Science.gov

Sample records for 10 promoter element

  1. Structural Basis for Promoter ;#8722;10 Element Recognition by the Bacterial RNA Polymerase [sigma] Subunit

    SciTech Connect

    Feklistov, Andrey; Darst, Seth A.

    2011-12-15

    The key step in bacterial promoter opening is recognition of the -10 promoter element (T-{sub 12}A-{sub 11}T-{sub 10}A-{sub 9}A-{sub 8}T{sub -7} consensus sequence) by the RNA polymerase {alpha} subunit. We determined crystal structures of {alpha} domain 2 bound to single-stranded DNA bearing -10 element sequences. Extensive interactions occur between the protein and the DNA backbone of every -10 element nucleotide. Base-specific interactions occur primarily with A{sub -11} and T{sub -7}, which are flipped out of the single-stranded DNA base stack and buried deep in protein pockets. The structures, along with biochemical data, support a model where the recognition of the -10 element sequence drives initial promoter opening as the bases of the nontemplate strand are extruded from the DNA double-helix and captured by {alpha}. These results provide a detailed structural basis for the critical roles of A{sub -11} and T{sub -7} in promoter melting and reveal important insights into the initiation of transcription bubble formation.

  2. Cooperativity and interaction energy threshold effects in recognition of the -10 promoter element by bacterial RNA polymerase.

    PubMed

    Mekler, Vladimir; Severinov, Konstantin

    2013-08-01

    RNA polymerase (RNAP) melts promoter DNA to form transcription-competent open promoter complex (RPo). Interaction of the RNAP σ subunit with non-template strand bases of a conserved -10 element (consensus sequence T-12A-11T-10A-9A-8T-7) is an important source of energy-driving localized promoter melting. Here, we used an RNAP molecular beacon assay to investigate interdependencies of RNAP interactions with -10 element nucleotides. The results reveal a strong cooperation between RNAP interactions with individual -10 element non-template strand nucleotides and indicate that recognition of the -10 element bases occurs only when free energy of the overall RNAP -10 element binding reaches a certain threshold level. The threshold-like mode of the -10 element recognition may be related to the energetic cost of attaining a conformation of the -10 element that is recognizable by RNAP. The RNAP interaction with T/A-12 base pair was found to be strongly stimulated by RNAP interactions with other -10 element bases and with promoter spacer between the -10 and -35 promoter elements. The data also indicate that unmelted -10 promoter element can impair RNAP interactions with promoter DNA upstream of the -11 position. We suggest that cooperativity and threshold effects are important factors guiding the dynamics and selectivity of RPo formation.

  3. Identification of an unknown promoter, OUTIIp, within the IS10R element.

    PubMed

    Martínez-García, Esteban; Navarro-Lloréns, Juana María; Tormo, Antonio

    2003-03-01

    A novel promoter in IS10R (OUTIIp) has been found in one of its ends in an inverted position relative to promoter pOUT. OUTIIp shows characteristics similar to those of rpoS-dependent promoters such as a gearbox expression pattern. It is under catabolite repression and positively regulated by ppGpp or conditioned media. This opens new challenges in IS10R transposition.

  4. The Borrelia burgdorferi flaB promoter has an extended -10 element and includes a T-rich -35/-10 spacer sequence that is essential for optimal activity

    PubMed Central

    Gautam, Aarti; Hathaway, Marianne; Ramamoorthy, Ramesh

    2009-01-01

    In this study, we investigated the functional elements of the flaB promoter of Borrelia burgdorferi. Promoter function was examined in a high-passage variant of strain JD1 using a set of 5′ deletions and mutations within the flaB promoter. Expression from the modified flaB promoters was assayed using the gene for green fluorescent protein (gfp) as a reporter. Although the -35 element of the promoter stimulated promoter activity, its disruption did not negate expression. Sequence upstream of the -35 had no effect on expression. The -35/-10 spacer region composed of a T-rich sequence was critical for optimal promoter function. Surprisingly, a Cytosine at the -13 site was found to be more favorable for transcription compared to a Guanosine at the same site. Based on these results and other characteristics, we propose that the B. burgdorferi flaB promoter is an example of an extended -10 promoter. Further, the T-rich spacer is a key element of the flaB promoter that contributes to the abundance of the flagellar core protein in Borrelia species. PMID:19260969

  5. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 1 2013-10-01 2013-10-01 false Message elements. 10.420 Section 10.420 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL WIRELESS EMERGENCY ALERTS Alert Message Requirements § 10.420 Message elements. A WEA Alert Message processed by a Participating CMS Provider shall...

  6. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 1 2014-10-01 2014-10-01 false Message elements. 10.420 Section 10.420 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL WIRELESS EMERGENCY ALERTS Alert Message Requirements § 10.420 Message elements. A WEA Alert Message processed by a Participating CMS Provider shall...

  7. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 1 2012-10-01 2012-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  8. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 1 2011-10-01 2011-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  9. 47 CFR 10.420 - Message elements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Message elements. 10.420 Section 10.420... Requirements § 10.420 Message elements. A CMAS Alert Message processed by a Participating CMS Provider shall include five mandatory CAP elements—Event Type; Area Affected; Recommended Action; Expiration Time...

  10. Crystallographic analysis of an RNA polymerase σ-subunit fragment complexed with -10 promoter element ssDNA: quadruplex formation as a possible tool for engineering crystal contacts in protein-ssDNA complexes.

    PubMed

    Feklistov, Andrey; Darst, Seth A

    2013-09-01

    Structural studies of -10 promoter element recognition by domain 2 of the RNA polymerase σ subunit [Feklistov & Darst (2011), Cell, 147, 1257-1269] reveal an unusual crystal-packing arrangement dominated by G-quartets. The 3'-terminal GGG motif of the oligonucleotide used in crystallization participates in G-quadruplex formation with GGG motifs from symmetry-related complexes. Stacking between neighboring G-quadruplexes results in the formation of pseudo-continuous four-stranded columns running throughout the length of the crystal (G-columns). Here, a new crystal form is presented with a different arrangement of G-columns and it is proposed that the fortuitous finding of G-quartet packing could be useful in engineering crystal contacts in protein-ssDNA complexes. PMID:23989139

  11. The cryptic enhancer elements of the tCUP promoter.

    PubMed

    Wu, Keqiang; Hu, Ming; Martin, Teresa; Wang, Changming; Li, Xiu-Qing; Tian, Lining; Brown, Dan; Miki, Brian

    2003-02-01

    Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. PMID:12602866

  12. Analysis of a ubiquitous promoter element in a primitive eukaryote: early evolution of the initiator element.

    PubMed

    Liston, D R; Johnson, P J

    1999-03-01

    Typical metazoan core promoter elements, such as TATA boxes and Inr motifs, have yet to be identified in early-evolving eukaryotes, underscoring the extensive divergence of these organisms. Towards the identification of core promoters in protists, we have studied transcription of protein-encoding genes in one of the earliest-diverging lineages of Eukaryota, that represented by the parasitic protist Trichomonas vaginalis. A highly conserved element, comprised of a motif similar to a metazoan initiator (Inr) element, surrounds the start site of transcription in all examined T. vaginalis genes. In contrast, a metazoan-like TATA element appears to be absent in trichomonad promoters. We demonstrate that the conserved motif found in T. vaginalis protein-encoding genes is an Inr promoter element. This trichomonad Inr is essential for transcription, responsible for accurate start site selection, and interchangeable between genes, demonstrating its role as a core promoter element. The sequence requirements of the trichomonad Inr are similar to metazoan Inrs and can be replaced by a mammalian Inr. These studies show that the Inr is a ubiquitous, core promoter element for protein-encoding genes in an early-evolving eukaryote. Functional and structural similarities between this protist Inr and the metazoan Inr strongly indicate that the Inr promoter element evolved early in eukaryotic evolution.

  13. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 25 2014-07-01 2014-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  14. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 26 2013-07-01 2013-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  15. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 26 2012-07-01 2011-07-01 true Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  16. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  17. 40 CFR 233.10 - Elements of a program submission.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 25 2011-07-01 2011-07-01 false Elements of a program submission. 233.10 Section 233.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING 404 STATE PROGRAM REGULATIONS Program Approval § 233.10 Elements of a program submission. Any...

  18. 27 CFR 10.24 - Sales promotion contests.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., DEPARTMENT OF THE TREASURY LIQUORS COMMERCIAL BRIBERY Commercial Bribery § 10.24 Sales promotion contests... officers, employees or representatives are inducements within the meaning of the Act....

  19. Classification of Promoters Based on the Combination of Core Promoter Elements Exhibits Different Histone Modification Patterns

    PubMed Central

    Natsume-Kitatani, Yayoi; Mamitsuka, Hiroshi

    2016-01-01

    Four different histones (H2A, H2B, H3, and H4; two subunits each) constitute a histone octamer, around which DNA wraps to form histone-DNA complexes called nucleosomes. Amino acid residues in each histone are occasionally modified, resulting in several biological effects, including differential regulation of transcription. Core promoters that encompass the transcription start site have well-conserved DNA motifs, including the initiator (Inr), TATA box, and DPE, which are collectively called the core promoter elements (CPEs). In this study, we systematically studied the associations between the CPEs and histone modifications by integrating the Drosophila Core Promoter Database and time-series ChIP-seq data for histone modifications (H3K4me3, H3K27ac, and H3K27me3) during development in Drosophila melanogaster via the modENCODE project. We classified 96 core promoters into four groups based on the presence or absence of the TATA box or DPE, calculated the histone modification ratio at the core promoter region, and transcribed region for each core promoter. We found that the histone modifications in TATA-less groups were static during development and that the core promoters could be clearly divided into three types: i) core promoters with continuous active marks (H3K4me3 and H3K27ac), ii) core promoters with a continuous inactive mark (H3K27me3) and occasional active marks, and iii) core promoters with occasional histone modifications. Linear regression analysis and non-linear regression by random forest showed that the TATA-containing groups included core promoters without histone modifications, for which the measured RNA expression values were not predictable accurately from the histone modification status. DPE-containing groups had a higher relative frequency of H3K27me3 in both the core promoter region and transcribed region. In summary, our analysis showed that there was a systematic link between the existence of the CPEs and the dynamics, frequency and influence

  20. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 4 2013-01-01 2013-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  1. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 4 2012-01-01 2012-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  2. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 4 2014-01-01 2014-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  3. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 4 2011-01-01 2011-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  4. 10 CFR 1004.4 - Elements of a request.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Elements of a request. 1004.4 Section 1004.4 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) FREEDOM OF INFORMATION § 1004.4 Elements of a request. (a) Addressed to the Freedom of Information Officer. A request for a record of the DOE which is not available...

  5. 27 CFR 10.24 - Sales promotion contests.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Sales promotion contests..., DEPARTMENT OF THE TREASURY LIQUORS COMMERCIAL BRIBERY Commercial Bribery § 10.24 Sales promotion contests. Sales contests sponsored by an industry member which offer prizes directly or indirectly to trade...

  6. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Allocations System regulation (10 CFR part 217), which is part of the Federal Priorities and Allocations System”; and (e) A current copy of the Energy Priorities and Allocations System regulation (10 CFR part... 10 Energy 3 2014-01-01 2014-01-01 false Elements of an allocation order. 217.54 Section...

  7. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Energy Priorities and Allocations System regulation at 10 CFR part 217. (2) If the rated order is placed... imminent hazard, as specified in EPAS Section 217.33(e), 10 CFR 217.33(e). ... 10 Energy 3 2013-01-01 2013-01-01 false Elements of a rated order. 217.32 Section 217.32...

  8. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Allocations System regulation (10 CFR part 217), which is part of the Federal Priorities and Allocations System”; and (e) A current copy of the Energy Priorities and Allocations System regulation (10 CFR part... 10 Energy 3 2012-01-01 2012-01-01 false Elements of an allocation order. 217.54 Section...

  9. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Energy Priorities and Allocations System regulation at 10 CFR part 217. (2) If the rated order is placed... imminent hazard, as specified in EPAS Section 217.33(e), 10 CFR 217.33(e). ... 10 Energy 3 2014-01-01 2014-01-01 false Elements of a rated order. 217.32 Section 217.32...

  10. 10 CFR 217.54 - Elements of an allocation order.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Allocations System regulation (10 CFR part 217), which is part of the Federal Priorities and Allocations System”; and (e) A current copy of the Energy Priorities and Allocations System regulation (10 CFR part... 10 Energy 3 2013-01-01 2013-01-01 false Elements of an allocation order. 217.54 Section...

  11. 10 CFR 217.32 - Elements of a rated order.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Energy Priorities and Allocations System regulation at 10 CFR part 217. (2) If the rated order is placed... imminent hazard, as specified in EPAS Section 217.33(e), 10 CFR 217.33(e). ... 10 Energy 3 2012-01-01 2012-01-01 false Elements of a rated order. 217.32 Section 217.32...

  12. Wnt10b promotes differentiation of mouse hair follicle melanocytes.

    PubMed

    Ye, Jixing; Yang, Tian; Guo, Haiying; Tang, Yinhong; Deng, Fang; Li, Yuhong; Xing, Yizhan; Yang, Li; Yang, Ke

    2013-01-01

    Previous research has revealed that Wnt10b activates canonical Wnt signaling, which is integral to melanocyte differentiation in hair follicles (HFs). However, the function of Wnt10b in HF melanocytes remains poorly understood. We determined using Dct-LacZ transgenic mice that Wnt10b is mainly expressed near and within melanocytes of the hair bulbs during the anagen stage of the hair cycle. We also found that Wnt10b promotes an increase in melanocyte maturation and pigmentation in the hair bulbs of the mouse HF. To further explore the potential functions of Wnt10b in mouse HF melanocytes, we infected iMC23 cells with Ad-Wnt10b to overexpress Wnt10b. We demonstrated that Wnt10b promotes the differentiation of melanocytes by activating canonical Wnt signaling in melanocytes.

  13. Heat-Shock Promoters: Targets for Evolution by P Transposable Elements in Drosophila

    PubMed Central

    Walser, Jean-Claude; Chen, Bing; Feder, Martin E

    2006-01-01

    Transposable elements are potent agents of genomic change during evolution, but require access to chromatin for insertion—and not all genes provide equivalent access. To test whether the regulatory features of heat-shock genes render their proximal promoters especially susceptible to the insertion of transposable elements in nature, we conducted an unbiased screen of the proximal promoters of 18 heat-shock genes in 48 natural populations of Drosophila. More than 200 distinctive transposable elements had inserted into these promoters; greater than 96% are P elements. By contrast, few or no P element insertions segregate in natural populations in a “negative control” set of proximal promoters lacking the distinctive regulatory features of heat-shock genes. P element transpositions into these same genes during laboratory mutagenesis recapitulate these findings. The natural P element insertions cluster in specific sites in the promoters, with up to eight populations exhibiting P element insertions at the same position; laboratory insertions are into similar sites. By contrast, a “positive control” set of promoters resembling heat-shock promoters in regulatory features harbors few P element insertions in nature, but many insertions after experimental transposition in the laboratory. We conclude that the distinctive regulatory features that typify heat-shock genes (in Drosophila) are especially prone to mutagenesis via P elements in nature. Thus in nature, P elements create significant and distinctive variation in heat-shock genes, upon which evolutionary processes may act. PMID:17029562

  14. Structural and Functional Studies of the Promoter Element for Dengue Virus RNA Replication ▿

    PubMed Central

    Lodeiro, María F.; Filomatori, Claudia V.; Gamarnik, Andrea V.

    2009-01-01

    The 5′ untranslated region (5′UTR) of the dengue virus (DENV) genome contains two defined elements essential for viral replication. At the 5′ end, a large stem-loop (SLA) structure functions as the promoter for viral polymerase activity. Next to the SLA, there is a short stem-loop that contains a cyclization sequence known as the 5′ upstream AUG region (5′UAR). Here, we analyzed the secondary structure of the SLA in solution and the structural requirements of this element for viral replication. Using infectious DENV clones, viral replicons, and in vitro polymerase assays, we defined two helical regions, a side stem-loop, a top loop, and a U bulge within SLA as crucial elements for viral replication. The determinants for SLA-polymerase recognition were found to be common in different DENV serotypes. In addition, structural elements within the SLA required for DENV RNA replication were also conserved among different mosquito- and tick-borne flavivirus genomes, suggesting possible common strategies for polymerase-promoter recognition in flaviviruses. Furthermore, a conserved oligo(U) track present downstream of the SLA was found to modulate RNA synthesis in transfected cells. In vitro polymerase assays indicated that a sequence of at least 10 residues following the SLA, upstream of the 5′UAR, was necessary for efficient RNA synthesis using the viral 3′UTR as template. PMID:19004935

  15. Promoter elements determining weak expression of the GAL4 regulatory gene of Saccharomyces cerevisiae.

    PubMed Central

    Griggs, D W; Johnston, M

    1993-01-01

    The GAL4 gene of Saccharomyces cerevisiae (encoding the activator of transcription of the GAL genes) is poorly expressed and is repressed during growth on glucose. To determine the basis for its weak expression and to identify DNA sequences recognized by proteins that activate transcription of a gene that itself encodes an activator of transcription, we have analyzed GAL4 promoter structure. We show that the GAL4 promoter is about 90-fold weaker than the strong GAL1 promoter and at least 7-fold weaker than the feeble URA3 promoter and that this low level of GAL4 expression is primarily due to a weak promoter. By deletion mapping, the GAL4 promoter can be divided into three functional regions. Two of these regions contain positive elements; a distal region termed the UASGAL4 (upstream activation sequence) contains redundant elements that increase promoter function, and a central region termed the UESGAL4 (upstream essential sequence) is essential for even basal levels of GAL4 expression. The third element, an upstream repression sequence, mediates glucose repression of GAL4 expression and is located between the UES and the transcriptional start site. The UASGAL4 is unusual because it is not interchangable with UAS elements in other yeast promoters; it does not function as a UAS element when inserted in a CYC1 promoter, and a normally strong UAS functions poorly in place of UASGAL4 in the GAL4 promoter. Similarly, the UES element of GAL4 does not function as a TATA element in a test promoter, and consensus TATA elements do not function in place of UES elements in the GAL4 promoter. These results suggest that GAL4 contains a weak TATA-less promoter and that the proteins regulating expression of this regulatory gene may be novel and context specific. PMID:8393142

  16. Identification of the core sequence elements in Penaeus stylirostris densovirus promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This manuscript describes the role of different core elements in the transcriptional activity of promoters in a marine parvovirus, Penaeus stylirostris densovirus (PstDNV) that infects shrimp. Although comprehensive information on the role of different elements in the promoters of several animal par...

  17. Reading Motivation: 10 Elements for Success. Motivational Strategies That Work!

    ERIC Educational Resources Information Center

    Gerbig, Kori M.

    2009-01-01

    Motivational processes are the foundation for coordinating cognitive goals and strategies in reading. Becoming an excellent, active reader involves attunement of motivational processes with cognitive and language processes in reading. This article presents K-12 strategies for motivating reading success. It describes 10 instructional elements that…

  18. Novel Core Promoter Elements and a Cognate Transcription Factor in the Divergent Unicellular Eukaryote Trichomonas vaginalis▿

    PubMed Central

    Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.

    2011-01-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

  19. Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

    PubMed

    Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

    2011-04-01

    A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

  20. A gene-type-specific enhancer regulates the carbamyl phosphate synthetase I promoter by cooperating with the proximal GAG activating element.

    PubMed Central

    Goping, I S; Lamontagne, S; Shore, G C; Nguyen, M

    1995-01-01

    The rat carbamyl phosphate synthetase I gene is expressed in two cell types: hepatocytes and epithelial cells of the intestinal mucosa. The proximal promoter contains a single activating element, GAG, two repressor elements (sites I and III) and an anti-repressor element (site II). Although these elements together exhibit the potential for complex regulation, they are unable to confer tissue-specific promoter activity. Here we have identified a cell-type-specific enhancer that lies 10 kilobases upstream of the promoter. Unexpectedly, the enhancer also functioned in a gene-type-specific manner. The enhancer stimulated promoter activity exclusively through the proximal GAG element. Abrogation of GAG, either directly by mutation of GAG or indirectly by sites I and III repressors, abolished enhancer activation. Conversely, activation of the heterologous thymidine kinase promoter by the enhancer required the introduction of GAG. The requirement for GAG, therefore, functions to constrain the enhancer to a specific target promoter. PMID:7784176

  1. miR-10b promotes invasion by targeting HOXD10 in colorectal cancer

    PubMed Central

    WANG, YUNFENG; LI, ZHEN; ZHAO, XUHONG; ZUO, XIAOMING; PENG, ZHIHAI

    2016-01-01

    Studies have shown that homeobox D10 (HOXD10) is the target gene of microRNA-10b (miR-10b) and is closely associated with the inhibition of cell migration and invasion. Ras homolog family member C (RhoC) has been reported to promote tumor metastasis in various types of cancer. The effect of miR-10b on colorectal cancer (CRC) metastasis and the associated molecular mechanisms remain elusive. The present study aimed to investigate whether miR-10b could promote invasion by targeting HOXD10 in CRC by exploring the association between miR-10b and HOXD10 expression in CRC patients. The findings revealed that miR-10b levels were elevated in the CRC specimens and significantly correlated with advanced clinical stage and lymph node metastasis. In addition, HOXD10 was a direct target of miR-10b, and the increased expression of RhoC and downregulation of HOXD10 correlated with the increased expression level of miR-10b. HOXD10 protein level was also markedly attenuated in lymph node metastasis-positive tumor tissues compared with lymph node metastasis-free tumor tissues. These findings suggest that miR-10b may stimulate the upregulation of RhoC through targeting HOXD10, thus promoting the invasion and migration in CRC tumor. PMID:27347170

  2. Modularization of genetic elements promotes synthetic metabolic engineering.

    PubMed

    Qi, Hao; Li, Bing-Zhi; Zhang, Wen-Qian; Liu, Duo; Yuan, Ying-Jin

    2015-11-15

    In the context of emerging synthetic biology, metabolic engineering is moving to the next stage powered by new technologies. Systematical modularization of genetic elements makes it more convenient to engineer biological systems for chemical production or other desired purposes. In the past few years, progresses were made in engineering metabolic pathway using synthetic biology tools. Here, we spotlighted the topic of implementation of modularized genetic elements in metabolic engineering. First, we overviewed the principle developed for modularizing genetic elements and then discussed how the genetic modules advanced metabolic engineering studies. Next, we picked up some milestones of engineered metabolic pathway achieved in the past few years. Last, we discussed the rapid raised synthetic biology field of "building a genome" and the potential in metabolic engineering.

  3. Alignment between DQC's 10 Essential Elements & America COMPETES Act's 12 Elements

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    In 2005, the Data Quality Campaign (DQC) identified the "10 Essential Elements of a Statewide Longitudinal Data System" to provide a roadmap for state policymakers as they built statewide longitudinal data systems designed to collect, store, & use longitudinal data to improve student achievement & outcomes. In 2007, the federal America COMPETES…

  4. Maize rbcS promoter activity depends on sequence elements not found in dicot rbcS promoters.

    PubMed Central

    Schäffner, A R; Sheen, J

    1991-01-01

    Although the molecular mechanisms of dicot photosynthetic gene regulation have been pursued actively, comparable studies of monocot regulation have been slow to come forth. We show here that monocot (maize and wheat) but not dicot (pea, tobacco, and Arabidopsis) ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) gene promoters are active in maize mesophyll protoplasts. The evolutionarily conserved GT and G boxes of dicot rbcS promoters are not essential for light-responsive expression in monocot leaf cells. Instead, at least six constitutive and light-sensitive regulatory elements are likely important for maize rbcS expression. Synergism between upstream and downstream promoter elements is required. Whereas in dicots, light triggers coupled leaf development and photosynthetic gene expression, in monocots, light regulation of rbcS is uncoupled from leaf development. Light regulation of maize rbcS may be divided into direct and indirect contributions mediated by different regulatory elements. Because wheat and maize rbcS promoters show sequence homologies and similar expression patterns in monocot and dicot leaf cells, it appears likely that monocots share conserved regulatory elements irrespective of whether they utilize the C3 or C4 pathway for carbon fixation. PMID:1822995

  5. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    PubMed

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  6. Analysis of functional elements in the human Egr-1 gene promoter.

    PubMed

    Aicher, W K; Sakamoto, K M; Hack, A; Eibel, H

    1999-01-01

    The early growth response (Egr)-1 gene encoding a zinc-finger transcription factor is transiently induced in many different cell types upon various differentiation signals. However, in synovial fibroblasts of rheumatoid arthritis patients, Egr-1 is constitutively expressed at high levels, and several genes with Egr-1 binding sites in their promoter regions have been associated with disease progression of RA. We analyzed the control of Egr-1 transcription by characterizing those regulatory elements in the Egr-1 promoter that induce Egr-1 expression in fibroblasts. Using reporter gene assays and deletion mutants of the Egr-1 promoter we could demonstrate that Egr-1 transcription is mainly activated by a single serum response element, whereas other transcription factor binding sites, including binding sites for AP-1 or Egr-1, were found to play a minor role. Furthermore, we identified a novel regulatory element in the human Egr-1 promoter similar to a NF kappa-B binding site. Deletion of this element enhanced Egr-1 promoter activity in 3T3 but not in L929 fibroblasts. Stimulation by phorbolester induced only transient Egr-1 expression in 3T3 fibroblasts but a extended expression of Egr-1 in L929 cells. These data suggest that in fibroblasts the most proximal serum response element in the Egr-1 promoter represents the major activation site, whereas binding of the NFkB-like factor may serve as negative regulatory signal for Egr-1 transcription in fibroblasts.

  7. Transcriptional activity of the transposable element Tn10 in the Salmonella typhimurium ilvGEDA operon.

    PubMed Central

    Blazey, D L; Burns, R O

    1982-01-01

    Polarity of Tn10 insertion mutations in the Salmonella typhimurium ilvGEDA operon depends on both the location and the orientation of the Tn10 element. One orientation of Tn10 insertions in ilvG and ilvE permits low-level expression of the downstream ilvEDA and ilvDA genes, respectively. Our analysis of Salmonella ilv recombinant plasmids shows that this residual ilv expression must result from Tn10-directed transcription and does not reflect the presence of internal promoters in the ilvGEDA operon, as was previously suggested. The opposite orientation of Tn10 insertion in ilvE prevents ilvDA expression, indicating that only one end of Tn10 is normally active in transcribing adjacent genes. Both orientations of Tn10 insertion in ilvD exert absolute polarity on ilvA expression. Expression of ilvA is known to be dependent on effective translation of ilvD, perhaps reflecting the lack of a ribosome binding site proximal to the ilvA sequence. Therefore, recognition of the ability of Tn10 to promote transcription of contiguous genes in the ilvGEDA operon apparently requires the presence of associated ribosome binding sites. PMID:6289328

  8. Quantitative Analysis of Cis-Regulatory Element Activity Using Synthetic Promoters in Transgenic Plants.

    PubMed

    Benn, Geoffrey; Dehesh, Katayoon

    2016-01-01

    Synthetic promoters, introduced stably or transiently into plants, are an invaluable tool for the identification of functional regulatory elements and the corresponding transcription factor(s) that regulate the amplitude, spatial distribution, and temporal patterns of gene expression. Here, we present a protocol describing the steps required to identify and characterize putative cis-regulatory elements. These steps include application of computational tools to identify putative elements, construction of a synthetic promoter upstream of luciferase, identification of transcription factors that regulate the element, testing the functionality of the element introduced transiently and/or stably into the species of interest followed by high-throughput luciferase screening assays, and subsequent data processing and statistical analysis. PMID:27557758

  9. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    PubMed

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen. PMID:2017174

  10. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.

    PubMed

    Hariharan, N; Perry, R P

    1989-07-11

    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  11. Stereospecific alignment of the X and Y elements is required for major histocompatibility complex class II DRA promoter function.

    PubMed Central

    Vilen, B J; Cogswell, J P; Ting, J P

    1991-01-01

    The regulatory mechanisms controlling expression of the major histocompatibility complex (MHC) class II genes involve several cis-acting DNA elements, including the X and Y boxes. These two elements are conserved within all murine and human class II genes and are required for accurate and efficient transcription from MHC class II promoters. Interestingly, the distance between the X and Y elements is also evolutionarily conserved at 18 to 20 bp. To investigate the function of the invariant spacing in the human MHC class II gene, HLA-DRA, we constructed a series of spacing mutants which alters the distance between the X and Y elements by integral and half-integral turns of the DNA helix. Transient transfection of the spacing constructs into Raji cells revealed that inserting integral turns of the DNA helix (+20 and +10 bp) did not reduce promoter activity, while inserting or deleting half-integral turns of the DNA helix (+15, +5, and -5 bp) drastically reduced promoter activity. The loss of promoter function in these half-integral turn constructs was due neither to the inability of the X and Y elements to bind proteins nor to improper binding of the X- and Y-box-binding proteins. These data indicate that the X and Y elements must be aligned on the same side of the DNA helix to ensure normal function. This requirement for stereospecific alignment strongly suggests that the X- and Y-box-binding proteins either interact directly or are components of a larger transcription complex which assembles on one face of the DNA double helix. Images PMID:1901941

  12. Substitution of Ribonucleotides in the T7 RNA Polymerase Promoter Element

    NASA Technical Reports Server (NTRS)

    McGinness, Kathleen E.; Joyce, Gerald F.

    2001-01-01

    A systematic analysis was carried out to examine the effects of ribonucleotide substitution at various locations within the promoter element for T7 RNA polymerase. Ribonucleotides could be introduced at most positions without significantly decreasing transcription efficiency. A critical window of residues that were intolerant of RNA substitution was defined for both the non-template and template strands of the promoter. These residues are involved in important contacts with the AT-rich recognition loop, specificity loop, and P-intercalating hairpin of the polymerase. These results highlight the malleability of T7 RNA polymerase in recognizing its promoter element and suggest that promoters with altered backbone conformations may be used in molecular biology applications that employ T7 RNA polymerase for in vitro transcription.

  13. Trafficking of mRNAs containing ALREX-promoting elements through nuclear speckles

    PubMed Central

    Akef, Abdalla; Zhang, Hui; Masuda, Seiji; Palazzo, Alexander F

    2013-01-01

    In vertebrates, the majority of mRNAs that encode secreted, membrane-bound or mitochondrial proteins contain RNA elements that activate an alternative mRNA nuclear export (ALREX) pathway. Here we demonstrate that mRNAs containing ALREX-promoting elements are trafficked through nuclear speckles. Although ALREX-promoting elements enhance nuclear speckle localization, additional features within the mRNA largely drive this process. Depletion of two TREX-associated RNA helicases, UAP56 and its paralog URH49, or inhibition of the TREX-associated nuclear transport factor, TAP, not only inhibits ALREX, but also appears to trap these mRNAs in nuclear speckles. mRNAs that contain ALREX-promoting elements associate with UAP56 in vivo. Finally, we demonstrate that mRNAs lacking a poly(A)-tail are not efficiently exported by the ALREX pathway and show enhanced association with nuclear speckles. Our data suggest that within the speckle, ALREX-promoting elements, in conjunction with the poly(A)-tail, likely stimulate UAP56/URH49 and TAP dependent steps that lead to the eventual egress of the export-competent mRNP from these structures. PMID:23934081

  14. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  15. Evolutionary forces act on promoter length: identification of enriched cis-regulatory elements.

    PubMed

    Kristiansson, Erik; Thorsen, Michael; Tamás, Markus J; Nerman, Olle

    2009-06-01

    Transcription factors govern gene expression by binding to short DNA sequences called cis-regulatory elements. These sequences are typically located in promoters, which are regions of variable length upstream of the open reading frames of genes. Here, we report that promoter length and gene function are related in yeast, fungi, and plants. In particular, the promoters for stress-responsive genes are in general longer than those of other genes. Essential genes have, on the other hand, relatively short promoters. We utilize these findings in a novel method for identifying relevant cis-regulatory elements in a set of coexpressed genes. The method is shown to generate more accurate results and fewer false positives compared with other common procedures. Our results suggest that genes with complex transcriptional regulation tend to have longer promoters than genes responding to few signals. This phenomenon is present in all investigated species, indicating that evolution adjust promoter length according to gene function. Identification of cis-regulatory elements in Saccharomyces cerevisiae can be done with the web service located at http://enricher.zool.gu.se.

  16. Fine structure of E. coli RNA polymerase-promoter interactions: α subunit binding to the UP element minor groove

    PubMed Central

    Ross, Wilma; Ernst, Alexander; Gourse, Richard L.

