. We have analyzed a DNA fragment spanning from -995 to +84 relative to the transcription start point. Mutagenesis analysis shows that, neither the previously described Stat6 (-395) nor the NFAT (-266) and NFkappaB (+25) sequences localized here, are involved in the IL-4Ralpha promoter activity. Reporter assays demonstrate that maximum transcriptional activity is achieved by the -89 to +84 sequence and this activity is independent of a TATA-like box located at -25. We have identified a GT box located at -45 as the critical element for the IL-4Ralpha promoter activity. Experiments in SL2 cells, which lack endogenous Sp proteins, show that IL-4Ralpha minimal promoter is transactivated by proteins of Sp family.

  4. A GC-rich element confers epidermal growth factor responsiveness to transcription from the gastrin promoter.

    PubMed Central

    Merchant, J L; Demediuk, B; Brand, S J

    1991-01-01

    Epidermal growth factor (EGF) and transforming growth factor alpha are important determinants of mucosal integrity in the gastrointestinal tract, and they act both directly and indirectly to prevent ulceration in the stomach. Consistent with this physiological role, EGF stimulates transcription of gastrin, a peptide hormone which regulates gastric acid secretion and mucosal growth. EGF stimulation of gastrin transcription is mediated by a GC-rich gastrin EGF response element (gERE) (GGGGCGGGGTGGGGGG) which lies between -54 and -68 in the human gastrin promoter. The gERE sequence also confers weaker responsiveness to phorbol ester stimulation. The gERE sequence differs from previously described EGF response elements. The gERE DNA sequence specifically interacts with a GH4 DNA-binding protein distinct from previously described transcription factors (Egr-1 and AP2) which bind GC-rich sequences and mediate transcriptional activation by growth factors. Furthermore, the gERE element does not bind the Sp1 transcription factor even though the gERE sequence contains a high-affinity Sp1-binding site (GGCGGG). Images PMID:2017173

  5. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 3 2011-01-01 2011-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  6. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities...

  7. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 3 2011-01-01 2011-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities...

  8. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  9. 10 CFR 719.21 - What are the required elements of an engagement letter?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false What are the required elements of an engagement letter? 719.21 Section 719.21 Energy DEPARTMENT OF ENERGY CONTRACTOR LEGAL MANAGEMENT REQUIREMENTS Engagement Letters § 719.21 What are the required elements of an engagement letter? (a) The engagement letter...

  10. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  11. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  12. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  13. PePPER: a webserver for prediction of prokaryote promoter elements and regulons

    PubMed Central

    2012-01-01

    Background Accurate prediction of DNA motifs that are targets of RNA polymerases, sigma factors and transcription factors (TFs) in prokaryotes is a difficult mission mainly due to as yet undiscovered features in DNA sequences or structures in promoter regions. Improved prediction and comparison algorithms are currently available for identifying transcription factor binding sites (TFBSs) and their accompanying TFs and regulon members. Results We here extend the current databases of TFs, TFBSs and regulons with our knowledge on Lactococcus lactis and developed a webserver for prediction, mining and visualization of prokaryote promoter elements and regulons via a novel concept. This new approach includes an all-in-one method of data mining for TFs, TFBSs, promoters, and regulons for any bacterial genome via a user-friendly webserver. We demonstrate the power of this method by mining WalRK regulons in Lactococci and Streptococci and, vice versa, use L. lactis regulon data (CodY) to mine closely related species. Conclusions The PePPER webserver offers, besides the all-in-one analysis method, a toolbox for mining for regulons, promoters and TFBSs and accommodates a new L. lactis regulon database in addition to already existing regulon data. Identification of putative regulons and full annotation of intergenic regions in any bacterial genome on the basis of existing knowledge on a related organism can now be performed by biologists and it can be done for a wide range of regulons. On the basis of the PePPER output, biologist can design experiments to further verify the existence and extent of the proposed regulons. The PePPER webserver is freely accessible at http://pepper.molgenrug.nl. PMID:22747501

  14. Identification of functional glucocorticoid response elements in the mouse FoxO1 promoter.

    PubMed

    Qin, Weiping; Pan, Jiangping; Qin, Yiwen; Lee, David N; Bauman, William A; Cardozo, Christopher

    2014-07-25

    Glucocorticoids stimulate muscle atrophy through a cascade of signals that includes activation of FoxO transcription factors which then upregulate multiple genes to promote degradation of myofibrillar and other muscle proteins and inhibit protein synthesis. Our previous finding that glucocorticoids upregulate mRNA levels for FoxO1 in skeletal muscle led us to hypothesize that the FoxO1 gene contains one or more glucocorticoid response elements (GREs). Here we show that upregulation of FoxO1 expression by glucocorticoids requires the glucocorticoid receptor (GR) and binding of hormones to it. In cultured C2C12 myoblasts dexamethasone did not alter FoxO1 mRNA stability. Computational analysis predicted that the proximal promoter of the FoxO1 gene contained a cluster of eight GRE half sites and one highly conserved near-consensus SRE; the cluster is found between -800 and -2000bp upstream of the first codon of the FoxO1 gene. A reporter gene constructed using the first 2kb of the FoxO1 promoter was stimulated by dexamethasone. Removal of a 5' domain containing half of the GREs reduced reporter gene activity and removal of all GREs in this region ablated activation by dexamethasone. Restriction fragments of the cluster of 8 upstream GREs bound recombinant GR in gel shift assays. Collectively, the data demonstrate that the proximal promoter of the FoxO1 gene contains multiple functional GREs, indicating that upregulation of FoxO1 expression by glucocorticoids through GREs represents an additional mechanism by which the GR drives glucocorticoid-mediated muscle atrophy. These findings are also relevant to other physiological roles of FoxO1 such as regulation of hepatic metabolism.

  15. Characterization of Promoter Elements Regulating the Expression of the Human Neurotensin/Neuromedin N Gene*

    PubMed Central

    Wang, Xiaofu; Gulhati, Pat; Li, Jing; Dobner, Paul R.; Weiss, Heidi; Townsend, Courtney M.; Evers, B. Mark

    2011-01-01

    Expression of the gene encoding neurotensin/neuromedin N (NT/N) is mostly limited to the brain and specialized enteroendocrine N cells in the distal small intestine. We have identified key regulatory elements in the promoter region that are involved in human NT/N (hNT/N) gene expression in the novel human endocrine cell line, BON, which resembles intestinal N cells in several important aspects including NT/N precursor protein processing, ratios of different NT/N mRNA isoforms, and high levels of constitutive expression of the NT/N gene. In this study, we demonstrated multiple cis-regulatory elements including a proximal region containing a cAMP-responsive element (CRE)/AP-1-like element that binds both the AP-1 and CRE-binding protein (CREB)/ATF proteins (c-Jun, ATF-1, ATF-2, JunD, and CREB). Similar to the rat NT/N gene, this region is critical for constitutive hNT/N gene expression. Moreover, we identified a novel region that binds the orphan hormone receptor, NR2F2. We have demonstrated that the C terminus of NR2F2 strongly represses hNT/N transcription, whereas an N-terminal domain antagonizes this repressive effect. Regulation of NT/N expression by NR2F2 may have important consequences for lipid metabolism. We speculate that a complex interplay between the proximal CRE/AP-1-like motif and NR2F2 binding region exists to regulate hNT/N expression, which is critical for the high level of constitutive expression of NT/N in enteroendocrine cells. Finally, the BON cell line provides a unique model to characterize the factors regulating expression of the hNT/N gene and to better understand the mechanisms responsible for terminal differentiation of the N cell lineage in the gut. PMID:21030593

  16. Transcriptional response elements in the promoter of CYP6B1, an insect P450 gene regulated by plant chemicals.

    PubMed

    Petersen, Rebecca A; Niamsup, Hataichanoke; Berenbaum, May R; Schuler, Mary A

    2003-02-17

    Papilio polyxenes, a lepidopteran continually exposed to toxic furanocoumarins in its hostplants, owes its tolerance to these compounds to the transcriptional induction of the CYP6B1 gene encoding a P450 capable of metabolizing linear furanocoumarins, such as xanthotoxin, at high rates. Transient expression of various lengths of wild-type and mutant CYP6B1v3 promoter in lepidopteran Sf9 cells defines a positive element (XRE-xan) from -136 to -119 required for both basal and xanthotoxin-inducible transcription and a negative element from -228 to -146 that represses basal transcription. Fusion of the CYP6B1v3 XRE-xan element to the Drosophila melanogaster Eip28/29 core promoter indicates that the XRE-xan functions in conjunction with its own core promoter but not with a heterologous core promoter. Sequence searches of the CYP6B1v3 proximal promoter region revealed a number of putative elements (XRE-AhR, ARE, OCT-1, EcRE, C/EBP, Inr) sharing sequence similarity with those in other regulated vertebrate and insect promoters. Mutation of TGAC nucleotides shared by the overlapping EcRE/ARE/XRE-xan indicates that this sequence is essential for basal and regulated transcription of this gene. Mutagenesis in the non-overlapping region of the EcRE indicates it modulates basal transcription. These findings are incorporated into a working model for regulation of this toxin-inducible promoter.

  17. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa

    PubMed Central

    Liu, Shaoqing; Dong, Lei; Liu, Chunying; Song, Wenwen; Liu, Jingjing; Gai, Shupeng

    2016-01-01

    The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release. PMID:27228117

  18. Advanced glycation end products increase carbohydrate responsive element binding protein expression and promote cancer cell proliferation.

    PubMed

    Chen, Hanbei; Wu, Lifang; Li, Yakui; Meng, Jian; Lin, Ning; Yang, Dianqiang; Zhu, Yemin; Li, Xiaoyong; Li, Minle; Xu, Ye; Wu, Yuchen; Tong, Xuemei; Su, Qing

    2014-09-01

    Diabetic patients have increased levels of advanced glycation end products (AGEs) and the role of AGEs in regulating cancer cell proliferation is unclear. Here, we found that treating colorectal and liver cancer cells with AGEs promoted cell proliferation. AGEs stimulated both the expression and activation of a key transcription factor called carbohydrate responsive element binding protein (ChREBP) which had been shown to promote glycolytic and anabolic activity as well as proliferation of colorectal and liver cancer cells. Using siRNAs or the antagonistic antibody for the receptor for advanced glycation end-products (RAGE) blocked AGEs-induced ChREBP expression or cell proliferation in cancer cells. Suppressing ChREBP expression severely impaired AGEs-induced cancer cell proliferation. Taken together, these results demonstrate that AGEs-RAGE signaling enhances cancer cell proliferation in which AGEs-mediated ChREBP induction plays an important role. These findings may provide new explanation for increased cancer progression in diabetic patients.

  19. Structural basis for LIN54 recognition of CHR elements in cell cycle-regulated promoters

    PubMed Central

    Marceau, Aimee H.; Felthousen, Jessica G.; Goetsch, Paul D.; Iness, Audra N.; Lee, Hsiau-Wei; Tripathi, Sarvind M.; Strome, Susan; Litovchick, Larisa; Rubin, Seth M.

    2016-01-01

    The MuvB complex recruits transcription factors to activate or repress genes with cell cycle-dependent expression patterns. MuvB contains the DNA-binding protein LIN54, which directs the complex to promoter cell cycle genes homology region (CHR) elements. Here we characterize the DNA-binding properties of LIN54 and describe the structural basis for recognition of a CHR sequence. We biochemically define the CHR consensus as TTYRAA and determine that two tandem cysteine rich regions are required for high-affinity DNA association. A crystal structure of the LIN54 DNA-binding domain in complex with a CHR sequence reveals that sequence specificity is conferred by two tyrosine residues, which insert into the minor groove of the DNA duplex. We demonstrate that this unique tyrosine-mediated DNA binding is necessary for MuvB recruitment to target promoters. Our results suggest a model in which MuvB binds near transcription start sites and plays a role in positioning downstream nucleosomes. PMID:27465258

  20. Vitamin D3 supports osteoclastogenesis via functional vitamin D response element of human RANKL gene promoter.

    PubMed

    Kitazawa, Sohei; Kajimoto, Kazuyoshi; Kondo, Takeshi; Kitazawa, Riko

    2003-07-01

    Receptor activator of NF-kappaB ligand (RANKL) has been identified as requisite for osteoclastogenesis. To elucidate the molecular mechanism that conducts its catabolic action on bone, the effect of 1alpha,25 dihydroxyvitamin D(3) (1alpha,25(OH)(2)D(3)) on osteoclastogenesis and RANKL mRNA expression was examined by coculture, RT-PCR and nuclear run-on studies. By accelerating the transcription rate of the RANKL gene in SaOS2 osteoblastic cells, 1alpha,25(OH)(2)D(3) enhanced in vitro osteoclast formation from peripheral monocytes. Cloning and characterization of the 5'-flanking region of the human RANKL gene revealed that the basic promoter comprises inverted TATA- and CAAT-boxes flanked by RUNX2 binding sites. Both electrophoresis mobility shift assay (EMSA) and transfection studies demonstrated that 1alpha,25(OH)(2)D(3) activated human RANKL promoter through vitamin D responsive elements (VDRE) located at -1584/-1570 by binding VDR and RXRalpha heterodimers in a ligand-dependent manner. The results provide direct evidence that 1alpha,25(OH)(2)D(3) augments osteoclastogenesis by transactivating the human RANKL gene in osteoblastic cells through VDRE.

  1. c/EBPbeta is a major regulatory element driving transcriptional activation of the CXCL12 promoter.

    PubMed

    Calonge, E; Alonso-Lobo, J M; Escandón, C; González, N; Bermejo, M; Santiago, B; Mestre, L; Pablos, J L; Caruz, A; Alcamí, J

    2010-02-26

    CXCL12 is considered a constitutively expressed chemokine with homeostatic functions. However, induction of CXCL12 expression and its potential role in several pathologic conditions have been reported, suggesting that CXCL12 gene expression can be induced by different stimuli. To elucidate the molecular mechanisms involved in the regulation of CXCL12 gene expression, we aim to define the molecular factors that operate at the transcriptional level. Basal, constitutive expression of CXCL12 was dependent on basic helix-loop-helix factors. Transcriptional up-regulation of the CXCL12 gene was induced by cellular confluence or inflammatory stimuli such as interleukin-1 and interleukin-6, in a CCAAT/enhancer binding protein beta (c/EBPbeta)-dependent manner. Chromatin immunoprecipitation assays confirmed c/EBPbeta binding to a specific response element located at -1171 of the promoter region of CXCL12. Our data show that c/EBPbeta is a major regulatory element driving transcription of the CXCL12 gene in response to cytokines and cell confluence.

  2. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  3. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  4. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  5. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  6. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  7. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  8. Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

    PubMed Central

    2012-01-01

    Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on comprehensive data from three

  9. FSD-C10, a Fasudil derivative, promotes neuroregeneration through indirect and direct mechanisms

    PubMed Central

    Li, Yan-Hua; Xie, Chong; Zhang, Yuan; Li, Xing; Zhang, Hai-fei; Wang, Qing; Chai, Zhi; Xiao, Bao-guo; Thome, Rodolfo; Zhang, Guang-Xian; Ma, Cun-gen

    2017-01-01

    FSD-C10, a Fasudil derivative, was shown to reduce severity of experimental autoimmune encephalomyelitis (EAE), an animal model of multiple sclerosis (MS), through the modulation of the immune response and induction of neuroprotective molecules in the central nervous system (CNS). However, whether FSD-C10 can promote neuroregeneration remains unknown. In this study, we further analyzed the effect of FSD-C10 on neuroprotection and remyelination. FSD-C10-treated mice showed a longer, thicker and more intense MAP2 and synaptophysin positive signal in the CNS, with significantly fewer CD4+ T cells, macrophages and microglia. Importantly, the CNS of FSD-C10-treated mice showed a shift of activated macrophages/microglia from the type 1 to type 2 status, elevated numbers of oligodendrocyte precursor cells (OPCs) and oligodendrocytes, and increased levels of neurotrophic factors NT-3, GDNF and BDNF. FSD-C10-treated microglia significantly inhibited Th1/Th17 cell differentiation and increased the number of IL-10+ CD4+ T cells, and the conditioned medium from FSD-C10-treated microglia promoted OPC survival and oligodendrocyte maturation. Addition of FSD-C10 directly promoted remyelination in a chemical-induced demyelination model on organotypic slice culture, in a BDNF-dependent manner. Together, these findings demonstrate that FSD-C10 promotes neural repair through mechanisms that involved both immunomodulation and induction of neurotrophic factors. PMID:28112256

  10. Extracellular compounds produced by bacterial consortium promoting elements mobilization from polymetallic Kupferschiefer black shale (Fore-Sudetic Monocline, Poland).

    PubMed

    Włodarczyk, Agnieszka; Stasiuk, Robert; Skłodowska, Aleksandra; Matlakowska, Renata

    2015-03-01

    Culture experiments employing Fe-deficient medium showed that a consortium of indigenous microorganisms isolated from Kupferschiefer black shale produced a mixture of extracellular compounds containing siderophores which could form complexes with a wide range of elements and were able to mediate element mobilization from polymetallic black shale. The mobilization of a diverse array of elements including a number of essential trace elements (Co, Cu, Mn, Mo, Zn) and toxic species (As) was shown. Since the bacteria used in this study were originally obtained from a subsurface copper deposit, these results highlight the potential importance of extracellular compounds in biogeochemical cycles of elements in underground environment and their ecological significance in promoting the uptake of essential trace metals and resistance to toxic elements.

  11. Widespread Use of TATA Elements in the Core Promoters for RNA Polymerases III, II, and I in Fission Yeast

    PubMed Central

    Hamada, Mitsuhiro; Huang, Ying; Lowe, Todd M.; Maraia, Richard J.

    2001-01-01

    In addition to directing transcription initiation, core promoters integrate input from distal regulatory elements. Except for rare exceptions, it has been generally found that eukaryotic tRNA and rRNA genes do not contain TATA promoter elements and instead use protein-protein interactions to bring the TATA-binding protein (TBP), to the core promoter. Genomewide analysis revealed TATA elements in the core promoters of tRNA and 5S rRNA (Pol III), U1 to U5 snRNA (Pol II), and 37S rRNA (Pol I) genes in Schizosaccharomyces pombe. Using tRNA-dependent suppression and other in vivo assays, as well as in vitro transcription, we demonstrated an obligatory requirement for upstream TATA elements for tRNA and 5S rRNA expression in S. pombe. The Pol III initiation factor Brf is found in complexes with TFIIIC and Pol III in S. pombe, while TBP is not, consistent with independent recruitment of TBP by TATA. Template commitment assays are consistent with this and confirm that the mechanisms of transcription complex assembly and initiation by Pol III in S. pombe differ substantially from those in other model organisms. The results were extended to large-rRNA synthesis, as mutation of the TATA element in the Pol I promoter also abolishes rRNA expression in fission yeast. A survey of other organisms' genomes reveals that a substantial number of eukaryotes may use widespread TATAs for transcription. These results indicate the presence of TATA-unified transcription systems in contemporary eukaryotes and provide insight into the residual need for TBP by all three Pols in other eukaryotes despite a lack of TATA elements in their promoters. PMID:11564871

  12. 10 cm x 10 cm Single Gas Electron Multiplier (GEM) X-ray Fluorescence Detector for Dilute Elements

    NASA Astrophysics Data System (ADS)

    Shaban, E. H.; Siddons, D. P.; Seifu, D.

    2014-03-01

    We have built and tested a 10 cm × 10 cm single Gas Electron Multiplier (GEM) X-ray detector to probe dilute amounts of Fe in a prepared sample. The detector uses Argon/Carbon Dioxide (75/25) gas mixture flowing at a slow rate through a leak proof Plexi-glass enclosure held together by O-rings and screws. The Fluorescence X-ray emitted by the element under test is directed through a Mylar window into the drift region of the detector where abundant gas is flowing. The ionized electrons are separated, drifted into the high electric field of the GEM, and multiplied by impact ionization. The amplified negatively charged electrons are collected and further amplified by a Keithley amplifier to probe the absorption edge of the element under test using X-ray absorption spectroscopy technique. The results show that the GEM detector provided good results with less noise as compared with a Silicon drift detector (SDD).

  13. Deciphering dynamic dose responses of natural promoters and single cis elements upon osmotic and oxidative stress in yeast.

    PubMed

    Dolz-Edo, Laura; Rienzo, Alessandro; Poveda-Huertes, Daniel; Pascual-Ahuir, Amparo; Proft, Markus

    2013-06-01

    Fine-tuned activation of gene expression in response to stress is the result of dynamic interactions of transcription factors with specific promoter binding sites. In the study described here we used a time-resolved luciferase reporter assay in living Saccharomyces cerevisiae yeast cells to gain insights into how osmotic and oxidative stress signals modulate gene expression in a dose-sensitive manner. Specifically, the dose-response behavior of four different natural promoters (GRE2, CTT1, SOD2, and CCP1) reveals differences in their sensitivity and dynamics in response to different salt and oxidative stimuli. Characteristic dose-response profiles were also obtained for artificial promoters driven by only one type of stress-regulated consensus element, such as the cyclic AMP-responsive element, stress response element, or AP-1 site. Oxidative and osmotic stress signals activate these elements separately and with different sensitivities through different signaling molecules. Combination of stress-activated cis elements does not, in general, enhance the absolute expression levels; however, specific combinations can increase the inducibility of the promoter in response to different stress doses. Finally, we show that the stress tolerance of the cell critically modulates the dynamics of its transcriptional response in the case of oxidative stress.

  14. Bioleaching of rare earth and radioactive elements from red mud using Penicillium tricolor RM-10.

    PubMed

    Qu, Yang; Lian, Bin

    2013-05-01

    The aim of this work is to investigate biological leaching of rare earth elements (REEs) and radioactive elements from red mud, and to evaluate the radioactivity of the bioleached red mud used for construction materials. A filamentous, acid-producing fungi named RM-10, identified as Penicillium tricolor, is isolated from red mud. In our bioleaching experiments by using RM-10, a total concentration of 2% (w/v) red mud under one-step bioleaching process was generally found to give the maximum leaching ratios of the REEs and radioactive elements. However, the highest extraction yields are achieved under two-step bioleaching process at 10% (w/v) pulp density. At pulp densities of 2% and 5% (w/v), red mud processed under both one- and two-step bioleaching can meet the radioactivity regulations in China.

  15. Impact of the IL-10 Promoter Gene Polymorphisms in the Severity of Chronic Hepatitis B Infection

    PubMed Central

    Ghaleh Baghi, Sahand; Alavian, Seyed Moayed; Mehrnoush, Leila; Salimi, Shima

    2015-01-01

    Background: Interleukin-10 (IL-10) is an important anti-inflammatory cytokine. The polymorphisms of its promoter gene have been considered to be related with the chronicity of hepatitis B infection. Objectives: The aim of this study was to evaluate the polymorphisms at different positions in the IL-10 promoter gene in patients with chronic hepatitis B. Patients and Methods: Totally, 166 patients with chronic hepatitis B infection were enrolled. Genotypes at different positions (i.e. -819, - 592, and - 1082) in the IL-10 gene promoter were determined. Results: The C/A genotype at position -592, C/T genotype at position -819, and GCC/ATA haplotype of the IL-10 gene promoter were significantly more common in the patients with cirrhosis. The genotypes were significantly different between the hepatitis B e antigen (HBeAg)-negative and HBeAg-positive patients at position -592 (C/A and C/C), position -819 (C/C and C/T), and position -1082 (A/A and G/A). Conclusions: Some IL-10 promoter gene polymorphisms predisposed the infected hepatitis B virus cases to cirrhosis in our study population. PMID:26300930

  16. Evidence for multiple promoters of the human IL-5 receptor alpha subunit gene: a novel 6-base pair element determines cell-specific promoter function.

    PubMed

    Zhang, J; Kuvelkar, R; Cheewatrakoolpong, B; Williams, S; Egan, R W; Billah, M M

    1997-12-01

    In addition to a previously characterized promoter (P1), we now show the existence of a second promoter for the human IL-5Ralpha gene. Initially, a genomic region (P2) 5' upstream of human IL-5Ralpha exon 2 was cloned by an inverted PCR. The transcriptional start site was then mapped to a deoxycytidine (C) residue within P2 by analyzing cellular mRNA with both the 5' rapid amplification of cDNA end-PCR and S1 nuclease protection assays. Transfection of eosinophilic HL-60 cells with reporter gene constructs in which either P1 or P2 was linked to the bacterial chloramphenicol acetyltransferase (CAT) gene resulted in CAT expression; little or no CAT expression occurred in other myeloid and nonmyeloid cell lines. Deletion studies showed that a 66-bp region, ranging from -31 to +35, was sufficient to promote CAT expression in eosinophilic HL-60 cells. Analysis of linker-scanning mutants identified a novel 6-bp element (5' CTAATT 3') spanning -19 to -14 that was essential for P2 promoter activity. In electrophoretic mobility shift assays, a P2 region from -31 to +1 containing the unique 6-bp element, when used as a probe, formed a complex with a protein(s) that was found only in the eosinophilic cell line. This binding activity was lost upon replacement of the 6-bp element with a 6-bp linker, suggesting that this element likely serves as the binding site for an eosinophilic HL-60 cell-specific transcription factor(s). Together, these data suggest an important role for P2 promoter in the regulation of eosinophil-specific expression of the human IL-5 receptor alpha gene.

  17. Studies of Ultra-Heavy Elements in Solar Energetic Particles Above 10 MeV/nucleon

    NASA Astrophysics Data System (ADS)

    Leske, R. A.; Cohen, C. M.; Cummings, A. C.; Mewaldt, R. A.; Stone, E. C.; Wiedenbeck, M. E.; von Rosenvinge, T. T.

    2006-05-01

    Measurements below several MeV/nucleon show that abundances of elements heavier than Ni (Z=28) can be enhanced relative to oxygen by factors of ~100 to 1000 (depending on species) in impulsive solar energetic particle (SEP) events, and large gradual events are often iron-rich and may contain admixtures of flare seed material. Recently, using the Solar Isotope Spectrometer (SIS) on NASA's ACE spacecraft, which measures the composition of energetic nuclei for elements up to ~Zr (Z=40) at energies from ~10 to >100 MeV/nucleon, we have reported detection of enhanced ultra-heavy (UH) abundances in SEP events above 10 MeV/nucleon, with resolved UH elements such as Zn, Ge and Se (Z=30, 32, and 34). We present further SIS observations of ultra-heavy SEPs that can be used to test models of acceleration and abundance enhancements in both gradual and impulsive events. By surveying the entire >8 years of ACE data, we determine the average SEP composition for elements from Z=30 to 40 and examine the time distribution of these nuclei to assess whether they arrived preferentially during gradual or impulsive events. We test whether iron-rich gradual events show noticeably larger UH enhancements than other gradual events (as expected if iron-rich events contain flare seed material), and we report cases of large excesses of UH elements in impulsive events. For example, at energies >10 MeV/nucleon, the event of 23 July 2004 had a (34

  18. Human transcription factor USF stimulates transcription through the initiator elements of the HIV-1 and the Ad-ML promoters.

    PubMed Central

    Du, H; Roy, A L; Roeder, R G

    1993-01-01

    Earlier in vitro studies identified USF as a cellular factor which activates the adenovirus major late (Ad-ML) promoter by binding to an E-box motif located at position -60 with respect to the cap site. Purified USF contains 44 and 43 kDa polypeptides, and the latter was found (by cDNA cloning) to be a helix-loop-helix protein. In this report, we demonstrate a 25-to 30-fold stimulation of transcription via an upstream binding site by ectopic expression of the 43 kDa form of USF (USF43) in transient transfection assays. More recent data have also revealed alternate interactions of USF43 at pyrimidine-rich (consensus YYAYTCYY) initiator (Inr) elements present in a variety of core promoters. In agreement with this observation, we show here that USF43 can recognize the initiator elements of the HIV-1 promoter, as well as those in the Ad-ML promoter, and that ectopic expression of USF43 can stimulate markedly the corresponding core promoters (TATA and initiator elements) when analyzed in transient co-transfection assays. Mutations in either Inr 1 or Inr 2 reduced the USF43-dependent transcription activity in vivo. In addition, in vitro transcription assays showed that mutations in either or both of the Inr 1 and Inr 2 sequences of the HIV-1 and Ad-ML promoters could affect transcription efficiency, but not the position of the transcriptional start site. These results indicate that USF43 can stimulate transcription through initiator elements in two viral promoters, although the exact mechanism and physiological significance of this effect remain unclear. Images PMID:8440240

  19. 10 CFR 719.21 - What are the required elements of an engagement letter?

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 4 2013-01-01 2013-01-01 false What are the required elements of an engagement letter? 719.21 Section 719.21 Energy DEPARTMENT OF ENERGY CONTRACTOR LEGAL MANAGEMENT REQUIREMENTS Engagement... with the certification in the Attachment to Appendix A to this part. (5) That professional conflicts...

  20. Comparative genomics and experimental promoter analysis reveal functional liver-specific elements in mammalian hepatic lipase genes

    PubMed Central

    van Deursen, Diederik; Botma, Gert-Jan; Jansen, Hans; Verhoeven, Adrie JM

    2007-01-01

    Background Mammalian hepatic lipase (HL) genes are transcribed almost exclusively in hepatocytes. The basis for this liver-restricted expression is not completely understood. We hypothesized that the responsible cis-acting elements are conserved among mammalian HL genes. To identify these elements, we made a genomic comparison of 30 kb of 5'-flanking region of the rat, mouse, rhesus monkey, and human HL genes. The in silico data were verified by promoter-reporter assays in transfected hepatoma HepG2 and non-hepatoma HeLa cells using serial 5'-deletions of the rat HL (-2287/+9) and human HL (-685/+13) promoter region. Results Highly conserved elements were present at the proximal promoter region, and at 14 and 22 kb upstream of the transcriptional start site. Both of these upstream elements increased transcriptional activity of the human HL (-685/+13) promoter region 2–3 fold. Within the proximal HL promoter region, conserved clusters of transcription factor binding sites (TFBS) were identified at -240/-200 (module A), -80/-40 (module B), and -25/+5 (module C) by the rVista software. In HepG2 cells, modules B and C, but not module A, were important for basal transcription. Module B contains putative binding sites for hepatocyte nuclear factors HNF1α. In the presence of module B, transcription from the minimal HL promoter was increased 1.5–2 fold in HepG2 cells, but inhibited 2–4 fold in HeLa cells. Conclusion Our data demonstrate that searching for conserved non-coding sequences by comparative genomics is a valuable tool in identifying candidate enhancer elements. With this approach, we found two putative enhancer elements in the far upstream region of the HL gene. In addition, we obtained evidence that the -80/-40 region of the HL gene is responsible for enhanced HL promoter activity in hepatoma cells, and for silencing HL promoter activity in non-liver cells. PMID:17428321

  1. cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice.

    PubMed

    Sharif, K A; Li, C; Gudas, L J

    2001-05-01

    The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development. LAMB1 transgene expression is observed in a selective set of nephrons of the neonatal and adult kidneys. The cis-acting DNA regulatory elements responsible for LAMB1 transgene expression in ovaries and in juvenile kidneys are present between -'1.4 and -0.7 kb relative to the transcription start site, while those of adult kidneys are located between -2.5 and -1.4 kb. The LAMB1 transgene is also expressed in the epididymis of 1 week old transgenic mice. Mutation of the retinoic acid response element (RARE) in the context of the 3.9LAMB1betagal transgene results in loss of LAMB1 transgene expression in all tissues. Thus, sequences between -2.5 and -0.7 kb plus the RARE are required for appropriate expression of the LAMB1 transgene in mice.

  2. IMPDH2 genetic polymorphism: a promoter single-nucleotide polymorphism disrupts a cyclic adenosine monophosphate responsive element.

    PubMed

    Garat, Anne; Cauffiez, Christelle; Hamdan-Khalil, Rima; Glowacki, François; Devos, Aurore; Leclerc, Julie; Lionet, Arnaud; Allorge, Delphine; Lo-Guidice, Jean-Marc; Broly, Franck

    2009-12-01

    Inosine 5'-monophosphate dehydrogenase (IMPDH), which catalyzes a key step in the de novo biosynthesis of guanine nucleotide, is mediated by two highly conserved isoforms, IMPDH1 and IMPDH2. In this study, IMPDH2 genetic polymorphism was investigated in 96 individuals of Caucasian origin. Four single-nucleotide polymorphisms were identified, comprising one previously described single base-pair substitution in the close vicinity of the consensus donor splice site of intron 7 (IVS7+10T>C), and three novel polymorphisms, one silent substitution in exon 9 (c.915C>G), one single base-pair insertion (g.6971_6972insT) within the 3'-untranslated region of the gene, and one substitution located in the promoter region (c.-95T>G) in a transcription factor binding site CRE(A) (cyclic adenosine monophosphate [cAMP] response element). Considering the nature and location of this latter polymorphism, its functional relevance was examined by transfecting HEK293 and Jurkat cell lines with constructs of the related region of IMPDH2/luciferase reporter gene. The c.-95T>G mutation leads to a significant decrease of luciferase activity (HEK293: 55% decrease, p < 0.05; Jurkat: 65% decrease, p < 0.05) compared with the wild-type promoter sequence and, therefore, is likely to determine interindividual differences in IMPDH2 transcriptional regulation. These results might contribute to a better understanding of the variability in clinical outcome and dose adjustments of certain immunosuppressors that are metabolized through the IMPDH pathway or that are IMPDH inhibitors.

  3. The measurement of elemental abundances above 10 sup 15 eV at a lunar base

    SciTech Connect

    Swordy, S.P. )

    1990-03-15

    At {approx}10{sup 15} eV the slope of the energy spectrum of cosmic rays becomes significantly steeper than at lower energies. The measurement of relative elemental abundances at these energies is expected to provide a means to resolve the origin of this feature and greatly contribute to the understanding of the sources of cosmic rays. We describe a moon based detector for making well resolved elemental measurements at these energies using hadronic calorimetry. This detector is particularly well suited for a site on the lunar surface because there is no overlying layer of atmosphere and the large mass required can be provided by the lunar regolith.

  4. An interlaboratory comparison study on the measurement of elements in PM10

    NASA Astrophysics Data System (ADS)

    Yatkin, Sinan; Belis, Claudio A.; Gerboles, Michel; Calzolai, Giulia; Lucarelli, Franco; Cavalli, Fabrizia; Trzepla, Krystyna

    2016-01-01

    An inter-laboratory comparison study was conducted to measure elemental loadings on PM10 samples, collected in Ispra, a regional background/rural site in Italy, using three different XRF (X-ray Fluorescence) methods, namely Epsilon 5 by linear calibration, Quant'X by the standardless analysis, and PIXE (Particle Induced X-ray Emission) with linear calibration. A subset of samples was also analyzed by ICP-MS (Inductively Coupled Plasma-Mass Spectrometry). Several metrics including method detection limits (MDLs), precision, bias from a NIST standard reference material (SRM 2783) quoted values, relative absolute difference, orthogonal regression and the ratio of the absolute difference between the methods to claimed uncertainty were used to compare the laboratories. The MDLs were found to be comparable for many elements. Precision estimates were less than 10% for the majority of the elements. Absolute biases from SRM 2783 remained less than 20% for the majority of certified elements. The regression results of PM10 samples showed that the three XRF laboratories measured very similar mass loadings for S, K, Ti, Mn, Fe, Cu, Br, Sr and Pb with slopes within 20% of unity. The ICP-MS results confirmed the agreement and discrepancies between XRF laboratories for Al, K, Ca, Ti, V, Cu, Sr and Pb. The ICP-MS results are inconsistent with the XRF laboratories for Fe and Zn. The absolute differences between the XRF laboratories generally remained within their claimed uncertainties, showing a pattern generally consistent with the orthogonal regression results.

  5. Alcohol dysregulates corticotropin-releasing-hormone (CRH) promoter activity by interfering with the negative glucocorticoid response element (nGRE).

    PubMed

    Przybycien-Szymanska, Magdalena M; Mott, Natasha N; Pak, Toni R

    2011-01-01

    EtOH exposure in male rats increases corticotropin-releasing hormone (CRH) mRNA in the paraventricular nucleus of the hypothalamus (PVN), a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB). In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR) antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE) on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT) or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  6. Identification of a functional antioxidant responsive element in the promoter of the Chinese hamster carbonyl reductase 3 (Chcr3) gene.

    PubMed

    Miura, Takeshi; Taketomi, Ayako; Nakabayashi, Toshikatsu; Nishinaka, Toru; Terada, Tomoyuki

    2015-07-01

    CHCR3, a member of the short-chain dehydrogenase/reductase superfamily, is a carbonyl reductase 3 enzyme in Chinese hamsters. Carbonyl reductase 3 in humans has been believed to involve the metabolism and/or pharmacokinetics of anthracycline drugs, and the mechanism underlying the gene regulation has been investigated. In this study, the nucleotide sequence of the Chcr3 promoter was originally determined, and its promoter activity was characterised. The proximal promoter region is TATA-less and GC-rich, similar to the promoter region of human carbonyl reductase 3. Cobalt stimulated the transcriptional activity of the Chcr3 gene. The results of a luciferase gene reporter assay demonstrated that cobalt-induced stimulation required an antioxidant responsive element. Forced expression of Nrf2, the transcription factor that binds to antioxidant responsive elements, enhanced the transcriptional activity of the Chcr3 gene. These results suggest that cobalt induces the expression of the Chcr3 gene via the Nrf2-antioxidant responsive element pathway.

  7. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    PubMed

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE.

  8. Transcriptional regulation of the bovine leukemia virus promoter by the cyclic AMP-response element modulator tau isoform.

    PubMed

    Nguyên, Thi Lien-Anh; de Walque, Stéphane; Veithen, Emmanuelle; Dekoninck, Ann; Martinelli, Valérie; de Launoit, Yvan; Burny, Arsène; Harrod, Robert; Van Lint, Carine

    2007-07-20

    Bovine leukemia virus (BLV) expression is controlled at the transcriptional level through three Tax(BLV)-responsive elements (TxREs) responsive to the viral transactivator Tax(BLV). The cAMP-responsive element (CRE)-binding protein (CREB) has been shown to interact with CRE-like sequences present in the middle of each of these TxREs and to play critical transcriptional roles in both basal and Tax(BLV)-transactivated BLV promoter activity. In this study, we have investigated the potential involvement of the cAMP-response element modulator (CREM) in BLV transcriptional regulation, and we have demonstrated that CREM proteins were expressed in BLV-infected cells and bound to the three BLV TxREs in vitro. Chromatin immunoprecipitation assays using BLV-infected cell lines demonstrated in the context of chromatin that CREM proteins were recruited to the BLV promoter TxRE region in vivo. Functional studies, in the absence of Tax(BLV), indicated that ectopic CREMtau protein had a CRE-dependent stimulatory effect on BLV promoter transcriptional activity. Cross-link of the B-cell receptor potentiated CREMtau transactivation of the viral promoter. Further experiments supported the notion that this potentiation involved CREMtau Ser-117 phosphorylation and recruitment of CBP/p300 to the BLV promoter. Although CREB and Tax(BLV) synergistically transactivated the BLV promoter, CREMtau repressed this Tax(BLV)/CREB synergism, suggesting that a modulation of the level of Tax(BLV) transactivation through opposite actions of CREB and CREMtau could facilitate immune escape and allow tumor development.

  9. A conserved 11 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene.

    PubMed Central

    Rapp, W D; Stern, D B

    1992-01-01

    To determine the structure of a functional plant mitochondrial promoter, we have partially purified an RNA polymerase activity that correctly initiates transcription at the maize mitochondrial atp1 promoter in vitro. Using a series of 5' deletion constructs, we found that essential sequences are located within--19 nucleotides (nt) of the transcription initiation site. The region surrounding the initiation site includes conserved sequence motifs previously proposed to be maize mitochondrial promoter elements. Deletion of a conserved 11 nt sequence showed that it is critical for promoter function, but deletion or alteration of conserved upstream G(A/T)3-4 repeats had no effect. When the atp1 11 nt sequence was inserted into different plasmids lacking mitochondrial promoter activity, transcription was only observed for one of these constructs. We infer from these data that the functional promoter extends beyond this motif, most likely in the 5' direction. The maize mitochondrial cox3 and atp6 promoters also direct transcription initiation in this in vitro system, suggesting that it may be widely applicable for studies of mitochondrial transcription in this species. Images PMID:1372246

  10. Promotion

    PubMed Central

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed. PMID:24436683

  11. Suitability of DCPs with screw locking elements to allow sufficient interfragmentary motion to promote secondary bone healing of osteoporotic fractures.

    PubMed

    Cuadrado, A; Yánez, A; Carta, J A; Garcés, G

    2013-06-01

    This paper analyses the suitability of a system comprising a Dynamic Compression Plate (DCP) and Screw Locking Elements (SLEs) to allow sufficient interfragmentary motion to promote secondary bone healing in osteoporotic fractures. Four fixation systems were mounted on bone-simulating reinforced epoxy bars filled with solid rigid polyurethane foam. Group 1, used for comparison purposes, represents a system comprised of a Locking Compression Plate (LCP) and eight locking screws. Groups 2 and 3 represent a system comprised of a DCP plate with eight cortical screws and two SLEs placed on the screws furthest from (group 2) and nearest to (group 3) the fracture. Group 4 represents the system comprised of a DCP plate with SLEs placed on all eight cortical screws. Cyclic compression tests of up to 10,000 load cycles were performed in order to determine the parameters of interest, namely the stiffnesses and the interfragmentary motion of the various configurations under consideration. Tukey's multiple comparison test was used to analyse the existence or otherwise of significant differences between the means of the groups. At 10,000 cycles, interfragmentary motion at the far cortex for group 2 was 0.60±0.04 mm and for group 3 0.59±0.03 mm (there being no significant differences: p=0.995). The mean interfragmentary motion at the far cortex of the LCP construct was 70% less than that of the two groups with 2SLEs (there being significant differences: p=1.1×10(-8)). In the case of group 4 this figure was 45% less than in groups 2 and 3 (there being significant differences: p=5.6×10(-6)). At 10,000 cycles, interfragmentary motion at the near cortex for group 2 was 0.24±0.06 mm and for group 3 0.24±0.03 mm (there being no significant differences: p=1.000). The mean interfragmentary motion at the near cortex of the LCP construct was 70.8% less than that of the two groups with 2SLEs (there being significant differences: p=0.011). In the case of group 4 this figure was 66

  12. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.

    PubMed

    Reichenstein, Moshe; German, Tania; Barash, Itamar

    2005-04-11

    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  13. Wnt-10b promotes differentiation of skin epithelial cells in vitro

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-03-31

    To evaluate the role of Wnt-10b in epithelial differentiation, we investigated the effects of Wnt-10b on adult mouse-derived primary skin epithelial cells (MPSEC). Recombinant Wnt-10b protein (rWnt-10b) was prepared using a gene engineering technique and MPSEC were cultured in its presence, which resulted in morphological changes from cuboidal to spindle-shaped and inhibited their proliferation. Further, involvement of the canonical Wnt signal pathway was also observed. MPSEC treated with rWnt-10b showed characteristics of the hair shaft and inner root sheath of the hair follicle, in results of Ayoub Shklar staining and immunocytochemistry. Further, the cells expressed mRNA for differentiated epithelial cells, including keratin 1, keratin 2, loricrin, mHa5, and mHb5, in association with a decreased expression of the basal cell marker keratin 5. These results suggest that Wnt-10b promotes the differentiation of MPSEC.

  14. Relative Strengths of Promoters Provided by Common Mobile Genetic Elements Associated with Resistance Gene Expression in Gram-Negative Bacteria

    PubMed Central

    Kamruzzaman, Muhammad; Patterson, Jason D.; Shoma, Shereen; Ginn, Andrew N.; Partridge, Sally R.

    2015-01-01

    Comparison of green fluorescent protein expression from outward-facing promoters (POUT) of ISAba1, ISEcp1, and ISAba125 revealed approximate equivalence in strength, intermediate between PCS (strong) and PCWTGN-10 (weak) class 1 integron promoter variants, >30-fold stronger than POUT of ISCR1, and >5 times stronger than Ptac. Consistent with its usual role, PCWTGN-10 produces more mRNA from a “downstream” gfp gene transcriptionally linked to a “usual” PCWTGN-10-associated gene cassette than does POUT of ISAba1. PMID:26055385

  15. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Illustrative List of Fuel Element Fabrication Plant... Appendix O to Part 110—Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority Note: Nuclear fuel elements are manufactured from source or...

  16. Technical advance: stringent control of transgene expression in Arabidopsis thaliana using the Top10 promoter system

    NASA Technical Reports Server (NTRS)

    Love, J.; Scott, A. C.; Thompson, W. F.; Brown, C. S. (Principal Investigator)

    2000-01-01

    We show that the tightly regulated tetracycline-sensitive Top10 promoter system (Weinmann et al. Plant J. 1994, 5, 559-569) is functional in Arabidopsis thaliana. A pure breeding A. thaliana line (JL-tTA/8) was generated which expressed a chimeric fusion of the tetracycline repressor and the activation domain of Herpes simplex virus (tTA), from a single transgenic locus. Plants from this line were crossed with transgenics carrying the ER-targeted green fluorescent protein coding sequence (mGFP5) under control of the Top10 promoter sequence. Progeny from this cross displayed ER-targeted GFP fluorescence throughout the plant, indicating that the tTA-Top10 promoter interaction was functional in A. thaliana. GFP expression was repressed by 100 ng ml-1 tetracycline, an order of magnitude lower than the concentration used previously to repress expression in Nicotiana tabacum. Moreover, the level of GFP expression was controlled by varying the concentration of tetracycline in the medium, allowing a titred regulation of transgenic activity that was previously unavailable in A. thaliana. The kinetics of GFP activity were determined following de-repression of the Top10:mGFP5 transgene, with a visible ER-targeted GFP signal appearing from 24 to 48 h after de-repression.

  17. Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

    NASA Technical Reports Server (NTRS)

    Frudakis, T. N.; Wilt, F.

    1995-01-01

    The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

  18. Promoter elements of the PHR1 gene of Saccharomyces cerevisiae and their roles in the response to DNA damage.

    PubMed Central

    Sancar, G B; Ferris, R; Smith, F W; Vandeberg, B

    1995-01-01

    The PHR1 gene of Saccharomyces cerevisiae encodes the apoenzyme for the DNA repair enzyme photolyase. PHR1 transcription is induced in response to 254 nm radiation and a variety of chemical damaging agents. We report here the identification of promoter elements required for PHR1 expression. Transcription is regulated primarily through three sequence elements clustered within a 120 bp region immediately upstream of the translational start site. A 20 bp interrupted palindrome comprises UASPHR1 and is responsible for 80-90% of basal and induced expression. UASPHR1 alone can activate transcription of a CYC1 minimal promoter but does not confer damage responsiveness. In the intact PHR1 promoter UAS function is dependent upon an upstream essential sequence (UES). URSPHR1 contains a binding site for the damage-responsive repressor Prp; consistent with this role, deletion or specific mutations of the URS increase basal level expression and decrease the induction ratio. Deletion of URSPHR1 also eliminates the requirement for UESPHR1 for promoter activation, indicating that the UES attenuates Prp-mediated repression. Sequences within UASPHR1 are similar to regulatory sequences found upstream of both damage responsive and nonresponsive genes involved in DNA repair and metabolism. PMID:7501452

  19. Lgl1 activation of rab10 promotes axonal membrane trafficking underlying neuronal polarization.

    PubMed

    Wang, Tong; Liu, Yang; Xu, Xiao-Hui; Deng, Cai-Yun; Wu, Kong-Yan; Zhu, Ji; Fu, Xiu-Qing; He, Miao; Luo, Zhen-Ge

    2011-09-13

    Directed membrane trafficking is believed to be crucial for axon development during neuronal morphogenesis. However, the underlying mechanisms are poorly understood. Here, we report a role of Lgl1, the mammalian homolog of Drosophila tumor suppressor Lethal giant larvae, in controlling membrane trafficking underlying axonal growth. We find that Lgl1 is associated with plasmalemmal precursor vesicles and enriched in developing axons. Lgl1 upregulation promoted axonal growth, whereas downregulation attenuated it as well as directional membrane insertion. Interestingly, Lgl1 interacted with and activated Rab10, a small GTPase that mediates membrane protein trafficking, by releasing GDP dissociation inhibitor (GDI) from Rab10. Furthermore, Rab10 lies downstream of Lgl1 in axon development and directional membrane insertion. Finally, both Lgl1 and Rab10 are required for neocortical neuronal polarization in vivo. Thus, the Lgl1 regulation of Rab10 stimulates the trafficking of membrane precursor vesicles, whose fusion with the plasmalemma is crucial for axonal growth.

  20. Wnt-10b secreted from lymphocytes promotes differentiation of skin epithelial cells

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-04-21

    Wnt-10b was originally isolated from lymphoid tissue and is known to be involved in a wide range of biological actions, while recently it was found to be expressed early in the development of hair follicles. However, few studies have been conducted concerning the role of Wnt-10b with the differentiation of skin epithelial cells. To evaluate its role in epithelial differentiation, we purified Wnt-10b from the supernatant of a concanavalin A-stimulated lymphocyte culture using an affinity column and investigated its effects on the differentiation of adult mouse-derived primary skin epithelial cells (MPSEC). MPSEC cultured with Wnt-10b showed morphological changes from cuboidal to spindle-shaped with inhibited proliferation, and also obtained characteristics of the hair shaft and inner root sheath of the hair follicle, represented by red-colored Ayoub Shklar staining, and reactions to AE-13 and AE-15 as seen with immunocytology. Further, RT-PCR analysis demonstrated the expression of mRNA for keratin 1, keratin 2, loricrin, mHa5, and mHb5, in association with a decreased expression of the basal cell marker keratin 5, in Wnt-10b-treated MPSEC. In addition, involvement of the canonical Wnt signal pathway was demonstrated by a TCF reporter (pTOPFLASH) assay. These results suggest that Wnt-10b promotes the differentiation of MPSEC and may play an important role in hair follicle development by promoting differentiation of epithelial cells.

  1. Investigation of Radar Propagation in Buildings: A 10 Billion Element Cartesian-Mesh FETD Simulation

    SciTech Connect

    Stowell, M L; Fasenfest, B J; White, D A

    2008-01-14

    In this paper large scale full-wave simulations are performed to investigate radar wave propagation inside buildings. In principle, a radar system combined with sophisticated numerical methods for inverse problems can be used to determine the internal structure of a building. The composition of the walls (cinder block, re-bar) may effect the propagation of the radar waves in a complicated manner. In order to provide a benchmark solution of radar propagation in buildings, including the effects of typical cinder block and re-bar, we performed large scale full wave simulations using a Finite Element Time Domain (FETD) method. This particular FETD implementation is tuned for the special case of an orthogonal Cartesian mesh and hence resembles FDTD in accuracy and efficiency. The method was implemented on a general-purpose massively parallel computer. In this paper we briefly describe the radar propagation problem, the FETD implementation, and we present results of simulations that used over 10 billion elements.

  2. Multiple DNA sequence elements are necessary for the function of an immunoglobulin heavy chain promoter.

    PubMed Central

    Eaton, S; Calame, K

    1987-01-01

    Sequences required for the function of the mouse V1 immunoglobulin heavy chain variable-region (VH) promoter were identified by transient transfection of the normal and mutated promoters into plasmacytoma cells. Our results identify four regions required for normal promoter function: (i) the octamer ATGCAAAT, previously identified by others; (ii) a heptamer, CTAATGA; (iii) a pyrimidine-rich region; and (iv) a region between positions -125 and -251 relative to the transcription start site. Sequence analysis of 19 mouse and human VH 5' flanking regions shows that the heptamer and pyrimidine stretch are strongly conserved. We have also demonstrated that the octamer functions in an orientation independent manner in the VH promoter. Images PMID:3118372

  3. Decreased HoxD10 expression promotes a proliferative and aggressive phenotype in prostate cancer.

    PubMed

    Mo, R-J; Lu, J-M; Wan, Y-P; Hua, W; Liang, Y-X; Zhuo, Y-J; Kuang, Q-W; Liu, Y-L; He, H-C; Zhong, W-D

    2017-02-19

    HoxD10 gene plays a critical role in cell proliferation in the process of tumor development. However, the protein expression level and the function of HoxD10 in prostate cancer remain unknown. Using tissue microarray, we demonstrate that the protein expression of HoxD10 is commonly decreased in prostate cancer tissues (n = 92) compared to adjacent benign prostate tissues (n = 77). Functionally, knockdown of HoxD10 resulted in significant promotion of prostate cancer cell proliferation. Moreover, knockdown of HoxD10 strikingly stimulated prostate tumor growth in a mouse xenograft model. We also found a significant association between decreased immunohistochemical staining of HoxD10 expression and higher Gleason score (P = 0.031) and advanced clinical pathological stage (P = 0.011). An analysis of the Taylor database revealed that decreased HoxD10 expression predicted worse biochemical recurrence (BCR)-free survival of PCa patients (P = 0.005) and the multivariate analyses further supported that HoxD10 might be an independent predictor for BCR-free survival (P = 0.027). Collectively, our data suggest that the loss of HoxD10 function is common and may thus result in a progressive phenotype in PCa. HoxD10 may function as a biomarker that differentiates patients with BCR disease from the ones that are not after radical prostatectomy, implicating its potential as a therapeutic target.

  4. Disease-Regulated Gene Therapy with Anti-Inflammatory Interleukin-10 Under the Control of the CXCL10 Promoter for the Treatment of Rheumatoid Arthritis.

    PubMed

    Broeren, Mathijs G A; de Vries, Marieke; Bennink, Miranda B; Arntz, Onno J; Blom, Arjen B; Koenders, Marije I; van Lent, Peter L E M; van der Kraan, Peter M; van den Berg, Wim B; van de Loo, Fons A J

    2016-03-01

    Disease-inducible promoters for the treatment of rheumatoid arthritis (RA) have the potential to provide regulated expression of therapeutic proteins in arthritic joints. In this study, we set out to identify promoters of human genes that are upregulated during RA and are suitable to drive the expression of relevant amounts of anti-inflammatory interleukin (IL)-10. Microarray analysis of RA synovial biopsies compared with healthy controls yielded a list of 22 genes upregulated during RA. Of these genes, CXCL10 showed the highest induction in lipopolysaccharide-stimulated synovial cells. The CXCL10 promoter was obtained from human cDNA and cloned into a lentiviral vector carrying firefly luciferase to determine the promoter inducibility in primary synovial cells and in THP-1 cells. The promoter activation was strongest 8-12 hr after stimulation with the proinflammatory cytokine tumor necrosis factor (TNF)-α and was reinducible after 96 hr. In addition, the CXCL10 promoter showed a significant response to RA patient serum, compared with sera from healthy individuals. The luciferase gene was replaced with IL-10 to determine the therapeutic properties of the CXCL10p-IL10 lentiviral vector. Primary synovial cells transduced with CXCL10p-IL10 showed a great increase in IL-10 production after stimulation, which reduced the release of proinflammatory cytokines TNF-α and IL-1β. We conclude that the selected proximal promoter of the CXCL10 gene responds to inflammatory mediators present in the serum of patients with RA and that transduction with the lentiviral CXCL10p-IL10 vector reduces inflammatory cytokine production by primary synovial cells from patients with RA. CXCL10 promoter-regulated IL-10 overexpression can thus provide disease-inducible local gene therapy suitable for RA.

  5. Regulation of mouse thymidylate synthase gene expression in growth-stimulated cells: upstream S phase control elements are indistinguishable from the essential promoter elements.

    PubMed Central

    Ash, J; Liao, W C; Ke, Y; Johnson, L F

    1995-01-01

    Expression of the mammalian thymidylate synthase (TS) gene in growth-stimulated cells is closely coordinated with entry into S phase. Previous studies with transfected TS minigenes have shown that sequences upstream of the coding region as well as an intron in the transcribed region are both necessary for proper regulation of TS mRNA content in growth-stimulated cells. The goal of the present study was to identify the upstream regulatory elements. Minigenes consisting of TS 5' flanking sequences linked to the TS coding region (interrupted by introns 1 and 2) were stably transfected into mouse 3T6 cells. Deletion and site-directed mutagenesis of the 5' flanking region revealed that there is a close correspondence between the upstream sequences that are necessary for S phase regulation and the 30 nucleotide region that is essential for promoter activity. These observations raised the possibility that regulation of the TS gene occurs at the transcriptional level. However, nuclear run-on assays showed that the rate of transcription of the TS gene changed very little during the G1-S phase transition. Furthermore, when the TS promoter was linked to an intron-less luciferase indicator gene, there was no change in expression following growth-stimulation. Therefore it appears that the TS gene is controlled primarily at the posttranscriptional level, and that the TS essential promoter region is necessary (although not sufficient) for proper S phase regulation. Images PMID:8524656

  6. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes

    PubMed Central

    Wang, Yu; Liu, Ou; Zhang, Jing; Gleason, Adenrele; Yang, Zhenrong; Wang, Hui; Shi, Anbing; Grant, Barth D.

    2016-01-01

    EHBP-1 (Ehbp1) is a conserved regulator of endocytic recycling, acting as an effector of small GTPases including RAB-10 (Rab10). Here we present evidence that EHBP-1 associates with tubular endosomal phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2] enriched membranes through an N-terminal C2-like (NT-C2) domain, and define residues within the NT-C2 domain that mediate membrane interaction. Furthermore, our results indicate that the EHBP-1 central calponin homology (CH) domain binds to actin microfilaments in a reaction that is stimulated by RAB-10(GTP). Loss of any aspect of this RAB-10/EHBP-1 system in the C. elegans intestinal epithelium leads to retention of basolateral recycling cargo in endosomes that have lost their normal tubular endosomal network (TEN) organization. We propose a mechanism whereby RAB-10 promotes the ability of endosome-bound EHBP-1 to also bind to the actin cytoskeleton, thereby promoting endosomal tubulation. PMID:27272733

  7. Invariant TAD Boundaries Constrain Cell-Type-Specific Looping Interactions between Promoters and Distal Elements around the CFTR Locus

    PubMed Central

    Smith, Emily M.; Lajoie, Bryan R.; Jain, Gaurav; Dekker, Job

    2016-01-01

    Three-dimensional genome structure plays an important role in gene regulation. Globally, chromosomes are organized into active and inactive compartments while, at the gene level, looping interactions connect promoters to regulatory elements. Topologically associating domains (TADs), typically several hundred kilobases in size, form an intermediate level of organization. Major questions include how TADs are formed and how they are related to looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb chromosome 7 region surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Furthermore, we find that these TAD boundaries are present irrespective of the expression and looping of genes located between them. In contrast, looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell-type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected, but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell-type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell-type-specific long-range interactions and gene regulation. PMID:26748519

  8. Electron microprobe analysis of trace elements in minerals at 10 PPM concentrations

    NASA Technical Reports Server (NTRS)

    Mckay, G. A.; Seymour, R. S.