    2001-01-01

    The α subunit of E. coli RNAP plays an important role in the recognition of many promoters by binding to the A+T-rich UP element, a DNA sequence located upstream of the recognition elements for the ς subunit, the −35 and −10 hexamers. We examined DNA–RNAP interactions using high resolution interference and protection footprinting methods and using the minor groove-binding drug distamycin. Our results suggest that α interacts with bases in the DNA minor groove and with the DNA backbone along the minor groove, but that UP element major groove surfaces do not make a significant contribution to α binding. On the basis of these and previous results, we propose a model in which α contacts UP element DNA through amino acid residues located in a pair of helix–hairpin–helix motifs. Furthermore, our experiments extend existing information about recognition of the core promoter by ς70 by identifying functional groups in the major grooves of the −35 and −10 hexamers in which modifications interfere with RNAP binding. These studies greatly improve the resolution of our picture of the promoter–RNAP interaction. PMID:11238372

  17. Modular Finite Element Methods Library Version: 1.0

    2010-06-22

    MFEM is a general, modular library for finite element methods. It provides a variety of finite element spaces and bilinear/linear forms in 2D and 3D. MFEM also includes classes for dealing with various types of meshes and their refinement.

  18. Tc, an unusual promoter element required for constitutive transcription of the yeast HIS3 gene.

    PubMed Central

    Mahadevan, S; Struhl, K

    1990-01-01

    Tc is the proximal promoter element required for constitutive his3 transcription that occurs in the absence of the canonical TATA element (TR) and is initiated from the +1 site. The TC element, unlike TR, does not respond to transcriptional stimulation by the GCN4 or GAL4 activator protein. Analysis of deletion, substitution, and point mutations indicates that Tc mapped between nucleotides -54 and -83 and is a sequence-dependent element because it could not be functionally replaced by other DNA sequences. However, in contrast to the behavior of typical promoter elements, it was surprisingly difficult to eliminate Tc function by base pair substitutions. Of 15 derivatives averaging four substitutions in the Tc region and representing 40% of all possible single changes, only 1 inactivated the Tc element. Moreover, the phenotypes of mutant and hybrid elements indicated that inactivation of Tc required multiple changes. The spacing between Tc and the initiation region could be varied over a 30-base-pair range without significantly affecting the level of transcription from the +1 site. From these results, we consider it possible that Tc may not interact with TFIID or some other typical sequence-specific transcription factor, but instead might influence transcription, either directly or indirectly, by its DNA structure. Images PMID:2201891

  19. Genome-wide computational prediction and analysis of core promoter elements across plant monocots and dicots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcription initiation, essential to gene expression regulation, involves recruitment of basal transcription factors to the core promoter elements (CPEs). The distribution of currently known CPEs across plant genomes is largely unknown. This is the first large scale genome-wide report on the compu...

  20. A common set of nuclear factors bind to promoter elements regulated by the retinoblastoma protein.

    PubMed

    Udvadia, A J; Rogers, K T; Horowitz, J M

    1992-09-01

    A 30-base pair element within the c-fos promoter, termed the RCE (retinoblastoma control element), has previously been shown to be the target of transcriptional regulation by the product of the retinoblastoma (Rb) gene. We have identified three nuclear proteins [retinoblastoma control proteins (RCPs)] that complex with this promoter element in vitro. The Rb gene does not appear to encode the RCPs as the expression of Rb in vivo does not correlate with RCE-RCP complex formation in vitro. A single binding site for the RCPs within the c-fos RCE was identified, and the nucleotides required for protein-DNA complex formation were defined. Similar sequences are found in the promoters of two additional genes that are regulated by Rb (c-myc and TGF-beta 1), and binding assays demonstrate that the RCPs also interact with these elements. Linkage of the c-fos RCE to the herpes simplex virus thymidine kinase promoter led to a 4-fold stimulation of expression in transient transfection assays. Mutations within the RCP binding site that abrogate stable interaction of the RCPs with the RCE in vitro block RCE transcriptional activity in vivo. Our results suggest a role for the RCPs in RCE-dependent transcription and the regulation of transcription by the Rb protein. PMID:1419910

  1. Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter.

    PubMed

    Wan, Qianhui; Wang, Yaxian; Wang, Huayan

    2015-10-27

    Bone morphogenetic protein 15 (BMP15) is secreted by the mammalian oocytes and is indispensable for ovarian follicular development, ovulation, and fertility. To determine the regulation mechanism of BMP15 gene, the regulatory sequence of porcine BMP15 was investigated in this study. The cloned BMP15 promoter retains the cell-type specificity, and is activated in cells derived from ovarian tissue. The luciferase assays in combination with a series of deletion of BMP15 promoter sequence show that the -427 to -376 bp region of BMP15 promoter is the primary regulatory element, in which there are a number of transcription factor binding sites, including LIM homeobox 8 (LHX8), newborn ovary homeobox gene (NOBOX), and paired-like homeodomain transcription factor 1 (PITX1). Determination of tissue-specific expression reveals that LHX8, but not PITX1 and NOBOX, is exclusively expressed in pig ovary tissue and is translocated into the cell nuclei. Overexpression of LHX8 in Chinese hamster ovary (CHO) cells could significantly promote BMP15 promoter activation. This study confirms a key regulatory element that is located in the proximal region of BMP15 promoter and is regulated by the LHX8 factor.

  2. Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter

    PubMed Central

    Wan, Qianhui; Wang, Yaxian; Wang, Huayan

    2015-01-01

    Bone morphogenetic protein 15 (BMP15) is secreted by the mammalian oocytes and is indispensable for ovarian follicular development, ovulation, and fertility. To determine the regulation mechanism of BMP15 gene, the regulatory sequence of porcine BMP15 was investigated in this study. The cloned BMP15 promoter retains the cell-type specificity, and is activated in cells derived from ovarian tissue. The luciferase assays in combination with a series of deletion of BMP15 promoter sequence show that the −427 to −376 bp region of BMP15 promoter is the primary regulatory element, in which there are a number of transcription factor binding sites, including LIM homeobox 8 (LHX8), newborn ovary homeobox gene (NOBOX), and paired-like homeodomain transcription factor 1 (PITX1). Determination of tissue-specific expression reveals that LHX8, but not PITX1 and NOBOX, is exclusively expressed in pig ovary tissue and is translocated into the cell nuclei. Overexpression of LHX8 in Chinese hamster ovary (CHO) cells could significantly promote BMP15 promoter activation. This study confirms a key regulatory element that is located in the proximal region of BMP15 promoter and is regulated by the LHX8 factor. PMID:26516845

  3. Definition of regulatory sequence elements in the promoter region and the first intron of the myotonic dystrophy protein kinase gene.

    PubMed

    Storbeck, C J; Sabourin, L A; Waring, J D; Korneluk, R G

    1998-04-10

    Myotonic dystrophy is the most common inherited adult neuromuscular disorder with a global frequency of 1/8000. The genetic defect is an expanding CTG trinucleotide repeat in the 3'-untranslated region of the myotonic dystrophy protein kinase gene. We present the in vitro characterization of cis regulatory elements controlling transcription of the myotonic dystrophy protein kinase gene in myoblasts and fibroblasts. The region 5' to the initiating ATG contains no consensus TATA or CCAAT box. We have mapped two transcriptional start sites by primer extension. Deletion constructs from this region fused to the bacterial chloramphenicol acetyltransferase reporter gene revealed only subtle muscle specific cis elements. The strongest promoter activity mapped to a 189-base pair fragment. This sequence contains a conserved GC box to which the transcription factor Sp1 binds. Reporter gene constructs containing a 2-kilobase pair first intron fragment of the myotonic dystrophy protein kinase gene enhances reporter activity up to 6-fold in the human rhabdomyosarcoma myoblast cell line TE32 but not in NIH 3T3 fibroblasts. Co-transfection of a MyoD expression vector with reporter constructs containing the first intron into 10 T1/2 fibroblasts resulted in a 10-20-fold enhancement of expression. Deletion analysis of four E-box elements within the first intron reveal that these elements contribute to enhancer activity similarly in TE32 myoblasts and 10 T1/2 fibroblasts. These data suggest that E-boxes within the myotonic dystrophy protein kinase first intron mediate interactions with upstream promoter elements to up-regulate transcription of this gene in myoblasts.

  4. Functional characterization of the GDEP promoter and three enhancer elements in retinoblastoma and prostate cell lines.

    PubMed

    Cross, D S; Burmester, J K

    2008-01-01

    GDEP (gene differentially expressed in prostate cancer aka. PCAN1), a newly discovered gene with remarkable tissue specificity, is a promising candidate for regulatory analysis because it exhibits a high level of expression that is limited to two tissues, the retina and the prostate. As these two tissues have different origins and disparate functions it is likely that the regulatory mechanisms responsible for expression are not shared in their entirety. In addition, both the retina and prostate are prime targets for gene therapy. To date there have been no functional studies of the GDEP promoter. Therefore to understand tissue-specific expression of GDEP we constructed promoter expression constructs. To further characterize functional regulatory regions within the GDEP gene, we investigated potential regulatory components for tissue-specific expression in the 40 kb intron of this gene. We have identified a 1.5 kb prostate-specific promoter from the proximal region of the GDEP gene. A smaller 0.5 kb promoter exhibited minimal activity in the retinoblastoma cell line Y79, but not in the prostate cells tested. In addition we have investigated three enhancer elements located in the 40 kb intron of the GDEP gene. We identified two enhancer elements that increase reporter gene expression in prostate cell line LNCaP and one additional enhancer element that increases expression in the Y79 cell line approximately 8-fold making it a strong retinal-specific enhancer. PMID:18188713

  5. Elements of Mathematics, Book 10: Groups and Rings.

    ERIC Educational Resources Information Center

    Exner, Robert; And Others

    One of 12 books developed for use with the core material (Book O) of the Elements of Mathematics Program, this text covers material well beyond the scope of the usual secondary mathematics sequences. These materials are designed for highly motivated students with strong verbal abilities; mathematical theories and ideas are developed through…

  6. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  7. Integrator element as a promoter of active learning in engineering teaching

    NASA Astrophysics Data System (ADS)

    Oliveira, Paulo C.; Oliveira, Cristina G.

    2014-03-01

    In this paper, we present a teaching proposal used in an Introductory Physics course to civil engineering students from Porto's Engineering Institute/Instituto Superior de Engenharia do Porto (ISEP). The proposal was born from the need to change students' perception and motivation for learning physics. It consists in the use of an integrator element, called the physics elevator project. This integrator element allows us to use, in a single project, all the content taught in the course and uses several active learning strategies. In this paper, we analyse this project as: (i) a clarifying element of the contents covered in the course; (ii) a promoter element of motivation and active participation in class and finally and (iii) a link between the contents covered in the course and the 'real world'. The data were collected by a questionnaire and interviews to students. From the data collected, it seems that the integrator element improves students' motivation towards physics and develops several skills that they consider to be important to their professional future. It also acts as a clarifying element and makes the connection between the physics that is taught and the 'real world'.

  8. Predicting the strength of UP-elements and full-length E. coli σE promoters

    PubMed Central

    Rhodius, Virgil A.; Mutalik, Vivek K.; Gross, Carol A.

    2012-01-01

    Predicting the location and strength of promoters from genomic sequence requires accurate sequenced-based promoter models. We present the first model of a full-length bacterial promoter, encompassing both upstream sequences (UP-elements) and core promoter modules, based on a set of 60 promoters dependent on σE, an alternative ECF-type σ factor. UP-element contribution, best described by the length and frequency of A- and T-tracts, in combination with a PWM-based core promoter model, accurately predicted promoter strength both in vivo and in vitro. This model also distinguished active from weak/inactive promoters. Systematic examination of promoter strength as a function of RNA polymerase (RNAP) concentration revealed that UP-element contribution varied with RNAP availability and that the σE regulon is comprised of two promoter types, one of which is active only at high concentrations of RNAP. Distinct promoter types may be a general mechanism for increasing the regulatory capacity of the ECF group of alternative σ's. Our findings provide important insights into the sequence requirements for the strength and function of full-length promoters and establish guidelines for promoter prediction and for forward engineering promoters of specific strengths. PMID:22156164

  9. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences. PMID:19231992

  10. Molecular cloning of a pathogen/wound-inducible PR10 promoter from Pinus monticola and characterization in transgenic Arabidopsis plants.

    PubMed

    Liu, Jun-Jun; Ekramoddoullah, Abul K M; Piggott, Nina; Zamani, Arezoo

    2005-05-01

    In Pinus monticola (Dougl. ex D. Don), the class ten pathogenesis-related (PR10) proteins comprise a family of multiple members differentially expressed upon pathogen infection and other environmental stresses. One of them, PmPR10-1.13, is studied here by investigating its transcriptional regulation in transgenic Arabidopsis plants. For functional analyses of the PmPR10-1.13 promoter, a 1,316-bp promoter fragment and three 5' deletions were translationally fused to the ss-glucuronidase (GUS) reporter gene. The 1,316-bp promoter-driven GUS activity first appeared in hypocotyls and cotyledons in 2- to 3-day-old seedlings. As transgenic plants grew, GUS activity was detected strongly in apical meristems, next in stems and leaves. No GUS activity was detected in roots and in reproductive tissues of flower organs. In adult plants, the PmPR10-1.13 promoter-directed GUS expression was upregulated following pathogen infection and by wounding treatment, which generally mimic the endogenous expression pattern in western white pine. Promoter analysis of 5' deletions demonstrated that two regions between -1,316 and -930, and between -309 and -100 were responsible for the wound responsiveness. By structural and functional comparisons with PmPR10-1.14 promoter, putative wound-responsive elements were potentially identified in the PmPR10-1.13 promoter. In conclusion, PmPR10-1.13 showed properties of a defence-responsive gene, being transcriptionally upregulated upon biotic and abiotic stresses. PMID:15609047

  11. Molecular cloning of a pathogen/wound-inducible PR10 promoter from Pinus monticola and characterization in transgenic Arabidopsis plants.

    PubMed

    Liu, Jun-Jun; Ekramoddoullah, Abul K M; Piggott, Nina; Zamani, Arezoo

    2005-05-01

    In Pinus monticola (Dougl. ex D. Don), the class ten pathogenesis-related (PR10) proteins comprise a family of multiple members differentially expressed upon pathogen infection and other environmental stresses. One of them, PmPR10-1.13, is studied here by investigating its transcriptional regulation in transgenic Arabidopsis plants. For functional analyses of the PmPR10-1.13 promoter, a 1,316-bp promoter fragment and three 5' deletions were translationally fused to the ss-glucuronidase (GUS) reporter gene. The 1,316-bp promoter-driven GUS activity first appeared in hypocotyls and cotyledons in 2- to 3-day-old seedlings. As transgenic plants grew, GUS activity was detected strongly in apical meristems, next in stems and leaves. No GUS activity was detected in roots and in reproductive tissues of flower organs. In adult plants, the PmPR10-1.13 promoter-directed GUS expression was upregulated following pathogen infection and by wounding treatment, which generally mimic the endogenous expression pattern in western white pine. Promoter analysis of 5' deletions demonstrated that two regions between -1,316 and -930, and between -309 and -100 were responsible for the wound responsiveness. By structural and functional comparisons with PmPR10-1.14 promoter, putative wound-responsive elements were potentially identified in the PmPR10-1.13 promoter. In conclusion, PmPR10-1.13 showed properties of a defence-responsive gene, being transcriptionally upregulated upon biotic and abiotic stresses.

  12. A negative element in the downstream region of the Rice tungro bacilliform virus promoter is orientation- and position-independent and is active with heterologous promoters.

    PubMed

    Purkayastha, Arunima; Sharma, Shweta; Dasgupta, Indranil

    2010-10-01

    The promoter of an Indian isolate of the pararetrovirus Rice tungro bacilliform virus (RTBV-WB) contains a negative element downstream of the transcription start site (TSS), between nucleotide residues +58 and +195 (Mathur and Dasgupta, 2007). To further characterize the element, we show, by using transient gus reporter gene assays in the cells of onion peel, rice calli and Arabidopsis leaves, that it down-regulates heterologous promoters CaMV35S and Maize ubiquitin. Quantitative measurements of transient GUS activity indicated more than 90% inhibition of reporter gene expression by the negative element. We also show, by reversing the orientation of the element downstream and by placing it in a position upstream to a constitutively expressing RTBV promoter, that the negative element is orientation- and position-independent, pointing towards its activity at the transcriptional and not post-transcriptional level. PMID:20621135

  13. Functional erythroid promoters created by interaction of the transcription factor GATA-1 with CACCC and AP-1/NFE-2 elements.

    PubMed Central

    Walters, M; Martin, D I

    1992-01-01

    We have investigated interactions between the erythroid transcription factor GATA-1 and factors binding two cis-acting elements commonly linked to GATA sites in erythroid control elements. GATA-1 is present at all stages of erythroid differentiation, is necessary for erythropoiesis, and binds sites in all erythroid control elements. However, minimal promoters containing GATA-1 sites are inactive when tested in erythroid cells. Based on this observation, two erythroid cis elements, here termed CACCC and AP-1/NFE-2, were linked to GATA sites in minimal promoters. None of the elements linked only to a TATA box created an active promoter, but GATA sites linked to either CACCC or AP-1/NFE-2 elements formed strong erythroid promoters. A mutation of T to C at position -175 in the gamma-globin promoter GATA site, associated with hereditary persistence of fetal hemoglobin (HPFH), increased expression of these promoters in both fetal and adult cells. A construct bearing the beta-globin CACCC element was more active in adult and less active in fetal erythroid cells, when compared with the gamma-globin CACCC element. These studies suggest that erythroid control elements are formed by the interactions of at least three transcription factors, none of which functions alone. Images PMID:1438231

  14. Effective elements of school health promotion across behavioral domains: a systematic review of reviews

    PubMed Central

    Peters, Louk WH; Kok, Gerjo; Ten Dam, Geert TM; Buijs, Goof J; Paulussen, Theo GWM

    2009-01-01

    Background Most school health education programs focus on a single behavioral domain. Integrative programs that address multiple behaviors may be more efficient, but only if the elements of change are similar for these behaviors. The objective of this study was to examine which effective elements of school health education are similar across three particular behavioral domains. Methods A systematic review of reviews of the effectiveness of school-based health promotion programs was conducted for the domains of substance abuse, sexual behavior, and nutrition. The literature search spanned the time period between 1995 and October 2006 and included three databases, websites of review centers and backward search. Fifty-five reviews and meta-analyses met predetermined relevance and publication criteria and were included. Data was extracted by one reviewer and checked by a second reviewer. A standardized data extraction form was used, with detailed attention to effective elements pertaining to program goals, development, content, methods, facilitator, components and intensity. Two assessors rated the quality of reviews as strong, moderate or weak. We included only strong and moderate reviews in two types of analysis: one based on interpretation of conflicting results, the other on a specific vote-counting rule. Results Thirty six reviews were rated strong, 6 moderate, and 13 weak. A multitude of effective elements was identified in the included reviews and many elements were similar for two or more domains. In both types of analysis, five elements with evidence from strong reviews were found to be similar for all three domains: use of theory; addressing social influences, especially social norms; addressing cognitive-behavioral skills; training of facilitators; and multiple components. Two additional elements had positive results in all domains with the rule-based method of analysis, but had inconclusive results in at least one domain with the interpretion-based method

  15. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  16. Upstream Distal Regulatory Elements Contact the Lmo2 Promoter in Mouse Erythroid Cells

    PubMed Central

    Bhattacharya, Anandi; Chen, Chih-Yu; Ho, Sara; Mitchell, Jennifer A.

    2012-01-01

    The Lim domain only 2 (Lmo2) gene encodes a transcriptional cofactor critical for the development of hematopoietic stem cells. Several distal regulatory elements have been identified upstream of the Lmo2 gene in the human and mouse genomes that are capable of enhancing reporter gene expression in erythroid cells and may be responsible for the high level transcription of Lmo2 in the erythroid lineage. In this study we investigate how these elements regulate transcription of Lmo2 and whether or not they function cooperatively in the endogenous context. Chromosome conformation capture (3C) experiments show that chromatin-chromatin interactions exist between upstream regulatory elements and the Lmo2 promoter in erythroid cells but that these interactions are absent from kidney where Lmo2 is transcribed at twelve fold lower levels. Specifically, long range chromatin-chromatin interactions occur between the Lmo2 proximal promoter and two broad regions, 3–31 and 66–105 kb upstream of Lmo2, which we term the proximal and distal control regions for Lmo2 (pCR and dCR respectively). Each of these regions is bound by several transcription factors suggesting that multiple regulatory elements cooperate in regulating high level transcription of Lmo2 in erythroid cells. Binding of CTCF and cohesin which support chromatin loops at other loci were also found within the dCR and at the Lmo2 proximal promoter. Intergenic transcription occurs throughout the dCR in erythroid cells but not in kidney suggesting a role for these intergenic transcripts in regulating Lmo2, similar to the broad domain of intergenic transcription observed at the human β-globin locus control region. Our data supports a model in which the dCR functions through a chromatin looping mechanism to contact and enhance Lmo2 transcription specifically in erythroid cells. Furthermore, these chromatin loops are supported by the cohesin complex recruited to both CTCF and transcription factor bound regions. PMID

  17. Functional redundancy of promoter elements ensures efficient transcription of the human 7SK gene in vivo.

    PubMed

    Boyd, D C; Turner, P C; Watkins, N J; Gerster, T; Murphy, S

    1995-11-10

    Deletion and mutation studies of the human 7SK gene transfected into HeLa cells have identified three functional regions of the promoter corresponding to the TATA box at -25, the proximal sequence element (PSE) between -49 and -65 and the distal sequence element (DSE) between -243 and -210. These elements show sequence homology to equivalent regions in other snRNA genes and are functionally analogous. Unlike the DSEs of many snRNA genes however, the 7SK DSE does not contain a consensus binding site for the transcription factor Oct-1 but rather, contains two non-consensus Oct-1 binding sites that can function independently of one another to enhance transcription. Unusually, the 7SK PSE can retain function even after extensive mutation and removal of the conserved TGACC of the PSE has little effect in the context of the whole promoter. However, the same mutation abolishes transcription in the absence of the DSE suggesting that protein/protein interactions between DSE and PSE binding factors can compensate for a mutant PSE. Mutation of the 7SK TATA box allows snRNA type transcription by RNA polymerase II to occur and this is enhanced by the DSE, indicating that both the DSE and the PSE can also function with pol II. In addition, mutation of the TATA box does not abolish pol III dependent transcription, suggesting that other sequence elements may also play a role in the determination of polymerase specificity. Although the human 7SK gene is transcribed efficiently in Xenopus oocytes, analysis of the 7SK wild-type gene and mutants in Xenopus oocytes gives significantly different results from the analysis in HeLa cells indicating that the recognition of functional elements is not the same in the two systems.

  18. Transcription of the interleukin 4 gene is regulated by multiple promoter elements

    PubMed Central

    1993-01-01

    Activation of T helper cell 1 (Th1) and Th2 results in transcription of the interleukin 2 (IL-2) and IL-4 cytokine genes, respectively. Whereas many of the regulatory elements and factors responsible for IL-2 transcription in T cells are well defined, little is known about parallel mechanisms that drive transcription of the IL-4 gene. Here we have analyzed the murine IL-4 promoter, both in vivo and in a Th2 clone. 3 kb of IL-4 upstream sequence is shown to be sufficient to achieve tissue-specific and inducible expression of a thymidine kinase reporter gene in vivo in a manner that mirrors the expression of endogenous IL-4. Tissue-specific and inducible expression is also demonstrated in a Th2 clone, but not in a B cell line. Deletional and mutational analysis of the IL-4 promoter demonstrated that sequences from -100 to -28 were necessary for a transcriptional response to Concanavalin A or anti-CD3 monoclonal antibody. An overlapping, yet smaller region, spanning the sequences from -60 to -28 bp was shown to be required for the response to ionomycin. Mutation of an 8-bp region from -43 to -35 of the IL-4 promoter completely abrogated IL-4 gene transcription in response to all stimuli tested. In addition, our results show that the effects of the immunosuppressive agent Cyclosporin A map to the same DNA sequences as the positive control elements. These results identify DNA sequences that are functionally important for the control of IL-4 gene transcription both in vivo and in vitro. Although these sequences are highly conserved in the human and murine IL-4 genes, they are largely not present in the IL-2 enhancer complex. Thus, cytokine-specific cis-acting elements may be one mechanism by which these two cytokine genes are differentially regulated. PMID:8496684

  19. Segment-specific mutagenesis: extensive mutagenesis of a lac promoter/operator element.

    PubMed

    Weiher, H; Schaller, H

    1982-03-01

    A method for highly efficient segment-specific mutagenesis is described. The method uses as target for sodium bisulfite mutagenesis the DNA single strands of a DNA restriction fragment that had been separated by cloning into base-complementary regions of a pair of phage fd vectors. After repair synthesis in vitro, the mutagenized DNA fragment is recovered by cloning into a nonmutated plasmid vector and analyzed for sequence and by functional tests. By using this method, the nucleotide sequence of a 109-base pair restriction fragment containing the lac promoter/operator from Escherichia coli was extensively modified. More than 90% of the 235 isolates obtained showed a change in phenotype; all of 22 analyzed for their nucleotide sequence were found to carry multiple C leads to T point mutations in up to 60% of the possible target positions. Nevertheless, few isolates showed major changes in promoter activity relative to the nonmutated promoter element, which indicates a high degree of flexibility in the promoter sequence. PMID:7041119

  20. A 5′ RNA element promotes dengue virus RNA synthesis on a circular genome

    PubMed Central

    Filomatori, Claudia V.; Lodeiro, Maria F.; Alvarez, Diego E.; Samsa, Marcelo M.; Pietrasanta, Lía; Gamarnik, Andrea V.

    2006-01-01

    The mechanisms of RNA replication of plus-strand RNA viruses are still unclear. Here, we identified the first promoter element for RNA synthesis described in a flavivirus. Using dengue virus as a model, we found that the viral RdRp discriminates the viral RNA by specific recognition of a 5′ element named SLA. We demonstrated that RNA–RNA interactions between 5′ and 3′ end sequences of the viral genome enhance dengue virus RNA synthesis only in the presence of an intact SLA. We propose a novel mechanism for minus-strand RNA synthesis in which the viral polymerase binds SLA at the 5′ end of the genome and reaches the site of initiation at the 3′ end via long-range RNA–RNA interactions. These findings provide an explanation for the strict requirement of dengue virus genome cyclization during viral replication. PMID:16882970

  1. Exchanging the as-1-like element of the PR-1 promoter by the as-1 element of the CaMV 35S promoter abolishes salicylic acid responsiveness and regulation by NPR1 and SNI1

    PubMed Central

    Pape, Sebastian; Thurow, Corinna

    2010-01-01

    The plant defense hormone salicylic acid (SA) activates gene expression through a number of different mechanisms. In Arabidopsis thaliana, the SA-induced PATHOGENESIS RELATED (PR)-1 promoter is regulated through TGA transcription factors binding to the two TGACG motifs of the so called as-1 (activation sequence-1)-like element which is located between base pair positions -665 and -641. Activation is mediated by the transcriptional co-activator NPR1 (NON EXPRESSOR OF PR GENES1), which physically interacts with TGA factors. Moreover, the promoter is under the control of the negative regulator SNI1 (SUPPRESSOR OF NPR1, INDUCIBLE1). We have recently reported that SNI1-mediated repression of basal promoter activities and NPR1-dependent induction are maintained in a truncated PR-1 promoter that contains sequences between -816 and -573 upstream of the -68 promoter region. In this addendum, we report that the expression characteristics of this truncated PR-1 promoter is changed profoundly when its as-1-like element is replaced by the as-1 element of Cauliflower Mosaic Virus 35S promoter which also contains two TGACG motifs. The resulting chimeric promoter showed high constitutive activity that was independent from SA, NPR1 and SNI1. Thus, the configuration of two TGA binding sites within the PR-1 promoter determines whether NPR1 can induce and whether SNI1 can repress the promoter. PMID:21139438

  2. Exchanging the as-1-like element of the PR-1 promoter by the as-1 element of the CaMV 35S promoter abolishes salicylic acid responsiveness and regulation by NPR1 and SNI1.

    PubMed

    Pape, Sebastian; Thurow, Corinna; Gatz, Christiane

    2010-12-01

    The plant defense hormone salicylic acid (SA) activates gene expression through a number of different mechanisms. In Arabidopsis thaliana, the SA-induced PATHOGENESIS RELATED (PR)-1 promoter is regulated through TGA transcription factors binding to the two TGACG motifs of the so called as-1 (activation sequence-1)-like element which is located between base pair positions -665 and -641. Activation is mediated by the transcriptional co-activator NPR1 (NON EXPRESSOR OF PR GENES1), which physically interacts with TGA factors. Moreover, the promoter is under the control of the negative regulator SNI1 (SUPPRESSOR OF NPR1, INDUCIBLE1). We have recently reported that SNI1-mediated repression of basal promoter activities and NPR1-dependent induction are maintained in a truncated PR-1 promoter that contains sequences between -816 and -573 upstream of the -68 promoter region. In this addendum, we report that the expression characteristics of this truncated PR-1 promoter is changed profoundly when its as-1-like element is replaced by the as-1 element of Cauliflower Mosaic Virus 35S promoter which also contains two TGACG motifs. The resulting chimeric promoter showed high constitutive activity that was independent from SA, NPR1 and SNI1. Thus, the configuration of two TGA binding sites within the PR-1 promoter determines whether NPR1 can induce and whether SNI1 can repress the promoter.

  3. Differential Top10 promoter regulation by six tetracycline analogues in plant cells

    NASA Technical Reports Server (NTRS)

    Love, John; Allen, George C.; Gatz, Christiane; Thompson, William F.; Brown, C. S. (Principal Investigator)

    2002-01-01

    The effects of five tetracycline analogues, anhydrotetracycline, doxycycline, minocycline, oxytetracycline, and tetracycline, on Top10 promoter activity in NT1 tobacco tissue culture cells have been analysed. The concentration that repressed Top10 promoter activity, the level of transgene repression and the kinetics of transgene de-repression were determined for each analogue, and could not be predicted from in vitro binding affinity to the tetracycline repressor or from comparison with animal cells. Doxycycline had the most potent effect on the Top10 promoter and completely inhibited transgene expression at 4 nmol l(-1). Tetracycline was the most versatile of the analogues tested; tetracycline inhibited the Top10 promoter at 10 nmol l(-1) and was easily washed out to restore Top10-driven expression in 12-24 h. A study was also made of the suitability for plant research of a novel tetracycline analogue, GR33076X. In animal cells, GR33076X de-repressed Top10 promoter activity in the presence of inhibitory concentrations of anhydrotetracycline. In NT1, it is shown that GR 33076X can antagonize repression of the Top10 promoter in the presence of tetracycline, but not of anhydrotetracycline or of doxycycline. Different tetracycline analogues can therefore be used to regulate the Top10 promoter in plant cells and this property may be exploited in planning an optimum course of transgene regulation.

  4. [Cloning of mouse adam10 gene promoter and construction and identification of dual luciferase reporter system].

    PubMed

    Chen, Wei; Chen, Chong; Zhang, Huan-Xin; Cao, Jiang; Sang, Wei; Wu, Qing-Yun; Zhao, Kai; Zang, Yu; Zeng, Ling-Yu; Xu, Kai-Lin

    2012-06-01

    This study was aimed to clone mouse adam10 gene promoter and construct its dual luciferase report vector, and to investigate its transcriptional activity. Total DNA was extracted from mouse brain and used for amplifying the fragment containing adam10 gene promoter by PCR. The amplified product was inserted into pGL-4.10 vector to construct pGL4.10-adam10. The pGL4.10-adam10 and control plasmid pGL4.74 were co-transfected into HEK293 FT cells by lipofectamine 2000. The activity of adam10 gene promoter was assayed by luciferase system. The results showed that the recombinant plasmid pGL4.10-adam10 containing promoter of mouse adam10 was correctly constructed. The method was optimized by changing ratio of two plasmids. Moreover, the transcriptional activity of pGL4.10-adam10 stimulated by ionomycin increased. It is concluded that the dual luciferase reporter system is successfully established, which is useful in bioluminescence imaging technology in vitro. The effect of ionomycin can enhance the transcriptional activity of adam10 gene promoter.

  5. Efficient transcription from the rice tungro bacilliform virus promoter requires elements downstream of the transcription start site.

    PubMed Central

    Chen, G; Rothnie, H M; He, X; Hohn, T; Fütterer, J

    1996-01-01

    Elements downstream of the transcription start site enhance the activity of the rice tungro bacilliform virus (RTBV) promoter in protoplasts derived from cultured rice cells. This enhancer region was located to the first 90 nucleotides of the RTBV leader sequence. Within this region, at least two components which act together to enhance expression from the RTBV promoter could be identified. One is a position- and orientation-independent DNA element within a CT-rich region, and the other is a position-dependent element. Either element was found to be capable of acting independently on a heterologous promoter. The enhancer activity of the DNA element correlates with specific binding of nuclear proteins. Nuclear proteins also recognize an RNA transcript covering the first 90 nucleotides of the RTBV leader. PMID:8970962

  6. Transposable B2 SINE elements can provide mobile RNA polymerase II promoters.

    PubMed

    Ferrigno, O; Virolle, T; Djabari, Z; Ortonne, J P; White, R J; Aberdam, D

    2001-05-01

    Short interspersed elements (SINEs) are highly abundant components of mammalian genomes that are propagated by retrotransposition. SINEs are recognized as a causal agent of human disease and must also have had a profound influence in shaping eukaryotic genomes. The B2 SINE family constitutes approximately 0.7% of total mouse genomic DNA (ref. 2) and is also found at low abundance in humans. It resembles the Alu family in several respects, such as its mechanism of propagation. B2 SINEs are derived from tRNA and are transcribed by RNA polymerase (pol) III to generate short transcripts that are not translated. We find here, however, that one B2 SINE also carries an active pol II promoter located outside the tRNA region. Indeed, a B2 element is responsible for the production of a mouse Lama3 transcript. The B2 pol II promoters can be bound and stimulated by the transcription factor USF (for upstream stimulatory factor), as shown by transient transfection experiments. Moreover, this pol II activity does not preclude the pol III transcription necessary for retrotransposition. Dispersal of B2 SINEs by retrotransposition may therefore have provided numerous opportunities for creating regulated pol II transcription at novel genomic sites. This mechanism may have allowed the evolution of new transcription units and new genes. PMID:11326281

  7. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  8. Human potassium chloride cotransporter 1 (SLC12A4) promoter is regulated by AP-2 and contains a functional downstream promoter element.

    PubMed

    Zhou, Guo-Ping; Wong, Clara; Su, Robert; Crable, Scott C; Anderson, Kathleen P; Gallagher, Patrick G

    2004-06-01

    Most K-Cl cotransport in the erythrocyte is attributed to potassium chloride cotransporter 1 (KCC1). K-Cl cotransport is elevated in sickle erythrocytes, and the KCC1 gene has been proposed as a modifier gene in sickle cell disease. To provide insight into our understanding of the regulation of the human KCC1 gene, we mapped the 5' end of the KCC1 cDNA, cloned the corresponding genomic DNA, and identified the KCC1 gene promoter. The core promoter lacks a TATA box and is composed of an initiator element (InR) and a downstream promoter element (DPE), a combination found primarily in Drosophila gene promoters and rarely observed in mammalian gene promoters. Mutational analyses demonstrated that both the InR and DPE sites were critical for full promoter activity. In vitro DNase I footprinting, electrophoretic mobility shift assays, and reporter gene assays identified functional AP-2 and Sp1 sites in this region. The KCC1 promoter was transactivated by forced expression of AP-2 in heterologous cells. Sequences encoding the InR, DPE, AP-2, and Sp1 sites were 100% conserved between human and murine KCC1 genes. In vivo studies using chromatin immunoprecipitation assays with antihistone H3 and antihistone H4 antibodies demonstrated hyperacetylation of this core promoter region.

  9. Parainfluenza virus chimeric mini-replicons indicate a novel regulatory element in the leader promoter.

    PubMed

    Matsumoto, Yusuke; Ohta, Keisuke; Goto, Hideo; Nishio, Machiko

    2016-07-01

    Gene expression of paramyxoviruses is regulated by genome-encoded cis-acting elements; however, whether all the required elements for viral growth have been identified is not clear. Using a mini-replicon system, it has been shown that human parainfluenza virus type 2 (hPIV2) polymerase can recognize the promoter elements of parainfluenza virus type 5 (PIV5), but reporter activity is lower in this case. We constructed a series of luciferase-encoding chimeric PIV2/5 mini-genomes that are basically hPIV2, but whose leader (le), mRNA start signal and trailer sequence are partially replaced with those of PIV5. Studies of the chimeric PIV2/5 mini-replicons demonstrated that replacement of hPIV2 le with PIV5 le results in remarkably weak luciferase expression. Further mutagenesis identified the responsible region as positions 25-30 of the PIV5 le. Using recombinant hPIV2, the impact of this region on viral life cycles was assessed. Insertion of the mutation at this region facilitated viral growth, genomic replication and mRNA transcription at the early stage of infection, which elicited severe cell damage. In contrast, at the late infection stage it caused a reduction in viral transcription. Here, we identify a novel cis-acting element in the internal region of an le sequence that is involved in the regulation of polymerase, and which contributes to maintaining a balance between viral growth and cytotoxicity. PMID:27072881

  10. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  11. 10 CFR 719.21 - What are the required elements of an engagement letter?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false What are the required elements of an engagement letter? 719.21 Section 719.21 Energy DEPARTMENT OF ENERGY CONTRACTOR LEGAL MANAGEMENT REQUIREMENTS Engagement Letters § 719.21 What are the required elements of an engagement letter? (a) The engagement letter...

  12. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 3 2011-01-01 2011-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities...

  13. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities...

  14. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  15. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  16. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 3 2013-01-01 2013-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities...

  17. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 3 2012-01-01 2012-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities...

  18. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 3 2014-01-01 2014-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  19. 10 CFR 420.17 - Optional elements of State Energy Program plans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Optional elements of State Energy Program plans. 420.17 Section 420.17 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION STATE ENERGY PROGRAM Formula Grant Procedures § 420.17 Optional elements of State Energy Program plans. (a) Other appropriate activities...

  20. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  1. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  2. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  3. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  4. 28 CFR 45.10 - Procedures to promote compliance with crime victims' rights obligations.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... crime victims' rights obligations. 45.10 Section 45.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.10 Procedures to promote compliance with crime victims' rights... implements the provisions of the Justice for All Act that relate to protection of the rights of crime...

  5. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa

    PubMed Central

    Liu, Shaoqing; Dong, Lei; Liu, Chunying; Song, Wenwen; Liu, Jingjing; Gai, Shupeng

    2016-01-01

    The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release. PMID:27228117

  6. Structural basis for LIN54 recognition of CHR elements in cell cycle-regulated promoters.

    PubMed

    Marceau, Aimee H; Felthousen, Jessica G; Goetsch, Paul D; Iness, Audra N; Lee, Hsiau-Wei; Tripathi, Sarvind M; Strome, Susan; Litovchick, Larisa; Rubin, Seth M

    2016-01-01

    The MuvB complex recruits transcription factors to activate or repress genes with cell cycle-dependent expression patterns. MuvB contains the DNA-binding protein LIN54, which directs the complex to promoter cell cycle genes homology region (CHR) elements. Here we characterize the DNA-binding properties of LIN54 and describe the structural basis for recognition of a CHR sequence. We biochemically define the CHR consensus as TTYRAA and determine that two tandem cysteine rich regions are required for high-affinity DNA association. A crystal structure of the LIN54 DNA-binding domain in complex with a CHR sequence reveals that sequence specificity is conferred by two tyrosine residues, which insert into the minor groove of the DNA duplex. We demonstrate that this unique tyrosine-mediated DNA binding is necessary for MuvB recruitment to target promoters. Our results suggest a model in which MuvB binds near transcription start sites and plays a role in positioning downstream nucleosomes.

  7. Structural basis for LIN54 recognition of CHR elements in cell cycle-regulated promoters

    PubMed Central

    Marceau, Aimee H.; Felthousen, Jessica G.; Goetsch, Paul D.; Iness, Audra N.; Lee, Hsiau-Wei; Tripathi, Sarvind M.; Strome, Susan; Litovchick, Larisa; Rubin, Seth M.

    2016-01-01

    The MuvB complex recruits transcription factors to activate or repress genes with cell cycle-dependent expression patterns. MuvB contains the DNA-binding protein LIN54, which directs the complex to promoter cell cycle genes homology region (CHR) elements. Here we characterize the DNA-binding properties of LIN54 and describe the structural basis for recognition of a CHR sequence. We biochemically define the CHR consensus as TTYRAA and determine that two tandem cysteine rich regions are required for high-affinity DNA association. A crystal structure of the LIN54 DNA-binding domain in complex with a CHR sequence reveals that sequence specificity is conferred by two tyrosine residues, which insert into the minor groove of the DNA duplex. We demonstrate that this unique tyrosine-mediated DNA binding is necessary for MuvB recruitment to target promoters. Our results suggest a model in which MuvB binds near transcription start sites and plays a role in positioning downstream nucleosomes. PMID:27465258

  8. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  9. Identification of regulatory elements in the AGT1 promoter of ale and lager strains of brewer's yeast.

    PubMed

    Vidgren, Virve; Kankainen, Matti; Londesborough, John; Ruohonen, Laura

    2011-08-01

    Agt1 is an interesting α-glucoside transporter for the brewing industry, as it efficiently transports maltotriose, a sugar often remaining partly unused during beer fermentation. It has been shown that on maltose the expression level of AGT1 is much higher in ale strains than in lager strains, and that glucose represses the expression, particularly in the ale strains. In the present study the regulatory elements of the AGT1 promoter of one ale and two lager strains were identified by computational methods. Promoter regions up to 1.9 kbp upstream of the AGT1 gene were sequenced from the three brewer's yeast strains and the laboratory yeast strain CEN.PK-1D. The promoter sequence of the laboratory strain was identical to the AGT1 promoter of strain S288c of the Saccharomyces Genome Database, whereas the promoter sequences of the industrial strains diverged markedly from the S288c strain. The AGT1 promoter regions of the ale and lager strains were for the most part identical to each other, except for one 22 bp deletion and two 94 and 95 bp insertions in the ale strain. Computational analyses of promoter elements revealed that the promoter sequences contained several Mig1- and MAL-activator binding sites, as was expected. However, some of the Mig1 and MAL-activator binding sites were located on the two insertions of the ale strain, and thus offered a plausible explanation for the different expression pattern of the AGT1 gene in the ale strains. Accordingly, functional analysis of A60 ale and A15 lager strain AGT1 promoters fused to GFP (encoding the green fluorescent protein) showed a significant difference in the ability of these two promoters to drive GFP expression. Under the control of the AGT1 promoter of the ale strain the emergence of GFP was strongly induced by maltose, whereas only a low level of GFP was detected with the construct carrying the AGT1 promoter of the lager strain. Thus, the extra MAL-activator binding element, present in the AGT1 promoter of

  10. Extracellular compounds produced by bacterial consortium promoting elements mobilization from polymetallic Kupferschiefer black shale (Fore-Sudetic Monocline, Poland).

    PubMed

    Włodarczyk, Agnieszka; Stasiuk, Robert; Skłodowska, Aleksandra; Matlakowska, Renata

    2015-03-01

    Culture experiments employing Fe-deficient medium showed that a consortium of indigenous microorganisms isolated from Kupferschiefer black shale produced a mixture of extracellular compounds containing siderophores which could form complexes with a wide range of elements and were able to mediate element mobilization from polymetallic black shale. The mobilization of a diverse array of elements including a number of essential trace elements (Co, Cu, Mn, Mo, Zn) and toxic species (As) was shown. Since the bacteria used in this study were originally obtained from a subsurface copper deposit, these results highlight the potential importance of extracellular compounds in biogeochemical cycles of elements in underground environment and their ecological significance in promoting the uptake of essential trace metals and resistance to toxic elements.

  11. Maize Adh-1 promoter sequences control anaerobic regulation: addition of upstream promoter elements from constitutive genes is necessary for expression in tobacco

    PubMed Central

    Ellis, J.G.; Llewellyn, D.J.; Dennis, E.S.; Peacock, W.J.

    1987-01-01

    The promoter region of a maize alcohol dehydrogenase gene (Adh-1) was linked to a reporter gene encoding chloramphenicol acetyl transferase (CAT) and transformed stably into tobacco cells using T-DNA vectors. No CAT enzyme activity could be detected in transgenic tobacco plants unless upstream promoter elements from the octopine synthase gene or the cauliflower mosaic virus 35S promoter were supplied in addition to the maize promoter region. CAT enzyme activity and transcription of the chimaeric gene were then readily detected after anaerobic induction. The first 247 bp upstream of the translation initiation codon of the maize Adh-1 gene were sufficient to impose anaerobic regulation on the hybrid gene and S1 nuclease mapping confirmed mRNA initiation is from the normal maize Adh-1 transcription start point. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Fig. 5.Fig. 6. PMID:15981329

  12. The human beta fibrinogen promoter contains a hepatocyte nuclear factor 1-dependent interleukin-6-responsive element.

    PubMed Central

    Dalmon, J; Laurent, M; Courtois, G

    1993-01-01

    Acute-phase reactants are liver proteins whose synthesis is positively or negatively regulated during inflammation. The main mediators of this phenomenon are glucocorticoids and interleukin-6 (IL-6), a pleiotropic cytokine that also controls hematopoiesis. Functional analysis of several acute-phase reactant promoter regions has identified two major DNA motifs used by IL-6-regulated genes. The first one corresponds to a CTGG(G/A)AA sequence, and the other is a binding site for members of the C/EBP family of nuclear proteins. We have previously shown that the human beta fibrinogen (beta Fg) promoter contains an IL-6-responsive region, located between bp -150 and -67 (P. Huber, M. Laurent, and J. Dalmon, J. Biol. Chem. 265:5695-5701, 1990). In this study, using DNase I footprinting, mobility shift assays, and mutagenesis, we demonstrate that at least three subdomains of this region are necessary to observe a full response to IL-6. The most distal contains a CTGGGAA motif, and its mutation inhibits IL-6 stimulation. Another, which is able to interact with several distinct nuclear proteins, among them members of the C/EBP family, is dispensable for IL-6 induction but plays an important role in the constitutive expression of beta Fg. Finally, a proximal hepatocyte nuclear factor 1 binding site, already described as the major determinant of beta Fg tissue-specific expression, is also required for IL-6 stimulation. These results indicate a complex interplay between nuclear proteins within the beta Fg IL-6-responsive region and suggest a tight functional coupling between the tissue-specific and inducible elements. Images PMID:8423785

  13. Regulatory elements involved in constitutive and phorbol ester-inducible expression of the plasminogen activator inhibitor type 2 gene promoter.

    PubMed Central

    Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K

    1991-01-01

    Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454

  14. Expression of Steroidogenic Factor 1 in the Testis Requires an Interactive Array of Elements Within Its Proximal Promoter1

    PubMed Central

    Scherrer, Serge P.; Rice, Daren A.; Heckert, Leslie L.

    2006-01-01

    Steroidogenic factor 1 (SF-1) is an orphan nuclear receptor that is important for expression of genes involved in sexual differentiation, testicular and adrenal development, and hormone synthesis and regulation. To better understand the mechanisms required for SF-1 production, we employed transient transfec-tion analysis and electrophoretic mobility shift assays to characterize the elements and proteins required for transcriptional activity of the SF-1 proximal promoter in testicular Sertoli and Leydig cells and adrenocortical cells. Direct comparison of SF-1-promoter activity in testis and adrenal cell types established that a similar set of regulatory elements (an E box, CCAAT box, and Sp1-binding sites) is required for proximal promoter activity in these cells. Further evaluation of the E box and CCAAT box revealed a novel synergism between the two elements and iden-tified functionally important bases within the elements. Importantly, DNA/protein-binding studies uncovered new proteins interacting with the E box and CCAAT box. Thus, in addition to the previously identified USF and NF-Y proteins, newly described complexes, having migration properties that differed between Sertoli and Leydig cells, were observed bound to the E box and CCAAT box. Transient transfection analysis also identified several Sp1/Sp3-binding elements important for expression of SF-1 in the testis, one of which was previously described for expression in the adrenal gland whereas the other two were newly disclosed elements. PMID:12390883

  15. 10 cm x 10 cm Single Gas Electron Multiplier (GEM) X-ray Fluorescence Detector for Dilute Elements

    NASA Astrophysics Data System (ADS)

    Shaban, E. H.; Siddons, D. P.; Seifu, D.

    2014-03-01

    We have built and tested a 10 cm × 10 cm single Gas Electron Multiplier (GEM) X-ray detector to probe dilute amounts of Fe in a prepared sample. The detector uses Argon/Carbon Dioxide (75/25) gas mixture flowing at a slow rate through a leak proof Plexi-glass enclosure held together by O-rings and screws. The Fluorescence X-ray emitted by the element under test is directed through a Mylar window into the drift region of the detector where abundant gas is flowing. The ionized electrons are separated, drifted into the high electric field of the GEM, and multiplied by impact ionization. The amplified negatively charged electrons are collected and further amplified by a Keithley amplifier to probe the absorption edge of the element under test using X-ray absorption spectroscopy technique. The results show that the GEM detector provided good results with less noise as compared with a Silicon drift detector (SDD).

  16. Bioleaching of rare earth and radioactive elements from red mud using Penicillium tricolor RM-10.

    PubMed

    Qu, Yang; Lian, Bin

    2013-05-01

    The aim of this work is to investigate biological leaching of rare earth elements (REEs) and radioactive elements from red mud, and to evaluate the radioactivity of the bioleached red mud used for construction materials. A filamentous, acid-producing fungi named RM-10, identified as Penicillium tricolor, is isolated from red mud. In our bioleaching experiments by using RM-10, a total concentration of 2% (w/v) red mud under one-step bioleaching process was generally found to give the maximum leaching ratios of the REEs and radioactive elements. However, the highest extraction yields are achieved under two-step bioleaching process at 10% (w/v) pulp density. At pulp densities of 2% and 5% (w/v), red mud processed under both one- and two-step bioleaching can meet the radioactivity regulations in China.

  17. Convergent transcription initiates from oppositely oriented promoters within the 5 prime end regions of Drosophila melanogaster F elements

    SciTech Connect

    Minchiotti, G. ); Di Nocera, P.P. )

    1991-10-01

    Drosophila melanogaster F elements are mobile, oligo(A)-terminated DNA sequences that likely propagate by the retrotranscription of RNA intermediates. Plasmids bearing DNA segments from the left-hand region of a full-length F element fused to the CAT gene were used as templates for transient expression assays in Drosophila Schneider II cultured cells. Protein and RNA analyses led to the identification of two promoters, F{sub in} and F{sub out}, that transcribe in opposite orientations. Analysis of the template activity of 3{prime} deletion derivatives indicates that the level of accumulation of F{sub in}RNA is also dependent upon the presence of sequences located within the +175 to +218 interval. The F{sub out} promoter drives transcription in the opposite orientation with respect to F{sub in}, F{sub out} transcripts initiate at nearby sites within the +92 to +102 interval. Sequences downstream of these multiple RNA start sites are not required for the activity of the F{sub out} promoter. Deletions knocking out the F{sub in} promoter do not impair F{sub out} transcription; conversely, initiation at the F{sub in} promoter still takes place in templates that lack the F{sub out} promoter. At a low level, both promoters are active in cultured cells.

  18. Identification of an insulin response element in the fatty acid synthase promoter.

    PubMed

    Moustaïd, N; Beyer, R S; Sul, H S

    1994-02-25

    We have previously reported that insulin increases fatty acid synthase (FAS) gene transcription, and that sequences responsible for positive regulation are located within the first 332 base pairs of the FAS promoter. To define minimal sequences required for insulin regulation within this region, chimeric constructs containing serial 5' deletions starting at -318 and extending through position +67 of the rat FAS gene ligated to the luciferase reporter gene were transfected into 3T3-L1 adipocytes. Insulin treatment at 10 nM increased luciferase activity 2-3-fold in 3T3-L1 adipocytes transfected with constructs containing progressive deletions from -318 to -67. This stimulation of the FAS promoter activity by insulin was dose-dependent. However, no effect of insulin was observed when fusion constructs containing FAS promoter sequences spanning from -25 or from -19 to +67 were transfected into adipocytes. These results suggest that the insulin response sequences of the FAS gene may be located in the region from -67 to -25. DNase I footprinting using liver nuclear extracts revealed a protected region spanning -71 and -50 in addition to a region near the putative TATA box. Gel mobility shift assays using the sequence from -71 to -50 as a probe revealed nuclear factor(s) from mouse liver and 3T3-L1 adipocytes that specifically complexed with this sequence. Mutational analysis of this region showed that sequences between -68 and -60 are essential for recognition and interaction with a trans-acting factor(s). Moreover, when three tandem repeats of the sequences spanning -68 to -52 were linked to the SV40 promoter and used for transfection, luciferase activity increased 3.6-fold in response to insulin treatment. Thus, we have identified novel cis-acting DNA sequences responsible for insulin regulation of the FAS gene, which interact with nuclear protein(s) from liver and adipocytes and which are found to share limited homology to insulin response sequences present in other

  19. Activation of matrix metalloproteinase-26 by HOXA10 promotes embryo adhesion in vitro.

    PubMed

    Jiang, Yue; Yan, Guijun; Zhang, Hui; Shan, Huizhi; Kong, Chengcai; Yan, Qiang; Xue, Bai; Diao, Zhenyu; Hu, Yali; Sun, Haixiang

    2014-03-14

    Successful embryonic implantation requires an effective maternal-embryonic molecular dialogue. However, the detailed mechanisms of epithelial-embryo adhesion remain poorly understood. Here, we report that matrix metalloproteinase-26 (MMP-26) is a novel downstream target gene of homeobox a 10 (HOXA10) in human endometrial cells. HOXA10 binds directly to a conserved TTAT unit (-442 to -439) located within the 5' regulatory region of the MMP-26 gene and regulates the expression and secretion of MMP-26 in a concentration-dependent manner. Moreover, the adenovirus-mediated overexpression of MMP-26 in Ishikawa cells markedly increased BeWo spheroid adhesion. An antibody blocking assay further demonstrated that the promotion of BeWo spheroid adhesion by HOXA10 and MMP-26 was significantly inhibited by pre-treatment with a specific antibody against MMP-26. These results demonstrate that the HOXA10-mediated expression of MMP-26 promotes embryo adhesion during the process of embryonic implantation. PMID:24565841

  20. Heterogeneous nuclear ribonucleoprotein K represses transcription from a cytosine/thymidine-rich element in the osteocalcin promoter

    PubMed Central

    2004-01-01

    HnRNP K (heterogeneous nuclear ribonucleoprotein K) was biochemically purified from a screen of proteins co-purifying with binding activity to the osteocalcin promoter. We identify hnRNP K as a novel repressor of osteocalcin gene transcription. Overexpression of hnRNP K lowers the expression of osteocalcin mRNA by 5-fold. Furthermore, luciferase reporter assays demonstrate that overexpression of hnRNP K represses osteocalcin transcription from a CT (cytosine/thymidine)-rich element in the proximal promoter. Electrophoretic mobility-shift analysis reveals that recombinant hnRNP K binds to the CT-rich element, but binds ss (single-stranded), rather than ds (double-stranded) oligonucleotide probes. Accordingly, hnRNP K antibody can supershift a binding activity present in nuclear extracts using ss sense, but not antisense or ds oligonucleotides corresponding to the CT-rich −95 to −47 osteocalcin promoter. Importantly, addition of recombinant hnRNP K to ROS 17/2.8 nuclear extract disrupts formation of a DNA–protein complex on ds CT element oligonucleotides. This action is mutually exclusive with hnRNP K's ability to bind ss DNA. These results demonstrate that hnRNPK, although co-purified with a dsDNA-binding activity, does not itself bind dsDNA. Rather, hnRNP K represses osteocalcin gene transcription by inhibiting the formation of a transcriptional complex on the CT element of the osteocalcin promoter. PMID:15361071

  1. Interleukin 10 promoter region polymorphisms and susceptibility to advanced alcoholic liver disease

    PubMed Central

    Grove, J; Daly, A; Bassendine, M; Gilvarry, E; Day, C

    2000-01-01

    BACKGROUND—The factors determining why less than 10% of heavy drinkers develop advanced alcoholic liver disease (ALD) remain elusive, although genetic factors may be important. Interleukin 10 (IL-10) is an important cytokine with anti-inflammatory, anti-immune, and antifibrotic functions. Several polymorphisms have been identified in the IL-10 promoter and recent evidence suggests that some of these may have functional effects on IL-10 secretion.
AIMS—To test the hypothesis that IL-10 promoter region polymorphisms are associated with susceptibility to ALD.
METHODS—The allele frequencies for the two single base pair substitutions at positions −627 (C→A) and −1117 (A→G) in the IL-10 promoter were determined in 287 heavy drinkers with biopsy proved advanced ALD, 107 heavy drinkers with no evidence of liver disease or steatosis only on biopsy, and 227 local healthy volunteers.
RESULTS—At position −627, 50% of patients with advanced ALD had a least one A allele compared with 33% of controls (p<0.0001) and 34% of drinkers with no or mild disease (p=0.017). At position −1117, the slight excess of the A allele in drinkers with advanced disease was because of linkage disequilibrium between the A alleles at the two sites.
CONCLUSIONS—Among heavy drinkers, possession of the A allele at position −627 in the IL-10 promoter is associated with an increased risk of advanced liver disease. This is consistent with recent functional data that the −627*A allele is associated with low IL-10 expression which will favour inflammatory, immune mediated, and profibrotic mechanisms of alcohol related liver injury.


Keywords: ethyl alcohol; cirrhosis; interleukin 10; genetic polymorphism PMID:10716685

  2. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    SciTech Connect

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun . E-mail: qqtang@shmu.edu.cn

    2006-09-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPAR{gamma} antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPAR{gamma}. Specific PPAR{gamma} ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium.

  3. Far upstream element-binding protein 1 is a prognostic biomarker and promotes nasopharyngeal carcinoma progression

    PubMed Central

    Liu, Z-H; Hu, J-L; Liang, J-Z; Zhou, A-J; Li, M-Z; Yan, S-M; Zhang, X; Gao, S; Chen, L; Zhong, Q; Zeng, M-S

    2015-01-01

    Nasopharyngeal carcinoma (NPC) is a malignant epithelial tumor with tremendous invasion and metastasis capacities, and it has a high incidence in southeast Asia and southern China. Previous studies identified that far upstream element-binding protein 1 (FBP1), a transcriptional regulator of c-Myc that is one of the most frequently aberrantly expressed oncogenes in various human cancers, including NPC, is an important biomarker for many cancers. Our study aimed to investigate the expression and function of FBP1 in human NPC. Quantitative real-time RT-PCR (qRT-PCR), western blot and immunohistochemical staining (IHC) were performed in NPC cells and biopsies. Furthermore, the effect of FBP1 knockdown on cell proliferation, colony formation, side population tests and tumorigenesis in nude mice were measured by MTT, clonogenicity analysis, flow cytometry and a xenograft model, respectively. The results showed that the mRNA and protein levels of FBP1, which are positively correlated with c-Myc expression, were substantially higher in NPC than that in nasopharyngeal epithelial cells. IHC revealed that the patients with high FBP1 expression had a significantly poorer prognosis compared with the patients with low expression (P=0.020). In univariate analysis, high FBP1 and c-Myc expression predicted poorer overall survival (OS) and poorer progression-free survival. Multivariate analysis indicated that high FBP1 and c-Myc expression were independent prognostic markers. Knockdown of FBP1 reduced cell proliferation, clonogenicity and the ratio of side populations, as well as tumorigenesis in nude mice. These data indicate that FBP1 expression, which is closely correlated with c-Myc expression, is an independent prognostic factor and promotes NPC progression. Our results suggest that FBP1 can not only serve as a useful prognostic biomarker for NPC but also as a potential therapeutic target for NPC patients. PMID:26469968

  4. IL-10 neutralization promotes parasite clearance in splenic aspirate cells from patients with visceral leishmaniasis.

    PubMed

    Gautam, Shalini; Kumar, Rajiv; Maurya, Radheshyam; Nylén, Susanne; Ansari, Nasim; Rai, Madhukar; Sundar, Shyam; Sacks, David

    2011-10-01

    The mechanisms underlying the failure to contain the growth of Leishmania parasites in human visceral leishmaniasis (VL) are not understood. L donovani amastigotes were quantified in cultured splenic aspirate cells to assess the function of IL-10 in lesional tissue ex vivo. In 67 patients with active VL, IL-10 neutralization promoted parasite killing in 73% and complete clearance in 30%, while 18% had more parasites and 9% did not change. The splenic cells secreted increased levels of both tumor necrosis factor α (TNFα) and interferon γ (IFNγ) under IL-10-neutralizing conditions. These findings provide direct support for targeting IL-10 as an approach to therapy in human VL. PMID:21881130

  5. Evidence that a consensus element found in naturally intronless mRNAs promotes mRNA export

    PubMed Central

    Lei, Haixin; Zhai, Bo; Yin, Shanye; Gygi, Steve; Reed, Robin

    2013-01-01

    We previously showed that mRNAs synthesized from three genes that naturally lack introns contain a portion of their coding sequence, known as a cytoplasmic accumulation region (CAR), which is essential for stable accumulation of the intronless mRNAs in the cytoplasm. The CAR in each mRNA is unexpectedly large, ranging in size from ∼160 to 285 nt. Here, we identified one or more copies of a 10-nt consensus sequence in each CAR. To determine whether this element (designated CAR-E) functions in cytoplasmic accumulation of intronless mRNA, we multimerized the most conserved CAR-E and inserted it upstream of β-globin cDNA, which is normally retained/degraded in the nucleus. Significantly, the tandem CAR-E, but not its antisense counterpart, rescued cytoplasmic accumulation of β-globin cDNA transcripts. Moreover, dinucleotide mutations in the CAR-E abolished this rescue. We show that the CAR-E, but not the mutant CAR-E, associates with components of the TREX mRNA export machinery, the Prp19 complex and U2AF2. Moreover, knockdown of these factors results in nuclear retention of the intronless mRNAs. Together, these data suggest that the CAR-E promotes export of intronless mRNA by sequence-dependent recruitment of the mRNA export machinery. PMID:23275560

  6. An interlaboratory comparison study on the measurement of elements in PM10

    NASA Astrophysics Data System (ADS)

    Yatkin, Sinan; Belis, Claudio A.; Gerboles, Michel; Calzolai, Giulia; Lucarelli, Franco; Cavalli, Fabrizia; Trzepla, Krystyna

    2016-01-01

    An inter-laboratory comparison study was conducted to measure elemental loadings on PM10 samples, collected in Ispra, a regional background/rural site in Italy, using three different XRF (X-ray Fluorescence) methods, namely Epsilon 5 by linear calibration, Quant'X by the standardless analysis, and PIXE (Particle Induced X-ray Emission) with linear calibration. A subset of samples was also analyzed by ICP-MS (Inductively Coupled Plasma-Mass Spectrometry). Several metrics including method detection limits (MDLs), precision, bias from a NIST standard reference material (SRM 2783) quoted values, relative absolute difference, orthogonal regression and the ratio of the absolute difference between the methods to claimed uncertainty were used to compare the laboratories. The MDLs were found to be comparable for many elements. Precision estimates were less than 10% for the majority of the elements. Absolute biases from SRM 2783 remained less than 20% for the majority of certified elements. The regression results of PM10 samples showed that the three XRF laboratories measured very similar mass loadings for S, K, Ti, Mn, Fe, Cu, Br, Sr and Pb with slopes within 20% of unity. The ICP-MS results confirmed the agreement and discrepancies between XRF laboratories for Al, K, Ca, Ti, V, Cu, Sr and Pb. The ICP-MS results are inconsistent with the XRF laboratories for Fe and Zn. The absolute differences between the XRF laboratories generally remained within their claimed uncertainties, showing a pattern generally consistent with the orthogonal regression results.

  7. The measurement of elemental abundances above 10 exp 15 eV at a lunar base

    NASA Astrophysics Data System (ADS)

    Swordy, S. P.