    1982-01-01

    An improved technique is developed for measuring backgrounds during trace element analysis of crystals and glass using electron microprobes. This technique overcomes major difficulties encountered with conventional techniques, such as the problem of obtaining the net X-ray intensity of the characteristic emission line of interest with sufficient precision and accuracy, as well as the error due to the inability to directly measure the intensity at the wavelength of the characteristic line on the sample being analyzed. It is shown that this technique can yield reproducible results to within 4 ppm in olivine, and has a minimum uncertainty and detection limit of 10 ppm Nd in olivine.

  9. Monoallelic Loss of the Imprinted Gene Grb10 Promotes Tumor Formation in Irradiated Nf1+/- Mice

    PubMed Central

    Mroue, Rana; Huang, Brian; Braunstein, Steve; Firestone, Ari J.; Nakamura, Jean L.

    2015-01-01

    Imprinted genes are expressed from only one parental allele and heterozygous loss involving the expressed allele is sufficient to produce complete loss of protein expression. Genetic alterations are common in tumorigenesis but the role of imprinted genes in this process is not well understood. In earlier work we mutagenized mice heterozygous for the Neurofibromatosis I tumor suppressor gene (NF1) to model radiotherapy-associated second malignant neoplasms that arise in irradiated NF1 patients. Expression analysis of tumor cell lines established from our mouse models identified Grb10 expression as widely absent. Grb10 is an imprinted gene and polymorphism analysis of cell lines and primary tumors demonstrates that the expressed allele is commonly lost in diverse Nf1 mutant tumors arising in our mouse models. We performed functional studies to test whether Grb10 restoration or loss alter fundamental features of the tumor growth. Restoring Grb10 in Nf1 mutant tumors decreases proliferation, decreases soft agar colony formation and downregulates Ras signaling. Conversely, Grb10 silencing in untransformed mouse embryo fibroblasts significantly increased cell proliferation and increased Ras-GTP levels. Expression of a constitutively activated MEK rescued tumor cells from Grb10-mediated reduction in colony formation. These studies reveal that Grb10 loss can occur during in vivo tumorigenesis, with a functional consequence in untransformed primary cells. In tumors, Grb10 loss independently promotes Ras pathway hyperactivation, which promotes hyperproliferation, an early feature of tumor development. In the context of a robust Nf1 mutant mouse model of cancer this work identifies a novel role for an imprinted gene in tumorigenesis. PMID:26000738

  10. Bcl10 can promote survival of antigen-stimulated B lymphocytes.

    PubMed

    Tian, Maoxin Tim; Gonzalez, Gabriel; Scheer, Barbara; DeFranco, Anthony L

    2005-09-15

    To understand the nature of negative responses through the B-cell antigen receptor (BCR), we have screened an expression cDNA library for the ability to block BCR-induced growth arrest and apoptosis in the immature B-cell line, WEHI-231. We isolated multiple copies of full-length, unmutated Bcl10, a signaling adaptor molecule encoded by a gene found to translocate to the immunoglobulin heavy chain (IgH) locus in some mucosa-associated lymphoid tissue (MALT) lymphomas. A conditionally active form of B-cell lymphoma 10 (Bcl10) protected WEHI-231 cells from BCR-induced apoptosis upon activation. Induction of Bcl10 activity caused rapid activation of nuclear factor-kappaB (NF-kappaB) and c-Jun N-terminal kinase (JNK), but not activation of extracellular signal-regulated kinase (ERK) or p38 mitogen-activated protein (MAP) kinases. These results support genetic and biochemical experiments that have implicated Bcl10 and its binding partners Carma1 and MALT1 in mediating the ability of the BCR to activate NF-kappaB. The ability of Bcl10 expression to prevent BCR-induced growth arrest and apoptosis of WEHI-231 cells was dependent on NF-kappaB activation. Finally, overexpression of Bcl10 in primary B cells activated ex vivo promoted the survival of these cells after removal of activating stimuli. Taken together these results support the hypothesis that enhanced BCL10 expression caused by translocation to the IGH locus can promote formation of MALT lymphomas.

  11. IP-10/CXCR3 Axis Promotes the Proliferation of Vascular Smooth Muscle Cells through ERK1/2/CREB Signaling Pathway.

    PubMed

    Wang, Hui-Jin; Zhou, Yu; Liu, Rui-Ming; Qin, Yuan-Sen; Cen, Ying-Huan; Hu, Ling-Yu; Wang, Shen-Ming; Hu, Zuo-Jun

    2017-03-01

    Excessive proliferation of vascular smooth muscle cells is one of the main pathological processes leading to atherosclerosis and intimal hyperplasia after vascular interventional therapy. Our previous study has shown that interferon-γ inducible protein-10 contributes to the proliferation of vascular smooth muscle cell. However, the underlying mechanisms remain unclear. Extracellular signal-regulated kinase 1/2, serine/threonine kinase Akt, and cAMP response element binding protein are signaling pathways, which are considered to play important roles in the processes of vascular smooth muscle cell proliferation. Moreover, chemokine receptor 3 and Toll-like receptor 4 are potential receptors of inducible protein-10 in this process. In the present study, IP-10 was found to directly induce vascular smooth muscle cell proliferation, and exposure to inducible protein-10 activated extracellular signal-regulated kinase 1/2, serine/threonine kinase, and cAMP response element binding protein signaling. Inhibitor of extracellular signal-regulated kinase 1/2, rather than inhibitor of serine/threonine kinase, inhibited the phosphorylation of cAMP response element binding protein and reduced inducible protein-10-stimulated vascular smooth muscle cell proliferation. Knockdown of cAMP response element binding protein by siRNA inhibited inducible protein-10-induced vascular smooth muscle cell proliferation. Moreover, anti-CXCR3 IgG, instead of anti-Toll-like receptor 4 IgG, reduced inducible protein-10-induced vascular smooth muscle cell proliferation and inducible protein-10-stimulated extracellular signal-regulated kinase 1/2 and cAMP response element binding protein activation. Together, these results indicate that inducible protein-10 promotes vascular smooth muscle cell proliferation via chemokine receptor 3 and activation of extracellular signal-regulated kinase 1/2 inducible protein-10-induced vascular smooth muscle cell proliferation. These data provide important targets

  12. SIRT1 gene expression upon genotoxic damage is regulated by APE1 through nCaRE-promoter elements

    PubMed Central

    Antoniali, Giulia; Lirussi, Lisa; D'Ambrosio, Chiara; Dal Piaz, Fabrizio; Vascotto, Carlo; Casarano, Elena; Marasco, Daniela; Scaloni, Andrea; Fogolari, Federico; Tell, Gianluca

    2014-01-01

    Apurinic/apyrimidinic endonuclease 1 (APE1) is a multifunctional protein contributing to genome stability via repair of DNA lesions via the base excision repair pathway. It also plays a role in gene expression regulation and RNA metabolism. Another, poorly characterized function is its ability to bind to negative calcium responsive elements (nCaRE) of some gene promoters. The presence of many functional nCaRE sequences regulating gene transcription can be envisioned, given their conservation within ALU repeats. To look for functional nCaRE sequences within the human genome, we performed bioinformatic analyses and identified 57 genes potentially regulated by APE1. We focused on sirtuin-1 (SIRT1) deacetylase due to its involvement in cell stress, including senescence, apoptosis, and tumorigenesis, and its role in the deacetylation of APE1 after genotoxic stress. The human SIRT1 promoter presents two nCaRE elements stably bound by APE1 through its N-terminus. We demonstrate that APE1 is part of a multiprotein complex including hOGG1, Ku70, and RNA Pol II, which is recruited on SIRT1 promoter to regulate SIRT1 gene functions during early response to oxidative stress. These findings provide new insights into the role of nCaRE sequences in the transcriptional regulation of mammalian genes. PMID:24356447

  13. Uroporphyrinogen III synthase erythroid promoter mutations in adjacent GATA1 and CP2 elements cause congenital erythropoietic porphyria.

    PubMed

    Solis, C; Aizencang, G I; Astrin, K H; Bishop, D F; Desnick, R J

    2001-03-01

    Congenital erythropoietic porphyria, an autosomal recessive inborn error of heme biosynthesis, results from the markedly deficient activity of uroporphyrinogen III synthase. Extensive mutation analyses of 40 unrelated patients only identified approximately 90% of mutant alleles. Sequencing the recently discovered erythroid-specific promoter in six patients with a single undefined allele identified four novel mutations clustered in a 20-bp region: (a) a -70T to C transition in a putative GATA-1 consensus binding element, (b) a -76G to A transition, (c) a -86C to A transversion in three unrelated patients, and (d) a -90C to A transversion in a putative CP2 binding motif. Also, a -224T to C polymorphism was present in approximately 4% of 200 unrelated Caucasian alleles. We inserted these mutant sequences into luciferase reporter constructs. When transfected into K562 erythroid cells, these constructs yielded 3 +/- 1, 54 +/- 3, 43 +/- 6, and 8 +/- 1%, respectively, of the reporter activity conferred by the wild-type promoter. Electrophoretic mobility shift assays indicated that the -70C mutation altered GATA1 binding, whereas the adjacent -76A mutation did not. Similarly, the -90C mutation altered CP2 binding, whereas the -86A mutation did not. Thus, these four pathogenic erythroid promoter mutations impaired erythroid-specific transcription, caused CEP, and identified functionally important GATA1 and CP2 transcriptional binding elements for erythroid-specific heme biosynthesis.

  14. The Heat-Shock Element Is a Functional Component of the Arabidopsis APX1 Gene Promoter1

    PubMed Central

    Storozhenko, Sergei; De Pauw, Pascal; Van Montagu, Marc; Inzé, Dirk; Kushnir, Sergei

    1998-01-01

    Ascorbate peroxidases are important enzymes that detoxify hydrogen peroxide within the cytosol and chloroplasts of plant cells. To better understand their role in oxidative stress tolerance, the transcriptional regulation of the apx1 gene from Arabidopsis was studied. The apx1 gene was expressed in all tested organs of Arabidopsis; mRNA levels were low in roots, leaves, and stems and high in flowers. Steady-state mRNA levels in leaves or cell suspensions increased after treatment with methyl viologen, ethephon, high temperature, and illumination of etiolated seedlings. A putative heat-shock cis element found in the apx1 promoter was shown to be recognized by the tomato (Lycopersicon esculentum) heat-shock factor in vitro and to be responsible for the in vivo heat-shock induction of the gene. The heat-shock cis element also contributed partially to the induction of the gene by oxidative stress. By using in vivo dimethyl sulfate footprinting, we showed that proteins interacted with a G/C-rich element found in the apx1 promoter. PMID:9808745

  15. Synthetic promoters consisting of defined cis-acting elements link multiple signaling pathways to probenazole-inducible system * #

    PubMed Central

    Zhu, Zheng; Gao, Jiong; Yang, Jin-xiao; Wang, Xiao-yan; Ren, Guo-dong; Ding, Yu-long; Kuai, Ben-ke

    2015-01-01

    Probenazole (3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ), the active component of Oryzemate, could induce systemic acquired resistance (SAR) in plants through the induction of salicylic acid (SA) biosynthesis. As a widely used chemical inducer, PBZ is a good prospect for establishing a new chemical-inducible system. We first designed artificially synthetic promoters with tandem copies of a single type of cis-element (SARE, JERE, GCC, GST1, HSRE, and W-box) that could mediate the expression of the β-glucuronidase (GUS) reporter gene in plants upon PBZ treatment. Then we combined different types of elements in order to improve inducibility in the PBZ-inducible system. On the other hand, we were surprised to find that the cis-elements, which are responsive to jasmonic acid (JA) and ethylene, also responded to PBZ, implying that SA, JA, and ethylene pathways also would play important roles in PBZ’s action. Further analysis demonstrated that PBZ also induced early events of innate immunity via a signaling pathway in which Ca2+ influx and mitogen-activated protein kinase (MAPK) activity were involved. We constructed synthesized artificial promoters to establish a PBZ chemical-inducible system, and preliminarily explored SA, JA, ethylene, calcium, and MAPK signaling pathways via PBZ-inducible system, which could provide an insight for in-depth study. PMID:25845359

  16. On the benefits and challenges of a coordinated Validation and Quality Assessment of the GMES Service Element for Atmosphere (PROMOTE)

    NASA Astrophysics Data System (ADS)

    Rosalia Delgado Blanco, Maria; Lambert, Jean-Christopher; Skarlas, Pauline

    PROtocol MOniToring for the GMES Service Element for Atmosphere (PROMOTE) is an ESA- funded project delivering sustainable geo-spatial information services related to atmospheric ozone, surface UV exposure, air quality, climate change, and volcanic hazards to aviation. Services are based on ground-, airand satellite-based Earth observation data and on numerical models and assimilation systems. As a major step in the building of Global Monitoring of Environment and Security (GMES), a European contribution to the Global Earth Observation System of Systems (GEOSS), PROMOTE Services are to support informed decisions relevant to the nine Societal Benefit Areas addressed by GEOSS. GEOSS objectives of interoperability, sustainability, traceability and dedication to users are particular challenges that are addressed, among others, by the PROMOTE Validation Office. The first goal of this cross-cutting body is to ensure appropriate, user-driven quality assessment and validation of all PROMOTE services. Going beyond the classical validation of individual data products from a satellite or a model, the Validation Office verifies not only the "fitness for purpose" of all PROMOTE Products and Services against service specifications and user requirements, but also the "fitness for purpose" of the validation itself against user requirements, and generally coordinates validation activities at project level. A driving task under the responsibility of the Validation Office is to establish the PROMOTE Service Validation Protocol which sets the top-level definition of applicable standards and validation approaches for all constituents of the PROMOTE Service Portfolio. It is through the development and implementation of such a Validation Protocol, that the fitness for purpose of every product and service and of their validation can be assessed and sustained. At the same time, their compliance with high-level recommendations (e.g. GEO-CEOS Best Practices for Cal/Val) and regulations

  17. Evaluation of standardless EDXRF analysis for the determination of elements on PM10 loaded filters

    NASA Astrophysics Data System (ADS)

    Yatkin, S.; Gerboles, M.; Borowiak, A.

    2012-07-01

    Energy Dispersive X-ray Fluorescence (EDXRF) was compared to Inductively Coupled Plasma Mass Spectrometer (ICP-MS) for the measurements of elements (Mg, Al, Si, S, Cl, K, Ca, Ti, V, Cr, Fe, Co, Ni, Mn, Cu, Zn, As, Br, Sr, Pb, Mo, Cd, Sn and Sb) in particulate matter (PM10) collected on Teflon and two types of quartz filters at different sites. Two different methods of EDXRF analysis, linear calibration and standardless analysis, were studied. For the linear calibration, Pb, Mn, Fe, Cu, Ti and Zn were found to be site and filter type independent whereas Ca was only site independent. The site effect was evidenced for K, As, Ni, and V for quartz filter. The standardless EDXRF analysis showed better results than linear calibrations except for As, Co and V for Teflon filters and Cr and V for quartz filters. The measurement uncertainty of standardless EDXRF analysis was estimated by establishing a model equation. The measurement uncertainty estimated with this model equation was confirmed by field experiments provided that elemental masses exceeded observed thresholds. It was found that standardless EDXRF analysis is able to quantify most of the elements studied, particularly on Teflon filters rather than quartz filters. The standardless EDXRF analysis complies with the data quality objectives (DQO) of European Directives to measure Pb in PM10 for three types of filters, even at concentrations lower than limit values (LV). The detection limits (MDL) of standardless EDXRF analysis for measuring As and Cd were found to be insufficient to meet the legislative requirements. The MDL of Ni was sufficiently low for measurements; however, measurement uncertainties remained higher than the DQO at the lower concentrations than LV.

  18. Promoting the Essential Elements of 4-H Youth Development through an Experiential Learning Model

    ERIC Educational Resources Information Center

    Meyer, Shelley; Jones, Kenneth R.

    2015-01-01

    The purpose of the project reported here was to apply Experiential Learning Theory to a context involving middle and high school aged youth while assessing the four concepts (belonging, mastery, independence, and generosity) in relation to the 4-H youth development essential elements. The conclusions of the project's evaluation suggest…

  19. Wnt-10b, uniquely among Wnts, promotes epithelial differentiation and shaft growth

    SciTech Connect

    Ouji, Yukiteru Yoshikawa, Masahide; Moriya, Kei; Nishiofuku, Mariko; Matsuda, Ryosuke; Ishizaka, Shigeaki

    2008-03-07

    Although Wnts are expressed in hair follicles throughout life from embryo to adult, and considered to be critical for their development and maturation, their roles remain largely unknown. In the present study, we investigated the effects of Wnts (Wnt-3a, Wnt-5a, Wnt-10b, and Wnt-11) on epithelial cell differentiation using adult mouse-derived primary skin epithelial cell (MPSEC) cultures and hair growth using hair follicle organ cultures. Only Wnt-10b showed evident promotion of epithelial cell differentiation and hair shaft growth, in contrast to Wnt-3a, 5a, and 11. Our results suggest that Wnt-10b is unique and plays an important role in differentiation of epithelial cells in the hair follicle.

  20. Loss of endothelial programmed cell death 10 activates glioblastoma cells and promotes tumor growth

    PubMed Central

    Zhu, Yuan; Zhao, Kai; Prinz, Anja; Keyvani, Kathy; Lambertz, Nicole; Kreitschmann-Andermahr, Ilonka; Lei, Ting; Sure, Ulrich

    2016-01-01

    Background Neo-angiogenesis is a hallmark of glioblastoma (GBM) and is sustained by autocrine and paracrine interactions between neoplastic and nonneoplastic cells. Programmed cell death 10 (PDCD10) is ubiquitously expressed in nearly all tissues and plays crucial roles in regulating angiogenesis and apoptosis. We recently discovered the absence of PDCD10 expression in the tumor vessels of GBM patients. This raised the hypothesis that loss of endothelial PDCD10 affected GBM cell phenotyping and tumor progression. Methods Endothelial PDCD10 was silenced by siRNA and lentiviral shRNA. The tumor cell phenotype was studied in direct and indirect co-culture of endothelial cells (ECs) with U87 or LN229. Angiogenic protein array was performed in the media of PDCD10-silenced ECs. Tumor angiogenesis and tumor growth were investigated in a human GBM xenograft mouse model. Results Endothelial silence of PDCD10 significantly stimulated tumor cell proliferation, migration, adhesion, and invasion and inhibited apoptosis in co-cultures. Stable knockdown of endothelial PDCD10 increased microvessel density and the formation of a functional vascular network, leading to a 4-fold larger tumor mass in mice. Intriguingly, endothelial deletion of PDCD10 increased (≥2-fold) the release of 20 of 55 tested proangiogenic factors including VEGF, which in turn activated Erk1/2 and Akt in GBM cells. Conclusions For the first time, we provide evidence that loss of endothelial PDCD10 activates GBM cells and promotes tumor growth, most likely via a paracrine mechanism. PDCD10 shows a tumor-suppressor-like function in the cross talk between ECs and tumor cells and is potentially implicated in GBM progression. PMID:26254477

  1. c-Jun represses the human insulin promoter activity that depends on multiple cAMP response elements.

    PubMed Central

    Inagaki, N; Maekawa, T; Sudo, T; Ishii, S; Seino, Y; Imura, H

    1992-01-01

    Glucose is known to increase the cAMP concentration in pancreatic beta cells. To determine the mechanism by which cAMP augments insulin gene expression, we first identified the cAMP response elements (CREs) of the human insulin gene. In DNase I footprint analysis, the bacterially synthesized CRE-binding protein, CRE-BP1, protected four sites: two sites in the region upstream from the insulin core promoter, one site in the first exon, and one site in the first intron. To examine the roles of those four sites, we constructed a series of DNA plasmids in which the wild-type and mutant insulin promoters were linked to the chloramphenicol acetyl-transferase gene. Studies of the transcriptional activity of these plasmids after transfection into hamster insulinoma (HIT) cells showed that these four sites contributed additively to the cAMP inducibility of the insulin promoter. Surprisingly, the c-jun protooncogene product (c-Jun) repressed the cAMP-induced activity of the insulin promoter in a cotransfection assay with the c-Jun expression plasmid. Northern blot analysis demonstrated that the level of c-jun mRNA was dramatically increased by glucose deprivation in HIT cells. These results suggest that glucose may regulate expression of the human insulin gene through multiple CREs and c-Jun. Images PMID:1310538

  2. Function Identification of the Nucleotides in Key cis-Element of DYSFUNCTIONAL TAPETUM1 (DYT1) Promoter

    PubMed Central

    Zhou, Shumin; Zhang, Hongli; Li, Ruisha; Hong, Qiang; Li, Yang; Xia, Qunfang; Zhang, Wei

    2017-01-01

    As a core regulatory gene of the anther development, DYSFUNCTIONAL TAPETUM1 (DYT1) was expressed in tapetum preferentially. Previous study had confirmed that a “CTCC” sequence within DYT1 promoter was indispensable for correct DYT1 expression. However, precise analysis on the function of each nucleotide of this sequence still lacks. Here we employed site mutation assay to identify the function roles of the nucleotides. As a result, the “T” and final “C” of “CTCC” were found essential for the temporal and spatial specificity of DYT1 expression, whereas the other two “C” nucleotides exhibited substitutable somewhat. The substitutes of two flanking nucleotides of “CTCC,” however, hardly affected the normal promoter function, suggesting that the “CTCC” sequence as a whole did meet the standard of a canonical cis-element by definition. In addition, it was found that as short as 497 bp DYT1 promoter was sufficient for tissue-specific expression, while longer 505 bp DYT1 promoter sequence was sufficient for species-specific expression. PMID:28261229

  3. Effect of the 21-bp repeat upstream element on in vitro transcription from the early and late SV40 promoters.

    PubMed Central

    Vigneron, M; Barrera-Saldana, H A; Baty, D; Everett, R E; Chambon, P

    1984-01-01

    The role of the 21-bp repeat region [simian virus 40 (SV40) coordinates 40-103] on early and late SV40 promoter functions has been investigated in vitro using a variety of mutated templates. Using either a HeLa whole cell extract or a S100 extract, we analyzed the transcripts by quantitative S1 nuclease mapping. GC-rich motifs contained in the 21-bp direct repeat constituted an essential element for efficient early transcription in vitro in agreement with previous in vivo results. These GC-rich motifs act in a non-polar fashion, since inversion of the 21-bp region did not reduce early transcription. Some point mutations in the 22-bp imperfectly repeated sequence, that drastically reduce initiations from the early promoter in vivo, had little effect in vitro, indicating that all the functions of these GC-rich motifs cannot be reproduced in vitro at present. The requirement for the 21-bp repeat region was less stringent when the concentration of the early promoter sequence was increased, which suggests that its function may be to facilitate the recognition of the 'weak' SV40 early TATA box. The multiple late start sites were accurately used in vitro and the GC-rich motifs contained in the 21-bp repeat region were an important element for efficient in vitro initiation of transcription from the late promoter, irrespective of their orientation. However, the effect of the 21-bp repeat region on late initiations decreased strikingly with increasing distance to the start sites, although it was still detectable over a distance of 220 bp. Under the present in vitro conditions, the 72-bp repeat region stimulates weakly both early and late transcription. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:6094181

  4. Siderophore-promoted transfer of rare earth elements and iron from volcanic ash into glacial meltwater, river and ocean water

    NASA Astrophysics Data System (ADS)

    Bau, Michael; Tepe, Nathalie; Mohwinkel, Dennis

    2013-02-01

    The rare earth elements (REE) are a group of trace elements that have short marine residence times and that in river, lake and marine surface waters are typically associated with organic and inorganic particles. Explosive volcanic eruptions, such as the 2010 eruptions of Eyjafjallajökull volcano in Iceland, produce volcanic ash particles which can be an important source of iron and other nutrients for aquatic organisms. To become bioavailable, however, this iron needs to be solubilized by complexing agents, such as siderophores. A well-studied example of such a chelator is the biogenic siderophore desferrioxamin-B (DFOB). Based on results from incubation experiments with glacial meltwater-rich river waters from southern Iceland, which are rich in suspended volcanic ash and that had been incubated with and without DFOB, respectively, we here show that siderophores not only enhance the release of iron, but also promote the mobilization of REE from these particles. In the presence of DFOB, partial dissolution of volcanic ash (and presumably other lithic particles) produces a flux of dissolved REE into ambient waters, that is characterized by depletion of the light REE over the middle REE and by selective enrichment of cerium, due to the formation of dissolved Ce(IV)-DFOB complexes. In siderophore-rich environments, this siderophore-bound REE flux has the potential to modify the concentrations and distribution of the dissolved REE and of the isotopic composition of dissolved Nd in glacial meltwaters, river waters and seawater and might be a component of the boundary effects between shelf sediments and seawater, which are assumed to account for the “missing Nd flux” to seawater. Thermodynamic data further suggest that siderophore-promoted element mobilization could also be important for other polyvalent (trace) elements, such as Hf.

  5. Altering genomic integrity: heavy metal exposure promotes trans-posable element-mediated damage

    PubMed Central

    Morales, Maria E.; Servant, Geraldine; Ade, Catherine; Roy-Enge, Astrid M.

    2015-01-01

    Maintenance of genomic integrity is critical for cellular homeostasis and survival. The active transposable elements (TEs) composed primarily of three mobile element lineages LINE-1, Alu, and SVA comprise approximately 30% of the mass of the human genome. For the past two decades, studies have shown that TEs significantly contribute to genetic instability and that TE-caused damages are associated with genetic diseases and cancer. Different environmental exposures, including several heavy metals, influence how TEs interact with its host genome increasing their negative impact. This mini-review provides some basic knowledge on TEs, their contribution to disease and an overview of the current knowledge on how heavy metals influence TE-mediated damage. PMID:25774044

  6. Promoter methylation of PCDH10 by HOTAIR regulates the progression of gastrointestinal stromal tumors

    PubMed Central

    Lee, Na Keum; Lee, Jung Hwa; Kim, Won Kyu; Yun, Seongju; Youn, Young Hoon; Park, Chan Hyuk; Choi, Yun Young; Kim, Hogeun; Lee, Sang Kil

    2016-01-01

    HOTAIR, a long non-coding RNA (lncRNA), plays a crucial role in tumor initiation and metastasis by interacting with the PRC2 complex and the modulation of its target genes. The role of HOTAIR in gastrointestinal stromal tumors (GISTs) is remains unclear. Herein we investigate the mechanism of HOTAIR in the genesis and promotion of GISTs. The expression of HOTAIR was found to be higher in surgically resected high-risk GISTs than that in low- and intermediate-risk GISTs. Using GIST-T1 and GIST882 cells, we demonstrated that HOTAIR repressed apoptosis, was associated with cell cycle progression, and controlled the invasion and migration of GIST cells. Using a gene expression microarray and lists of HOTAIR-associated candidate genes, we suggested that protocadherin 10 (PCDH10) is a key molecule. PCDH10 expression was significantly decreased in GIST-T1 and GIST882 cells, possibly as a consequence of hypermethylation. We observed that HOTAIR induced PCDH10 methylation in a SUZ12-dependent manner. In this study, we found that the malignant character of GISTs was initiated and amplified by PCDH10 in a process regulated by HOTAIR. In summary, our findings imply that PCDH10 and HOTAIR may be useful markers of disease progression and therapeutic targets. PMID:27659532

  7. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences

    SciTech Connect

    Ch'ang, L.Y.; Yang, W.K.; Myer, F.E.; Yang, D.M.

    1989-06-01

    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenical acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of the ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-pb inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs on the enhancer segment as well as the upstream LTF sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression.

  8. p11 is up-regulated in the forebrain of stressed rats by glucocorticoid acting via two specific glucocorticoid response elements in the p11 promoter.

    PubMed

    Zhang, L; Li, H; Su, T P; Barker, J L; Maric, D; Fullerton, C S; Webster, M J; Hough, C J; Li, X X; Ursano, R

    2008-06-02

    Posttraumatic stress disorder (PTSD) is one of the most common psychiatric disorders. Despite the extensive study of the neurobiological correlates of this disorder, the underlying mechanisms of PTSD are still poorly understood. Recently, a study demonstrated that dexamethasone (Dex), a synthetic glucocorticoid, can up-regulate p11, known as S100A10-protein which is down-regulated in patients with depression, (Yao et al., 1999; Huang et al., 2003) a common comorbid disorder in PTSD. These observations led to our hypothesis that traumatic stress may alter expression of p11 mediated through a glucocorticoid receptor. Here, we demonstrate that inescapable tail shock increased both prefrontal cortical p11 mRNA levels and plasma corticosterone levels in rats. We also found that Dex up-regulated p11 expression in SH-SY5Y cells through glucocorticoid response elements (GREs) within the p11 promoter. This response was attenuated by either RU486, a glucocorticoid receptor (GR) antagonist or mutating two of three glucocorticoid response elements (GRE2 and GRE3) in the p11 promoter. Finally, we showed that p11 mRNA levels were increased in postmortem prefrontal cortical tissue (area 46) of patients with PTSD. The data obtained from our work in a rat model of inescapable tail shock, a p11-transfected cell line and postmortem brain tissue from PTSD patients outline a possible mechanism by which p11 is regulated by glucocorticoids elevated by traumatic stress.

  9. SWI/SNF enzymes promote SOX10- mediated activation of myelin gene expression.

    PubMed

    Marathe, Himangi G; Mehta, Gaurav; Zhang, Xiaolu; Datar, Ila; Mehrotra, Aanchal; Yeung, Kam C; de la Serna, Ivana L

    2013-01-01

    SOX10 is a Sry-related high mobility (HMG)-box transcriptional regulator that promotes differentiation of neural crest precursors into Schwann cells, oligodendrocytes, and melanocytes. Myelin, formed by Schwann cells in the peripheral nervous system, is essential for propagation of nerve impulses. SWI/SNF complexes are ATP dependent chromatin remodeling enzymes that are critical for cellular differentiation. It was recently demonstrated that the BRG1 subunit of SWI/SNF complexes activates SOX10 expression and also interacts with SOX10 to activate expression of OCT6 and KROX20, two transcriptional regulators of Schwann cell differentiation. To determine the requirement for SWI/SNF enzymes in the regulation of genes that encode components of myelin, which are downstream of these transcriptional regulators, we introduced SOX10 into fibroblasts that inducibly express dominant negative versions of the SWI/SNF ATPases, BRM or BRG1. Dominant negative BRM and BRG1 have mutations in the ATP binding site and inhibit gene activation events that require SWI/SNF function. Ectopic expression of SOX10 in cells derived from NIH 3T3 fibroblasts led to the activation of the endogenous Schwann cell specific gene, myelin protein zero (MPZ) and the gene that encodes myelin basic protein (MBP). Thus, SOX10 reprogrammed these cells into myelin gene expressing cells. Ectopic expression of KROX20 was not sufficient for activation of these myelin genes. However, KROX20 together with SOX10 synergistically activated MPZ and MBP expression. Dominant negative BRM and BRG1 abrogated SOX10 mediated activation of MPZ and MBP and synergistic activation of these genes by SOX10 and KROX20. SOX10 was required to recruit BRG1 to the MPZ locus. Similarly, in immortalized Schwann cells, BRG1 recruitment to SOX10 binding sites at the MPZ locus was dependent on SOX10 and expression of dominant negative BRG1 inhibited expression of MPZ and MBP in these cells. Thus, SWI/SNF enzymes cooperate with SOX10 to

  10. Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element

    SciTech Connect

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In

    2008-04-01

    Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.

  11. ZmbZIP91 regulates expression of starch synthesis-related genes by binding to ACTCAT elements in their promoters.

    PubMed

    Chen, Jiang; Yi, Qiang; Cao, Yao; Wei, Bin; Zheng, Lanjie; Xiao, Qianling; Xie, Ying; Gu, Yong; Li, Yangping; Huang, Huanhuan; Wang, Yongbin; Hou, Xianbin; Long, Tiandan; Zhang, Junjie; Liu, Hanmei; Liu, Yinghong; Yu, Guowu; Huang, Yubi

    2016-03-01

    Starch synthesis is a key process that influences crop yield and quality, though little is known about the regulation of this complex metabolic pathway. Here, we present the identification of ZmbZIP91 as a candidate regulator of starch synthesis via co-expression analysis in maize (Zea mays L.). ZmbZIP91 was strongly associated with the expression of starch synthesis genes. Reverse tanscription-PCR (RT-PCR) and RNA in situ hybridization indicated that ZmbZIP91 is highly expressed in maize endosperm, with less expression in leaves. Particle bombardment-mediated transient expression in maize endosperm and leaf protoplasts demonstrated that ZmbZIP91 could positively regulate the expression of starch synthesis genes in both leaves and endosperm. Additionally, the Arabidopsis mutant vip1 carried a mutation in a gene (VIP1) that is homologous to ZmbZIP91, displayed altered growth with less starch in leaves, and ZmbZIP91 was able to complement this phenotype, resulting in normal starch synthesis. A yeast one-hybrid experiment and EMSAs showed that ZmbZIP91 could directly bind to ACTCAT elements in the promoters of starch synthesis genes (pAGPS1, pSSI, pSSIIIa, and pISA1). These results demonstrate that ZmbZIP91 acts as a core regulatory factor in starch synthesis by binding to ACTCAT elements in the promoters of starch synthesis genes.

  12. The expression of human H2A-H2B histone gene pairs is regulated by multiple sequence elements in their joint promoters.

    PubMed

    Trappe, R; Doenecke, D; Albig, W

    1999-09-03

    The majority of human H2A and H2B histone genes are organized as gene pairs: 14 H2A-H2B gene pairs, one solitary H2A gene and three solitary H2B genes have been described. Two of the H2A genes and two of the H2B genes arranged within gene pairs are pseudogenes. The gene pairs are organized with divergent transcriptional orientation, and the coding regions of the respective H2A and H2B genes are separated by about 320 nucleotide pairs that form overlapping promoter regions. Comparison of promoters of H2A-H2B gene pairs has previously shown that these belong to two different groups (groups I and II) which are characterized by specific patterns of conserved sequence elements. We have constructed a reporter gene vector that allows the simultaneous analysis of both genes regulated by the divergent promoters belonging to group I or II, respectively. Firefly-luciferase and beta-galactosidase genes were taken as reporter genes. Site directed mutagenesis performed at individual promoter elements revealed that individual sequence elements within both groups of promoters functionally depend on each other and may contribute to a coordinate expression of paired H2A and H2B genes through assembly of their joint promoter into a mutually dependent promoter complex. Group II promoters are characterized by the presence of an E2F binding site upstream of the H2A gene-proximal TATA box. Immediately upstream of the E2F element, we have identified a highly conserved octanucleotide CACAGCTT (RT-1) that exists in all human group II H2A-H2B gene promoters. Protein binding studies at the RT-1 element indicate factor binding to this sequence. Site directed mutagenesis indicates that both the E2F element and the RT-1 motif are essential for full promoter activity.

  13. Interleukin-10 Promoter Gene Polymorphisms and Susceptibility to Tuberculosis: A Meta-Analysis

    PubMed Central

    Gao, Xuan; Chen, Junjun; Tong, Zhongkai; Yang, Guangdie; Yao, Yinan; Xu, Fei; Zhou, Jianying

    2015-01-01

    Objective As an update to other recent meta-analyses, the purpose of this study was to explore whether interleukin-10 (IL-10) polymorphisms and their haplotypes contribute to tuberculosis (TB) susceptibility. Methods We searched for published case-control studies examining IL-10 polymorphisms and TB in PubMed, EMBASE, Cochrane Central Register of Controlled Trials (CENTRAL), Wanfang databases and the Chinese National Knowledge Infrastructure (CNKI). Odds ratios (ORs) with 95% confidence intervals (CIs) were used to calculate the strengths of the associations. Results A total of 28 studies comprising 8,242 TB patients and 9,666 controls were included in the present study. There were no significant associations between the -1082G/A, -819C/T, and -592A/C polymorphisms and TB in the pooled samples. Subgroup analyses revealed that the -819T allele was associated with an increased TB risk in Asians in all genetic models (T vs. C: OR=1.17, 95% CI=1.05-1.29, P=0.003; TT vs. CC: OR=1.37, 95% CI=1.09-1.72, P=0.006; CT+TT vs. CC: OR=1.33, 95% CI=1.09-1.63, P=0.006; TT vs. CT+CC: OR=1.17, 95% CI=1.02-1.35, P=0.03) and that the -592A/C polymorphism was significantly associated with TB in Europeans under two genetic models (A vs. C: OR=0.77, 95% CI=0.60-0.98, P=0.03; AA vs. CC: OR=0.53, 95% CI=0.30-0.95, P=0.03). Furthermore, the GCC IL-10 promoter haplotype was associated with an increased risk of TB (GCC vs. others: P=1.42, 95% CI=1.02-1.97, P=0.04). Subgroup analyses based on ethnicity revealed that the GCC haplotype was associated with a higher risk of TB in Europeans, whereas the ACC haplotype was associated with a lower TB risk in both Asians and Europeans. Conclusions This meta-analysis suggests that the IL-10-819T/C polymorphism is associated with the risk of TB in Asians and that the IL-10-592A/C polymorphism may be a risk factor for TB in Europeans. Furthermore, these data indicate that IL-10 promoter haplotypes play a vital role in the susceptibility to or protection

  14. Correlating interleukin-10 promoter gene polymorphisms with human cerebral infarction onset

    PubMed Central

    Jiang, Xin-hong; Lin, Ke-xu; Zhang, Yi-xian; Chen, Rong-hua; Liu, Nan

    2015-01-01

    Evidence suggests that interleukin-10 (IL-10) deficiency exacerbates inflammation and worsens the outcome of brain ischemia. In view of the critical role of the single nucleotide polymorphic sites -1082 (A/G) and -819 (C/T) in the promoter region of the IL-10 gene, we hypothesized that they are associated with cerebral infarction morbidity in the Chinese Han population. We genotyped these allelic gene polymorphisms by amplification refractory mutation system-polymerase chain reaction methods in 181 patients with cerebral infarction (cerebral infarction group) and 115 healthy subjects (control group). We identified significant differences in genotype distribution and allele frequency of the IL-10-1082 A/G allele between cerebral infarction and control groups (χ2 = 6.643, P = 0.010). The IL-10-1082 A allele frequency was significantly higher in the cerebral infarction group (92.3%) than in the control group (86.1%) (P = 0.015). Moreover, cerebral infarction risk of the AA genotype was 2-fold higher than with the AG genotype (OR = 2.031, 95%CI: 1.134–3.637). In addition, AA genotype together with hypertension was the independent risk factor of cerebral infarction (OR = 2.073, 95%CI: 1.278–3.364). No statistical difference in genotype distribution or allele frequency of IL-10-819 C/T was found between cerebral infarction and control groups (P > 0.05). These findings suggest that the IL-10-1082 A/G gene polymorphism is involved in cerebral infarction, and increased A allele frequency is closely associated with occurrence of cerebral infarction. PMID:26807116

  15. Correlating interleukin-10 promoter gene polymorphisms with human cerebral infarction onset.

    PubMed

    Jiang, Xin-Hong; Lin, Ke-Xu; Zhang, Yi-Xian; Chen, Rong-Hua; Liu, Nan

    2015-11-01

    Evidence suggests that interleukin-10 (IL-10) deficiency exacerbates inflammation and worsens the outcome of brain ischemia. In view of the critical role of the single nucleotide polymorphic sites -1082 (A/G) and -819 (C/T) in the promoter region of the IL-10 gene, we hypothesized that they are associated with cerebral infarction morbidity in the Chinese Han population. We genotyped these allelic gene polymorphisms by amplification refractory mutation system-polymerase chain reaction methods in 181 patients with cerebral infarction (cerebral infarction group) and 115 healthy subjects (control group). We identified significant differences in genotype distribution and allele frequency of the IL-10-1082 A/G allele between cerebral infarction and control groups (χ (2) = 6.643, P = 0.010). The IL-10-1082 A allele frequency was significantly higher in the cerebral infarction group (92.3%) than in the control group (86.1%) (P = 0.015). Moreover, cerebral infarction risk of the AA genotype was 2-fold higher than with the AG genotype (OR = 2.031, 95%CI: 1.134-3.637). In addition, AA genotype together with hypertension was the independent risk factor of cerebral infarction (OR = 2.073, 95%CI: 1.278-3.364). No statistical difference in genotype distribution or allele frequency of IL-10-819 C/T was found between cerebral infarction and control groups (P > 0.05). These findings suggest that the IL-10-1082 A/G gene polymorphism is involved in cerebral infarction, and increased A allele frequency is closely associated with occurrence of cerebral infarction.

  16. A retroviral promoter and a cellular enhancer define a bipartite element which controls env ERVWE1 placental expression.

    PubMed

    Prudhomme, Sarah; Oriol, Guy; Mallet, François

    2004-11-01

    The HERV-W family contains hundreds of loci diversely expressed in several physiological and pathological contexts. A unique locus termed ERVWE1 encodes an envelope glycoprotein (syncytin) involved in hominoid placental physiology. Here we show that syncytin expression is regulated by a bipartite element consisting of a cyclic AMP (cAMP)-inducible long terminal repeat (LTR) retroviral promoter adjacent to a cellular enhancer conferring a high level of expression and placental tropism. Deletion mutant analysis showed that the ERVWE1 5' LTR contains binding sites essential for basal placental activity in the region from positions +1 to +125. The region from positions +125 to +310 represents a cAMP-responsive core HERV-W promoter active in all cell types. Site-directed mutagenesis analysis highlighted the complexity of U3 regulation. ERVWE1 placenta-specific positive (e.g., T240) and negative (e.g., G71) regulatory sites were identified, as were essential sites required for basic activity (e.g., A247). The flanking sequences of the ERVWE1 provirus contain several putative regulatory elements. The upstream HERV-H and HERV-P LTRs were found to be inactive. Conversely, the 436-bp region located between the HERV-P LTR and ERVWE1 was shown to be an upstream regulatory element (URE) which is significantly active in placenta cells. This URE acts as a tissue-specific enhancer. Genetic and functional analyses of hominoid UREs revealed large differences between UREs of members of the Hominidae and the Hylobatidae. These data allowed the identification of a positive regulatory region from positions -436 to -128, a mammalian apparent LTR retrotransposon negative regulatory region from positions -128 to -67, and a trophoblast-specific enhancer (TSE) from positions -67 to -35. Putative AP-2, Sp-1, and GCMa binding sites are essential constituents of the 33-bp TSE.

  17. Kinetics of transcription initiation directed by multiple cis-regulatory elements on the glnAp2 promoter

    PubMed Central

    Wang, Yaolai; Liu, Feng; Wang, Wei

    2016-01-01

    Transcription initiation is orchestrated by dynamic molecular interactions, with kinetic steps difficult to detect. Utilizing a hybrid method, we aim to unravel essential kinetic steps of transcriptional regulation on the glnAp2 promoter, whose regulatory region includes two enhancers (sites I and II) and three low-affinity sequences (sites III-V), to which the transcriptional activator NtrC binds. By structure reconstruction, we analyze all possible organization architectures of the transcription apparatus (TA). The main regulatory mode involves two NtrC hexamers: one at enhancer II transiently associates with site V such that the other at enhancer I can rapidly approach and catalyze the σ54-RNA polymerase holoenzyme. We build a kinetic model characterizing essential steps of the TA operation; with the known kinetics of the holoenzyme interacting with DNA, this model enables the kinetics beyond technical detection to be determined by fitting the input-output function of the wild-type promoter. The model further quantitatively reproduces transcriptional activities of various mutated promoters. These results reveal different roles played by two enhancers and interpret why the low-affinity elements conditionally enhance or repress transcription. This work presents an integrated dynamic picture of regulated transcription initiation and suggests an evolutionarily conserved characteristic guaranteeing reliable transcriptional response to regulatory signals. PMID:27899598

  18. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sha...

  19. Statistically significant strings are related to regulatory elements in the promoter regions of Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Hu, Rui; Wang, Bin

    2001-02-01

    Finding out statistically significant words in DNA and protein sequences forms the basis for many genetic studies. By applying the maximal entropy principle, we give one systematic way to study the nonrandom occurrence of words in DNA or protein sequences. Through comparison with experimental results, it was shown that patterns of regulatory binding sites in Saccharomyces cerevisiae ( yeast) genomes tend to occur significantly in the promoter regions. We studied two correlated gene families of yeast. The method successfully extracts the binding sites verified by experiments in each family. Many putative regulatory sites in the upstream regions are proposed. The study also suggested that some regulatory sites are active in both directions, while others show directional preference.

  20. Does STES-Oriented Science Education Promote 10th-Grade Students' Decision-Making Capability?

    NASA Astrophysics Data System (ADS)

    Levy Nahum, Tami; Ben-Chaim, David; Azaiza, Ibtesam; Herskovitz, Orit; Zoller, Uri

    2010-07-01

    Today's society is continuously coping with sustainability-related complex issues in the Science-Technology-Environment-Society (STES) interfaces. In those contexts, the need and relevance of the development of students' higher-order cognitive skills (HOCS) such as question-asking, critical-thinking, problem-solving and decision-making capabilities within science teaching have been argued by several science educators for decades. Three main objectives guided this study: (1) to establish "base lines" for HOCS capabilities of 10th grade students (n = 264) in the Israeli educational system; (2) to delineate within this population, two different groups with respect to their decision-making capability, science-oriented (n = 142) and non-science (n = 122) students, Groups A and B, respectively; and (3) to assess the pre-post development/change of students' decision-making capabilities via STES-oriented HOCS-promoting curricular modules entitled Science, Technology and Environment in Modern Society (STEMS). A specially developed and validated decision-making questionnaire was used for obtaining a research-based response to the guiding research questions. Our findings suggest that a long-term persistent application of purposed decision-making, promoting teaching strategies, is needed in order to succeed in affecting, positively, high-school students' decision-making ability. The need for science teachers' involvement in the development of their students' HOCS capabilities is thus apparent.

  1. A short, highly repetitive element in intron -1 of the human c-Ha-ras gene acts as a block to transcriptional readthrough by a viral promoter.

    PubMed Central

    Lowndes, N F; Bushel, P; Mendelsohn, L; Wu, J; Yen, M Y; Allan, M

    1990-01-01

    We have identified a short, highly repetitive element within intron -1 of the human c-Ha-ras gene. This element was found to be transcribed in both orientations and to be homologous to heterogeneous nonpolyadenylated transcripts. The repetitive element blocked transcriptional readthrough from a strong upstream viral promoter but allowed unimpaired readthrough from the c-Has-ras promoter. We suggest that it may serve to prevent excessive transcription into the coding region of the gene under such circumstances as viral insertion. Images PMID:2201911

  2. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    PubMed Central

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; Staskawicz, Brian J.; Loqué, Dominique; Hammond, Ming C.

    2015-01-01

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightly regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. Beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes. PMID:26138488

  3. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    SciTech Connect

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; Staskawicz, Brian J.; Loqué, Dominique; Hammond, Ming C.

    2015-07-02

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightly regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. In conclusion, beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes.

  4. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    DOE PAGES

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; ...

    2015-07-02

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightlymore » regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. In conclusion, beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes.« less

  5. Live monitoring of small vessels during development and disease using the flt-1 promoter element.

    PubMed

    Herz, Katia; Heinemann, Jan C; Hesse, Michael; Ottersbach, Annika; Geisen, Caroline; Fuegemann, Christopher J; Röll, Wilhelm; Fleischmann, Bernd K; Wenzel, Daniela

    2012-03-01

    Vessel formation is of critical importance for organ function in the normal and diseased state. In particular, the labeling and quantitation of small vessels prove to be technically challenging using current approaches. We have, therefore, established a transgenic embryonic stem (ES) cell line and a transgenic mouse model where the vascular endothelial growth factor receptor VEGFR-1 (flt-1) promoter drives the expression of the live reporter eGFP. Fluorescence microscopy and immunostainings revealed endothelial-specific eGFP labeling of vascular networks. The expression pattern recapitulates that of the endogenous flt-1 gene, because small and large vessels are labeled by eGFP during embryonic development; after birth, the expression becomes more restricted to small vessels. We have explored this in the cardiovascular system more in detail and found that all small vessels and capillaries within the heart are strongly eGFP+. In addition, myocardial injuries have been induced in transgenic mice and prominent vascular remodeling, and an increase in endothelial cell area within the peri-infarct area could be observed underscoring the utility of this mouse model. Thus, the transgenic flt-1/eGFP models are powerful tools to investigate and quantify vascularization in vivo and to probe the effect of different compounds on vessel formation in vitro.

  6. Vitamin D Responsive Elements within the HLA-DRB1 Promoter Region in Sardinian Multiple Sclerosis Associated Alleles

    PubMed Central

    Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola; Mura, Gioia; Rosatelli, Maria Cristina; Marrosu, Maria Giovanna

    2012-01-01

    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15∶01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15∶01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04∶05, *03∶01, *13∶01 and *15∶01 and non-MS-associated *16∶01, *01, *11, *07∶01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects). Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15∶01, *16∶01, *11 and in 45/73 *03∶01 and in heterozygous state in 28/73 *03∶01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13∶03, *04∶05 and *07∶01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04∶05 and *03∶01 alleles carrying the new mutated VDRE, while the *16∶01 and *03∶01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16∶01 and in the *15∶01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients. PMID:22848563

  7. Vitamin D responsive elements within the HLA-DRB1 promoter region in Sardinian multiple sclerosis associated alleles.

    PubMed

    Cocco, Eleonora; Meloni, Alessandra; Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola; Mura, Gioia; Rosatelli, Maria Cristina; Marrosu, Maria Giovanna

    2012-01-01

    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15:01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15:01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04:05, *03:01, *13:01 and *15:01 and non-MS-associated *16:01, *01, *11, *07:01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects). Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15:01, *16:01, *11 and in 45/73 *03:01 and in heterozygous state in 28/73 *03:01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13:03, *04:05 and *07:01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04:05 and *03:01 alleles carrying the new mutated VDRE, while the *16:01 and *03:01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16:01 and in the *15:01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients.

  8. Promoter elements and transcriptional control of the chicken tropomyosin gene [corrected

    PubMed Central

    Toutant, M; Gauthier-Rouviere, C; Fiszman, M Y; Lemonnier, M

    1994-01-01

    The chicken beta tropomyosin (beta TM) gene has two alternative transcription start sites (sk and nmCAP sites) which are used in muscle or non muscle tissues respectively. In order to understand the mechanisms involved in the tissue-specific and developmentally-regulated expression of the beta TM gene, we have analyzed the 5' regions associated with each CAP site. Truncated regions 5' to the nmCAP site were inserted upstream to the bacterial chloramphenicol acetyltransferase (CAT) reporter gene and these constructs were transfected into avian myogenic and non myogenic cells. The maximum transcription is driven by the CAT construct (-168/ + 216 nt) in all cell types. Previous deletion analysis of the region 5' to the beta TMskCAP site has indicated that 805 nt confer myotube-specific transcription. In this work, we characterized an enhancer element (-201/-68 nt) which contains an E box (-177), a variant CArG box (-104) and a stretch of 7Cs (-147). Mutation of any of these motifs results in a decrease of the myotube-specific transcriptional activity. Electrophoretic mobility shift assays indicate that these cis-acting sequences specifically bind nuclear proteins. This enhancer functions in an orientation-dependent manner. Images PMID:8208608

  9. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar

    2003-01-01

    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  10. HIV-1 and Human PEG10 Frameshift Elements Are Functionally Distinct and Distinguished by Novel Small Molecule Modulators

    PubMed Central

    Sleebs, Brad E.; Lackovic, Kurt; Parisot, John P.; Moss, Rebecca M.; Crowe-McAuliffe, Caillan; Mathew, Suneeth F.; Edgar, Christina D.; Kleffmann, Torsten; Tate, Warren P.

    2015-01-01

    Frameshifting during translation of viral or in rare cases cellular mRNA results in the synthesis of proteins from two overlapping reading frames within the same mRNA. In HIV-1 the protease, reverse transcriptase, and integrase enzymes are in a second reading frame relative to the structural group-specific antigen (gag), and their synthesis is dependent upon frameshifting. This ensures that a strictly regulated ratio of structural proteins and enzymes, which is critical for HIV-1 replication and viral infectivity, is maintained during protein synthesis. The frameshift element in HIV-1 RNA is an attractive target for the development of a new class of anti HIV-1 drugs. However, a number of examples are now emerging of human genes using −1 frameshifting, such as PEG10 and CCR5. In this study we have compared the HIV-1 and PEG10 frameshift elements and shown they have distinct functional characteristics. Frameshifting occurs at several points within each element. Moreover, frameshift modulators that were isolated by high-throughput screening of a library of 114,000 lead-like compounds behaved differently with the PEG10 frameshift element. The most effective compounds affecting the HIV-1 element enhanced frameshifting by 2.5-fold at 10 μM in two different frameshift reporter assay systems. HIV-1 protease:gag protein ratio was affected by a similar amount in a specific assay of virally-infected cultured cell, but the modulation of frameshifting of the first-iteration compounds was not sufficient to show significant effects on viral infectivity. Importantly, two compounds did not affect frameshifting with the human PEG10 element, while one modestly inhibited rather than enhanced frameshifting at the human element. These studies indicate that frameshift elements have unique characteristics that may allow targeting of HIV-1 and of other viruses specifically for development of antiviral therapeutic molecules without effect on human genes like PEG10 that use the same

  11. The transposon-like Correia elements encode numerous strong promoters and provide a potential new mechanism for phase variation in the meningococcus.

    PubMed

    Siddique, Azeem; Buisine, Nicolas; Chalmers, Ronald

    2011-01-20

    Neisseria meningitidis is the primary causative agent of bacterial meningitis. The genome is rich in repetitive DNA and almost 2% is occupied by a diminutive transposon called the Correia element. Here we report a bioinformatic analysis defining eight subtypes of the element with four distinct types of ends. Transcriptional analysis, using PCR and a lacZ reporter system, revealed that two ends in particular encode strong promoters. The activity of the strongest promoter is dictated by a recurrent polymorphism (Y128) at the right end of the element. We highlight examples of elements that appear to drive transcription of adjacent genes and others that may express small non-coding RNAs. Pair-wise comparisons between three meningococcal genomes revealed that no more than two-thirds of Correia elements maintain their subtype at any particular locus. This is due to recombinational class switching between elements in a single strain. Upon switching subtype, a new allele is available to spread through the population by natural transformation. This process may represent a hitherto unrecognized mechanism for phase variation in the meningococcus. We conclude that the strain-to-strain variability of the Correia elements, and the large number of strong promoters encoded by them, allows for potentially widespread effects within the population as a whole. By defining the strength of the promoters encoded by the eight subtypes of Correia ends, we provide a resource that allows the transcriptional effects of a particular subtype at a given locus to be predicted.

  12. Mitogen- and stress-activated protein kinase 1 MSK1 regulates glucocorticoid response element promoter activity in a glucocorticoid concentration-dependent manner.

    PubMed

    Beck, Ilse M; Clarisse, Dorien; Bougarne, Nadia; Okret, Sam; Haegeman, Guy; De Bosscher, Karolien

    2013-09-05

    The glucocorticoid receptor is a nuclear receptor, and can be activated by glucocorticoid ligands. Mitogen- and stress-activated protein kinase (MSK1), when activated by p38 and ERK mitogen-activated protein kinases (MAPKs), plays a major role in chromatin relaxation via phosphorylation of histone H3 S10. The glucocorticoid receptor can target MSK1 as part of its anti-inflammatory mechanism. Here, we studied the converse mechanism, i.e. the impact of MSK1 on glucocorticoid receptor-mediated transactivation. Upstream MSK1-activating kinases concentration-dependently enhanced glucocorticoid response element (GRE)-regulated promoter activity. Correspondingly, MSK1 inhibition, via H89, or combined p38 and ERK MAPK inhibition, via SB203580 and U0126, diminished maximally stimulated GRE-regulated promoter activity using high concentrations of glucocorticoids. Concomitantly, the combination of these agents does not seem to alter site-specific phosphorylations of murine glucocorticoid receptor S212 or S220. Paradoxically, we reveal that a sub-maximally activated GRE-mediated promoter activity, by using lower concentrations of glucocorticoids, is consistently enhanced by H89 or a combination of SB203580 and U0126, irrespective of the GRE promoter context. Furthermore, we show that the glucocorticoid-induced nucleocytoplasmic translocation of MSK1 occurs in a glucocorticoid concentration-dependent manner. The observed glucocorticoid concentration-dependent effect of MSK1 or MAPK inhibition on glucocorticoid receptor transactivation warrants further research into the applicability of combined glucocorticoid and kinase inhibitor strategies for anti-inflammatory purposes.

  13. Rearrangement of mouse immunoglobulin kappa deleting element recombining sequence promotes immune tolerance and lambda B cell production.

    PubMed

    Vela, José Luis; Aït-Azzouzene, Djemel; Duong, Bao Hoa; Ota, Takayuki; Nemazee, David

    2008-02-01

    The recombining sequence (RS) of mouse and its human equivalent, the immunoglobulin (Ig) kappa deleting element (IGKDE), are sequences found at the 3' end of the Ig kappa locus (Igk) that rearrange to inactivate Igk in developing B cells. RS recombination correlates with Ig lambda (Iglambda) light (L) chain expression and likely plays a role in receptor editing by eliminating Igk genes encoding autoantibodies. A mouse strain was generated in which the recombination signal of RS was removed, blocking RS-mediated Igk inactivation. In RS mutant mice, receptor editing and self-tolerance were impaired, in some cases leading to autoantibody formation. Surprisingly, mutant mice also made fewer B cells expressing lambda chain, whereas lambda versus kappa isotype exclusion was only modestly affected. These results provide insight into the mechanism of L chain isotype exclusion and indicate that RS has a physiological role in promoting the formation of lambda L chain-expressing B cells.

  14. A critical Sp1 element in the rhesus rhadinovirus (RRV) Rta promoter confers high-level activity that correlates with cellular permissivity for viral replication.