    1990-03-01

    At about 10 exp 15 eV the slope of the energy spectrum of cosmic rays becomes significantly steeper than at lower energies. The measurement of relative elemental abundances at these energies is expected to provide a means to resolve the origin of this feature and greatly contribute to the understanding of the sources of cosmic rays. A moon-based detector for making well-resolved elemental measurements at these energies is described using hadronic calorimetry. This detector is particularly well suited for a site on the lunar surface because there is no overlying layer of atmosphere and the large mass required can be provided by the lunar regolith.

  8. A reporter promoter assay confirmed the role of a distal promoter NOBOX binding element in enhancing expression of GDF9 gene in buffalo oocytes.

    PubMed

    Roy, Bhaskar; Rajput, Sandeep; Raghav, Sarvesh; Kumar, Parveen; Verma, Arpana; Kumar, Sandeep; De, Sachinandan; Goswami, Surender Lal; Datta, Tirtha Kumar

    2012-11-01

    Growth differentiation factor 9 is primarily expressed in oocytes and plays a vital role in oocyte cumulus crosstalk. Earlier studies with buffalo oocytes revealed differential expression of this gene under different media stimulation conditions which, in turn, are correlated with the blastocyst yield. In this study, different germ cell specific cis elements including a NOBOX binding elements (NBE) and several E-boxes were identified at the 5' upstream region of buffalo GDF9 gene and their potential role in GDF9 expression was investigated. Transfecting oocytes with GDF9 promoter deletion constructs harbouring the NBE reporter gene revealed a 33% increase in GFP as well as the luciferase signal signifying its role in stimulating the minimal promoter activity of GDF9 in buffalo oocytes. Site directed mutation of core binding nucleotides at NBE at 1.8 kb upstream to TSS further confirmed its role for enhancing the basal transcriptional activity of GDF9 promoter in buffalo oocytes. Current work will provide important leads for understanding the role of GDF9 in oocytes competence and designing a more physiological IVF protocol in case of buffalo.

  9. Wnt-10b promotes differentiation of skin epithelial cells in vitro

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-03-31

    To evaluate the role of Wnt-10b in epithelial differentiation, we investigated the effects of Wnt-10b on adult mouse-derived primary skin epithelial cells (MPSEC). Recombinant Wnt-10b protein (rWnt-10b) was prepared using a gene engineering technique and MPSEC were cultured in its presence, which resulted in morphological changes from cuboidal to spindle-shaped and inhibited their proliferation. Further, involvement of the canonical Wnt signal pathway was also observed. MPSEC treated with rWnt-10b showed characteristics of the hair shaft and inner root sheath of the hair follicle, in results of Ayoub Shklar staining and immunocytochemistry. Further, the cells expressed mRNA for differentiated epithelial cells, including keratin 1, keratin 2, loricrin, mHa5, and mHb5, in association with a decreased expression of the basal cell marker keratin 5. These results suggest that Wnt-10b promotes the differentiation of MPSEC.

  10. MiRNA-10a is upregulated in NSCLC and may promote cancer by targeting PTEN

    PubMed Central

    Yu, Tao; Liu, Lei; Li, Jing; Yan, Mingxia; Lin, Hechun; Liu, Ying; Chu, Dandan; Tu, Hong; Gu, Aiqin; Yao, Ming

    2015-01-01

    MicroRNAs (miRNAs) are involved in human cancer including non-small cell lung cancer (NSCLC). In this study, we compared miRNA expression microarray of SPC-A-1sci (high metastatic) and SPC-A-1 (weakly metastatic) cells. We found that miRNA-10a was up-regulated in NSCLC compared with corresponding normal tissues. High expression of miR-10a was associated with tumor node metastasis and lymph node metastasis. Furthermore, overexpression of miR-10a promoted NSCLC cell proliferation, migration and invasion in vitro. We found that PTEN was a direct target of miR-10a in NSCLC. Also miR-10a activated the PTEN/AKT/ERK pathway. We suggest that miR-10a contributes to NSCLC by targeting PTEN. PMID:26317552

  11. Sequence-specific initiator elements focus initiation of transcription to distinct sites in the yeast TRP4 promoter.

    PubMed Central

    Mösch, H U; Graf, R; Braus, G H

    1992-01-01

    Transcription from the yeast TRP4 promoter initiates at two basal (i127 and i76) and three GCN4 dependent (i31, i25 and i12) initiator elements. All of these elements contain not more than one deviation from the earlier proposed initiator consensus sequence PuPuPyPuPu, a pyrimidine nucleotide flanked on either side by two purine nucleotides. A point mutation analysis of these elements in various combinations was performed and revealed that the central pyrimidine nucleotide and at least one of the 3' flanking purine nucleotides of the PuPuPyPuPu consensus sequence are essential but alone not sufficient to define a functional initiator element. Multiple cryptic transcription start sites, which function independently whether they are located on the coding or the non-coding strand, can replace the function of mutated initiator elements and therefore the overall level of transcription initiation is not affected. The sequence specificity is identical for basal and GCN4 dependent initiator elements demonstrating that they are functionally homologous. These findings imply that the role of initiator elements is to 'focus' the start point(s) of transcription to distinct sites located in the region between the site(s) of the assembly of the transcriptional complex and the start codon of translation. Images PMID:1425591

  12. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  13. Interleukin-10 Promotes Pathological Angiogenesis by Regulating Macrophage Response to Hypoxia during Development

    PubMed Central

    Dace, Dru S.; Khan, Aslam A.; Kelly, Jennifer; Apte, Rajendra S.

    2008-01-01

    Aberrant angiogenesis in the eye is the most common cause of blindness. The current study examined the role of interleukin-10 (IL-10) in ischemia-induced pathological angiogenesis called neovascularization during postnatal development. IL-10 deficiency resulted in significantly reduced pathological retinal angiogenesis. In contrast to the choroicapillaris where IL-10 interferes with macrophage influx, IL-10 did not prevent anti-angiogenic macrophages from migrating to the retina in response to hypoxia. Instead, IL-10 promoted retinal angiogenesis by altering macrophage angiogenic function, as macrophages from wild-type mice demonstrated increased vascular endothelial growth factor (VEGF) and nitric oxide (NO) compared to IL-10 deficient macrophages. IL-10 appears to directly affect macrophage responsiveness to hypoxia, as macrophages responded to hypoxia with increased levels of IL-10 and STAT3 phosphorylation as opposed to IL-10 deficient macrophages. Also, IL-10 deficient macrophages inhibited the proliferation of vascular endothelial cells in response to hypoxia while wild-type macrophages failed to do so. These findings suggest that hypoxia guides macrophage behavior to a pro-angiogenic phenotype via IL-10 activated pathways. PMID:18852882

  14. Technical advance: stringent control of transgene expression in Arabidopsis thaliana using the Top10 promoter system

    NASA Technical Reports Server (NTRS)

    Love, J.; Scott, A. C.; Thompson, W. F.; Brown, C. S. (Principal Investigator)

    2000-01-01

    We show that the tightly regulated tetracycline-sensitive Top10 promoter system (Weinmann et al. Plant J. 1994, 5, 559-569) is functional in Arabidopsis thaliana. A pure breeding A. thaliana line (JL-tTA/8) was generated which expressed a chimeric fusion of the tetracycline repressor and the activation domain of Herpes simplex virus (tTA), from a single transgenic locus. Plants from this line were crossed with transgenics carrying the ER-targeted green fluorescent protein coding sequence (mGFP5) under control of the Top10 promoter sequence. Progeny from this cross displayed ER-targeted GFP fluorescence throughout the plant, indicating that the tTA-Top10 promoter interaction was functional in A. thaliana. GFP expression was repressed by 100 ng ml-1 tetracycline, an order of magnitude lower than the concentration used previously to repress expression in Nicotiana tabacum. Moreover, the level of GFP expression was controlled by varying the concentration of tetracycline in the medium, allowing a titred regulation of transgenic activity that was previously unavailable in A. thaliana. The kinetics of GFP activity were determined following de-repression of the Top10:mGFP5 transgene, with a visible ER-targeted GFP signal appearing from 24 to 48 h after de-repression.

  15. Interaction of Escherichia coli RNA polymerase σ70 subunit with promoter elements in the context of free σ70, RNA polymerase holoenzyme, and the β'-σ70 complex.

    PubMed

    Mekler, Vladimir; Pavlova, Olga; Severinov, Konstantin

    2011-01-01

    Promoter recognition by RNA polymerase is a key point in gene expression and a target of regulation. Bacterial RNA polymerase binds promoters in the form of the holoenzyme, with the σ specificity subunit being primarily responsible for promoter recognition. Free σ, however, does not recognize promoter DNA, and it has been proposed that the intrinsic DNA binding ability is masked in free σ but becomes unmasked in the holoenzyme. Here, we use a newly developed fluorescent assay to quantitatively study the interactions of free σ(70) from Escherichia coli, the β'-σ complex, and the σ(70) RNA polymerase (RNAP) holoenzyme with non-template strand of the open promoter complex transcription bubble in the context of model non-template oligonucleotides and fork junction templates. We show that σ(70), free or in the context of the holoenzyme, recognizes the -10 promoter element with the same efficiency and specificity. The result implies that there is no need to invoke a conformational change in σ for recognition of the -10 element in the single-stranded form. In the holoenzyme, weak but specific interactions of σ are increased by contacts with DNA downstream of the -10 element. We further show that region 1 of σ(70) is required for stronger interaction with non-template oligonucleotides in the holoenzyme but not in free σ. Finally, we show that binding of the β' RNAP subunit is sufficient to allow specific recognition of the TG motif of the extended -10 promoter element by σ(70). The new fluorescent assay, which we call a protein beacon assay, will be instrumental in quantitative dissection of fine details of RNAP interactions with promoters.

  16. Relative Strengths of Promoters Provided by Common Mobile Genetic Elements Associated with Resistance Gene Expression in Gram-Negative Bacteria.

    PubMed

    Kamruzzaman, Muhammad; Patterson, Jason D; Shoma, Shereen; Ginn, Andrew N; Partridge, Sally R; Iredell, Jonathan R

    2015-08-01

    Comparison of green fluorescent protein expression from outward-facing promoters (POUT) of ISAba1, ISEcp1, and ISAba125 revealed approximate equivalence in strength, intermediate between PCS (strong) and PCWTGN-10 (weak) class 1 integron promoter variants, >30-fold stronger than POUT of ISCR1, and >5 times stronger than Ptac. Consistent with its usual role, PCWTGN-10 produces more mRNA from a "downstream" gfp gene transcriptionally linked to a "usual" PCWTGN-10-associated gene cassette than does POUT of ISAba1. PMID:26055385

  17. Transcriptional regulation of the c-Myc promoter by NFAT1 involves negative and positive NFAT-responsive elements.

    PubMed

    Mognol, Giuliana P; de Araujo-Souza, Patricia S; Robbs, Bruno K; Teixeira, Leonardo K; Viola, Joao P B

    2012-03-01

    A number of physiological processes in both normal and cancer cells are regulated by the proto-oncogene c-Myc. Among them, processes such as cell cycle regulation, apoptosis, angiogenesis and metastasis are also controlled by the nuclear factor of activated T cells (NFAT) family of transcription factors. It is already known that NFAT upregulates c-Myc expression by binding to an element located in the minimal c-Myc promoter. However, the importance of other NFAT sites in the context of the full promoter has not been evaluated. In this work, we demonstrate that the regulation of c-Myc by NFAT1 is more complex than previously conceived. In addition to the proximal site, NFAT1 directly binds to distal sites in the c-Myc promoter with different affinities. Promoter deletions and site-directed mutagenesis of NFAT binding sites in HEK293T cells suggest that in NFAT1-mediated transactivation, some NFAT elements are negative and dominant and others are positive and recessive. Furthermore, we demonstrate that cooperation with partner proteins, such as p300, enhances NFAT1-mediated transactivation of the c-Myc promoter. At last, the newly identified sites are also responsive to NFAT2 in HEK293T cells. However, in NIH3T3 cells, the regulation mediated by NFAT proteins is not dependent on the known NFAT sites, including the site previously described. Thus, our data suggest that the contribution of NFAT to the regulation of c-Myc expression may depend on a balance between the binding to positive and negative NFAT-responsive elements and cooperation with transcriptional cofactors, which may differ according to the context and/or cell type.

  18. Wnt-10b secreted from lymphocytes promotes differentiation of skin epithelial cells

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-04-21

    Wnt-10b was originally isolated from lymphoid tissue and is known to be involved in a wide range of biological actions, while recently it was found to be expressed early in the development of hair follicles. However, few studies have been conducted concerning the role of Wnt-10b with the differentiation of skin epithelial cells. To evaluate its role in epithelial differentiation, we purified Wnt-10b from the supernatant of a concanavalin A-stimulated lymphocyte culture using an affinity column and investigated its effects on the differentiation of adult mouse-derived primary skin epithelial cells (MPSEC). MPSEC cultured with Wnt-10b showed morphological changes from cuboidal to spindle-shaped with inhibited proliferation, and also obtained characteristics of the hair shaft and inner root sheath of the hair follicle, represented by red-colored Ayoub Shklar staining, and reactions to AE-13 and AE-15 as seen with immunocytology. Further, RT-PCR analysis demonstrated the expression of mRNA for keratin 1, keratin 2, loricrin, mHa5, and mHb5, in association with a decreased expression of the basal cell marker keratin 5, in Wnt-10b-treated MPSEC. In addition, involvement of the canonical Wnt signal pathway was demonstrated by a TCF reporter (pTOPFLASH) assay. These results suggest that Wnt-10b promotes the differentiation of MPSEC and may play an important role in hair follicle development by promoting differentiation of epithelial cells.

  19. Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

    NASA Technical Reports Server (NTRS)

    Frudakis, T. N.; Wilt, F.

    1995-01-01

    The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

  20. Root-specific expression of a western white pine PR10 gene is mediated by different promoter regions in transgenic tobacco.

    PubMed

    Liu, Jun-Jun; Ekramoddoullah, Abul K M

    2003-05-01

    We report here the isolation and characterization of a novel PR10 gene, PmPR10-1.14, from western white pine (Pinus monticola Dougl. ex. D. Don). The PmPR10-1.14 gene encodes a polypeptide exhibiting high similarity with other members of the PR10 family and corresponds to one of six isoforms immunodetected in the roots of western white pine. Northern blot and western immunoblot analyses showed that expression of the PR10 gene family, including PmPR10-1.14, was detected in vegetative tissues constitutively, but not in developing reproductive organs. RT-PCR with gene-specific primers showed that the transcript of PmPR10-1.14 gene was found only in lateral roots and needles during growth. To study PR10 gene regulation at the cellular level, PmPR10-1.14 promoter was fused to the beta-glucuronidase (GUS) report gene, and analyzed for transient and stable gene expression. The transient expression assays in agroinfiltrated tobacco leaves indicated that the core promoter of PmPR10-1.14 gene resided in the sequence from -101 to +69 relative to the first nucleotide of PR10 cDNA. Furthermore, the promoter region from -311 to -101 acted as an enhancer, and the region from -506 to -311 as a silencer. Fluorometric GUS assays of transgenic tobacco plants demonstrated that the longest promoter of 1675 bp directed GUS expression constitutively at high levels in the roots of mature plants, but expression levels were too low to be detectable in other organs in histochemical assays. Histochemical localization analysis showed that PmPR10-1.14 promoter directed a tissue-specific expression exclusively during the initiation and development of the lateral roots. The distal 5' deletion of the promoter to -311 did not decrease the expression level significantly in the roots, suggesting that the cis-regulatory elements necessary for a high level of gene expression reside in the proximal fragment from -311 to +69. As one striking feature, PmPR10-1.14 promoter contains two copies of direct

  1. Gene promoter of apoptosis inhibitory protein IAP2: identification of enhancer elements and activation by severe hypoxia.

    PubMed Central

    Dong, Zheng; Nishiyama, Junichiro; Yi, Xiaolan; Venkatachalam, Manjeri A; Denton, Michael; Gu, Sumin; Li, Senlin; Qiang, Mei

    2002-01-01

    Inhibitors of apoptosis (IAPs) antagonize cell death and regulate the cell cycle. One mechanism controlling IAP expression is translation initiation through the internal ribosome entry sites. Alternatively, IAP expression can be regulated at the transcription level. We showed recently the activation of IAP2 transcription by severe hypoxia. To pursue this regulation, we have cloned the full-length cDNA of rat IAP2, and have isolated and analysed the promoter regions of this gene. The cDNA encodes a protein of 589 amino acids, exhibiting structural features of IAP. In rat tissues, a major IAP2 transcript of approximately 3.5 kb was detected. We subsequently isolated 3.3 kb of the proximal 5'-flanking regions of this gene, which showed significant promoter activity. Of interest, 5' sequential deletion of the promoter sequence identified an enhancer of approximately 200 bp. Deletion of cAMP-response-element-binding protein (CREB) sites in the enhancer sequence diminished its activity. Finally, the IAP2 gene promoter was activated significantly by severe hypoxia and not by CoCl(2) or desferrioxamine, pharmacological inducers of hypoxia-inducible factor-1. In conclusion, in this study we have cloned the full-length cDNA of rat IAP2, and for the first time we have isolated and analysed promoter sequences of this gene, leading to the identification of enhancer elements. Moreover, we have demonstrated activation of the gene promoter by severe hypoxia, a condition shown to induce IAP2. These findings provide a basis for further investigation of gene regulation of IAP2, a protein with multiple functions. PMID:12023884

  2. The Structural Basis for Promoter −35 Element Recognition by the Group IV σ Factors

    PubMed Central

    Lane, William J; Darst, Seth A

    2006-01-01

    The control of bacterial transcription initiation depends on a primary σ factor for housekeeping functions, as well as alternative σ factors that control regulons in response to environmental stresses. The largest and most diverse subgroup of alternative σ factors, the group IV extracytoplasmic function σ factors, directs the transcription of genes that regulate a wide variety of responses, including envelope stress and pathogenesis. We determined the 2.3-Å resolution crystal structure of the −35 element recognition domain of a group IV σ factor, Escherichia coli σE4, bound to its consensus −35 element, GGAACTT. Despite similar function and secondary structure, the primary and group IV σ factors recognize their −35 elements using distinct mechanisms. Conserved sequence elements of the σE −35 element induce a DNA geometry characteristic of AA/TT-tract DNA, including a rigid, straight double-helical axis and a narrow minor groove. For this reason, the highly conserved AA in the middle of the GGAACTT motif is essential for −35 element recognition by σE4, despite the absence of direct protein–DNA interactions with these DNA bases. These principles of σE4/−35 element recognition can be applied to a wide range of other group IV σ factors. PMID:16903784

  3. Top 10 research questions to promote physical activity research in people with binge eating disorder.

    PubMed

    Vancampfort, Davy; Rosenbaum, Simon; Probst, Michel; Connaughton, Joanne; Du Plessis, Christy; Yamamoto, Taisei; Diedens, Jolien; Stubbs, Brendon

    2016-01-01

    Despite emerging evidence illustrating the benefits of physical activity for people with binge eating disorder, engaging this population in physical activity is challenging. The International Organization of Physical Therapists in Mental Health (IOPTMH) set out to summarize, appraise, and strengthen the direction of physical activity endeavors. This process led to the identification of 10 important research questions which are discussed. Addressing these 10 research questions is critical for developing evidence-based approaches for promoting and sustaining an active lifestyle in people with binge eating disorder. PMID:26694684

  4. Disease-Regulated Gene Therapy with Anti-Inflammatory Interleukin-10 Under the Control of the CXCL10 Promoter for the Treatment of Rheumatoid Arthritis.

    PubMed

    Broeren, Mathijs G A; de Vries, Marieke; Bennink, Miranda B; Arntz, Onno J; Blom, Arjen B; Koenders, Marije I; van Lent, Peter L E M; van der Kraan, Peter M; van den Berg, Wim B; van de Loo, Fons A J

    2016-03-01

    Disease-inducible promoters for the treatment of rheumatoid arthritis (RA) have the potential to provide regulated expression of therapeutic proteins in arthritic joints. In this study, we set out to identify promoters of human genes that are upregulated during RA and are suitable to drive the expression of relevant amounts of anti-inflammatory interleukin (IL)-10. Microarray analysis of RA synovial biopsies compared with healthy controls yielded a list of 22 genes upregulated during RA. Of these genes, CXCL10 showed the highest induction in lipopolysaccharide-stimulated synovial cells. The CXCL10 promoter was obtained from human cDNA and cloned into a lentiviral vector carrying firefly luciferase to determine the promoter inducibility in primary synovial cells and in THP-1 cells. The promoter activation was strongest 8-12 hr after stimulation with the proinflammatory cytokine tumor necrosis factor (TNF)-α and was reinducible after 96 hr. In addition, the CXCL10 promoter showed a significant response to RA patient serum, compared with sera from healthy individuals. The luciferase gene was replaced with IL-10 to determine the therapeutic properties of the CXCL10p-IL10 lentiviral vector. Primary synovial cells transduced with CXCL10p-IL10 showed a great increase in IL-10 production after stimulation, which reduced the release of proinflammatory cytokines TNF-α and IL-1β. We conclude that the selected proximal promoter of the CXCL10 gene responds to inflammatory mediators present in the serum of patients with RA and that transduction with the lentiviral CXCL10p-IL10 vector reduces inflammatory cytokine production by primary synovial cells from patients with RA. CXCL10 promoter-regulated IL-10 overexpression can thus provide disease-inducible local gene therapy suitable for RA.

  5. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes.

    PubMed

    Wang, Peixiang; Liu, Hang; Wang, Yu; Liu, Ou; Zhang, Jing; Gleason, Adenrele; Yang, Zhenrong; Wang, Hui; Shi, Anbing; Grant, Barth D

    2016-06-01

    EHBP-1 (Ehbp1) is a conserved regulator of endocytic recycling, acting as an effector of small GTPases including RAB-10 (Rab10). Here we present evidence that EHBP-1 associates with tubular endosomal phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2] enriched membranes through an N-terminal C2-like (NT-C2) domain, and define residues within the NT-C2 domain that mediate membrane interaction. Furthermore, our results indicate that the EHBP-1 central calponin homology (CH) domain binds to actin microfilaments in a reaction that is stimulated by RAB-10(GTP). Loss of any aspect of this RAB-10/EHBP-1 system in the C. elegans intestinal epithelium leads to retention of basolateral recycling cargo in endosomes that have lost their normal tubular endosomal network (TEN) organization. We propose a mechanism whereby RAB-10 promotes the ability of endosome-bound EHBP-1 to also bind to the actin cytoskeleton, thereby promoting endosomal tubulation. PMID:27272733

  6. RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes

    PubMed Central

    Wang, Yu; Liu, Ou; Zhang, Jing; Gleason, Adenrele; Yang, Zhenrong; Wang, Hui; Shi, Anbing; Grant, Barth D.

    2016-01-01

    EHBP-1 (Ehbp1) is a conserved regulator of endocytic recycling, acting as an effector of small GTPases including RAB-10 (Rab10). Here we present evidence that EHBP-1 associates with tubular endosomal phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2] enriched membranes through an N-terminal C2-like (NT-C2) domain, and define residues within the NT-C2 domain that mediate membrane interaction. Furthermore, our results indicate that the EHBP-1 central calponin homology (CH) domain binds to actin microfilaments in a reaction that is stimulated by RAB-10(GTP). Loss of any aspect of this RAB-10/EHBP-1 system in the C. elegans intestinal epithelium leads to retention of basolateral recycling cargo in endosomes that have lost their normal tubular endosomal network (TEN) organization. We propose a mechanism whereby RAB-10 promotes the ability of endosome-bound EHBP-1 to also bind to the actin cytoskeleton, thereby promoting endosomal tubulation. PMID:27272733

  7. [Identification of the regulation elements in heat-inducible Lehsp23.8 promoter].

    PubMed

    Yi, Shuying; Zhai, Jing; Xu, Hua; Zhang, Yuanying

    2009-06-01

    The promoter of mitochondria-localized small heat shock protein gene in Lycopersicon esculentum (Lehsp23.8) is characterized as strongly heat-inducible. In this study, to determine how the expression of Lehsp23.8 is regulated, we conducted five expression vectors carrying the gus gene driven by the 5' deletion products of the Lehsp23.8 promoter. The corresponding transgenic tobacco plants were generated via Agrobacterium tumefaciens-mediated transformation. Transgenic plants were identified by PCR and Southern blotting analysis. GUS activities under heat-shock conditions were characterized in transgenic tobacco plants. After heat shock, obvious GUS staining was detected in the leaves, shoots, roots, flowers and fruits of the transgenic tobacco plants. The result of fluorometric GUS assays in leaves showed that the heat-induced GUS activity of the 565 bp promoter was the strongest, while that of the 255 bp promoter was the lowest. Deletion analysis shows that the smallest promoter fragment (-255 bp to -23 bp) is sufficient for heat induction. It also indicates that the sequences between -255 bp and -565 bp serve as enhancers, while the sequences between -565 bp and -871 bp can repress the heat-induced activity of the Lehsp23.8 promoter. PMID:19777808

  8. Regulation of gene expression in the protozoan parasite Entamoeba invadens: identification of core promoter elements and promoters with stage-specific expression patterns.

    PubMed

    Manna, Dipak; Ehrenkaufer, Gretchen M; Singh, Upinder

    2014-10-01

    Developmental switching between life-cycle stages is a common feature among many pathogenic organisms. Entamoeba histolytica is an important human pathogen and is a leading parasitic cause of death globally. During its life cycle, Entamoeba converts between cysts (essential for disease transmission) and trophozoites (responsible for tissue invasion). Despite being central to its biology, the triggers that are involved in the developmental pathways of this parasite are not well understood. In order to define the transcriptional network associated with stage conversion we used Entamoeba invadens which serves as a model system for Entamoeba developmental biology, and performed RNA sequencing at different developmental time points. In this study RNA-Seq data was utilised to define basal transcriptional control elements as well as to identify promoters which regulate stage-specific gene expression patterns. We discovered that the 5' and 3' untranslated regions of E. invadens genes are short, a median of 20 nucleotides (nt) and 26 nt respectively. Bioinformatics analysis of DNA sequences proximate to the start and stop codons identified two conserved motifs: (i) E. invadens Core Promoter Motif - GAAC-Like (EiCPM-GL) (GAACTACAAA), and (ii) E. invadens 3'-U-Rich Motif (Ei3'-URM) (TTTGTT) in the 5' and 3' flanking regions, respectively. Electrophoretic mobility shift assays demonstrated that both motifs specifically bind nuclear protein(s) from E. invadens trophozoites. Additionally, we identified select genes with stage-specific expression patterns and analysed the ability of each gene promoter to drive a luciferase reporter gene during the developmental cycle. This approach confirmed three trophozoite-specific, four encystation-specific and two excystation-specific promoters. This work lays the framework for use of stage-specific promoters to express proteins of interest in a particular life-cycle stage, adding to the molecular toolbox for genetic manipulation of E

  9. Monoallelic Loss of the Imprinted Gene Grb10 Promotes Tumor Formation in Irradiated Nf1+/- Mice

    PubMed Central

    Mroue, Rana; Huang, Brian; Braunstein, Steve; Firestone, Ari J.; Nakamura, Jean L.

    2015-01-01

    Imprinted genes are expressed from only one parental allele and heterozygous loss involving the expressed allele is sufficient to produce complete loss of protein expression. Genetic alterations are common in tumorigenesis but the role of imprinted genes in this process is not well understood. In earlier work we mutagenized mice heterozygous for the Neurofibromatosis I tumor suppressor gene (NF1) to model radiotherapy-associated second malignant neoplasms that arise in irradiated NF1 patients. Expression analysis of tumor cell lines established from our mouse models identified Grb10 expression as widely absent. Grb10 is an imprinted gene and polymorphism analysis of cell lines and primary tumors demonstrates that the expressed allele is commonly lost in diverse Nf1 mutant tumors arising in our mouse models. We performed functional studies to test whether Grb10 restoration or loss alter fundamental features of the tumor growth. Restoring Grb10 in Nf1 mutant tumors decreases proliferation, decreases soft agar colony formation and downregulates Ras signaling. Conversely, Grb10 silencing in untransformed mouse embryo fibroblasts significantly increased cell proliferation and increased Ras-GTP levels. Expression of a constitutively activated MEK rescued tumor cells from Grb10-mediated reduction in colony formation. These studies reveal that Grb10 loss can occur during in vivo tumorigenesis, with a functional consequence in untransformed primary cells. In tumors, Grb10 loss independently promotes Ras pathway hyperactivation, which promotes hyperproliferation, an early feature of tumor development. In the context of a robust Nf1 mutant mouse model of cancer this work identifies a novel role for an imprinted gene in tumorigenesis. PMID:26000738

  10. Invariant TAD Boundaries Constrain Cell-Type-Specific Looping Interactions between Promoters and Distal Elements around the CFTR Locus

    PubMed Central

    Smith, Emily M.; Lajoie, Bryan R.; Jain, Gaurav; Dekker, Job

    2016-01-01

    Three-dimensional genome structure plays an important role in gene regulation. Globally, chromosomes are organized into active and inactive compartments while, at the gene level, looping interactions connect promoters to regulatory elements. Topologically associating domains (TADs), typically several hundred kilobases in size, form an intermediate level of organization. Major questions include how TADs are formed and how they are related to looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb chromosome 7 region surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Furthermore, we find that these TAD boundaries are present irrespective of the expression and looping of genes located between them. In contrast, looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell-type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected, but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell-type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell-type-specific long-range interactions and gene regulation. PMID:26748519

  11. Invariant TAD Boundaries Constrain Cell-Type-Specific Looping Interactions between Promoters and Distal Elements around the CFTR Locus.

    PubMed

    Smith, Emily M; Lajoie, Bryan R; Jain, Gaurav; Dekker, Job

    2016-01-01

    Three-dimensional genome structure plays an important role in gene regulation. Globally, chromosomes are organized into active and inactive compartments while, at the gene level, looping interactions connect promoters to regulatory elements. Topologically associating domains (TADs), typically several hundred kilobases in size, form an intermediate level of organization. Major questions include how TADs are formed and how they are related to looping interactions between genes and regulatory elements. Here we performed a focused 5C analysis of a 2.8 Mb chromosome 7 region surrounding CFTR in a panel of cell types. We find that the same TAD boundaries are present in all cell types, indicating that TADs represent a universal chromosome architecture. Furthermore, we find that these TAD boundaries are present irrespective of the expression and looping of genes located between them. In contrast, looping interactions between promoters and regulatory elements are cell-type specific and occur mostly within TADs. This is exemplified by the CFTR promoter that in different cell types interacts with distinct sets of distal cell-type-specific regulatory elements that are all located within the same TAD. Finally, we find that long-range associations between loci located in different TADs are also detected, but these display much lower interaction frequencies than looping interactions within TADs. Interestingly, interactions between TADs are also highly cell-type-specific and often involve loci clustered around TAD boundaries. These data point to key roles of invariant TAD boundaries in constraining as well as mediating cell-type-specific long-range interactions and gene regulation. PMID:26748519

  12. Multiple Promoter Elements Contribute to Activity of the Follicle-Stimulating Hormone Receptor (FSHR) Gene in Testicular Sertoli Cells

    PubMed Central

    Heckert, Leslie L.; Daggett, Melissa A. F.; Chen, Jiangkai

    2006-01-01

    The FSH receptor (FSHR) is expressed only in granulosa cells of the ovary and Sertoli cells of the testis. This highly specific pattern of gene expression asserts that transcriptional events unique to these two cell types are responsible for activation of the FSHR gene. We have characterized the promoter elements required for activity of the rat FSHR gene in a Sertoli cell line MSC-1, primary cultures of rat Sertoli cells, and two non-Sertoli cell lines. Transient transfection analysis of deletion and block replacement mutants identified several elements, both 5′ and 3′ to the transcriptional start sites, that are essential for full promoter activity in Sertoli cells. These studies confirmed the use of an important E box element (CACGTG), which had the single greatest impact on promoter function. Bases within the core CACGTG of the E box, as well as flanking sequences, were shown to be essential for its function. Electrophoretic mobility shift assays identified both upstream stimulatory factor 1 (USF1) and USF2 as primary components of the complexes binding the E box. Sequence requirements for USF binding in vitro modestly diverged from the sequence requirements for in vivo function of the element. Comparison of the E box binding proteins in different cell types revealed that similar proteins bind the E box in Sertoli and non-Sertoli cell lines. Extracts from primary cultures of rat and mouse Sertoli cells have a second E box-binding complex that cross-reacts with USF antibodies that is not present in the cell lines. PMID:9773974

  13. Molecular structure of the chicken vitamin D-induced calbindin-D28K gene reveals eleven exons, six Ca2+-binding domains, and numerous promoter regulatory elements.

    PubMed

    Minghetti, P P; Cancela, L; Fujisawa, Y; Theofan, G; Norman, A W

    1988-04-01

    The seco-steroid hormone 1,25-dihydroxyvitamin D3 is known to induce the expression of a calcium binding protein termed calbindin-D28K in a variety of target tissues. In order to comprehend the mechanism of induction we have cloned and sequenced the chicken calbindin-D28K gene. The gene spans some 18.5 kilobases (kb) of chromosomal DNA from the putative Cap site to the polyadenylation site of the 2.8 kb mRNA. It is split into 11 coding exons by 10 intervening sequences. The promoter region of this gene is markedly G + C-rich (60-80%) extending from -225 to +400. Within this region we find 70 CpG dinucleotides, four G-C boxes, and numerous known promoter regulatory signals. These putative regulatory signals include a TATA box (ATAAATA) at -30 and a CAT box (CCAAT) at -326. Ten additional variant CAT boxes are found in the upstream promoter region (-218 to -770) of this gene. Furthermore we have identified a glucocorticoid-like responsive element at -410 (TCTACACACTGTTCC) and this element overlaps a metal responsive element (TGCACTC) and a variant CAT box (CCAAAT) and juxtaposes an enhancer-like core element (AAATGGT) on its 3'-side. In addition, the calbindin-D28K promoter is composed of a variety of simple repeated sequences, some of which are components of putative regulatory signals. All splice junctions were found to conform to the GT-AG rule. A consensus sequence of the 5'-splice junction reads AG/GTAAG-TTATA. A consensus sequence of the 3'-splice site consists of two elements: a pyrimidine track (mainly T) followed by ACAG/G-T. A two-dimensional model of calbindin-D28K was constructed which projects the existence of 6 alpha-helix-loop-alpha-helix regions characteristic of calcium binding domains. The 3'-end of the gene consists of a single large (2039 base pair) uninterrupted exon, an organizational feature common to other members of the calcium binding protein gene family which include calmodulin, parvalbumin, Spec I, myosin light chains, etc. Another feature

  14. Investigation of Radar Propagation in Buildings: A 10 Billion Element Cartesian-Mesh FETD Simulation

    SciTech Connect

    Stowell, M L; Fasenfest, B J; White, D A

    2008-01-14

    In this paper large scale full-wave simulations are performed to investigate radar wave propagation inside buildings. In principle, a radar system combined with sophisticated numerical methods for inverse problems can be used to determine the internal structure of a building. The composition of the walls (cinder block, re-bar) may effect the propagation of the radar waves in a complicated manner. In order to provide a benchmark solution of radar propagation in buildings, including the effects of typical cinder block and re-bar, we performed large scale full wave simulations using a Finite Element Time Domain (FETD) method. This particular FETD implementation is tuned for the special case of an orthogonal Cartesian mesh and hence resembles FDTD in accuracy and efficiency. The method was implemented on a general-purpose massively parallel computer. In this paper we briefly describe the radar propagation problem, the FETD implementation, and we present results of simulations that used over 10 billion elements.

  15. Functional cooperation between GATA factors and cJUN on the star promoter in MA-10 Leydig cells.

    PubMed

    Martin, Luc J; Bergeron, Francis; Viger, Robert S; Tremblay, Jacques J

    2012-01-01

    Steroid hormone biosynthesis requires the steroidogenic acute regulatory protein (STAR). STAR is part of a protein complex that transports cholesterol through the mitochondrial membrane where steroidogenesis begins. Several transcription factors participate to direct the proper spatiotemporal and hormonal regulation of the Star gene in Leydig cells. Mechanistically, this is believed to involve the functional interplay between many of these factors. Here we report a novel transcriptional cooperation between GATA factors and cJUN on the mouse Star and human STAR promoters in MA-10 Leydig cells. This cooperation was observed with different GATA members (GATA1, 4, and 6), whereas only cJUN could cooperate with GATA factors. GATA/cJUN transcriptional cooperation on the Star promoter is mediated via closely juxtaposed GATA and AP-1 binding motifs. Mutation of all functional GATA and cJUN elements abolished GATA/cJUN cooperation, which is in agreement with previous data reporting a direct interaction between GATA4 and cJUN in a heterologous system. These data add valuable new insights that further define the molecular mechanisms that govern Star transcription in steroidogenic cells of the testis.

  16. ACC interleukin-10 gene promoter haplotype as a breast cancer risk factor predictor among Jordanian females

    PubMed Central

    Atoum, Manar Fayiz

    2016-01-01

    Introduction Interleukin-10 (IL-10) is a multifactorial cytokine with a complex biological role in breast cancer. The aims of this study were to investigate any association between IL-10 gene promoter polymorphisms, 1082A>/G, −819T>C, and −592A>C, or haplotypes and breast cancer risk among Jordanian women and to evaluate any association between the most common haplotype with clinicopathological features of breast cancer. Patients and methods A total of 202 breast cancer patients and 210 age-matched healthy control subjects were genotyped for −1082A/G, −819T/C, and −592A/C single nucleotide polymorphisms in the promoter region of the IL-10 gene by polymerase chain reaction-restriction fragment length polymorphism. Study patients and control subjects were recruited from Prince Hamzah Hospital, Amman, Jordan (2012–2013). Ethical approval and signed consent forms were signed by all participants. DNA was extracted, and polymerase chain reaction fragments were amplified and restriction digested by MnII, MaeIII, and RsaI. Results This study showed no statistically significant difference between −1082A/G, −819T/C, and −592A/C IL-10 genotypes or alleles among breast cancer patients or controls. Four different haplotypes ATA, ACC, GTA, and ACA within the IL-10 promoter gene were determined among both breast cancer and control groups. The most frequent haplotype was ACC among breast cancer patients and controls (41.6% and 40.7%, respectively). No statistical differences in these haplotypes among breast cancer patients or controls were determined. Analysis of the most common ACC haplotype showed statistical difference in positive estrogen receptor (P=0.022), positive progesterone receptor (P=0.004), cancer grade (P=0.0001), and cancer stage (P=0.009) among the ACC haplotype compared to non-ACC haplotype. Conclusion To our knowledge, this is the first report studying the association of IL-10 haplotype with breast cancer risk events among Jordanian females. The

  17. The Calponin Family Member CHDP-1 Interacts with Rac/CED-10 to Promote Cell Protrusions

    PubMed Central

    Zhang, Jingyan; Liu, Jia-Jia; Wang, Yingchun; Ding, Mei

    2016-01-01

    Eukaryotic cells extend a variety of surface protrusions to direct cell motility. Formation of protrusions is mediated by coordinated actions between the plasma membrane and the underlying actin cytoskeleton. Here, we found that the single calponin homology (CH) domain-containing protein CHDP-1 induces the formation of cell protrusions in C. elegans. CHDP-1 is anchored to the cortex through its amphipathic helix. CHDP-1 associates through its CH domain with the small GTPase Rac1/CED-10, which is a key regulator of the actin cytoskeleton. CHDP-1 preferentially binds to the GTP-bound active form of the CED-10 protein and preserves the membrane localization of GTP-CED-10. Hence, by coupling membrane expansion to Rac1-mediated actin dynamics, CHDP-1 promotes the formation of cellular protrusions in vivo. PMID:27415421

  18. The Calponin Family Member CHDP-1 Interacts with Rac/CED-10 to Promote Cell Protrusions.

    PubMed

    Guan, Liying; Ma, Xuehua; Zhang, Jingyan; Liu, Jia-Jia; Wang, Yingchun; Ding, Mei

    2016-07-01

    Eukaryotic cells extend a variety of surface protrusions to direct cell motility. Formation of protrusions is mediated by coordinated actions between the plasma membrane and the underlying actin cytoskeleton. Here, we found that the single calponin homology (CH) domain-containing protein CHDP-1 induces the formation of cell protrusions in C. elegans. CHDP-1 is anchored to the cortex through its amphipathic helix. CHDP-1 associates through its CH domain with the small GTPase Rac1/CED-10, which is a key regulator of the actin cytoskeleton. CHDP-1 preferentially binds to the GTP-bound active form of the CED-10 protein and preserves the membrane localization of GTP-CED-10. Hence, by coupling membrane expansion to Rac1-mediated actin dynamics, CHDP-1 promotes the formation of cellular protrusions in vivo. PMID:27415421

  19. Wnt-10b, uniquely among Wnts, promotes epithelial differentiation and shaft growth

    SciTech Connect

    Ouji, Yukiteru Yoshikawa, Masahide; Moriya, Kei; Nishiofuku, Mariko; Matsuda, Ryosuke; Ishizaka, Shigeaki

    2008-03-07

    Although Wnts are expressed in hair follicles throughout life from embryo to adult, and considered to be critical for their development and maturation, their roles remain largely unknown. In the present study, we investigated the effects of Wnts (Wnt-3a, Wnt-5a, Wnt-10b, and Wnt-11) on epithelial cell differentiation using adult mouse-derived primary skin epithelial cell (MPSEC) cultures and hair growth using hair follicle organ cultures. Only Wnt-10b showed evident promotion of epithelial cell differentiation and hair shaft growth, in contrast to Wnt-3a, 5a, and 11. Our results suggest that Wnt-10b is unique and plays an important role in differentiation of epithelial cells in the hair follicle.

  20. Combined probiotic bacteria promotes intestinal epithelial barrier function in interleukin-10-gene-deficient mice

    PubMed Central

    Shi, Chen-Zhang; Chen, Hong-Qi; Liang, Yong; Xia, Yang; Yang, Yong-Zhi; Yang, Jun; Zhang, Jun-Dong; Wang, Shu-Hai; Liu, Jing; Qin, Huan-Long

    2014-01-01

    AIM: To investigate the protective effects of combinations of probiotic (Bifico) on interleukin (IL)-10-gene-deficient (IL-10 KO) mice and Caco-2 cell monolayers. METHODS: IL-10 KO mice were used to assess the benefits of Bifico in vivo. IL-10 KO and control mice received approximately 1.5 × 108 cfu/d of Bifico for 4 wk. Colons were then removed and analyzed for epithelial barrier function by Ussing Chamber, while an ELISA was used to evaluate proinflammatory cytokines. The colon epithelial cell line, Caco-2, was used to test the benefit of Bifico in vitro. Enteroinvasive Escherichia coli (EIEC) and the probiotic mixture Bifico, or single probiotic strains, were applied to cultured Caco-2 monolayers. Barrier function was determined by measuring transepithelial electrical resistance and tight junction protein expression. RESULTS: Treatment of IL-10 KO mice with Bifico partially restored body weight, colon length, and epithelial barrier integrity to wild-type levels. In addition, IL-10 KO mice receiving Bifico treatment had reduced mucosal secretion of tumor necrosis factor-α and interferon-γ, and attenuated colonic disease. Moreover, treatment of Caco-2 monolayers with Bifico or single-strain probiotics in vitro inhibited EIEC invasion and reduced the secretion of proinflammatory cytokines. CONCLUSION: Bifico reduced colon inflammation in IL-10 KO mice, and promoted and improved epithelial-barrier function, enhanced resistance to EIEC invasion, and decreased proinflammatory cytokine secretion. PMID:24782616

  1. SIRT1 gene expression upon genotoxic damage is regulated by APE1 through nCaRE-promoter elements

    PubMed Central

    Antoniali, Giulia; Lirussi, Lisa; D'Ambrosio, Chiara; Dal Piaz, Fabrizio; Vascotto, Carlo; Casarano, Elena; Marasco, Daniela; Scaloni, Andrea; Fogolari, Federico; Tell, Gianluca

    2014-01-01

    Apurinic/apyrimidinic endonuclease 1 (APE1) is a multifunctional protein contributing to genome stability via repair of DNA lesions via the base excision repair pathway. It also plays a role in gene expression regulation and RNA metabolism. Another, poorly characterized function is its ability to bind to negative calcium responsive elements (nCaRE) of some gene promoters. The presence of many functional nCaRE sequences regulating gene transcription can be envisioned, given their conservation within ALU repeats. To look for functional nCaRE sequences within the human genome, we performed bioinformatic analyses and identified 57 genes potentially regulated by APE1. We focused on sirtuin-1 (SIRT1) deacetylase due to its involvement in cell stress, including senescence, apoptosis, and tumorigenesis, and its role in the deacetylation of APE1 after genotoxic stress. The human SIRT1 promoter presents two nCaRE elements stably bound by APE1 through its N-terminus. We demonstrate that APE1 is part of a multiprotein complex including hOGG1, Ku70, and RNA Pol II, which is recruited on SIRT1 promoter to regulate SIRT1 gene functions during early response to oxidative stress. These findings provide new insights into the role of nCaRE sequences in the transcriptional regulation of mammalian genes. PMID:24356447

  2. Synthetic promoters consisting of defined cis-acting elements link multiple signaling pathways to probenazole-inducible system * #

    PubMed Central

    Zhu, Zheng; Gao, Jiong; Yang, Jin-xiao; Wang, Xiao-yan; Ren, Guo-dong; Ding, Yu-long; Kuai, Ben-ke

    2015-01-01

    Probenazole (3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ), the active component of Oryzemate, could induce systemic acquired resistance (SAR) in plants through the induction of salicylic acid (SA) biosynthesis. As a widely used chemical inducer, PBZ is a good prospect for establishing a new chemical-inducible system. We first designed artificially synthetic promoters with tandem copies of a single type of cis-element (SARE, JERE, GCC, GST1, HSRE, and W-box) that could mediate the expression of the β-glucuronidase (GUS) reporter gene in plants upon PBZ treatment. Then we combined different types of elements in order to improve inducibility in the PBZ-inducible system. On the other hand, we were surprised to find that the cis-elements, which are responsive to jasmonic acid (JA) and ethylene, also responded to PBZ, implying that SA, JA, and ethylene pathways also would play important roles in PBZ’s action. Further analysis demonstrated that PBZ also induced early events of innate immunity via a signaling pathway in which Ca2+ influx and mitogen-activated protein kinase (MAPK) activity were involved. We constructed synthesized artificial promoters to establish a PBZ chemical-inducible system, and preliminarily explored SA, JA, ethylene, calcium, and MAPK signaling pathways via PBZ-inducible system, which could provide an insight for in-depth study. PMID:25845359

  3. Fatty acid activated PPARγ promotes tumorigenicity of prostate cancer cells by up regulating VEGF via PPAR responsive elements of the promoter

    PubMed Central

    Forootan, Farzad S.; Forootan, Shiva S.; Gou, Xiaojun; Yang, Jin; Liu, Bichong; Chen, Danqing; Fayi, Majed Saad Al; Al-Jameel, Waseem; Rudland, Philip S.; Hussain, Syed A.; Ke, Youqiang

    2016-01-01

    In previous work, it is suggested that the excessive amount of fatty acids transported by FABP5 may facilitate the malignant progression of prostate cancer cells through a FABP5-PPARγ-VEGF signal transduction axis to increase angiogenesis. To further functionally characterise the FABP5-PPARγ-VEGF signal transduction pathway, we have, in this work, investigated the molecular mechanisms involved in its tumorigenicity promoting role in prostate cancer. Suppression of PPARγ in highly malignant prostate cancer cells produced a significant reduction (up to 53%) in their proliferation rate, invasiveness (up to 89%) and anchorage-independent growth (up to 94%) in vitro. Knockdown of PPARγ gene in PC3-M cells by siRNA significantly reduced the average size of tumours formed in nude mice by 99% and tumour incidence by 90%, and significantly prolonged the latent period by 3.5 fold. Results in this study combined with some previous results suggested that FABP5 promoted VEGF expression and angiogenesis through PPARγ which was activated by fatty acids transported by FABP5. Further investigations showed that PPARγ up-regulated VEGF expression through acting with the PPAR-responsive elements in the promoter region of VEGF gene in prostate cancer cells. Although androgen can modulate VEGF expression through Sp1/Sp3 binding site on VEGF promoter in androgen-dependent prostate cancer cells, this route, disappeared as the cells gradually lost their androgen dependency; was replaced by the FABP5-PPARγ-VEGF signalling pathway. These results suggested that the FABP5-PPARγ-VEGF signal transduction axis, rather than androgen modulated route, may be a more important novel therapeutic target for angiogenesis-suppression treatment of castration resistant prostate cancer. PMID:26814431

  4. Residential indoor PM 10 and PM 2.5 in Hong Kong and the elemental composition

    NASA Astrophysics Data System (ADS)

    Chao, Christopher Y.; Wong, Kelvin K.

    Indoor air particulate samples were collected in 34 homes and their adjacent outdoor environments in Hong Kong during the fall and winter seasons. It was found that the mean indoor PM 2.5 and PM 10 concentrations were 45.0 and 63.3 μg m -3, respectively. The corresponding mean outdoor levels were 47.0 and 69.5 μg m -3, respectively. The indoor particulate levels were found to be about 2-4 times higher than those in the homes in western countries where most are located in suburb areas with a much better ambient air quality. Pearson paired t-tests were conducted on the data and it was found that poor correlation was seen in the indoor and the outdoor particulate concentrations. This was probably due to the fact that windows were closed more often in the fall and winter seasons keeping the ventilation rate low, plus the factor that window type air conditioners were used commonly in Hong Kong, which again, constituted to a low air change rate. Both the indoor and the outdoor elemental compositions of the particulate samples collected in these 34 homes were identified by proton-induced X-ray emission analysis. Seventeen elements were identified. The mean inorganic elemental compositions in the indoor PM 2.5 and PM 10 samples were 6.4 and 10.2 μg m -3, respectively while those in the outdoor samples were 7.9 and 14.1 μg m -3, respectively. Enrichment factor analysis was performed and it was noted that those species existing in fine mode were highly enriched (bromine, lead, nickel, potassium, sulfur, vanadium and zinc) while those species existing in the coarse mode had their enrichment factors close to 1 (aluminum, calcium, iron, magnesium, silicon, sodium and titanium).

  5. Promoting Connectedness through Whole-School Approaches: Key Elements and Pathways of Influence

    ERIC Educational Resources Information Center

    Rowe, Fiona; Stewart, Donald

    2011-01-01

    Purpose: A comprehensive whole-school approach has emerged as a promising model for building connectedness in the school setting. The health-promoting school model, through its whole-school orientation and attention to the school organizational environment, identifies structures and processes that influence school connectedness. This paper aims to…

  6. Promoting the Essential Elements of 4-H Youth Development through an Experiential Learning Model

    ERIC Educational Resources Information Center

    Meyer, Shelley; Jones, Kenneth R.

    2015-01-01

    The purpose of the project reported here was to apply Experiential Learning Theory to a context involving middle and high school aged youth while assessing the four concepts (belonging, mastery, independence, and generosity) in relation to the 4-H youth development essential elements. The conclusions of the project's evaluation suggest…

  7. Lactase persistence DNA variant enhances lactase promoter activity in vitro: functional role as a cis regulatory element.

    PubMed

    Olds, Lynne C; Sibley, Eric

    2003-09-15

    Lactase persistence is a heritable, autosomal dominant, condition that results in a sustained ability to digest the milk sugar lactose throughout adulthood. The majority of the world's human population experiences a decline in production of the digestive enzyme lactase-phlorizin hydrolase during maturation. However, individuals with lactase persistence continue to express high levels of the lactase gene into adulthood. Lactase persistence has been strongly correlated with single nucleotide genetic variants, C/T_(13910) and G/A_(22018), located 13.9 and 22 kb upstream from the lactase structural gene. We aimed to characterize a functional role for the polymorphisms in regulating lactase gene transcription. DNA in the region of the C/T_(13910) or G/A_(22018) human lactase variants was cloned upstream of the 3.0 kb rat lactase gene promoter in a luciferase reporter construct. Human intestinal Caco-2 cells were transfected with the lactase variant/promoter-reporter constructs and assayed for promoter activity. A 200 bp region surrounding the C_(13910) variant, associated with lactase non-persistence, results in a 2.2-fold increase in lactase promoter activity. The T_(13910) variant, associated with lactase persistence, results in an even greater 2.8-fold increase. The DNA sequence of the C/T_(13910) variants differentially interacts with intestinal cell nuclear proteins on EMSAs. AP2 co-transfection results in a similar repression of the C/T_(13910) variant/promoter-reporter constructs. The DNA region of the C/T_(13910) lactase persistence/non-persistence variant functions in vitro as a cis element capable of enhancing differential transcriptional activation of the lactase promoter. Such differential regulation by the C and T variants is consistent with a causative role in the mechanism specifying the lactase persistence/non-persistence phenotypes in humans.

  8. A human cytomegalovirus early promoter with upstream negative and positive cis-acting elements: IE2 negates the effect of the negative element, and NF-Y binds to the positive element.

    PubMed Central

    Huang, L; Malone, C L; Stinski, M F

    1994-01-01

    The human cytomegalovirus early promoter for the UL4 gene, which codes for an early viral envelope glycoprotein designated gpUL4, requires immediate-early viral protein two (IE2) synthesis to be activated (C.-P. Chang, C. L. Malone, and M. F. Stinski, J. Virol. 63:281, 1989). We investigated the cis-acting and trans-acting factors that regulate transcription from this UL4 promoter. In transient transfection assays, the viral IE2 protein negated the effect of an upstream cis-acting negative element and enhanced downstream gene expression. A cis-acting positive element contributed to the activity of the viral promoter when an upstream cis-acting negative element was deleted or when the viral IE2 protein was present. The cellular protein(s) that binds to the cis-acting negative element requires further investigation. The cellular protein that binds to the cis-acting positive element was characterized. Two DNA sequence-specific protein complexes were detected with DNA probes spanning the region containing the cis-acting positive element and human cytomegalovirus-infected human fibroblast cell nuclear extracts. The more slowly migrating complex was labeled complex A, and the faster was labeled complex B. Only complex B was detected with mock-infected cell nuclear extracts. Competition experiments confirmed the specificity of the A and B complexes. The protein bound to the DNA in both the complexes contacts a CCAAT box imperfect dyad symmetry (5'CCAATCACTGG3'). Either CCAAT box within the dyad symmetry could compete for binding the nuclear factor. Mutation of the CCAAT box dyad symmetry resulted in a decrease of the transcriptional activity from the UL4 promoter. A cellular transcription factor, antigenically related to nuclear factor-Y (NF-Y), was found in both complexes A and B. Events associated with viral infection caused phosphorylation of protein complex A. Dephosphorylation of the DNA-binding protein converts complex A to complex B. The effect of phosphorylation

  9. Altering genomic integrity: heavy metal exposure promotes trans-posable element-mediated damage

    PubMed Central

    Morales, Maria E.; Servant, Geraldine; Ade, Catherine; Roy-Enge, Astrid M.

    2015-01-01

    Maintenance of genomic integrity is critical for cellular homeostasis and survival. The active transposable elements (TEs) composed primarily of three mobile element lineages LINE-1, Alu, and SVA comprise approximately 30% of the mass of the human genome. For the past two decades, studies have shown that TEs significantly contribute to genetic instability and that TE-caused damages are associated with genetic diseases and cancer. Different environmental exposures, including several heavy metals, influence how TEs interact with its host genome increasing their negative impact. This mini-review provides some basic knowledge on TEs, their contribution to disease and an overview of the current knowledge on how heavy metals influence TE-mediated damage. PMID:25774044

  10. MicroRNA-191 promotes pancreatic cancer progression by targeting USP10.

    PubMed

    Liu, Hua; Xu, Xuan-Fu; Zhao, Yan; Tang, Mao-Chun; Zhou, Ying-Qun; Lu, Jie; Gao, Feng-Hou

    2014-12-01

    Recent studies have shown that microRNAs, a class of small and noncoding RNA molecules, play crucial roles in the initiation and progression of pancreatic cancer. In the present study, the expression and roles of miR-191 were investigated. Through both gain-of function and loss-of function experiments, a pro-oncogenic function of miR-191 was demonstrated. At the molecular level, bioinformatic prediction, luciferase, and protein expression analysis suggested that miR-191 could inhibit protein levels of UPS10, which suppressed the proliferation and growth of cancer cells through stabilizing P53 protein. Collectively, these data suggest that miR-191 could promote pancreatic cancer progression through targeting USP10, implicating a novel mechanism for the tumorigenesis.

  11. Promoter Variants of the ADAM10 Gene and Their Roles in Temporal Lobe Epilepsy

    PubMed Central

    Tao, Hua; Zhao, Jianghao; Zhou, Xu; Ma, Zhonghua; Chen, Ying; Sun, Fuhai; Cui, Lili; Zhou, Haihong; Cai, Yujie; Chen, Yanyan; Zhao, Shu; Yao, Lifen; Zhao, Bin; Li, Keshen

    2016-01-01

    Previous evidence has indicated that downregulated ADAM10 gives rise to epileptic seizures in Alzheimer’s disease, and this study investigated the association of ADAM10 with temporal lobe epilepsy (TLE) from a genetic perspective. A total of 496 TLE patients and 528 healthy individuals were enrolled and genotyped for ADAM10 promoter variants (rs653765 G > A and rs514049 A > C). The alleles, genotypes, and haplotypes were then compared with clarify the association of these variants with TLE and their impacts upon age at onset, initial seizure types before treatments, and responses to drug treatments. In cohorts I, II, and I + II, the frequencies of the A allele and AA genotype at rs514049 were consistently increased in the cases compared with the controls (p = 0.020 and p = 0.009; p = 0.008 and p = 0.009; p = 0.000 and p = 0.000; q = 0.003 and q = 0.002, respectively). In contrast, the frequency of the AC haplotype (rs653765–rs514049) decreased in cohorts I + II (p = 0.013). Further analyses of the TLE patients indicated that the AA genotype functioned as a predisposing factor to drug-resistant TLE and the AC haplotype as a protective factor against generalized tonic–clonic seizures (GTCS) and drug-resistant TLE. This study is the first to demonstrate an association of the ADAM10 promoter variants with TLE. In particular, the AA genotype and AC haplotype showed their effects upon GTCS and drug-resistant TLE. PMID:27445971

  12. SWI/SNF enzymes promote SOX10- mediated activation of myelin gene expression.

    PubMed

    Marathe, Himangi G; Mehta, Gaurav; Zhang, Xiaolu; Datar, Ila; Mehrotra, Aanchal; Yeung, Kam C; de la Serna, Ivana L

    2013-01-01

    SOX10 is a Sry-related high mobility (HMG)-box transcriptional regulator that promotes differentiation of neural crest precursors into Schwann cells, oligodendrocytes, and melanocytes. Myelin, formed by Schwann cells in the peripheral nervous system, is essential for propagation of nerve impulses. SWI/SNF complexes are ATP dependent chromatin remodeling enzymes that are critical for cellular differentiation. It was recently demonstrated that the BRG1 subunit of SWI/SNF complexes activates SOX10 expression and also interacts with SOX10 to activate expression of OCT6 and KROX20, two transcriptional regulators of Schwann cell differentiation. To determine the requirement for SWI/SNF enzymes in the regulation of genes that encode components of myelin, which are downstream of these transcriptional regulators, we introduced SOX10 into fibroblasts that inducibly express dominant negative versions of the SWI/SNF ATPases, BRM or BRG1. Dominant negative BRM and BRG1 have mutations in the ATP binding site and inhibit gene activation events that require SWI/SNF function. Ectopic expression of SOX10 in cells derived from NIH 3T3 fibroblasts led to the activation of the endogenous Schwann cell specific gene, myelin protein zero (MPZ) and the gene that encodes myelin basic protein (MBP). Thus, SOX10 reprogrammed these cells into myelin gene expressing cells. Ectopic expression of KROX20 was not sufficient for activation of these myelin genes. However, KROX20 together with SOX10 synergistically activated MPZ and MBP expression. Dominant negative BRM and BRG1 abrogated SOX10 mediated activation of MPZ and MBP and synergistic activation of these genes by SOX10 and KROX20. SOX10 was required to recruit BRG1 to the MPZ locus. Similarly, in immortalized Schwann cells, BRG1 recruitment to SOX10 binding sites at the MPZ locus was dependent on SOX10 and expression of dominant negative BRG1 inhibited expression of MPZ and MBP in these cells. Thus, SWI/SNF enzymes cooperate with SOX10 to

  13. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences.

    PubMed Central

    Ch'ang, L Y; Yang, W K; Myer, F E; Yang, D M

    1989-01-01

    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenicol acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base-pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-bp inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs of the enhancer segment as well as the upstream LTR sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression. Further analyses using chimeric LTR constructs located the presence of a strong negative regulatory element within the region containing the 5' portion of the enhancer and the immediate upstream sequences in the MuLV-related LTRs. Images PMID:2542587

  14. The developmental activation of the chicken lysozyme locus in transgenic mice requires the interaction of a subset of enhancer elements with the promoter.

    PubMed Central

    Huber, M C; Jägle, U; Krüger, G; Bonifer, C

    1997-01-01

    The complete chicken lysozyme locus is expressed in a position independent fashion in macrophages of transgenic mice and forms the identical chromatin structure as observed with the endogenous gene in chicken cells. Individual lysozyme cis -regulatory elements reorganize their chromatin structure at different developmental stages. Accordingly, their activities are developmentally regulated, indicating a differential role of these elements in locus activation. We have shown previously that a subset of enhancer elements and the promoter are sufficient to activate transcription of the chicken lysozyme gene at the correct developmental stage. Here, we analyzed to which grade the developmentally controlled chromatin reorganizing capacity of cis -regulatory elements in the 5'-region of the chicken lysozyme locus is dependent on promoter elements, and we examined whether the lysozyme locus carries a dominant chromatin reorganizing element. To this end we generated transgenic mouse lines carrying constructs with a deletion of the lysozyme promoter. Expression of the transgene in macrophages is abolished, however, the chromatin reorganizing ability of the cis -regulatory elements is differentially impaired. Some cis -elements require the interaction with the promoter to stabilize transcription factor complexes detectable as DNase I hypersensitive sites in chromatin, whereas other elements reorganize their chromatin structure autonomously. PMID:9224598

  15. Roles of salicylic acid-responsive cis-acting elements and W-boxes in salicylic acid induction of VCH3 promoter in transgenic tobaccos.

    PubMed

    Li, Hai-Yan; Wei, Wei; Li, Yu

    2006-01-01

    A salicylic acid (SA)-inducible VCH3 promoter was recently identified from grapevine (Vitis amurensis) that contains two inverse SA-responsive cis-acting elements and four W-boxes. To further demonstrate the roles of these elements, four fragments with lengths from -1187, -892, -589, -276 to +7 bp were fused with the b-glucuronidase (GUS) reporter gene and transferred to Nicotiana tobacum, together with another four VCH3 promoter fragments with mutation in the two inverse SA-responsive elements. The functions of each promoter fragment were examined by analysis of GUS activity in the transgenic tobacco root treated with SA. Enhanced GUS activity was shown in the roots of transgenic tobaccos with the VCH3 (-1187)-GUS construct containing two SA-responsive cis-acting elements and four W-boxes. However, GUS activity directed by the VCH3 (-892)-GUS construct, containing one SA cis-acting element and four W-boxes, was reduced by up to 35% compared with that in tobaccos transformed with the VCH3 (-1187)-GUS construct, indicating that the SA cis-acting element plays an important role in SA induction of the VCH3 promoter. Neither the m2VCH3 (-1187)-GUS nor the mVCH3 (-892)-GUS construct, with mutation on the SA-responsive elements, abolished the expression of GUS activity, demonstrating that the W-boxes in the VCH3 promoter are also involved in SA induction. Histochemical analysis of GUS activity directed by each of the eight VCH3 promoter fragments showed that GUS was expressed specifically in vascular tissue. It was concluded that both the SA-responsive cis-acting elements and the W-boxes are important for the SA induction of the VCH3 promoter. This promoter might have a potential use in plant genetic engineering. PMID:16395526

  16. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element.

    PubMed

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G; Chi, Young-In

    2008-04-01

    Hepatocyte nuclear factor 4alpha (HNF4alpha) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4alpha cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4alpha DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1alpha. The HNF4alpha protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 A using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 A, beta = 119.36 degrees . A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants. PMID:18391435

  17. Sp-1 binds promoter elements regulated by the RB protein and Sp-1-mediated transcription is stimulated by RB coexpression.