    PubMed

    DeMaster, Laura K; Rose, Timothy M

    2014-01-05

    KSHV establishes characteristic latent infections in vitro, while RRV, a related macaque rhadinovirus, establishes characteristic permissive infections with virus replication. We identified cells that are not permissive for RRV replication and recapitulate the latent KSHV infection and reactivation processes. The RRV replication and transactivator (Rta) promoter was characterized in permissive and non-permissive cells and compared to the KSHV Rta promoter. Both promoters contained a critical Sp1 element, had equivalent activities in different cell types, and were inhibited by LANA. RRV and KSHV infections were non-permissive in cells with low Rta promoter activity. While RRV infections were permissive in cells with high basal promoter activity, KSHV infections remained non-permissive. Our studies suggest that RRV lacks the Rta-inducible LANA promoter that is responsible for LANA inhibition of the KSHV Rta promoter and induction of latency during KSHV infection. Instead, the outcome of RRV infection is determined by host factors, such as Sp1.

  15. Glucocorticoid and progestin receptors are differently involved in the cooperation with a structural element of the mouse mammary tumor virus promoter.

    PubMed Central

    Le Ricousse, S; Gouilleux, F; Fortin, D; Joulin, V; Richard-Foy, H

    1996-01-01

    We have previously characterized a regulatory element located between -294 and -200 within the mouse mammary tumor virus (MMTV) long terminal repeat (LTR). This element termed AA element cooperates with the glucocorticoid response elements (GREs) for glucocorticoid activation. Here we show that in a MMTV LTR wild type context, the deletion of this element significantly reduces both glucocorticoid and progestin activation of the promoter. Deletion of the two most distal GREs forces the glucocorticoid receptor (GR) and the progestin receptor (PR) to bind the same response elements and results in a dramatic decrease in the inducibility of the MMTV promoter by the two hormones. The simultaneous deletion of the two distal GREs and of the AA element abolishes completely the glucocorticoid-induced activation of the promoter. In contrast it restores a significant level of progestin-induced activation. This different effect of the double deletion on glucocorticoid- and progestin-induced MMTV promoter activation is not cell specific because it is also observed, and is even stronger, when either GR or PR is expressed in the same cell line (NIH 3T3). This is the first description of a mutated MMTV promoter that, although retaining GREs, is activated by progestins and not by glucocorticoids. This suggests a different functional cooperation between protein(s) interacting with the AA element and GR or PR. Cotransfections with constructs containing wild-type or mutated MMTV LTR with either PR lacking its C-terminal domain or GR/PR chimeras in which the N-terminal domains have been exchanged demonstrate that the N-terminal domains of the receptors specify the different behavior of GR and PR regarding the AA element. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8643531

  16. The Core Promoter and Redox-sensitive Cis-elements as Key Targets for Inactivation of the Lysyl Oxidase Gene by Cadmium

    PubMed Central

    Li, Jianmin; Cheng, Guang; Zheng, Maoguen; Zhao, Yinzhi; Zhou, Jing; Li, Wande

    2015-01-01

    Exposure of humans to cadmium (Cd) either from environmental contamination or from cigarette smoke, often induces lung emphysema and cancers. Lysyl oxidase (LOX), a copper-dependent enzyme essential for crosslinking of the extracellular matrix, displays antagonistic effects on emphysema and cancer pathogenesis. Our previous studies showed down-regulation of LOX in Cd-resistant (CdR) rat fetal lung fibroblasts (RFL6) derived from parental cells via long-term Cd exposure. The cloned rat LOX gene promoter −804/−1 (relative to ATG) with the maximal promoter activity contains the Inr-DPE core promoter, putative NFI binding sites, metal response elements (MRE) and antioxidant response elements (ARE). ChIP assays reported here further characterize the rat LOX gene promoter in response to Cd. CdR cells exhibited enhanced methylation of CpG at the LOX core promoter region and reduced activities of the NFI binding sites and MRE, but increased activity of the ARE in a dose-dependent manner. The collective effect of Cd on the LOX promoter is trans-inhibition of the LOX gene as shown by suppression of histone H3 acetylation in the LOX core promoter region. Thus, the LOX core promoter and redox-sensitive cis-elements are key Cd targets for down-regulation of LOX relevant to mechanisms for Cd-induced emphysema and lung cancers. PMID:25741534

  17. MicroRNA-376b promotes breast cancer metastasis by targeting Hoxd10 directly

    PubMed Central

    An, Ning; Luo, Xinmei; Zhang, Ming; Yu, Ruilian

    2017-01-01

    Breast cancer is the most common malignant disease in women, and metastasis formed at distant anatomic sites was the major cause of cancer-related mortality. Thus, a novel therapy target and progression biomarker for breast cancer metastasis was necessary. microRNA (miR)-376b has been demonstrated to regulate angiogenesis; however, its role in cancer metastasis remains elusive. In the present study, the expression of miR-376b in normal breast tissue, JC and 4T1 cells was determined by qPCR. Furthermore, in vitro and in vivo experiments were performed to determine the effect of miR-376b on breast cancer metastasis. The direct target of miR-376b was determined by the luciferase assay and western blotting. The results indicated that silencing of miR-376b by the miR-376-mimic significantly inhibited 4T1 cell migration and invasion in vitro. Lung metastasis was also evidently decreased after silencing of miR-376b in 4T1 cells. Moreover, the luciferase assay and western blotting identified that Hoxd10 is the direct target of miR-376b during the regulation of breast cancer metastasis. To the best of our knowledge, the present study was the first to demonstrate the promoting breast cancer metastasis role of miR-376b by directly targeting Hoxd10. Therefore, it would be a novel therapy target and prognostic biomarker for breast cancer. PMID:28123472

  18. In vivo promoter analysis on refeeding response of hepatic sterol regulatory element-binding protein-1c expression

    SciTech Connect

    Takeuchi, Yoshinori; Yahagi, Naoya; Nakagawa, Yoshimi; Matsuzaka, Takashi; Shimizu, Ritsuko; Sekiya, Motohiro; Iizuka, Yoko; Ohashi, Ken; Gotoda, Takanari; Yamamoto, Masayuki; Nagai, Ryozo; Kadowaki, Takashi; Yamada, Nobuhiro; Osuga, Jun-ichi; Shimano, Hitoshi

    2007-11-16

    Sterol regulatory element-binding protein (SREBP)-1c is the master regulator of lipogenic gene expression in liver. The mRNA abundance of SREBP-1c is markedly induced when animals are refed after starvation, although the regulatory mechanism is so far unknown. To investigate the mechanism of refeeding response of SREBP-1c gene expression in vivo, we generated a transgenic mouse model that carries 2.2 kb promoter region fused to the luciferase reporter gene. These transgenic mice exhibited refeeding responses of the reporter in liver and adipose tissues with extents essentially identical to those of endogenous SREBP-1c mRNA. The same results were obtained from experiments using adenovirus-mediated SREBP-1c-promoter-luciferase fusion gene transduction to liver. These data demonstrate that the regulation of SREBP-1c gene expression is at the transcription level, and that the 2.2 kb 5'-flanking region is sufficient for this regulation. Moreover, when these transgenic or adenovirus-infected mice were placed on insulin-depleted state by streptozotocin treatment, the reporter expression was upregulated as strongly as in control mice, demonstrating that this regulation is not dominated by serum insulin level. These mice are the first models to provide the mechanistic insight into the transcriptional regulation of SREBP-1c gene in vivo.

  19. Cell Type-Specific Replication of Simian Virus 40 Conferred by Hormone Response Elements in the Late Promoter

    PubMed Central

    Farrell, Michael L.; Mertz, Janet E.

    2002-01-01

    The late genes of SV40 are not expressed at significant levels until after the onset of viral DNA replication. We previously identified two hormone response elements (HREs) in the late promoter that contribute to this delay. Mutants defective in these HREs overexpress late RNA at early, but not late, times after transfection of CV-1PD cells. Overexpression of nuclear receptors (NRs) that recognize these HREs leads to repression of the late promoter in a sequence-specific and titratable manner, resulting in a delay in late gene expression. These observations led to a model in which the late promoter is repressed at early times after infection by NRs, with this repression being relieved by titration of these repressors through simian virus 40 (SV40) genome replication to high copy number. Here, we tested this model in the context of the viral life cycle. SV40 genomes containing mutations in either or both HREs that significantly reduce NR binding without altering the coding of any proteins were constructed. Competition for replication between mutant and wild-type viruses in low-multiplicity coinfections indicated that the +1 HRE offered a significant selective advantage to the virus within a few cycles of infection in African green monkey kidney cell lines CV-1, CV-1P, TC-7, MA-134, and Vero but not in CV-1PD′ cells. Interestingly, the +55 HRE offered a selective disadvantage in MA-134 cells but had no effect in CV-1, CV-1P, TC-7, Vero, and CV-1PD′ cells. Thus, we conclude that these HREs are biologically important to the virus, but in a cell type-specific manner. PMID:12050389

  20. Cellular localization of the embryo-specific hybrid PRP from Zea mays, and characterization of promoter regulatory elements of its gene.

    PubMed

    Jose-Estanyol, M; Puigdomènech, P

    2012-10-01

    The expression, regulation and cellular localization of ZmHyPRP, a gene marker of embryo differentiation whose expression declines after ABA induction, was studied. ZmHyPRP is a proline-rich protein with a C-terminal domain having eight cysteines in a CM8 pattern. Transient expression in onion epidermal cells, transformed with a 2x35S::ZmHyPRP-GFP construction, indicated the protein is present in vesicles lining the membrane of the cell. The ZmHyPRP gene expression is under the control of classic promoter seed-specific regulatory elements such as Sph/RY and G-boxes, suggesting regulation by B3 and b-ZIP transcription factors. Promoter deletion analysis, by particle-bombardment transient transformation of maize immature embryos with serial deletions of the promoter fused to GUS, showed the presence of two negative regulatory elements, NE1 (-2070 to -1280) and NE2 (-232 to -178), in the ZmHyPRP promoter. By selective deletion or mutation of ZmHyPRP regulatory promoter elements we conclude that the promoter expression is attenuated by the NE2 element as well as by the G-box2 and the Sph1-2 box together with the G-box2.

  1. A 83-dB SFDR 10-MHz Bandwidth Continuous-Time Delta-Sigma Modulator Employing a One-Element-Shifting Dynamic Element Matching

    NASA Astrophysics Data System (ADS)

    Ninh, Hong Phuc; Miyahara, Masaya; Matsuzawa, Akira

    This paper considers a simple type of Dynamic Element Matching (DEM), Clocked Averaging (CLA) method referred to as one-element-shifting (OES) and its effectiveness for the implementation of high spurious-free dynamic range (SFDR) multi-bit Delta-Sigma modulators (DSMs). Generic DEM techniques are successful at suppressing the mismatch error and increasing the SFDR of data converters. However, they will induce additional glitch energy in most cases. Some recent DEM methods achieve improvements in minimizing glitch energy but sacrificing their effects in harmonic suppression due to mismatches. OES technique discussed in this paper can suppress the effect of glitch while preserving the reduction of element mismatch effects. Hence, this approach achieves better SFDR performance over the other published DEM methods. With this OES, a 3rd order, 10MHz bandwidth continuous-time DSM is implemented in 90nm CMOS process. The measured SFDR attains 83dB for a 10MHz bandwidth. The measurement result also shows that OES improves the SFDR by higher than 10dB.

  2. Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

    PubMed

    Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

    2014-01-01

    The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  3. Finite Element Analysis and Test Correlation of a 10-Meter Inflation-Deployed Solar Sail

    NASA Technical Reports Server (NTRS)

    Sleight, David W.; Michii, Yuki; Lichodziejewski, David; Derbes, Billy; Mann. Troy O.; Slade, Kara N.; Wang, John T.

    2005-01-01

    Under the direction of the NASA In-Space Propulsion Technology Office, the team of L Garde, NASA Jet Propulsion Laboratory, Ball Aerospace, and NASA Langley Research Center has been developing a scalable solar sail configuration to address NASA's future space propulsion needs. Prior to a flight experiment of a full-scale solar sail, a comprehensive phased test plan is currently being implemented to advance the technology readiness level of the solar sail design. These tests consist of solar sail component, subsystem, and sub-scale system ground tests that simulate the vacuum and thermal conditions of the space environment. Recently, two solar sail test articles, a 7.4-m beam assembly subsystem test article and a 10-m four-quadrant solar sail system test article, were tested in vacuum conditions with a gravity-offload system to mitigate the effects of gravity. This paper presents the structural analyses simulating the ground tests and the correlation of the analyses with the test results. For programmatic risk reduction, a two-prong analysis approach was undertaken in which two separate teams independently developed computational models of the solar sail test articles using the finite element analysis software packages: NEiNastran and ABAQUS. This paper compares the pre-test and post-test analysis predictions from both software packages with the test data including load-deflection curves from static load tests, and vibration frequencies and mode shapes from vibration tests. The analysis predictions were in reasonable agreement with the test data. Factors that precluded better correlation of the analyses and the tests were uncertainties in the material properties, test conditions, and modeling assumptions used in the analyses.

  4. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation*

    PubMed Central

    Guo, Jianfei; Öz, Orhan K.

    2015-01-01

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the −36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  5. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.

    PubMed

    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K

    2015-09-25

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance.

  6. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... peak demands for energy and improve the efficiency of energy supply systems, including electricity... following: (1) Program activities of public education to promote energy efficiency, renewable energy, and... adequate and reliable energy supplies, including greater energy efficiency, that meet applicable...

  7. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... peak demands for energy and improve the efficiency of energy supply systems, including electricity... following: (1) Program activities of public education to promote energy efficiency, renewable energy, and... adequate and reliable energy supplies, including greater energy efficiency, that meet applicable...

  8. Making sense of the global economy: 10 resources for health promoters.

    PubMed

    Mohindra, K S; Labonté, Ronald

    2010-09-01

    Population health is shaped by more than local or national influences-the global matters. Health promotion practitioners and researchers increasingly are challenged to engage with upstream factors related to the global economy, such as global prescriptions for national macroeconomic policies, debt relief and international trade. This paper identifies 10 books (A Brief History of Neoliberalism, Bad Samaritans: The Myth of Free Trade and the Secret History of Capitalism, The World is Not Flat: Inequality and Injustice in Our Global Economy, Globalization and its Discontents, The Debt Threat: How Debt is Destroying the Developing World, Global Woman: Nannies, Maids, and Sex Workers in the New Economy, A Race Against Time, Globalization and Health: An Introduction, Global Public Goods for Health: Health Economics and Public Health Perspectives, Trade and Health: Seeking Common Ground) and several key reports that we found to be particularly useful for understanding the global economy's effects on people's health. We draw attention to issues helpful in understanding the present global financial crisis.

  9. The ubiquitous cellular transcriptional factor USF targets the varicella-zoster virus open reading frame 10 promoter and determines virulence in human skin xenografts in SCIDhu mice in vivo.

    PubMed

    Che, Xibing; Berarducci, Barbara; Sommer, Marvin; Ruyechan, William T; Arvin, Ann M

    2007-04-01

    Varicella-zoster virus (VZV) open reading frame 10 (ORF10) is a determinant of virulence in SCIDhu skin xenografts but not in human T cells in vivo. In this analysis of the regulation of ORF10 transcription, we have identified four ORF10-related transcripts, including a major 1.3-kb RNA spanning ORF10 only and three other read-through transcripts. Rapid-amplification-of-cDNA-ends experiments indicated that the 1.3-kb transcript of ORF10 has single initiation and termination sites. In transient expression assays, the ORF10 promoter was strongly stimulated by the major VZV transactivator, IE62. Deletion analyses revealed approximate boundaries for the full ORF10 promoter activity between -75 and -45 and between +5 and -8, relative to the ORF10 transcription start site. The recombinant virus POKA10-Deltapro, with the ORF10 promoter deletion, blocked transcription of ORF10 and also of ORF9A and ORF9 mRNAs, whereas expression of read-through ORF9A/9/10 and ORF9/10 transcripts was increased, compensating for the loss of the monocistronic mRNAs. The cellular factor USF bound specifically to its consensus site within the ORF10 promoter and was required for IE62 transactivation, whereas disrupting the predicted TATA boxes or Oct-1 binding elements had no effect. The USF binding site was disrupted in the recombinant virus, POKA10-proDeltaUSF, and no ORF10 protein was produced. Both ORF10 promoter mutants reduced VZV replication in SCIDhu skin xenografts. These observations provided further evidence of the contribution of the ORF10 protein to VZV pathogenesis in skin and demonstrated that VZV depends upon the cellular transcriptional factor USF to support its virulence in human skin in vivo.

  10. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  11. Atmospheric wet and dry deposition of trace elements at 10 sites in Northern China

    NASA Astrophysics Data System (ADS)

    Pan, Y. P.; Wang, Y. S.

    2015-01-01

    Atmospheric deposition is considered to be a major process that removes pollutants from the atmosphere and an important source of nutrients and contaminants for ecosystems. Trace elements (TEs), especially toxic metals deposited on plants and into soil or water, can cause substantial damage to the environment and human health due to their transfer and accumulation in food chains. Despite public concerns, quantitative knowledge of metal deposition from the atmosphere to ecosystems remains scarce. To advance our understanding of the spatiotemporal variations in the magnitudes, pathways, compositions and impacts of atmospherically deposited TEs, precipitation (rain and snow) and dry-deposited particles were collected simultaneously at 10 sites in Northern China from December 2007 to November 2010. The measurements showed that the wet and dry depositions of TEs in the target areas were orders of magnitude higher than previous observations within and outside China, generating great concern over the potential risks. The spatial distribution of the total (wet plus dry) deposition flux was consistent with that of the dry deposition, with a significant decrease from industrial and urban areas to suburban, agricultural and rural sites, while the wet deposition exhibited less spatial variation. In addition, the seasonal variation of wet deposition was also different from that of dry deposition, although they were both governed by the precipitation and emission patterns. For the majority of TEs that exist as coarse particles, dry deposition dominated the total flux at each site. This was not the case for potassium, nickel, arsenic, lead, zinc, cadmium, selenium, silver and thallium, for which the relative importance between wet and dry deposition fluxes varied by site. Whether wet deposition is the major atmospheric cleansing mechanism for the TEs depends on the size distribution of the particles. We found that atmospheric inputs of copper, lead, zinc, cadmium, arsenic and

  12. [Determination of 10 elements in the feather of brown-eared pheasant by ICP and AAS].

    PubMed

    Wu, Yu-Zhen; Zhang, Feng; Wang, Meng-Ben; Zhao, Gen-Gui

    2008-03-01

    Crossoptilon mantchuricum (brown-eared pheasant) is an endemic to northern China and one of the state first-protection animals, which is now confined to scattered localities in Guandi Mountains, Guancen Mountains, Luliang Ranges of western Shanxi, and the mountains of north-western Hebei, western Beijing and central Shaanxi. Its range is fragmented by habitat loss because of human activity and other intervention, and isolated populations are resulting in facing the extinction risk from further forest destroyed and other pressures. The trace elements are very important to the growth and development of brown-eared pheasant, and these elements in the feather are closely correlated to the contents in the organs of the bird. By research on the elements contents in the feather, the authors are able to get more information about the growth, development, reproduction, immunity and metabolism function for this bird. The aim of this study is to try providing scientific basis for further enhancing the protection and the artificial breeding. Ten elements including Mo, Zn, Ni, Fe, Mn, Cr, Cu, K, Pb and Cd were determined in the feather of brown-eared pheasant by ICP and AAS, respectively. For the analysis two samples were from Luya Mountain Natural Reserve and Pangquangou Natural Reserve, and one was from Taiyuan Zoo, Shanxi. The contents of the elements in the feather of wild and captive brown-eared pheasants were compared each other. The results showed that the contents of the eight elements the feather from the Zoo were lower than those from Luya Mountain Natural Reserve and Pangquangou Natural Reserve. Moreover, Fe is the highest among those ten elements, Cd was not found, and Mo and Cr were much lower than the others. It is suggested that varying habitats have obvious effects on the elements contents of wild bird body, and wild habitant is more beneficial to the bird growth and development. Applying the results to wild animal management would be favorable to the protection

  13. A computer simulation for evaluating the array performance of the 10-m/phi/ 5-element super-synthesis telescope

    NASA Astrophysics Data System (ADS)

    Morita, K.-I.; Ishiguro, M.

    1980-03-01

    The array performance in several successive configurations was examined for the 10-m(phi) 5-element super-synthesis telescope. The number of (u, v) samples was used as a criterion of optimum (u, v) coverages. The optimum solution for a given declination was obtained by a random trial method. The performance was evaluated by computer simulation using model brightness distributions.

  14. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Relief from fingerprinting, identification and criminal history records checks and other elements of background checks for designated categories of individuals. 73.59 Section 73.59 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF...

  15. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Relief from fingerprinting, identification and criminal history records checks and other elements of background checks for designated categories of individuals. 73.59 Section 73.59 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF...

  16. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR..., grinding and grading will be present. Mixed oxide fuels are handled in glove boxes (or...

  17. [Health promotion in Germany 10 years after the Ottawa Charter--exemplified by prevention of smoking].

    PubMed

    Luber, E

    1997-06-01

    In Germany, there is no national preventive policy defining health problems, priorities and development of adequate intervention strategies including the factors of change. Thus, preventive potential remains unused. This is most evident for societal strategies, whereas individual strategies have been promoted when the responsibility for health promotion (h.p.) was resting with the sickness funds. In 1996, financing of h.p. through sickness funds was stopped. Redefining structures for preventive measures is overdue. Health authorities should play an active role in focussing on the coordination of health promotion. These arguments are discussed using the example of non-smoking campaign policies.

  18. IFN-gamma AU-rich element removal promotes chronic IFN-gamma expression and autoimmunity in mice

    PubMed Central

    Hodge, Deborah L.; Berthet, Cyril; Coppola, Vincenzo; Kastenmüller, Wolfgang; Buschman, Matthew D.; Schaughency, Paul M.; Shirota, Hidekazu; Scarzello, Anthony J.; Subleski, Jeff J.; Anver, Miriam R.; Ortaldo, John R.; Lin, Fanching; Reynolds, Della A.; Sanford, Michael E.; Kaldis, Philipp; Tessarollo, Lino; Klinman, Dennis M.; Young, Howard A.

    2014-01-01

    We generated a mouse model with a 162 nt AU-rich element (ARE) region deletion in the 3′ untranslated region (3′UTR) of the interferon-gamma (IFN-γ) gene that results in chronic circulating serum IFN-γ levels. Mice homozygous for the ARE deletion (ARE-Del) −/− present both serologic and cellular abnormalities typical of patients with systemic lupus erythematosus (SLE). ARE-Del−/− mice display increased numbers of pDCs in bone marrow and spleen. Addition of IFN-γ to Flt3-ligand (Flt3L) treated in vitro bone marrow cultures results in a 2-fold increase in pDCs with concurrent increases in IRF8 expression. Marginal zone B (MZB) cells and marginal zone macrophages (MZMs) are absent in ARE-Del−/− mice. ARE-Del+/− mice retain both MZB cells and MZMs and develop no or mild autoimmunity. However, low dose clodronate treatment in ARE-Del+/− mice specifically eliminates MZMs and promotes anti-DNA antibody development and glomerulonephritis. Our findings demonstrate the consequences of a chronic IFN-γ milieu on B220+ cell types and in particular the impact of MZB cell loss on MZM function in autoimmunity. Furthermore, similarities between disease states in ARE-Del−/− mice and SLE patients suggest that IFN-γ may not only be a product of SLE but may be critical for disease onset and progression. PMID:24583068

  19. Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter

    PubMed Central

    1993-01-01

    Tumor necrosis factor alpha (TNF-alpha), a cytokine with pleiotropic biological effects, is produced by a variety of cell types in response to induction by diverse stimuli. In this paper, TNF-alpha mRNA is shown to be highly induced in a murine T cell clone by stimulation with T cell receptor (TCR) ligands or by calcium ionophores alone. Induction is rapid, does not require de novo protein synthesis, and is completely blocked by the immunosuppressant cyclosporin A (CsA). We have identified a human TNF-alpha promoter element, kappa 3, which plays a key role in the calcium-mediated inducibility and CsA sensitivity of the gene. In electrophoretic mobility shift assays, an oligonucleotide containing kappa 3 forms two DNA protein complexes with proteins that are present in extracts from unstimulated T cells. These complexes appear in nuclear extracts only after T cell stimulation. Induction of the inducible nuclear complexes is rapid, independent of protein synthesis, and blocked by CsA, and thus, exactly parallels the induction of TNF-alpha mRNA by TCR ligands or by calcium ionophore. Our studies indicate that the kappa 3 binding factor resembles the preexisting component of nuclear factor of activated T cells. Thus, the TNF-alpha gene is an immediate early gene in activated T cells and provides a new model system in which to study CsA-sensitive gene induction in activated T cells. PMID:8376940

  20. IFN-gamma AU-rich element removal promotes chronic IFN-gamma expression and autoimmunity in mice.

    PubMed

    Hodge, Deborah L; Berthet, Cyril; Coppola, Vincenzo; Kastenmüller, Wolfgang; Buschman, Matthew D; Schaughency, Paul M; Shirota, Hidekazu; Scarzello, Anthony J; Subleski, Jeff J; Anver, Miriam R; Ortaldo, John R; Lin, Fanching; Reynolds, Della A; Sanford, Michael E; Kaldis, Philipp; Tessarollo, Lino; Klinman, Dennis M; Young, Howard A

    2014-09-01

    We generated a mouse model with a 162 nt AU-rich element (ARE) region deletion in the 3' untranslated region (3'UTR) of the interferon-gamma (IFN-γ) gene that results in chronic circulating serum IFN-γ levels. Mice homozygous for the ARE deletion (ARE-Del) (-/-) present both serologic and cellular abnormalities typical of patients with systemic lupus erythematosus (SLE). ARE-Del(-/-) mice display increased numbers of pDCs in bone marrow and spleen. Addition of IFN-γ to Flt3-ligand (Flt3L) treated in vitro bone marrow cultures results in a 2-fold increase in pDCs with concurrent increases in IRF8 expression. Marginal zone B (MZB) cells and marginal zone macrophages (MZMs) are absent in ARE-Del(-/-) mice. ARE-Del(+/-) mice retain both MZB cells and MZMs and develop no or mild autoimmunity. However, low dose clodronate treatment in ARE-Del(+/-) mice specifically eliminates MZMs and promotes anti-DNA antibody development and glomerulonephritis. Our findings demonstrate the consequences of a chronic IFN-γ milieu on B220(+) cell types and in particular the impact of MZB cell loss on MZM function in autoimmunity. Furthermore, similarities between disease states in ARE-Del(-/-) mice and SLE patients suggest that IFN-γ may not only be a product of SLE but may be critical for disease onset and progression.

  1. The maize regulatory gene B-Peru contains a DNA rearrangement that specifies tissue-specific expression through both positive and negative promoter elements.

    PubMed Central

    Selinger, D A; Lisch, D; Chandler, V L

    1998-01-01

    The B-Peru allele of the maize b regulatory gene is unusual relative to most b alleles in that it is expressed in the aleurone layer of the seed. It is also expressed in a subset of plant vegetative tissues. Transgenic maize plants containing the B-Peru gene with the first 710 bases of upstream sequence conferred the same levels of aleurone expression as nontransgenic B-Peru plants, but no pigment was made in vegetative tissues. Transient transformation assays in aleurone tissue localized the aleurone-specific promoter to the first 176 bases of the B-Peru upstream region and identified two critically important regions within this fragment. Mutation of either region alone reduced expression greater than fivefold. Surprisingly, the double mutation actually increased expression to twice the native promoter level. Our results suggest that these two critical sequences, which lie close together in the promoter, may form a negative regulatory element. Several lines of evidence suggest that the B-Peru promoter arose through the translocation of an existing aleurone-specific promoter to the b locus. Immediately upstream of the aleurone-specific promoter elements and in the opposite orientation to the b coding sequence is a pseudogene sequence with strong similarity to a known class of proteins. Our findings that novel aleurone-specific promoter sequences of the B-Peru transcription factor are found adjacent to part of another gene in a small insertion are quite unexpected and have interesting evolutionary implications. PMID:9611220

  2. Identification of a cis-acting element in the class I major histocompatibility complex gene promoter responsive to activation by retroviral sequences.

    PubMed Central

    Choi, S Y; van de Mark, K; Faller, D V

    1997-01-01

    The infection of cells with Moloney murine leukemia virus (M-MuLV) causes an increase in specific cellular gene products, including the major histocompatibility complex (MHC) class I antigens. This upregulation occurs through a transactivation process mediated by the long terminal repeat (LTR) of M-MuLV, and we show here that the gene activation response to the LTR requires at least one specific cis element within the MHC proximal promoter region. Nested deletions of MHC class I H-2Kb gene promoter sequence were subcloned into a chloramphenicol acetyltransferase (CAT) reporter vector and then transiently introduced into BALB/c-3T3 cells expressing M-MuLV or cotransfected into BALB/c-3T3 cells with a vector containing subgenomic portions of the virus, including the LTR. CAT activity assays demonstrated that a minimal H-2Kb gene promoter (-64 to +12) contained elements sufficient for this transactivation. DNase I footprinting assays located a protein-binding site in the region of -64 to -34 bp from the transcriptional start site, and point mutation analysis confirmed the location of this cis-acting element, designated the let response element (LRE), and defined a binding motif. This LRE is distinct from binding sites for currently known transcription factors in the class I MHC gene promoter and is conserved in the promoters of human and murine MHC class I genes. Mutation of the LRE resulted in dramatic reduction in both DNA-protein binding activity in electrophoretic mobility shift assay and in the ability of the mutated promoter to respond to retroviral transactivation. Addition of the LRE to a heterologous promoter conferred the ability to respond to retroviral transactivation. PMID:8995614

  3. Haplotype-specific modulation of a SOX10/CREB response element at the Charcot-Marie-Tooth disease type 4C locus SH3TC2.

    PubMed

    Brewer, Megan Hwa; Ma, Ki Hwan; Beecham, Gary W; Gopinath, Chetna; Baas, Frank; Choi, Byung-Ok; Reilly, Mary M; Shy, Michael E; Züchner, Stephan; Svaren, John; Antonellis, Anthony

    2014-10-01

    Loss-of-function mutations in the Src homology 3 (SH3) domain and tetratricopeptide repeats 2 (SH3TC2) gene cause autosomal recessive demyelinating Charcot-Marie-Tooth neuropathy. The SH3TC2 protein has been implicated in promyelination signaling through axonal neuregulin-1 and the ERBB2 Schwann cell receptor. However, little is known about the transcriptional regulation of the SH3TC2 gene. We performed computational and functional analyses that revealed two cis-acting regulatory elements at SH3TC2-one at the promoter and one ∼150 kb downstream of the transcription start site. Both elements direct reporter gene expression in Schwann cells and are responsive to the transcription factor SOX10, which is essential for peripheral nervous system myelination. The downstream enhancer harbors a single-nucleotide polymorphism (SNP) that causes an ∼80% reduction in enhancer activity. The SNP resides directly within a predicted binding site for the transcription factor cAMP response element binding protein (CREB), and we demonstrate that this regulatory element binds to CREB and is activated by CREB expression. Finally, forskolin induces Sh3tc2 expression in rat primary Schwann cells, indicating that SH3TC2 is a CREB target gene. These findings prompted us to determine if SNP genotypes at SH3TC2 are associated with differential phenotypes in the most common demyelinating peripheral neuropathy, CMT1A. Interestingly, this revealed several associations between SNP alleles and disease severity. In summary, our data indicate that SH3TC2 is regulated by the transcription factors CREB and SOX10, define a regulatory SNP at this disease-associated locus and reveal SH3TC2 as a candidate modifier locus of CMT disease phenotypes.

  4. The salt-regulated element in the promoter of lycopene β-cyclase gene confers a salt regulatory pattern in carotenogenesis of Dunaliella bardawil.

    PubMed

    Liang, Ming-Hua; Lu, Yan; Chen, Hao-Hong; Jiang, Jian-Guo

    2017-03-01

    In the carotenoid biosynthesis, lycopene β-cyclase (LCYb) is a key regulatory enzyme involved in the conversion of lycopene into β-carotene. Under stress conditions, such as high salinity, high light and nutrient deprivation, large amounts of β-carotene can be accumulated in Dunaliella bardawil. To study on the molecular responses of salt stress in D. bardawil is of great significance to reveal the mechanisms of salt tolerance and engineer crop plants to be salt-tolerant. In this study, the full-length coding sequence of lcyb from D. bardawil (Dblcyb, GenBank: KX218392) was isolated by transcriptome sequencing. Then, the genomic sequence, promoter and terminator regions of Dblcyb were isolated by genome walking. The Dblcyb promoter (GenBank: KX218393) contained several typical transcription boxes, multiple light response elements and a salt-regulated element (SRE, GT1GMSCAM4). Dbpsy and Dblcyb responsible for β-carotene biosynthesis in D. bardawil was shown to be up-regulated under salt stress and their promoters contained the common SRE. By element deletion analysis and using Ble-EGFP as the reporter, the salt-inducible SRE was confirmed to confer salt-induced expression of Dblcyb promoter. It was indicated that the salt-regulated expression of Dblcyb may be attributed to the salt-responsive element (GT1GMSCAM4) and the GT-rich region in its genomic sequence.

  5. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  6. FEHMN 1.0: Finite element heat and mass transfer code; Revision 1

    SciTech Connect

    Zyvoloski, G.; Dash, Z.; Kelkar, S.

    1992-05-01

    A computer code is described which can simulate non-isothermal multi-phase multicomponent flow in porous media. It is applicable to natural-state studies of geothermal systems and groundwater flow. The equations of heat and mass transfer for multiphase flow in porous and permeable media are solved sing the finite element method. The permeability and porosity of the medium are allowed to depend on pressure and temperature. The code also has provisions for movable air and water phases and noncoupled tracers; that is, tracer solutions that do not affect the heat and mass transfer solutions. The tracers can be passive or reactive. The code can simulate two-dimensional, two-dimensional radial, or three-dimensional geometries. A summary of the equations in the model and the numerical solution procedure are provided in this report. A user`s guide and sample problems are also included. The FEHMN (Finite Element Heat and Mass Nuclear) code, described in this report, is a version of FEHM (Finite Element Heat and Mass, Zyvoloski et al., 1988) developed for the Yucca Mountain Site Characterization Project (YMP). The main use of FEHMN will be to assist in the understanding of flow fields in the saturated zone below the potential Yucca Mountain repository.

  7. The wheat HMW-glutenin 1Dy10 gene promoter controls endosperm expression in Brachypodium distachyon.

    PubMed

    Thilmony, Roger; Guttman, Mara E; Lin, Jeanie W; Blechl, Ann E

    2014-01-01

    The grass species Brachypodium distachyon has emerged as a model system for the study of gene structure and function in temperate cereals. As a first demonstration of the utility of Brachypodium to study wheat gene promoter function, we transformed it with a T-DNA that included the uidA reporter gene under control of a wheat High-Molecular-Weight Glutenin Subunit (HMW-GS) gene promoter and transcription terminator. For comparison, the same expression cassette was introduced into wheat by biolistics. Histochemical staining for β-glucuronidase (GUS) activity showed that the wheat promoter was highly expressed in the endosperms of all the seeds of Brachypodium and wheat homozygous plants. It was not active in any other tissue of transgenic wheat, but showed variable and sporadic activity in a minority of styles of the pistils of four homozygous transgenic Brachypodium lines. The ease of obtaining transgenic Brachypodium plants and the overall faithfulness of expression of the wheat HMW-GS promoter in those plants make it likely that this model system can be used for studies of other promoters from cereal crop species that are difficult to transform.

  8. Comprehensive analysis of regulatory elements of the promoters of rice sulfate transporter gene family and functional characterization of OsSul1;1 promoter under different metal stress.

    PubMed

    Kumar, Smita; Asif, Mehar Hasan; Chakrabarty, Debasis; Tripathi, Rudra Deo; Dubey, Rama Shanker; Trivedi, Prabodh Kumar

    2015-01-01

    Adverse environmental conditions including heavy metal stress impose severe effects on the plant growth and development limiting productivity and yield. Studies demonstrated that changes in genome-wide expression modulate various biochemical processes and molecular components in response to heavy metal stress in plants. Some of the key components involved in such a regulation are the transcription initiation machinery, nucleotide sequence of promoters and presence of cis-acting elements. Therefore, identification of the putative cis-acting DNA sequences involved in gene regulation and functional characterization of promoters are important steps in understanding response of plants to heavy metal stress. In this study, comprehensive analysis of the proximal promoters of members of rice sulfate transporter gene family which is an essential component of stress response has been carried out. Analysis suggests presence of various common stress related cis-acting elements in the promoters of members of this gene family. In addition, transcriptional regulation of the arsenic-responsive high affinity sulfate transporter, OsSul1;1, has been studied through development of Arabidopsis transgenic lines expressing reporter gene encoding β-glucuronidase under the control of OsSul1;1 promoter. Analysis of the transgenic lines suggests differential response of the OsSul1;1 promoter to various heavy metals as well as other abiotic stresses.

  9. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  10. Identification of fungus-responsive cis-acting element in the promoter of Brassica juncea chitinase gene, BjCHI1.

    PubMed

    Gao, Ying; Zan, Xin-Li; Wu, Xue-Feng; Yao, Lei; Chen, Yu-Ling; Jia, Shuang-Wei; Zhao, Kai-Jun

    2014-02-01

    Chitinases are a group of pathogenesis-related proteins. The Brassica juncea chitinase gene BjCHI1 is highly inducible by pathogenic fungal infection, suggesting that the promoter of BjCHI1 might contain specific cis-acting element responsive to fungal attack. To identify the fungus-responsive element in BjCHI1 promoter (BjC-P), a series of binary plant transformation vectors were constructed by fusing the BjC-P or its deletion-derivatives to β-glucuronidase (GUS) reporter gene. Expression of the GUS reporter gene was systematically assayed by a transient gene expression system in Nicotiana benthamiana leaves treated with fungal elicitor Hexa-N-Acetyl-Chitohexaose, as well as in transgenic Arabidopsis plants inoculated with fungus Botrytis cinerea. The histochemical and quantitative GUS assays showed that the W-box-like element (GTAGTGACTCAT) in the region (-668 to -657) was necessary for the fungus-response, although there were another five W-box-like elements in BjC-P. In addition, gain-of-function analysis demonstrated that the fragment (-409 to -337) coupled to the W-box-like element was needed for full magnitude of the fungal induction. These results revealed the existence of a novel regulation mechanism of W-box-like element involved in plant pathogenic resistance, and will benefit the potential application of BjC-P in engineering crops.

  11. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus. L).

    PubMed

    Duraisamy, Ganesh Selvaraj; Mishra, Ajay Kumar; Kocabek, Tomas; Matoušek, Jaroslav

    2016-10-01

    Molecular and biochemical studies have shown that gene contains single or combination of different cis-acting regulatory elements are actively controlling the transcriptional regulation of associated genes, downstream effects of these result in the modulation of various biological pathways such as biotic/abiotic stress responses, hormonal responses to growth and development processes and secondary metabolite production. Therefore, the identification of promoters and their cis-regulatory elements is one of intriguing area to study the dynamic complex regulatory network of genes activities by integrating computational, comparative, structural and functional genomics. Several bioinformatics servers or database have been established to predict the cis-acting elements present in the promoter region of target gene and their association with the expression profiles in the TFs. The aim of this study is to predict possible cis-acting regulatory elements that have putative role in the transcriptional regulation of a dynamic network of metabolite gene activities controlling prenylflavonoid and bitter acids biosynthesis in hop (Humulus lupulus). Recent release of hop draft genome enabled us to predict the possible cis-acting regulatory elements by extracting 2kbp of 5' regulatory regions of genes important for lupulin metabolome biosynthesis, using Plant CARE, PLACE and Genomatix Matinspector professional databases. The result reveals the plausible role of cis-acting regulatory elements in the regulation of gene expression primarily involved in lupulin metabolome biosynthesis including under various stress conditions.

  12. The wheat HMW-glutenin 1Dy10 gene promoter controls endosperm expression in Brachypodium distachyon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The grass species Brachypodium distachyon has emerged as a model system for the study of gene structure and function in temperate cereals. As a first demonstration of the utility of Brachypodium to study wheat gene promoter function, we transformed it with a T-DNA that included the GUS reporter gene...

  13. Polymorphisms in the interleukin-10 gene promoter and the risk of alcoholism and alcoholic liver disease in Caucasian Spaniard men.

    PubMed

    Auguet, Teresa; Vidal, Francesc; Broch, Montserrat; Olona, Montserrat; Aguilar, Carmen; Morancho, Beatriz; López-Dupla, Miguel; Quer, Joan-Carles; Sirvent, Joan-Josep; Richart, Cristóbal

    2010-05-01

    Controversy surrounds the possible influence of the single nucleotide polymorphisms (SNPs) of the interleukin-10 (IL-10) gene promoter on the risk for alcoholic liver disease. Our aim was to determine whether the SNP of the IL-10 gene promoter are associated with an increased risk for alcoholism and for alcoholic liver disease in male Spaniards. The -627 C>A SNP of the IL-10 gene promoter was assessed in a cohort of 344 Caucasian Spanish men, 168 alcoholics, and 176 nonalcoholics. The alcoholic group comprised 79 individuals without liver histopathologic abnormalities and 89 patients with chronic alcoholic liver disease. The nonalcoholic group was made of 62 healthy controls and 114 patients with chronic nonalcoholic liver disease. Genotyping was performed using PCR and automatic sequencing analysis methods on white cell DNA. Genotype and allele frequencies were compared by using the chi(2) test. Overall, no differences in either genotype and allele distribution was observed when comparing the four patient categories defined (P=0.62 and P=0.33, respectively). Subset analyses showed no differences in the genotype and allele distributions between all alcoholic and all nonalcoholic subjects (P=0.55 and P=0.29, respectively). This study failed to detect significant associations of the IL-10 -627C>A SNP and alcoholism or alcoholic liver disease in a cohort of Caucasian male Spaniards.

  14. Promotion of hair follicle development and trichogenesis by Wnt-10b in cultured embryonic skin and in reconstituted skin

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-06-30

    We previously showed that Wnt-10b promoted the differentiation of primary skin epithelial cells (MPSEC) toward hair shaft and inner root sheath of the hair follicle (IRS) cells in vitro. In the present study, we found that Wnt-10b promotes the development of hair follicles using a culture of mouse embryonic skin tissue and trichogenesis using a reconstitution experiment with nude mice. Hair follicle development was observed in skin taken from mouse embryos on embryonic day 10.5 following a 2-day culture with recombinant Wnt-10b (rWnt-10b), however, not without rWnt-10b. Brown hair growth was observed at the site of reconstituted skin in Balb/c nude mice where dermal fibroblasts and keratinocytes, derived from C3H/HeN new born mice, were transplanted with Wnt-10b-producing COS cells (Wnt-COS). Without the co-transplantation of Wnt-COS, no hair growth was observed. Our results suggest an important role of Wnt-10b in the initiation of hair follicle development and following trichogenesis.

  15. Genetic engineering of the Xa10 promoter for broad-spectrum and durable resistance to Xanthomonas oryzae pv. oryzae.

    PubMed

    Zeng, Xuan; Tian, Dongsheng; Gu, Keyu; Zhou, Zhiyun; Yang, Xiaobei; Luo, Yanchang; White, Frank F; Yin, Zhongchao

    2015-09-01

    Many pathovars of plant pathogenic bacteria Xanthomonas species inject transcription activator-like (TAL) effectors into plant host cells to promote disease susceptibility or trigger disease resistance. The rice TAL effector-dependent disease resistance gene Xa10 confers narrow-spectrum race-specific resistance to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial blight disease in rice. To generate broad-spectrum and durable resistance to Xoo, we developed a modified Xa10 gene, designated as Xa10(E5) . Xa10(E5) has an EBE-amended promoter containing 5 tandemly arranged EBEs each responding specifically to a corresponding virulent or avirulent TAL effector and a stable transgenic rice line containing Xa10(E5) was generated in the cultivar Nipponbare. The Xa10(E5) gene was specifically induced by Xoo strains that harbour the corresponding TAL effectors and conferred TAL effector-dependent resistance to the pathogens at all developmental stages of rice. Further disease evaluation demonstrated that the Xa10(E5) gene in either Nipponbare or 9311 genetic backgrounds provided broad-spectrum disease resistance to 27 of the 28 Xoo strains collected from 11 countries. The development of Xa10(E5) and transgenic rice lines provides new genetic materials for molecular breeding of rice for broad-spectrum and durable disease resistance to bacterial blight.

  16. ILS Element E14 Support Management and Analysis. Distribution Program and User’s Manual Version 1.0

    DTIC Science & Technology

    1991-04-01

    C ILS ELEMENT E14 SUPPORT MANAGEMENT AND ANALYSIS Distribution Program and User’s Manual Version 1.0 APJ 966-679 iAAA MILITAR \\SCIENTIFIC RESEARCH M...editing and typing support were most competently provided by Barbara Boren and Denise Montanez . We gratefully acknowledge the significant contributions...procedures. 1. Turn the computer and monitor on. The computer should boot-up and the hard disk drive prompt (usually C :\\) should appear on the screen

  17. Combined promoter haplotypes of the IL10R genes are associated with protection against severe malaria in Gabonese children.

    PubMed

    Velavan, T P; Büyükyazici, Birgül; Kremsner, Peter G; Kun, Jürgen F J

    2012-02-01

    The critical barrier in control of infections remains the failure of the immune system to clear parasites despite antigen recognition. We examined and validated possible association of regulatory immune gene polymorphisms in a cohort of children with mild and severe malaria. We focussed on two precursors of the Interleukin 10 Receptor (IL10R) gene namely the IL10R alpha and IL10R beta that play a fundamental role in initiation of signal transduction. Initial screening across 40 Gabonese adult individuals revealed two promoter variants for the IL10R alpha and three for the IL10R beta precursor, respectively. Validation of these variants for their allelic gene expression by transient transfection assays exhibited an altered expression in rs56356146 and rs7925112 of the IL10R alpha (P < 0.5); rs8178435 and rs999788 in the IL10R beta constructs (P < 0.0001), respectively. We further investigated the functional role of those SNP variants exhibiting altered expression in a cohort of children with mild and severe malaria. We genotyped 145 children with mild and 185 children with severe malaria for IL10R alpha; for IL10R beta, 102 children with mild and 101 children with severe malaria. We found that none of the SNP variants had any significant association neither in children with mild or severe malaria. The haplotype -185/-116 of IL10R alpha (TT) in combination with the haplotype -754/-750 of IL10R beta (AC) contributed towards mild malaria in comparison to severe malaria [TT + AC odds ratio of 0.73 (95% CI 0.56-0.94) P = 0.01]. This study may provide a better understanding on the role of IL10R promoter allelic variants contribution to a protective effect on the development of severe malaria.

  18. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  19. WNT10B functional dualism: beta-catenin/Tcf-dependent growth promotion or independent suppression with deregulated expression in cancer.

    PubMed

    Yoshikawa, Hirohide; Matsubara, Kenichi; Zhou, Xiaoling; Okamura, Shu; Kubo, Takahiko; Murase, Yaeko; Shikauchi, Yuko; Esteller, Manel; Herman, James G; Wei Wang, Xin; Harris, Curtis C

    2007-11-01

    We found aberrant DNA methylation of the WNT10B promoter region in 46% of primary hepatocellular carcinoma (HCC) and 15% of colon cancer samples. Three of 10 HCC and one of two colon cancer cell lines demonstrated low or no expression, and 5-aza-2'deoxycytidine reactivated WNT10B expression with the induction of demethylation, indicating that WNT10B is silenced by DNA methylation in some cancers, whereas WNT10B expression is up-regulated in seven of the 10 HCC cell lines and a colon cancer cell line. These results indicate that WNT10B can be deregulated by either overexpression or silencing in cancer. We found that WNT10B up-regulated beta-catenin/Tcf activity. However, WNT10B-overexpressing cells demonstrated a reduced growth rate and anchorage-independent growth that is independent of the beta-catenin/Tcf activation, because mutant beta-catenin-transduced cells did not suppress growth, and dominant-negative hTcf-4 failed to alleviate the growth suppression by WNT10B. Although WNT10B expression alone inhibits cell growth, it acts synergistically with the fibroblast growth factor (FGF) to stimulate cell growth. WNT10B is bifunctional, one function of which is involved in beta-catenin/Tcf activation, and the other function is related to the down-regulation of cell growth through a different mechanism. We suggest that FGF switches WNT10B from a negative to a positive cell growth regulator.

  20. cis-Acting Elements within the Candida albicans ERG11 Promoter Mediate the Azole Response through Transcription Factor Upc2p▿

    PubMed Central

    Oliver, Brian G.; Song, Jia L.; Choiniere, Jake H.; White, Theodore C.

    2007-01-01

    The azole antifungal drugs are used to treat infections caused by Candida albicans and other fungi. These drugs interfere with the biosynthesis of ergosterol, the major sterol in fungal cells, by inhibiting an ergosterol biosynthetic enzyme, lanosterol 14 α-demethylase, encoded by the ERG11 gene. In vitro, these drugs as well as other ergosterol biosynthesis inhibitors increase ERG11 mRNA expression by activation of the ERG11 promoter. The signal for this activation most likely is the depletion of ergosterol, the end product of the pathway. To identify cis-acting regulatory elements that mediate this activation, ERG11 promoter fragments have been fused to the luciferase reporter gene from Renilla reniformis. Promoter deletions and linker scan mutations localized the region important for azole induction to a segment from bp −224 to −251 upstream of the start codon, specifically two 7-bp sequences separated by 13 bp. These sequences form an imperfect inverted repeat. The region is recognized by the transcription factor Upc2p and functions as an enhancer of transcription, as it can be placed upstream of a heterologous promoter in either direction, resulting in the azole induction of that promoter. The promoter constructs are not azole inducible in the upc2/upc2 homozygous deletion, demonstrating that Upc2p controls the azole induction of ERG11. These results identify an azole-responsive enhancer element (ARE) in the ERG11 promoter that is controlled by the Upc2p transcription factor. No other ARE is present in the promoter. Thus, this ARE and Upc2p are necessary and sufficient for azole induction of ERG11. PMID:17951521

  1. A Preliminary Report on X-Ray Photoabsorption Coefficients andAtomic Scattering Factors for 92 Elements in the 10-10,000 eVRegion

    SciTech Connect

    Henke, B.L.; Davis, J.C.; Gullikson, E.M.; Perera, R.C.C.

    1988-11-01

    Based on currently available photoabsorption measurements and recent theoretical calculations by Doolen and Liberman (Physica Scripta 36, 77 (1987)), a revised (from ADNDT 27, 1 (1982)) best-fit determination of the photoabsorption cross sections is presented here for the elements Z=1 to Z=92 in the 10-10,000 eV range. The photoabsorption data used include those described in the Lockheed and DOE listings of research abstracts for the past ten years and those which have been recently added to the comprehensive NBS Measured Data Base (NBSIR 86-3461, Hubbell et al.). The best-fit curves are compared with both the compilation of measurements and the calculations by Doolen and Liberman. Using the photoabsorption curves, the atomic scattering factors have been calculated for the energy range 50-10,000 eV and are also presented in this report.

  2. Galactose-inducible expression systems in Candida maltosa using promoters of newly-isolated GAL1 and GAL10 genes.

    PubMed

    Park, S M; Ohkuma, M; Masuda, Y; Ohta, A; Takagi, M

    1997-01-01

    The GAL1 and GAL10 gene cluster encoding the enzymes of galactose utilization was isolated from an asporogenic yeast, Candida maltosa. The structure of the gene cluster in which both genes were divergently transcribed from the central promoter region resembled those of some other yeasts. The expression of both genes was strongly induced by galactose and repressed by glucose in the medium. Galactose-inducible expression vectors in C. maltosa were constructed on low- and high-copy number plasmids using the promoter regions of both genes. With these vectors and the beta-galactosidase gene from Kluyveromyces lactis as a reporter, galactose-inducible expression was confirmed. Homologous overexpression of members of the cytochrome P-450 gene family in C. maltosa was also successful by using a high-copy-number vector under the control of these promoters.

  3. Trace elements in striped dolphins (Stenella coeruleoalba) from the Eastern Mediterranean: A 10-years perspective.

    PubMed

    Shoham-Frider, Efrat; Goffman, Oz; Harlavan, Yehudit; Kress, Nurit; Morick, Danny; Roditi-Elasar, Mia; Shefer, Edna; Kerem, Dan

    2016-08-15

    Concentrations of Hg, Se, Cd, Cu, Zn, Fe, Mn and As, in kidney, liver, muscle and blubber from 7 specimens of Stenella coeruleoalba, stranded along the Israeli Mediterranean coast (IMC) from 2006 to 2011 (2011-series) were determined and compared to previous data on S. coeruleoalba from the IMC (2001-series). No differences were observed in essential and toxic elements concentrations, between the two series, except for hepatic Mn which was higher in the latter. Hg/Se molar ratios in blubber, kidney and liver increased linearly with log Hg concentrations, while muscle was more heterogenic in this respect. Means (±SD) of hepatic Hg concentrations (134±89 and 181±200mgkg(-1), from the 2011 and 2001 series, respectively) were similar to that found in 2007-2009 specimens from Spain, possibly reflecting the relatively high natural background levels of mercury in the Mediterranean Sea.

  4. IL10R2 Overexpression Promotes IL22/STAT3 Signaling in Colorectal Carcinogenesis.

    PubMed

    Khare, Vineeta; Paul, Gregor; Movadat, Oliver; Frick, Adrian; Jambrich, Manuela; Krnjic, Anita; Marian, Brigitte; Wrba, Friedrich; Gasche, Christoph

    2015-11-01

    The mucosal immune response in the setting of intestinal inflammation contributes to colorectal cancer. IL10 signaling has a central role in gut homeostasis and is impaired in inflammatory bowel disease (IBD). Out of two IL10 receptor subunits, IL10R1 and IL10R2, the latter is shared among the IL10 family of cytokines and activates STAT signaling. STAT3 is oncogenic in colorectal cancer; however, knowledge about IL10 signaling upstream of STAT3 in colorectal cancer is lacking. Here, expression of IL10 signaling genes was examined in matched pairs from normal and tumor tissue from colorectal cancer patients showing overexpression (mRNA, protein) of IL10R2 and STAT3 but not IL10R1. IL10R2 overexpression was related to microsatellite stability. Transient overexpression of IL10R2 in HT29 cells increased proliferation upon ligand activation (IL10 and IL22). IL22, and not IL10, phosphorylated STAT3 along with increased phosphorylation of AKT and ERK. A significantly higher expression of IL22R1 and IL10R2 was also confirmed in a separate cohort of colorectal cancer samples. IL22 expression was elevated in gut mucosa from patients with IBD and colitis-associated cancer, which also exhibited increased expression of IL22R1 but not its coreceptor IL10R2. Overall, these data indicate that overexpression of IL10R2 and STAT3 contributes to colorectal carcinogenesis in microsatellite-stable tumors through IL22/STAT3 signaling.

  5. Replacement of the human cytomegalovirus promoter with fish enhancer and core elements to control the expression of the G gene of viral haemorrhagic septicemia virus (VHSV).

    PubMed

    Martinez-Lopez, A; Chinchilla, B; Encinas, P; Gomez-Casado, E; Estepa, A; Coll, J M

    2012-12-15

    This work explores some of the possibilities to replace human cytomegalovirus (CMV) core and/or enhancer promoter control elements to create new expression vectors for use with fish. The work is relevant to fish vaccination, since DNA vaccines use eukaryotic expression plasmids controlled by the human cytomegalovirus (CMV) promoter to be effective against novirhabdoviruses, such as viral haemorrhagic septicemia virus (VHSV), one of the most devastating fish viral European diseases. To reduce possible homologous recombination with fish genome, core and enhancer sequences from fish origin, such as trout interferon-inducible myxovirus protein (Mx), zebrafish retrovirus long terminal repeat (LTR) and carp β-actin (AE6), were combined with those of CMV to design alternative hybrid promoters. The substitution of CMV core and/or enhancer with the corresponding elements of Mx or the LTR core maintained a similar in vitro protein G expression level than that obtained by using the CMV promoter. Vectors using the dsRNA-inducible Mx enhancer followed either by the LTR or the AE6 cores showed the highest in vitro protein G expression levels. Furthermore, synthetic constructs using the Mx enhancer maintained their polyI:C induction capabilities despite the core used. Some of these hybrid promoters might contribute to the development of all-fish-vectors for DNA vaccines while others might be useful for more basic studies.

  6. The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

    PubMed

    Gaji, Rajshekhar Y; Howe, Daniel K

    2009-07-01

    The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

  7. An RRM-ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion.

    PubMed

    Collins, Katherine M; Kainov, Yaroslav A; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A; Makeyev, Eugene V; Ramos, Andres

    2017-04-04

    RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1-ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping.

  8. The mutant phenotype associated with P-element alleles of the vestigial locus in Drosophila melanogaster may be caused by a readthrough transcript initiated at the P-element promoter.

    PubMed

    Hodgetts, R B; O'Keefe, S L

    2001-04-01

    We report here the isolation of a new P-element-induced allele of the vestigial locus vg(2a33), the molecular characterization of which allows us to propose a unifying explanation of the phenotypes of the large number of vestigial P-element alleles that now exists. The first P-element allele of vestigial to be isolated was vg(21), which results in a very weak mutant wing phenotype that is suppressed in the P cytotype. By destabilizing vg(2a33) in a dysgenic cross, we isolated the vg(2a33) allele, which exhibits a moderate mutant wing phenotype and is not suppressed by the P cytotype. The new allele is characterized by a 46-bp deletion that removes the 3'-proximal copy of the 11-bp internal repeat from the P element of vg(21). To understand how this subtle difference between the two alleles leads to a rather pronounced difference in their phenotypes, we mapped both the vg and P-element transcription units present in wild type and mutants. Using both 5'-RACE and S1 protection, we found that P-element transcription is initiated 19 bp farther upstream than previously thought. Using primer extension, the start of vg transcription was determined to lie 435 bp upstream of the longest cDNA recovered to date and upstream of the P-element insertion site. Our discovery that the P element is situated within the first vg exon has prompted a reassessment of the large body of genetic data on a series of alleles derived from vg(21). Our current hypothesis to explain the degree of variation in the mutant phenotypes and their response to the P repressor invokes a critical RNA secondary structure in the vg transcript, the formation of which is hindered by a readthrough transcript initiated at the P-element promoter.

  9. FEHMN 1.0: Finite element heat and mass transfer code

    SciTech Connect

    Zyvoloski, G.; Dash, Z.; Kelkar, S.