    PubMed Central

    Udvadia, A J; Rogers, K T; Higgins, P D; Murata, Y; Martin, K H; Humphrey, P A; Horowitz, J M

    1993-01-01

    The retinoblastoma (RB) protein is implicated in transcriptional regulation of at least five cellular genes, including c-fos, c-myc, and transforming growth factor beta 1. Cotransfection of RB and truncated promoter constructs has defined a discrete element (retinoblastoma control element; RCE) within the promoters of each of these genes as being necessary for RB-mediated transcription control. Previously, we have shown that RCEs form protein-DNA complexes in vitro with three heretofore unidentified nuclear proteins and mutation of their DNA-binding site within the c-fos RCE results in an abrogation of RCE-dependent transcription in vivo. Here, we demonstrate that one of the nuclear proteins that binds the c-fos, c-myc, and transforming growth factor beta 1 RCEs in vitro is Sp-1 and that Sp-1 stimulates RCE-dependent transcription in vivo. Moreover, we show that Sp-1-mediated transcription is stimulated by the transient coexpression of RB protein. We conclude from these observations that RB may regulate transcription in part by virtue of its ability to functionally interact with Sp-1. Images Fig. 1 Fig. 2 Fig. 3 PMID:8475068

  18. Controlled release of osteopontin and interleukin-10 from modified endovascular coil promote cerebral aneurysm healing.

    PubMed

    Chen, Jingyi; Yang, Lijun; Chen, Yan; Zhang, Gengshen; Fan, Zheneng

    2016-01-15

    Cerebral aneurysm is a bulging of the artery inside the brain that results from a weakened or thin area of the artery wall. Ruptured cerebral aneurysm could lead to serious brain damage or even death, thus the proper treatment is essential. Compared with the conventional microsurgical clipping approach, the endovascular coiling treatment has many advantages, however, with a major disadvantage of high recurrence rate. One way to lower the recurrence rate, which has been tried since one decade ago, is to modify the coil to be bioactive and releasing biological molecules to stimulate tissue ingrowth and aneurysm healing. We have identified three candidates including osteopontin (OPN), IL-10 and matrix metallopeptidase 9 (MMP-9) from previous studies and generated platinum coils coated with these proteins in the carrier of poly-DL-lactic glycolic acid (PLGA). We were interested to know whether coils coated with OPN, IL-10 and MMP-9 were able to promote aneurysm healing and we have tested it in the rat carotid aneurysm model. We found that OPN and IL-10 coated coils had shown significant improvement in tissue ingrowth while MMP-9 coated coils failed to enhance tissue ingrowth compared with the control group. Our studies suggested the possible application of OPN and IL-10 coated coils in aneurysm treatment to overcome the recurrence.

  19. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central

    2013-01-01

    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  20. Abscisic acid-induced gene expression in the liverwort Marchantia polymorpha is mediated by evolutionarily conserved promoter elements.

    PubMed

    Ghosh, Totan K; Kaneko, Midori; Akter, Khaleda; Murai, Shuhei; Komatsu, Kenji; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2016-04-01

    Abscisic acid (ABA) is a phytohormone widely distributed among members of the land plant lineage (Embryophyta), regulating dormancy, stomata closure and tolerance to environmental stresses. In angiosperms (Magnoliophyta), ABA-induced gene expression is mediated by promoter elements such as the G-box-like ACGT-core motifs recognized by bZIP transcription factors. In contrast, the mode of regulation by ABA of gene expression in liverworts (Marchantiophyta), representing one of the earliest diverging land plant groups, has not been elucidated. In this study, we used promoters of the liverwort Marchantia polymorpha dehydrin and the wheat Em genes fused to the β-glucuronidase (GUS) reporter gene to investigate ABA-induced gene expression in liverworts. Transient assays of cultured cells of Marchantia indicated that ACGT-core motifs proximal to the transcription initiation site play a role in the ABA-induced gene expression. The RY sequence recognized by B3 transcriptional regulators was also shown to be responsible for the ABA-induced gene expression. In transgenic Marchantia plants, ABA treatment elicited an increase in GUS expression in young gemmalings, which was abolished by simultaneous disruption of the ACGT-core and RY elements. ABA-induced GUS expression was less obvious in mature thalli than in young gemmalings, associated with reductions in sensitivity to exogenous ABA during gametophyte growth. In contrast, lunularic acid, which had been suggested to function as an ABA-like substance, had no effect on GUS expression. The results demonstrate the presence of ABA-specific response mechanisms mediated by conserved cis-regulatory elements in liverworts, implying that the mechanisms had been acquired in the common ancestors of embryophytes. PMID:26456006

  1. Hypoxia/ischemia promotes CXCL10 expression in cardiac microvascular endothelial cells by NFkB activation.

    PubMed

    Xia, Jing-Bo; Liu, Guang-Hui; Chen, Zhuo-Ying; Mao, Cheng-Zhou; Zhou, Deng-Cheng; Wu, Hai-Yan; Park, Kyu-Sang; Zhao, Hui; Kim, Soo-Ki; Cai, Dong-Qing; Qi, Xu-Feng

    2016-05-01

    CXCL10, the chemokine with potent chemotactic activity on immune cells and other non-immune cells expressing its receptor CXCR3, has been demonstrated to involve in myocardial infarction, which was resulted from hypoxia/ischemia. The cardiac microvascular endothelial cells (CMECs) are the first cell type which is implicated by hypoxia/ischemia. However, the potential molecular mechanism by which hypoxia/ischemia regulates the expression of CXCL10 in CMECs remains unclear. In the present study, the expression of CXCL10 was firstly examined by real-time PCR and ELISA analysis. Several potential binding sites (BS) for transcription factors including NF-kappaB (NFkB), HIF1 alpha (HIF1α) and FoxO3a were identified in the promoter region of CXCL10 gene from -2000 bp to -1 bp using bioinformatics software. Luciferase reporter gene vectors for CXCL10 promoter and for activation of above transcription factors were constructed. The activation of NFkB, hypoxia-inducible transcription factor-1 alpha (HIF-1α) and FoxO3a was also analyzed by Western blotting. It was shown that the production of CXCL10 in CMECs was significantly increased by hypoxia/ischemia treatment, in parallel with the activation of CXCL10 promoter examined by reporter gene vector system. Furthermore, transcription factors including NFkB, HIF1α and FoxO3a were activated by hypoxia/ischemia in CMECs. However, over-expression of NFkB, but not that of HIF1α or FoxO3a, significantly promoted the activation of CXCL10 promoter reporter gene. These findings indicated that CXCL10 production in CMECs was significantly increased by hypoxia/ischemia, at least in part, through activation of NFkB pathway and subsequently binding to CXCL10 promoter, finally promoted the transcription of CXCL10 gene.

  2. MALAT1 long ncRNA promotes gastric cancer metastasis by suppressing PCDH10

    PubMed Central

    Qi, Ying; Ooi, Hong Sain; Wu, Jun; Chen, Jian; Zhang, Xiaoli; Tan, Sheng; Yu, Qing; Li, Yuan-Yuan; Kang, Yani; Li, Hua; Xiong, Zirui; Zhu, Tao; Liu, Bingya; Shao, Zhifeng; Zhao, Xiaodong

    2016-01-01

    EZH2, the catalytic component of polycomb repressive complex 2 (PRC2), is frequently overexpressed in human cancers and contributes to tumor initiation and progression, in part through transcriptional silencing of tumor suppressor genes. A number of noncoding RNAs (ncRNAs) recruit EZH2 to specific chromatin loci, where they modulate gene expression. Here, we used RNA immunoprecipitation sequencing (RIP-seq) to profile EZH2-associated transcripts in human gastric cancer cell lines. We identified 8,256 transcripts, including both noncoding and coding transcripts, some of which were derived from cancer-related loci. In particular, we found that long noncoding RNA (lncRNA) MALAT1 binds EZH2, suppresses the tumor suppressor PCDH10, and promotes gastric cellular migration and invasion. Our work thus provides a global view of the EZH2-associated transcriptome and offers new insight into the function of EZH2 in gastric tumorigenesis. PMID:26871474

  3. IL10-driven STAT3 signalling in senescent macrophages promotes pathological eye angiogenesis

    PubMed Central

    Nakamura, Rei; Sene, Abdoulaye; Santeford, Andrea; Gdoura, Abdelaziz; Kubota, Shunsuke; Zapata, Nicole; Apte, Rajendra S.

    2015-01-01

    Macrophage dysfunction plays a pivotal role during neovascular proliferation in diseases of ageing including cancers, atherosclerosis and blinding eye disease. In the eye, choroidal neovascularization (CNV) causes blindness in patients with age-related macular degeneration (AMD). Here we report that increased IL10, not IL4 or IL13, in senescent eyes activates STAT3 signalling that induces the alternative activation of macrophages and vascular proliferation. Targeted inhibition of both IL10 receptor-mediated signalling and STAT3 activation in macrophages reverses the ageing phenotype. In addition, adoptive transfer of STAT3-deficient macrophages into eyes of old mice significantly reduces the amount of CNV. Systemic and CD163+ eye macrophages obtained from AMD patients also demonstrate STAT3 activation. Our studies demonstrate that impaired SOCS3 feedback leads to permissive IL10/STAT3 signalling that promotes alternative macrophage activation and pathological neovascularization. These findings have significant implications for our understanding of the pathobiology of age-associated diseases and may guide targeted immunotherapy. PMID:26260587

  4. IL10-driven STAT3 signalling in senescent macrophages promotes pathological eye angiogenesis.

    PubMed

    Nakamura, Rei; Sene, Abdoulaye; Santeford, Andrea; Gdoura, Abdelaziz; Kubota, Shunsuke; Zapata, Nicole; Apte, Rajendra S

    2015-01-01

    Macrophage dysfunction plays a pivotal role during neovascular proliferation in diseases of ageing including cancers, atherosclerosis and blinding eye disease. In the eye, choroidal neovascularization (CNV) causes blindness in patients with age-related macular degeneration (AMD). Here we report that increased IL10, not IL4 or IL13, in senescent eyes activates STAT3 signalling that induces the alternative activation of macrophages and vascular proliferation. Targeted inhibition of both IL10 receptor-mediated signalling and STAT3 activation in macrophages reverses the ageing phenotype. In addition, adoptive transfer of STAT3-deficient macrophages into eyes of old mice significantly reduces the amount of CNV. Systemic and CD163(+) eye macrophages obtained from AMD patients also demonstrate STAT3 activation. Our studies demonstrate that impaired SOCS3 feedback leads to permissive IL10/STAT3 signalling that promotes alternative macrophage activation and pathological neovascularization. These findings have significant implications for our understanding of the pathobiology of age-associated diseases and may guide targeted immunotherapy. PMID:26260587

  5. Identification and characterization of cis-acting elements conferring insulin responsiveness on hamster cholesterol 7alpha-hydroxylase gene promoter.

    PubMed Central

    De Fabiani, E; Crestani, M; Marrapodi, M; Pinelli, A; Golfieri, V; Galli, G

    2000-01-01

    Bile acid biosynthesis occurs primarily through a pathway initiated by the 7alpha-hydroxylation of cholesterol, catalysed by cholesterol 7alpha-hydroxylase (encoded by CYP7A1). Insulin down-regulates CYP7A1 transcription. The aim of our study was to characterize the sequences of hamster CYP7A1 promoter, mediating the response to insulin. We therefore performed transient transfection assays with CYP7A1 promoter/luciferase chimaeras mutated at putative response elements and studied protein-DNA interactions by means of gel electrophoresis mobility-shift assay. Here we show that two sequences confer insulin responsiveness on hamster CYP7A1 promoter: a canonical insulin response sequence TGTTTTG overlapping a binding site for hepatocyte nuclear factor 3 (HNF-3) (at nt -235 to -224) and a binding site for HNF-4 at nt -203 to -191. In particular we show that the hamster CYP7A1 insulin response sequence is part of a complex unit involved in specific interactions with multiple transcription factors such as members of the HNF-3 family; this region does not bind very strongly to HNF-3 and as a consequence partly contributes to the transactivation of the gene. Another sequence located at nt -138 to -128 binds to HNF-3 and is involved in the tissue-specific regulation of hamster CYP7A1. The sequence at nt -203 to -191 is not only essential for insulin effect but also has a major role in the liver-specific expression of CYP7A1; it is the target of HNF-4. Therefore the binding sites for liver-enriched factors, present in the hamster CYP7A1 proximal promoter in close vicinity and conserved between species, constitute a regulatory unit important for basal hepatic expression and tissue restriction of the action of hormones such as insulin. PMID:10727413

  6. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    PubMed Central

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; Staskawicz, Brian J.; Loqué, Dominique; Hammond, Ming C.

    2015-01-01

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightly regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. Beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes. PMID:26138488

  7. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    SciTech Connect

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; Staskawicz, Brian J.; Loqué, Dominique; Hammond, Ming C.

    2015-07-02

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightly regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. In conclusion, beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes.

  8. Tight regulation of plant immune responses by combining promoter and suicide exon elements

    DOE PAGES

    Gonzalez, Tania L.; Liang, Yan; Nguyen, Bao N.; Staskawicz, Brian J.; Loqué, Dominique; Hammond, Ming C.

    2015-07-02

    Effector-triggered immunity (ETI) is activated when plant disease resistance (R) proteins recognize the presence of pathogen effector proteins delivered into host cells. The ETI response generally encompasses a defensive ‘hypersensitive response’ (HR) that involves programmed cell death at the site of pathogen recognition. While many R protein and effector protein pairs are known to trigger HR, other components of the ETI signaling pathway remain elusive. Effector genes regulated by inducible promoters cause background HR due to leaky protein expression, preventing the generation of relevant transgenic plant lines. By employing the HyP5SM suicide exon, we have developed a strategy to tightlymore » regulate effector proteins such that HR is chemically inducible and non-leaky. This alternative splicing-based gene regulation system was shown to successfully control Bs2/AvrBs2-dependent and RPP1/ATR1Δ51-dependent HR in Nicotiana benthamiana and Nicotiana tabacum, respectively. It was also used to generate viable and healthy transgenic Arabidopsis thaliana plants that inducibly initiate HR. In conclusion, beyond enabling studies on the ETI pathway, our regulatory strategy is generally applicable to reduce or eliminate undesired background expression of transgenes.« less

  9. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  10. Vitamin D Responsive Elements within the HLA-DRB1 Promoter Region in Sardinian Multiple Sclerosis Associated Alleles

    PubMed Central

    Murru, Maria Rita; Corongiu, Daniela; Tranquilli, Stefania; Fadda, Elisabetta; Murru, Raffaele; Schirru, Lucia; Secci, Maria Antonietta; Costa, Gianna; Asunis, Isadora; Cuccu, Stefania; Fenu, Giuseppe; Lorefice, Lorena; Carboni, Nicola; Mura, Gioia; Rosatelli, Maria Cristina; Marrosu, Maria Giovanna

    2012-01-01

    Vitamin D response elements (VDREs) have been found in the promoter region of the MS-associated allele HLA-DRB1*15∶01, suggesting that with low vitamin D availability VDREs are incapable of inducing *15∶01 expression allowing in early life autoreactive T-cells to escape central thymic deletion. The Italian island of Sardinia exhibits a very high frequency of MS and high solar radiation exposure. We test the contribution of VDREs analysing the promoter region of the MS-associated DRB1 *04∶05, *03∶01, *13∶01 and *15∶01 and non-MS-associated *16∶01, *01, *11, *07∶01 alleles in a cohort of Sardinians (44 MS patients and 112 healthy subjects). Sequencing of the DRB1 promoter region revealed a homozygous canonical VDRE in all *15∶01, *16∶01, *11 and in 45/73 *03∶01 and in heterozygous state in 28/73 *03∶01 and all *01 alleles. A new mutated homozygous VDRE was found in all *13∶03, *04∶05 and *07∶01 alleles. Functionality of mutated and canonical VDREs was assessed for its potential to modulate levels of DRB1 gene expression using an in vitro transactivation assay after stimulation with active vitamin D metabolite. Vitamin D failed to increase promoter activity of the *04∶05 and *03∶01 alleles carrying the new mutated VDRE, while the *16∶01 and *03∶01 alleles carrying the canonical VDRE sequence showed significantly increased transcriptional activity. The ability of VDR to bind the mutant VDRE in the DRB1 promoter was evaluated by EMSA. Efficient binding of VDR to the VDRE sequence found in the *16∶01 and in the *15∶01 allele reduced electrophoretic mobility when either an anti-VDR or an anti-RXR monoclonal antibody was added. Conversely, the Sardinian mutated VDRE sample showed very low affinity for the RXR/VDR heterodimer. These data seem to exclude a role of VDREs in the promoter region of the DRB1 gene in susceptibility to MS carried by DRB1* alleles in Sardinian patients. PMID:22848563

  11. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar

    2003-01-01

    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  12. The distal elements, OCT and SPH, stimulate the formation of preinitiation complexes on a human U6 snRNA gene promoter in vitro.

    PubMed

    Kunkel, G R; Hixson, J D

    1998-03-15

    The distal control region of a human U6 small nuclear RNA (snRNA) gene promoter contains two separable elements, octamer (OCT) and SPH, found in many vertebrate snRNA genes. Complete distal regions generally account for a 4- to 100-fold stimulation of snRNA gene promoters. We examined the mechanism of transcriptional stimulation by each element when linked to the proximal U6 promoter. Multimers of either OCT or SPH did not increase transcriptional levels above that with a single copy, either in transfected human cells or after in vitro transcription in a HeLa S100 extract. The orientation of a single SPH element differentially stimulated transcription in transfected cells, whereas the orientation of an octamer element was not important. Using Sarkosyl to limit transcription to a single-round, we concluded that promoters containing either OCT or SPH elements supported an increased number of preinitiation complexes in vitro. Furthermore, the rate of formation of U6 promoter preinitiation complexes resistant to low (0.015%) concentrations of Sarkosyl was accelerated on templates containing either OCT or SPH. However, neither element had a significant effect on the number of rounds of reinitiation in the S100 extract.

  13. Redefining abdominal anatomy: 10 key elements for restoring form in abdominoplasty.

    PubMed

    Patronella, Christopher K

    2015-11-01

    While traditional abdominoplasty methods can successfully achieve the objective of restoring a flat appearance, the results can be artificially board-like, lacking the subtle anatomical features of a three-dimensional abdomen, thus creating the potential for patient dissatisfaction. While often difficult to articulate, patient criticism is almost always distilled to the ubiquitous concern that the surgical abdomen lacks the natural features of an authentic, youthful abdomen. In an effort to provide a more anatomically accurate outcome and improve patient satisfaction, I have made a series of technical modifications to the abdominoplasty that I now perform. Ten key technical refinements, including a modified "Anatomy Defining" Progressive Tension Suture technique, were successively incorporated in 177 patients during the first 5 years of 2000-2014. All have been applied consistently in 961 abdominoplasty procedures during the subsequent 10 years, often accompanied by liposuction of adjacent lateral (non-abdominal) areas to ensure harmonious proportion. This series of refinements adds precision and detail by redefining the native anatomical nuances of the abdomen, an aesthetic objective that has been consistently achieved in BMI ranges between 20 and 35. Overall satisfaction with results was high (94%). The 10 elements described are safe, effective, and lasting. PMID:26508649

  14. The transposon-like Correia elements encode numerous strong promoters and provide a potential new mechanism for phase variation in the meningococcus.

    PubMed

    Siddique, Azeem; Buisine, Nicolas; Chalmers, Ronald

    2011-01-01

    Neisseria meningitidis is the primary causative agent of bacterial meningitis. The genome is rich in repetitive DNA and almost 2% is occupied by a diminutive transposon called the Correia element. Here we report a bioinformatic analysis defining eight subtypes of the element with four distinct types of ends. Transcriptional analysis, using PCR and a lacZ reporter system, revealed that two ends in particular encode strong promoters. The activity of the strongest promoter is dictated by a recurrent polymorphism (Y128) at the right end of the element. We highlight examples of elements that appear to drive transcription of adjacent genes and others that may express small non-coding RNAs. Pair-wise comparisons between three meningococcal genomes revealed that no more than two-thirds of Correia elements maintain their subtype at any particular locus. This is due to recombinational class switching between elements in a single strain. Upon switching subtype, a new allele is available to spread through the population by natural transformation. This process may represent a hitherto unrecognized mechanism for phase variation in the meningococcus. We conclude that the strain-to-strain variability of the Correia elements, and the large number of strong promoters encoded by them, allows for potentially widespread effects within the population as a whole. By defining the strength of the promoters encoded by the eight subtypes of Correia ends, we provide a resource that allows the transcriptional effects of a particular subtype at a given locus to be predicted. PMID:21283790

  15. Monoclonal Antibodies to Ferric Pseudobactin, the Siderophore of Plant Growth-Promoting Pseudomonas putida B10

    PubMed Central

    Buyer, Jeffrey S.; Sikora, Lawrence J.; Kratzke, Marian G.

    1990-01-01

    Monoclonal antibodies to ferric pseudobactin, the siderophore (microbial iron transport agent) of plant growth-promoting Pseudomonas putida B10, have been developed. Three immunoglobulin G subclass 1-type monoclonal antibodies have been characterized. Each antibody appears to be unique on the basis of their reactions with ferric pseudobactin and with culture supernatants from other pseudomonads. None of the three cross-reacts with ferric pseudobactin-type siderophores produced by seven other pseudomonads. However, P. aeruginosa ATCC 15692 and P. fluorescens ATCC 17400 produced relatively high-molecular-mass compounds (mass greater than approximately 30,000 daltons) that did react with the antibodies. The compound from P. aeruginosa was not iron regulated, while the compound from P. fluorescens was produced only under iron-limiting conditions. A competitive assay using these antibodies has a detection limit of 5 × 10−12 mol of ferric pseudobactin. This is, to our knowledge, the first report of monoclonal antibodies reactive with siderophores. PMID:16348116

  16. HIV-1 and Human PEG10 Frameshift Elements Are Functionally Distinct and Distinguished by Novel Small Molecule Modulators

    PubMed Central

    Sleebs, Brad E.; Lackovic, Kurt; Parisot, John P.; Moss, Rebecca M.; Crowe-McAuliffe, Caillan; Mathew, Suneeth F.; Edgar, Christina D.; Kleffmann, Torsten; Tate, Warren P.

    2015-01-01

    Frameshifting during translation of viral or in rare cases cellular mRNA results in the synthesis of proteins from two overlapping reading frames within the same mRNA. In HIV-1 the protease, reverse transcriptase, and integrase enzymes are in a second reading frame relative to the structural group-specific antigen (gag), and their synthesis is dependent upon frameshifting. This ensures that a strictly regulated ratio of structural proteins and enzymes, which is critical for HIV-1 replication and viral infectivity, is maintained during protein synthesis. The frameshift element in HIV-1 RNA is an attractive target for the development of a new class of anti HIV-1 drugs. However, a number of examples are now emerging of human genes using −1 frameshifting, such as PEG10 and CCR5. In this study we have compared the HIV-1 and PEG10 frameshift elements and shown they have distinct functional characteristics. Frameshifting occurs at several points within each element. Moreover, frameshift modulators that were isolated by high-throughput screening of a library of 114,000 lead-like compounds behaved differently with the PEG10 frameshift element. The most effective compounds affecting the HIV-1 element enhanced frameshifting by 2.5-fold at 10 μM in two different frameshift reporter assay systems. HIV-1 protease:gag protein ratio was affected by a similar amount in a specific assay of virally-infected cultured cell, but the modulation of frameshifting of the first-iteration compounds was not sufficient to show significant effects on viral infectivity. Importantly, two compounds did not affect frameshifting with the human PEG10 element, while one modestly inhibited rather than enhanced frameshifting at the human element. These studies indicate that frameshift elements have unique characteristics that may allow targeting of HIV-1 and of other viruses specifically for development of antiviral therapeutic molecules without effect on human genes like PEG10 that use the same

  17. Binding of cellular repressor protein or the IE2 protein to a cis-acting negative regulatory element upstream of a human cytomegalovirus early promoter.

    PubMed Central

    Huang, L; Stinski, M F

    1995-01-01

    We have previously shown that the human cytomegalovirus early UL4 promoter has upstream negative and positive cis-acting regulatory elements. In the absence of the upstream negative regulatory region, the positive element confers strong transcriptional activity. The positive element contains a CCAAT box dyad symmetry and binds the cellular transcription factor NF-Y. The effect of the negative regulatory element is negated by the viral IE2 protein (L. Huang, C.L. Malone, and M.F. Stinski, J. Virol. 68:2108, 1994). We investigated the binding of cellular or viral IE2 protein to the negative regulatory region. The major cis-acting negative regulatory element was located between -168 and -134 bp relative to the transcription start site. This element could be transferred to a heterologous promoter, and it functioned in either orientation. Mutational analysis demonstrated that a core DNA sequence in the cis-acting negative regulatory element, 5'-GTTTGGAATCGTT-3', was required for the binding of either a cellular repressor protein(s) or the viral IE2 protein. The cellular DNA binding activity was present in both nonpermissive HeLa and permissive human fibroblast cells but more abundant in HeLa cells. Binding of the cellular repressor protein to the upstream cis-acting negative regulatory element correlates with repression of transcription from the early UL4 promoter. Binding of the viral IE2 protein correlates with negation of the repressive effect. PMID:7494269

  18. In vitro transcription profiling of the σS subunit of bacterial RNA polymerase: re-definition of the σS regulon and identification of σS-specific promoter sequence elements

    PubMed Central

    Maciąg, Anna; Peano, Clelia; Pietrelli, Alessandro; Egli, Thomas; De Bellis, Gianluca; Landini, Paolo

    2011-01-01

    Specific promoter recognition by bacterial RNA polymerase is mediated by σ subunits, which assemble with RNA polymerase core enzyme (E) during transcription initiation. However, σ70 (the housekeeping σ subunit) and σS (an alternative σ subunit mostly active during slow growth) recognize almost identical promoter sequences, thus raising the question of how promoter selectivity is achieved in the bacterial cell. To identify novel sequence determinants for selective promoter recognition, we performed run-off/microarray (ROMA) experiments with RNA polymerase saturated either with σ70 (Eσ70) or with σS (EσS) using the whole Escherichia coli genome as DNA template. We found that Eσ70, in the absence of any additional transcription factor, preferentially transcribes genes associated with fast growth (e.g. ribosomal operons). In contrast, EσS efficiently transcribes genes involved in stress responses, secondary metabolism as well as RNAs from intergenic regions with yet-unknown function. Promoter sequence comparison suggests that, in addition to different conservation of the −35 sequence and of the UP element, selective promoter recognition by either form of RNA polymerase can be affected by the A/T content in the −10/+1 region. Indeed, site-directed mutagenesis experiments confirmed that an A/T bias in the −10/+1 region could improve promoter recognition by EσS. PMID:21398637

  19. Cell type-specific replication of simian virus 40 conferred by hormone response elements in the late promoter.

    PubMed

    Farrell, Michael L; Mertz, Janet E

    2002-07-01

    The late genes of SV40 are not expressed at significant levels until after the onset of viral DNA replication. We previously identified two hormone response elements (HREs) in the late promoter that contribute to this delay. Mutants defective in these HREs overexpress late RNA at early, but not late, times after transfection of CV-1PD cells. Overexpression of nuclear receptors (NRs) that recognize these HREs leads to repression of the late promoter in a sequence-specific and titratable manner, resulting in a delay in late gene expression. These observations led to a model in which the late promoter is repressed at early times after infection by NRs, with this repression being relieved by titration of these repressors through simian virus 40 (SV40) genome replication to high copy number. Here, we tested this model in the context of the viral life cycle. SV40 genomes containing mutations in either or both HREs that significantly reduce NR binding without altering the coding of any proteins were constructed. Competition for replication between mutant and wild-type viruses in low-multiplicity coinfections indicated that the +1 HRE offered a significant selective advantage to the virus within a few cycles of infection in African green monkey kidney cell lines CV-1, CV-1P, TC-7, MA-134, and Vero but not in CV-1PD' cells. Interestingly, the +55 HRE offered a selective disadvantage in MA-134 cells but had no effect in CV-1, CV-1P, TC-7, Vero, and CV-1PD' cells. Thus, we conclude that these HREs are biologically important to the virus, but in a cell type-specific manner.

  20. DEG 10, an update of the database of essential genes that includes both protein-coding genes and noncoding genomic elements.

    PubMed

    Luo, Hao; Lin, Yan; Gao, Feng; Zhang, Chun-Ting; Zhang, Ren

    2014-01-01

    The combination of high-density transposon-mediated mutagenesis and high-throughput sequencing has led to significant advancements in research on essential genes, resulting in a dramatic increase in the number of identified prokaryotic essential genes under diverse conditions and a revised essential-gene concept that includes all essential genomic elements, rather than focusing on protein-coding genes only. DEG 10, a new release of the Database of Essential Genes (available at http://www.essentialgene.org), has been developed to accommodate these quantitative and qualitative advancements. In addition to increasing the number of bacterial and archaeal essential genes determined by genome-wide gene essentiality screens, DEG 10 also harbors essential noncoding RNAs, promoters, regulatory sequences and replication origins. These essential genomic elements are determined not only in vitro, but also in vivo, under diverse conditions including those for survival, pathogenesis and antibiotic resistance. We have developed customizable BLAST tools that allow users to perform species- and experiment-specific BLAST searches for a single gene, a list of genes, annotated or unannotated genomes. Therefore, DEG 10 includes essential genomic elements under different conditions in three domains of life, with customizable BLAST tools.

  1. Regulatory elements in the FBP1 promoter respond differently to glucose-dependent signals in Saccharomyces cerevisiae.

    PubMed Central

    Zaragoza, O; Vincent, O; Gancedo, J M

    2001-01-01

    In Saccharomyces cerevisiae expression of the fructose-1,6-bisphosphatase-encoding gene, FBP1, is controlled by glucose through the upstream activating sequences UAS1 and UAS2 and the upstream repressing sequence URS1 in its promoter. We have studied the regulation of the proteins that could bind to these elements. We have investigated the role of the putative transcription factors Cat8 and Sip4 in the formation of specific DNA-protein complexes with UAS1 and UAS2, and in the expression of UAS1-lacZ and UAS2-lacZ. The expression of CAT8-lacZ and SIP4-lacZ has been also measured in mig1, tup1 or hxk2 mutants, partially refractory to catabolite repression. We conclude that there is no strict correlation between Cat8 and Sip4 expression or in vitro formation of DNA-protein complexes and expression of UAS1-lacZ and UAS2-lacZ. The URS1 element binds the regulatory protein Mig1, which blocks transcription by recruiting the proteins Cyc8 and Tup1. The pattern of complexes of URS1 with nuclear extracts was dependent on the carbon source and on Cyc8, but not on Tup1; it was also affected by the protein kinase Snf1 and by the exportin Msn5. The repression caused by URS1 in a fusion gene was dependent on Mig1, Cyc8 and Tup1, and on the carbon source in the medium; in a snf1 strain the repression observed was independent of the carbon source. Expression of Mig1 could occur in the absence of Snf1 and was moderately sensitive to glucose. We present data showing that different elements of the regulatory system controlling FBP1 responded differently to the concentration of glucose in the medium. PMID:11563983

  2. A minimal ubiquitous chromatin opening element (UCOE) effectively prevents silencing of juxtaposed heterologous promoters by epigenetic remodeling in multipotent and pluripotent stem cells

    PubMed Central

    Müller-Kuller, Uta; Ackermann, Mania; Kolodziej, Stephan; Brendel, Christian; Fritsch, Jessica; Lachmann, Nico; Kunkel, Hana; Lausen, Jörn; Schambach, Axel; Moritz, Thomas; Grez, Manuel

    2015-01-01

    Epigenetic silencing of transgene expression represents a major obstacle for the efficient genetic modification of multipotent and pluripotent stem cells. We and others have demonstrated that a 1.5 kb methylation-free CpG island from the human HNRPA2B1-CBX3 housekeeping genes (A2UCOE) effectively prevents transgene silencing and variegation in cell lines, multipotent and pluripotent stem cells, and their differentiated progeny. However, the bidirectional promoter activity of this element may disturb expression of neighboring genes. Furthermore, the epigenetic basis underlying the anti-silencing effect of the UCOE on juxtaposed promoters has been only partially explored. In this study we removed the HNRPA2B1 moiety from the A2UCOE and demonstrate efficient anti-silencing properties also for a minimal 0.7 kb element containing merely the CBX3 promoter. This DNA element largely prevents silencing of viral and tissue-specific promoters in multipotent and pluripotent stem cells. The protective activity of CBX3 was associated with reduced promoter CpG-methylation, decreased levels of repressive and increased levels of active histone marks. Moreover, the anti-silencing effect of CBX3 was locally restricted and when linked to tissue-specific promoters did not activate transcription in off target cells. Thus, CBX3 is a highly attractive element for sustained, tissue-specific and copy-number dependent transgene expression in vitro and in vivo. PMID:25605798

  3. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ..., including Safeguards Information designated as Safeguards Information-Modified Handling as defined in 10 CFR... required by 10 CFR 73.22(b) or 73.23(b). ... history records checks and other elements of background checks for designated categories of...