    1991-04-01

    A computer code is described which can simulate non-isothermal multiphase multicomponent flow in porous media. It is applicable to natural-state studies of geothermal systems and ground-water flow. The equations of heat and mass transfer for multiphase flow in porous and permeable media are solved using the finite element method. The permeability and porosity of the medium are allowed to depend on pressure and temperature. The code also has provisions for movable air and water phases and noncoupled tracers; that is, tracer solutions that do not affect the heat and mass transfer solutions. The tracers can be passive or reactive. The code can simulate two-dimensional, two-dimensional radial, or three-dimensional geometries. A summary of the equations in the model and the numerical solution procedure are provided in this report. A user`s guide and sample problems are also included. The main use of FEHMN will be to assist in the understanding of flow fields in the saturated zone below the proposed Yucca Mountain Repository. 33 refs., 27 figs., 12 tabs.

  10. 5-Aminolaevulinate synthase gene promoter contains two cAMP-response element (CRE)-like sites that confer positive and negative responsiveness to CRE-binding protein (CREB).

    PubMed Central

    Giono, L E; Varone, C L; Cánepa, E T

    2001-01-01

    The first and rate-controlling step of the haem biosynthetic pathway in mammals and fungi is catalysed by the mitochondrial-matrix enzyme 5-aminolaevulinate synthase (ALAS). The purpose of this work was to explore the molecular mechanisms involved in the cAMP regulation of rat housekeeping ALAS gene expression. Thus we have examined the ALAS promoter for putative transcription-factor-binding sites that may regulate transcription in a cAMP-dependent protein kinase (PKA)-induced context. Applying both transient transfection assays with a chloramphenicol acetyltransferase reporter gene driven by progressive ALAS promoter deletions in HepG2, and electrophoresis mobility-shift assays we have identified two putative cAMP-response elements (CREs) at positions -38 and -142. Functional analysis showed that both CRE-like sites were necessary for complete PKA induction, but only one for basal expression. Co-transfection with a CRE-binding protein (CREB) expression vector increased PKA-mediated induction of ALAS promoter transcriptional activity. However, in the absence of co-transfected PKA, CREB worked as a specific repressor for ALAS promoter activity. A CREB mutant deficient in a PKA phosphorylation site was unable to induce expression of the ALAS gene but could inhibit non-stimulated promoter activity. Furthermore, a DNA-binding mutant of CREB did not interfere with ALAS promoter basal activity. Site-directed-mutagenesis studies showed that only the nearest element to the transcription start site was able to inhibit the activity of the promoter. Therefore, we conclude that CREB, through its binding to CRE-like sites, mediates the effect of cAMP on ALAS gene expression. Moreover, we propose that CREB could also act as a repressor of ALAS transcription, but is able to reverse its role after PKA activation. Dephosphorylated CREB would interfere in a spatial-disposition-dependent manner with the transcriptional machinery driving inhibition of gene expression. PMID:11139395

  11. Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene.

    PubMed Central

    Salero, Enrique; Giménez, Cecilio; Zafra, Francisco

    2003-01-01

    We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter. The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library. Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated. Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element. The retarded complexes contained USF1, as deduced from competition and supershift assays. Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50%. Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box. The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells. Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells. These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. PMID:12444925

  12. Spatial distribution and potential sources of trace elements in PM10 monitored in urban and rural sites of Piedmont Region.

    PubMed

    Padoan, Elio; Malandrino, Mery; Giacomino, Agnese; Grosa, Mauro M; Lollobrigida, Francesco; Martini, Sara; Abollino, Ornella

    2016-02-01

    The results on elemental composition of aerosol (PM10) sampled during 2011 in Piedmont region (Italy) are interpreted using meteorological data, Enrichment Factors (EF), chemometric processing by Principal Component Analysis (PCA), Factor Analysis (FA) and Hierarchical Cluster Analysis (HCA). Daily concentrations of about 30 elements were measured using HR-ICP-MS in five monitoring sites. A clear seasonal pattern, with higher concentrations in autumn and winter, was observed, particularly in the urban sites. Levels of As, Cd, Ni and Pb in most of the samples were within the limits imposed by the European legislation. Spatial differences in PM10 and metal concentrations were significant, with rural and urban sites showing different metal patterns, indicating different sources. K and Ca were used, respectively, as marker of biomass burning and industrial marker (cement plant); EFs showed that Ca was enriched just in one area and K was enriched only in the winter period considered and in some stations. Data analysis through PCA, FA and HCA allowed us to identify correlations among the investigated elements and similarities between sampling sites in order to individuate specific emission sources, such as non-exhaust vehicle emission.

  13. DC-Derived IL-10 Modulates Pro-inflammatory Cytokine Production and Promotes Induction of CD4+IL-10+ Regulatory T Cells during Plasmodium yoelii Infection

    PubMed Central

    Loevenich, Katharina; Ueffing, Kristina; Abel, Simone; Hose, Matthias; Matuschewski, Kai; Westendorf, Astrid M.; Buer, Jan; Hansen, Wiebke

    2017-01-01

    The cytokine IL-10 plays a crucial role during malaria infection by counteracting the pro-inflammatory immune response. We and others demonstrated that Plasmodium yoelii infection results in enhanced IL-10 production in CD4+ T cells accompanied by the induction of an immunosuppressive phenotype. However, it is unclear whether this is a direct effect caused by the parasite or an indirect consequence due to T cell activation by IL-10-producing antigen-presenting cells. Here, we demonstrate that CD11c+CD11b+CD8− dendritic cells (DCs) produce elevated levels of IL-10 after P. yoelii infection of BALB/c mice. DC-specific ablation of IL-10 in P. yoelii-infected IL-10flox/flox/CD11c-cre mice resulted in increased IFN-γ and TNF-α production with no effect on MHC-II, CD80, or CD86 expression in CD11c+ DCs. Accordingly, DC-specific ablation of IL-10 exacerbated systemic IFN-γ and IL-12 production without altering P. yoelii blood stage progression. Strikingly, DC-specific inactivation of IL-10 in P. yoelii-infected mice interfered with the induction of IL-10-producing CD4+ T cells while raising the frequency of IFN-γ-secreting CD4+ T cells. These results suggest that P. yoelii infection promotes IL-10 production in DCs, which in turn dampens secretion of pro-inflammatory cytokines and supports the induction of CD4+IL-10+ T cells. PMID:28293237

  14. ADCK4 mutations promote steroid-resistant nephrotic syndrome through CoQ10 biosynthesis disruption

    PubMed Central

    Ashraf, Shazia; Gee, Heon Yung; Woerner, Stephanie; Xie, Letian X.; Vega-Warner, Virginia; Lovric, Svjetlana; Fang, Humphrey; Song, Xuewen; Cattran, Daniel C.; Avila-Casado, Carmen; Paterson, Andrew D.; Nitschké, Patrick; Bole-Feysot, Christine; Cochat, Pierre; Esteve-Rudd, Julian; Haberberger, Birgit; Allen, Susan J.; Zhou, Weibin; Airik, Rannar; Otto, Edgar A.; Barua, Moumita; Al-Hamed, Mohamed H.; Kari, Jameela A.; Evans, Jonathan; Bierzynska, Agnieszka; Saleem, Moin A.; Böckenhauer, Detlef; Kleta, Robert; El Desoky, Sherif; Hacihamdioglu, Duygu O.; Gok, Faysal; Washburn, Joseph; Wiggins, Roger C.; Choi, Murim; Lifton, Richard P.; Levy, Shawn; Han, Zhe; Salviati, Leonardo; Prokisch, Holger; Williams, David S.; Pollak, Martin; Clarke, Catherine F.; Pei, York; Antignac, Corinne; Hildebrandt, Friedhelm

    2013-01-01

    Identification of single-gene causes of steroid-resistant nephrotic syndrome (SRNS) has furthered the understanding of the pathogenesis of this disease. Here, using a combination of homozygosity mapping and whole human exome resequencing, we identified mutations in the aarF domain containing kinase 4 (ADCK4) gene in 15 individuals with SRNS from 8 unrelated families. ADCK4 was highly similar to ADCK3, which has been shown to participate in coenzyme Q10 (CoQ10) biosynthesis. Mutations in ADCK4 resulted in reduced CoQ10 levels and reduced mitochondrial respiratory enzyme activity in cells isolated from individuals with SRNS and transformed lymphoblasts. Knockdown of adck4 in zebrafish and Drosophila recapitulated nephrotic syndrome-associated phenotypes. Furthermore, ADCK4 was expressed in glomerular podocytes and partially localized to podocyte mitochondria and foot processes in rat kidneys and cultured human podocytes. In human podocytes, ADCK4 interacted with members of the CoQ10 biosynthesis pathway, including COQ6, which has been linked with SRNS and COQ7. Knockdown of ADCK4 in podocytes resulted in decreased migration, which was reversed by CoQ10 addition. Interestingly, a patient with SRNS with a homozygous ADCK4 frameshift mutation had partial remission following CoQ10 treatment. These data indicate that individuals with SRNS with mutations in ADCK4 or other genes that participate in CoQ10 biosynthesis may be treatable with CoQ10. PMID:24270420

  15. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation

    PubMed Central

    Zhu, Zhixin; Wang, Hailong; Wang, Yiting; Guan, Shan; Wang, Fang; Tang, Jingyu; Zhang, Ruijuan; Xie, Lulu; Lu, Yingqing

    2015-01-01

    Cellular activities such as compound synthesis often require the transcriptional activation of an entire pathway; however, the molecular mechanisms underlying pathway activation have rarely been explained. Here, the cis regulatory architecture of the anthocyanin pathway genes targeted by the transcription factor (TF) complex including MYB, bHLH, and WDR was systematically analysed in one species and the findings extended to others. In Ipomoea purpurea, the IpMYB1-IpbHLH2-IpWDR1 (IpMBW) complex was found to be orthologous to the PAP1-GL3-TTG1 (AtPGT) complex of Arabidopsis thaliana, and interacted with a 7-bp MYB-recognizing element (MRE) and a 6-bp bHLH-recognizing element (BRE) at the proximal promoter region of the pathway genes. There was little transcription of the gene in the absence of the MRE or BRE. The cis elements identified experimentally converged on two syntaxes, ANCNNCC for MREs and CACN(A/C/T)(G/T) for BREs, and our bioinformatic analysis showed that these were present within anthocyanin gene promoters in at least 35 species, including both gymnosperms and angiosperms. For the anthocyanin pathway, IpMBW and AtPGT recognized the interspecific promoters of both early and later genes. In A. thaliana, the seed-specific TF complex (TT2, TT8, and TTG1) may regulate all the anthocyanin pathway genes, in addition to the proanthocyanidin-specific BAN. When multiple TF complexes in the anthocyanin pathway were compared, the cis architecture played a role larger than the TF complex in determining the variation in promoter activity. Collectively, a cis logic common to the pathway gene promoters was found, and this logic is essential for the trans factors to regulate the pathway. PMID:25911741

  16. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  17. An Instrument to Measure Elemental Energy Spectra of Cosmic Ray Nuclei Up to 10(exp 16) eV

    NASA Technical Reports Server (NTRS)

    Adams, J.; Bashindzhagyan, G.; Chilingarian, A.; Drury, L.; Egorov, N.; Golubkov,S.; Korotkova, N.; Panasyuk, M.; Podorozhnyi, D.; Procqureur, J.

    2000-01-01

    A longstanding goal of cosmic ray research is to measure the elemental energy spectra of cosmic rays up to and through the "knee" (approx. equal to 3 x 10 (exp 15) eV. It is not currently feasible to achieve this goal with an ionization calorimeter because the mass required to be deployed in Earth orbit is very large (at least 50 tonnes). An alternative method will be presented. This is based on measuring the primary particle energy by determining the angular distribution of secondaries produced in a target layer using silicon microstrip detector technology. The proposed technique can be used over a wide range of energies (10 (exp 11)- 10 (exp 16) eV) and gives an energy resolution of 60% or better. Based on this technique, a design for a new lightweight instrument with a large aperture (KLEM) will be described.

  18. A 3.7 kb Fragment of the Mouse Scn10a Gene Promoter Directs Neural Crest But Not Placodal Lineage EGFP Expression in a Transgenic Animal

    PubMed Central

    Lu, Van B.; Ikeda, Stephen R.

    2015-01-01

    Under physiological conditions, the voltage-gated sodium channel Nav1.8 is expressed almost exclusively in primary sensory neurons. The mechanism restricting Nav1.8 expression is not entirely clear, but we have previously described a 3.7 kb fragment of the Scn10a promoter capable of recapitulating the tissue-specific expression of Nav1.8 in transfected neurons and cell lines (Puhl and Ikeda, 2008). To validate these studies in vivo, a transgenic mouse encoding EGFP under the control of this putative sensory neuron specific promoter was generated and characterized in this study. Approximately 45% of dorsal root ganglion neurons of transgenic mice were EGFP-positive (mean diameter = 26.5 μm). The majority of EGFP-positive neurons bound isolectin B4, although a small percentage (∼10%) colabeled with markers of A-fiber neurons. EGFP expression correlated well with the presence of Nav1.8 transcript (95%), Nav1.8-immunoreactivity (70%), and TTX-R INa (100%), although not all Nav1.8-expressing neurons expressed EGFP. Several cranial sensory ganglia originating from neurogenic placodes, such as the nodose ganglion, failed to express EGFP, suggesting that additional regulatory elements dictate Scn10a expression in placodal-derived sensory neurons. EGFP was also detected in discrete brain regions of transgenic mice. Quantitative PCR and Nav1.8-immunoreactivity confirmed Nav1.8 expression in the amygdala, brainstem, globus pallidus, lateral and paraventricular hypothalamus, and olfactory tubercle. TTX-R INa recorded from EGFP-positive hypothalamic neurons demonstrate the usefulness of this transgenic line to study novel roles of Nav1.8 beyond sensory neurons. Overall, Scn10a-EGFP transgenic mice recapitulate the majority of the Nav1.8 expression pattern in neural crest-derived sensory neurons. PMID:25995484

  19. A 3.7 kb fragment of the mouse Scn10a gene promoter directs neural crest but not placodal lineage EGFP expression in a transgenic animal.

    PubMed

    Lu, Van B; Ikeda, Stephen R; Puhl, Henry L

    2015-05-20

    Under physiological conditions, the voltage-gated sodium channel Nav1.8 is expressed almost exclusively in primary sensory neurons. The mechanism restricting Nav1.8 expression is not entirely clear, but we have previously described a 3.7 kb fragment of the Scn10a promoter capable of recapitulating the tissue-specific expression of Nav1.8 in transfected neurons and cell lines (Puhl and Ikeda, 2008). To validate these studies in vivo, a transgenic mouse encoding EGFP under the control of this putative sensory neuron specific promoter was generated and characterized in this study. Approximately 45% of dorsal root ganglion neurons of transgenic mice were EGFP-positive (mean diameter = 26.5 μm). The majority of EGFP-positive neurons bound isolectin B4, although a small percentage (∼10%) colabeled with markers of A-fiber neurons. EGFP expression correlated well with the presence of Nav1.8 transcript (95%), Nav1.8-immunoreactivity (70%), and TTX-R INa (100%), although not all Nav1.8-expressing neurons expressed EGFP. Several cranial sensory ganglia originating from neurogenic placodes, such as the nodose ganglion, failed to express EGFP, suggesting that additional regulatory elements dictate Scn10a expression in placodal-derived sensory neurons. EGFP was also detected in discrete brain regions of transgenic mice. Quantitative PCR and Nav1.8-immunoreactivity confirmed Nav1.8 expression in the amygdala, brainstem, globus pallidus, lateral and paraventricular hypothalamus, and olfactory tubercle. TTX-R INa recorded from EGFP-positive hypothalamic neurons demonstrate the usefulness of this transgenic line to study novel roles of Nav1.8 beyond sensory neurons. Overall, Scn10a-EGFP transgenic mice recapitulate the majority of the Nav1.8 expression pattern in neural crest-derived sensory neurons.

  20. CD226 ligation protects against EAE by promoting IL-10 expression via regulation of CD4+ T cell differentiation

    PubMed Central

    Chen, Kun; Zhang, Chunmei; Song, Chaojun; Fang, Liang; Xu, Zhuwei; Yang, Kun; Jin, Boquan; Wang, Qintao; Chen, Lihua

    2016-01-01

    Treatment targeting CD226 can ameliorate experimental autoimmune encephalomyelitis (EAE), the widely accepted model of MS. However, the mechanisms still need to be elucidated. Here we showed that CD226 blockage by anti-CD226 blocking mAb LeoA1 efficiently promoted IL-10 production in human peripheral blood monocytes (PBMC) or in mixed lymphocyte culture (MLC) system, significantly induced the CD4+IL-10+ T cell differentiation while suppressing the generation of Th1 and Th17. Furthermore, CD226 pAb administration in vivo reduced the onset of EAE in mice by promoting IL-10 production and regulating T cell differentiation. Concomitantly, the onset and severity of EAE were reduced and the serum IL-10 expression levels were increased in CD226 knockout mice than that in control mice when both received EAE induction. These novel findings confirmed that CD226 played a pivotal role in mediating autoimmune diseases such as EAE. Furthermore, to our knowledge, we show for the first time that IL-10 is an important contributor in the inhibitory effects of CD226 ligation on EAE. PMID:26942885

  1. Concentrations and source apportionment of PM10 and associated major and trace elements in the Rhodes Island, Greece.

    PubMed

    Argyropoulos, Georgios; Manoli, Evangelia; Kouras, Athanasios; Samara, Constantini

    2012-08-15

    Ambient concentrations of PM(10) and associated major and trace elements were measured over the cold and the warm season of 2007 at two sites located in the Rhodes Island (Greece), in Eastern Mediterranean, aimed at source apportionment by Chemical Mass Balance (CMB) receptor modeling. Source chemical profiles, necessary in CMB modeling, were obtained for a variety of emission sources that could possibly affect the study area, including sea spray, geological material, soot emissions from the nearby oil-fuelled thermal power plant, and other anthropogenic activities, such as vehicular traffic, residential oil combustion, wood burning, and uncontrolled open-air burning of agricultural biomass and municipal waste. Source apportionment of PM(10) and elemental components was carried out by employing an advanced CMB version, the Robotic Chemical Mass Balance model (RCMB). Vehicular emissions were found to be major PM(10) contributor accounting, on average, for 36.8% and 31.7% during the cold period, and for 40.9% and 39.2% in the warm period at the two sites, respectively. The second largest source of ambient PM(10), with minor seasonal variation, was secondary sulfates (mainly ammonium and calcium sulfates), with total average contribution around 16.5% and 18% at the two sites. Soil dust was also a remarkable source contributing around 22% in the warm period, whereas only around 10% in the cold season. Soot emitted from the thermal power plant was found to be negligible contributor to ambient PM(10) (<1%), however it appeared to appreciably contribute to the ambient V and Ni (11.3% and 5.1%, respectively) at one of the sites during the warm period, when electricity production is intensified. Trajectory analysis did not indicate any transport of Sahara dust; on the contrary, long range transport of soil dust from arid continental regions of Minor Asia and of biomass burning aerosol from the countries surrounding the Black Sea was considered possible.

  2. ICOS promotes IL-17 synthesis in colonic intraepithelial lymphocytes in IL-10−/− mice

    PubMed Central

    Schaefer, Jeremy S.; Montufar-Solis, Dina; Vigneswaran, Nadarajah; Klein, John R.

    2010-01-01

    In the absence of IL-10, colonic inflammation ensues, which is characterized by high levels of IL-17. Here, we demonstrate a direct correlation between ICOS expression and IL-17 production in cIELs. IL-10−/− mice had increased numbers of cIELs and greater colon weight. Although the CD69 early activation antigen was expressed on cIELs from normal and IL-10−/− mice, ICOS was expressed only on cIELs from IL-10−/− mice. IL-17-producing cells in IL-10−/− mice consisted of CD4+ and CD8+ cIELs; however, CD4+ cells were the predominant IL-17-producing cell population. Culture of cIELs from IL-10−/− mice with IL-23 resulted in an increase in ICOS and IL-17 expression, whereas IL-10 suppressed expression of ICOS and IL-17. This occurred in primary cultures and recall stimulation experiments. The ICOS ligand B7RP-1 was up-regulated on colonic epithelial cells and on a population of large granular leukocytes during inflammation. Culture of cIELs with B7RP-1+ DCs enhanced IL-17A production from normal cIELs but failed to do so using cIELs from ICOS−/− mice. In vivo treatment of IL-10−/− mice with antibody to ICOS resulted in a significant reduction in colonic pathology. These findings implicate ICOS as an activational signal of Th17 cells during chronic intestinal inflammation, and they suggest that under some conditions, control of ICOS expression may help to suppress chronic intestinal inflammation. PMID:19889730

  3. Neuronal ADAM10 Promotes Outgrowth of Small-Caliber Myelinated Axons in the Peripheral Nervous System.

    PubMed

    Meyer zu Horste, Gerd; Derksen, Angelika; Stassart, Ruth; Szepanowski, Fabian; Thanos, Melissa; Stettner, Mark; Boettcher, Christina; Lehmann, Helmar C; Hartung, Hans-Peter; Kieseier, Bernd C

    2015-11-01

    The regulation of myelination and axonal outgrowth in the peripheral nervous system is controlled by a complex signaling network involving various signaling pathways. Members of the A Disintegrin And Metalloproteinase (ADAM) family are membrane-anchored proteinases with both proteolytic and disintegrin characteristics that modulate the function of signaling molecules. One family member, ADAM17, is known to influence myelination by cleaving and thus regulating one of the key signals, neuregulin-1, which controls peripheral nervous system myelination. A similar function for ADAM10 had been suggested by previous in vitro studies. Here, we assessed whether ADAM10 exerts a similar function in vivo and deleted ADAM10 in a cell type-specific manner in either neurons or Schwann cells. We found that ADAM10 is not required in either Schwann cells or neurons for normal myelination during development or for remyelination after injury. Instead, ADAM10 is required specifically in neurons for the outgrowth of myelinated small-fiber axons in vitro and after injury in vivo. Thus, we report for the first time a neuron-intrinsic function of ADAM10 in axonal regeneration that is distinct from that of the related protein family member ADAM17 and that may have implications for targeting ADAM function in nervous system diseases.

  4. Measurements of Ultra-Heavy Elements in Solar Energetic Particle Events Above 10 MeV/nucleon

    NASA Astrophysics Data System (ADS)

    Leske, R. A.; Cohen, C. M.; Cummings, A. C.; Mewaldt, R. A.; Stone, E. C.; Wiedenbeck, M. E.; von Rosenvinge, T. T.

    2005-12-01

    Recent measurements from Wind/LEMT and ACE/ULEIS show that abundances of elements heavier than Ni (Z=28) can be enhanced relative to oxygen by factors of ~100 to 1000 (depending on species) in impulsive solar energetic particle (SEP) events at energies below several MeV/nucleon. The Solar Isotope Spectrometer (SIS) on ACE measures the composition of energetic nuclei for elements up to ~Zr (Z=40) at energies from ~10 to >100 MeV/nucleon. At these energies, even large gradual events often are very iron rich and may appear similar in composition to impulsive events, perhaps due to admixtures of flare seed material. Since August 1997, SIS has recorded ~1000 nuclei with Z≥29, including measurable quantities of Zn, Ge and Se (Z=30, 32, and 34). We present observations that establish the potential of extending ultra-heavy SEP measurements up to higher energies in order to test models of acceleration and abundance enhancements in both gradual and impulsive events. We find that the long-term average composition for elements from Z=30 to 40 appears to be similar to standard solar system values above 10 MeV/nucleon, but that there is considerable event-to-event variability. In particular, the event of 23 July 2004 is found to have very large enhancements in ultra-heavy ions at energies >10 MeV/nucleon, with a (34

  5. FBG_SiMul V1.0: Fibre Bragg grating signal simulation tool for finite element method models

    NASA Astrophysics Data System (ADS)

    Pereira, G.; McGugan, M.; Mikkelsen, L. P.

    FBG_SiMul V1.0 is a tool to study and design the implementation of fibre Bragg grating (FBG) sensors solutions in any arbitrary loaded structure or application. The software removes the need for a fibre optic expert user and makes the sensor response of a structural health monitoring solution using FBG sensors more simple and fast. The software uses a modified T-Matrix method to simulate the FBG reflected spectrum based on the stress and strain from a finite element method model. The article describes the theory and algorithm implementation, followed by an empirical validation.

  6. Twenty-one-base-pair insertion polymorphism creates an enhancer element and potentiates SLC6A1 GABA transporter promoter activity

    PubMed Central

    Hirunsatit, Rungnapa; George, Elizabeth D.; Lipska, Barbara K.; Elwafi, Hani M.; Sander, Lisa; Yrigollen, Carolyn M.; Gelernter, Joel; Grigorenko, Elena L.; Lappalainen, Jaakko; Mane, Shrikant; Nairn, Angus C.; Kleinman, Joel E.; Simen, Arthur A.

    2009-01-01

    Objective Sodium-dependent and chloride-dependent γ-aminobutyric acid (GABA) transporter 1 (SLC6A1) is the target of a number of drugs of clinical importance and is a major determinant of synaptic GABA concentrations. We resequenced the human SLC6A1 gene previously and discovered a novel 21 bp insertion in the predicted promoter region that creates a second tandem copy of the sequence. Here we sought to determine the functional relevance of this variation. Methods We used reporter assays, mobility shift assays, quantitative PCR, and proteomics methods as well as postmortem expression analysis for this work. Results Reporter assays showed that the insertion allele significantly increases promoter activity in multiple cell lines. The zinc finger transcription factor ZNF148 was found to significantly transactivate the promoter and increase expression when overexpressed but could not account for the differences in activity between the two alleles of the promoter. Copy number of the insertion sequence was associated with exponentially increasing activity of a downstream promoter, suggesting that the insertion sequence has enhancer activity when present in multiple copies. SLC6A1 promoter genotype was found to predict SLC6A1 RNA expression in human postmortem hippocampal samples. These results suggest that the insertion polymorphism leads to increased SLC6A1 promoter activity because, in part, of creation of an enhancer element when present as multiple copies. Genotyping individuals from Tanzania in this study suggested that the insertion allele has its origin in Africa. Conclusion On account of the effect of the insertion on promoter activity, this relatively common polymorphism may prove useful in predicting clinical response to pharmacological modulators of SLC6A1 as well as GABAergic function in individuals of African descent. PMID:19077666

  7. Association between interleukin-10 gene promoter polymorphisms and susceptibility to liver cirrhosis.

    PubMed

    Yao, Lanjie; Xing, Shuli; Fu, Xueqin; Song, Hongjie; Wang, Zhendong; Tang, Jianrong; Zhao, Yongjing

    2015-01-01

    We conducted a case-control study to investigate the association between three common SNPs in IL-10 gene (rs1800896, rs1800871 and rs1800872) and the development of liver cirrhosis in a Chinese population. Between January 2013 and December 2014, a total of 318 patients with liver cirrhosis and 318 health control subjects were enrolled into our study. The IL-10 rs1800896, rs1800871 and rs1800872 polymorphisms were analyzed using polymerase chain reaction (PCR) coupled with restriction fragment length polymorphism (RFLP). By multivariate logistic regression analysis, we found that individuals with the AA genotype and GA+AA genotype of IL-10 rs1800896 were more likely to have an increased risk of liver cirrhosis when compared with the GG genotype, and the ORs (95% CI) for the AA genotype and GA+AA genotype were 2.04 (1.20-3.50) and 1.41 (1.02-1.96), respectively. We found that the GA+AA genotype of IL-10 rs1800896 had higher risk of liver cirrhosis in individuals with chronic hepatitis B when compared with the GG genotype (OR = 1.95, 95% CI = 1.01-3.59). In conclusion, we found that IL-10 rs1800896 polymorphism was correlated with an increased risk of liver cirrhosis, especially in individuals with chronic hepatitis B.

  8. Promoting a Functional Physical Self-Concept in Physical Education: Evaluation of a 10-Week Intervention

    ERIC Educational Resources Information Center

    Schmidt, Mirko; Valkanover, Stefan; Roebers, Claudia; Conzelmann, Achim

    2013-01-01

    Most physical education intervention studies on the positive effect of sports on self-concept development have attempted to "increase" schoolchildren's self-concept without taking the "veridicality" of the self-concept into account. The present study investigated whether a 10-week intervention in physical education would lead…

  9. Association of the recurrence and canceration rate of vocal leukoplakia with interleukin-10 promoter variants over a 2-year period.

    PubMed

    Zhou, Jian; Zhang, Duo; Zhou, Liang; Yang, Yue; Liu, Fei; Tao, Lei; Lu, Li-Ming

    2016-11-01

    Conclusion This study indicates that IL-10 promoter polymorphism variants, smoking, and alcohol consumption increase the risk of recurrence and canceration in vocal leukoplakia. Objective This prospective, clinical trial was performed to evaluate the association of interleukin (IL)-10 promoter polymorphism variants and canceration and recurrence rates in vocal leukoplakia (a pre-cancerous laryngeal carcinoma lesion) over a 2-year period. Participants and method Sixty-one post-operative patients with vocal leukoplakia were enrolled in this prospective, observational study and genotyped for the IL-10 promoter gene (IL-10-1082 A/G, -819 T/C and -592 A/C) using pyrosequencing, and responded to a 2-year follow-up survey. Recurrence and canceration rates were used to evaluate the association between the genotype variants and the clinical outcome. Results There was an increased canceration rate in the variant genotype group compared to that in the normal genotype group in the 2-year follow-up period (18.4% vs 0%, p-value = 0.038). Compared with the non-smoker group, the smoker group had a higher recurrence rate of vocal leukoplakia (29.3% vs 5%, p-value =0.044). Likewise, the recurrence rate in the alcohol consumption group was also higher (30.6% vs 8%, p-value =0.034). The percentage of cancerization in the alcohol consumption group was significantly higher than that in the non-alcohol consumption group (19.4% vs 0%, p-value =0.035).

  10. Constitutive and carbon source-responsive promoter elements are involved in the regulated expression of the Saccharomyces cerevisiae malate synthase gene MLS1.

    PubMed

    Caspary, F; Hartig, A; Schüller, H J

    1997-08-01

    The malate synthase gene, MLS1, of the yeast Saccharomyces cerevisiae is transcriptionally regulated by the carbon source in the growth medium. A MLS1-lacZ fusion gene, expressed at a basal level in the presence of 2% glucose, is derepressed more than 100-fold under conditions of sugar limitation. No evidence for MLS1 induction by oleic acid was found. By deletion analysis of the MLS1 control region, we identified two sites, UAS1 and UAS2, as important for efficient derepression of the gene. Both sites contain sequences that resemble the previously characterized carbon source-responsive element (CSRE) found in the promoter of the isocitrate lyase gene ICL1. Indeed, UAS1 and UAS2 in the MLS1 upstream region turn out to be functional CSRE sequence variants. This finding allowed us to define a modified version of the CSRE consensus sequence (CCRTYSRNCCG). Protein binding to UAS1MLS1 was observed with extracts from derepressed but not from repressed cells, and could be competed for by an excess of the unlabelled CSRE (ICL1) sequence. No competition was observed with a mutated CSRE variant. Site-directed mutagenesis of both CSREs in the MLS1 promoter reduced gene activation under derepressing conditions to 20% of the wild-type level. The same decrease was observed with the wild-type MLS1 promoter in a cat8 mutant, lacking an activator of CSRE-dependent transcription. The CSRE/Cat8p-independent activation of MLS1 is mediated by constitutive UAS elements. The pleiotropic transcription factor Abf1p, which binds to the MLS1 upstream region, may contribute to constitutive activation. Thus, in order to ensure the severe glucose repression of MLS1 observed, repressor elements that respond to the carbon source must counteract constitutive activation. In summary, ICL1 and MLS1 share common cis-acting elements, although a distinct mechanism of carbon source control also contributes to MLS1 regulation.

  11. DNA hydrolysis promoted by 1,7-dimethyl-1,4,7,10-tetraazacyclododecane.

    PubMed

    Wan, Shu-Hui; Liang, Feng; Xiong, Xiao-Qin; Yang, Li; Wu, Xiao-Jun; Wang, Ping; Zhou, Xiang; Wu, Cheng-Tai

    2006-05-15

    Several acyclic and macrocyclic polyamines were evaluated for their ability to cleave DNA. 1,7-Dimethyl-1,4,7,10-tetraazacyclododecane (DMC) could hydrolyze double-strand DNA at a concentration of 25microM. pH 7.2 was the optimal condition to cleave DNA in the presence of DMC. Supercoiled DNA hydrolytic cleavage by DMC was supported by the evidence from free radical quenching and T4 ligase ligation.

  12. Ephedrine hydrochloride protects mice from LPS challenge by promoting IL-10 secretion and inhibiting proinflammatory cytokines.

    PubMed

    Zheng, Yuejuan; Guo, Ziyi; He, Weigang; Yang, Yang; Li, Yuhu; Zheng, Aoxiang; Li, Ping; Zhang, Yan; Ma, Jinzhu; Wen, Mingyue; Yang, Muyi; An, Huazhang; Ji, Guang; Yu, Yizhi

    2012-05-01

    Sepsis and its derivative endotoxic shock are still serious conditions with high mortality in the intensive care unit. The mechanisms that ensure the balance of proinflammatory cytokines and anti-inflammatory cytokine production are of particular importance. As an active α- and β-adrenergic agonist, ephedrine hydrochloride (EH) is a widely used agent for cardiovascular diseases, especially boosting blood pressure. Here we demonstrate that EH increased Toll-like receptor 4 (TLR4)-mediated production of interleukin 10 (IL-10) through p38 MAPK activation. Simultaneously, EH negatively regulated the production of proinflammatory cytokines. Consistently, EH increased lipopolysaccharide (LPS)-induced serum IL-10 and inhibited tumor necrotic factor-α (TNFα) production in vivo. As a result, EH treatment protected mice from endotoxic shock by lethal LPS challenge. In brief, our data demonstrated that EH could contribute to immune homeostasis by balancing the production of proinflammatory cytokines and anti-inflammatory cytokine in TLR4 signaling. This study provides a potential usage of EH in autoimmunologic diseases or other severe inflammations.

  13. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    PubMed

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-03

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression.

  14. Identification of two novel Rhizoctonia solani-inducible cis-acting elements in the promoter of the maize gene, GRMZM2G315431

    PubMed Central

    Li, Ning; Chen, Jing; Yang, Fangfang; Wei, Shutong; Kong, Lingguang; Ding, Xinhua; Chu, Zhaohui

    2017-01-01

    Plants are continuously exposed to myriad pathogen stresses. However, the molecular mechanisms by which these stress signals are perceived and transduced are poorly understood. In this study, the maize gene GRMZM2G315431 was identified to be highly inducible by Rhizoctonia solani infection, suggesting that the promoter of GRMZM2G315431 (pGRMZM2G315431) might contain a specific cis-acting element responsive to R. solani attack. To identify the R. solani-responsive element in pGRMZM2G315431, a series of binary plant transformation vectors were constructed by fusing pGRMZM2G315431 or its deletion-derivatives with the reporter genes. In the transient gene expression system of Nicotiana benthamiana leaves inoculated with R. solani, GUS quantification suggested that the DNA fragment contains the unknown pathogen-inducible cis-elements in the −1323 to −1212 region. Furthermore, detailed quantitative assays showed that two novel cis-elements, GTTGA in the −1243 to −1239 region and TATTT in the −1232 to −1228 region, were responsible for the R. solani-inducible activity. These two cis-elements were also identified to have R. solani-specific-inducible activity in stable transgenic rice plants, suggesting the existence of a novel regulation mechanism involved in the interaction between R. solani and Zea mays. PMID:28163300

  15. Reduction of TIP30 in esophageal squamous cell carcinoma cells involves promoter methylation and microRNA-10b

    SciTech Connect

    Dong, Wenjie; Shen, Ruizhe; Cheng, Shidan

    2014-10-31

    Highlights: • TIP30 expression is frequently suppressed in ESCC. • TIP30 was hypermethylated in ESCC. • Reduction of TIP30 was significantly correlated with LN metastasis. • miR-10b is a direct regulator of TIP30. - Abstract: TIP30 is a putative tumor suppressor that can promote apoptosis and inhibit angiogenesis. However, the role of TIP30 in esophageal squamous cell carcinoma (ESCC) biology has not been investigated. Immunohistochemistry was used to investigate the expression of TIP30 in 70 ESCC. Hypermethylation of TIP30 was evaluated by the methylation specific PCR (MSP) method in ESCC (tumor and paired adjacent non-tumor tissues). Lost expression of TIP30 was observed in 50 of 70 (71.4%) ESCC. 61.4% (43 of 70) of primary tumors analyzed displayed TIP30 hypermethylation, indicating that this aberrant characteristic is common in ESCC. Moreover, a statistically significant inverse association was found between TIP30 methylation status and expression of the TIP30 protein in tumor tissues (p = 0.001). We also found that microRNA-10b (miR-10b) targets a homologous DNA region in the 3′untranslated region of the TIP30 gene and represses its expression at the transcriptional level. Reporter assay with 3′UTR of TIP30 cloned downstream of the luciferase gene showed reduced luciferase activity in the presence of miR-10b, providing strong evidence that miR-10b is a direct regulator of TIP30. These results suggest that TIP30 expression is regulated by promoter methylation and miR-10b in ESCC.

  16. Thyroid hormones directly activate the expression of the human and mouse uncoupling protein-3 genes through a thyroid response element in the proximal promoter region

    PubMed Central

    2004-01-01

    The transcription of the human UCP3 (uncoupling protein-3) gene in skeletal muscle is tightly regulated by metabolic signals related to fatty acid availability. However, changes in thyroid status also modulate UCP3 gene expression, albeit by unknown mechanisms. We created transgenic mice bearing the entire human UCP3 gene to investigate the effect of thyroid hormones on human UCP3 gene expression. Treatment of human UCP3 transgenic mice with thyroid hormones induced the expression of the human gene in skeletal muscle. In addition, transient transfection experiments demonstrate that thyroid hormones activate the transcription of the human UCP3 gene promoter when MyoD and the TR (thyroid hormone receptor) were co-transfected. The action of thyroid hormones on UCP3 gene transcription is mediated by the binding of the TR to a proximal region in the UCP3 gene promoter that contains a direct repeat structure. An intact DNA sequence of this site is required for thyroid hormone responsiveness and TR binding. Chromatin immunoprecipitation assays revealed that the TR binds this element in vivo. The murine Ucp3 gene promoter was also dependent on MyoD and responsive to thyroid hormone in transient transfection assays. However, it was much less sensitive to thyroid hormone than the human UCP3 promoter. In summary, UCP3 gene transcription is activated by thyroid hormone treatment in vivo, and this activation is mediated by a TRE (thyroid hormone response element) in the proximal promoter region. Such regulation suggests a link between UCP3 gene expression and the effects of thyroid hormone on mitochondrial function in skeletal muscle. PMID:15496137

  17. Long-range DNase I hypersensitivity mapping reveals the imprinted Igf2r and Air promoters share cis-regulatory elements

    PubMed Central

    Pauler, Florian M.; Stricker, Stefan H.; Warczok, Katarzyna E.; Barlow, Denise P.

    2005-01-01

    Epigenetic mechanisms restrict the expression of imprinted genes to one parental allele in diploid cells. At the Igf2r/Air imprinted cluster on mouse chromosome 17, paternal-specific expression of the Air noncoding RNA has been shown to silence three genes in cis: Igf2r, Slc22a2, and Slc22a3. By an unbiased mapping of DNase I hypersensitive sites (DHS) in a 192-kb region flanking Igf2r and Air, we identified 21 DHS, of which nine mapped to evolutionarily conserved sequences. Based on the hypothesis that silencing effects of Air would be directed towards cis regulatory elements used to activate genes, DHS are potential key players in the control of imprinted expression. However, in this 192-kb region only the two DHS mapping to the Igf2r and Air promoters show parental specificity. The remaining 19 DHS were present on both parental alleles and, thus, have the potential to activate Igf2r on the maternal allele and Air on the paternal allele. The possibility that the Igf2r and Air promoters share the same cis-acting regulatory elements, albeit on opposite parental chromosomes, was supported by the similar expression profiles of Igf2r and Air in vivo. These results refine our understanding of the onset of imprinted silencing at this cluster and indicate the Air noncoding RNA may specifically target silencing to the Igf2r promoter. PMID:16204191

  18. All six GC-motifs of the SV40 early upstream element contribute to promoter activity in vivo and in vitro.

    PubMed Central

    Barrera-Saldana, H; Takahashi, K; Vigneron, M; Wildeman, A; Davidson, I; Chambon, P

    1985-01-01

    Recombinants in which the six GC-motifs (I-VI) present in the upstream element of the SV40 early promoter region have been point mutated either individually or in pairs were used to determine the possible contribution of each GC-motif to the function of the overlapping early-early and late-early SV40 promoters. GC-motif I, and to a lesser extent, GC-motifs II and III, are critical for initiation at the early-early start sites. GC-motifs IV-VI play a subsidiary role. Mutations in GC-motifs I and II do not decrease the activity of the late-early promoter, whereas mutations in the GC-motifs III-VI have a moderate effect on it. The in vivo phenotype of the GC-motif mutants can be almost fully reproduced in vitro using a nuclear extract. DNase I protection footprinting experiments using wild-type or mutated templates and nuclear extracts indicate that each GC-motif behaves principally as an independent protein-binding site, presumably for transcription factor Sp1. The effect of changing the position of the 21-bp repeat region on initiation from the early-early and late-early start sites indicates that there is little flexibility in the position in which this upstream element can efficiently activate initiation of transcription from these start sites. Images Fig. 3. Fig. 4. Fig. 7. Fig. 8. Fig. 9. PMID:3004974

  19. The Ewing sarcoma protein (EWS) binds directly to the proximal elements of the macrophage-specific promoter of the CSF-1 receptor (csf1r) gene.

    PubMed

    Hume, David A; Sasmono, Tedjo; Himes, S Roy; Sharma, Sudarshana M; Bronisz, Agnieszka; Constantin, Myrna; Ostrowski, Michael C; Ross, Ian L

    2008-05-15

    Many macrophage-specific promoters lack classical transcriptional start site elements such as TATA boxes and Sp1 sites. One example is the CSF-1 receptor (CSF-1R, CD115, c-fms), which is used as a model of the transcriptional regulation of macrophage genes. To understand the molecular basis of start site recognition in this gene, we identified cellular proteins binding specifically to the transcriptional start site (TSS) region. The mouse and human csf1r TSS were identified using cap analysis gene expression (CAGE) data. Conserved elements flanking the TSS cluster were analyzed using EMSAs to identify discrete DNA-binding factors in primary bone marrow macrophages as candidate transcriptional regulators. Two complexes were identified that bind in a highly sequence-specific manner to the mouse and human TSS proximal region and also to high-affinity sites recognized by myeloid zinc finger protein 1 (Mzf1). The murine proteins were purified by DNA affinity isolation from the RAW264.7 macrophage cell line and identified by mass spectrometry as EWS and FUS/TLS, closely related DNA and RNA-binding proteins. Chromatin immunoprecipitation experiments in bone marrow macrophages confirmed that EWS, but not FUS/TLS, was present in vivo on the CSF-1R proximal promoter in unstimulated primary macrophages. Transfection assays suggest that EWS does not act as a conventional transcriptional activator or repressor. We hypothesize that EWS contributes to start site recognition in TATA-less mammalian promoters.

  20. The use of olive-mill waste compost to promote the plant vegetation cover in a trace-element-contaminated soil.

    PubMed

    Pardo, Tania; Martínez-Fernández, Domingo; Clemente, Rafael; Walker, David J; Bernal, M Pilar

    2014-01-01

    The applicability of a mature compost as a soil amendment to promote the growth of native species for the phytorestoration of a mine-affected soil from a semi-arid area (SE Spain), contaminated with trace elements (As, Cd, Cu, Mn, Pb and Zn), was evaluated in a 2-year field experiment. The effects of an inorganic fertiliser were also determined for comparison. Bituminaria bituminosa was the selected native plant since it is a leguminous species adapted to the particular local pedoclimatic conditions. Compost addition increased total organic-C concentrations in soil with respect to the control and fertiliser treatments, maintained elevated available P concentrations throughout the duration of the experiment and stimulated soil microbial biomass, while trace elements extractability in the soil was rather low due to the calcareous nature of the soil and almost unaltered in the different treatments. Tissue concentrations of P and K in B. bituminosa increased after the addition of compost, associated with growth stimulation. Leaf Cu concentration was also increased by the amendments, although overall the trace elements concentrations can be considered non-toxic. In addition, the spontaneous colonisation of the plots by a total of 29 species of 15 different families at the end of the experiment produced a greater vegetation cover, especially in plots amended with compost. Therefore, the use of compost as a soil amendment appears to be useful for the promotion of a vegetation cover and the phytostabilisation of moderately contaminated soils under semi-arid conditions.

  1. TspanC8 tetraspanins regulate ADAM10/Kuzbanian trafficking and promote Notch activation in flies and mammals

    PubMed Central

    Dornier, Emmanuel; Coumailleau, Franck; Ottavi, Jean-François; Moretti, Julien; Boucheix, Claude; Mauduit, Philippe

    2012-01-01

    The metalloprotease ADAM10/Kuzbanian catalyzes the ligand-dependent ectodomain shedding of Notch receptors and activates Notch. Here, we show that the human tetraspanins of the evolutionary conserved TspanC8 subfamily (Tspan5, Tspan10, Tspan14, Tspan15, Tspan17, and Tspan33) directly interact with ADAM10, regulate its exit from the endoplasmic reticulum, and that four of them regulate ADAM10 surface expression levels. In an independent RNAi screen in Drosophila, two TspanC8 genes were identified as Notch regulators. Functional analysis of the three Drosophila TspanC8 genes (Tsp3A, Tsp86D, and Tsp26D) indicated that these genes act redundantly to promote Notch signaling. During oogenesis, TspanC8 genes were up-regulated in border cells and regulated Kuzbanian distribution, Notch activity, and cell migration. Furthermore, the human TspanC8 tetraspanins Tspan5 and Tspan14 positively regulated ligand-induced ADAM10-dependent Notch1 signaling. We conclude that TspanC8 tetraspanins have a conserved function in the regulation of ADAM10 trafficking and activity, thereby positively regulating Notch receptor activation. PMID:23091066

  2. Recognition of distinct HLA-DQA1 promoter elements by a single nuclear factor containing Jun and Fos or antigenically related proteins.

    PubMed Central

    Neve Ombra, M; Autiero, M; DeLerma Barbaro, A; Barretta, R; Del Pozzo, G; Guardiola, J

    1993-01-01

    The activity of MHC class II promoters depends upon conserved regulatory signals one of which, the extended X-box, contains in its X2 subregion a sequence related to the cAMP response element, CRE and to the TPA response element, TRE. Accordingly, X2 is recognized by the AP-1 factor and by other c-Jun or c-Fos containing heterodimers. We report that the X-box dependent promoter activity of the HLA-DQA1 gene is down-modulated by an array of DNA elements each of which represented twice either in an invertedly or directly repeated orientation. In this frame, we describe a nuclear binding factor, namely DBF, promiscuously interacting with two of these additional signals, delta and sigma, and with a portion of the X-box, namely the X-core, devoid of X2. The presence of a single factor recognizing divergent DNA sequences was indicated by the finding that these activities were co-eluted from a heparin-Sepharose column and from DNA affinity columns carrying different DNA binding sites as ligands. Competition experiments made with oligonucleotides representing wild type and mutant DNA elements showed that each DNA element specifically inhibited the binding of the others, supporting the contention that DBF is involved in recognition of different targets. Furthermore, we found that DBF also exhibits CRE/TRE binding activity and that this activity can be competed out by addition of an excess of sigma, delta and X-core oligonucleotides. Anti-Jun peptide and anti-Fos peptide antibodies blocked not only the binding activity of DBF, but also its X-core and sigma binding; this blockade was removed by the addition of the Jun or Fos peptides against which the antibodies had been raised. In vitro synthesized Jun/Fos was able to bind to all these boxes, albeit with seemingly different affinities. The cooperativity of DBF interactions may explain the modulation of the X-box dependent promoter activity mediated by the accessory DNA elements described here. Images PMID:8493100

  3. Origin of trace elements and inorganic ions in PM 10 aerosols to the South of Mexico City

    NASA Astrophysics Data System (ADS)

    Báez, P. A.; García, M. R.; Torres, B. M. del C.; Padilla, H. G.; Belmont, R. D.; Amador, O. M.; Villalobos-Pietrini, R.

    2007-07-01

    Measurements of trace metals and inorganic ions were carried out on PM 10 aerosols. Sampling was made in the southern section of downtown Mexico City. Samples were collected with an Andersen PM 10 high volume sampler, on glass fiber filters. The ions SO 42-, NO 3-, Cl -, and NH 4+ were analyzed by ion chromatography, Na +, K +, Ca 2+ and Mg 2+ by flame atomic absorption spectroscopy and the trace metals using an atomic absorption spectrometer with a graphite furnace attachment. The results indicated that SO 42- was the most abundant ion, and with respect to trace metals, Pb had the highest concentration in spite of the fact that lead tetraethyl content in gasoline is prohibited by Mexican Federal Law. Pearson's correlation, applied to all data, showed a high correlation among SO 42-, NO 3- and NH 4+, indicating a common anthropogenic origin. In addition the correlation found between Na + and K + indicated a crustal origin. No correlation among the trace metals was found. The scatter plots showed a high neutralization of SO 42- and NO 3- by NH 4+, (NH 4) 2SO 4 and NH 4NO 3 were the major species formed. Enrichment factors were calculated using K as a reference and the results reflected the possible origins of the elements: crustal or anthropogenic. In order to gain a better insight into the origin of trace metals and major inorganic ions, a Principal Component Analysis was applied to the results for 10 elements and 4 ions, for the years 2003 and 2004. Sources of anthropogenic species, such as industries and vehicles are discussed.

  4. Source apportionment of PM10, organic carbon and elemental carbon at Swiss sites: an intercomparison of different approaches.

    PubMed

    Gianini, M F D; Piot, C; Herich, H; Besombes, J-L; Jaffrezo, J-L; Hueglin, C

    2013-06-01

    In this study, the results of source apportionment of particulate matter (PM10), organic carbon (OC), and elemental carbon (EC) - as obtained through different approaches at different types of sites (urban background, urban roadside, and two rural sites in Switzerland) - are compared. The methods included in this intercomparison are positive matrix factorisation modelling (PMF, applied to chemical composition data including trace elements, inorganic ions, OC, and EC), molecular marker chemical mass balance modelling (MM-CMB), and the aethalometer model (AeM). At all sites, the agreement of the obtained source contributions was reasonable for OC, EC, and PM10. Based on an annual average, and at most of the considered sites, secondary organic carbon (SOC) is the component with the largest contribution to total OC; the most important primary source of OC is wood combustion, followed by road traffic. Secondary aerosols predominate in PM10. All considered techniques identified road traffic as the dominant source of EC, while wood combustion emissions are of minor importance for this constituent. The intercomparison of different source apportionment approaches is helpful to identify the strengths and the weaknesses of the different methods. Application of PMF has limitations when source emissions have a strong temporal correlation, or when meteorology has a strong impact on PM variability. In these cases, the use of PMF can result in mixed source profiles and consequently in the under- or overestimation of the real-world sources. The application of CMB models can be hampered by the unavailability of source profiles and the non-representativeness of the available profiles for local source emissions. This study also underlines that chemical transformations of molecular markers in the atmosphere can lead to the underestimation of contributions from primary sources, in particular during the summer period or when emission sources are far away from the receptor sites.

  5. Phosphorus-Based Dendrimer ABP Treats Neuroinflammation by Promoting IL-10-Producing CD4(+) T Cells.

    PubMed

    Hayder, Myriam; Varilh, Marjorie; Turrin, Cédric-Olivier; Saoudi, Abdelhadi; Caminade, Anne-Marie; Poupot, Rémy; Liblau, Roland S

    2015-11-09

    Dendrimers are polyfunctional nano-objects of perfectly defined structure that can provide innovative alternatives for the treatment of chronic inflammatory diseases, including multiple sclerosis (MS). To investigate the efficiency of a recently described amino-bis(methylene phosphonate)-capped ABP dendrimer as a potential drug candidate for MS, we used the classical mouse model of MOG35-55-induced experimental autoimmune encephalomyelitis (EAE). Our study provides evidence that the ABP dendrimer prevents the development of EAE and inhibits the progression of established disease with a comparable therapeutic benefit as the approved treatment Fingolimod. We also show that the ABP dendrimer redirects the pathogenic myelin-specific CD4(+) T cell response toward IL-10 production.

  6. Cis-element of the rice PDIL2-3 promoter is responsible for inducing the endoplasmic reticulum stress response.

    PubMed

    Takahashi, Hideyuki; Wang, Shuyi; Hayashi, Shimpei; Wakasa, Yuhya; Takaiwa, Fumio

    2014-05-01

    A protein disulfide isomerase (PDI) family oxidoreductase, PDIL2-3, is involved in endoplasmic reticulum (ER) stress responses in rice. We identified a critical cis-element required for induction of the ER stress response. The activation of PDIL2-3 in response to ER stress strongly depends on the IRE1-OsbZIP50 signaling pathway.

  7. Novel core promoter elements in the oomycete pathogen Phytophthora infestans and their influence on expression detected by genome-wide analysis

    PubMed Central

    2013-01-01

    Background The core promoter is the region flanking the transcription start site (TSS) that directs formation of the pre-initiation complex. Core promoters have been studied intensively in mammals and yeast, but not in more diverse eukaryotes. Here we investigate core promoters in oomycetes, a group within the Stramenopile kingdom that includes important plant and animal pathogens. Prior studies of a small collection of genes proposed that oomycete core promoters contain a 16 to 19 nt motif bearing an Initiator-like sequence (INR) flanked by a novel sequence named FPR, but this has not been extended to whole-genome analysis. Results We used expectation maximization to find over-represented motifs near TSSs of Phytophthora infestans, the potato blight pathogen. The motifs corresponded to INR, FPR, and a new element found about 25 nt downstream of the TSS called DPEP. TATA boxes were not detected. Assays of DPEP function by mutagenesis were consistent with its role as a core motif. Genome-wide searches found a well-conserved combined INR+FPR in only about 13% of genes after correcting for false discovery, which contradicted prior reports that INR and FPR are found together in most genes. INR or FPR were found alone near TSSs in 18% and 7% of genes, respectively. Promoters lacking the motifs had pyrimidine-rich regions near the TSS. The combined INR+FPR motif was linked to higher than average mRNA levels, developmentally-regulated transcription, and functions related to plant infection, while DPEP and FPR were over-represented in constitutively-expressed genes. The INR, FPR, and combined INR+FPR motifs were detected in other oomycetes including Hyaloperonospora arabidopsidis, Phytophthora sojae, Pythium ultimum, and Saprolegnia parasitica, while DPEP was found in all but S. parasitica. Only INR seemed present in a non-oomycete stramenopile. Conclusions The absence of a TATA box and presence of novel motifs show that the oomycete core promoter is diverged from that of

  8. CCM3/PDCD10 stabilizes GCKIII proteins to promote Golgi assembly and cell orientation.

    PubMed

    Fidalgo, Miguel; Fraile, María; Pires, Ana; Force, Thomas; Pombo, Celia; Zalvide, Juan

    2010-04-15

    Mutations in CCM3/PDCD10 result in cerebral cavernous malformations (CCMs), a major cause of cerebral hemorrhage. Despite intense interest in CCMs, very little is known about the function of CCM3. Here, we report that CCM3 is located on the Golgi apparatus, forming a complex with proteins of the germinal center kinase III (GCKIII) family and GM130, a Golgi-resident protein. Cells depleted of CCM3 show a disassembled Golgi apparatus. Furthermore, in wound-healing assays, CCM3-depleted cells cannot reorient the Golgi and centrosome properly, and demonstrate impaired migration. Golgi disassembly after either depletion of CCM3 or dissociation of CCM3 from the GM130-GCKIII complex is the result of destabilization of GCKIII proteins and dephosphorylation of their substrate, 14-3-3zeta. Significantly, the phenotype induced by CCM3 depletion can be reverted by expression of wild-type CCM3, but not by disease-associated mutants. Our findings suggest that Golgi dysfunction and the ensuing abnormalities of cell orientation and migration resulting from CCM3 mutations contribute to CCM pathogenesis.

  9. Multiple E-Boxes in the Distal Promoter of the Rat Pyruvate Carboxylase Gene Function as a Glucose-Responsive Element

    PubMed Central

    Muangsawat, Sureeporn; Boonsaen, Thirajit; MacDonald, Michael J.; Jitrapakdee, Sarawut

    2014-01-01

    Pyruvate carboxylase (PC) is an anaplerotic enzyme that regulates glucose-induced insulin secretion in pancreatic islets. Dysregulation of its expression is associated with type 2 diabetes. Herein we describe the molecular mechanism underlying the glucose-mediated transcriptional regulation of the PC gene. Incubation of the rat insulin cell line INS-1 832/13 with glucose resulted in a 2-fold increase in PC mRNA expression. Transient transfections of the rat PC promoter-luciferase reporter construct in the above cell line combined with mutational analysis indicated that the rat PC gene promoter contains the glucose-responsive element (GRE), comprising three canonical E-boxes (E1, E3 and E4) and one E-box-like element (E2) clustering between nucleotides –546 and –399, upstream of the transcription start site. Mutation of any of these E-boxes resulted in a marked reduction of glucose-mediated transcriptional induction of the reporter gene. Electrophoretic mobility shift assays revealed that the upstream stimulatory factors 1 and 2 (USF1 and USF2) bind to E1, the Specificity Protein-1 (Sp1) binds to E2, USF2 and the carbohydrate responsive element binding protein (ChREBP) binds to E4, while unknown factors binds to E3. High glucose promotes the recruitment of Sp1 to E2 and, USF2 and ChREBP to E4. Silencing the expression of Sp1, USF2 and ChREBP by their respective siRNAs in INS-1 832/13 cells blunted glucose-induced expression of endogenous PC. We conclude that the glucose-mediated transcriptional activation of the rat PC gene is regulated by at least these three transcription factors. PMID:25054881

  10. STAT5a promotes the transcription of mature mmu-miR-135a in 3T3-L1 cells by binding to both miR-135a-1 and miR-135a-2 promoter elements.

    PubMed

    Wei, Xiajie; Cheng, Xiaoyan; Peng, Yongdong; Zheng, Rong; Chai, Jin; Jiang, Siwen

    2016-08-01

    Despite extensive research on the role of miR-135a in biological processes, very little attention has been paid to the regulation of its transcription. We have previously reported that miR-135a suppresses 3T3-L1 preadipocyte differentiation and adipogenesis by directly targeting the adenomatous polyposis coli (APC) gene and activating the canonical Wnt/β-catenin signaling pathway, but the regulatory elements that regulate the expression of the two isoforms of miR-135a (miR-135a-1 and miR-135a-2) remain poorly understood. Here, by using deletion analysis, we predicted two binding sites (-874/-856 and -2020/-2002) for the transcription factor Signal Transducers and Activators of Transcription 5a (STAT5a) within the core promoters of miR-135a-1 and miR-135a-2 (-1128/-556 and -2264/-1773), and the subsequent site-directed mutagenesis indicated that the two STAT5a binding sites regulated the activity of the miR-135a-1 and miR-135a-2 promoters. The binding of STAT5a to the miR-135a-1/2 core promoters in vitro and in cell culture was identified by electrophoretic mobility shift assays (EMSA) and chromatin immunoprecipitation (ChIP) assays. Overexpression and RNAi knockdown of STAT5a showed that the transcription factor regulated the endogenous miR-135a expression. Additionally, The expression time frame of STAT5a and APC indicated a potential negative feedback between them. In sum, the overall results from this study indicate that STAT5a regulates miR-135a transcription by binding to both miR-135a-1 and miR135a-2 promoter elements and the findings provide novel insights into the molecular regulatory mechanisms of miR-135a during adipogenesis.

  11. Lentiviral MGMT(P140K)-mediated in vivo selection employing a ubiquitous chromatin opening element (A2UCOE) linked to a cellular promoter.

    PubMed

    Phaltane, Ruhi; Lachmann, Nico; Brennig, Sebastian; Ackermann, Mania; Modlich, Ute; Moritz, Thomas

    2014-08-01

    Notwithstanding recent successes, insertional mutagenesis as well as silencing and variegation of transgene expression still represent considerable obstacles to hematopoietic gene therapy. This also applies to O(6)-methylguanine DNA methyltransferase (MGMT)-mediated myeloprotection, a concept recently proven clinically effective in the context of glioblastoma therapy. To improve on this situation we here evaluate a SIN-lentiviral vector expressing the MGMT(P140K)-cDNA from a combined A2UCOE/PGK-promoter. In a murine in vivo chemoselection model the A2UCOE.PGK.MGMT construct allowed for significant myeloprotection as well as robust and stable selection of transgenic hematopoietic cells. In contrast, only transient enrichment and severe myelotoxicity was observed for a PGK.MGMT control vector. Selection of A2UCOE.PGK.MGMT-transduced myeloid and lymphoid mature and progenitor cells was demonstrated in the peripheral blood, bone marrow, spleen, and thymus. Unlike the PGK and SFFV promoters used as controls, the A2UCOE.PGK promoter allowed for sustained vector copy number-related transgene expression throughout the experiment indicating an increased resistance to silencing, which was further confirmed by CpG methylation studies of the PGK promoter. Thus, our data support a potential role of the A2UCOE.PGK.MGMT-vector in future MGMT-based myeloprotection and chemoselection strategies, and underlines the suitability of the A2UCOE element to stabilize lentiviral transgene expression in hematopoietic gene therapy.

  12. A promoter element with enhancer properties, and the orphan nuclear receptor RORalpha, are required for Purkinje cell-specific expression of a Gi/o modulator.

    PubMed

    Serinagaoglu, Yelda; Zhang, Rui; Zhang, Yufang; Zhang, Linda; Hartt, Greg; Young, Anthony P; Oberdick, John

    2007-03-01

    The promoter and structural portion of the gene, Pcp-2(L7), has frequently been used to target expression of proteins to cerebellar Purkinje cells. In our continuing analysis of the transcription of this gene and how it relates to the G-protein and Ca2+ channel modulatory functions of the encoded protein, we have dissociated the promoter and structural gene and identified cooperative functions. A 0.9 kb fragment of the proximal promoter has positional properties of a classical enhancer, yet its function requires the presence of the structural gene. We demonstrate that RORalpha, the gene product of the mutant mouse locus called staggerer (Rora(sg)), binds to and activates expression through this promoter element using functional assays in vitro and in vivo. The structural gene has a repressive effect on gene expression outside Purkinje cells, and likely participates in the suppression of Pcp-2(L7) gene expression in the many other brain and non-neuronal cell types, besides Purkinje cells, known to express RORalpha. Additional studies in vivo show that while Pcp-2(L7) expression is dependent on RORalpha throughout the cerebellum, this dependence is greatest in the intermediate region between the vermis and far lateral hemispheres. Thus, in addition to its recently indicated role in Ca2+-mediated reciprocal cell-cell signaling in Purkinje cells, RORalpha may also contribute to functional differences in cerebellar subregions.

  13. Sclerostin expression is induced by BMPs in human Saos-2 osteosarcoma cells but not via direct effects on the sclerostin gene promoter or ECR5 element.

    PubMed

    Yu, Longchuan; van der Valk, Marissa; Cao, Jin; Han, Chun-Ya E; Juan, Todd; Bass, Michael B; Deshpande, Chetan; Damore, Michael A; Stanton, Richard; Babij, Philip

    2011-12-01

    Sclerostin is a secreted inhibitor of Wnt signaling and plays an essential role in the regulation of bone mass. The expression of sclerostin is largely restricted to osteocytes although its mode of transcriptional regulation is not well understood. We observed regulated expression of sclerostin mRNA and protein that was directly correlated with the mineralization response in cultured human Saos-2 osteosarcoma cells and rat primary calvarial cells. Sclerostin mRNA and protein levels were increased following treatment of cells with BMP2, BMP4 and BMP7. Analysis of deletion mutants from the -7.4 kb upstream region of the human sclerostin promoter did not reveal any specific regions that were responsive to BMPs, Wnt3a, PTH, TGFβ1 or Activin A in Saos-2 cells. The downstream ECR5 element did not show enhancer activity in Saos-2 cells and also was not affected when Saos-2 cells were treated with BMPs or PTH. Genome-wide microarray analysis of Saos-2 cells treated with BMP2 showed significant changes in expression of several transcription factors with putative consensus DNA binding sites in the region of the sclerostin promoter. However, whereas most factors tested showed either a range of inhibitory activity (DLX family, MSX2, HEY1, SMAD6/7) or lack of activity on the sclerostin promoter including SMAD9, only MEF2B showed a positive effect on both the promoter and ECR5 element. These results suggest that the dramatic induction of sclerostin gene expression by BMPs in Saos-2 cells occurs indirectly and is associated with late stage differentiation of osteoblasts and the mineralization process.

  14. An unexpected, conserved element of the U3 snoRNA is required for Mpp10p association.

    PubMed Central

    Wormsley, S; Samarsky, D A; Fournier, M J; Baserga, S J

    2001-01-01

    The U3 small nucleolar ribonucleoprotein (snoRNP) is composed of a small nucleolar RNA (snoRNA) and at least 10 proteins. The U3 snoRNA base pairs with the pre-rRNA to carry out the A0, A1, and A2 processing reactions that lead to the release of the 18S rRNA from the nascent pre-rRNA transcript. The yeast U3 snoRNA can be divided into a short 5' domain (nt 1-39) and a larger 3' domain (73 to the 3' end) separated by a stretch of nucleotides called the hinge region (nt 40-72). The sequences required for pre-rRNA base pairing are found in the 5' domain and hinge region whereas the 3' domain is largely covered with proteins. Mpp10p, one of the protein components unique to the U3 snoRNP, plays a role in processing at the A1 and A2 sites. Because of its critical role in U3 snoRNP function, we determined which sequences in the U3 snoRNA are required for Mpp10p association. Unlike fibrillarin and all the previous U3 snoRNP components studied in this manner, sequences in the 3' domain are not sufficient for Mpp10p association. Instead, a conserved sequence element in the U3 snoRNA hinge region is required, placing Mpp10p near the 5' domain that carries out the pre-rRNA base-pairing interactions in the functional center of the U3 snoRNP. PMID:11421365

  15. Transgenic analysis of the thyroid-responsive elements in the alpha-cardiac myosin heavy chain gene promoter.

    PubMed

    Subramaniam, A; Gulick, J; Neumann, J; Knotts, S; Robbins, J

    1993-02-25

    The role of two putative, cis-acting thyroid hormone-responsive elements, TRE1 and TRE2, located at -129 to -149 and -102 to -120, respectively, on the murine alpha-myosin heavy chain (MHC) gene, has been investigated in transgenic mice. These motifs are present in a 4.5-kilobase fragment lying upstream of the transcriptional start site of the mouse alpha-MHC gene: this fragment directs appropriate expression of a reporter gene in transgenic mice (Subramaniam, A., Jones, W. K., Gulick, J., Wert, S., Neumann, J., and Robbins, J. (1991) J. Biol. Chem. 266, 24613-24620). Here, we independently mutate the TRE1 and TRE2 elements by base substitution. The mice were analyzed for transgene expression in different muscle and non-muscle tissues including the atria and ventricles. Normal levels of transgene expression were observed in euthyroid mice carrying a mutation in TRE1. In contrast to these results, mice in which TRE2 was mutated showed reduced levels of CAT activity in both the atria and ventricles, suggesting a previously undefined role for this element in the constitutive up-regulation of the alpha-MHC gene. In hypothyroid mice carrying either of these mutations, the complete cessation of ventricular expression of the chloramphenicol acetyltransferase transcripts that takes place in the alpha-5.5 (wild type) animals did not occur.

  16. A novel PR10 promoter from Erianthus arundinaceus directs high constitutive transgene expression and is enhanced upon wounding in heterologous plant systems.

    PubMed

    Chakravarthi, M; Syamaladevi, Divya P; Harunipriya, P; Augustine, Sruthy Maria; Subramonian, N

    2016-01-01

    In genetic engineering, inducible promoters play an important role as the expression of genes driven by them can be turned on or off under situations like biotic or abiotic factors. There are few reports on inducible promoters that can be employed in the development of transgenic plants, particularly in sugarcane. In the present study, four wound inducible genes (Chitinase, PR1A, PR10 and HRGP) were selected and were amplified from Erianthus arundinaceus, a distant relative of sugarcane. In order to determine the gene that is highly induced upon wounding, RT-qPCR was performed, which showed that PR10 gene expression was instantaneous and higher upon wounding when compared to the other three genes. Using the random amplification of genomic ends technique, a 592 bp promoter sequence was obtained and in silico analysis of the upstream regulatory region revealed a 469 bp promoter and 123 bp of 5' untranslated region (UTR). Functional analyses of the promoter sequence (with and without 5' UTR) in tobacco, rice and sugarcane using β-glucuronidase (GUS) as the reporter gene revealed the constitutive and inducible nature of the PR10 promoter. Our studies have demonstrated that the PR10 promoter, though highly constitutive, was quickly induced upon wounding as well as on treatment with abscisic acid and methyl jasmonate hormones. This is the first report on the isolation and characterization of a PR10 promoter from a wild grass and is expected to have application for development of transgenic plants.

  17. Inferring regulatory elements from a whole genome. An analysis of Helicobacter pylori sigma(80) family of promoter signals.

    PubMed

    Vanet, A; Marsan, L; Labigne, A; Sagot, M F

    2000-03-24

    Helicobacter pylori is adapted to life in a unique niche, the gastric epithelium of primates. Its promoters may therefore be different from those of other bacteria. Here, we determine motifs possibly involved in the recognition of such promoter sequences by the RNA polymerase using a new motif identification method. An important feature of this method is that the motifs are sought with the least possible assumptions about what they may look like. The method starts by considering the whole genome of H. pylori and attempts to infer directly from it a description for a family of promoters. Thus, this approach differs from searching for such promoters with a previously established description. The two algorithms are based on the idea of inferring motifs by flexibly comparing words in the sequences with an external object, instead of between themselves. The first algorithm infers single motifs, the second a combination of two motifs separated from one another by strictly defined, sterically constrained distances. Besides independently finding motifs known to be present in other bacteria, such as the Shine-Dalgarno sequence and the TATA-box, this approach suggests the existence in H. pylori of a new, combined motif, TTAAGC, followed optimally 21 bp downstream by TATAAT. Between these two motifs, there is in some cases another, TTTTAA or, less frequently, a repetition of TTAAGC separated optimally from the TATA-box by 12 bp. The combined motif TTAAGCx(21+/-2)TATAAT is present with no errors immediately upstream from the only two copies of the ribosomal 23 S-5 S RNA genes in H. pylori, and with one error upstream from the only two copies of the ribosomal 16 S RNA genes. The operons of both ribosomal RNA molecules are strongly expressed, representing an encouraging sign of the pertinence of the motifs found by the algorithms. In 25 cases out of a possible 30, the combined motif is found with no more than three substitutions immediately upstream from ribosomal proteins, or

  18. ADAM-10-Mediated N-cadherin Cleavage is Protein Kinase C-α–Dependent and Promotes Glioblastoma Cell Migration

    PubMed Central

    Kohutek, Zachary A.; diPierro, Charles G.; Redpath, Gerard T.; Hussaini, Isa M.

    2009-01-01

    Matrix metalloproteinases (MMPs) and the related ‘a disintegrin and metalloproteinases’ (ADAMs) promote tumorigenesis by cleaving extracellular matrix and protein substrates, including N-cadherin. While N-cadherin is thought to regulate cell adhesion, migration and invasion, its role has not been characterized in glioblastomas (GBMs). In this study, we investigated the expression and function of post-translational N-cadherin cleavage in GBM cells as well as its regulation by protein kinase C (PKC). N-cadherin cleavage occurred at a higher level in glioblastoma cells than in non-neoplastic astrocytes. Treatment with the PKC-activator phorbol 12-myristate 13-acetate (PMA) increased N-cadherin cleavage, which was reduced by pharmacological inhibitors and siRNA specific for ADAM-10 or PKC-α. Furthermore, treatment of GBM cells with PMA induced the translocation of ADAM-10 to the cell membrane, the site where N-cadherin was cleaved, and this translocation was significantly reduced by the PKC-α inhibitor Gö6976 or PKC-α shRNA. In functional studies, N-cadherin cleavage was required for GBM cell migration, as depletion of N-cadherin cleavage by N-cadherin siRNA, ADAM-10 siRNA, or a cleavage-site mutant N-cadherin, decreased GBM cell migration. Taken together, these results suggest that N-cadherin cleavage is regulated by a PKC-α-ADAM-10 cascade in GBM cells and may be involved in mediating GBM cell migration. PMID:19357285

  19. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... history records checks and other elements of background checks for designated categories of individuals..., identification and criminal history records checks and other elements of background checks for designated categories of individuals. Fingerprinting, and the identification and criminal history records...

  20. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... history records checks and other elements of background checks for designated categories of individuals..., identification and criminal history records checks and other elements of background checks for designated categories of individuals. Fingerprinting, and the identification and criminal history records...

  1. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... history records checks and other elements of background checks for designated categories of individuals..., identification and criminal history records checks and other elements of background checks for designated categories of individuals. Fingerprinting, and the identification and criminal history records...

  2. Transcriptional promoter and enhancer elements in the long terminal repeats (LTR) of endogenous murine leukemia virus (MuLV)-related proviral sequences

    SciTech Connect

    Ch'ang, L.Y.; Myer, F.E.; Yang, D.M.; Koh, C.K.; Yang, W.K.

    1987-05-01

    Mouse genome harbors 2 families of MuLV-related proviral sequences, which do not directly produce infectious virus, but may express RNA transcripts in a tissue-specific manner. The LTRS of MuLV-related sequences contain a mid-U3 inserted segment (IS) of approx. 200 bp not found in the LTR of infectious MuLVs. To test for the LTR promoter and enhancer activities, chloramphenicol acetyltransferase (CAT) gene, alone or carrying SV40 promoter, was linked to various LTR sequences of 2 MuLV and 6 representative MuLV-related DNA clones and the recombinant genes were examined for transient CAT expression in mouse NIH-3T3, mink CCL64 and human HT1080 cells by DNA transfection. While the CAT expression was high with the 2 ecotropic MuLV LTRs, very little to undetectable activities were obtained with all MuLV-related LTRs. To determine the basis for the very low activity of the MuLV-related LTRs, series of experiments were performed, which indicate that the TATA- and CCAAC-containing domain, downstream of the IS, is functionally intact as a promoter and that the IS sequences, while inactive as a promoter by itself, could provide a bi-directional enhancer-like activity to its own or MuLV LTR or SV40 promoter. Further studies suggest the presence of a cis-acting negative regulatory element in sequences upstream of the IS in both the 2 subfamilies of MuLV-related LTRs.

  3. An Sp1 response element in the Kaposi's sarcoma-associated herpesvirus open reading frame 50 promoter mediates lytic cycle induction by butyrate.

    PubMed

    Ye, Jianjiang; Shedd, Duane; Miller, George

    2005-02-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) can be driven into the lytic cycle in vitro by phorbol esters and sodium butyrate. This report begins to analyze the process by which butyrate activates the promoter of KSHV open reading frame 50 (ORF50), the key viral regulator of the KSHV latency to lytic cycle switch. A short fragment of the promoter, 134 nucleotides upstream of the translational start of ORF50, retained basal uninduced activity and conferred maximal responsiveness to sodium butyrate. The butyrate response element was mapped to a consensus Sp1-binding site. By means of electrophoretic mobility shift assays, both Sp1 and Sp3 were shown to form complexes in vitro with the ORF50 promoter at the Sp1 site. Butyrate induced the formation of a group of novel complexes, including several Sp3-containing complexes, one Sp1-containing complex, and several other complexes that were not identified with antibodies to Sp1 or Sp3. Formation of all butyrate-induced DNA-protein complexes was mediated by the consensus Sp1 site. In insect and mammalian cell lines, Sp1 significantly activated the ORF50 promoter linked to luciferase. Chromatin immunoprecipitation experiments in a PEL cell line showed that butyrate induced Sp1, CBP, and p300 binding to the ORF50 promoter in vivo in an on-off manner. The results suggest that induction of the KSHV lytic cycle by butyrate is mediated through interactions at the Sp1/Sp3 site located 103 to 112 nucleotides upstream of the translational initiation of ORF50 presumably by enhancing the binding of Sp1 to this site.

  4. Organic and elemental carbon associated to PM10 and PM 2.5 at urban sites of northern Greece.

    PubMed

    Samara, Constantini; Voutsa, Dimitra; Kouras, Athanasios; Eleftheriadis, Kostas; Maggos, Thomas; Saraga, D; Petrakakis, M

    2014-02-01

    Organic carbon (OC) and elemental carbon (EC) concentrations, associated to PM10 and PM2.5 particle fractions, were concurrently determined during the warm and the cold months of the year (July-September 2011 and February-April 2012, respectively) at two urban sites in the city of Thessaloniki, northern Greece, an urban-traffic site (UT) and an urban-background site (UB). Concentrations at the UT site (11.3 ± 5.0 and 8.44 ± 4.08 14 μg m(-3) for OC10 and OC2.5 vs. 6.56 ± 2.14 and 5.29 ± 1.54 μg m(-3) for EC10 and EC2.5) were among the highest values reported for urban sites in European cities. Significantly lower concentrations were found at the UB site for both carbonaceous species, particularly for EC (6.62 ± 4.59 and 5.72 ± 4.36 μg m(-3) for OC10 and OC2.5 vs. 0.93 ± 0.61 and 0.69 ± 0.39 μg m(-3) for EC10 and EC2.5). Despite that, a negative UT-UB increment was frequently evidenced for OC2.5 and PM2.5 in the cold months possibly indicative of emissions from residential wood burning at the urban-background site. At both sites, cconcentrations of OC fractions were significantly higher in the cold months; on the contrary, EC fractions at the UT site were prominent in the warm season suggesting some influence from maritime emissions in the nearby harbor area. Secondary organic carbon, being estimated using the EC tracer method and seasonally minimum OC/EC ratios, was found to be an appreciable component of particle mass particularly in the cold season. The calculated secondary contributions to OC ranged between 35 and 59 % in the PM10 fraction, with relatively higher values in the PM2.5 fraction (39-61 %). The source origin of carbonaceous species was investigated by means of air parcel back trajectories, satellite fire maps, and concentration roses. A local origin was mainly concluded for OC and EC with limited possibility for long range transport of biomass (agricultural waste) burning aerosol.

  5. A proinflammatory cytokine interleukin-32beta promotes the production of an anti-inflammatory cytokine interleukin-10.

    PubMed

    Kang, Jeong-Woo; Choi, Seung-Chul; Cho, Min-Chul; Kim, Hee-Jong; Kim, Jae-Hwa; Lim, Jong-Seok; Kim, Soo-Hyun; Han, Jae-Yong; Yoon, Do-Young

    2009-09-01

    A new proinflammatory cytokine interleukin-32 (IL-32) has six isoforms. Although IL-32 can be detected in sera from patients suffering from Crohn's disease and rheumatoid arthritis, it is unclear which isoforms are involved. To this end, we investigated the functions of the most abundant IL-32beta by generating K562-IL-32beta stable cell lines. This report confirms, using IL-32 small interfering RNA, that IL-32beta induces an anti-inflammatory cytokine IL-10 in K562-IL-32beta cells and U937 promonocytic cells, which express endogenous IL-32beta upon phorbol 12-myristate 13-acetate (PMA) treatment, and monocyte-derived dendritic cells (DC) upon lipopolysaccharide (LPS) treatment. Interleukin-32beta was induced in monocyte-derived macrophages by LPS and in monocyte-derived DC by LPS, poly(I:C), or anti-CD40 antibody, but was not induced by PMA. We showed that IL-32beta expression was increased in a time-dependent manner in monocyte-derived DC upon LPS treatment and peaked at 24 hr. Production of IL-10 was exactly coincident with IL-32beta expression, but IL-1beta and tumour necrosis factor-alpha production peaked at 6 hr after LPS treatment, then steeply declined. Interleukin-12 p40 was induced at 9 hr and gradually increased until 48 hr, at which time IL-32beta and IL-10 were no longer increased. Knock-down of IL-32beta by IL-32 small interfering RNA led to the decrease of IL-10, but the increase of IL-12 in monocyte-derived DC, which means that IL-32beta promotes IL-10 production, but limits IL-12 production. We also showed that IL-10 neutralization increases IL-12, IL-1beta and tumour necrosis factor-alpha production, which implies that IL-10 suppresses such proinflammatory cytokines. Taken together, our results suggest that IL-32beta upregulates the production of an anti-inflammatory cytokine IL-10, and then IL-10 suppresses proinflammatory cytokines.

  6. miR-92a/DUSP10/JNK signalling axis promotes human pancreatic cancer cells proliferation.

    PubMed

    He, Gengsheng; Zhang, Lei; Li, Qing; Yang, Longqiu

    2014-02-01

    Pancreatic cancer is one of the most common types of cancers in the whole world with a poor prognosis. Finding out how the cancer form and develop is the most important way to cure this cancer. miRNAs, 21-22 nucleotides regulatory small non-coding RNAs, have been found to be critical involved in the growth of pancreatic cancer. In this study, we found that miR-92a was up regulated in three kinds of human pancreatic cancer cell lines. There is a correlation between miR-92a and malignant degree of human pancreatic cancer cell lines. Then we found that miR-92a was essential for promoting cell proliferation in human pancreatic cancer. Inhibition of the function of miR-92a repressed the proliferation of pancreatic cancer cells. Further, we found that miR-92a enhanced the activation of JNK signalling pathway by directly targeting the JNK signalling inhibitor DUSP10. DUSP10 is responsible for miR-92a induced JNK signalling and cell proliferation. Altogether, our study showed a miR-92a/DUSP10/JNK signalling pathway that plays an important role in regulating the proliferation of pancreatic cancer cells.

  7. Psoriasis mutations disrupt CARD14 autoinhibition promoting BCL10-MALT1-dependent NF-κB activation.

    PubMed

    Howes, Ashleigh; O'Sullivan, Paul A; Breyer, Felix; Ghose, Ashavari; Cao, Li; Krappmann, Daniel; Bowcock, Anne M; Ley, Steven C

    2016-06-15

    Inherited and de novo mutations in the CARD14 gene promote the development of psoriasis, an inflammatory disease of the skin. Caspase recruitment domain-containing protein 14 (CARD14) is a member of the CARMA protein family that includes the structurally related CARD11 adaptor that mediates NF-κB activation by antigen receptors. We investigated the mechanism by which CARD14 mutation in psoriasis activates NF-κB. In contrast with wild-type CARD14, CARD14(E138A) and CARD14(G117S) psoriasis mutants interacted constitutively with BCL10 and MALT1, and triggered BCL10- and MALT1-dependent activation of NF-κB in keratinocytes. These alterations disrupted the inhibitory effect of the CARD14 linker region (LR) on NF-κB activation by facilitating BCL10 binding. Therefore, psoriasis mutations activated CARD14 by a mechanism analogous to oncogenic CARD11 mutations in non-Hodgkin B cell lymphomas. CARD14(E138A) also stimulated MALT1 paracaspase activity and activated both ERK1/2 and p38α MAP kinases. Inhibition of MALT1 with mepazine reduced CARD14(E138A)-induced expression of specific psoriasis-associated transcripts in keratinocytes. Our results establish the mechanism whereby gain-of-function CARD14 variants, which induce psoriatic disease in affected individuals, activate pro-inflammatory signalling.

  8. Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

    PubMed

    Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

    2016-11-01

    We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally.

  9. Light and CO2/cAMP Signal Cross Talk on the Promoter Elements of Chloroplastic β-Carbonic Anhydrase Genes in the Marine Diatom Phaeodactylum tricornutum.

    PubMed

    Tanaka, Atsushi; Ohno, Naoki; Nakajima, Kensuke; Matsuda, Yusuke

    2016-02-01

    Our previous study showed that three CO2/cAMP-responsive elements (CCRE) CCRE1, CCRE2, and CCRE3 in the promoter of the chloroplastic β-carbonic anhydrase 1 gene in the marine diatom Phaeodactylum tricornutum (Pptca1) were critical for the cAMP-mediated transcriptional response to ambient CO2 concentration. Pptca1 was activated under CO2 limitation, but the absence of light partially disabled this low-CO2-triggered transcriptional activation. This suppression effect disappeared when CCRE2 or two of three CCREs were replaced with a NotI restriction site, strongly suggesting that light signal cross-talks with CO2 on the cAMP-signal transduction pathway that targets CCREs. The paralogous chloroplastic carbonic anhydrase gene, ptca2 was also CO2/cAMP-responsive. The upstream truncation assay of the ptca2 promoter (Pptca2) revealed a short sequence of -367 to -333 relative to the transcription-start site to be a critical regulatory region for the CO2 and light responses. This core-regulatory region comprises one CCRE1 and two CCRE2 sequences. Further detailed analysis of Pptca2 clearly indicates that two CCRE2s are the cis-element governing the CO2/light response of Pptca2. The transcriptional activation of two Pptcas in CO2 limitation was evident under illumination with a photosynthetically active light wavelength, and an artificial electron acceptor from the reduction side of PSI efficiently inhibited Pptcas activation, while neither inhibition of the linear electron transport from PSII to PSI nor inhibition of ATP synthesis showed an effect on the promoter activity, strongly suggesting a specific involvement of the redox level of the stromal side of the PSI in the CO2/light cross talk.

  10. Glucocorticoid repression of human with-no-lysine (K) kinase-4 gene expression is mediated by the negative response elements in the promoter.

    PubMed

    Li, Chunyi; Li, Yan; Li, Yinghui; Liu, Hong; Sun, Zhijun; Lu, Jingyu; Zhao, Yanyan

    2008-01-01

    With-no-lysine (K) kinase-4 (WNK4) is a serine/threonine kinase that plays an essential role in the regulation of fluid and electrolyte homeostasis. The effects of glucocorticoids, key physiological regulators, on the WNK4 gene expression are still unknown. Here, we used dexamethasone (Dex) to treat the human embryo kidney 293 (HEK293) cells and found a decrease of human WNK4 (hWNK4) mRNA level by northern blot and real-time quantitative PCR. After an hWNK4 transcriptional initiation site was located by 5' rapid amplification of cDNA end assay, a series of 5'-deleted hWNK4 promoter-luciferase constructs were generated by PCR. Transfection of these constructs in COS-7 and HEK293 cells revealed that Dex inhibited the hWNK4 transcriptional activity in glucocorticoid receptor (GR)-dependent pattern. Two negative glucocorticoid response elements (nGREs) were identified at -285 and -337 of the hWNK4 gene promoter and the GR binding activity to them was increased by Dex as shown by electrophoretic mobility shift assay and chromatin immunoprecipitation. In summary, these data demonstrated that hWNK4 was a new glucocorticoid-regulated gene whose expression was inhibited through the interaction of GR with nGREs in the promoter region.

  11. Additive Promotion of Viral Internal Ribosome Entry Site-Mediated Translation by Far Upstream Element-Binding Protein 1 and an Enterovirus 71-Induced Cleavage Product

    PubMed Central

    Hung, Chuan-Tien; Kung, Yu-An; Li, Mei-Ling; Lee, Kuo-Ming; Liu, Shih-Tung; Shih, Shin-Ru

    2016-01-01

    The 5' untranslated region (5' UTR) of the enterovirus 71 (EV71) RNA genome contains an internal ribosome entry site (IRES) that is indispensable for viral protein translation. Due to the limited coding capacity of their RNA genomes, EV71 and other picornaviruses typically recruit host factors, known as IRES trans-acting factors (ITAFs), to mediate IRES-dependent translation. Here, we show that EV71 viral proteinase 2A is capable of cleaving far upstream element-binding protein 1 (FBP1), a positive ITAF that directly binds to the EV71 5' UTR linker region to promote viral IRES-driven translation. The cleavage occurs at the Gly-371 residue of FBP1 during the EV71 infection process, and this generates a functional cleavage product, FBP11-371. Interestingly, the cleavage product acts to promote viral IRES activity. Footprinting analysis and gel mobility shift assay results showed that FBP11-371 similarly binds to the EV71 5' UTR linker region, but at a different site from full-length FBP1; moreover, FBP1 and FBP11-371 were found to act additively to promote IRES-mediated translation and virus yield. Our findings expand the current understanding of virus-host interactions with regard to viral recruitment and modulation of ITAFs, and provide new insights into translational control during viral infection. PMID:27780225

  12. Verification of the in vivo activity of three distinct cis-acting elements within the Gata1 gene promoter-proximal enhancer in mice.

    PubMed

    Shimizu, Ritsuko; Hasegawa, Atsushi; Ottolenghi, Sergio; Ronchi, Antonella; Yamamoto, Masayuki

    2013-11-01

    The transcription factor GATA1 is essential for erythroid and megakaryocytic cell differentiation. Gata1 hematopoietic regulatory domain (G1HRD) has been shown to recapitulate endogenous Gata1 gene expression in transgenic mouse assays in vivo. G1HRD contains a promoter-proximal enhancer composed of a GATA-palindrome motif, four CP2-binding sites and two CACCC boxes. We prepared transgenic reporter mouse lines in which green fluorescent protein and β-galactosidase expression are driven by wild-type G1HRD (as a positive control) and the G1HRD harboring mutations within these cis-acting elements (as the experimental conditions), respectively. Exploiting this transgenic dual reporter (TDR) assay, we show here that in definitive erythropoiesis, G1HRD activity was markedly affected by individual mutations in the GATA-palindrome motif and the CACCC boxes. Mutation of CP2-binding sites also moderately decreased G1HRD activity. The combined mutation of the CP2-binding sites and the GATA-palindrome motif resulted in complete loss of G1HRD activity. In contrast, in primitive erythroid cells, individual mutations of each element did not affect G1HRD activity; G1HRD activity was abolished only when these three mutations were combined. These results thus show that all three elements independently and cooperatively contribute to G1HRD activity in vivo in definitive erythropoiesis, although these are contributing redundantly to primitive erythropoiesis.

  13. Insertion of core CpG island element into human CMV promoter for enhancing recombinant protein expression stability in CHO cells.

    PubMed

    Mariati; Yeo, Jessna H M; Koh, Esther Y C; Ho, Steven C L; Yang, Yuansheng

    2014-01-01

    The human cytomegalovirus promoter (hCMV) is susceptible to gene silencing in CHO cells, most likely due to epigenetic events, such as DNA methylation and histone modifications. The core CpG island element (IE) from the hamster adenine phosphoribosyltransferase gene has been shown to prevent DNA methylation. A set of modified hCMV promoters was developed by inserting one or two copies of IE in either forward or reverse orientations either upstream of the hCMV enhancer, between the enhancer and core promoter (CP), or downstream of the CP. The modified hCMV with one copy of IE inserted between the enhancer and core promoter in reverse orientation (MR1) was most effective at enhancing expression stability without compromising expression level when compared with the wild-type (WT) hCMV. A third of 18 EGFP expressing clones generated using MR1 retained 70% of their starting expression level after 8 weeks of culture in the absence of selection pressure, while none of 18 WT hCMV generated clones had expression above 50%. MR1 also improved antibody expression stability of methotrexate (MTX) amplified CHO cell lines. Stably transfected pools generated using MR1 maintained 62% of their original monoclonal antibody titer after 8 weeks of culture in the absence of MTX, compared to only 37% for WT hCMV pools. Low levels of CpG methylation within both WT hCMV and MR1 were observed in all the analyzed cell lines and the methylation levels did not correlate to the expression stability, suggesting IE enhances expression stability by other mechanisms other than preventing methylation.

  14. Identification of two glucocorticoid response elements in the promoter region of the ubiquitous isoform of glutamine synthetase in gulf toadfish, Opsanus beta.

    PubMed

    Esbaugh, Andrew J; Walsh, Patrick J

    2009-10-01

    Unlike most teleosts, gulf toadfish have the capacity to switch from ammoniotely to ureotely as the predominate means of nitrogen excretion during periods of stress. The switch to ureotely is a result of increased glutamine synthetase (GS) mRNA expression/enzyme activity in the liver and muscle, which is initiated by cortisol. Cortisol typically affects gene expression through the action of cortisol-activated transcription factors, such as glucocorticoid receptors, which bind to glucocorticoid response elements (GRE) in the upstream regulatory region of genes. The purpose of the present study was to identify the GRE responsible for increased GS gene expression during crowding/confinement in gulf toadfish using an in vivo luciferase reporter assay. Upstream promoter regions for both the ubiquitous and gill GS isoforms were amplified by PCR. Additionally, an intron was amplified from the ubiquitous GS isoform that suggested the possibility of two discreet transcripts for the mitochondrial and cytoplasmic proteins. When tested via in vivo reporter assays, both the cytoplasmic and mitochondrial ubiquitous GS promoters showed increased luciferase activity during crowding vs. noncrowded controls; the gill GS promoter showed no effects in response to crowding. In silico analysis of the mitochondrial and cytoplasmic ubiquitous GS promoter constructs showed an overlapping section of 565 bp containing two potential GREs. Mutation of either site alone had no effect on luciferase activity vs. wild-type controls. However, when both sites were mutated a significant decrease in luciferase activity was observed. We conclude that two functional GREs combine to confer cortisol-inducible GS expression in the liver of gulf toadfish.

  15. Measurement of proton production cross sections of {sup 10}Be and {sup 26}Al from elements found in lunar rocks

    SciTech Connect

    Sisterson, J.M.; Kim, K.; Englert, P.A.J.

    1996-07-01

    Cosmic rays penetrate the lunar surface and interact with the lunar rocks to produce both radionuclides and stable nuclides. Production depth profiles for long-lived radionuclides produce in lunar rocks are measured using Accelerator Mass Spectrometry (AMS). For a particular radionuclide these production depth profiles can be interpreted to give an estimate for the solar proton flux over a time period characterized by the half life of the radionuclide under study. This analysis is possible if and only if all the cross sections for the interactions of all cosmic ray particles with all elements found in lunar rocks are well known. In practice, the most important cross sections needed are the proton production cross sections, because 98% of solar cosmic rays and {similar_to}87% of galactic cosmic rays are protons. The cross sections for the production of long-lived radionuclides were very difficult to measure before the development of AMS and only in recent years has significant progress been made in determining these essential cross sections. Oxygen and silicon are major constituents of lunar rocks. We have reported already {sup 14}C production cross sections from O and Si for proton energies 25-500 MeV, and O(p,x){sup 10}Be from 58 160 MeV[6]. Here we present new measurements for the cross sections O(p,x){sup 10}Be,O(p,x){sup 7}Be, Si(p,x){sup 7}Be,Si(p,x){sup 26}Al, and Si(p,x){sup 22}Na from {approximately}30 - 500 MeV.

  16. Measurement of proton production cross sections of (sup 10)Be and (sup 26)Al from elements found in lunar rocks

    NASA Technical Reports Server (NTRS)

    Sisterson, J. M.; Kim, K.; Englert, P. A. J.; Caffee, M.; Jull, A. J. T.; Donahue, D. J.; McHargue, L.; Castaneda, C.; Vincent, J.; Reedy, R. C.

    1996-01-01

    Cosmic rays penetrate the lunar surface and interact with the lunar rocks to produce both radionuclides and stable nuclides. Production depth profiles for long-lived radionuclides produce in lunar rocks are measured using Accelerator Mass Spectrometry (AMS). For a particular radionuclide these production depth profiles can be interpreted to give an estimate for the solar proton flux over a time period characterized by the half life of the radionuclide under study. This analysis is possible if and only if all the cross sections for the interactions of all cosmic ray particles with all elements found in lunar rocks are well known. In practice, the most important cross sections needed are the proton production cross sections, because 98% of solar cosmic rays and (similar to)87% of galactic cosmic rays are protons. The cross sections for the production of long-lived radionuclides were very difficult to measure before the development of AMS and only in recent years has significant progress been made in determining these essential cross sections. Oxygen and silicon are major constituents of lunar rocks. We have reported already C-14 production cross sections from O and Si for proton energies 25-500 MeV, and O(p,x)(sup 10)Be from 58 160 MeV[6]. Here we present new measurements for the cross sections O(p,x)Be-10,O(p,x)Be-7, Si(p,x)Be-7,Si(p,x)Al-26, and Si(p,x)Na-22 from approximately 30 - 500 MeV.

  17. Effective leadership, teamwork and mentoring--essential elements in promoting generational cohesion in the nursing workforce and retaining nurses.

    PubMed

    Nelsey, Lorraine; Brownie, Sonya

    2012-01-01

    Despite recent increases in nurse recruitment in Australia, the current nursing workforce is still below the predicted numbers for the future demands. The combination of an ageing workforce, high nursing staff turnover and an inability to attract and retain nurses is eroding the capacity of the health care sector to appropriately respond to the care needs of the community. Currently, the nursing workforce may have as many as four generations working together. Differences in employment needs and values, work ethics, attitudes towards authority, and professional aspirations, contribute to some of the cross-generational problems that emerge and the turnover of nursing staff. Strategies to improve the retention rates of nurses need to focus on building a cohesive workforce by utilising the strengths and skill sets that characterise different generations of nurses, and creating the conditions in which nurses across all generations feel supported and valued. The aim of this article is to explain how effective leadership, teamwork and mentoring can assist efforts to promote generational cohesion and address the decline in the number of nurses in the workforce.

  18. 5-HT4 Receptors Constitutively Promote the Non-Amyloidogenic Pathway of APP Cleavage and Interact with ADAM10

    PubMed Central

    2012-01-01

    In addition to the amyloidogenic pathway, amyloid precursor protein (APP) can be cleaved by α-secretases, producing soluble and neuroprotective APP alpha (sAPPα) (nonamyloidogenic pathway) and thus preventing the generation of pathogenic amyloid-β. However, the mechanisms regulating APP cleavage by α-secretases remain poorly understood. Here, we showed that expression of serotonin type 4 receptors (5-HT4Rs) constitutively (without agonist stimulation) induced APP cleavage by the α-secretase ADAM10 and the release of neuroprotective sAPPα in HEK-293 cells and cortical neurons. This effect was independent of cAMP production. Interestingly, we demonstrated that 5-HT4 receptors physically interacted with the mature form of ADAM10. Stimulation of 5-HT4 receptors by an agonist further increased sAPPα secretion, and this effect was mediated by cAMP/Epac signaling. These findings describe a new mechanism whereby a GPCR constitutively stimulates the cleavage of APP by α-secretase and promotes the nonamyloidogenic pathway of APP processing. PMID:23336052

  19. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  20. Structural polymorphism within a regulatory element of the human KRAS promoter: formation of G4-DNA recognized by nuclear proteins

    PubMed Central

    Cogoi, Susanna; Paramasivam, Manikandan; Spolaore, Barbara; Xodo, Luigi E.

    2008-01-01

    The human KRAS proto-oncogene contains a critical nuclease hypersensitive element (NHE) upstream of the major transcription initiation site. In this article, we demonstrate by primer-extension experiments, PAGE, chemical footprinting, CD, UV and FRET experiments that the G-rich strand of NHE (32R) folds into intra-molecular G-quadruplex structures. Fluorescence data show that 32R in 100 mM KCl melts with a biphasic profile, showing the formation of two distinct G-quadruplexes with Tm of ∼55°C (Q1) and ∼72°C (Q2). DMS-footprinting and CD suggest that Q1 can be a parallel and Q2 a mixed parallel/antiparallel G-quadruplex. When dsNHE (32R hybridized to its complementary) is incubated with a nuclear extract from Panc-1 cells, three DNA–protein complexes are observed by EMSA. The complex of slower mobility is competed by quadruplex 32R, but not by mutant oligonucleotides, which cannot form a quadruplex structure. Using paramagnetic beads coupled with 32R, we pulled down from the Panc-1 extract proteins with affinity for quadruplex 32R. One of these is the heterogeneous nuclear ribonucleoprotein A1, which was previously reported to unfold quadruplex DNA. Our study suggests a role of quadruplex DNA in KRAS transcription and provides the basis for the rationale design of molecular strategies to inhibit the expression of KRAS. PMID:18490377

  1. Elemental compositions of PM10-2.5 and PM2.5 aerosols of a Nigerian urban city using ion beam analytical techniques

    NASA Astrophysics Data System (ADS)

    Ezeh, G. C.; Obioh, I. B.; Asubiojo, O. I.; Chiari, M.; Nava, S.; Calzolai, G.; Lucarelli, F.; Nuviadenu, C. K.

    2014-09-01

    The paucity of data on air quality studies in Nigeria prompted us to commence the sampling of particulate matter (PM10-2.5 and PM2.5) in Mushin Lagos, Nigeria. Both size-segregated fractions were collected using a double staged ‘Gent' stack filter unit sampler. Elemental characterization was carried out by Particle Induced X-ray Emission (PIXE) and Proton Induced γ-ray Emission (PIGE) techniques using an external ion beam set-up. Twenty-four elements (Na, Mg, Al, Si, P, S, Cl, K, Ca, Ti, V, Cr, Mn, Fe, Ni, Cu, Zn, Se, Br, Rb, Sr, Zr, Cs and Pb) were detected in both fractions and their concentrations were assessed. A study of their inter-elemental correlations indicated that some elements could have common source origins or similar chemical properties while enrichment factors (EF) displayed that most elements emanated from anthropogenic sources. Source apportionment studies are thus recommended.

  2. Overexpression of the Multidrug Efflux Operon acrEF by Insertional Activation with IS1 or IS10 Elements in Salmonella enterica Serovar Typhimurium DT204 acrB Mutants Selected with Fluoroquinolones

    PubMed Central

    Olliver, Anne; Vallé, Michel; Chaslus-Dancla, Elisabeth; Cloeckaert, Axel

    2005-01-01

    High-level fluoroquinolone (FQ) resistance in Salmonella enterica serovar Typhimurium phage type DT204 has been previously shown to be essentially due to both multiple target gene mutations and active efflux by the AcrAB-TolC efflux system. In this study we show that in intermediatly resistant acrB-inactivated serovar Typhimurium DT204 mutants, high-level resistance to FQs can be restored on in vitro selection with FQs. In each FQ- resistant mutant selected from serovar Typhimurium DT204 acrB mutant strains, an insertion sequence (IS1 or IS10) was found integrated upstream of the acrEF operon, coding for AcrEF, an efflux pump highly homologous to AcrAB. In one of the strains, transposition of IS1 caused partial deletion of acrS, the putative local repressor gene of the acrEF operon. Sequence analysis showed that both IS1 and IS10 elements contain putative promoter sequences that might alter the expression of adjacent acrEF genes. Indeed, reverse transcription-PCR experiments showed an 8- to 10-fold increase in expression of acrF in these insertional mutants, relative to their respective parental strain, which correlated well with the resistance levels observed to FQs and other unrelated drugs. It is noteworthy that AcrEF did not contribute to the intrinsic drug resistance of serovar Typhimurium, since acrF deletion in wild-type strains did not result in any increase in drug susceptibility. Moreover, deletion of acrS did not cause any acrF overexpression or any decrease in drug susceptibility, suggesting that acrEF overexpression is mediated solely by the IS1 and IS10 promoter sequences and not by inactivity of AcrS. Southern blot experiments showed that the number of chromosomal IS1 and IS10 elements in the serovar Typhimurium DT204 genome was about 5 and 15 respectively. None were detected in epidemic serovar Typhimurium DT104 strains or in the serovar Typhimurium reference strain LT2. Carrying IS1 and/or IS10 elements in their chromosome may thus be a selective

  3. NK4 antagonizes Tbx1/10 to promote cardiac versus pharyngeal muscle fate in the ascidian second heart field.

    PubMed

    Wang, Wei; Razy-Krajka, Florian; Siu, Eric; Ketcham, Alexandra; Christiaen, Lionel

    2013-12-01

    The heart and head muscles share common developmental origins and genetic underpinnings in vertebrates, including humans. Parts of the heart and cranio-facial musculature derive from common mesodermal progenitors that express NKX2-5, ISL1, and TBX1. This ontogenetic kinship is dramatically reflected in the DiGeorge/Cardio-Velo-Facial syndrome (DGS/CVFS), where mutations of TBX1 cause malformations in the pharyngeal apparatus and cardiac outflow tract. Cardiac progenitors of the first heart field (FHF) do not require TBX1 and segregate precociously from common progenitors of the second heart field (SHF) and pharyngeal muscles. However, the cellular and molecular mechanisms that govern heart versus pharyngeal muscle specification within this lineage remain elusive. Here, we harness the simplicity of the ascidian larva to show that, following asymmetric cell division of common progenitors, NK4/NKX2-5 promotes GATAa/GATA4/5/6 expression and cardiac specification in the second heart precursors by antagonizing Tbx1/10-mediated inhibition of GATAa and activation of Collier/Olf/EBF (COE), the determinant of atrial siphon muscle (ASM) specification. Our results uncover essential regulatory connections between the conserved cardio-pharyngeal factor Tbx1/10 and muscle determinant COE, as well as a mutual antagonism between NK4 and Tbx1/10 activities upstream of GATAa and COE. The latter cross-antagonism underlies a fundamental heart versus pharyngeal muscle fate choice that occurs in a conserved lineage of cardio-pharyngeal progenitors. We propose that this basic ontogenetic motif underlies cardiac and pharyngeal muscle development and evolution in chordates.

  4. NK4 Antagonizes Tbx1/10 to Promote Cardiac versus Pharyngeal Muscle Fate in the Ascidian Second Heart Field

    PubMed Central

    Wang, Wei; Razy-Krajka, Florian; Siu, Eric; Ketcham, Alexandra; Christiaen, Lionel

    2013-01-01

    The heart and head muscles share common developmental origins and genetic underpinnings in vertebrates, including humans. Parts of the heart and cranio-facial musculature derive from common mesodermal progenitors that express NKX2-5, ISL1, and TBX1. This ontogenetic kinship is dramatically reflected in the DiGeorge/Cardio-Velo-Facial syndrome (DGS/CVFS), where mutations of TBX1 cause malformations in the pharyngeal apparatus and cardiac outflow tract. Cardiac progenitors of the first heart field (FHF) do not require TBX1 and segregate precociously from common progenitors of the second heart field (SHF) and pharyngeal muscles. However, the cellular and molecular mechanisms that govern heart versus pharyngeal muscle specification within this lineage remain elusive. Here, we harness the simplicity of the ascidian larva to show that, following asymmetric cell division of common progenitors, NK4/NKX2-5 promotes GATAa/GATA4/5/6 expression and cardiac specification in the second heart precursors by antagonizing Tbx1/10-mediated inhibition of GATAa and activation of Collier/Olf/EBF (COE), the determinant of atrial siphon muscle (ASM) specification. Our results uncover essential regulatory connections between the conserved cardio-pharyngeal factor Tbx1/10 and muscle determinant COE, as well as a mutual antagonism between NK4 and Tbx1/10 activities upstream of GATAa and COE. The latter cross-antagonism underlies a fundamental heart versus pharyngeal muscle fate choice that occurs in a conserved lineage of cardio-pharyngeal progenitors. We propose that this basic ontogenetic motif underlies cardiac and pharyngeal muscle development and evolution in chordates. PMID:24311985

  5. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    SciTech Connect

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia . E-mail: patrizia.mancini@uniroma1.it

    2007-05-15

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10.

  6. 1,4,7,10-tetraazacyclododecane metal complexes as potent promoters of phosphodiester hydrolysis under physiological conditions.

    PubMed

    Subat, Michael; Woinaroschy, Kristina; Gerstl, Corinna; Sarkar, Biprajit; Kaim, Wolfgang; König, Burkhard

    2008-06-02

    Previously reported mono- and dinuclear Zn(II), Cu(II), and Ni(II) complexes of 1,4,7,10-tetrazacyclododecane ([12]aneN4 or cyclen) with different heterocyclic spacers (triazine, pyridine) of various lengths (bi- and tripyridine) or an azacrown-pendant have been tested for the hydrolysis of bis(4-nitrophenyl)phosphate (BNPP) under physiological conditions (pH 7-9, 25 degrees C). All Zn(II) complexes promote the hydrolysis of BNPP under physiological conditions, while those of Cu(II) and Ni(II) do not have a significant effect on the hydrolysis reaction. The hydrolysis kinetics in buffered solutions (0.05 M Bis/Tris, TRIS, HEPES, or CHES, I=0.1 M, NaCl) at 25 degrees C were determined by the initial slope method (product conversion<5%). Comparison of the second-order pH-independent rate constants (kBNPP, M(-1) s(-1)) for the mononuclear complexes ZnL1, ZnL3, and ZnL6, which are 6.1x10 (-5), 5.1x10(-5), and 5.7x10(-5), respectively, indicate that the heterocyclic moiety improves the rate of hydrolysis up to six times over the parent Zn([12]aneN4) complex (kBNPP=1.1x10(-5) M(-1) s(-1)). The reactive species is the Zn(II)-OH- complex, in which the Zn(II)-bound OH- acts as a nucleophile. For dinuclear complexes Zn2L2, Zn2L4, and Zn2L5, the rate of reaction is defined by the degree of cooperation between the metal centers, which is determined by the spacer length. Zn2L2 and Zn2L4 possessing shorter spacers are able to hydrolyze BNPP 1 to 2 orders of magnitudes faster than Zn2L5. The second-order rate constants k of Zn2L4 and Zn2L2 at pH 7, 8, and 9 are significantly higher than those of previously reported related complexes. The high BNPP hydrolytic activity may be related to pi-stacking and hydrophobic interactions between the aromatic spacer moieties and the substrate. Complexes Zn2L4 and Zn2L2 show hydrolytic activity at pH 7 and 8, which allows for the hydrolysis of activated phosphate esters under physiological conditions.

  7. Stress hormones promote growth of B16-F10 melanoma metastases: an interleukin 6- and glutathione-dependent mechanism

    PubMed Central

    2013-01-01

    Background Interleukin (IL)-6 (mainly of tumor origin) activates glutathione (GSH) release from hepatocytes and its interorgan transport to B16-F10 melanoma metastatic foci. We studied if this capacity to overproduce IL-6 is regulated by cancer cell-independent mechanisms. Methods Murine B16-F10 melanoma cells were cultured, transfected with red fluorescent protein, injected i.v. into syngenic C57BL/6J mice to generate lung and liver metastases, and isolated from metastatic foci using high-performance cell sorting. Stress hormones and IL-6 levels were measured by ELISA, and CRH expression in the brain by in situ hybridization. DNA binding activity of NF-κB, CREB, AP-1, and NF-IL-6 was measured using specific transcription factor assay kits. IL-6 expression was measured by RT-PCR, and silencing was achieved by transfection of anti-IL-6 small interfering RNA. GSH was determined by HPLC. Cell death analysis was distinguished using fluorescence microscopy, TUNEL labeling, and flow cytometry techniques. Statistical analyses were performed using Student’s t test. Results Plasma levels of stress-related hormones (adrenocorticotropin hormone, corticosterone, and noradrenaline) increased, following a circadian pattern and as compared to non-tumor controls, in mice bearing B16-F10 lung or liver metastases. Corticosterone and noradrenaline, at pathophysiological levels, increased expression and secretion of IL-6 in B16-F10 cells in vitro. Corticosterone- and noradrenaline-induced transcriptional up-regulation of IL-6 gene involves changes in the DNA binding activity of nuclear factor-κB, cAMP response element-binding protein, activator protein-1, and nuclear factor for IL-6. In vivo inoculation of B16-F10 cells transfected with anti-IL-6-siRNA, treatment with a glucocorticoid receptor blocker (RU-486) or with a β-adrenoceptor blocker (propranolol), increased hepatic GSH whereas decreased plasma IL-6 levels and metastatic growth. Corticosterone, but not NORA, also induced

  8. 1,25-dihydroxyvitamin D3 suppresses renin gene transcription by blocking the activity of the cyclic AMP response element in the renin gene promoter.

    PubMed

    Yuan, Weihua; Pan, Wei; Kong, Juan; Zheng, Wei; Szeto, Frances L; Wong, Kari E; Cohen, Ronald; Klopot, Anna; Zhang, Zhongyi; Li, Yan Chun

    2007-10-12

    We have shown that 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) down-regulates renin expression. To explore the molecular mechanism, we analyzed the mouse Ren-1c gene promoter by luciferase reporter assays. Deletion analysis revealed two DNA fragments from -2,725 to -2,647 (distal fragment) and from -117 to +6 (proximal fragment) that are sufficient to mediate the repression. Mutation of the cAMP response element (CRE) in the distal fragment blunted forskolin stimulation as well as 1,25(OH)(2)D(3) inhibition of the transcriptional activity, suggesting the involvement of CRE in 1,25(OH)(2)D(3)-induced suppression. EMSA revealed that 1,25(OH)(2)D(3) markedly inhibited nuclear protein binding to the CRE in the promoter. ChIP and GST pull-down assays demonstrated that liganded VDR blocked the binding of CREB to the CRE by directly interacting with CREB with the ligand-binding domain, and the VDR-mediated repression can be rescued by CREB, CBP, or p300 overexpression. These data indicate that 1,25(OH)(2)D(3) suppresses renin gene expression at least in part by blocking the formation of CRE-CREB-CBP complex.

  9. A calmodulin like EF hand protein positively regulates oxalate decarboxylase expression by interacting with E-box elements of the promoter

    PubMed Central

    Kamthan, Ayushi; Kamthan, Mohan; Kumar, Avinash; Sharma, Pratima; Ansari, Sekhu; Thakur, Sarjeet Singh; Chaudhuri, Abira; Datta, Asis

    2015-01-01

    Oxalate decarboxylase (OXDC) enzyme has immense biotechnological applications due to its ability to decompose anti-nutrient oxalic acid. Flammulina velutipes, an edible wood rotting fungus responds to oxalic acid by induction of OXDC to maintain steady levels of pH and oxalate anions outside the fungal hyphae. Here, we report that upon oxalic acid induction, a calmodulin (CaM) like protein-FvCaMLP, interacts with the OXDC promoter to regulate its expression. Electrophoretic mobility shift assay showed that FvCamlp specifically binds to two non-canonical E-box elements (AACGTG) in the OXDC promoter. Moreover, substitutions of amino acids in the EF hand motifs resulted in loss of DNA binding ability of FvCamlp. F. velutipes mycelia treated with synthetic siRNAs designed against FvCaMLP showed significant reduction in FvCaMLP as well as OXDC transcript pointing towards positive nature of the regulation. FvCaMLP is different from other known EF hand proteins. It shows sequence similarity to both CaMs and myosin regulatory light chain (Cdc4), but has properties typical of a calmodulin, like binding of 45Ca2+, heat stability and Ca2+ dependent electrophoretic shift. Hence, FvCaMLP can be considered a new addition to the category of unconventional Ca2+ binding transcriptional regulators. PMID:26455820

  10. A calmodulin like EF hand protein positively regulates oxalate decarboxylase expression by interacting with E-box elements of the promoter.

    PubMed

    Kamthan, Ayushi; Kamthan, Mohan; Kumar, Avinash; Sharma, Pratima; Ansari, Sekhu; Thakur, Sarjeet Singh; Chaudhuri, Abira; Datta, Asis

    2015-10-12

    Oxalate decarboxylase (OXDC) enzyme has immense biotechnological applications due to its ability to decompose anti-nutrient oxalic acid. Flammulina velutipes, an edible wood rotting fungus responds to oxalic acid by induction of OXDC to maintain steady levels of pH and oxalate anions outside the fungal hyphae. Here, we report that upon oxalic acid induction, a calmodulin (CaM) like protein-FvCaMLP, interacts with the OXDC promoter to regulate its expression. Electrophoretic mobility shift assay showed that FvCamlp specifically binds to two non-canonical E-box elements (AACGTG) in the OXDC promoter. Moreover, substitutions of amino acids in the EF hand motifs resulted in loss of DNA binding ability of FvCamlp. F. velutipes mycelia treated with synthetic siRNAs designed against FvCaMLP showed significant reduction in FvCaMLP as well as OXDC transcript pointing towards positive nature of the regulation. FvCaMLP is different from other known EF hand proteins. It shows sequence similarity to both CaMs and myosin regulatory light chain (Cdc4), but has properties typical of a calmodulin, like binding of (45)Ca(2+), heat stability and Ca(2+) dependent electrophoretic shift. Hence, FvCaMLP can be considered a new addition to the category of unconventional Ca(2+) binding transcriptional regulators.

  11. The CXCL10/CXCR3 axis promotes cardiac microvascular endothelial cell migration via the p38/FAK pathway in a proliferation-independent manner.