  4. Making sense of the global economy: 10 resources for health promoters.

    PubMed

    Mohindra, K S; Labonté, Ronald

    2010-09-01

    Population health is shaped by more than local or national influences-the global matters. Health promotion practitioners and researchers increasingly are challenged to engage with upstream factors related to the global economy, such as global prescriptions for national macroeconomic policies, debt relief and international trade. This paper identifies 10 books (A Brief History of Neoliberalism, Bad Samaritans: The Myth of Free Trade and the Secret History of Capitalism, The World is Not Flat: Inequality and Injustice in Our Global Economy, Globalization and its Discontents, The Debt Threat: How Debt is Destroying the Developing World, Global Woman: Nannies, Maids, and Sex Workers in the New Economy, A Race Against Time, Globalization and Health: An Introduction, Global Public Goods for Health: Health Economics and Public Health Perspectives, Trade and Health: Seeking Common Ground) and several key reports that we found to be particularly useful for understanding the global economy's effects on people's health. We draw attention to issues helpful in understanding the present global financial crisis.

  5. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.

    PubMed

    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K

    2015-09-25

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance.

  6. Disruption of the Abdominal-B Promoter Tethering Element Results in a Loss of Long-Range Enhancer-Directed Hox Gene Expression in Drosophila

    PubMed Central

    Ho, Margaret C. W.; Schiller, Benjamin J.; Akbari, Omar S.; Bae, Esther; Drewell, Robert A.

    2011-01-01

    There are many examples within gene complexes of transcriptional enhancers interacting with only a subset of target promoters. A number of molecular mechanisms including promoter competition, insulators and chromatin looping are thought to play a role in regulating these interactions. At the Drosophila bithorax complex (BX-C), the IAB5 enhancer specifically drives gene expression only from the Abdominal-B (Abd-B) promoter, even though the enhancer and promoter are 55 kb apart and are separated by at least three insulators. In previous studies, we discovered that a 255 bp cis-regulatory module, the promoter tethering element (PTE), located 5′ of the Abd-B transcriptional start site is able to tether IAB5 to the Abd-B promoter in transgenic embryo assays. In this study we examine the functional role of the PTE at the endogenous BX-C using transposon-mediated mutagenesis. Disruption of the PTE by P element insertion results in a loss of enhancer-directed Abd-B expression during embryonic development and a homeotic transformation of abdominal segments. A partial deletion of the PTE and neighboring upstream genomic sequences by imprecise excision of the P element also results in a similar loss of Abd-B expression in embryos. These results demonstrate that the PTE is an essential component of the regulatory network at the BX-C and is required in vivo to mediate specific long-range enhancer-promoter interactions. PMID:21283702

  7. Quantification of 10 elements in human cerebrospinal fluid from chronic pain patients with and without spinal cord stimulation.

    PubMed

    Korvela, Marcus; Lind, Anne-Li; Wetterhall, Magnus; Gordh, Torsten; Andersson, Marit; Pettersson, Jean

    2016-09-01

    Neuropathic pain affects 1-10% of the general population and is caused by a lesion or disease of the somatosensory nervous system. Spinal cord stimulation (SCS), a method where implanted electrodes stimulate the spinal cord, has been successfully used to treat drug-resistant neuropathic pain, but the mechanism of action is largely unknown. Studies show that SCS changes the protein levels in CSF (cerebrospinal fluid) of pain patients. Several neurological conditions have been shown to alter the elemental composition of CSF. Therefore changes in the levels of ions and trace elements in the CSF may correspond to SCS use. This study used ICP-MS (Inductively coupled plasma mass spectrometry) and ICP-AES (Inductively coupled plasma atomic emission spectroscopy) to quantify 10 elements in CSF from chronic neuropathic pain patients using SCS. The element concentrations in CSF from patients with SCS treatment on/off, were measured. No effect on the element concentrations in CSF from treatment with SCS could be detected. Also, the elemental concentrations in pooled CSF from patients without chronic neuropathic pain was determined and compared to the patients using SCS. The concentration of the elements Ca, Sr, Na, K, P, Mg and Ti were, significantly higher in patients compared to the CSF-control. PMID:27473826

  8. Negative regulation of expression of the pituitary-specific transcription factor GHF-1/Pit-1 by thyroid hormones through interference with promoter enhancer elements.

    PubMed Central

    Sanchez-Pacheco, A; Palomino, T; Aranda, A

    1995-01-01

    Expression of the growth hormone gene is due to the presence of the pituitary-specific transcription factor GHF-1/Pit-1. The action of the thyroid hormone T3 is mediated by nuclear receptors that regulate transcription by interaction with DNA elements located near promoters of the regulated genes. In this study, we show that T3 inhibits expression of the GHF-1/Pit-1 gene in rat pituitary GH4C1 cells by a novel mechanism that involves transcriptional interference with other regulatory elements of the promoter. Sequences between bp -90 and -200 of the rat GHF-1/Pit-1 gene which do not contain a hormone response element but contain two cyclic AMP-responsive elements mediate most of the repressive effect of T3. The hormone reduces basal levels of GHF-1/Pit-1 promoter activity and antagonizes its response to cyclic AMP and the tumor promoter TPA (12-O-tetradecanoylphorbol-13-acetate). A similar repression is found with a heterologous promoter that contains four copies of the cyclic AMP-responsive element motif. This regulation provides a novel example of the cross-talk between the thyroid hormone receptor and the signal transduction pathways used by different hormones and growth factors. Additionally, T3 interferes with in vitro binding of GHF-1/Pit-1 to a positive autoregulatory element located at bp -45 to -63 and has a detectable inhibitory effect on the activity of a promoter construct which extends to bp -90 of 5'-flanking DNA. The regulation of the transcription factor provides a novel example of negative transcriptional regulation by thyroid hormones. PMID:7565785

  9. Finite Element Analysis and Test Correlation of a 10-Meter Inflation-Deployed Solar Sail

    NASA Technical Reports Server (NTRS)

    Sleight, David W.; Michii, Yuki; Lichodziejewski, David; Derbes, Billy; Mann. Troy O.; Slade, Kara N.; Wang, John T.

    2005-01-01

    Under the direction of the NASA In-Space Propulsion Technology Office, the team of L Garde, NASA Jet Propulsion Laboratory, Ball Aerospace, and NASA Langley Research Center has been developing a scalable solar sail configuration to address NASA's future space propulsion needs. Prior to a flight experiment of a full-scale solar sail, a comprehensive phased test plan is currently being implemented to advance the technology readiness level of the solar sail design. These tests consist of solar sail component, subsystem, and sub-scale system ground tests that simulate the vacuum and thermal conditions of the space environment. Recently, two solar sail test articles, a 7.4-m beam assembly subsystem test article and a 10-m four-quadrant solar sail system test article, were tested in vacuum conditions with a gravity-offload system to mitigate the effects of gravity. This paper presents the structural analyses simulating the ground tests and the correlation of the analyses with the test results. For programmatic risk reduction, a two-prong analysis approach was undertaken in which two separate teams independently developed computational models of the solar sail test articles using the finite element analysis software packages: NEiNastran and ABAQUS. This paper compares the pre-test and post-test analysis predictions from both software packages with the test data including load-deflection curves from static load tests, and vibration frequencies and mode shapes from vibration tests. The analysis predictions were in reasonable agreement with the test data. Factors that precluded better correlation of the analyses and the tests were uncertainties in the material properties, test conditions, and modeling assumptions used in the analyses.

  10. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  11. Organocatalytic enantioselective Michael addition of 2,4-pentandione to nitroalkenes promoted by bifunctional thioureas with central and axial chiral elements.

    PubMed

    Peng, Fang-Zhi; Shao, Zhi-Hui; Fan, Bao-Min; Song, He; Li, Gan-Peng; Zhang, Hong-Bin

    2008-07-01

    Two novel bifunctional amine-thiourea organocatalysts 1 and 2, which both bear central and axial chiral elements, have been developed to promote enantioselective Michael reaction between 1,3-dicarbonyl compounds and nitro olefins. The catalyst 2 afforded the desired products with good levels of enantioselectivity (up to 96% ee), showing clearly that two chiral elements of 2 are matched, and enhance the stereochemical control.

  12. Homeobox D10 Gene, a Candidate Tumor Suppressor, Is Downregulated through Promoter Hypermethylation and Associated with Gastric Carcinogenesis

    PubMed Central

    Wang, Liangjing; Chen, Shujie; Xue, Meng; Zhong, Jing; Wang, Xian; Gan, Lihong; Lam, Emily KY; Liu, Xin; Zhang, Jianbin; Zhou, Tianhua; Yu, Jun; Jin, Hongchuan; Si, Jianmin

    2012-01-01

    Homeobox D10 (HoxD10 ) gene plays a critical role in cell differentiation and morphogenesis during development. However, the function of HoxD10 in tumor progression remains largely unknown. We demonstrate that the expression of HoxD10 is commonly downregulated in gastric cancer tissues (n = 33) and cell lines (n = 8) relative to normal stomach tissues. Functionally, reexpression of HoxD10 results in significant inhibition of cell survival, induction of cell apoptosis, and impairment of cell migration and invasion. Moreover, ectopic expression of HoxD10 suppresses gastric tumor growth in a mouse xenograft model. To identify target candidates of HoxD10, we performed cDNA microarray and showed that HoxD10 regulates multiple downstream genes including IGFBP3. Reintroduction of HoxD10 transcriptionally upregulates IGFBP3, activates caspase 3 and caspase 8, and subsequently induces cell apoptosis. Methylation specific PCR revealed that HoxD10 promoter DNA was hypermethylated in gastric cancer cell lines. Additionally, 5-aza demethylation treatment could transiently reactivate the expression of HoxD10 in gastric cancer cells. HoxD10 promoter methylation frequently was detected in gastric cancer tissues obtained from endoscopic biopsies (85.7%, 24/28) and surgically resected samples (82.6%, 57/69). Intestinal metaplasia tissues showed a 60% methylation rate (18/30), but no detectable methylation in normal stomach tissues (0%, 0/10). Taken together, our results suggest that HoxD10 functions as a candidate tumor suppressor in gastric cancer, which is inactivated through promoter hypermethylation. PMID:22160393

  13. Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter

    PubMed Central

    1993-01-01

    Tumor necrosis factor alpha (TNF-alpha), a cytokine with pleiotropic biological effects, is produced by a variety of cell types in response to induction by diverse stimuli. In this paper, TNF-alpha mRNA is shown to be highly induced in a murine T cell clone by stimulation with T cell receptor (TCR) ligands or by calcium ionophores alone. Induction is rapid, does not require de novo protein synthesis, and is completely blocked by the immunosuppressant cyclosporin A (CsA). We have identified a human TNF-alpha promoter element, kappa 3, which plays a key role in the calcium-mediated inducibility and CsA sensitivity of the gene. In electrophoretic mobility shift assays, an oligonucleotide containing kappa 3 forms two DNA protein complexes with proteins that are present in extracts from unstimulated T cells. These complexes appear in nuclear extracts only after T cell stimulation. Induction of the inducible nuclear complexes is rapid, independent of protein synthesis, and blocked by CsA, and thus, exactly parallels the induction of TNF-alpha mRNA by TCR ligands or by calcium ionophore. Our studies indicate that the kappa 3 binding factor resembles the preexisting component of nuclear factor of activated T cells. Thus, the TNF-alpha gene is an immediate early gene in activated T cells and provides a new model system in which to study CsA-sensitive gene induction in activated T cells. PMID:8376940

  14. An Annotated Reference Guide to the Finite-Element Interface Specification Version 1.0

    SciTech Connect

    Alan B. Williams; Ivan J. Otero; Kyran D. Mish; Lee M. Tayor; Robert L. Clay

    1999-04-01

    The Finite-Element Interface (FEI) specification provides a layered abstraction that permits finite-element analysis codes to utilize various linear-algebra solution packages with minimal concern for the internal details of the solver modules. Alternatively, this interface can be viewed as a way for solver developers to provide solution services to finite-element clients without having to embed finite-element abstractions within their solver libraries. The purpose of this document is to provide some level of documentation between the bare interface specification itself, which consists only of C/C++ header files, and the full documentation suite that supports the interface definition by providing considerable detail as to its design and implementation. This document primarily provides the ''how'' of calling the interface member functions, so that programmers can readily learn how to utilize the interface implementation without having to consider all the details contained in the interface's definition, design, and motivation. The interface specification is presented three times in this document, each time with an increasing level of detail. The first presentation provides a general overview of the calling sequence, in order to acquaint the programmer with a basic introduction to how the interface is used to ''train'' the underlying solver software on the particular finite-element problem that is to be solved. The second pass through the interface definition provides considerable detail on each method, including specific considerations as to the structure of the underlying data, and an exposition of potential pitfalls that may occur as a byproduct of either the finite-element modeling process, or of the use of the associated interface implementation. Finally, a third description of the interface is given implicitly via the discussion of sample problems that provide concrete examples of the use of the finite-element interface.

  15. Atmospheric wet and dry deposition of trace elements at 10 sites in Northern China

    NASA Astrophysics Data System (ADS)

    Pan, Y. P.; Wang, Y. S.

    2015-01-01

    Atmospheric deposition is considered to be a major process that removes pollutants from the atmosphere and an important source of nutrients and contaminants for ecosystems. Trace elements (TEs), especially toxic metals deposited on plants and into soil or water, can cause substantial damage to the environment and human health due to their transfer and accumulation in food chains. Despite public concerns, quantitative knowledge of metal deposition from the atmosphere to ecosystems remains scarce. To advance our understanding of the spatiotemporal variations in the magnitudes, pathways, compositions and impacts of atmospherically deposited TEs, precipitation (rain and snow) and dry-deposited particles were collected simultaneously at 10 sites in Northern China from December 2007 to November 2010. The measurements showed that the wet and dry depositions of TEs in the target areas were orders of magnitude higher than previous observations within and outside China, generating great concern over the potential risks. The spatial distribution of the total (wet plus dry) deposition flux was consistent with that of the dry deposition, with a significant decrease from industrial and urban areas to suburban, agricultural and rural sites, while the wet deposition exhibited less spatial variation. In addition, the seasonal variation of wet deposition was also different from that of dry deposition, although they were both governed by the precipitation and emission patterns. For the majority of TEs that exist as coarse particles, dry deposition dominated the total flux at each site. This was not the case for potassium, nickel, arsenic, lead, zinc, cadmium, selenium, silver and thallium, for which the relative importance between wet and dry deposition fluxes varied by site. Whether wet deposition is the major atmospheric cleansing mechanism for the TEs depends on the size distribution of the particles. We found that atmospheric inputs of copper, lead, zinc, cadmium, arsenic and

  16. Cell type-specific gene expression in the neuroendocrine system. A neuroendocrine-specific regulatory element in the promoter of chromogranin A, a ubiquitous secretory granule core protein.

    PubMed Central

    Wu, H; Rozansky, D J; Webster, N J; O'Connor, D T

    1994-01-01

    The acidic secretory protein chromogranin A universally occurs in amine and peptide hormone and neurotransmitter storage granules throughout the neuroendocrine system. What factors govern the activity of the chromogranin A gene, to yield such a widespread yet neuroendocrine-selective pattern of expression? To address this question, we isolated the mouse chromogranin A gene promoter. The promoter conferred cell type-specific expression in several neuroendocrine cell types (adrenal medullary chromaffin cells, anterior pituitary corticotropes, and anterior pituitary somatolactotropes) but not in control (fibroblast or kidney) cells. In neuroendocrine cells, analysis of promoter deletions established both positive and negative transcriptional regulatory domains. A distal positive domain (-4.8/-2.2 kbp) was discovered, as well as negative (-258/-181 bp) and positive (-147/-61 bp) domains in the proximate promoter. The proximate promoter contained a minimal neuroendocrine-specific element between -77 and -61 bp. Sequence alignment of the mouse promoter with corresponding regions in rat and bovine clones indicated that the mouse sequence shares over 85% homology with rat and 52% with bovine promoters. DNaseI footprinting and electrophoretic gel mobility shift assays demonstrated the presence of nuclear factors in neuroendocrine cells that recognized the proximate promoter. We conclude that the chromogranin A promoter contains both positive and negative domains governing its cell type-specific pattern of transcription, and that a small proximate region of the promoter, containing novel as well as previously described elements, interacts specifically with neuroendocrine nuclear proteins, and is thereby sufficient to ensure widespread neuroendocrine expression of the gene. Images PMID:8040254

  17. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... and equipment to extremely high standards is necessary in order to ensure predictable and safe...

  18. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... and equipment to extremely high standards is necessary in order to ensure predictable and safe...

  19. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... and equipment to extremely high standards is necessary in order to ensure predictable and safe...

  20. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export Licensing Authority O Appendix O to Part 110 Energy NUCLEAR... and equipment to extremely high standards is necessary in order to ensure predictable and safe...

  1. The wheat HMW-glutenin 1Dy10 gene promoter controls endosperm expression in Brachypodium distachyon

    PubMed Central

    Thilmony, Roger; Guttman, Mara E; Lin, Jeanie W; Blechl, Ann E

    2014-01-01

    The grass species Brachypodium distachyon has emerged as a model system for the study of gene structure and function in temperate cereals. As a first demonstration of the utility of Brachypodium to study wheat gene promoter function, we transformed it with a T-DNA that included the uidA reporter gene under control of a wheat High-Molecular-Weight Glutenin Subunit (HMW-GS) gene promoter and transcription terminator. For comparison, the same expression cassette was introduced into wheat by biolistics. Histochemical staining for β-glucuronidase (GUS) activity showed that the wheat promoter was highly expressed in the endosperms of all the seeds of Brachypodium and wheat homozygous plants. It was not active in any other tissue of transgenic wheat, but showed variable and sporadic activity in a minority of styles of the pistils of four homozygous transgenic Brachypodium lines. The ease of obtaining transgenic Brachypodium plants and the overall faithfulness of expression of the wheat HMW-GS promoter in those plants make it likely that this model system can be used for studies of other promoters from cereal crop species that are difficult to transform. PMID:24322586

  2. [Determination of 10 elements in the feather of brown-eared pheasant by ICP and AAS].

    PubMed

    Wu, Yu-Zhen; Zhang, Feng; Wang, Meng-Ben; Zhao, Gen-Gui

    2008-03-01

    Crossoptilon mantchuricum (brown-eared pheasant) is an endemic to northern China and one of the state first-protection animals, which is now confined to scattered localities in Guandi Mountains, Guancen Mountains, Luliang Ranges of western Shanxi, and the mountains of north-western Hebei, western Beijing and central Shaanxi. Its range is fragmented by habitat loss because of human activity and other intervention, and isolated populations are resulting in facing the extinction risk from further forest destroyed and other pressures. The trace elements are very important to the growth and development of brown-eared pheasant, and these elements in the feather are closely correlated to the contents in the organs of the bird. By research on the elements contents in the feather, the authors are able to get more information about the growth, development, reproduction, immunity and metabolism function for this bird. The aim of this study is to try providing scientific basis for further enhancing the protection and the artificial breeding. Ten elements including Mo, Zn, Ni, Fe, Mn, Cr, Cu, K, Pb and Cd were determined in the feather of brown-eared pheasant by ICP and AAS, respectively. For the analysis two samples were from Luya Mountain Natural Reserve and Pangquangou Natural Reserve, and one was from Taiyuan Zoo, Shanxi. The contents of the elements in the feather of wild and captive brown-eared pheasants were compared each other. The results showed that the contents of the eight elements the feather from the Zoo were lower than those from Luya Mountain Natural Reserve and Pangquangou Natural Reserve. Moreover, Fe is the highest among those ten elements, Cd was not found, and Mo and Cr were much lower than the others. It is suggested that varying habitats have obvious effects on the elements contents of wild bird body, and wild habitant is more beneficial to the bird growth and development. Applying the results to wild animal management would be favorable to the protection

  3. The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters

    PubMed Central

    Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S.; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y. Eugene

    2015-01-01

    Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, ‘TTC(N3)GAA’)-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320–494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence ‘AGG(N3)AGG’. Surprisingly, the helical N-terminal region (1–355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. PMID:26384563

  4. RNA Replication from the Simian Virus 5 Antigenomic Promoter Requires Three Sequence-Dependent Elements Separated by Sequence-Independent Spacer Regions

    PubMed Central

    Keller, Michael A.; Murphy, Susan K.; Parks, Griffith D.

    2001-01-01

    We have previously shown for the paramyxovirus simian virus 5 (SV5) that a functional promoter for RNA replication requires proper spacing between two discontinuous elements: a 19-base segment at the 3′ terminus (conserved region I [CRI]) and an 18-base internal region (CRII) that is contained within the coding region of the L protein gene. In the work described here, we have used a reverse-genetics system to determine if the 53-base segment between CRI and CRII contains additional sequence-specific signals required for optimal replication or if this segment functions solely as a sequence-independent spacer region. A series of copyback defective interfering minigenome analogs were constructed to contain substitutions of nonviral sequences in place of bases 21 to 72 of the antigenomic promoter, and the relative level of RNA replication was measured by Northern blot analysis. The results from our mutational analysis indicate that in addition to CRI and CRII, optimal replication from the SV5 antigenomic promoter requires a third sequence-dependent element located 51 to 66 bases from the 3′ end of the RNA. Minigenome RNA replication was not affected by changes in the either the position of this element in relation to CRI and CRII or the predicted hexamer phase of NP encapsidation. Thus, optimal RNA replication from the SV5 antigenomic promoter requires three sequence-dependent elements, CRI, CRII and bases 51 to 66. PMID:11264390

  5. Air quality in urban parking garages (PM10, major and trace elements, PAHs): Instrumental measurements vs. active moss biomonitoring

    NASA Astrophysics Data System (ADS)

    Vuković, Gordana; Aničić Urošević, Mira; Razumenić, Ivana; Kuzmanoski, Maja; Pergal, Miodrag; Škrivanj, Sandra; Popović, Aleksandar

    2014-03-01

    This study was performed in four parking garages in downtown of Belgrade with the aim to provide multi-pollutant assessment. Concentrations of 16 US EPA priority PAHs and Al, Ba, Ca, Cd, Co, Cr, Cu, Fe, K, Mg, Mn, Na, Ni, Pb, Sr and Zn were determined in PM10 samples. The carcinogenic health risk of employees' occupational exposure to heavy metals (Cd, Cr, Ni and Pb) and PAHs (B[a]A, Cry, B[b]F, B[k]F, B[a]P and DB[ah]A) was estimated. A possibility of using Sphagnum girgensohnii moss bags for monitoring of trace element air pollution in semi-enclosed spaces was evaluated as well. The results showed that concentrations of PM10, Cd, Ni and B[a]P exceeded the EU Directive target values. Concentration of Zn, Ba and Cu were two orders of magnitude higher than those measured at different urban sites in European cities. Cumulative cancer risk obtained for heavy metals and PAHs was 4.51 × 10-5 and 3.75 × 10-5 in M and PP, respectively; upper limit of the acceptable US EPA range is 10-4. In the moss, higher post-exposure than pre-exposure (background) element concentrations was observed. In comparison with instrumental monitoring data, similar order of abundances of the most elements in PM10 and moss samples was found. However, using of the S. girgensohnii moss bag technique in indoor environments needs further justification.

  6. Comprehensive analysis of regulatory elements of the promoters of rice sulfate transporter gene family and functional characterization of OsSul1;1 promoter under different metal stress

    PubMed Central

    Kumar, Smita; Asif, Mehar Hasan; Chakrabarty, Debasis; Tripathi, Rudra Deo; Dubey, Rama Shanker; Trivedi, Prabodh Kumar

    2015-01-01

    Adverse environmental conditions including heavy metal stress impose severe effects on the plant growth and development limiting productivity and yield. Studies demonstrated that changes in genome-wide expression modulate various biochemical processes and molecular components in response to heavy metal stress in plants. Some of the key components involved in such a regulation are the transcription initiation machinery, nucleotide sequence of promoters and presence of cis-acting elements. Therefore, identification of the putative cis-acting DNA sequences involved in gene regulation and functional characterization of promoters are important steps in understanding response of plants to heavy metal stress. In this study, comprehensive analysis of the proximal promoters of members of rice sulfate transporter gene family which is an essential component of stress response has been carried out. Analysis suggests presence of various common stress related cis-acting elements in the promoters of members of this gene family. In addition, transcriptional regulation of the arsenic-responsive high affinity sulfate transporter, OsSul1;1, has been studied through development of Arabidopsis transgenic lines expressing reporter gene encoding β-glucuronidase under the control of OsSul1;1 promoter. Analysis of the transgenic lines suggests differential response of the OsSul1;1 promoter to various heavy metals as well as other abiotic stresses. PMID:25807334

  7. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  8. The wheat HMW-glutenin 1Dy10 gene promoter controls endosperm expression in Brachypodium distachyon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The grass species Brachypodium distachyon has emerged as a model system for the study of gene structure and function in temperate cereals. As a first demonstration of the utility of Brachypodium to study wheat gene promoter function, we transformed it with a T-DNA that included the GUS reporter gene...

  9. Polymorphisms in the interleukin-10 gene promoter and the risk of alcoholism and alcoholic liver disease in Caucasian Spaniard men.

    PubMed

    Auguet, Teresa; Vidal, Francesc; Broch, Montserrat; Olona, Montserrat; Aguilar, Carmen; Morancho, Beatriz; López-Dupla, Miguel; Quer, Joan-Carles; Sirvent, Joan-Josep; Richart, Cristóbal

    2010-05-01

    Controversy surrounds the possible influence of the single nucleotide polymorphisms (SNPs) of the interleukin-10 (IL-10) gene promoter on the risk for alcoholic liver disease. Our aim was to determine whether the SNP of the IL-10 gene promoter are associated with an increased risk for alcoholism and for alcoholic liver disease in male Spaniards. The -627 C>A SNP of the IL-10 gene promoter was assessed in a cohort of 344 Caucasian Spanish men, 168 alcoholics, and 176 nonalcoholics. The alcoholic group comprised 79 individuals without liver histopathologic abnormalities and 89 patients with chronic alcoholic liver disease. The nonalcoholic group was made of 62 healthy controls and 114 patients with chronic nonalcoholic liver disease. Genotyping was performed using PCR and automatic sequencing analysis methods on white cell DNA. Genotype and allele frequencies were compared by using the chi(2) test. Overall, no differences in either genotype and allele distribution was observed when comparing the four patient categories defined (P=0.62 and P=0.33, respectively). Subset analyses showed no differences in the genotype and allele distributions between all alcoholic and all nonalcoholic subjects (P=0.55 and P=0.29, respectively). This study failed to detect significant associations of the IL-10 -627C>A SNP and alcoholism or alcoholic liver disease in a cohort of Caucasian male Spaniards.

  10. Promotion of hair follicle development and trichogenesis by Wnt-10b in cultured embryonic skin and in reconstituted skin

    SciTech Connect

    Ouji, Yukiteru . E-mail: oujix@naramed-u.ac.jp; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-06-30

    We previously showed that Wnt-10b promoted the differentiation of primary skin epithelial cells (MPSEC) toward hair shaft and inner root sheath of the hair follicle (IRS) cells in vitro. In the present study, we found that Wnt-10b promotes the development of hair follicles using a culture of mouse embryonic skin tissue and trichogenesis using a reconstitution experiment with nude mice. Hair follicle development was observed in skin taken from mouse embryos on embryonic day 10.5 following a 2-day culture with recombinant Wnt-10b (rWnt-10b), however, not without rWnt-10b. Brown hair growth was observed at the site of reconstituted skin in Balb/c nude mice where dermal fibroblasts and keratinocytes, derived from C3H/HeN new born mice, were transplanted with Wnt-10b-producing COS cells (Wnt-COS). Without the co-transplantation of Wnt-COS, no hair growth was observed. Our results suggest an important role of Wnt-10b in the initiation of hair follicle development and following trichogenesis.

  11. Raspberry ketone promotes the differentiation of C3H10T1/2 stem cells into osteoblasts.

    PubMed

    Takata, Tomoyo; Morimoto, Chie

    2014-03-01

    The decrease in the bone mass associated with osteoporosis caused by ovariectomy, aging, and other conditions is accompanied by an increase in bone marrow adipose tissue. The balance between osteoblasts and adipocytes is influenced by a reciprocal relationship. The development of modalities to promote local/systemic bone formation by inhibiting bone marrow adipose tissue is important in the treatment of fractures or metabolic bone diseases such as osteoporosis. In this study, we examined whether raspberry ketone [4-(4-hydroxyphenyl)butan-2-one; RK], which is one of the major aromatic compounds of red raspberry and exhibits anti-obesity action, could promote osteoblast differentiation in C3H10T1/2 stem cells. Confluent C3H10T1/2 stem cells were treated for 6 days with 10-100 μg/mL of RK in culture medium containing 10 nM all-trans-retinoic acid (ATRA) or 300 ng/mL recombinant human bone morphogenetic protein (rhBMP)-2 protein as an osteoblast-differentiating agent. RK in the presence of ATRA increased alkaline phosphatase (ALP) activity in a dose-dependent manner. RK in the presence of rhBMP-2 also increased ALP activity. RK in the presence of ATRA also increased the levels of mRNAs of osteocalcin, α1(I) collagen, and TGF-βs (TGF-β1, TGF-β2, and TGF-β3) compared with ATRA only. RK promoted the differentiation of C3H10T1/2 stem cells into osteoblasts. However, RK did not affect the inhibition of early-stage adipocyte differentiation. Our results suggest that RK enhances the differentiation of C3H10T1/2 stem cells into osteoblasts, and it may promote bone formation by an action unrelated to adipocyte differentiation.

  12. Transcriptional regulation of the human mu opioid receptor (hMOR) gene: evidence of positive and negative cis-acting elements in the proximal promoter and presence of a distal promoter.

    PubMed

    Xu, Y; Carr, L G

    2001-07-01

    The mu opioid receptor (MOR), the primary binding site for morphine, is an important target for treating pain and drug addiction. The MOR gene is tightly regulated at the level of transcription, and potential polymorphisms in its 5' regulatory region can cause individual variation in MOR gene expression, nociception, and opiate responses. To study the 5' regulatory region of the human MOR gene (hMOR), we further investigated our previous finding of two regulatory regions and have localized a 40-bp positive cis-acting element and a 35-bp negative cis-acting element that regulate hMOR transcription in SK-N-SH cells. Electromobility shift assays and methylation interference assay with the 40-bp probe suggested that protein contacts were made with the core recognition sequence GCC (-510 to -508). The 35-bp sequence (-694 to -660) was the hMOR homolog of the mMOR negative regulatory element, and it suppressed proximal promoter activity of the hMOR gene. Additionally, the presence of an hMOR distal promoter was confirmed using RT-PCR. However, the activity of the distal promoter construct (-2325 to -777) was weak compared with the activity of the proximal promoter construct (-776 to -212).

  13. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail: yingzhu@whu.edu.cn; Wu Jianguo . E-mail: wu9988@vip.sina.com

    2007-04-06

    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  14. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  15. A single nucleotide change in a core promoter is involved in the progressive overexpression of the duplicated CYP9M10 haplotype lineage in Culex quinquefasciatus.

    PubMed

    Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Tomita, Takashi

    2015-11-01

    Although the importance of cis-acting mutations on detoxification enzyme genes for insecticide resistance is widely accepted, only a few of them have been determined as concrete mutations present in genomic DNA till date. The overexpression of a cytochrome P450 gene, CYP9M10, is associated with pyrethroid resistance in the southern house mosquito Culex quinquefasciatus. The haplotypes of CYP9M10 exhibiting overexpression (resistant haplotypes) belong to one specific phylogenetic lineage that shares high nucleotide sequence homology and the same insertion of a transposable element. Among the resistant haplotypes, allelic progression involving an additional cis-acting mutation and gene duplication evolved a CYP9M10 haplotype associated with extremely high transcription and strong pyrethroid resistance. Here we show that a single nucleotide substitution G-27A, which is located near the transcription start site of CYP9M10, is involved in the progression of the duplicated haplotype lineage. The deletion of a 7-bp AT-rich sequence that includes nucleotide -27 inhibited the initiation of transcription from the original transcriptional initiation site. The mutation was suspected to reside within a core promoter, TATA-box, of CYP9M10. PMID:26494013

  16. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    PubMed Central

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  17. Promoting effect of low concentration of benzotriazole on the corrosion of Cu10Ni alloy in sulfide polluted salt water

    NASA Astrophysics Data System (ADS)

    Allam, Nageh K.; Ashour, Elsayed A.