    PubMed

    Xia, Jing-Bo; Mao, Cheng-Zhou; Chen, Zhuo-Ying; Liu, Guang-Hui; Wu, Hai-Yan; Zhou, Deng-Cheng; Park, Kyu-Sang; Zhao, Hui; Kim, Soo-Ki; Cai, Dong-Qing; Qi, Xu-Feng

    2016-04-01

    CXCL10 is a chemokine with potent chemotactic activity for immune and non-immune cells expressing its receptor CXCR3. Previous studies have demonstrated that CXCL10 is involved in myocardial infarction. However, the role of CXCL10 in cardiac microvascular endothelial cell (CMEC) regulation and related mechanisms remains unclear. In this study, we investigated the effects of CXCL10 on the CMEC migration and explored its potential molecular mechanism by wound healing, cell proliferation and viability analysis. Furthermore, migration-related signaling pathways, including FAK, Erk, p38 and Smad, were examined by Western blotting. We found that CXCL10 significantly promotes CMEC migration under normal conditions and during hypoxia/ischemia. However, no significant differences in CMEC proliferation and viability were observed with or without CXCL10 treatment. CXCL10-mediated CMEC migration was greatly blocked by treatment with an anti-CXCR3 antibody. Although CXCL10 treatment promoted phosphorylation and activation of the FAK, Erk, and p38 pathways during hypoxia/ischemia, CXCL10-mediated CMEC migration was significantly blocked by p38 and FAK inhibitors, but not by an Erk inhibitor. Furthermore, CXCL10-mediated FAK activation was suppressed by the p38 inhibitor. These findings indicated that the CXCL10/CXCR3 pathway promotes the migration of CMECs under normal conditions and during hypoxia/ischemia in a proliferation-independent manner, at least in part, through regulation of the p38/FAK pathways.

  12. Identification of a regulatory element responsible for salt induction of rice OsRAV2 through ex situ and in situ promoter analysis.

    PubMed

    Duan, Yong-Bo; Li, Juan; Qin, Rui-Ying; Xu, Rong-Fang; Li, Hao; Yang, Ya-Chun; Ma, Hui; Li, Li; Wei, Peng-Cheng; Yang, Jian-Bo

    2016-01-01

    Salt is a major environmental stress factor that can affect rice growth and yields. Recent studies suggested that members of the AP2/ERF domain-containing RAV (related to ABI3/VP1) TF family are involved in abiotic stress adaptation. However, the transcriptional response of rice RAV genes (OsRAVs) to salt has not yet been fully characterized. In this study, the expression patterns of all five OsRAVs were examined under salt stress. Only one gene, OsRAV2, was stably induced by high-salinity treatment. Further expression profile analyses indicated that OsRAV2 is transcriptionally regulated by salt, but not KCl, osmotic stress, cold or ABA (abscisic acid) treatment. To elucidate the regulatory mechanism of the stress response at the transcriptional level, we isolated and characterized the promoter region of OsRAV2 (P OsRAV2 ). Transgenic analysis indicated that P OsRAV2 is induced by salt stress but not osmotic stress or ABA treatment. Serial 5' deletions and site-specific mutations in P OsRAV2 revealed that a GT-1 element located at position -664 relative to the putative translation start site is essential for the salt induction of P OsRAV2 . The regulatory function of the GT-1 element in the salt induction of OsRAV2 was verified in situ in plants with targeted mutations generated using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) system. Taken together, our results indicate that the GT-1 element directly controls the salt response of OsRAV2. This study provides a better understanding of the putative functions of OsRAVs and the molecular regulatory mechanisms of plant genes under salt stress.

  13. Activation of dioxin response element (DRE)-associated genes by benzo(a)pyrene 3,6-quinone and benzo(a)pyrene 1,6-quinone in MCF-10A human mammary epithelial cells

    SciTech Connect

    Burchiel, Scott W. . E-mail: SBurchiel@salud.unm.edu; Thompson, Todd A.; Lauer, Fredine T.; Oprea, Tudor I.

    2007-06-01

    Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known as electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress-associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1), PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor-associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion.

  14. A sugar beet chlorophyll a/b binding protein promoter void of G-box like elements confers strong and leaf specific reporter gene expression in transgenic sugar beet

    PubMed Central

    Stahl, Dietmar J; Kloos, Dorothee U; Hehl, Reinhard

    2004-01-01

    Background Modification of leaf traits in sugar beet requires a strong leaf specific promoter. With such a promoter, expression in taproots can be avoided which may otherwise take away available energy resources for sugar accumulation. Results Suppression Subtractive Hybridization (SSH) was utilized to generate an enriched and equalized cDNA library for leaf expressed genes from sugar beet. Fourteen cDNA fragments corresponding to thirteen different genes were isolated. Northern blot analysis indicates the desired tissue specificity of these genes. The promoters for two chlorophyll a/b binding protein genes (Bvcab11 and Bvcab12) were isolated, linked to reporter genes, and transformed into sugar beet using promoter reporter gene fusions. Transient and transgenic analysis indicate that both promoters direct leaf specific gene expression. A bioinformatic analysis revealed that the Bvcab11 promoter is void of G-box like regulatory elements with a palindromic ACGT core sequence. The data indicate that the presence of a G-box element is not a prerequisite for leaf specific and light induced gene expression in sugar beet. Conclusions This work shows that SSH can be successfully employed for the identification and subsequent isolation of tissue specific sugar beet promoters. These promoters are shown to drive strong leaf specific gene expression in transgenic sugar beet. The application of these promoters for expressing resistance improving genes against foliar diseases is discussed. PMID:15579211

  15. Kerb and urban increment of highly time-resolved trace elements in PM10, PM2.5 and PM1.0 winter aerosol in London during ClearfLo 2012

    NASA Astrophysics Data System (ADS)

    Visser, S.; Slowik, J. G.; Furger, M.; Zotter, P.; Bukowiecki, N.; Dressler, R.; Flechsig, U.; Appel, K.; Green, D. C.; Tremper, A. H.; Young, D. E.; Williams, P. I.; Allan, J. D.; Herndon, S. C.; Williams, L. R.; Mohr, C.; Xu, L.; Ng, N. L.; Detournay, A.; Barlow, J. F.; Halios, C. H.; Fleming, Z. L.; Baltensperger, U.; Prévôt, A. S. H.

    2015-03-01

    Ambient concentrations of trace elements with 2 h time resolution were measured in PM10-2.5, PM2.5-1.0 and PM1.0-0.3 size ranges at kerbside, urban background and rural sites in London during winter 2012. Samples were collected using rotating drum impactors (RDIs) and subsequently analysed with synchrotron radiation-induced X-ray fluorescence spectrometry (SR-XRF). Quantification of kerb and urban increments (defined as kerb-to-urban and urban-to-rural concentration ratios, respectively), and assessment of diurnal and weekly variability provided insight into sources governing urban air quality and the effects of urban micro-environments on human exposure. Traffic-related elements yielded the highest kerb increments, with values in the range of 10.4 to 16.6 for SW winds (3.3-6.9 for NE) observed for elements influenced by brake wear (e.g. Cu, Sb, Ba) and 5.7 to 8.2 for SW (2.6-3.0 for NE) for other traffic-related processes (e.g. Cr, Fe, Zn). Kerb increments for these elements were highest in the PM10-2.5 mass fraction, roughly twice that of the PM1.0-0.3 fraction. These elements also showed the highest urban increments (~ 3.0), although no difference was observed between brake wear and other traffic-related elements. All elements influenced by traffic exhibited higher concentrations during morning and evening rush hours, and on weekdays compared to weekends, with the strongest trends observed at the kerbside site, and additionally enhanced by winds coming directly from the road, consistent with street canyon effects. Elements related to mineral dust (e.g. Al, Si, Ca, Sr) showed significant influences from traffic-induced resuspension, as evidenced by moderate kerb (3.4-5.4 for SW, 1.7-2.3 for NE) and urban (~ 2) increments and increased concentrations during peak traffic flow. Elements related to regional transport showed no significant enhancement at kerb or urban sites, with the exception of PM10-2.5 sea salt (factor of up to 2), which may be influenced by

  16. Dental pain among 10–15 year old children attending oral health promoting schools: A cross-sectional study

    PubMed Central

    Saheer, Abdul; Kousalya, Pallavi Swami; Raju, Rekha; Gubbihal, Radha

    2015-01-01

    Introduction: Dental pain is a major public health problem and one of the consequences of oral diseases which requires significant adjustments in life management leading to decreased quality of life. Objective: To assess prevalence of dental pain and its impact on daily life and to explore its relationship with oral health behavior and clinical oral status among 10-15 year old school children attending oral health promoting schools. Method: This cross sectional study was conducted in 6 schools serving low -middle socio economic strata in Bangalore, India. A total of 1237 children were surveyed for history of dental pain during past 3 month. Participants who reported dental pain completed self-reported oral health behaviour and Child dental pain questionnaire. Clinical oral examination included assessment of dental caries, periodontal status. Data was analyzed using t - test, Chi-square test, ANOVA and Regression Analysis. Results: Prevalence of dental pain was 15.6% (n = 194). Among children with pain, 17%, 43% and 40% reported mild, moderate and severe pain. Impact on daily activities was reported by 66%. Mean DMFT and DMFS was 1.80 and 2.11 Mean deft and defs was 2.47 and 3.41. Multiple logistic regression revealed that severity and impact of dental pain was associated with gender, frequency of tooth brushing, consumption of sweets and deciduous dental caries experience. Conclusion: Prevalence of Dental pain is associated with brushing behavior, consumption of sweets and deciduous dental caries experience, showing need for further attention to these conditions and a need to strengthen preventive and therapeutic dental services. PMID:26942112

  17. Kerb and urban increment of highly time-resolved trace elements in PM10, PM2.5 and PM1.0 winter aerosol in London during ClearfLo 2012

    NASA Astrophysics Data System (ADS)

    Visser, S.; Slowik, J. G.; Furger, M.; Zotter, P.; Bukowiecki, N.; Dressler, R.; Flechsig, U.; Appel, K.; Green, D. C.; Tremper, A. H.; Young, D. E.; Williams, P. I.; Allan, J. D.; Herndon, S. C.; Williams, L. R.; Mohr, C.; Xu, L.; Ng, N. L.; Detournay, A.; Barlow, J. F.; Halios, C. H.; Fleming, Z. L.; Baltensperger, U.; Prévôt, A. S. H.

    2014-06-01

    Ambient concentrations of trace elements with 2 h time resolution were measured in PM10-2.5, PM2.5-1.0 and PM1.0-0.3 size ranges at kerbside, urban background and rural sites in London during winter 2012. Samples were collected using rotating drum impactors (RDIs) and subsequently analysed with synchrotron radiation-induced X-ray fluorescence spectrometry (SR-XRF). Quantification of kerb and urban increments (defined as kerb-to-urban and urban-to-rural concentration ratios, respectively), and assessment of diurnal and weekly variability provided insight into sources governing urban air quality and the effects of urban micro-environments on human exposure. Traffic-related elements yielded the highest kerb increments, with values in the range of 11.6 to 18.5 for SW winds (3.6-9.4 for NE) observed for elements influenced by brake wear (e.g. Cu, Sb, Ba) and 5.6 to 8.0 for SW (2.6-6.5 for NE) for other traffic-related processes (e.g. Cr, Fe, Zn). Kerb increments for these elements were highest in the PM10-2.5 mass fraction, roughly 3 times that of the PM1.0-0.3 fraction. These elements also showed the highest urban increments (∼3.0), although no difference was observed between brake wear and other traffic-related elements. Traffic-related elements exhibited higher concentrations during morning and evening rush hour, and on weekdays compared to weekends, with the strongest trends observed at the kerbside site, and additionally enhanced by winds coming directly from the road, consistent with street canyon effects. Elements related to mineral dust (e.g. Al, Ca, Sr) showed significant influences from traffic-induced resuspension, as evidenced by moderate kerb (2.0-4.1 for SW, 1.4-2.1 for NE) and urban (1.7-2.3) increments and increased concentrations during peak traffic flow. Elements related to regional transport showed no significant enhancement at kerb or urban sites, with the exception of PM10-2.5 sea salt (factor of 1.5-2.0), which may be influenced by traffic

  18. Direct regulation of the Microphthalmia promoter by Sox10 links Waardenburg-Shah syndrome (WS4)-associated hypopigmentation and deafness to WS2.

    PubMed

    Lee, M; Goodall, J; Verastegui, C; Ballotti, R; Goding, C R

    2000-12-01

    The transcription factor Sox10 is genetically linked with Waardenburg syndrome 4 (WS4) in humans and the Dominant megacolon (Dom) mouse model for this disease. The pigmentary defects observed in the Dom mouse and WS4 are reminiscent of those associated with mutations in the microphthalmia (Mitf) gene, which encodes a transcription factor essential for the development of the melanocyte lineage. We demonstrate here that wild type Sox10 directly binds and activates transcription of the MITF promoter, whereas a mutant form of the Sox10 protein genetically linked with WS4 acts as a dominant-negative repressor of MITF expression and can reduce endogenous MITF protein levels. The ability of Sox10 to activate transcription of the MITF promoter implicates Sox10 in the regulation of melanocyte development and provides a molecular basis for the hypopigmentation and deafness associated with WS4.

  19. The Upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia

    PubMed Central

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D.; Mansfield, Brian C.; Chou, Janice Y.

    2013-01-01

    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. PMID:23856420

  20. The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.

    PubMed

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y

    2013-11-01

    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia.

  1. Far upstream element-binding protein 1 (FUBP1) is a potential c-Myc regulator in esophageal squamous cell carcinoma (ESCC) and its expression promotes ESCC progression.

    PubMed

    Yang, Lei; Zhu, Jun-Ya; Zhang, Jian-Guo; Bao, Bo-Jun; Guan, Cheng-Qi; Yang, Xiao-Jing; Liu, Yan-Hua; Huang, Yue-Jiao; Ni, Run-Zhou; Ji, Li-Li

    2016-03-01

    The human far upstream element (FUSE) binding protein 1 (FUBP1) belongs to an ancient family which is required for proper regulation of the c-Myc proto-oncogene. Although c-Myc plays an important role in development of various carcinomas, the relevance of FUBP1 and their contribution to esophageal squamous cell carcinoma (ESCC) development remain unclear. In this study, we aimed to investigate the relationship between FUBP1 and c-Myc as well as their contribution to ESCC development. Western blot and immunohistochemical analyses were performed to evaluate FUBP1 expression. Coimmunoprecipitation analysis was performed to explore the correlation between FUBP1 and c-Myc in ESCC. In addition, the role of FUBP1 in ESCC proliferation was studied in ESCC cells through knocking FUBP1 down. The regulation of FUBP1 on proliferation was confirmed by Cell Counting Kit-8 (CCK-8) assay, flow cytometric assays, and clone formation assays. The expressions of FUBP1 and c-Myc were both upregulated in ESCC tissues. In addition to correlation between expression of FUBP1 and tumor grade, we also confirmed the correlation of FUBP1, c-Myc, and Ki-67 expression by twos. Moreover, upregulation of FUBP1 and c-Myc in ESCC was associated with poor survival. FUBP1 was confirmed to activate c-Myc in ESCC tissues and cells. FUBP1 was demonstrated to promote proliferation of ESCC cells. Moreover, downregulation of both FUBP1 and c-Myc was confirmed to inhibit proliferation of ESCC cells. Our results indicated that FUBP1 may potentially stimulate c-Myc expression in ESCC and its expression may promote ESCC progression.

  2. Long interspersed nucleotide acid element-1 ORF-1 protein promotes proliferation and invasion of human colorectal cancer LoVo cells through enhancing ETS-1 activity.

    PubMed

    Li, M Y; Zhu, M; Feng, F; Cai, F Y; Fan, K C; Jiang, H; Wang, Z Q; Linghu, E Q

    2014-04-14

    The human proto-oncogene long interspersed nucleotide acid element-1 (LINE-1) open reading frame-1 protein (ORF-1p) is involved in the progress of several cancers. The transcription factor ETS-1 can mediate the transcription of some downstream genes that play specific roles in the regulation of cancerous cell invasion and metastasis. In this study, the effects of LINE-1 ORF-1p on ETS-1 activity and on the proliferation and invasion of human colorectal cancer LoVo cells were investigated. Results showed that the overexpression of LINE-1 ORF-1p enhanced the transcription of ETS-1 downstream genes and increased their protein levels, and downregulation of the LINE-1 ORF-1p level by small interfering RNA (siRNA) reduced the transcriptional activation of ETS-1. In addition, overexpression of LINE-1 ORF-1p promoted LoVo cell proliferation and anchor-independent growth, and a knockdown of the LINE-1 protein level by siRNA reduced the proliferation and anchor-independent growth ability of LoVo cells. In vivo data revealed that LINE-1 ORF-1p overexpression increased LoVo tumor growth in nude mice, whereas the siRNA knockdown of endogenous LINE-1 ORF-1p expression decreased LoVo cell growth in nude mice. Therefore, LINE- 1 ORF-1p could promote LoVo cell proliferation and invasion both in vitro and in vivo, indicating that it might be a useful molecular target for the treatment of human colorectal cancer.

  3. The red sport of 'Zaosu' pear and its red-striped pigmentation pattern are associated with demethylation of the PyMYB10 promoter.

    PubMed

    Qian, Minjie; Sun, Yongwang; Allan, Andrew C; Teng, Yuanwen; Zhang, Dong

    2014-11-01

    'Zaosu' pear, a hybrid of Pyrus pyrifolia and Pyrus communis, is a popular cultivar developed in China. 'Zaosu Red' is a bud sport of 'Zaosu' with red shoots, young leaves, and fruit. After grafting of 'Zaosu Red', reverse mutations in some branches lead to a loss of colour in leaves and stems. Also, the mature fruit of 'Zaosu Red' exhibits two phenotypes; fully red and striped. The aim of this study was to establish the mechanism of the red colour mutation in 'Zaosu' and the striped pigmentation pattern in fruit of 'Zaosu Red'. The accumulation of anthocyanins and transcript levels of the genes PpUFGT2 and PyMYB10 were highly correlated. The open reading frames (ORF) and promoter regions of these two key genes were cloned and compared between 'Zaosu' and its bud sports, but no sequence differences were found. The R2R3 MYB, PyMYB10, can activate expression of genes encoding enzymes of the anthocyanin biosynthetic pathway. A yeast one-hybrid assay showed that PyMYB10 was associated with the -658 to -172bp fragment of the PpUFGT2 promoter, probably via a MYB binding site (MBS) located at -466bp. The PyMYB10 promoter had lower methylation levels in anthocyanin-rich tissues, indicating that the red bud sport of 'Zaosu' pear and the striped pigmentation pattern of 'Zaosu Red' pear are associated with demethylation of the PyMYB10 promoter.

  4. Hepatic and renal concentrations of 10 trace elements in crocodiles (Crocodylus niloticus) in the Kafue and Luangwa rivers in Zambia.

    PubMed

    Almli, Bjørn; Mwase, Maxwell; Sivertsen, Tore; Musonda, Mike M; Flåøyen, Arne

    2005-01-20

    Hepatic and renal concentrations of the elements arsenic, cadmium, cobalt, copper, lead, manganese, mercury, molybdenum, selenium and zinc were determined in samples collected from four crocodiles from the Kafue River, Kafue National Park and five crocodiles from the Luangwa River, Luangwa National Park, Zambia. The concentrations of the essential elements were similar to those reported in other vertebrates. Arsenic and cadmium concentrations were low (medians below 0.05 microg As/g and below 0.16 microg Cd/g, wet wt.). Mercury and lead concentrations were several orders of magnitude higher (medians up to 3.7 microg Hg/g, and up to 8.7 microg Pb/g, all wet wt.) than in hippopotami from the same rivers, probably as a result of food-chain biomagnification. Judging by the results obtained in this study, pollution from the mining activity around the Kafue River drainage area in the Copperbelt region has not significantly influenced the trace element concentrations in tissues of the crocodiles in the Kafue National Park. The trace element concentrations measured may serve as reference values in future studies on crocodilians.

  5. Best Short Stories. Middle Level. 10 Stories for Young Adults--With Lessons for Teaching the Basic Elements of Literature.

    ERIC Educational Resources Information Center

    Harris, Raymond

    This workbook contains ten short stories by modern masters aimed at young adult readers, with each story followed by a concise lesson on a basic element of literature (such as plot, setting, or mood) clearly illustrated in the story. Some of the authors represented in the book are John Updike, Isaac Bashevis Singer, Carson McCullers, and Ray…

  6. Promotion of morphological transformation by Di-n-butyltin dichloride in C3H/10T1/2 cells: prediction by prior expression of tumour promoter-responsive genes.

    PubMed

    Parfett, C L; Marquardt, T; Pilon, R

    2000-04-01

    Previous studies in our laboratory have shown that chemical treatments may induce increases in proliferin gene family mRNA accumulation in cultured murine embryonic cells. Proliferin inductions are highly correlated with subsequent promotional outcomes during two-stage focus-formation assays in C3H/10T1/2 cell cultures. In work reported here, the strong affiliation between these two responses was further validated after treating cells with di-n-butyltin dichloride which is a polyvinyl chloride (PVC) plastic additive that often contaminates food and water. Increased proliferin expression and promotion of morphological transformation occurred at similar concentrations. Promotion of transformation was detected at di-n-butyltin dichloride concentrations of 80 nM (24 ng/ml) and above, if added to initiated cultures before confluent monolayers had formed. Proliferin induction and morphological transformation were both reduced in confluent cultures treated with di-n-butyltin dichloride, as compared to subconfluent cultures. Proliferin expression measured in near-confluent cultures was induced up to 10-fold during the 36-hr period following di-n-butyltin dichloride exposure and was accompanied by increased accumulation of transcripts from many genes regulated by oxidative stresses, growth-inducing agents, and/or other promoting agents (asbestos, superoxide radicals ). Di-n-butyltin dichloride-induced mRNA species included members of the fos and jun proto-oncogene families, c-myc, egr1, ribonucleotide reductase (R2 subunit), odc, macrophage chemotactic protein/je, hsp70, metallothionine IIA, c-sod and mn-sod. The observed patterns of RNA accumulation suggested that a small subset of mRNA species, including proliferin, exhibit regulatory behaviour as a response to dissimilar agents or conditions that promote focus-formation in C3H/10T1/2 cultures. Plausible predictions of promotional effects in two-stage morphological transformation assays can be made from gene

  7. Spatial/temporal variations of elemental carbon, organic carbon, and trace elements in PM10 and the impact of land-use patterns on community air pollution in Paterson, NJ.

    PubMed

    Yu, Chang Ho; Fan, Zhi-Hua; Meng, Qingyu; Zhu, Xianlei; Korn, Leo; Bonanno, Linda J

    2011-06-01

    An urban community PM10 (particulate matter < or = 10 microm in aerodynamic diameter) air pollution study was conducted in Paterson, NJ, a mixed land-use community that is interspersed with industrial, commercial, mobile, and residential land-use types. This paper examines (1) the spatial/temporal variation of PM10, elemental carbon (EC), organic carbon (OC), and nine elements; and (2) the impact of land-use type on those variations. Air samples were collected from three community-oriented locations in Paterson that attempted to capture industrial, commercial, and mobile source-dominated emissions. Sampling was conducted for 24 hr every 6 days from November 2005 through December 2006. Samples were concurrently collected at the New Jersey Department of Environmental Protection-designated air toxics background site in Chester, NJ. PM10 mass, EC, OC, and nine elements (Ca, Cu, Fe, Pb, Mn, Ni, S, Ti, and Zn) that had more than 50% of samples above detection and known sources or are toxic were selected for spatial/temporal analysis in this study. The concentrations of PM10, EC, OC, and eight elements (except S) were significantly higher in Paterson than in Chester (P < 0.05). The concentrations of these elements measured in Paterson were also found to be higher during winter than the other three seasons (except S), and higher on weekdays than on weekends (except Pb). The concentrations of EC, Cu, Fe, and Zn at the commercial site in Paterson were significantly higher than the industrial and mobile sites; however, the other eight species were not significantly different within the city (P > 0.05). These results indicated that anthropogenic sources of air pollution were present in Paterson. The source apportionment confirmed the impact of vehicular and industrial emissions on the PM10 ambient air pollution in Paterson. The multiple linear regression analysis showed that categorical land-use type was a significant predictor for all air pollution levels, explaining up to 42

  8. Spatial/Temporal Variations of Elemental Carbon, Organic Carbon, and Trace Elements in PM10 and the Impact of Land-Use Patterns on Community Air Pollution in Paterson, NJ

    PubMed Central

    Yu, Chang Ho; Fan, Zhi-Hua; Meng, Qingyu; Zhu, Xianlei; Korn, Leo; Bonanno, Linda J.

    2014-01-01

    An urban community PM10 (particulate matter ≤ 10 μm in aerodynamic diameter) air pollution study was conducted in Paterson, NJ, a mixed land-use community that is interspersed with industrial, commercial, mobile, and residential land-use types. This paper examines (1) the spatial/temporal variation of PM10, elemental carbon (EC), organic carbon (OC), and nine elements; and (2) the impact of land-use type on those variations. Air samples were collected from three community-oriented locations in Paterson that attempted to capture industrial, commercial, and mobile source-dominated emissions. Sampling was conducted for 24 hr every 6 days from November 2005 through December 2006. Samples were concurrently collected at the New Jersey Department of Environmental Protection-designated air toxics background site in Chester, NJ. PM10 mass, EC, OC, and nine elements (Ca, Cu, Fe, Pb, Mn, Ni, S, Ti, and Zn) that had more than 50% of samples above detection and known sources or are toxic were selected for spatial/temporal analysis in this study. The concentrations of PM10, EC, OC, and eight elements (except S) were significantly higher in Paterson than in Chester (P < 0.05). The concentrations of these elements measured in Paterson were also found to be higher during winter than the other three seasons (except S), and higher on weekdays than on weekends (except Pb). The concentrations of EC, Cu, Fe, and Zn at the commercial site in Paterson were significantly higher than the industrial and mobile sites; however, the other eight species were not significantly different within the city (P > 0.05). These results indicated that anthropogenic sources of air pollution were present in Paterson. The source apportionment confirmed the impact of vehicular and industrial emissions on the PM10 ambient air pollution in Paterson. The multiple linear regression analysis showed that categorical land-use type was a significant predictor for all air pollution levels, explaining up to 42% of

  9. Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

    SciTech Connect

    Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju; Liao, Yi-Ji; Lin, Sheng; Zong, Yong-Sheng; Zeng, Mu-Sheng; Zeng, Yi-Xin; Mai, Shi-Juan; Xie, Dan

    2011-12-20

    Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.

  10. Methanol-Independent Protein Expression by AOX1 Promoter with trans-Acting Elements Engineering and Glucose-Glycerol-Shift Induction in Pichia pastoris.

    PubMed

    Wang, Jinjia; Wang, Xiaolong; Shi, Lei; Qi, Fei; Zhang, Ping; Zhang, Yuanxing; Zhou, Xiangshan; Song, Zhiwei; Cai, Menghao

    2017-02-02

    The alcohol oxidase 1 promoter (PAOX1) of Pichia pastoris is commonly used for high level expression of recombinant proteins. While the safety risk of methanol and tough process control for methanol induction usually cause problems especially in large-scale fermentation. By testing the functions of trans-acting elements of PAOX1 and combinatorially engineering of them, we successfully constructed a methanol-free PAOX1 start-up strain, in which, three transcription repressors were identified and deleted and, one transcription activator were overexpressed. The strain expressed 77% GFP levels in glycerol compared to the wide-type in methanol. Then, insulin precursor (IP) was expressed, taking which as a model, we developed a novel glucose-glycerol-shift induced PAOX1 start-up for this methanol-free strain. A batch phase with glucose of 40 g/L followed by controlling residual glucose not lower than 20 g/L was compatible for supporting cell growth and suppressing PAOX1. Then, glycerol induction was started after glucose used up. Accordingly, an optimal bioprocess was further determined, generating a high IP production of 2.46 g/L in a 5-L bioreactor with dramatical decrease of oxygen consumption and heat evolution comparing with the wild-type in methanol. This mutant and bioprocess represent a safe and efficient alternative to the traditional glycerol-repressed/methanol-induced PAOX1 system.

  11. Methanol-Independent Protein Expression by AOX1 Promoter with trans-Acting Elements Engineering and Glucose-Glycerol-Shift Induction in Pichia pastoris

    PubMed Central

    Wang, Jinjia; Wang, Xiaolong; Shi, Lei; Qi, Fei; Zhang, Ping; Zhang, Yuanxing; Zhou, Xiangshan; Song, Zhiwei; Cai, Menghao

    2017-01-01

    The alcohol oxidase 1 promoter (PAOX1) of Pichia pastoris is commonly used for high level expression of recombinant proteins. While the safety risk of methanol and tough process control for methanol induction usually cause problems especially in large-scale fermentation. By testing the functions of trans-acting elements of PAOX1 and combinatorially engineering of them, we successfully constructed a methanol-free PAOX1 start-up strain, in which, three transcription repressors were identified and deleted and, one transcription activator were overexpressed. The strain expressed 77% GFP levels in glycerol compared to the wide-type in methanol. Then, insulin precursor (IP) was expressed, taking which as a model, we developed a novel glucose-glycerol-shift induced PAOX1 start-up for this methanol-free strain. A batch phase with glucose of 40 g/L followed by controlling residual glucose not lower than 20 g/L was compatible for supporting cell growth and suppressing PAOX1. Then, glycerol induction was started after glucose used up. Accordingly, an optimal bioprocess was further determined, generating a high IP production of 2.46 g/L in a 5-L bioreactor with dramatical decrease of oxygen consumption and heat evolution comparing with the wild-type in methanol. This mutant and bioprocess represent a safe and efficient alternative to the traditional glycerol-repressed/methanol-induced PAOX1 system. PMID:28150747

  12. Promoter chromatin remodeling of immediate-early genes is mediated through H3 phosphorylation at either serine 28 or 10 by the MSK1 multi-protein complex

    PubMed Central

    Drobic, Bojan; Pérez-Cadahía, Beatriz; Yu, Jenny; Kung, Sam Kam-Pun; Davie, James R.

    2010-01-01

    Upon activation of the ERK and p38 MAPK pathways, the MSK1/2-mediated nucleosomal response, including H3 phosphorylation at serine 28 or 10, is coupled with the induction of immediate-early (IE) gene transcription. The outcome of this response, varying with the stimuli and cellular contexts, ranges from neoplastic transformation to neuronal synaptic plasticity. Here, we used sequential co-immunoprecipitation assays and sequential chromatin immunoprecipitation (ChIP) assays on mouse fibroblast 10T1/2 and MSK1 knockdown 10T1/2 cells to show that H3 serine 28 and 10 phosphorylation leads to promoter remodeling. MSK1, in complexes with phospho-serine adaptor 14-3-3 proteins and BRG1 the ATPase subunit of the SWI/SNF remodeler, is recruited to the promoter of target genes by transcription factors such as Elk-1 or NF-κB. Following MSK1-mediated H3 phosphorylation, BRG1 associates with the promoter of target genes via 14-3-3 proteins, which act as scaffolds. The recruited SWI/SNF remodels nucleosomes at the promoter of IE genes enabling the binding of transcription factors like JUN and the onset of transcription. PMID:20129940

  13. Mass concentration and elemental composition of indoor PM 2.5 and PM 10 in University rooms in Thessaloniki, northern Greece

    NASA Astrophysics Data System (ADS)

    Gemenetzis, Panagiotis; Moussas, Panagiotis; Arditsoglou, Anastasia; Samara, Constantini

    The mass concentration and the elemental composition of PM 2.5 and PM 10 were measured in 40 rooms (mainly offices or mixed office-lab rooms, and photocopying places) of the Aristotle University of Thessaloniki, northern Greece. A total of 27 major, minor and trace elements were determined by ED-XRF analysis. The PM 2.5/PM 10 concentration ratios averaged 0.8±0.2, while the corresponding elemental ratios ranged between 0.4±0.2 and 0.9±0.2. The concentrations of PM 2.5 and PM 10 were significantly higher (by 70% and 50%, respectively) in the smokers' rooms compared to the non-smokers' places. The total elemental concentrations were also higher in the smokers' rooms (11.5 vs 8.2 μg m -3 for PM 2.5, and 10.3 vs 7.6 μg m -3 for PM 2.5-10). Fine particle concentrations (PM 2.5) were found to be quite proportional to smoking strength. On the contrary, the two environments exhibited similar coarse (PM 2.5-10) particle fractions not related to the number of cigarettes smoked. A slight decrease of particle concentrations with increasing the floor level was also observed, particularly for PM 2.5, suggesting that high-level floors are less impacted by near ground-level sources like traffic emissions. Finally, the removal efficiency of air purification systems was evaluated.

  14. Interleukin 2 and interleukin 10 function synergistically to promote CD8(+) T cell cytotoxicity, which is suppressed by regulatory T cells in breast cancer.

    PubMed

    Li, Xiaogang; Lu, Ping; Li, Bo; Zhang, Wanfu; Yang, Rong; Chu, Yan; Luo, Kaiyuan

    2017-03-06

    The precise role of interleukin (IL)-10 in breast cancer is not clear. Previous studies suggested a tumor-promoting role of IL-10 in breast cancer, whereas recent discoveries that IL-10 activated and expanded tumor-resident CD8(+) T cells challenged the traditional view. Here, we investigated the role of IL-10 in HLA-A2-positive breast cancer patients with Grade III, Stage IIA or IIB in-situ and invasive ductal carcinoma, and compared it with that of IL-2, the canonical CD8(+) T cell growth factor. We first observed that breast cancer patients presented higher serum levels of IL-2 and IL-10 than healthy controls. Upon prolonged TCR stimulation, peripheral blood CD8(+) T cells from breast cancer patients tended to undergo apoptosis, which could be prevented by the addition of IL-2 and/or IL-10. The cytotoxicity of TCR-activated CD8(+) T cells was also enhanced by exogenous IL-2 and/or IL-10. Interestingly, IL-2 and IL-10 demonstrated synergistic effects, since the enhancement in CD8(+) T cell function when both cytokines were added was greater than the sum of the improvements mediated by each individual cytokine. IL-10 by itself could not promote the proliferation of CD8(+) T cells but could significantly enhance IL-2-mediated promotion of CD8(+) T cell proliferation. In addition, the cytotoxicity of tumor-infiltrating CD8(+) T cells in breast tumor was elevated when both IL-2 and IL-10 were present but not when either one was absent. This synergistic effect was stopped by CD4(+)CD25(+) regulatory T cells (Treg), which depleted IL-2 in a cell number-dependent manner. Together, these results demonstrated that IL-2 and IL-10 could work synergistically to improve the survival, proliferation, and cytotoxicity of activated CD8(+) T cells, an effect suppressible by CD4(+)CD25(+) Treg cells.

  15. Interaction between composite elements in the napA promoter: both the B-box ABA-responsive complex and the RY/G complex are necessary for seed-specific expression.

    PubMed

    Ezcurra, I; Ellerström, M; Wycliffe, P; Stålberg, K; Rask, L

    1999-07-01

    During seed maturation, the transcriptional activity of napin genes is regulated by developmental signals involving the transcriptional activator ABI3 and abscisic acid (ABA). To localize cis elements involved in the seed-specific activity of the napin napA promoter, a systematic analysis was performed focusing on two major element complexes, the B-box and RY/G. Substitution mutation analysis using promoter-reporter gene fusions in stable transgenic tobacco showed synergistic interactions between elements within these complexes. The distal part of the B-box shows similarities to abscisic acid response elements and the proximal portion contains a CA-rich element. In vitro studies involving Exonuclease III protection and electrophoretic mobility shift assays revealed binding by nuclear proteins to elements within the B-box. The distal and proximal parts of the B-box were found to bind distinct nuclear protein complexes. By gain-of-function analysis with a tetramer of the B-box fused to a truncated (-46) cauliflower mosaic virus (CaMV) 35S minimal promoter, it was demonstrated that the B-box mediates strong activity in seeds. Further, it was shown that the elements in the B-box constitute an ABA-responsive complex, since the B-box tetramer mediates ABA-responsiveness in vegetative tissues to a construct containing the CaMV virus 35S enhancer (-343 to -90). Thus, the seed-specific activity of the napA promoter relies on the combinatorial interaction between the RY/G complex and the B-box ABA-responsive complex during the ABA response in seed development.

  16. The E6/E7 promoter of human papillomavirus type 16 is activated in the absence of E2 proteins by a sequence-aberrant Sp1 distal element.

    PubMed Central

    Gloss, B; Bernard, H U

    1990-01-01

    The E6/E7 promoter of all genital human papillomaviruses is responsible for expression of the viral transforming genes. Centered 60 bp upstream of the transcription start, it contains a 20-bp segment with partially overlapping binding sites for the viral E2 proteins and for a cellular factor that was identified by footprint experiments. Bandshifts, bandshift competitions, and footprints revealed that protein complexes between nuclear extracts and these sequences have binding properties indistinguishable from those of the Sp1 factor that binds the simian virus 40 early promoter GC motif. Reactions of these complexes with anti-Sp1 antiserum were analyzed by superbandshifts and precipitation with protein A, and the results confirmed the identity of this transcription factor as Sp1. Sp1 binds in simian virus 40 and different human papillomavirus promoters the consensus sequence 5'-NGGNGN-3'. RNase protection analysis of in vitro or in vivo transcriptions with wild-type and mutant test vectors shows that the E6/E7 promoter of human papillomavirus type 16 is functionally dependent on the Sp1 distal promoter element. In all genital papillomaviruses, the Sp1 hexamer is invariably spaced by a single nucleotide from the distal E2 element, suggesting some precise interaction between Sp1 and E2 proteins. Published experimental evidence documents negative regulation of the E6/E7 promoter by E2 proteins through the proximal E2 element, whereas only minor quantitative differences in E6/E7 promoter function after cotransfection with E2 expression vectors were observed in this study. A detailed study of the interactions of Sp1 and E2 proteins with one another and with the corresponding three binding sites may reveal a complex modulation of this promoter. Images PMID:2170687

  17. Evaluation of elemental status of ancient human bone samples from Northeastern Hungary dated to the 10th century AD by XRF

    NASA Astrophysics Data System (ADS)

    János, I.; Szathmáry, L.; Nádas, E.; Béni, A.; Dinya, Z.; Máthé, E.

    2011-11-01

    The present study is a multielemental analysis of bone samples belonging to skeletal individuals originating from two contemporaneous (10th century AD) cemeteries (Tiszavasvári Nagy-Gyepáros and Nagycserkesz-Nádasibokor sites) in Northeastern Hungary, using the XRF analytical technique. Emitted X-rays were detected in order to determine the elemental composition of bones and to appreciate the possible influence of the burial environment on the elemental content of the human skeletal remains. Lumbar vertebral bodies were used for analysis. Applying the ED(P)XRF technique concentration of the following elements were determined: P, Ca, K, Na, Mg, Al, Cl, Mn, Fe, Zn, Br and Sr. The results indicated post mortem mineral exchange between the burial environment (soil) and bones (e.g. the enhanced levels of Fe and Mn) and referred to diagenetic alteration processes during burials. However, other elements such as Zn, Sr and Br seemed to be accumulated during the past life. On the basis of statistical analysis, clear separation could not be observed between the two excavation sites in their bone elemental concentrations which denoted similar diagenetic influences, environmental conditions. The enhanced levels of Sr might be connected with the past dietary habits, especially consumption of plant food.

  18. PDCD10 interacts with Ste20-related kinase MST4 to promote cell growth and transformation via modulation of the ERK pathway.

    PubMed

    Ma, Xi; Zhao, Hongshan; Shan, Jingxuan; Long, Feng; Chen, Yaoyao; Chen, Yingyu; Zhang, Yingmei; Han, Xiao; Ma, Dalong

    2007-06-01

    PDCD10 (programmed cell death 10, TFAR15), a novel protein associated with cell apoptosis has been recently implicated in mutations associated with Cerebral Cavernous Malformations (CCM). Yeast two-hybrid screening revealed that PDCD10 interacts with MST4, a member of Ste20-related kinases. This interaction was confirmed by coimmunoprecipitation and colocalization assays in mammalian cells. Furthermore, the co-overexpression of PDCD10 and MST4 promoted cell proliferation and transformation via modulation of the extracellular signal-regulated kinase (ERK) pathway. Potent short interfering RNAs (siRNAs) against PDCD10 (siPDCD10) and MST4 (siMST4) were designed to specifically inhibit the expression of PDCD10 and MST4 mRNA, respectively. The induction of siPDCD10 or siMST4 resulted in decreased expression of endogenous PDCD10 or MST4, which was accompanied by reduced ERK activity and attenuated cell growth and anchorage-independent growth. On the other hand, siMST4 had similar effects in PDCD10-overexpressed cells. And more importantly, we confirmed that either overexpressing or endogenous PDCD10 can increase the MST4 kinase activity in vitro. Our results demonstrated that PDCD10 modulation of ERK signaling was mediated by MST4, and PDCD10 could be a regulatory adaptor necessary for MST4 function, suggesting a link between cerebral cavernous malformation pathogenesis and the ERK-MAPK cascade via PDCD10/MST4.

  19. Energy spectra of elements with 18 or = Z or = 28 between 10 and 300 GeV/amu

    NASA Technical Reports Server (NTRS)

    Jones, M. D.; Klarmann, J.; Stone, E. C.; Waddington, C. J.; Binns, W. R.; Garrard, T. L.; Israel, M. H.

    1985-01-01

    The HEAO-3 Heavy Nuclei Experiment is composed of ionization chambers above and below a plastic Cerenkov counter. The energy dependence of the abundances of elements with atomic number, Z, between 18 and 28 at very high energies where they are rare and thus need the large area x time are measured. The measurements of the Danish-French HEAO-3 experiment (Englemann,, et al., 1983) are extended to higher energies, using the relativistic rise of ionization signal as a measure of energy. Source abundances for Ar and Ca were determined.

  20. FELIX-1.0: A finite element solver for the time dependent generator coordinate method with the Gaussian overlap approximation

    SciTech Connect

    Regnier, D.; Verriere, M.; Dubray, N.; Schunck, N.

    2015-11-30

    In this study, we describe the software package FELIX that solves the equations of the time-dependent generator coordinate method (TDGCM) in NN-dimensions (N ≥ 1) under the Gaussian overlap approximation. The numerical resolution is based on the Galerkin finite element discretization of the collective space and the Crank–Nicolson scheme for time integration. The TDGCM solver is implemented entirely in C++. Several additional tools written in C++, Python or bash scripting language are also included for convenience. In this paper, the solver is tested with a series of benchmarks calculations. We also demonstrate the ability of our code to handle a realistic calculation of fission dynamics.

  1. IRBIT controls apoptosis by interacting with the Bcl-2 homolog, Bcl2l10, and by promoting ER-mitochondria contact

    PubMed Central

    Bonneau, Benjamin; Ando, Hideaki; Kawaai, Katsuhiro; Hirose, Matsumi; Takahashi-Iwanaga, Hiromi; Mikoshiba, Katsuhiko

    2016-01-01

    IRBIT is a molecule that interacts with the inositol 1,4,5-trisphosphate (IP3)-binding pocket of the IP3 receptor (IP3R), whereas the antiapoptotic protein, Bcl2l10, binds to another part of the IP3-binding domain. Here we show that Bcl2l10 and IRBIT interact and exert an additive inhibition of IP3R in the physiological state. Moreover, we found that these proteins associate in a complex in mitochondria-associated membranes (MAMs) and that their interplay is involved in apoptosis regulation. MAMs are a hotspot for Ca2+ transfer between endoplasmic reticulum (ER) and mitochondria, and massive Ca2+ release through IP3R in mitochondria induces cell death. We found that upon apoptotic stress, IRBIT is dephosphorylated, becoming an inhibitor of Bcl2l10. Moreover, IRBIT promotes ER mitochondria contact. Our results suggest that by inhibiting Bcl2l10 activity and promoting contact between ER and mitochondria, IRBIT facilitates massive Ca2+ transfer to mitochondria and promotes apoptosis. This work then describes IRBIT as a new regulator of cell death. DOI: http://dx.doi.org/10.7554/eLife.19896.001 PMID:27995898

  2. Source Apportionment and Elemental Composition of PM2.5 and PM10 in Jeddah City, Saudi Arabia

    PubMed Central

    Khodeir, Mamdouh; Shamy, Magdy; Alghamdi, Mansour; Zhong, Mianhua; Sun, Hong; Costa, Max; Chen, Lung-Chi; Maciejczyk, Polina

    2014-01-01

    This paper presents the first comprehensive investigation of PM2.5 and PM10 composition and sources in Saudi Arabia. We conducted a multi-week multiple sites sampling campaign in Jeddah between June and September, 2011, and analyzed samples by XRF. The overall mean mass concentration was 28.4 ± 25.4 μg/m3 for PM2.5 and 87.3 ± 47.3 μg/m3 for PM10, with significant temporal and spatial variability. The average ratio of PM2.5/PM10 was 0.33. Chemical composition data were modeled using factor analysis with varimax orthogonal rotation to determine five and four particle source categories contributing significant amount of for PM2.5 and PM10 mass, respectively. In both PM2.5 and PM10 sources were (1) heavy oil combustion characterized by high Ni and V; (2) resuspended soil characterized by high concentrations of Ca, Fe, Al, and Si; and (3) marine aerosol. The two other sources in PM2.5 were (4) Cu/Zn source; (5) traffic source identified by presence of Pb, Br, and Se; while in PM10 it was a mixed industrial source. To estimate the mass contributions of each individual source category, the CAPs mass concentration was regressed against the factor scores. Cumulatively, resuspended soil and oil combustion contributed 77 and 82% mass of PM2.5 and PM10, respectively. PMID:24634602

  3. Validation of trans-acting elements that promote exon 7 skipping of SMN2 in SMN2-GFP stable cell line.

    PubMed

    Cho, Sunghee; Moon, Heegyum; Yang, Xiaoming; Zhou, Jianhua; Kim, Hye-Ran; Shin, Myung-Geun; Loh, Tiing Jen; Zheng, Xuexiu; Shen, Haihong

    2012-07-06

    Spinal muscular atrophy is a genetic disease in which the SMN1 gene is deleted. The SMN2 gene exists in all of the patients. Alternative splicing of these two genes are different. More than 90% of exon 7 included form is produced from SMN1 pre-mRNA, whereas only ∼20% of exon 7 included form is produced from SMN2 pre-mRNA. Only exon 7 inclusion form produces functional protein. Exon 7 skipped SMN isoform is unstable. Here we constructed a GFP reporter system that recapitulates the alternative splicing of SMN1 and SMN2 pre-mRNA. We designed a system in which GFP protein is expressed only when exon 7 of is included in alternative splicing. The stable cell that expresses SMN1-GFP produces ∼4 times more GFP protein than the stable cell line that expresses SMN2-GFP; as demonstrated by microscopy, FACS analysis and immunoblotting. In addition the ratio of exon 7 inclusion and skipping of SMN1-GFP and SMN2-GFP pre-mRNA was similar to endogenous SMN1 and SMN2 pre-mRNA as shown in RT-PCR. Furthermore the knockdown with hnRNP A1 shRNA, a known protein which promotes exon 7 skipping of SMN2, induces exon 7 inclusion of exon 7 in SMN2-GFP pre-mRNA in SMN2-GFP cell line. We conclude that we have established the stable cell lines that recapitulate alternative splicing of the SMN1 and SMN2 genes. The stable cell line can be used to identify the trans-acting elements with siRNA.

  4. Interleukin-10 promotes B16-melanoma growth by inhibition of macrophage functions and induction of tumour and vascular cell proliferation

    PubMed Central

    García-Hernández, M L; Hernández-Pando, R; Gariglio, P; Berumen, J

    2002-01-01

    The aim of this study was to investigate the mechanisms by which interleukin-10 (IL-10) induces tumour growth in a mouse-melanoma model. A B16-melanoma cell line (B16-0) was transfected with IL-10 cDNA and three clones that secreted high (B16-10), medium and low amounts of IL-10 were selected. Cell proliferation and IL-10 production were compared in vitro, and tumour growth, percentages of necrotic areas, tumour cells positive for proliferating cell nuclear antigen (PCNA), IL-10 receptor (IL-10R) and major histocompatibility complex type I (MHC-I) and II (MHC-II), as well as infiltration of macrophages, CD4+ and CD8+ lymphocytes and blood vessels were compared in vivo among IL-10-transfected and non-transfected tumours. Proliferation and tumour growth were greater for IL-10-transfected than for non-transfected cells (P < 0·001), and correlated with IL-10 concentration (r ≥ 0·79, P < 0·006). Percentages of tumour cells positive for PCNA and IL-10R were 4·4- and 16·7-fold higher, respectively, in B16-10 than in B16-0 tumours (P < 0·001). Macrophage distribution changed from a diffuse pattern in non-transfected (6·4 ± 1·7%) to a peripheral pattern in IL-10-transfected (3·8 ± 1·7%) tumours. The percentage of CD4+ lymphocytes was 7·6 times higher in B16-10 than in B16-0 tumours (P = 0·002). The expression of MHC-I molecules was present in all B16-0 tumour cells and completely negative in B16–10 tumour cells. In B16-0 tumours, 89 ± 4% of the whole tumour area was necrotic, whereas tumours produced by B16-10 cells showed only 4·3 ± 6% of necrotic areas. IL-10-transfected tumours had 17-fold more blood vessels than non-transfected tumours (61·8 ± 8% versus 3·5 ± 1·7% blood vessels/tumour; P < 0·001). All the effects induced by IL-10 were prevented in mice treated with a neutralizing anti-IL-10 monoclonal antibody. These data indicate that IL-10 could induce tumour growth in this B16-melanoma model by stimulation of tumour-cell proliferation

  5. Two Paralogous Tetraspanins TSP-12 and TSP-14 Function with the ADAM10 Metalloprotease SUP-17 to Promote BMP Signaling in Caenorhabditis elegans

    PubMed Central

    Shi, Herong

    2017-01-01

    The highly conserved bone morphogenetic protein (BMP) signaling pathway regulates many developmental and homeostatic processes. While the core components of the BMP pathway have been well studied, much research is needed for understanding the mechanisms involved in the precise spatiotemporal control of BMP signaling in vivo. Here, we provide evidence that two paralogous and evolutionarily conserved tetraspanins, TSP-12 and TSP-14, function redundantly to promote BMP signaling in C. elegans. We further show that the ADAM10 (a disintegrin and metalloprotease 10) ortholog SUP-17 also functions to promote BMP signaling, and that TSP-12 can bind to and promote the cell surface localization of SUP-17. SUP-17/ADAM10 is known to be involved in the ligand-induced proteolytic processing of the Notch receptor. We have evidence that the function of SUP-17, and of TSP-12/TSP-14 in BMP signaling is independent of their roles in Notch signaling. Furthermore, presenilins, core components of the γ-secretase complex involved in processing Notch, do not appear to play a role in BMP signaling. These studies established a new role of the TSP-12/TSP-14/SUP-17 axis in regulating BMP signaling, in addition to their known function in the Notch signaling pathway. We also provide genetic evidence showing that a known BMP signaling modulator, UNC-40/neogenin/DCC, is one of the substrates of SUP-17/ADAM10 in the BMP signaling pathway. PMID:28068334

  6. A set of fluorescent protein-based markers expressed from constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal elements in Medicago truncatula.

    PubMed

    Ivanov, Sergey; Harrison, Maria J

    2014-12-01

    Medicago truncatula is widely used for analyses of arbuscular mycorrhizal (AM) symbiosis and nodulation. To complement the genetic and genomic resources that exist for this species, we generated fluorescent protein fusions that label the nucleus, endoplasmic reticulum, Golgi apparatus, trans-Golgi network, plasma membrane, apoplast, late endosome/multivesicular bodies (MVB), transitory late endosome/ tonoplast, tonoplast, plastids, mitochondria, peroxisomes, autophagosomes, plasmodesmata, actin, microtubules, periarbuscular membrane (PAM) and periarbuscular apoplastic space (PAS) and expressed them from the constitutive AtUBQ10 promoter and the AM symbiosis-specific MtBCP1 promoter. All marker constructs showed the expected expression patterns and sub-cellular locations in M. truncatula root cells. As a demonstration of their utility, we used several markers to investigate AM symbiosis where root cells undergo major cellular alterations to accommodate their fungal endosymbiont. We demonstrate that changes in the position and size of the nuclei occur prior to hyphal entry into the cortical cells and do not require DELLA signaling. Changes in the cytoskeleton, tonoplast and plastids also occur in the colonized cells and in contrast to previous studies, we show that stromulated plastids are abundant in cells with developing and mature arbuscules, while lens-shaped plastids occur in cells with degenerating arbuscules. Arbuscule development and secretion of the PAM creates a periarbuscular apoplastic compartment which has been assumed to be continuous with apoplast of the cell. However, fluorescent markers secreted to the periarbuscular apoplast challenge this assumption. This marker resource will facilitate cell biology studies of AM symbiosis, as well as other aspects of legume biology.

  7. Health Promotion

    DTIC Science & Technology

    1986-03-11

    Department of Defense DIRECTIVEAD-A269 638 , , AD-A29 638March 11, 1986 IIIIii!IN 111111111,11 Ii1111,111111[NUMBER 1010.10 SUBJECT: Health Promotion ...34 March 13, 1985 INC A. URPOSE SThis Directive establishes a health promotion policy within the Department of Defense to improve and maintain military...civilian employees. C. DEFINITIONS 1. Health Promotion . Any combination of health education and related organizational, social, economic or health care

  8. Interleukin 10 promotes immune response by increasing the survival of activated CD8(+) T cells in human papillomavirus 16-infected cervical cancer.

    PubMed

    Li, Li; Ma, Yan; Liu, Shuang; Zhang, Jin; Xu, Xin-Yan

    2016-10-11

    Human papillomavirus (HPV)-specific CD8(+) T cells are present in HPV-infected cervical cancer patients and have demonstrated potent antitumor properties. However, these cells cannot control tumor progression in most patients. To investigate the underlying mechanisms involved in suppressing or promoting CD8(+) T cell functions, we focused on interleukin 10 (IL-10), a pleiotropic cytokine with controversial roles in antitumor immunity. We found that compared to healthy controls, circulating CD8(+) T cells in HPV 16-infected cervical cancer patients expressed significantly higher levels of IL-10. Interestingly, these CD8(+) T cells from cervical cancer patients, but not those from healthy controls, responded to HPV 16 E6/E7 peptide stimulation by increasing IL-10 expression, demonstrating an antigen-specific IL-10 release. Addition of exogenous IL-10 improved the survival, but did not increase the proliferation, of peptide-stimulated CD8(+) T cells. CD8(+) T cells cultured in the presence of IL-10 also resulted in significantly higher interferon gamma (IFN-gamma) and granzyme B concentration, primarily due to improved cell survival. In resected cervical tumors, the frequency of tumor-infiltrating IL-10(+) CD8(+) T cells was positively correlated with the frequency of tumor-infiltrating IFN-gamma(+) and granzyme B(+) CD8(+) T cells. Tumor-associated macrophages were more potent than peripheral blood monocyte-derived macrophages at inducing IL-10 expression in CD8(+) T cells, possibly explaining the elevated IL-10(+) CD8(+) T cell frequency in cervical cancer patients. Together, these results are consistent with an immunostimulatory role of IL-10, which promoted CD8(+) T cell response by increasing the survival of activated CD8(+) T cells.

  9. CHCHD10 mutations promote loss of mitochondrial cristae junctions with impaired mitochondrial genome maintenance and inhibition of apoptosis.

    PubMed

    Genin, Emmanuelle C; Plutino, Morgane; Bannwarth, Sylvie; Villa, Elodie; Cisneros-Barroso, Eugenia; Roy, Madhuparna; Ortega-Vila, Bernardo; Fragaki, Konstantina; Lespinasse, Françoise; Pinero-Martos, Estefania; Augé, Gaëlle; Moore, David; Burté, Florence; Lacas-Gervais, Sandra; Kageyama, Yusuke; Itoh, Kie; Yu-Wai-Man, Patrick; Sesaki, Hiromi; Ricci, Jean-Ehrland; Vives-Bauza, Cristofol; Paquis-Flucklinger, Véronique

    2016-01-01

    CHCHD10-related diseases include mitochondrial DNA instability disorder, frontotemporal dementia-amyotrophic lateral sclerosis (FTD-ALS) clinical spectrum, late-onset spinal motor neuropathy (SMAJ), and Charcot-Marie-Tooth disease type 2 (CMT2). Here, we show that CHCHD10 resides with mitofilin, CHCHD3 and CHCHD6 within the "mitochondrial contact site and cristae organizing system" (MICOS) complex. CHCHD10 mutations lead to MICOS complex disassembly and loss of mitochondrial cristae with a decrease in nucleoid number and nucleoid disorganization. Repair of the mitochondrial genome after oxidative stress is impaired in CHCHD10 mutant fibroblasts and this likely explains the accumulation of deleted mtDNA molecules in patient muscle. CHCHD10 mutant fibroblasts are not defective in the delivery of mitochondria to lysosomes suggesting that impaired mitophagy does not contribute to mtDNA instability. Interestingly, the expression of CHCHD10 mutant alleles inhibits apoptosis by preventing cytochrome c release.

  10. ICP-MS determination of trace elements in aerosols using a dynamic reaction cell: first results in PM10 comparing road and aerial traffic in Nice area (France).

    PubMed

    Fabretti, Jean-François; Sauret, Nathalie; Gal, Jean-François; Maria, Pierre-Charles; Schärer, Urs

    2007-09-01

    An analytical methodology was developed for the determination of 21 trace elements in suspended particulate matter (PM) using a microwave digestion procedure associated with an inductively coupled plasma mass spectrometry (ICP-MS). The dynamic reaction cell (DRC) of the instrument was carefully optimized to eliminate polyatomic species causing spectral interferences for three specified elements (Cr, Fe, Mn). With this method, the detection limits based on the analysis of seven quartz fibre filters (QFF) considering a one-week sample (250 m3) varied between 0.2 and 650 pg m(-3) for trace elements and between 2.1 and 5.6 ng m(-3) for major elements (Fe, Ti, Zn). The recovery of the analytes was tested with NIST SRM 1648 urban dust within 10% of the certified values only for 3-4 mg of material. The first results were discussed for a field campaign which was carried out simultaneously in the heaviest traffic road tunnel of the centre of Nice and near the landing-taking-off runways in the international airport of Nice Côte d'Azur. The behaviour of some combustion tracers was especially studied.

  11. Uranyl mediated photofootprinting reveals strong E. coli RNA polymerase--DNA backbone contacts in the +10 region of the DeoP1 promoter open complex.

    PubMed Central

    Jeppesen, C; Nielsen, P E

    1989-01-01

    Employing a newly developed uranyl photofootprinting technique (Nielsen et al. (1988) FEBS Lett. 235, 122), we have analyzed the structure of the E. coli RNA polymerase deoP1 promoter open complex. The results show strong polymerase DNA backbone contacts in the -40, -10, and most notably in the +10 region. These results suggest that unwinding of the -12 to +3 region of the promoter in the open complex is mediated through polymerase DNA backbone contacts on both sides of this region. The pattern of bases that are hyperreactive towards KMnO4 or uranyl within the -12 to +3 region furthermore argues against a model in which this region is simply unwound and/or single stranded. The results indicate specific protein contacts and/or a fixed DNA conformation within the -12 to +3 region. Images PMID:2503811

  12. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    PubMed

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses.

  13. Cytomegalovirus-Specific IL-10-Producing CD4+ T Cells Are Governed by Type-I IFN-Induced IL-27 and Promote Virus Persistence

    PubMed Central

    Marsden, Morgan; Stacey, Maria A.; Abdul-Karim, Juneid; Gimeno Brias, Silvia; Costa Bento, Diana; Ghazal, Peter; Weaver, Casey T.; Carlesso, Gianluca; Clare, Simon; Godkin, Andrew; Jones, Gareth W.; Humphreys, Ian R.

    2016-01-01

    CD4+ T cells support host defence against herpesviruses and other viral pathogens. We identified that CD4+ T cells from systemic and mucosal tissues of hosts infected with the β-herpesviridae human cytomegalovirus (HCMV) or murine cytomegalovirus (MCMV) express the regulatory cytokine interleukin (IL)-10. IL-10+CD4+ T cells co-expressed TH1-associated transcription factors and chemokine receptors. Mice lacking T cell-derived IL-10 elicited enhanced antiviral T cell responses and restricted MCMV persistence in salivary glands and secretion in saliva. Thus, IL-10+CD4+ T cells suppress antiviral immune responses against CMV. Expansion of this T-cell population in the periphery was promoted by IL-27 whereas mucosal IL-10+ T cell responses were ICOS-dependent. Infected Il27rα-deficient mice with reduced peripheral IL-10+CD4+ T cell accumulation displayed robust T cell responses and restricted MCMV persistence and shedding. Temporal inhibition experiments revealed that IL-27R signaling during initial infection was required for the suppression of T cell immunity and control of virus shedding during MCMV persistence. IL-27 production was promoted by type-I IFN, suggesting that β-herpesviridae exploit the immune-regulatory properties of this antiviral pathway to establish chronicity. Further, our data reveal that cytokine signaling events during initial infection profoundly influence virus chronicity. PMID:27926930

  14. Ultra-small lipid nanoparticles promote the penetration of coenzyme Q10 in skin cells and counteract oxidative stress.

    PubMed

    Lohan, Silke B; Bauersachs, Sonja; Ahlberg, Sebastian; Baisaeng, Nuttakorn; Keck, Cornelia M; Müller, Rainer H; Witte, Ellen; Wolk, Kerstin; Hackbarth, Steffen; Röder, Beate; Lademann, Jürgen; Meinke, Martina C

    2015-01-01

    UV irradiation leads to the formation of reactive oxygen species (ROS). An imbalance between the antioxidant system and ROS can lead to cell damage, premature skin aging or skin cancer. To counteract these processes, antioxidants such as coenzyme Q10 (CoQ10) are contained in many cosmetics. To improve and optimize cell/tissue penetration properties of the lipophilic CoQ10, ultra-small lipid nanoparticles (usNLC) were developed. The antioxidant effectiveness of CoQ10-loaded usNLC compared to conventional nanocarriers was investigated in the human keratinocyte cell line HaCaT. Using confocal laser scanning microscopy investigations of the carriers additionally loaded with nile red showed a clear uptake into cells and their distribution within the cytoplasm. By use of the XTT cell viability test, CoQ10 concentrations of 10-50 μg/ml were shown to be non-toxic, and the antioxidant potential of 10 μg/ml CoQ10 loaded usNLC in the HaCaT cells was analyzed via electron paramagnetic resonance spectroscopy after cellular exposure to UVA (1J/cm(2)) and UVB (18 mJ/cm(2)) irradiation. In comparison with the CoQ10-loaded conventional carriers, usNLC-CoQ10 demonstrated the strongest reduction of the radical formation; reaching up to 23% compared to control cells without nanocarrier treatment. Therefore, usNLC-CoQ10 are very suitable to increase the antioxidant potential of skin.

  15. The composition and relationships between trace element levels in inhalable atmospheric particles (PM10) and in leaves of Nerium oleander L. and Lantana camara L.

    PubMed

    Fernández Espinosa, A J; Rossini Oliva, S

    2006-03-01

    In order to evaluate the composition of inhalable atmospheric particles and to study the relationship between trace element levels in PM10 and in leaves of two plant species, the amount of Ba, Cu, Fe, Mn, Pb, Ti and V were analysed in PM10 and in Nerium oleander L. and Lantana camara L. leaves from two sites in the city of Seville and one remote control site. In PM10, the Cu and Fe content was significantly lower (p<0.05) in the control site than in the other sites. No correlations between leaf content and air content were found for the elements in L. camara. On the contrary, positive and significant correlations (p<0.05) were found between leaf content of N. oleander and PM10 content for Cu and Fe. The data suggest that N. oleander can be used in atmospheric biomonitoring studies, because it is especially useful for Cu and Fe, N. oleander being a better indicator than L. camara.

  16. Identification of a negative regulatory cis-element in the enhancer core region of the prostate-specific antigen promoter: implications for intersection of androgen receptor and nuclear factor-kappaB signalling in prostate cancer cells.

    PubMed Central

    Cinar, Bekir; Yeung, Fan; Konaka, Hiroyuki; Mayo, Marty W; Freeman, Michael R; Zhau, Haiyen E; Chung, Leland W K

    2004-01-01

    The NF-kappaB (nuclear factor-kappaB) transcription factors mediate activation of a large number of gene promoters containing diverse kappaB-site sequences. Here, PSA (prostate-specific antigen) was used as an AR (androgen receptor)-responsive gene to examine the underlying mechanism by which the NF-kappaB p65 transcription factor down-regulates the transcriptional activity of AR in cells. We observed that activation of NF-kappaB by TNFalpha (tumour necrosis factor alpha) inhibited both basal and androgen-stimulated PSA expression, and that this down-regulation occurred at the promoter level, as confirmed by the super-repressor IkappaBalpha (S32A/S36A), a dominant negative inhibitor of NF-kappaB. Using a linker-scanning mutagenesis approach, we identified a cis -element, designated XBE (X-factor-binding element), in the AREc (androgen response element enhancer core) of the PSA promoter, which negatively regulated several AR-responsive promoters, including that of PSA. When three copies of XBE in tandem were juxtaposed to GRE4 (glucocorticoid response element 4), a 4-6-fold reduction of inducible GRE4 activity was detected in three different cell lines, LNCaP, ARCaP-AR and PC3-AR. Bioinformatics and molecular biochemical studies indicated that XBE is a kappaB-like element that binds specifically to the NF-kappaB p65 subunit; consistent with these observations, only NF-kappaB p65, but not the NF-kappaB p50 subunit, was capable of inhibiting AR-mediated PSA promoter transactivation in LNCaP cells. In addition, our data also showed that AR binds to XBE, as well as to the kappaB consensus site, and that the transfection of AR inhibits the kappaB-responsive promoter in transient co-transfection assays. Collectively, these data indicate that cross-modulation between AR and NF-kappaB p65 transcription factors may occur by a novel mechanism involving binding to a common cis -DNA element. PMID:14715080

  17. SEM in situ MiniCantilever Beam Bending of U-10Mo/Zr/Al Fuel Elements

    SciTech Connect

    Mook, William; Baldwin, Jon K.; Martinez, Ricardo M.; Mara, Nathan A.

    2014-06-16

    In this work, the fracture behavior of Al/Zr and Zr/dU-10Mo interfaces was measured via the minicantilever bend technique. The energy dissipation rates were found to be approximately 3.7-5 mj/mm2 and 5.9 mj/mm2 for each interface, respectively. It was found that in order to test the Zr/U-10Mo interface, location of the hinge of the cantilever was a key parameter. While this test could be adapted to hot cell use through careful alignment fixturing and measurement of crack lengths with an optical microscope (as opposed to SEM, which was used here out of convenience), machining of the cantilevers via MiniMill in such a way as to locate the interfaces at the cantilever hinge, as well as proper placement of a femtosecond laser notch will continue to be key challenges in a hot cell environment.

  18. CD44 co-stimulation promotes FoxP3+ regulatory T-cell persistence and function via production of IL-2, IL-10 and TGF-beta

    PubMed Central

    Bollyky, Paul L.; Falk, Ben A.; Long, Alice; Preisinger, Anton; Braun, Kathy R.; Wu, Rebecca P.; Evanko, Stephen P.; Buckner, Jane H.; Wight, Thomas N.; Nepom, Gerald T.

    2011-01-01

    Work by our group and others has demonstrated a role for the extracellular matrix receptor CD44 and it's ligand hyaluronan in CD4+CD25+ regulatory T-cell (Treg) function. Herein we explore the mechanistic basis for this observation. Using mouse FoxP3/GFP+ Treg we find that CD44 co-stimulation promotes expression of FoxP3, in part through production of IL-2. This promotion of IL-2 production was also resistant to Cyclosporine A treatment, suggesting that CD44 costimulation may promote IL-2 production through bypassing FoxP3-mediated suppression of NFAT. CD44 co-stimulation increased production of IL-10 in a partially Il-2 dependant manner and also promoted cell-surface TGF-β expression. Consistent with these findings, Treg from CD44 knock-out mice demonstrated impaired regulatory function ex vivo and depressed production of IL-10 and cell-surface TGF-β. These data reveal a novel role for CD44 cross-linking in the production of regulatory cytokines. Similar salutary effects on FoxP3 expression were observed upon co-stimulation with hyaluronan, the primary natural ligand for CD44. This effect is dependent upon CD44 cross-linking; while both high molecular weight hyaluronan (HMW-HA) and plate-bound anti-CD44 Ab promoted FoxP3 expression, neither low-molecular weight HA (LMW-HA) nor soluble anti-CD44 Ab did so. The implication is that intact HMW-HA can cross-link CD44 only in those settings where it predominates over fragmentary LMW-HA, namely in un-inflamed tissue. We propose that intact but not fragmented ECM is capable of cross-linking CD44 and thereby maintains immunologic tolerance in uninjured or healing tissue. PMID:19635906

  19. Haemophilus ducreyi-induced interleukin-10 promotes a mixed M1 and M2 activation program in human macrophages.

    PubMed

    Li, Wei; Katz, Barry P; Spinola, Stanley M

    2012-12-01

    During microbial infection, macrophages are polarized to classically activated (M1) or alternatively activated (M2) cells in response to microbial components and host immune mediators. Proper polarization of macrophages is critical for bacterial clearance. To study the role of macrophage polarization during Haemophilus ducreyi infection, we analyzed a panel of macrophage surface markers in skin biopsy specimens of pustules obtained from experimentally infected volunteers. Lesional macrophages expressed markers characteristic of both M1 and M2 polarization. Monocyte-derived macrophages (MDM) also expressed a mixed M1 and M2 profile of surface markers and cytokines/chemokines upon infection with H. ducreyi in vitro. Endogenous interleukin 10 (IL-10) produced by infected MDM downregulated and enhanced expression of several M1 and M2 markers, respectively. Bacterial uptake, mediated mainly by class A scavenger receptors, and activation of mitogen-activated protein kinase and phosphoinositide 3-kinase signaling pathways were required for H. ducreyi-induced IL-10 production in MDM. Compared to M1 cells, IL-10-polarized M2 cells displayed enhanced phagocytic activity against H. ducreyi and similar bacterial killing. Thus, IL-10-modulated macrophage polarization may contribute to H. ducreyi clearance during human infection.

  20. Elemental characterization of PM2.5 and PM10 emitted from light duty vehicles in the Washburn Tunnel of Houston, Texas: release of rhodium, palladium, and platinum.

    PubMed

    Bozlaker, Ayşe; Spada, Nicholas J; Fraser, Matthew P; Chellam, Shankararaman

    2014-01-01

    We report the elemental composition, including Rh, Pd, and Pt, of total (i.e., tailpipe and nontailpipe) PM2.5 and PM10 emissions from predominantly gasoline-driven light-duty vehicles (LDVs) traversing the Washburn Tunnel in Houston, Texas during November and December, 2012. Using a novel sample preparation and dynamic reaction cell-quadrupole-inductively coupled plasma-mass spectrometry technique, we quantify the emission of numerous representative, transition, and lanthanoid elements. Two sets of time integrated PM samples were collected over 3-4week duration both inside the tunnel as well as from the tunnel ventilation air supply to derive accurate LDV source profiles incorporating three platinum group elements (PGEs) for the first time. Average Rh, Pd, and Pt concentrations from the tunnel ventilation air supply were 1.5, 11.1, and 4.5pgm(-3) in PM2.5 and 3.8, 23.1, and 15.1pgm(-3) in PM10, respectively. Rh, Pd, and Pt levels were elevated inside the Washburn Tunnel reaching 12.5, 91.1, and 30.1pgm(-3) in PM2.5 and 36.3, 214, and 61.1pgm(-3) in PM10, respectively. Significantly higher enrichment factors of Cu, Zr, Rh, Pd, Sb, and Pt (referenced to Ti in the upper continental crust) inside the tunnel compared with the ventilation air supply suggested that they are unique elemental tracers of PM derived from gasoline-driven LDVs. This highlights the importance of advancing methods to quantify the trace level PGE emissions as a technique to more accurately estimate LDVs' contributions to airborne PM. Using the emission profile based on PGEs and ambient quantification, mass balancing revealed that approximately half the fine PM mass in the tunnel could be attributed to tailpipe emissions, approximately one-quarter to road dust, with smaller contributions from brake (7%) and tire (3%) wear. On the other hand, PM10 mostly originated from resuspended road dust (∼50%), with progressively lower contributions from tailpipe emissions (14%), brake wear (9%), and tire

  1. A positive feedback loop between ROS and Mxi1-0 promotes hypoxia-induced VEGF expression in human hepatocellular carcinoma cells.

    PubMed

    Hu, Zhenzhen; Dong, Na; Lu, Dian; Jiang, Xiuqin; Xu, Jinjin; Wu, Zhiwei; Zheng, Datong; Wechsler, Daniel S

    2017-02-01

    VEGF expression induced by hypoxia plays a critical role in promoting tumor angiogenesis. However, the molecular mechanism that modulates VEGF expression under hypoxia is still poorly understood. In this study, we found that VEGF induction in hypoxic HepG2 cells is ROS-dependent. ROS mediates hypoxia-induced VEGF by upregulation of Mxi1-0. Furthermore, PI3K/AKT/HIF-1α signaling pathway is involved in ROS-mediated Mxi1-0 and VEGF expression in hypoxic HepG2 cells. Finally, Mxi1-0 could in turn regulate ROS generation in hypoxic HepG2 cells, creating a positive feedback loop. Taken together, this study demonstrate a positive regulatory feedback loop in which ROS mediates hypoxia-induced Mxi1-0 via activation of PI3K/AKT/HIF-1α pathway, events that in turn elevate ROS generation and promote hypoxia-induced VEGF expression. These findings could provide a rationale for designing new therapies based on inhibition of hepatocellular carcinoma (HCC) angiogenesis.

  2. CXCL10/CXCR3 axis promotes the invasion of gastric cancer via PI3K/AKT pathway-dependent MMPs production.

    PubMed

    Zhou, Hongfeng; Wu, Jin; Wang, Tianjiao; Zhang, Xufeng; Liu, Dan

    2016-08-01

    CXCR3, a G-protein coupled chemokine receptor, has been found to be overexpressed in many tumors and act as an independent prognostic marker. However, it is still unclear whether CXCR3 is involved in gastric cancer progression. In this study, we found that CXCR3 was markedly expressed in gastric cancer cells and tissues. High CXCR3 expression correlated with advanced tumor stage, vascular invasion, lymph node metastasis and poor survival of gastric cancer patients. Activation of CXCR3 by one of its ligands CXCL10 promoted the invasion and migration of gastric cancer BGC-823 and MGC-803 cells, and increased the secretion and activities of MMP-2 and MMP-9. However, the effects of CXCL10 on gastric cancer cells were attenuated by CXCR3 siRNA transfection. Furthermore, overexpression of CXCR3 enhanced CXCL10-mediated cell invasion and migration of gastric cancer MKN28 cells. In addition, CXCR3 time-dependently induced activation of AKT. PI3K/AKT pathway was required for CXCR3-mediated gastric cancer cell invasion, migration and MMP-2/9 production. Together, our findings suggest that CXCL10/CXCR3 axis promotes gastric cancer cell invasion and migration by upregulating MMP-2 and MMP-9 production via PI3K/AKT pathway. Thus, CXCR3 could be a potential target for the gastric cancer treatment.

  3. Regulation of Cytochrome P450 2B10 (CYP2B10) Expression in Liver by Peroxisome Proliferator-activated Receptor-β/δ Modulation of SP1 Promoter Occupancy.

    PubMed

    Koga, Takayuki; Yao, Pei-Li; Goudarzi, Maryam; Murray, Iain A; Balandaram, Gayathri; Gonzalez, Frank J; Perdew, Gary H; Fornace, Albert J; Peters, Jeffrey M

    2016-11-25

    Alcoholic liver disease is a pathological condition caused by overconsumption of alcohol. Because of the high morbidity and mortality associated with this disease, there remains a need to elucidate the molecular mechanisms underlying its etiology and to develop new treatments. Because peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) modulates ethanol-induced hepatic effects, the present study examined alterations in gene expression that may contribute to this disease. Chronic ethanol treatment causes increased hepatic CYP2B10 expression inPparβ/δ(+/+) mice but not in Pparβ/δ(-/-) mice. Nuclear and cytosolic localization of the constitutive androstane receptor (CAR), a transcription factor known to regulate Cyp2b10 expression, was not different between genotypes. PPARγ co-activator 1α, a co-activator of both CAR and PPARβ/δ, was up-regulated in Pparβ/δ(+/+) liver following ethanol exposure, but not in Pparβ/δ(-/-) liver. Functional mapping of the Cyp2b10 promoter and ChIP assays revealed that PPARβ/δ-dependent modulation of SP1 promoter occupancy up-regulated Cyp2b10 expression in response to ethanol. These results suggest that PPARβ/δ regulates Cyp2b10 expression indirectly by modulating SP1 and PPARγ co-activator 1α expression and/or activity independent of CAR activity. Ligand activation of PPARβ/δ attenuates ethanol-induced Cyp2b10 expression in Pparβ/δ(+/+) liver but not in Pparβ/δ(-/-) liver. Strikingly, Cyp2b10 suppression by ligand activation of PPARβ/δ following ethanol treatment occurred in hepatocytes and was mediated by paracrine signaling from Kupffer cells. Combined, results from the present study demonstrate a novel regulatory role of PPARβ/δ in modulating CYP2B10 that may contribute to the etiology of alcoholic liver disease.

  4. The development and characterization of synthetic minimal yeast promoters

    PubMed Central

    Redden, Heidi; Alper, Hal S.

    2015-01-01

    Synthetic promoters, especially minimally sized, are critical for advancing fungal synthetic biology. Fungal promoters often span hundreds of base pairs, nearly ten times the amount of bacterial counterparts. This size limits large-scale synthetic biology efforts in yeasts. Here we address this shortcoming by establishing a methodical workflow necessary to identify robust minimal core elements that can be linked with minimal upstream activating sequences to develop short, yet strong yeast promoters. Through a series of library-based synthesis, analysis and robustness tests, we create a set of non-homologous, purely synthetic, minimal promoters for yeast. These promoters are comprised of short core elements that are generic and interoperable and 10 bp UAS elements that impart strong, constitutive function. Through this methodology, we are able to generate the shortest fungal promoters to date, which can achieve high levels of both inducible and constitutive expression with up to an 80% reduction in size. PMID:26183606

  5. Enacting Dialogue: The Impact of Promoting Philosophy for Children on the Literate Thinking of Identified Poor Readers, Aged 10

    ERIC Educational Resources Information Center

    Jenkins, Philip; Lyle, Sue

    2010-01-01

    The Philosophy for Children in Schools Project (P4CISP) is a research project to monitor and evaluate the impact of Philosophy for Children (P4C) on classroom practices. In this paper the impact of P4C on the thinking skills of four children aged 10 is examined. Standardised tests indicated the children had below-average reading ages. The pupils…

  6. Interleukin-10 deficiency impairs regulatory T cell-derived neuropilin-1 functions and promotes Th1 and Th17 immunity

    PubMed Central

    Wang, Shimin; Gao, Xiang; Shen, Guobo; Wang, Wei; Li, Jingyu; Zhao, Jingyi; Wei, Yu-Quan; Edwards, Carl K.

    2016-01-01

    Regulatory T cells (Tregs) expand in peripheral lymphoid organs and can produce immunosuppressive cytokines to support tumor growth. IL-10 abrogation efficiently induces Treg formation but dampens tumoral neuropilin-1 (Nrp-1) Treg signaling, which simultaneously augments Th1 and Th17 immunity. These effects are associated with the plasticity and stability of Tregs and effector T cell functions that can limit tumorigenesis. Within the tumor microenvironment, there appears to be a “mutual antagonism” between immunoenhancement and immunosuppression mechanisms, eventually leading to decreased metastasis. In contrast, tumor progression is paralleled by a reduction in Nrp-1-producing Tregs controlled by the IL-10 and TGF-β1 levels. However, Th1, Th17 and Treg immunity is primarily regulated by IL-10 or Nrp-1 and not TGF-β1 except when combined with IL-10. These results emphasize the important implications for the therapeutic use of Tregs. The number of Treg cells must be maintained in a healthy and dynamic homeostatic range to prevent malignant diseases. Moreover, Treg-mediated immunosuppression can be limited by reducing tumor-derived Treg Nrp-1 levels. PMID:27075020

  7. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factor 1, CCAAT/enhancer-binding protein alpha, liver activator protein, and D-element-binding protein.

    PubMed Central

    van Ooij, C; Snyder, R C; Paeper, B W; Duester, G

    1992-01-01

    The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113

  8. Expression of the Myosin Heavy Chain IIB Gene in Porcine Skeletal Muscle: The Role of the CArG-Box Promoter Response Element

    PubMed Central

    Brown, David M.; Brameld, John M.; Parr, Tim

    2014-01-01

    Due to its similarity to humans, the pig is increasingly being considered as a good animal model for studying a range of human diseases. Despite their physiological similarities, differential expression of the myosin heavy chain (MyHC) IIB gene (MYH4) exists in the skeletal muscles of these species, which is associated with a different muscle phenotype. The expression of different MyHC isoforms is a critical determinant of the contractile and metabolic characteristics of the muscle fibre. We aimed to elucidate whether a genomic mechanism was responsible for the drastically different expression of MYH4 between pigs and humans, thus improving our understanding of the pig as a model for human skeletal muscle research. We utilized approximately 1 kb of the MYH4 promoter from a domestic pig and a human (which do and do not express MYH4, respectively) to elucidate the role of the promoter sequence in regulating the high expression of MYH4 in porcine skeletal muscle. We identified a 3 bp genomic difference within the proximal CArG and E-box region of the MYH4 promoter of pigs and humans that dictates the differential activity of these promoters during myogenesis. Subtle species-specific genomic differences within the CArG-box region caused differential protein-DNA interactions at this site and is likely accountable for the differential MYH4 promoter activity between pigs and humans. We propose that the genomic differences identified herein explain the differential activity of the MYH4 promoter of pigs and humans, which may contribute to the differential expression patterns displayed in these otherwise physiologically similar mammals. Further, we report that both the pig and human MYH4 promoters can be induced by MyoD over-expression, but the capacity to activate the MYH4 promoter is largely influenced by the 3 bp difference located within the CArG-box region of the proximal MYH4 promoter. PMID:25469802

  9. Biomimicry Promotes the Efficiency of a 10-Step Sequential Enzymatic Reaction on Nanoparticles, Converting Glucose to Lactate.

    PubMed

    Mukai, Chinatsu; Gao, Lizeng; Nelson, Jacquelyn L; Lata, James P; Cohen, Roy; Wu, Lauren; Hinchman, Meleana M; Bergkvist, Magnus; Sherwood, Robert W; Zhang, Sheng; Travis, Alexander J

    2017-01-02

    For nanobiotechnology to achieve its potential, complex organic-inorganic systems must grow to utilize the sequential functions of multiple biological components. Critical challenges exist: immobilizing enzymes can block substrate-binding sites or prohibit conformational changes, substrate composition can interfere with activity, and multistep reactions risk diffusion of intermediates. As a result, the most complex tethered reaction reported involves only 3 enzymes. Inspired by the oriented immobilization of glycolytic enzymes on the fibrous sheath of mammalian sperm, here we show a complex reaction of 10 enzymes tethered to nanoparticles. Although individual enzyme efficiency was higher in solution, the efficacy of the 10-step pathway measured by conversion of glucose to lactate was significantly higher when tethered. To our knowledge, this is the most complex organic-inorganic system described, and it shows that tethered, multi-step biological pathways can be reconstituted in hybrid systems to carry out functions such as energy production or delivery of molecular cargo.

  10. Loss of the repressor REST in uterine fibroids promotes aberrant G protein-coupled receptor 10 expression and activates mammalian target of rapamycin pathway

    PubMed Central

    Varghese, Binny V.; Koohestani, Faezeh; McWilliams, Michelle; Colvin, Arlene; Gunewardena, Sumedha; Kinsey, William H.; Nowak, Romana A.; Nothnick, Warren B.; Chennathukuzhi, Vargheese M.

    2013-01-01

    Uterine fibroids (leiomyomas) are the most common tumors of the female reproductive tract, occurring in up to 77% of reproductive-aged women, yet molecular pathogenesis remains poorly understood. A role for atypically activated mammalian target of rapamycin (mTOR) pathway in the pathogenesis of uterine fibroids has been suggested in several studies. We identified that G protein-coupled receptor 10 [GPR10, a putative signaling protein upstream of the phosphoinositide 3-kinase–protein kinase B/AKT–mammalian target of rapamycin (PI3K/AKT–mTOR) pathway] is aberrantly expressed in uterine fibroids. The activation of GPR10 by its cognate ligand, prolactin releasing peptide, promotes PI3K–AKT–mTOR pathways and cell proliferation specifically in cultured primary leiomyoma cells. Additionally, we report that RE1 suppressing transcription factor/neuron-restrictive silencing factor (REST/NRSF), a known tumor suppressor, transcriptionally represses GPR10 in the normal myometrium, and that the loss of REST in fibroids permits GPR10 expression. Importantly, mice overexpressing human GPR10 in the myometrium develop myometrial hyperplasia with excessive extracellular matrix deposition, a hallmark of uterine fibroids. We demonstrate previously unrecognized roles for GPR10 and its upstream regulator REST in the pathogenesis of uterine fibroids. Importantly, we report a unique genetically modified mouse model for a gene that is misexpressed in uterine fibroids. PMID:23284171

  11. An isotopic and trace element study of ostracods from Lake Miragoane, Haiti: A 10,500 year record of paleosalinity and paleotemperature changes in the Caribbean

    NASA Astrophysics Data System (ADS)

    Curtis, Jason H.; Hodell, David A.

    We report a high-resolution climate reconstruction for the Caribbean based on isotopic and trace element analysis of freshwater ostracod shells from Lake Miragoane, Haiti. By combining oxygen isotopes with Sr/Ca and Mg/Ca ratios, we are able to determine qualitative changes in temperature and salinity of this small, deep lake from the very late Pleistocene (10,500 years BP) to the present. During the latter part of the Younger Dryas Chronozone from ˜10,500 to 10,000 years BP, isotopic, trace element, and pollen results suggest that climate was arid and temperature was cooler than today in the Caribbean region. Similar interpretations of lake level lowering and increased aridity have been made for African lakes during this period. During the last deglaciation (Termination 1b), from ˜10,000 to 7,000 years BP, temperature increased and salinity decreased as lake levels rose during the early Holocene. Minimum salinity conditions are recorded between 7,000 and 4,000 years BP, which coincides with the early Holocene moist period when lake levels were consistently high in the tropics. From ˜4,000 to 2,500 years BP, lake level declined and salinity increased with the onset of a dry climate that generally prevailed throughout the late Holocene. The interval from ˜2,500 to 1,500 years BP was marked by an exceptionally dry period when all parameters indicate high salinity. This severe dry period persisted until ˜1000 years BP when wetter conditions briefly returned. The last millennia has been marked by a general trend toward increased salinity and inferred drier conditions.

  12. trans-10,cis-12 CLA promotes osteoblastogenesis via SMAD mediated mechanism in bone marrow mesenchymal stem cells.

    PubMed

    Kim, Jonggun; Park, Yooheon; Park, Yeonhwa

    2014-05-01

    The inverse relationship between osteoblast and adipocyte differentiation in bone marrow mesenchymal stem cells has been linked to overall bone mass. It has previously been reported that conjugated linoleic acid (CLA) inhibits adipogenesis via a peroxisome-proliferator activated receptor-γ (PPARγ) mediated mechanism, while it increases osteoblastogenesis via a PPARγ-independent mechanism in mesenchymal stem cells. This suggests potential implication of CLA on improving bone mass. Thus the purpose of this study was to determine involvement of CLA on regulation of osteoblastogenesis in murine mesenchymal stem cells by focusing on the Mothers against decapentaplegic (MAD)-related family of molecules 8 (SMAD8), one of key regulators of osteoblastogenesis. The trans-10,cis-12 CLA, but not the cis-9,trans-11, significantly increased osteoblastogenesis via SMAD8, and inhibited adipogenesis independent of SMAD8, while inhibiting factors regulating osteoclastogenesis in this model. These suggest that CLA may help improve osteoblastogenesis via a SMAD8 mediated mechanism.

  13. trans-10,cis-12 CLA promotes osteoblastogenesis via SMAD mediated mechanism in bone marrow mesenchymal stem cells

    PubMed Central

    Kim, Jonggun; Park, Yooheon; Park, Yeonhwa

    2014-01-01

    The inverse relationship between osteoblast and adipocyte differentiation in bone marrow mesenchymal stem cells has been linked to overall bone mass. It has previously been reported that conjugated linoleic acid (CLA) inhibits adipogenesis via a peroxisome-proliferator activated receptor-γ (PPARγ) mediated mechanism, while it increases osteoblastogenesis via a PPARγ-independent mechanism in mesenchymal stem cells. This suggests potential implication of CLA on improving bone mass. Thus the purpose of this study was to determine involvement of CLA on regulation of osteoblastogenesis in murine mesenchymal stem cells by focusing on the Mothers against decapentaplegic (MAD)-related family of molecules 8 (SMAD8), one of key regulators of osteoblastogenesis. The trans-10,cis-12 CLA, but not the cis-9,trans-11, significantly increased osteoblastogenesis via SMAD8, and inhibited adipogenesis independent of SMAD8, while inhibiting factors regulating osteoclastogenesis in this model. These suggest that CLA may help improve osteoblastogenesis via a SMAD8 mediated mechanism. PMID:25035711

  14. MicroRNA 10b promotes abnormal expression of the proto-oncogene c-Jun in metastatic breast cancer cells

    PubMed Central

    Knirsh, Revital; Ben-Dror, Iris; Modai, Shira; Shomron, Noam; Vardimon, Lily

    2016-01-01

    MicroRNAs have been shown to act as oncogenes or tumor suppressers via various cellular pathways. Specifically, in breast cancer, upregulation of miR-10b is positively associated with aggressiveness of tumors. However, the mechanism by which miR-10b contributes to cell malignancy is largely unknown. Here we show that at the receiving end of the miR-10b pathway is the proto-oncogene c-Jun, a transcription factor that plays a critical role in stimulation of cell proliferation and tumor progression. c-Jun is known to be translationally activated by loss of cell contacts or restructuring of the cytoskeleton. A comprehensive analysis of miRNA expression exhibited a significant increase in miR-10b expression. This was supported by analysis of breast cancer cells, which showed that loss of E-cadherin in metastatic cells is accompanied by elevation of miR-10b and interestingly, by a marked increase in accumulation of c-Jun. Silencing miR-10b in metastatic breast cancer cells leads to a decline in c-Jun expression, whereas overexpression of miR-10b in HaCaT cells is sufficient to elevate the accumulation of c-Jun. The increase in c-Jun protein accumulation in metastatic cells is not accompanied by an increase in c-Jun mRNA and is not dependent on MAPK activity. Knockdown and overexpression experiments revealed that the increase is mediated by NF1 and RhoC, downstream targets of miR-10b that affect cytoskeletal dynamics through the ROCK pathway. Overall, we show the ability of miR-10b to activate the expression of c-Jun through RhoC and NF1, which represents a novel pathway for promoting migration and invasion of human cancer cells. PMID:27494896

  15. NEUTRONIC REACTOR CONTROL ELEMENT

    DOEpatents

    Beaver, R.J.; Leitten, C.F. Jr.

    1962-04-17

    A boron-10 containing reactor control element wherein the boron-10 is dispersed in a matrix material is describeri. The concentration of boron-10 in the matrix varies transversely across the element from a minimum at the surface to a maximum at the center of the element, prior to exposure to neutrons. (AEC)

  16. Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements.

    PubMed Central

    Liu, B; Stinski, M F

    1992-01-01

    The tegument proteins of human cytomegalovirus are introduced into cells as components of infectious virus. The tegument proteins may affect viral and cellular transcription prior to the synthesis of the immediate-early viral regulatory proteins. The phosphorylated tegument protein of 71 kDa (pp71) is reported to be encoded by the UL82 gene. The UL82 gene products transactivated promoters containing upstream ATF or AP-1 binding sites. In contrast, the phosphorylated tegument protein of 65 kDa (pp65), encoded by the UL83 gene, had no detectable effect on these promoters. Enhancement by UL82 of downstream transcription was directly proportional to the number of upstream ATF sites. Response to UL82 transactivation was abolished by mutation of the ATF site. Mutation in the carboxy-terminal region of UL82 also eliminated transactivation. Even though the major immediate-early promoter of human cytomegalovirus is a strong enhancer-containing promoter, UL82 further enhanced its transcription as much as 20-fold. The mechanism of UL82 enhancement of transcription from viral or cellular promoters is not known, but the enhancement may be mediated by triggering one of the protein kinase signaling pathways, increasing the affinity of ATF or AP-1 for the target sequence, or stabilizing the complex between the eucaryotic transcription factor and the target sequence. Images PMID:1318413

  17. TH-C-12A-08: New Compact 10 MV S-Band Linear Accelerator: 3D Finite-Element Design and Monte Carlo Dose Simulations

    SciTech Connect

    Baillie, D; St Aubin, J; Fallone, B; Steciw, S

    2014-06-15

    Purpose: To design a new compact S-band linac waveguide capable of producing a 10 MV x-ray beam, while maintaining the length (27.5 cm) of current 6 MV waveguides. This will allow higher x-ray energies to be used in our linac-MRI systems with the same footprint. Methods: Finite element software COMSOL Multiphysics was used to design an accelerator cavity matching one published in an experiment breakdown study, to ensure that our modeled cavities do not exceed the threshold electric fields published. This cavity was used as the basis for designing an accelerator waveguide, where each cavity of the full waveguide was tuned to resonate at 2.997 GHz by adjusting the cavity diameter. The RF field solution within the waveguide was calculated, and together with an electron-gun phase space generated using Opera3D/SCALA, were input into electron tracking software PARMELA to compute the electron phase space striking the x-ray target. This target phase space was then used in BEAM Monte Carlo simulations to generate percent depth doses curves for this new linac, which were then used to re-optimize the waveguide geometry. Results: The shunt impedance, Q-factor, and peak-to-mean electric field ratio were matched to those published for the breakdown study to within 0.1% error. After tuning the full waveguide, the peak surface fields are calculated to be 207 MV/m, 13% below the breakdown threshold, and a d-max depth of 2.42 cm, a D10/20 value of 1.59, compared to 2.45 cm and 1.59, respectively, for the simulated Varian 10 MV linac and brehmsstrahlung production efficiency 20% lower than a simulated Varian 10 MV linac. Conclusion: This work demonstrates the design of a functional 27.5 cm waveguide producing 10 MV photons with characteristics similar to a Varian 10 MV linac.

  18. AKARI observations of brown dwarfs. IV. Effect of elemental abundances on near-infrared spectra between 1.0 and 5.0 μm

    SciTech Connect

    Sorahana, S.; Yamamura, I.

    2014-09-20

    The detection of the CO{sub 2} absorption band at 4.2 μm in brown dwarf spectra by AKARI has made it possible to discuss CO{sub 2} molecular abundance in brown dwarf atmospheres. In our previous studies, we found an excess in the 4.2 μm CO{sub 2} absorption band of three brown dwarf spectra, and suggested that these deviations were caused by high C and O elemental abundances in their atmospheres. To validate this hypothesis, we have constructed a set of models of brown dwarf atmospheres with various elemental abundance patterns, and we investigate the variations of the molecular composition and the thermal structure, and how they affect the near-infrared spectra between 1.0 and 5.0 μm. The 4.2 μm CO{sub 2} absorption band in some late-L and T dwarfs taken by AKARI is stronger or weaker than predicted by corresponding models with solar abundance. By comparing the CO{sub 2} band in the model spectra to the observed near-infrared spectra, we confirm possible elemental abundance variations among brown dwarfs. We find that the band strength is especially sensitive to O abundance, but C is also needed to reproduce the entire near-infrared spectra. This result indicates that both the C and O abundances should increase and decrease simultaneously for brown dwarfs. We find that a weaker CO{sub 2} absorption band in a spectrum can also be explained by a model with lower 'C and O' abundances.

  19. Functional cyclic AMP response element in the breast cancer resistance protein (BCRP/ABCG2) promoter modulates epidermal growth factor receptor pathway- or androgen withdrawal-mediated BCRP/ABCG2 transcription in human cancer cells.

    PubMed

    Xie, Yi; Nakanishi, Takeo; Natarajan, Karthika; Safren, Lowell; Hamburger, Anne W; Hussain, Arif; Ross, Douglas D

    2015-03-01

    Phosphorylated cyclic-AMP (cAMP) response element binding protein (p-CREB) is a downstream effector of a variety of important signaling pathways. We investigated whether the human BCRP promoter contains a functional cAMP response element (CRE). 8Br-cAMP, a cAMP analogue, increased the activity of a BCRP promoter reporter construct and BCRP mRNA in human carcinoma cells. Epidermal growth factor receptor (EGFR) pathway activation also led to an increase in p-CREB and in BCRP promoter reporter activity via two major downstream EGFR signaling pathways: the phosphotidylinositol-3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. EGF treatment increased the phosphorylation of EGFR, AKT, ERK and CREB, while simultaneously enhancing BCRP mRNA and functional protein expression. EGF-stimulated CREB phosphorylation and BCRP induction were diminished by inhibition of EGFR, PI3K/AKT or RAS/MAPK signaling. CREB silencing using RNA interference reduced basal levels of BCRP mRNA and diminished the induction of BCRP by EGF. Chromatin immunoprecipitation assays confirmed that a putative CRE site on the BCRP promoter bound p-CREB by a point mutation of the CRE site abolished EGF-induced stimulation of BCRP promoter reporter activity. Furthermore, the CREB co-activator, cAMP-regulated transcriptional co-activator (CRTC2), is involved in CREB-mediated BCRP transcription: androgen depletion of LNCaP human prostate cancer cells increased both CREB phosphorylation and CRTC2 nuclear translocation, and enhanced BCRP expression. Silencing CREB or CRTC2 reduced basal BCRP expression and BCRP induction under androgen-depletion conditions. This novel CRE site plays a central role in mediating BCRP gene expression in several human cancer cell lines following activation of multiple cancer-relevant signaling pathways.

  20. The Cyst Nematode Effector Protein 10A07 Targets and Recruits Host Posttranslational Machinery to Mediate Its Nuclear Trafficking and to Promote Parasitism in Arabidopsis

    PubMed Central

    Hewezi, Tarek; Juvale, Parijat S.; Piya, Sarbottam; Maier, Tom R.; Rambani, Aditi; Rice, J. Hollis; Mitchum, Melissa G.; Davis, Eric L.; Hussey, Richard S.; Baum, Thomas J.

    2015-01-01

    Plant-parasitic cyst nematodes synthesize and secrete effector proteins that are essential for parasitism. One such protein is the 10A07 effector from the sugar beet cyst nematode, Heterodera schachtii, which is exclusively expressed in the nematode dorsal gland cell during all nematode parasitic stages. Overexpression of H. schachtii 10A07 in Arabidopsis thaliana produced a hypersusceptible phenotype in response to H. schachtii infection along with developmental changes reminiscent of auxin effects. The 10A07 protein physically associates with a plant kinase and the IAA16 transcription factor in the cytoplasm and nucleus, respectively. The interacting plant kinase (IPK) phosphorylates 10A07 at Ser-144 and Ser-231 and mediates its trafficking from the cytoplasm to the nucleus. Translocation to the nucleus is phosphorylation dependent since substitution of Ser-144 and Ser-231 by alanine resulted in exclusive cytoplasmic accumulation of 10A07. IPK and IAA16 are highly upregulated in the nematode-induced syncytium (feeding cells), and deliberate manipulations of their expression significantly alter plant susceptibility to H. schachtii in an additive fashion. An inactive variant of IPK functioned antagonistically to the wild-type IPK and caused a dominant-negative phenotype of reduced plant susceptibility. Thus, exploitation of host processes to the advantage of the parasites is one mechanism by which cyst nematodes promote parasitism of host plants. PMID:25715285

  1. AJUBA promotes the migration and invasion of esophageal squamous cell carcinoma cells through upregulation of MMP10 and MMP13 expression.

    PubMed

    Shi, Xuejiao; Chen, Zhaoli; Hu, Xueda; Luo, Mei; Sun, Zengmiao; Li, Jiagen; Shi, Susheng; Feng, Xiaoli; Zhou, Chengcheng; Li, Zitong; Yang, Wenhui; Li, Yuan; Wang, Pan; Zhou, Fang; Gao, Yibo; He, Jie

    2016-06-14

    The LIM-domain protein AJUBA has been reported to be involved in cell-cell adhesion, proliferation, migration and cell fate decision by acting as a scaffold or adaptor protein. We previously identified AJUBA as a putative cancer gene in esophageal squamous cell carcinoma (ESCC). However, the function and underlying mechanisms of AJUBA in ESCC remain largely unknown. In the present study, we detected AJUBA levels in ESCC tumor tissues and in corresponding adjacent non-tumor tissues by immunohistochemistry (IHC) and investigated the function and mechanism of AJUBA in ESCC cells. The IHC results showed that AJUBA levels were significantly higher in ESCC tissues compared with corresponding adjacent non-tumor tissues (P < 0.001). Both in vitro and in vivo experiments showed that AJUBA promoted cell growth and colony formation, inhibited cisplatin-induced apoptosis of ESCC cells, and promoted ESCC cell migration and invasion. RNA sequencing was used to reveal the oncogenic pathways of AJUBA that were involved, and MMP10 and MMP13 were identified as two of the downstream targets of AJUBA. Thus, AJUBA upregulates the levels of MMP10 and MMP13 by activating ERK1/2. Taken together, these findings revealed that AJUBA serves as oncogenic gene in ESCC and may serve as a new target for ESCC therapy.

  2. A novel phase variation mechanism in the meningococcus driven by a ligand-responsive repressor and differential spacing of distal promoter elements.

    PubMed

    Metruccio, Matteo M E; Pigozzi, Eva; Roncarati, Davide; Berlanda Scorza, Francesco; Norais, Nathalie; Hill, Stuart A; Scarlato, Vincenzo; Delany, Isabel

    2009-12-01

    Phase variable expression, mediated by high frequency reversible changes in the length of simple sequence repeats, facilitates adaptation of bacterial populations to changing environments and is frequently important in bacterial virulence. Here we elucidate a novel phase variable mechanism for NadA, an adhesin and invasin of Neisseria meningitidis. The NadR repressor protein binds to operators flanking the phase variable tract and contributes to the differential expression levels of phase variant promoters with different numbers of repeats likely due to different spacing between operators. We show that IHF binds between these operators, and may permit looping of the promoter, allowing interaction of NadR at operators located distally or overlapping the promoter. The 4-hydroxyphenylacetic acid, a metabolite of aromatic amino acid catabolism that is secreted in saliva, induces NadA expression by inhibiting the DNA binding activity of the repressor. When induced, only minor differences are evident between NadR-independent transcription levels of promoter phase variants and are likely due to differential RNA polymerase contacts leading to altered promoter activity. Our results suggest that NadA expression is under both stochastic and tight environmental-sensing regulatory control, both mediated by the NadR repressor, and may be induced during colonization of the oropharynx where it plays a major role in the successful adhesion and invasion of the mucosa. Hence, simple sequence repeats in promoter regions may be a strategy used by host-adapted bacterial pathogens to randomly switch between expression states that may nonetheless still be induced by appropriate niche-specific signals.

  3. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  4. Interleukin-8 gene regulation in epithelial cells by Vibrio cholerae: role of multiple promoter elements, adherence and motility of bacteria and host MAPKs.

    PubMed

    Sarkar, Madhubanti; Bhowmick, Swati; Casola, Antonella; Chaudhuri, Keya

    2012-04-01

    Interleukin (IL)-8 is an important mediator in neutrophil-mediated acute inflammation. We previously demonstrated that incubation of intestinal epithelial cells with Vibrio cholerae O395 resulted in increased IL-8 mRNA expression and IL-8 secretion, which was associated with the adherence and motility of bacteria. However, the mechanisms responsible for transcriptional regulation of the IL-8 gene in epithelial cells during V. cholerae infections were not explored. Transient transfection analysis of 5' deletions and mutations of the IL-8 promoter driving expression of the luciferase reporter gene indicates that multiple binding sites contribute to IL-8 promoter induction in response to V. cholerae and that cooperation among these different sites is required for full activation of the promoter. Stimulation with V. cholerae O395 insertional mutants, defective in adherence and motility, significantly reduced IL-8 promoter activity compared with the wild-type strain. We further demonstrate maximal involvement of extracellular signal-regulated kinase 1/2/mitogen-activated protein kinase pathways to regulate IL-8 gene transcription. This study will help to design agents which could reduce the V. cholerae-induced inflammatory response and in the generation of safe vaccines.

  5. Elements of the maize A1 promoter required for transactivation by the anthocyanin B/C1 or phlobaphene P regulatory genes.

    PubMed Central

    Tuerck, J A; Fromm, M E

    1994-01-01

    The extensive genetic and molecular characterization of the flavonoid pathway's structural and regulatory genes has provided some of the most detailed knowledge of gene interactions in plants. In maize flavonoid biosynthesis, the A1 gene is independently regulated in the anthocyanin and phlobaphene pathways. Anthocyanin production requires the expression of the C1 or PI and R or B regulatory genes, whereas phlobaphene production requires only the P regulatory gene. By deletion analysis of the A1 promoter, we show that the sequences between -123 and -88 are critical for activation by anthocyanin and phlobaphene regulatory genes. Linker-scanner mutations indicated that the -123 to -100 region is more important for transactivation by the P protein. The -98 to -88 region is more important for B/C1 transactivation and shows a strong homology with the region of the Bz1 anthocyanin structural gene promoter shown to be activated by B/C1 and not by P. We identified a 14-bp consensus sequence that is also present in the promoters of three other genes in the anthocyanin pathway, and we propose a model for how the flavonoid regulatory proteins interact with the promoters of the structural genes. PMID:7827497

  6. Altered spacing of promoter elements due to the dodecamer repeat expansion contributes to reduced expression of the cystatin B gene in EPM1.

    PubMed

    Lalioti, M D; Scott, H S; Antonarakis, S E

    1999-09-01

    Progressive myoclonus epilepsy of the Unverricht-Lundborg type (EPM1; MIM 254800) is an autosomal recessive disorder characterized by seizures, myoclonus and progression to cerebellar ataxia. EPM1 arises due to mutations in the cystatin B (CSTB) gene which encodes a cysteine proteinase inhibitor. Only a minority of EPM1 alleles carry point mutations, while the majority contain large expansions of the dodecamer CCCCGCCCCGCG repeat which is present at two to three copies in normal individuals. The dodecamer repeat is located in the 5' flanking region of the CSTB gene, presumably in its promoter. The pathological repeat expansion results in a reduction in CSTB mRNA, which may be cell specific. To elucidate the mechanism of this reduction of gene expression, we have studied the putative CSTB promoter in vitro. A 3.8 kb fragment, containing the putative promoter with a 600 bp repeat expansion, showed a 2- to 4-fold reduction in luciferase activity compared with an identical fragment with a normal repeat; this reduction was observed only in certain cell types. Introduction of heterologous DNA fragments of 730 and 1000 bp into the normal promoter, instead of the repeat expansion, showed similarly reduced activity. Terminal deletions of the promoter implicate a putative AP-1 binding site, upstream of the repeat, in CSTB transcription activation. We propose that a novel mechanism of pathogenesis, the altering of the spacing of transcription factor binding sites from each other and/or the transcription initiation site due to repeat expansion, is among the causes of reduction in CSTB expression and thus EPM1.

  7. Early and late promoters of BK polyomavirus, Merkel cell polyomavirus, Trichodysplasia spinulosa-associated polyomavirus and human polyomavirus 12 are among the strongest of all known human polyomaviruses in 10 different cell lines.

    PubMed

    Moens, Ugo; Van Ghelue, Marijke; Ludvigsen, Maria; Korup-Schulz, Sarah; Ehlers, Bernhard

    2015-08-01

    Recently, 11 new human polyomaviruses (HPyVs) have been isolated and named KI, WU, Merkel cell polyomavirus (MCPyV), HPyV6,  -7,  -9,  -10 and  -12, Trichodysplasia spinulosa-associated polyomavirus (TSPyV), STLPyV and NJPyV-2013. Little is known about cell tropism of the novel HPyVs, and cell cultures allowing virus propagation are lacking. Because viral tropism partially depends on the interaction of cellular transcription factors with the viral promoter, we monitored the promoter activity of all known HPyVs. Therefore, we compared the relative early and late promoter activity of the BK polyomavirus (BKPyV) (WW strain) with the corresponding activities of the other HPyVs in 10 different cell lines derived from brain, colon, kidney, liver, lung, the oral cavity and skin. Our results show that the BKPyV, MCPyV, TSPyV and HPyV12 early promoters displayed the strongest activity in most cell lines tested, while the remaining HPyV had relative low early promoter activity. HPyV12 showed the highest late promoter activity of all HPyVs in most cell lines, but also the BKPyV, MCPyV and TSPyV late promoters belonged to the stronger ones among HPyVs. The HPyVs with weak early promoter activity had in general also weak late promoter activity, except for HPyV10 whose late promoter was relatively strong in six of the 10 cell lines. A 20 bp deletion in the promoter of an HPyV12 variant significantly affected both early and late promoter activity in most cell lines. In conclusion, our findings suggest which cell lines may be suitable for virus propagation and may give an indication of the cell tropism of the HPyVs.

  8. A bipartite operator interacts with a heat shock element to mediate early meiotic induction of Saccharomyces cerevisiae HSP82

    SciTech Connect

    Szent-Gyorgyi, C.

    1995-12-01

    This report seeks to characterize the activation of meiotic gene in terms of cis-acting DNA elements and their associated factors in Saccharomyces cerevisiae. It was found that vegetative repression and meiotic induction depend on interactions of the promoter-proximal heat shock element with a nearby bipartite repression element. The experiments described explore how two different regulatory pathways induce transcription by stimulating a single classical activation element, a nonspecific heat shock element. 81 refs., 10 figs., 1 tab.

  9. Functional analysis of basic transcription element (BTE)-binding protein (BTEB) 3 and BTEB4, a novel Sp1-like protein, reveals a subfamily of transcriptional repressors for the BTE site of the cytochrome P4501A1 gene promoter.

    PubMed Central

    Kaczynski, Joanna A; Conley, Abigail A; Fernandez Zapico, Martin; Delgado, Sharon M; Zhang, Jin-San; Urrutia, Raul

    2002-01-01

    The Sp1-like family of transcription factors is emerging as an integral part of the cellular machinery involved in the control of gene expression. Members of this family of proteins contain three highly homologous C-terminal zinc-finger motifs that bind GC-rich sequences found in the promoters of a diverse number of genes, such as the basic transcription element (BTE) in the promoter of the carcinogen-metabolizing cytochrome P4501A1 (CYP1A1) gene. In the present study, we report the molecular and functional characterization of BTE-binding protein (BTEB) 4, a novel ubiquitously expressed member of the Sp1-like proteins family. This protein represents a new homologue of BTEB1, originally described as a regulator of the BTE site in the CYP1A1 gene promoter. Similarly to the recently described BTEB3, we demonstrate that the N-terminal region of BTEB4 directly represses transcription and binds the co-repressor mSin3A. In addition, we show that the C-terminal zinc-finger domain of BTEB4 binds specifically the BTE site of the CYP1A1 promoter, similar to BTEB1 and BTEB3. Also, we show that both BTEB3 and BTEB4 repress the CYP1A1 gene promoter via the BTE site in HepG2 and BxPC3 cells. Thus the identification of this protein expands the repertoire of BTEB-like members of the Sp1-like protein family involved in transcriptional repression. Furthermore, our results demonstrate that the BTEB subfamily can repress the CYP1A1 gene promoter via the BTE site. PMID:12036432

  10. Recent developments in alkene hydro-functionalisation promoted by homogeneous catalysts based on earth abundant elements: formation of C-N, C-O and C-P bond.

    PubMed

    Rodriguez-Ruiz, Violeta; Carlino, Romain; Bezzenine-Lafollée, Sophie; Gil, Richard; Prim, Damien; Schulz, Emmanuelle; Hannedouche, Jérôme

    2015-07-21

    This Perspective article provides an overview of the recent advancements in the field of intra- and inter-molecular C-N, C-O and C-P bond formation by hydroamination, hydroalkoxylation, hydrophosphination, hydrophosphonylation or hydrophosphinylation of unactivated alkenes, including allenes, 1,3-dienes and strained alkenes, promoted by (chiral) homogeneous catalysts based on earth abundant elements of the s and p blocks, the first row transition metals and the rare-earth metals. The relevant literature from 2009 until late 2014 has been covered.

  11. Kaposi's sarcoma-associated herpesvirus Rta tetramers make high-affinity interactions with repetitive DNA elements in the Mta promoter to stimulate DNA binding of RBP-Jk/CSL.

    PubMed

    Palmeri, Diana; Carroll, Kyla Driscoll; Gonzalez-Lopez, Olga; Lukac, David M

    2011-11-01

    Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus 8 [HHV-8]) is the etiologic agent of Kaposi's sarcoma (KS) and lymphoproliferative diseases. We previously demonstrated that the KSHV lytic switch protein Rta stimulates DNA binding of the cellular RBP-Jk/CSL protein, the nuclear component of the Notch pathway, on Rta target promoters. In the current study, we define the promoter requirements for formation of transcriptionally productive Rta/RBP-Jk/DNA complexes. We show that highly pure Rta footprints 7 copies of a previously undescribed repetitive element in the promoter of the essential KSHV Mta gene. We have termed this element the "CANT repeat." CANT repeats are found on both strands of DNA and have a consensus sequence of ANTGTAACANT(A/T)(A/T)T. We demonstrate that Rta tetramers make high-affinity interactions (i.e., nM) with 64 bp of the Mta promoter but not single CANT units. The number of CANT repeats, their presence in palindromes, and their positions relative to the RBP-Jk binding site determine the optimal target for Rta stimulation of RBP-Jk DNA binding and formation of ternary Rta/RBP-Jk/DNA complexes. DNA binding and tetramerization mutants of Rta fail to stimulate RBP-Jk DNA binding. Our chromatin immunoprecipitation assays show that RBP-Jk DNA binding is broadly, but selectively, stimulated across the entire KSHV genome during reactivation. We propose a model in which tetramerization of Rta allows it to straddle RBP-Jk and contact repeat units on both sides of RBP-Jk. Our study integrates high-affinity Rta DNA binding with the requirement for a cellular transcription factor in Rta transactivation.

  12. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  13. PARP-1 expression in the mouse is controlled by an autoregulatory loop: PARP-1 binding to an upstream S/MAR element and to a novel recognition motif in its promoter suppresses transcription.

    PubMed

    Vidaković, Melita; Gluch, Angela; Qiao, Junhua; Oumard, Andrè; Frisch, Matthias; Poznanović, Goran; Bode, Juergen

    2009-05-15

    This work identifies central components of a feedback mechanism for the expression of mouse poly(ADP-ribose) polymerase-1 (PARP-1). Using the stress-induced duplex destabilization algorithm, multiple base-unpairing regions (BURs) could be localized in the 5' region of the mouse PARP-1 gene (muPARP-1). Some of these could be identified as scaffold/matrix-attachment regions (S/MARs), suggesting an S/MAR-mediated transcriptional regulation. PARP-1 binding to the most proximal element, S/MAR 1, and to three consensus motifs, AGGCC, in its own promoter (basepairs -956 to +100), could be traced by electrophoretic mobility-shift assay. The AGGCC-complementary GGCCT motif was detected by cis-diammine-dichloro platinum cross-linking and functionally characterized by the effects of site-directed mutagenesis on its performance in wild type (PARP-1(+/+)) and PARP-1 knockout cells (PARP-1(-/-)). Mutation of the central AGGCC tract at basepairs -554 to -550 prevented PARP-1/promoter interactions, whereby muPARP-1 expression became up-regulated. Transfection of a series of reporter gene constructs with or without S/MAR 1 (basepairs -1523 to -1007) and the more distant S/MAR 2 (basepairs -8373 to -6880), into PARP-1(+/+) as well as PARP-1(-/-) cells, revealed an additional, major level of muPARP-1 promoter down-regulation, triggered by PARP-1 binding to S/MAR 1. We conclude that S/MAR 1 represents an upstream control element that acts in conjunction with the muPARP-1 promoter. These interactions are part of a negative autoregulatory loop.

  14. Elemental composition of strawberry plants inoculated with the plant growth-promoting bacterium Azospirillum brasilense REC3, assessed with scanning electron microscopy and energy dispersive X-ray analysis.

    PubMed

    Guerrero-Molina, M F; Lovaisa, N C; Salazar, S M; Díaz-Ricci, J C; Pedraza, R O

    2014-07-01

    The elemental composition of strawberry plants (Fragaria ananassa cv. Macarena) inoculated with the plant growth-promoting bacterium Azospirillum brasilense REC3, and non-inoculated controls, was studied using scanning electron microscopy (SEM) and energy dispersive X-ray (EDS) analysis. This allowed simultaneous semi-quantification of different elements in a small, solid sample. Plants were inoculated and grown hydroponically in 50% or 100% Hoagland solution, corresponding to limited or optimum nutrient medium, respectively. Bacteria-inoculated plants increased the growth index 45% and 80% compared to controls when grown in 100% and 50% Hoagland solution, respectively. Thus, inoculation with A. brasilense REC3 in a nutrient-limited medium had the strongest effect in terms of increasing both shoot and root biomass and growth index, as already described for Azospirillum inoculated into nutrient-poor soils. SEM-EDS spectra and maps showed the elemental composition and relative distribution of nutrients in strawberry tissues. Leaves contained C, O, N, Na, P, K, Ca and Cu, while roots also had Si and Cl. The organic fraction (C, O and N) accounted for over 96.3% of the total chemical composition; of the mineral fraction, Na had higher accumulation in both leaves and roots. Azospirillum-inoculated and control plants had similar elemental quantities; however, in bacteria-inoculated roots, P was significantly increased (34.33%), which constitutes a major benefit for plant nutrition, while Cu content decreased (35.16%).

  15. Identification of a lactose-responsive element upstream of the promoter of Bacillus megaterium beta-galactosidase-encoding gene mbgA.

    PubMed

    Li, Jen-Ming; Chiou, Chih-Yung; Lee, Tian-Ren; Chen, Yuan-Shou; Shaw, Gwo-Chyuan

    2005-07-01

    The Bacillus megaterium mbgA gene encodes a lactose-hydrolyzing beta-galactosidase. An AraC/XylS-type activator BgaR can activate mbgA transcription in response to lactose. In this report, we show by various deletion analyses and point mutagenesis analyses that an inverted repeat centered at position -60.5 relative to the mbgA transcriptional initiation site is the cis-acting element responsible for lactose induction of mbgA expression.

  16. ARGONAUTE10 promotes the degradation of miR165/6 through the SDN1 and SDN2 exonucleases in Arabidopsis

    PubMed Central

    Zhai, Jixian; Chen, Jiayi; Luscher, Elizabeth; Gao, Lei; Liu, Chunyan; Cao, Xiaofeng; Mo, Beixin; Ma, Jinbiao; Meyers, Blake C.

    2017-01-01

    The degradation of small RNAs in plants and animals is associated with small RNA 3′ truncation and 3′ uridylation and thus relies on exonucleases and nucleotidyl transferases. ARGONAUTE (AGO) proteins associate with small RNAs in vivo and are essential for not only the activities but also the stability of small RNAs. AGO1 is the microRNA (miRNA) effector in Arabidopsis, and its closest homolog, AGO10, maintains stem cell homeostasis in meristems by sequestration of miR165/6, a conserved miRNA acting through AGO1. Here, we show that SMALL RNA DEGRADING NUCLEASES (SDNs) initiate miRNA degradation by acting on AGO1-bound miRNAs to cause their 3′ truncation, and the truncated species are uridylated and degraded. We report that AGO10 reduces miR165/6 accumulation by enhancing its degradation by SDN1 and SDN2 in vivo. In vitro, AGO10-bound miR165/6 is more susceptible to SDN1-mediated 3′ truncation than AGO1-bound miR165/6. Thus, AGO10 promotes the degradation of miR165/6, which is contrary to the stabilizing effect of AGO1. Our work identifies a class of exonucleases responsible for miRNA 3′ truncation in vivo and uncovers a mechanism of specificity determination in miRNA turnover. This work, together with previous studies on AGO10, suggests that spatially regulated miRNA degradation underlies stem cell maintenance in plants. PMID:28231321

  17. [Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

    PubMed

    Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

    2016-01-01

    In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

  18. Cold induction of Arabidopsis CBF genes involves multiple ICE (inducer of CBF expression) promoter elements and a cold-regulatory circuit that is desensitized by low temperature.

    PubMed

    Zarka, Daniel G; Vogel, Jonathan T; Cook, Daniel; Thomashow, Michael F

    2003-10-01

    The Arabidopsis CBF1, 2, and 3 genes (also known as DREB1b, c, and a, respectively) encode transcriptional activators that have a central role in cold tolerance. CBF1-3 are rapidly induced upon exposing plants to low temperature, followed by expression of CBF-targeted genes, the CBF regulon, resulting in an increase in plant freezing tolerance. At present, little is known about the cold-sensing mechanism that controls CBF expression. Results presented here indicate that this mechanism does not require a cold shock to bring about the accumulation of CBF transcripts, but instead, absolute temperature is monitored with a greater degree of input, i.e. lower temperature, resulting in a greater output, i.e. higher levels of CBF transcripts. Temperature-shift experiments also indicate that the cold-sensing mechanism becomes desensitized to a given low temperature, such as 4 degrees C, and that resensitization to that temperature requires between 8 and 24 h at warm temperature. Gene fusion experiments identified a 125-bp section of the CBF2 promoter that is sufficient to impart cold-responsive gene expression. Mutational analysis of this cold-responsive region identified two promoter segments that work in concert to impart robust cold-regulated gene expression. These sequences, designated ICEr1 and ICEr2 (induction of CBF expression region 1 or 2), were also shown to stimulate transcription in response to mechanical agitation and the protein synthesis inhibitor, cycloheximide.

  19. Development of land use regression models for elemental, organic carbon, PAH, and hopanes/steranes in 10 ESCAPE/TRANSPHORM European study areas.

    PubMed

    Jedynska, Aleksandra; Hoek, Gerard; Wang, Meng; Eeftens, Marloes; Cyrys, Josef; Keuken, Menno; Ampe, Christophe; Beelen, Rob; Cesaroni, Giulia; Forastiere, Francesco; Cirach, Marta; de Hoogh, Kees; De Nazelle, Audrey; Nystad, Wenche; Declercq, Christophe; Eriksen, Kirsten T; Dimakopoulou, Konstantina; Lanki, Timo; Meliefste, Kees; Nieuwenhuijsen, Mark J; Yli-Tuomi, Tarja; Raaschou-Nielsen, Ole; Brunekreef, Bert; Kooter, Ingeborg M

    2014-12-16

    Land use regression (LUR) models have been used to model concentrations of mainly traffic-related air pollutants (nitrogen oxides (NOx), particulate matter (PM) mass or absorbance). Few LUR models are published of PM composition, whereas the interest in health effects related to particle composition is increasing. The aim of our study was to evaluate LUR models of polycyclic aromatic hydrocarbons (PAH), hopanes/steranes, and elemental and organic carbon (EC/OC) content of PM2.5. In 10 European study areas, PAH, hopanes/steranes, and EC/OC concentrations were measured at 16-40 sites per study area. LUR models for each study area were developed on the basis of annual average concentrations and predictor variables including traffic, population, industry, natural land obtained from geographic information systems. The highest median model explained variance (R(2)) was found for EC - 84%. The median R(2) was 51% for OC, 67% for benzo[a]pyrene, and 38% for sum of hopanes/steranes, with large variability between study areas. Traffic predictors were included in most models. Population and natural land were included frequently as additional predictors. The moderate to high explained variance of LUR models and the overall moderate correlation with PM2.5 model predictions support the application of especially the OC and PAH models in epidemiological studies.

  20. Transcriptional activation of the SH2D2A gene is dependent on a cyclic adenosine 5'-monophosphate-responsive element in the proximal SH2D2A promoter.

    PubMed

    Dai, Ke-Zheng; Johansen, Finn-Eirik; Kolltveit, Kristin Melkevik; Aasheim, Hans-Christian; Dembic, Zlatko; Vartdal, Frode; Spurkland, Anne

    2004-05-15

    The SH2D2A gene, encoding the T cell-specific adapter protein (TSAd), is rapidly induced in activated T cells. In this study we investigate the regulation of the SH2D2A gene in Jurkat T cells and in primary T cells. Reporter gene assays demonstrated that the proximal 1-kb SH2D2A promoter was constitutively active in Jurkat TAg T cells and, to a lesser extent, in K562 myeloid cells, Reh B cells, and 293T fibroblast cells. The minimal SH2D2A promoter was located between position -236 and -93 bp from the first coding ATG, and transcriptional activity in primary T cells depended on a cAMP response element (CRE) centered around position -117. Nuclear extracts from Jurkat TAg cells and activated primary T cells contained binding activity to this CRE, as observed in an EMSA. Consistent with this observation, we found that a cAMP analog was a very potent inducer of SH2D2A mRNA expression in primary T cells as measured by real-time RT-PCR. Furthermore, activation of SH2D2A expression by CD3 stimulation required cAMP-dependent protein kinase activity. Thus, transcriptional regulation of the SH2D2A gene in activated T cells is critically dependent on a CRE in the proximal promoter region.

  1. PF1: an A-T hook-containing DNA binding protein from rice that interacts with a functionally defined d(AT)-rich element in the oat phytochrome A3 gene promoter.

    PubMed Central

    Nieto-Sotelo, J; Ichida, A; Quail, P H

    1994-01-01

    Phytochrome-imposed down-regulation of the expression of its own phytochrome A gene (PHYA) is one of the fastest light-induced effects on transcription reported in plants to date. Functional analysis of the oat PHYA3 promoter in a transfection assay has revealed two positive elements, PE1 and PE3, that function synergistically to support high levels of transcription in the absence of light. We have isolated a rice cDNA clone (pR4) encoding a DNA binding protein that binds to the AT-rich PE1 element. We tested the selectivity of the pR4-encoded DNA binding activity using linker substitution mutations of PE1 that are known to disrupt positive expression supported by the PHYA3 promoter in vivo. Binding to these linker substitution mutants was one to two orders of magnitude less than to the native PE1 element. Because this is the behavior expected of positive factor 1 (PF1), the presumptive nuclear transcription factor that acts in trans at the PE1 element in vivo, the data support the conclusion that the protein encoded by pR4 is in fact rice PF1. The PF1 polypeptide encoded by pR4 is 213 amino acids long and contains four repeats of the A-T hook DNA binding motif found in high-mobility group I-Y (HMGI-Y) proteins. In addition, PF1 contains an 11-amino acid-long hydrophobic region characteristic of HMG I proteins, its N-terminal region shows strong similarities to a pea H1 histone sequence and a short peptide sequence from wheat HMGa, and it shows a high degree of similarity along its entire length to the HMG Y-like protein encoded by a soybean cDNA, SB16. In vitro footprinting and quantitative gel shift analyses showed that PF1 binds preferentially to the PE1 element but also at lower affinity to two other AT-rich regions upstream of PE1. This feature is consistent with the binding characteristics of HMG I-Y proteins that are known to bind to most runs of six or more AT base pairs. Taken together, the properties of PF1 suggest that it belongs to a newly described

  2. Exendin-4 promotes the membrane trafficking of the AMPA receptor GluR1 subunit and ADAM10 in the mouse neocortex.

    PubMed

    Ohtake, Nobuaki; Saito, Mieko; Eto, Masaaki; Seki, Kenjiro

    2014-05-01

    Glucagon-like peptide-1 (GLP-1) is a novel treatment modality for type 2 diabetes mellitus. However, GLP-1 has been suggested as a therapeutic target for Alzheimer's disease (AD). In rodent studies, GLP-1 reduces amyloid beta (Aβ) and facilitates synaptic plasticity. Therefore, in the present study, we investigated how GLP-1 facilitates synaptic plasticity and reduces the Aβ in vivo. Exendin-4, a GLP-1 receptor agonist that can cross the blood brain barrier, was subcutaneously administered to adult mice. We then extracted the total and the plasma membrane proteins from the mouse neocortex. Exendin-4 significantly increased the phosphorylation level of cAMP response element-binding protein (CREB). Consistently, the expression level of brain-derived neurotrophic factor (BDNF), a transcriptional target of CREB, was increased. Furthermore, exendin-4 increased the membrane protein level of the AMPA receptor GluR1 subunit and postsynaptic density protein-95 (PSD-95), whereas GluR2 was unaffected. These exendin-4-dependent increases in membrane GluR1, total PSD-95 and BDNF were abrogated by pretreatment with temozolomide (TMZ), a DNA-alkylating agent, indicating that these alterations were dependent on exendin-4-induced transcriptional activity. In addition, we found that exendin-4 increased the level of the α-C terminal fragment (α-CTF) of amyloid precursor protein (APP). Furthermore, protein levels of both mature and immature ADAM10, the α-secretase of APP in the plasma membrane, were increased, whereas the total mature and immature ADAM10 levels were unchanged. These exendin-4-dependent increases in α-CTF and ADAM10 were not affected by TMZ. These findings suggested that GLP-1 facilitates the GluR1 membrane insertion through CREB activation and increases α-secretase activity through ADAM10 membrane trafficking. Upregulation of GluR1 and ADAM10 at the plasma membrane were also observed in mice with intracerebroventricular administration of Aβ oligomer

  3. Concentrations and source apportionment of PM10 and associated elemental and ionic species in a lignite-burning power generation area of southern Greece.

    PubMed

    Argyropoulos, G; Grigoratos, Th; Voutsinas, M; Samara, C

    2013-10-01

    Ambient concentrations of PM10 and associated elemental and ionic species were measured over the cold and the warm months of 2010 at an urban and two rural sites located in the lignite-fired power generation area of Megalopolis in Peloponnese, southern Greece. The PM10 concentrations at the urban site (44.2 ± 33.6 μg m(-3)) were significantly higher than those at the rural sites (23.7 ± 20.4 and 22.7 ± 26.9 μg m(-3)). Source apportionment of PM10 and associated components was accomplished by an advanced computational procedure, the robotic chemical mass balance model (RCMB), using chemical profiles for a variety of local fugitive dust sources (power plant fly ash, flue gas desulfurization wet ash, feeding lignite, infertile material from the opencast mines, paved and unpaved road dusts, soil), which were resuspended and sampled through a PM10 inlet onto filters and then chemically analyzed, as well as of other common sources such as vehicular traffic, residential oil combustion, biomass burning, uncontrolled waste burning, marine aerosol, and secondary aerosol formation. Geological dusts (road/soil dust) were found to be major PM10 contributors in both the cold and warm periods of the year, with average annual contribution of 32.6 % at the urban site vs. 22.0 and 29.0 % at the rural sites. Secondary aerosol also appeared to be a significant source, contributing 22.1 % at the urban site in comparison to 30.6 and 28.7 % at the rural sites. At all sites, the contribution of biomass burning was most significant in winter (28.2 % at the urban site vs. 14.6 and 24.6 % at the rural sites), whereas vehicular exhaust contribution appeared to be important mostly in the summer (21.9 % at the urban site vs. 11.5 and 10.5 % at the rural sites). The highest contribution of fly ash (33.2 %) was found at the rural site located to the north of the power plants during wintertime, when winds are favorable. In the warm period, the highest contribution of fly ash was found at the

  4. One base pair change abolishes the T cell-restricted activity of a kB-like proto-enhancer element from the interleukin 2 promoter.

    PubMed Central

    Briegel, K; Hentsch, B; Pfeuffer, I; Serfling, E

    1991-01-01

    The inducible, T cell-specific enhancers of murine and human Interleukin 2 (Il-2) genes contain the kB-like sequence GGGATTTCACC as an essential cis-acting enhancer motif. When cloned in multiple copies this so-called TCEd (distal T cell element) acts as an inducible proto-enhancer element in E14 T lymphoma cells, but not in HeLa cells. In extracts of induced, Il-2 secreting El4 cells three individual protein factors bind to TCEd DNA. The binding of the most prominent factor, named TCF-1 (T cell factor 1), is correlated with the proto-enhancer activity of TCEd. TCF-1 consists of two polypeptides of about 50 kD and 105 kD; the former seems to be related to the 50 kD polypeptide of NF-kB. Purified NF-kB is also able to bind to the TCEd, but TCF-1 binds stronger than NF-kB to TCEd DNA. The conversion of the TCEd to a 'perfect' NF-kB binding site leads to a tighter binding of NF-kB to TCEd DNA and, as a functional consequence, to the activity of the 'converted' TCEd motifs in HeLa cells. Thus, the substitution of the underlined A residue to a C within the GGGATTTCACC motif abolishes its T cell-restricted activity and leads to its functioning in both El4 cells and HeLa cells. These results indicate that lymphocyte-specific factors binding to the TCEd are involved in the control of T cell specific-transcription of the Il-2 gene. Images PMID:1945879

  5. Continuous in vitro evolution of bacteriophage RNA polymerase promoters

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Banerji, A.; Joyce, G. F.

    1994-01-01

    Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

  6. Association of MMP7 -181A→G Promoter Polymorphism with Gastric Cancer Risk: INFLUENCE OF NICOTINE IN DIFFERENTIAL ALLELE-SPECIFIC TRANSCRIPTION VIA INCREASED PHOSPHORYLATION OF cAMP-RESPONSE ELEMENT-BINDING PROTEIN (CREB).

    PubMed

    Kesh, Kousik; Subramanian, Lakshmi; Ghosh, Nillu; Gupta, Vinayak; Gupta, Arnab; Bhattacharya, Samir; Mahapatra, Nitish R; Swarnakar, Snehasikta

    2015-06-05

    Elevated expression of matrix metalloproteinase7 (MMP7) has been demonstrated to play a pivotal role in cancer invasion. The -181A→G (rs11568818) polymorphism in the MMP7 promoter modulates gene expression and possibly affects cancer progression. Here, we evaluated the impact of -181A→G polymorphism on MMP7 promoter activity and its association with gastric cancer risk in eastern Indian case-control cohorts (n = 520). The GG genotype as compared with the AA genotype was predisposed (p = 0.02; odds ratio = 1.9, 95% confidence interval = 1.1-3.3) to gastric cancer risk. Stratification analysis showed that tobacco addiction enhanced gastric cancer risk in GG subjects when compared with AA subjects (p = 0.03, odds ratio = 2.46, and 95% confidence interval = 1.07-5.68). Meta-analysis revealed that tobacco enhanced the risk for cancer more markedly in AG and GG carriers. Activity and expression of MMP7 were significantly higher in GG than in AA carriers. In support, MMP7 promoter-reporter assays showed greater transcriptional activity toward A to G transition under basal/nicotine-induced/cAMP-response element-binding protein (CREB) overexpressed conditions in gastric adenocarcinoma cells. Moreover, nicotine (a major component of tobacco) treatment significantly up-regulated MMP7 expression due to enhanced CREB phosphorylation followed by its nuclear translocation in gastric adenocarcinoma cells. Furthermore, chromatin immunoprecipitation experiments revealed higher binding of phosphorylated CREB with the -181G than the -181A allele. Altogether, specific binding of phosphorylated CREB to the G allele-carrying promoter enhances MMP7 gene expression that is further augmented by nicotine due to increased CREB phosphorylation and thereby increases the risk for gastric cancer.

  7. The Human CCHC-type Zinc Finger Nucleic Acid-Binding Protein Binds G-Rich Elements in Target mRNA Coding Sequences and Promotes Translation.

    PubMed

    Benhalevy, Daniel; Gupta, Sanjay K; Danan, Charles H; Ghosal, Suman; Sun, Hong-Wei; Kazemier, Hinke G; Paeschke, Katrin; Hafner, Markus; Juranek, Stefan A

    2017-03-21

    The CCHC-type zinc finger nucleic acid-binding protein (CNBP/ZNF9) is conserved in eukaryotes and is essential for embryonic development in mammals. It has been implicated in transcriptional, as well as post-transcriptional, gene regulation; however, its nucleic acid ligands and molecular function remain elusive. Here, we use multiple systems-wide approaches to identify CNBP targets and function. We used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) to identify 8,420 CNBP binding sites on 4,178 mRNAs. CNBP preferentially bound G-rich elements in the target mRNA coding sequences, most of which were previously found to form G-quadruplex and other stable structures in vitro. Functional analyses, including RNA sequencing, ribosome profiling, and quantitative mass spectrometry, revealed that CNBP binding did not influence target mRNA abundance but rather increased their translational efficiency. Considering that CNBP binding prevented G-quadruplex structure formation in vitro, we hypothesize that CNBP is supporting translation by resolving stable structures on mRNAs.

  8. Post-Zygotic and Inter-Individual Structural Genetic Variation in a Presumptive Enhancer Element of the Locus between the IL10Rβ and IFNAR1 Genes

    PubMed Central

    Prakash, Kancherla Reddy; Przerada, Szymon; Paprocka, Hanna; Zywicka, Anna; Westerman, Maxwell P.; Pedersen, Nancy L.; O'Hanlon, Terrance P.; Rider, Lisa G.; Miller, Frederick W.; Srutek, Ewa; Jankowski, Michal; Zegarski, Wojciech; Piotrowski, Arkadiusz; Absher, Devin; Dumanski, Jan P.

    2013-01-01

    Although historically considered as junk-DNA, tandemly repeated sequence motifs can affect human phenotype. For example, variable number tandem repeats (VNTR) with embedded enhancers have been shown to regulate gene transcription. The post-zygotic variation is the presence of genetically distinct populations of cells in an individual derived from a single zygote, and this is an understudied aspect of genome biology. We report somatically variable VNTR with sequence properties of an enhancer, located upstream of IFNAR1. Initially, SNP genotyping of 63 monozygotic twin pairs and multiple tissues from 21 breast cancer patients suggested a frequent post-zygotic mosaicism. The VNTR displayed a repeated 32 bp core motif in the center of the repeat, which was flanked by similar variable motifs. A total of 14 alleles were characterized based on combinations of segments, which showed post-zygotic and inter-individual variation, with up to 6 alleles in a single subject. Somatic variation occurred in ∼24% of cases. In this hypervariable region, we found a clustering of transcription factor binding sites with strongest sequence similarity to mouse Foxg1 transcription factor binding motif. This study describes a VNTR with sequence properties of an enhancer that displays post-zygotic and inter-individual genetic variation. This element is within a locus containing four related cytokine receptors: IFNAR2, IL10Rβ, IFNAR1 and IFNGR2, and we hypothesize that it might function in transcriptional regulation of several genes in this cluster. Our findings add another level of complexity to the variation among VNTR-based enhancers. Further work may unveil the normal function of this VNTR in transcriptional control and its possible involvement in diseases connected with these receptors, such as autoimmune conditions and cancer. PMID:24023707

  9. Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

    SciTech Connect

    Piette, J.; Decuyper-Debergh, D.; Gamper, H.

    1985-11-01

    Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totally deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.

  10. Upregulation of Far Upstream Element-Binding Protein 1 (FUBP1) Promotes Tumor Proliferation and Tumorigenesis of Clear Cell Renal Cell Carcinoma

    PubMed Central

    Duan, Junyao; Bao, Xu; Ma, Xin; Zhang, Yu; Ni, Dong; Wang, Hanfeng; Zhang, Fan; Du, Qingshan; Fan, Yang; Chen, Jianwen; Wu, Shengpan; Li, Xintao; Gao, Yu

    2017-01-01

    Objective The far upstream element (FUSE)-binding protein 1 (FUBP1) is a transactivator of human c-myc proto-oncogene transcription, with important roles in carcinogenesis. However, the expression pattern and potential biological function of FUBP1 in clear cell renal cell carcinoma (ccRCC) is yet to be established. Methods FUBP1 expression was detected in ccRCC tissues and cell lines by real-time RT-PCR, Western blot analysis, and immunohistochemistry. The correlations of FUBP1 mRNA expression levels with clinicopathological factors were evaluated. The biological function of FUBP1 during tumor cell proliferation was studied by MTS, colony formation, and soft-agar colony formation. The effects of FUBP1 on cell cycle distribution and apoptosis were analyzed by flow cytometry. Western blot analysis was used to identify the potential mechanism of FUBP1 regulating cell cycle and apoptosis. Results The levels of FUBP1 mRNA and protein expression were upregulated in human ccRCC tissues compared with adjacent noncancerous tissues. High levels of FUBP1 mRNA expression were associated with higher tumor stage and tumor size. FUBP1 knockdown inhibited cell proliferation and induced cell cycle arrest and apoptosis. Meanwhile, the expression levels of c-myc and p21 mRNA were correlated with that of FUBP1 mRNA. Conclusions FUBP1 acts as a potential oncogene in ccRCC and may be considered as a novel biomarker or an attractive treatment target of ccRCC. PMID:28076379

  11. Association Study Between Metabolic Syndrome and rs8066560 Polymorphism in the Promoter Region of Sterol Regulatory Element-binding Transcription Factor 1 Gene in Iranian Children and Adolescents

    PubMed Central

    Miranzadeh-Mahabadi, Hajar; Emadi-Baygi, Modjtaba; Nikpour, Parvaneh; Kelishadi, Roya

    2016-01-01

    Background: Metabolic syndrome (MetS) is a prevalent disorder in pediatric age groups, described by a combination of genetic and environmental factors. Sterol regulatory element-binding transcription factor 1 (SREBF-1) induces the expression of a family of genes involved in fatty acid synthesis. Moreover, dysregulation of miR-33b, which is located within the intron 17 of the SREBF-1 gene, disrupts fatty acid oxidation and insulin signaling, thus leading to MetS. The aim of the present study was to investigate the association between SREBF-1 rs8066560 polymorphism and MetS in Iranian children and adolescents. Methods: This study includes 100 MetS and 100 normal individuals aged 9–19 years. Anthropological and biochemical indexes were measured. The -1099G > A polymorphism was genotyped by TaqMan real-time polymerase chain reaction. Results: Significant differences were observed in anthropometric measurements and lipid profiles between MetS and normal children. There were no differences in the genotype frequencies or allele distribution for -1099G > A polymorphism between MetS and control groups. High-density lipoprotein cholesterol levels were significantly higher in the MetS GG group than in the A allele carrier group. The genotype AA controls had significantly increased cholesterol and low-density lipoprotein cholesterol levels than AG genotypes. By logistic regression using different genetic models, no significant association was observed between SREBF-1 rs8066560 polymorphism and the risk of MetS. Conclusions: We conclude that the -1099G > A variant on SREBF-1 gene associated with serum lipid profiles, however, it may not be a major risk factor for the MetS in Iranian children and adolescents. PMID:27076879

  12. Promotion of Linkage between Technical and Vocational Education and the World of Work. UNEVOC Studies in Technical and Vocational Education, Number 10.

    ERIC Educational Resources Information Center

    United Nations Economic, Scientific, and Cultural Organization, Paris (France). Section for Technical and Vocational Education.

    This document contains seven papers about and from an international meeting on promoting linkage between technical and vocational education and the world of work. The first paper, a Final Report on the "International Expert Meeting on the Promotion of Linkage between Technical/Vocational Education and the World of Work (Tokyo, Japan, 3-6…

  13. Transgenic expression of medicago truncatula PR10 and PR5 promoters in alfalfa shows pathogen-induced up-regulation of transgene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic modification of alfalfa to introduce novel traits requires promoters for controlling gene expression. Promoters that are constitutively activated for expression of genes that enhance disease resistance pose a great energy load on the plant and exert a strong selective pressure on the pathoge...

  14. IL-10 promotes homeostatic proliferation of human CD8(+) memory T cells and, when produced by CD1c(+) DCs, shapes naive CD8(+) T-cell priming.

    PubMed

    Nizzoli, Giulia; Larghi, Paola; Paroni, Moira; Crosti, Maria Cristina; Moro, Monica; Neddermann, Petra; Caprioli, Flavio; Pagani, Massimiliano; De Francesco, Raffaele; Abrignani, Sergio; Geginat, Jens

    2016-07-01

    IL-10 is an anti-inflammatory cytokine that inhibits maturation and cytokine production of dendritic cells (DCs). Although mature DCs have the unique capacity to prime CD8(+) CTL, IL-10 can promote CTL responses. To understand these paradoxic findings, we analyzed the role of IL-10 produced by human APC subsets in T-cell responses. IL-10 production was restricted to CD1c(+) DCs and CD14(+) monocytes. Interestingly, it was differentially regulated, since R848 induced IL-10 in DCs, but inhibited IL-10 in monocytes. Autocrine IL-10 had only a weak inhibitory effect on DC maturation, cytokine production, and CTL priming with high-affinity peptides. Nevertheless, it completely blocked cross-priming and priming with low-affinity peptides of a self/tumor-antigen. IL-10 also inhibited CD1c(+) DC-induced CD4(+) T-cell priming and enhanced Foxp3 induction, but was insufficient to induce T-cell IL-10 production. CD1c(+) DC-derived IL-10 had also no effect on DC-induced secondary expansions of memory CTL. However, IL-15-driven, TCR-independent proliferation of memory CTL was enhanced by IL-10. We conclude that DC-derived IL-10 selects high-affinity CTL upon priming. Moreover, IL-10 preserves established CTL memory by enhancing IL-15-dependent homeostatic proliferation. These combined effects on CTL priming and memory maintenance provide a plausible mechanism how IL-10 promotes CTL responses in humans.

  15. Use of a new rat chondrosarcoma cell line to delineate a 119-base pair chondrocyte-specific enhancer element and to define active promoter segments in the mouse pro-alpha 1(II) collagen gene.

    PubMed

    Mukhopadhyay, K; Lefebvre, V; Zhou, G; Garofalo, S; Kimura, J H; de Crombrugghe, B

    1995-11-17

    We show that a new rat chondrosarcoma (RCS) cell line established in long-term culture from the Swarm tumor displayed a stable differentiated chondrocyte-like phenotype. Indeed, these cells produced the collagen types II, IX, and XI and alcian blue-stainable cartilage-specific proteoglycans, but no type I or type III collagen. To functionally characterize their chondrocytic nature, the cells were stably transfected with a type II collagen/beta geo chimeric gene which confers essentially perfect chondrocyte-specific expression in transgenic mice. RCS cells expressed both beta-galactosidase and G418 resistance, in comparison with similarly transfected 10T1/2 and NIH/3T3 fibroblasts which did not. These cells were then used to perform a systematic deletion analysis of the first intron of the mouse type II collagen gene (Col2a1) using transient expression experiments to determine which segments stimulated expression of a luciferase reporter gene in RCS cells but not in 10T1/2 fibroblasts. Cloning of two tandem copies of a 156-base pair (bp) intron 1 fragment (+2188 to +2343) in a construction containing a 314-bp Col2a1 promoter caused an almost 200-fold increase in promoter activity in RCS cells but no increase in 10T1/2 cells. DNase I footprint analysis over this 156-bp fragment revealed two adjacent protected regions, FP1 and FP2, located in the 3'-half of this segment, but no differences were seen with nuclear extracts of RCS cells and 10T1/2 fibroblasts. Deletion of FP2 to leave a 119-bp segment decreased enhancer activity by severalfold, but RCS cell specificity was maintained. Further deletions indicated that sequences both in the 5' part of the 119-bp fragment and in FP1 were needed simultaneously for RCS cell-specific enhancer activity. A series of deletions in the promoter region of the mouse Col2a1 gene progressively reduced activity when these promoters were tested by themselves in transient expression experiments. However, these promoter deletions were all

  16. Influence of electronegativity on the electronic structures and stabilities of microclusters of carbides MC_n (M : transition, rare-earth or normal element, n < 10)

    NASA Astrophysics Data System (ADS)

    Leleyter, M.

    1991-10-01

    MC_n, clusters (n < 10) produced from carbides by various experimental techniques (SIMS, SSMS, LAMMA, Knudsen effusion, etc.) show strong alternations in their emission intensities I(MC^+_n) according to the parity of the carbon atom number n. Maxima take place for odd n (“odd" alternations) if M = H, F, Cl or Fe, Ni, Rh, Ir, Pt or for even n (“even" alternations) if M = B, Si, Ba, Ge or Sc, Ti, V, Cr, Y, Zr, La, Ce, W, Th, U or even the ions exist only for even n (Nd, Dy, Ho, Er). Moreover, only CO, C_3O, CN and C_3N are known for O and N. Such phenomena are due to the stability properties of the clusters themselves (“correspondence rule") and can be interpreted with the Pitzer and Clementi model (sp hybridization in Hückel approximation): the clusters are assumed to be linear chains of “cumulene" type :C=C=..C=C=M and the alternations in the relative stabilities of these chains are mainly due to the fact that the HOMO (highest occupied molecular orbital) of the clusters lies in a double degenerate π level band. Now HOMO may be either full or half-filled, and an aggregate with a complete (or almost complete) HOMO is more stable than an aggregate with a half-filled HOMO. Consequently, the number of π electrons is governing the parity effect in the stability alternations. However, this number is depending on the number of σ electrons of the chain and besides, for the transition or rare-earth metals, on the positions of the dσ and degenerate dδ levels due to the M atom, which are governed by Pauling's electronegativity (EN) of atom M. For transition or lanthanide metals, the alternations are “even" if EN le 1.7 (deficient d electron-elements: columns IIIA to VIIA; empty dσ and δ levels) or “odd" in the reverse case (rich d electron elements: column VIIIA bonding dσ and δ levels). For normal elements, the limit of EN seems to be the EN of C (2.5) and the alternations are “even" if EN le 2.5 or “odd" in the other case. Thus it is possible to

  17. Examining Incentives to Promote Physical Activity Maintenance Among Hospital Employees Not Achieving 10,000 Daily Steps: A Web-Based Randomized Controlled Trial Protocol

    PubMed Central

    White, Lauren; Oh, Paul; Kwan, Matthew; Gove, Peter; Leahey, Tricia; Faulkner, Guy

    2016-01-01

    Background The economic burden of physical inactivity in Canada is estimated at Can $6.8 billion (US $5 billion) per year. Employers bear a substantial proportion of the economic costs, as they pay more for inactive workers in health care and other organizational costs. In response, many Canadian employers offer wellness programs, though these are often underutilized. While financial health incentives have been proposed as one way of increasing participation, their longer term effects (ie postintervention effects) are not clear. Objective The objective of this paper is to outline the methodology for a randomized control trial (RCT) examining the longer term impact of an existing physical activity promotion program that is enhanced by adding guaranteed rewards (Can $1 [US $0.74] per day step goal met) in a lower active hospital employee population (less than 10,000 steps per day). Methods A 12-week, parallel-arm RCT (with a 12-week postintervention follow-up) will be employed. Employees using Change4Life (a fully automated, incentive-based wellness program) and accumulating fewer than 10,000 steps per day at baseline (weeks 1 to 2) will be randomly allocated (1:1) to standard care (wellness program, accelerometer) or an intervention group (standard care plus guaranteed incentives). All study participants will be asked to wear the accelerometer and synchronize it to Change4Life daily, although only intervention group participants will receive guaranteed incentives for reaching tailored daily step count goals (Can $1 [US $0.74] per day; weeks 3 to 12). The primary study outcome will be mean proportion of participant-days step goal reached during the postintervention follow-up period (week 24). Mean proportion of participant-days step goal reached during the intervention period (week 12) will be a secondary outcome. Results Enrollment for the study will be completed in February 2017. Data analysis will commence in September 2017. Study results are to be published in

  18. Synthesis and properties of layered synthetic microstructure (LSM) dispersion elements for 62 eV (200A) to 1. 24 keV (10A) radiation. Final report

    SciTech Connect

    Barbee, T.W. Jr.

    1981-08-01

    The opportunities offered by engineered synthetic multilayer dispersion elements for x-rays have been recognized since the earliest days of x-ray diffraction analysis. In this paper, application of sputter deposition technology to the synthesis of Layered Synthetic Microstructure (LSMs) of sufficient quality for use as x-ray dispersion elements is discussed. It will be shown that high efficiency, controllable bandwidth dispersion elements, with d spacings varying from 15 A to 180 A, may be synthesized onto both mechanically stiff and flexible substrates. Multilayer component materials include tungsten, niobium, molybdenum, titanium, vanadium, and silicon layers separated by carbon layers. Experimental observations of peak reflectivity in first order, integrated reflectivity in first order, and diffraction performance at selected photon energies in the range, 100 to 15,000 eV, will be reported and compared to theory.

  19. Analyses of Ca2+ dynamics using a ubiquitin-10 promoter-driven Yellow Cameleon 3.6 indicator reveal reliable transgene expression and differences in cytoplasmic Ca2+ responses in Arabidopsis and rice (Oryza sativa) roots.

    PubMed

    Behera, Smrutisanjita; Wang, Nili; Zhang, Chunxia; Schmitz-Thom, Ina; Strohkamp, Sarah; Schültke, Stefanie; Hashimoto, Kenji; Xiong, Lizhong; Kudla, Jörg

    2015-04-01

    Ca(2+) signatures are central to developmental processes and adaptive responses in plants. However, high-resolution studies of Ca(2+) dynamics using genetically encoded Ca(2+) indicators (GECIs) such as Yellow Cameleon (YC) proteins have so far not been conducted in important model crops such as rice (Oryza sativa). We conducted a comparative study of 35S and ubiquitin-10 (UBQ10) promoter functionality in Arabidopsis thaliana and O. sativa plants expressing the Ca(2+) indicator Yellow Cameleon 3.6 (YC3.6) under control of the UBQ10 or 35S promoter. Ca(2+) signatures in roots of both species were analyzed during exposure to hyperpolarization/depolarization cycles or in response to application of the amino acid glutamate. We found a superior performance of the UBQ10 promoter with regard to expression pattern, levels and expression stabilities in both species. We observed remarkable differences between the two species in the spatiotemporal parameters of the observed Ca(2+) signatures. Rice appeared in general to respond with a lower maximal signal amplitude but greatly increased signal duration when compared with Arabidopsis. Our results identify important advantages to using the UBQ10 promoter in Arabidopsis and rice and in T-DNA mutant backgrounds. Moreover, the observed differences in Ca(2+) signaling in the two species underscore the need for comparative studies to achieve a comprehensive understanding of Ca(2+) signaling in plants.

  20. Evidence that the Dictyostelium STAT protein Dd-STATa plays a role in the differentiation of inner basal disc cells and identification of a promoter element essential for expression in these cells.

    PubMed

    Shimada, Nao; Maruo, Toshinari; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi

    2005-02-01

    Dd-STATa, a Dictyostelium homolog of the metazoan STAT (signal transducers and activators of transcription) proteins, is necessary in the slug for correct entry into culmination. Dd-STATa-null mutant fails to culminate and its phenotype correlates with the loss of a funnel-shaped core region, the pstAB core region, which expresses both the ecmA and ecmB genes. To understand how the differentiation of pstAB core cells is regulated, we identified an EST that is expressed in the core cells of normal slugs but down-regulated in the Dd-STATa-null mutant. This EST, SSK348, encodes a close homolog of the Dictyostelium acetyl-CoA synthetase (ACS). A promoter fragment of the cognate gene, aslA (acetyl-CoA synthetase-like A), was fused to a lacZ reporter and the expression pattern determined. As expected from the behavior of the endogenous aslA gene, the aslA::lacZ fusion gene is not expressed in Dd-STATa-null slugs. In parental cells, the aslA promoter is first activated in the funnel-shaped core cells located at the slug anterior, the "pstAB core." During culmination, the pstAB core cells move down, through the prespore cells, to form the inner part of the basal disc. As the spore mass climbs the stalk, the aslA gene comes to be expressed in cells of the upper and lower cups, structures that cradle the spore head. Deletion and point mutation analyses of the promoter identified an AT-rich sequence that is necessary for expression in the pstAB core. This acts in combination with repressor regions that prevent ectopic aslA expression in the pre-stalk regions of slugs and the stalks of culminants. Thus, this study confirms that Dd-STATa is necessary for the differentiation of pstAB core cells, by showing that it is needed for the activation of the aslA gene. It also identifies aslA promoter elements that are likely to be regulated, directly or indirectly, by Dd-STATa.

  1. A novel rho promoter::Tn10 mutation suppresses and ftsQ1(Ts) missense mutation in an essential Escherichia coli cell division gene by a mechanism not involving polarity suppression.

    PubMed Central

    Storts, D R; Markovitz, A

    1991-01-01

    An extragenic suppressor of the Escherichia coli cell division gene ftsQ1(Ts) was isolated. The suppressor is a Tn10 insertion into the -35 promoter consensus sequence of the rho gene, designated rho promoter::Tn10. The ftsQ1(Ts) mutation was also suppressed by the rho-4 mutant allele. The rho promoter::Tn10 strain does not exhibit rho mutant polarity suppressor phenotypes. In addition, overexpression of the ftsQ1(Ts) mutation does not reverse temperature sensitivity. Furthermore, DNA sequence analysis of the ftsQ1(Ts) allele revealed that the salt-remediable, temperature-sensitive phenotype arose from a single missense mutation. The most striking phenotype of the rho promoter::Tn10 mutant strain is an increase in the level of negative supercoiling. On the basis of these observations, we conclude that the ftsQ1(Ts) mutation may be suppressed by a change in supercoiling. Images PMID:1846147

  2. Study of the chemical elements and polycyclic aromatic hydrocarbons in atmospheric particles of PM 10 and PM 2.5 in the urban and rural areas of South Brazil

    NASA Astrophysics Data System (ADS)

    Dallarosa, Juliana; Calesso Teixeira, Elba; Meira, Lindolfo; Wiegand, Flavio

    2008-07-01

    The purpose of this work is to study the chemical elements and PAHs associated with atmospheric particulate in samples of PM 10 collected in the Metropolitan Area of Porto Alegre—MAPA, Rio Grande do Sul, Brazil. In addition, to study the chemical elements associated with particles of different fractions of PM 10-2.5 and PM 2.5 using dichotomous sampling, in urban (MAPA) and rural areas. Two types of samplers were used: HV PM 10 and Dichotomous (PM 10-2.5 and PM 2.5). Samples were collected during 2002 and 2005. The concentration of the elements Si, S, Cl, K, Ca, Ti, V, Cr, Mn, Fe, Ni, Cu, and Zn was determined by PIXE (Particle-Induced X-ray Emission), while the concentrations of 16 major PAHs were determined according to EPA with a gas chromatograph coupled to a mass spectrometer (GS/MS). Results showed that elements of anthropogenic origin (V, Zn, Cr, Ni, Cu, and S) were mainly associated with the fraction PM 2.5, while the soil dust (Si, Al, Ti and Fe) were found mainly on fraction PM 10-2.5. In samples of PM 10, the most frequent PAHs found were Bgp, Flt, BaA, Chr, B(b + k)F, BaP and Dba. The types of emission and their association with the atmospheric parameters were studied applying the statistical analysis of the principal component method. The main sources found in the area under study were vehicles, industries (steel mills and a coal-fired power station), dust, sea breeze, and burning.

  3. o,p'-DDT induces cyclooxygenase-2 gene expression in murine macrophages: Role of AP-1 and CRE promoter elements and PI3-kinase/Akt/MAPK signaling pathways

    SciTech Connect

    Han, Eun Hee; Kim, Ji Young; Kim, Hyung-Kyun; Hwang, Yong Pil; Jeong, Hye Gwang

    2008-12-01

    Dichlorodiphenyltrichloroethane (DDT) has been used as an insecticide to prevent the devastation of malaria in tropical zones. However, many reports suggest that DDT may act as an endocrine disruptor and may have possible carcinogenic effects. Cyclooxygenase-2 (COX-2) acts as a link between inflammation and carcinogenesis through its involvement in tumor promotion. In the present study, we examined the effect of o,p'-DDT on COX-2 gene expression and analyzed the molecular mechanism of its activity in murine RAW 264.7 macrophages. Exposure to o,p'-DDT markedly enhanced the production of prostaglandin E{sub 2} (PGE{sub 2}), a major COX-2 metabolite, in murine macrophages. Furthermore, o,p'-DDT dose-dependently increased the levels of COX-2 protein and mRNA. Transfection with human COX-2 promoter construct, electrophoretic mobility shift assays and DNA-affinity protein-binding assay experiments revealed that o,p'-DDT activated the activator protein 1 (AP-1) and cyclic AMP response element (CRE) sites, but not the NF-{kappa}B site. Phosphatidylinositol 3 (PI3)-kinase, its downstream signaling molecule, Akt, and mitogen-activated protein kinases (MAPK) were also significantly activated by the o,p'-DDT-induced AP-1 and CRE activation. These results demonstrate that o,p'-DDT induced COX-2 expression via AP-1 and CRE activation through the PI3-K/Akt/ERK, JNK, and p38 MAP kinase pathways. These findings provide further insight into the signal transduction pathways involved in the carcinogenic effects of o,p'-DDT.

  4. Androgens Up-regulate Transcription of the Notch Inhibitor Numb in C2C12 Myoblasts via Wnt/β-Catenin Signaling to T Cell Factor Elements in the Numb Promoter*

    PubMed Central

    Liu, Xin-Hua; Wu, Yong; Yao, Shen; Levine, Alice C.; Kirschenbaum, Alexander; Collier, Lauren; Bauman, William A.; Cardozo, Christopher P.

    2013-01-01

    Androgen signaling via the androgen receptor is a key pathway that contributes to development, cell fate decisions, and differentiation, including that of myogenic progenitors. Androgens and synthetic steroids have well established anabolic actions on skeletal muscle. Wnt and Notch signaling pathways are also essential to myogenic cell fate decisions during development and tissue repair. However, the interactions among these pathways are largely unknown. Androgenic regulation of Wnt signaling has been reported. Nandrolone, an anabolic steroid, has been shown to inhibit Notch signaling and up-regulate Numb, a Notch inhibitor. To elucidate the mechanisms of interaction between nandrolone and Wnt/Notch signaling, we investigated the effects of nandrolone on Numb expression and Wnt signaling and determined the roles of Wnt signaling in nandrolone-induced Numb expression in C2C12 myoblasts. Nandrolone increased Numb mRNA and protein levels and T cell factor (Tcf) transcriptional activity via inhibition of glycogen synthase kinase 3β. Up-regulation of Numb expression by nandrolone was blocked by the Wnt inhibitors, sFRP1 and DKK1, whereas Wnt3a increased Numb mRNA and protein expression. In addition, we observed that the proximal promoter of the Numb gene had functional Tcf binding elements to which β-catenin was recruited in a manner enhanced by both nandrolone and Wnt3a. Moreover, site-directed mutagenesis indicated that the Tcf binding sites in the Numb promoter are required for the nandrolone-induced Numb transcriptional activation in this cell line. These results reveal a novel molecular mechanism underlying up-regulation of Numb transcription with a critical role for increased canonical Wnt signaling. In addition, the data identify Numb as a novel target gene of the Wnt signaling pathway by which Wnts would be able to inhibit Notch signaling. PMID:23649620

  5. Insulin induces a transcriptional activation of epiregulin, HB-EGF and amphiregulin, by a PI3K-dependent mechanism: Identification of a specific insulin-responsive promoter element

    SciTech Connect

    Ornskov, Dorthe; Nexo, Ebba; Sorensen, Boe S. . E-mail: boess@as.aaa.dk

    2007-03-23

    Previously we have shown that insulin-stimulation of RT4 bladder cancer cells leads to increased proliferation, which require HER1 activation, and is accompanied by increased mRNA expression of the EGF-ligands heparin-binding EGF-like growth factor (HB-EGF), amphiregulin (AR), and epiregulin (EPI) [D. Ornskov, E. Nexo, B.S. Sorensen, Insulin-induced proliferation of bladder cancer cells is mediated through activation of the epidermal growth factor system, FEBS J. 273 (2006) 5479-5489]. In the present paper, we have investigated the molecular mechanism leading to this insulin-induced expression. We monitored the decay of mRNA after inhibiting transcription with Actinomycin D and demonstrated that the insulin-mediated increase was not caused by enhanced mRNA stability. In untreated cells, HB-EGF mRNA was the least stable, whereas AR and EPI mRNA decayed with slower kinetics. However, promoter analysis of HB-EGF and EPI demonstrated that insulin stimulated transcription. Studies on the EPI promoter identified the insulin-responsive element to be located in the region -564 to -365 bp. This region contains potential binding sites for the transcription factors SP1, AP1, and NF-{kappa}B. Interestingly, all three transcription factors can be activated by PI3K. We demonstrate that the insulin-induced expression of HB-EGF, AR, and EPI mRNA is completely prevented by the specific PI3K inhibitor Wortmannin, suggesting an involvement of the PI3K.

  6. Promoting Positive Learning in Australian Students Aged 10- to 12-Years-Old Using Attribution Retraining and Cognitive Behavioral Therapy: A Pilot Study

    ERIC Educational Resources Information Center

    Chodkiewicz, Alicia R; Boyle, Christopher

    2016-01-01

    This study piloted an intervention using attribution retraining and cognitive behavioral therapy techniques to promote positive learning experiences and outcomes for students. This research is an important step to revitalise the dwindling field of attribution retraining research by assessing whether these techniques effectively improve student…

  7. Senescence responsive transcriptional element

    DOEpatents

    Campisi, Judith; Testori, Alessandro

    1999-01-01

    Recombinant polynucleotides have expression control sequences that have a senescence responsive element and a minimal promoter, and which are operatively linked to a heterologous nucleotide sequence. The molecules are useful for achieving high levels of expression of genes in senescent cells. Methods of inhibiting expression of genes in senescent cells also are provided.

  8. Effects of a 10-Day Intensive Health Promotion Program Combining Diet and Physical Activity on Body Composition, Physical Fitness, and Blood Factors of Young Adults: A Randomized Pilot Study.

    PubMed

    Lee, Kyoung Soon; Lee, Jae Koo; Yeun, Young Ran

    2017-04-11

    BACKGROUND A lifestyle characterized by poor eating habits and physical inactivity is a risk factor for multiple lifestyle diseases in young adults. This study assessed the effects of implementing an intensive 10-day health promotion program combining diet and physical activities on body composition, physical fitness, and biochemical parameters of young adults. MATERIAL AND METHODS In this randomized pilot study, 30 female undergraduate students were randomly allocated to an intervention and a control group. The health promotion program consisted of unlimited amounts of vegetarian food; aerobic, flexibility, and strength exercises (3 hours/day); lectures on health (3 hours/day); massage practice (2 hours/day); and healthy cooking practice (1 hour/day). The effects of the intervention were analyzed using the Mann-Whitney U test and the Wilcoxon signed-rank test. RESULTS The intensive 10-day health promotion program significantly reduced body weight, body mass index, triglyceride, total cholesterol, low-density lipoprotein cholesterol, blood glucose, and the homeostasis model assessment of insulin resistance. At the same time, participants demonstrated increased back muscle, leg muscle, and grip strength; waist and shoulder flexibility; balance; and cardiorespiratory endurance. CONCLUSIONS The intensive 10-day health promotion program is a viable intervention for improving body composition, physical fitness, glycemic control, and blood lipid levels in young adults.

  9. Identification of a Bipartite Jasmonate-Responsive Promoter Element in the Catharanthus roseus ORCA3 Transcription Factor Gene That Interacts Specifically with AT-Hook DNA-Binding Proteins1[W

    PubMed Central

    Vom Endt, Débora; Soares e Silva, Marina; Kijne, Jan W.; Pasquali, Giancarlo; Memelink, Johan

    2007-01-01

    Jasmonates are plant signaling molecules that play key roles in defense against certain pathogens and insects, among others, by controlling the biosynthesis of protective secondary metabolites. In Catharanthus roseus, the APETALA2-domain transcription factor ORCA3 is involved in the jasmonate-responsive activation of terpenoid indole alkaloid biosynthetic genes. ORCA3 gene expression is itself induced by jasmonate. By loss- and gain-of-function experiments, we located a 74-bp region within the ORCA3 promoter, which contains an autonomous jasmonate-responsive element (JRE). The ORCA3 JRE is composed of two important sequences: a quantitative sequence responsible for a high level of expression and a qualitative sequence that appears to act as an on/off switch in response to methyl jasmonate. We isolated 12 different DNA-binding proteins having one of four different types of DNA-binding domains, using the ORCA3 JRE as bait in a yeast (Saccharomyces cerevisiae) one-hybrid transcription factor screening. The binding of one class of proteins bearing a single AT-hook DNA-binding motif was affected by mutations in the quantitative sequence within the JRE. Two of the AT-hook proteins tested had a weak activating effect on JRE-mediated reporter gene expression, suggesting that AT-hook family members may be involved in determining the level of expression of ORCA3 in response to jasmonate. PMID:17496112

  10. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and ApoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1.

    PubMed

    Singaraja, R R; Bocher, V; James, E R; Clee, S M; Zhang, L H; Leavitt, B R; Tan, B; Brooks-Wilson, A; Kwok, A; Bissada, N; Yang, Y Z; Liu, G; Tafuri, S R; Fievet, C; Wellington, C L; Staels, B; Hayden, M R

    2001-09-07

    By using BAC transgenic mice, we have shown that increased human ABCA1 protein expression results in a significant increase in cholesterol efflux in different tissues and marked elevation in high density lipoprotein (HDL)-cholesterol levels associated with increases in apoAI and apoAII. Three novel ABCA1 transcripts containing three different transcription initiation sites that utilize sequences in intron 1 have been identified. In BAC transgenic mice there is an increased expression of ABCA1 protein, but the distribution of the ABCA1 product in different cells remains similar to wild type mice. An internal promoter in human intron 1 containing liver X response elements is functional in vivo and directly contributes to regulation of the human ABCA1 gene in multiple tissues and to raised HDL cholesterol, apoAI, and apoAII levels. A highly significant relationship between raised protein levels, increased efflux, and level of HDL elevation is evident. These data provide proof of the principle that increased human ABCA1 efflux activity is associated with an increase in HDL levels in vivo.

  11. TamiR1123 originated from a family of miniature inverted-repeat transposable elements (MITE) including one inserted in the Vrn-A1a promoter in wheat.

    PubMed

    Yu, Ming; Carver, Brett F; Yan, Liuling

    2014-02-01

    More than half of spring wheat cultivars have a dominant Vrn-A1a allele that has an insertion of a miniature inverted-repeat transposable element (MITE) in its promoter. In this study, we found that the MITE present in the Vrn-A1a gene (MITE_VRN) is a nearly perfect palindrome and it can form highly stable hairpin loops when expressed as RNA. MITE_VRN also possessed sequences of a microRNA in Triticum aestivum (TamiR1123). The P(32) labeled TamiR1123 probe detected two RNA molecules on a small RNA gel blot, one expected for MITE_VRN, and the other expected for TamiR1123. These results demonstrated that MITE_VRN was expressed as RNAs and TamiR1123 was originated from the MITE_VRN family. The isogenic line TDD carrying the dominant Vrn-A1a allele with MITE_VRN showed higher TamiR1123 and Vrn-A1a transcript levels than the isogenic line TDE carrying the recessive vrn-A1a allele without MITE_VRN. TamiR1123 were greatly up-regulated by plant age but slightly down-regulated by low temperature and short days. These findings have pointed to alternative regulatory mechanisms for plant development governed by Vrn-A1a in spring wheat.

  12. Sensitivity and uncertainty in the measurement of H*(10) in neutron fields using an REM500 and a multi-element TEPC.

    PubMed

    Waker, Anthony; Taylor, Graeme

    2014-10-01

    The REM500 is a commercial instrument based on a tissue-equivalent proportional counter (TEPC) that has been successfully deployed as a hand-held neutron monitor, although its sensitivity is regarded by some workers as low for nuclear power plant radiation protection work. Improvements in sensitivity can be obtained using a multi-element proportional counter design in which a large number of small detecting cavities replace the single large volume cavity of conventional TEPCs. In this work, the authors quantify the improvement in uncertainty that can be obtained by comparing the ambient dose equivalent measured with a REM500, which utilises a 5.72 cm (2(1/4) inch) diameter Rossi counter, with that of a multi-element TEPC designed to have the sensitivity of a 12.7 cm (5 inch) spherical TEPC. The results obtained also provide some insight into the influence of other design features of TEPCs, such as geometry and gas filling, on the measurement of ambient dose equivalent.

  13. Light-element Nucleosynthesis in a Molecular Cloud Interacting with a Supernova Remnant and the Origin of Beryllium-10 in the Protosolar Nebula

    NASA Astrophysics Data System (ADS)

    Tatischeff, Vincent; Duprat, Jean; de Séréville, Nicolas

    2014-12-01

    The presence of short-lived radionuclides (t 1/2 < 10 Myr) in the early solar system provides important information about the astrophysical environment in which the solar system formed. The discovery of now extinct 10Be (t 1/2 = 1.4 Myr) in calcium-aluminum-rich inclusions (CAIs) with Fractionation and Unidentified Nuclear isotope anomalies (FUN-CAIs) suggests that a baseline concentration of 10Be in the early solar system was inherited from the protosolar molecular cloud. In this paper, we investigate various astrophysical contexts for the nonthermal nucleosynthesis of 10Be by cosmic-ray-induced reactions. We first show that the 10Be recorded in FUN-CAIs cannot have been produced in situ by irradiation of the FUN-CAIs themselves. We then show that trapping of Galactic cosmic rays (GCRs) in the collapsing presolar cloud core induced a negligible 10Be contamination of the protosolar nebula, the inferred 10Be/9Be ratio being at least 40 times lower than that recorded in FUN-CAIs (10Be/9Be ~ 3 × 10-4). Irradiation of the presolar molecular cloud by background GCRs produced a steady-state 10Be/9Be ratio <~ 1.3 × 10-4 at the time of the solar system formation, which suggests that the presolar cloud was irradiated by an additional source of CRs. Considering a detailed model for CR acceleration in a supernova remnant (SNR), we find that the 10Be abundance recorded in FUN-CAIs can be explained within two alternative scenarios: (1) the irradiation of a giant molecular cloud by CRs produced by >~ 50 supernovae exploding in a superbubble of hot gas generated by a large star cluster of at least 20,000 members, and (2) the irradiation of the presolar molecular cloud by freshly accelerated CRs escaped from an isolated SNR at the end of the Sedov-Taylor phase. In the second picture, the SNR resulted from the explosion of a massive star that ran away from its parent OB association, expanded during most of its adiabatic phase in an intercloud medium of density of about 1 H

  14. Elemental ZOO

    NASA Astrophysics Data System (ADS)

    Helser, Terry L.

    2003-04-01

    This puzzle uses the symbols of 39 elements to spell the names of 25 animals found in zoos. Underlined spaces and the names of the elements serve as clues. To solve the puzzle, students must find the symbols that correspon