    2008-06-01

    The interaction of benzotriazole (BTAH) with the surface of a corroding copper-nickel alloy in a sulfide polluted salt solution reveals a change in its role from an inhibitor to a promoter of localized corrosion as its concentration changes. A concentration of BTAH ≥5 × 10 -4 M inhibits the corrosion reaction in both the polluted and the unpolluted media. On the other hand, a concentration of 10 -4 M BTAH promotes the localized corrosion of the alloy in the polluted medium while it acts as an inhibitor in the unpolluted salt solution. This finding is substantiated by measurements of mass loss and current transients and examination of the surface by SEM microscopy.

  18. Matrix metalloproteinase-10 promotes tumor progression through regulation of angiogenic and apoptotic pathways in cervical tumors

    PubMed Central

    2014-01-01

    Background Cancer invasion and metastasis develops through a series of steps that involve the loss of cell to cell and cell to matrix adhesion, degradation of extracellular matrix and induction of angiogenesis. Different protease systems (e.g., matrix metalloproteinases, MMPs) are involved in these steps. MMP-10, one of the lesser studied MMPs, is limited to epithelial cells and can facilitate tumor cell invasion by targeting collagen, elastin and laminin. Enhanced MMP-10 expression has been linked to poor clinical prognosis in some cancers, however, mechanisms underlying a role for MMP-10 in tumorigenesis and progression remain largely unknown. Here, we report that MMP-10 expression is positively correlated with the invasiveness of human cervical and bladder cancers. Methods Using commercial tissue microarray (TMA) of cervical and bladder tissues, MMP-10 immunohistochemical staining was performed. Furthermore using a panel of human cells (HeLa and UROtsa), in vitro and in vivo experiments were performed in which MMP-10 was overexpressed or silenced and we noted phenotypic and genotypic changes. Results Experimentally, we showed that MMP-10 can regulate tumor cell migration and invasion, and endothelial cell tube formation, and that MMP-10 effects are associated with a resistance to apoptosis. Further investigation revealed that increasing MMP-10 expression stimulates the expression of HIF-1α and MMP-2 (pro-angiogenic factors) and PAI-1 and CXCR2 (pro-metastatic factors), and accordingly, targeting MMP-10 with siRNA in vivo resulted in diminution of xenograft tumor growth with a concomitant reduction of angiogenesis and a stimulation of apoptosis. Conclusion Taken together, our findings show that MMP-10 can play a significant role in tumor growth and progression, and that MMP-10 perturbation may represent a rational strategy for cancer treatment. PMID:24885595

  19. A Preliminary Report on X-Ray Photoabsorption Coefficients andAtomic Scattering Factors for 92 Elements in the 10-10,000 eVRegion

    SciTech Connect

    Henke, B.L.; Davis, J.C.; Gullikson, E.M.; Perera, R.C.C.

    1988-11-01

    Based on currently available photoabsorption measurements and recent theoretical calculations by Doolen and Liberman (Physica Scripta 36, 77 (1987)), a revised (from ADNDT 27, 1 (1982)) best-fit determination of the photoabsorption cross sections is presented here for the elements Z=1 to Z=92 in the 10-10,000 eV range. The photoabsorption data used include those described in the Lockheed and DOE listings of research abstracts for the past ten years and those which have been recently added to the comprehensive NBS Measured Data Base (NBSIR 86-3461, Hubbell et al.). The best-fit curves are compared with both the compilation of measurements and the calculations by Doolen and Liberman. Using the photoabsorption curves, the atomic scattering factors have been calculated for the energy range 50-10,000 eV and are also presented in this report.

  20. 9,10-Phenanthrenequinone promotes secretion of pulmonary aldo-keto reductases with surfactant.

    PubMed

    Matsunaga, Toshiyuki; Haga, Mariko; Watanabe, Gou; Shinoda, Yuhki; Endo, Satoshi; Kajiwara, Yu; Tanaka, Hiroyuki; Inagaki, Naoki; El-Kabbani, Ossama; Hara, Akira

    2012-02-01

    9,10-Phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust particles, induces apoptosis via the generation of reactive oxygen species (ROS) because of 9,10-PQ redox cycling. We have found that intratracheal infusion of 9,10-PQ facilitates the secretion of surfactant into rat alveolus. In the cultured rat lung, treatment with 9,10-PQ results in an increase in a lower-density surfactant by ROS generation through redox cycling of the quinone. The surfactant contains aldo-keto reductase (AKR) 1C15, which reduces 9,10-PQ and the enzyme level in the surfactant increases on treatment with 9,10-PQ suggesting an involvement of AKR1C15 in the redox cycling of the quinone. In six human cell types (A549, MKN45, Caco2, Hela, Molt4 and U937) only type II epithelial A549 cells secrete three human AKR1C subfamily members (AKR1C1, AKR1C2 and AKR1C3) with the surfactant into the medium; this secretion is highly increased by 9,10-PQ treatment. Using in vitro enzyme inhibition analysis, we have identified AKR1C3 as the most abundantly secreted AKR1C member. The AKR1C enzymes in the medium efficiently reduce 9,10-PQ and initiate its redox cycling accompanied by ROS production. The exposure of A549 cells to 9,10-PQ provokes viability loss, which is significantly protected by the addition of the AKR1C3 inhibitor and antioxidant enzyme and by the removal of the surfactants from the culture medium. Thus, the AKR1C enzymes secreted in pulmonary surfactants probably participate in the toxic mechanism triggered by 9,10-PQ.

  1. 9,10-Phenanthrenequinone promotes secretion of pulmonary aldo-keto reductases with surfactant.

    PubMed

    Matsunaga, Toshiyuki; Haga, Mariko; Watanabe, Gou; Shinoda, Yuhki; Endo, Satoshi; Kajiwara, Yu; Tanaka, Hiroyuki; Inagaki, Naoki; El-Kabbani, Ossama; Hara, Akira

    2012-02-01

    9,10-Phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust particles, induces apoptosis via the generation of reactive oxygen species (ROS) because of 9,10-PQ redox cycling. We have found that intratracheal infusion of 9,10-PQ facilitates the secretion of surfactant into rat alveolus. In the cultured rat lung, treatment with 9,10-PQ results in an increase in a lower-density surfactant by ROS generation through redox cycling of the quinone. The surfactant contains aldo-keto reductase (AKR) 1C15, which reduces 9,10-PQ and the enzyme level in the surfactant increases on treatment with 9,10-PQ suggesting an involvement of AKR1C15 in the redox cycling of the quinone. In six human cell types (A549, MKN45, Caco2, Hela, Molt4 and U937) only type II epithelial A549 cells secrete three human AKR1C subfamily members (AKR1C1, AKR1C2 and AKR1C3) with the surfactant into the medium; this secretion is highly increased by 9,10-PQ treatment. Using in vitro enzyme inhibition analysis, we have identified AKR1C3 as the most abundantly secreted AKR1C member. The AKR1C enzymes in the medium efficiently reduce 9,10-PQ and initiate its redox cycling accompanied by ROS production. The exposure of A549 cells to 9,10-PQ provokes viability loss, which is significantly protected by the addition of the AKR1C3 inhibitor and antioxidant enzyme and by the removal of the surfactants from the culture medium. Thus, the AKR1C enzymes secreted in pulmonary surfactants probably participate in the toxic mechanism triggered by 9,10-PQ. PMID:22281686

  2. GEM at 10: a decade's experience with the Guideline Elements Model.

    PubMed

    Hajizadeh, Negin; Kashyap, Nitu; Michel, George; Shiffman, Richard N

    2011-01-01

    The Guideline Elements Model (GEM) was developed in 2000 to organize the information contained in clinical practice guidelines using XML and to represent guideline content in a form that can be understood by human readers and processed by computers. In this work, we systematically reviewed the literature to better understand how GEM was being used, potential barriers to its use, and suggestions for improvement. Fifty external and twelve internally produced publications were identified and analyzed. GEM was used most commonly for modeling and ontology creation. Other investigators applied GEM for knowledge extraction and data mining, for clinical decision support for guideline generation. The GEM Cutter software-used to markup guidelines for translation into XML- has been downloaded 563 times since 2000. Although many investigators found GEM to be valuable, others critiqued its failure to clarify guideline semantics, difficulties in markup, and the fact that GEM files are not usually executable. PMID:22195106

  3. Trace elements in striped dolphins (Stenella coeruleoalba) from the Eastern Mediterranean: A 10-years perspective.

    PubMed

    Shoham-Frider, Efrat; Goffman, Oz; Harlavan, Yehudit; Kress, Nurit; Morick, Danny; Roditi-Elasar, Mia; Shefer, Edna; Kerem, Dan

    2016-08-15

    Concentrations of Hg, Se, Cd, Cu, Zn, Fe, Mn and As, in kidney, liver, muscle and blubber from 7 specimens of Stenella coeruleoalba, stranded along the Israeli Mediterranean coast (IMC) from 2006 to 2011 (2011-series) were determined and compared to previous data on S. coeruleoalba from the IMC (2001-series). No differences were observed in essential and toxic elements concentrations, between the two series, except for hepatic Mn which was higher in the latter. Hg/Se molar ratios in blubber, kidney and liver increased linearly with log Hg concentrations, while muscle was more heterogenic in this respect. Means (±SD) of hepatic Hg concentrations (134±89 and 181±200mgkg(-1), from the 2011 and 2001 series, respectively) were similar to that found in 2007-2009 specimens from Spain, possibly reflecting the relatively high natural background levels of mercury in the Mediterranean Sea. PMID:27210566

  4. The Brome mosaic virus subgenomic promoter hairpin is structurally similar to the iron-responsive element and functionally equivalent to the minus-strand core promoter stem-loop C.

    PubMed Central

    Joost Haasnoot, P C; Olsthoorn, René C L; Bol, John F

    2002-01-01

    In the Bromoviridae family of plant viruses, trinucleotide hairpin loops play an important role in RNA transcription. Recently, we reported that Brome mosaic virus (BMV) subgenomic (sg) transcription depended on the formation of an unusual triloop hairpin. By native gel electrophoresis, enzymatic structure probing, and NMR spectroscopy it is shown here that in the absence of viral replicase the hexanucleotide loop 5'C1AUAG5A3' of this RNA structure can adopt a pseudo trinucleotide loop conformation by transloop base pairing between C1 and G5. By means of in vitro replication assays using partially purified BMV RNA-dependent RNA polymerase (RdRp) it was found that other base pairs contribute to sg transcription, probably by stabilizing the formation of this pseudo triloop, which is proposed to be the primary element recognized by the viral replicase. The BMV pseudo triloop structure strongly resembles iron-responsive elements (IREs) in cellular messenger RNAs and may represent a general protein-binding motif. In addition, in vitro replication assays showed that the BMV sg hairpin is functionally equivalent to the minus-strand core promoter hairpin stem-loop C at the 3' end of BMV RNAs. Replacement of the sg hairpin by stem-loop C yielded increased sg promoter activity whereas replacement of stem-loop C by the sg hairpin resulted in reduced minus-strand promoter activity. We conclude that AUA triloops represent the common motif in the BMV sg and minus-strand promoters required for recruitment of the viral replicase. Additional sequence elements of the minus-strand promoter are proposed to direct the RdRp to the initiation site at the 3' end of the genomic RNA. PMID:11873757

  5. A 3.7 kb fragment of the mouse Scn10a gene promoter directs neural crest but not placodal lineage EGFP expression in a transgenic animal.

    PubMed

    Lu, Van B; Ikeda, Stephen R; Puhl, Henry L

    2015-05-20

    Under physiological conditions, the voltage-gated sodium channel Nav1.8 is expressed almost exclusively in primary sensory neurons. The mechanism restricting Nav1.8 expression is not entirely clear, but we have previously described a 3.7 kb fragment of the Scn10a promoter capable of recapitulating the tissue-specific expression of Nav1.8 in transfected neurons and cell lines (Puhl and Ikeda, 2008). To validate these studies in vivo, a transgenic mouse encoding EGFP under the control of this putative sensory neuron specific promoter was generated and characterized in this study. Approximately 45% of dorsal root ganglion neurons of transgenic mice were EGFP-positive (mean diameter = 26.5 μm). The majority of EGFP-positive neurons bound isolectin B4, although a small percentage (∼10%) colabeled with markers of A-fiber neurons. EGFP expression correlated well with the presence of Nav1.8 transcript (95%), Nav1.8-immunoreactivity (70%), and TTX-R INa (100%), although not all Nav1.8-expressing neurons expressed EGFP. Several cranial sensory ganglia originating from neurogenic placodes, such as the nodose ganglion, failed to express EGFP, suggesting that additional regulatory elements dictate Scn10a expression in placodal-derived sensory neurons. EGFP was also detected in discrete brain regions of transgenic mice. Quantitative PCR and Nav1.8-immunoreactivity confirmed Nav1.8 expression in the amygdala, brainstem, globus pallidus, lateral and paraventricular hypothalamus, and olfactory tubercle. TTX-R INa recorded from EGFP-positive hypothalamic neurons demonstrate the usefulness of this transgenic line to study novel roles of Nav1.8 beyond sensory neurons. Overall, Scn10a-EGFP transgenic mice recapitulate the majority of the Nav1.8 expression pattern in neural crest-derived sensory neurons. PMID:25995484

  6. A 3.7 kb Fragment of the Mouse Scn10a Gene Promoter Directs Neural Crest But Not Placodal Lineage EGFP Expression in a Transgenic Animal

    PubMed Central

    Lu, Van B.; Ikeda, Stephen R.

    2015-01-01

    Under physiological conditions, the voltage-gated sodium channel Nav1.8 is expressed almost exclusively in primary sensory neurons. The mechanism restricting Nav1.8 expression is not entirely clear, but we have previously described a 3.7 kb fragment of the Scn10a promoter capable of recapitulating the tissue-specific expression of Nav1.8 in transfected neurons and cell lines (Puhl and Ikeda, 2008). To validate these studies in vivo, a transgenic mouse encoding EGFP under the control of this putative sensory neuron specific promoter was generated and characterized in this study. Approximately 45% of dorsal root ganglion neurons of transgenic mice were EGFP-positive (mean diameter = 26.5 μm). The majority of EGFP-positive neurons bound isolectin B4, although a small percentage (∼10%) colabeled with markers of A-fiber neurons. EGFP expression correlated well with the presence of Nav1.8 transcript (95%), Nav1.8-immunoreactivity (70%), and TTX-R INa (100%), although not all Nav1.8-expressing neurons expressed EGFP. Several cranial sensory ganglia originating from neurogenic placodes, such as the nodose ganglion, failed to express EGFP, suggesting that additional regulatory elements dictate Scn10a expression in placodal-derived sensory neurons. EGFP was also detected in discrete brain regions of transgenic mice. Quantitative PCR and Nav1.8-immunoreactivity confirmed Nav1.8 expression in the amygdala, brainstem, globus pallidus, lateral and paraventricular hypothalamus, and olfactory tubercle. TTX-R INa recorded from EGFP-positive hypothalamic neurons demonstrate the usefulness of this transgenic line to study novel roles of Nav1.8 beyond sensory neurons. Overall, Scn10a-EGFP transgenic mice recapitulate the majority of the Nav1.8 expression pattern in neural crest-derived sensory neurons. PMID:25995484

  7. Klf10 regulates odontoblast differentiation and mineralization via promoting expression of dentin matrix protein 1 and dentin sialophosphoprotein genes

    PubMed Central

    Chen, Zhuo; Li, Wentong; Wang, Han; Wan, Chunyan; Luo, Daoshu; Deng, Shuli

    2016-01-01

    Klf10, a member of the Krüppel-like family of transcription factors, is critical for osteoblast differentiation, bone formation and mineralization. However, whether Klf10 is involved in odontoblastic differentiation and tooth development has not been determined. In this study, we investigate the expression patterns of Klf10 during murine tooth development in vivo and its role in odontoblastic differentiation in vitro. Klf10 protein was expressed in the enamel organ and the underlying mesenchyme, ameloblasts and odontoblasts at early and later stages of murine molar formation. Furthermore, the expression of Klf10, Dmp1, Dspp and Runx2 was significantly elevated during the process of mouse dental papilla mesenchymal differentiation and mineralization. The overexpression of Klf10 induced dental papilla mesenchymal cell differentiation and mineralization as detected by alkaline phosphatase staining and alizarin red S assay. Klf10 additionally up-regulated the expression of odontoblastic differentiation marker genes Dmp1, Dspp and Runx2 in mouse dental papilla mesenchymal cells. The molecular mechanism of Klf10 in controlling Dmp1 and Dspp expression is thus to activate their regulatory regions in a dosage-dependent manner. Our results suggest that Klf10 is involved in tooth development and promotes odontoblastic differentiation via the up-regulation of Dmp1 and Dspp transcription. PMID:26310138

  8. ALU repeats in promoters are position-dependent co-response elements (coRE) that enhance or repress transcription by dimeric and monomeric progesterone receptors.

    PubMed

    Jacobsen, Britta M; Jambal, Purevsuren; Schittone, Stephanie A; Horwitz, Kathryn B

    2009-07-01

    We have conducted an in silico analysis of progesterone response elements (PRE) in progesterone receptor (PR) up-regulated promoters. Imperfect inverted repeats, direct repeats, and half-site PRE are widespread, not only in PR-regulated, but also in non-PR-regulated and random promoters. Few resemble the commonly used palindromic PRE with three nucleotide (nt) spacers. We speculated that PRE may be necessary but insufficient to control endogenous PR-dependent transcription. A search for PRE partners identified a highly conserved 234-nt sequence invariably located within 1-2 kb of transcription start sites. It resembles ALU repeats and contains binding sites for 11 transcription factors. The 234-nt sequence of the PR-regulated 8-oxoguanine DNA glycosylase promoter was cloned in the forward or reverse orientation in front of zero, one, or two inverted repeat PRE, and one or tandem PRE half-sites, driving luciferase. Under these conditions the 234-nt sequence functions as a co-response element (coRE). From the PRE or tandem half-sites, the reverse coRE is a strong activator of PR and glucocorticoid receptor-dependent transcription. The forward coRE is a powerful repressor. The prevalence of PRE half-sites in natural promoters suggested that PR monomers regulate transcription. Indeed, dimerization-domain mutant PR monomers were stronger transactivators than wild-type PR on PRE or tandem half-sites. This was repressed by the forward coRE. We propose that in natural promoters the coRE functions as a composite response element with imperfect PRE and half-sites to present variable, orientation-dependent transcription factors for interaction with nearby PR. PMID:19372234

  9. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation

    PubMed Central

    Zhu, Zhixin; Wang, Hailong; Wang, Yiting; Guan, Shan; Wang, Fang; Tang, Jingyu; Zhang, Ruijuan; Xie, Lulu; Lu, Yingqing

    2015-01-01

    Cellular activities such as compound synthesis often require the transcriptional activation of an entire pathway; however, the molecular mechanisms underlying pathway activation have rarely been explained. Here, the cis regulatory architecture of the anthocyanin pathway genes targeted by the transcription factor (TF) complex including MYB, bHLH, and WDR was systematically analysed in one species and the findings extended to others. In Ipomoea purpurea, the IpMYB1-IpbHLH2-IpWDR1 (IpMBW) complex was found to be orthologous to the PAP1-GL3-TTG1 (AtPGT) complex of Arabidopsis thaliana, and interacted with a 7-bp MYB-recognizing element (MRE) and a 6-bp bHLH-recognizing element (BRE) at the proximal promoter region of the pathway genes. There was little transcription of the gene in the absence of the MRE or BRE. The cis elements identified experimentally converged on two syntaxes, ANCNNCC for MREs and CACN(A/C/T)(G/T) for BREs, and our bioinformatic analysis showed that these were present within anthocyanin gene promoters in at least 35 species, including both gymnosperms and angiosperms. For the anthocyanin pathway, IpMBW and AtPGT recognized the interspecific promoters of both early and later genes. In A. thaliana, the seed-specific TF complex (TT2, TT8, and TTG1) may regulate all the anthocyanin pathway genes, in addition to the proanthocyanidin-specific BAN. When multiple TF complexes in the anthocyanin pathway were compared, the cis architecture played a role larger than the TF complex in determining the variation in promoter activity. Collectively, a cis logic common to the pathway gene promoters was found, and this logic is essential for the trans factors to regulate the pathway. PMID:25911741

  10. Molecular basis of the recognition of the ap65-1 gene transcription promoter elements by a Myb protein from the protozoan parasite Trichomonas vaginalis.

    PubMed

    Jiang, Ingjye; Tsai, Chen-Kun; Chen, Sheng-Chia; Wang, Szu-Huan; Amiraslanov, Imamaddin; Chang, Chi-Fon; Wu, Wen-Jin; Tai, Jung-Hsiang; Liaw, Yen-Chywan; Huang, Tai-Huang

    2011-11-01

    Iron-inducible transcription of the ap65-1 gene in Trichomonas vaginalis involves at least three Myb-like transcriptional factors (tvMyb1, tvMyb2 and tvMyb3) that differentially bind to two closely spaced promoter sites, MRE-1/MRE-2r and MRE-2f. Here, we defined a fragment of tvMyb2 comprising residues 40-156 (tvMyb2₄₀₋₁₅₆) as the minimum structural unit that retains near full binding affinity with the promoter DNAs. Like c-Myb in vertebrates, the DNA-free tvMyb2₄₀₋₁₅₆ has a flexible and open conformation. Upon binding to the promoter DNA elements, tvMyb2₄₀₋₁₅₆ undergoes significant conformational re-arrangement and structure stabilization. Crystal structures of tvMyb2₄₀₋₁₅₆ in complex with promoter element-containing DNA oligomers showed that 5'-a/gACGAT-3' is the specific base sequence recognized by tvMyb2₄₀₋₁₅₆, which does not fully conform to that of the Myb binding site sequence. Furthermore, Lys⁴⁹, which is upstream of the R2 motif (amino acids 52-102) also participates in specific DNA sequence recognition. Intriguingly, tvMyb2₄₀₋₁₅₆ binds to the promoter elements in an orientation opposite to that proposed in the HADDOCK model of the tvMyb1₃₅₋₁₄₁/MRE-1-MRE-2r complex. These results shed new light on understanding the molecular mechanism of Myb-DNA recognition and provide a framework to study the molecular basis of transcriptional regulation of myriad Mybs in T. vaginalis. PMID:21771861

  11. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  12. A constitutive decay element promotes tumor necrosis factor alpha mRNA degradation via an AU-rich element-independent pathway.

    PubMed

    Stoecklin, Georg; Lu, Min; Rattenbacher, Bernd; Moroni, Christoph

    2003-05-01

    Tumor necrosis factor alpha (TNF-alpha) expression is regulated by transcriptional as well as posttranscriptional mechanisms, the latter including the control of mRNA decay through an AU-rich element (ARE) in the 3' untranslated region (UTR). Using two mutant cell lines deficient for ARE-mediated mRNA decay, we provide evidence for a second element, the constitutive decay element (CDE), which is also located in the 3' UTR of TNF-alpha. In stably transfected RAW 264.7 macrophages stimulated with lipopolysaccharide (LPS), the CDE continues to target a reporter transcript for rapid decay, whereas ARE-mediated decay is blocked. Similarly, the activation of p38 kinase and phosphatidylinositol 3-kinase in NIH 3T3 cells inhibits ARE-mediated but not CDE-mediated mRNA decay. The CDE was mapped to an 80-nucleotide (nt) segment downstream of the ARE, and point mutation analysis identified within the CDE a conserved sequence of 15 nt that is required for decay activity. We propose that the CDE represses TNF-alpha expression by maintaining the mRNA short-lived, thereby preventing excessive induction of TNF-alpha after LPS stimulation. Thus, CDE-mediated mRNA decay is likely to be an important mechanism limiting LPS-induced pathologic processes.

  13. Activation of proglucagon gene transcription through a novel promoter element by the caudal-related homeodomain protein cdx-2/3.

    PubMed Central

    Jin, T; Drucker, D J

    1996-01-01

    The proglucagon gene is expressed in a highly restricted tissue-specific manner in the A cells of the pancreatic islet and the L cells of the small and large intestines. The results of previous experiments indicate that cell-specific expression of the proglucagon gene is mediated by proteins that interact with the proximal G1 promoter element. We show here that the G1 element contains several AT-rich subdomains that bind proteins present in islet and enteroendocrine cell extracts. Electrophoretic mobility shift assay experiments using specific antisera identified the homeobox protein cdx-2/3 (which designates the same homeobox protein called cdx-2 for mice and cdx-3 for hamsters) as a major component of the G1-Gc2 complex in islet and intestinal cells. Mutations of the Gc element that decreased cdx-2/3 binding also resulted in decreased proglucagon promoter activity in islet and intestinal cell lines. The finding that cdx-2/3 mediates activation of the proglucagon promoter in both islet and enteroendocrine cells is consistent with the common endodermal lineage of these tissues and provides new insight into the coordinate regulation of genes expressed in both pancreatic and intestinal endocrine cell types. PMID:8524295

  14. FEHMN 1.0: Finite element heat and mass transfer code

    SciTech Connect

    Zyvoloski, G.; Dash, Z.; Kelkar, S.

    1991-04-01

    A computer code is described which can simulate non-isothermal multiphase multicomponent flow in porous media. It is applicable to natural-state studies of geothermal systems and ground-water flow. The equations of heat and mass transfer for multiphase flow in porous and permeable media are solved using the finite element method. The permeability and porosity of the medium are allowed to depend on pressure and temperature. The code also has provisions for movable air and water phases and noncoupled tracers; that is, tracer solutions that do not affect the heat and mass transfer solutions. The tracers can be passive or reactive. The code can simulate two-dimensional, two-dimensional radial, or three-dimensional geometries. A summary of the equations in the model and the numerical solution procedure are provided in this report. A user`s guide and sample problems are also included. The main use of FEHMN will be to assist in the understanding of flow fields in the saturated zone below the proposed Yucca Mountain Repository. 33 refs., 27 figs., 12 tabs.

  15. Chemical studies of H chondrites-10: Contents of thermally labile trace elements are unaffected by late heating

    NASA Astrophysics Data System (ADS)

    Wang, Ming-Sheng; Wolf, Stephen F.; Lipschutz, Michael E.

    1999-09-01

    We have used radiochemical neutron activation analysis (RNAA) to determine 15 trace elements, including 10 moderately and highly volatile ones - Rb, Ag, Se, Cs, Te, Zn, Cd, Bi, Tl, In (in increasing volatility order) - in 6 H chondrite falls with low 3He contents. These plus prior RNAA data provide a compositional database of 92 H4-6 chondrite falls. Three suites of samples can be identified from their noble gas contents: 44 with "normal" contents, and, therefore, "normal" orbits and cosmic ray exposure histories; 8 that lost radiogenic gases, presumably by shock late in their histories; and 17 that lost cosmogenic gases by heating during close solar approach. We used the standard multivariate statistical techniques of linear discriminant analysis and logistic regression to compare contents of the 10 moderately and highly volatile trace elements, listed above, in these 3 suites. We found no significant differences. This contrasts sharply with similar comparisons involving random falls and H4-6 chondrites that landed on Earth at specific time intervals. Apparently, contents of volatile trace elements in H4-6 chondrites were established early in their histories and they are so retentively sited that loss during later heating episodes did not occur.

  16. Spatial distribution and potential sources of trace elements in PM10 monitored in urban and rural sites of Piedmont Region.

    PubMed

    Padoan, Elio; Malandrino, Mery; Giacomino, Agnese; Grosa, Mauro M; Lollobrigida, Francesco; Martini, Sara; Abollino, Ornella

    2016-02-01

    The results on elemental composition of aerosol (PM10) sampled during 2011 in Piedmont region (Italy) are interpreted using meteorological data, Enrichment Factors (EF), chemometric processing by Principal Component Analysis (PCA), Factor Analysis (FA) and Hierarchical Cluster Analysis (HCA). Daily concentrations of about 30 elements were measured using HR-ICP-MS in five monitoring sites. A clear seasonal pattern, with higher concentrations in autumn and winter, was observed, particularly in the urban sites. Levels of As, Cd, Ni and Pb in most of the samples were within the limits imposed by the European legislation. Spatial differences in PM10 and metal concentrations were significant, with rural and urban sites showing different metal patterns, indicating different sources. K and Ca were used, respectively, as marker of biomass burning and industrial marker (cement plant); EFs showed that Ca was enriched just in one area and K was enriched only in the winter period considered and in some stations. Data analysis through PCA, FA and HCA allowed us to identify correlations among the investigated elements and similarities between sampling sites in order to individuate specific emission sources, such as non-exhaust vehicle emission.

  17. Association between interleukin-10 gene promoter polymorphisms and susceptibility to liver cirrhosis.

    PubMed

    Yao, Lanjie; Xing, Shuli; Fu, Xueqin; Song, Hongjie; Wang, Zhendong; Tang, Jianrong; Zhao, Yongjing

    2015-01-01

    We conducted a case-control study to investigate the association between three common SNPs in IL-10 gene (rs1800896, rs1800871 and rs1800872) and the development of liver cirrhosis in a Chinese population. Between January 2013 and December 2014, a total of 318 patients with liver cirrhosis and 318 health control subjects were enrolled into our study. The IL-10 rs1800896, rs1800871 and rs1800872 polymorphisms were analyzed using polymerase chain reaction (PCR) coupled with restriction fragment length polymorphism (RFLP). By multivariate logistic regression analysis, we found that individuals with the AA genotype and GA+AA genotype of IL-10 rs1800896 were more likely to have an increased risk of liver cirrhosis when compared with the GG genotype, and the ORs (95% CI) for the AA genotype and GA+AA genotype were 2.04 (1.20-3.50) and 1.41 (1.02-1.96), respectively. We found that the GA+AA genotype of IL-10 rs1800896 had higher risk of liver cirrhosis in individuals with chronic hepatitis B when compared with the GG genotype (OR = 1.95, 95% CI = 1.01-3.59). In conclusion, we found that IL-10 rs1800896 polymorphism was correlated with an increased risk of liver cirrhosis, especially in individuals with chronic hepatitis B.

  18. KLF10 Mediated Epigenetic Dysregulation of Epithelial CD40/CD154 Promotes Endometriosis.

    PubMed

    Delaney, Abigail A; Khan, Zaraq; Zheng, Ye; Correa, Luiz F; Zanfagnin, Valentina; Shenoy, Chandra C; Schoolmeester, John K; Saadalla, Abdulrahman M; El-Nashar, Sherif; Famuyide, Abimbola O; Subramaniam, Malayannan; Hawse, John R; Khazaie, Khashayarsha; Daftary, Gaurang S

    2016-09-01

    Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human disease association, loss of the paralog Klf10 causes a unique inflammatory, cystic endometriosis phenotype in contrast to fibrotic progression seen with loss of Klf11. We identify here for the first time a novel role for KLF10 in endometriosis. In an animal endometriosis model, unlike wild-type controls, Klf10(-/-) animals developed cystic lesions with massive immune infiltrate and minimal peri-lesional fibrosis. The Klf10(-/-) disease progression phenotype also contrasted with prolific fibrosis and minimal immune cell infiltration seen in Klf11(-/-) animals. We further found that lesion genotype rather than that of the host determined each unique disease progression phenotype. Mechanistically, KLF10 regulated CD40/CD154-mediated immune pathways. Both inflammatory as well as fibrotic phenotypes are the commonest clinical manifestations in chronic fibro-inflammatory diseases such as endometriosis. The complementary, paralogous Klf10 and Klf11 models therefore offer novel insights into the mechanisms of inflammation and fibrosis in a disease-relevant context. Our data suggests that divergence in underlying gene dysregulation critically determines disease-phenotype predominance rather than the conventional paradigm of inflammation being precedent to fibrotic scarring. Heterogeneity in clinical progression and treatment response are thus likely from disparate gene regulation profiles. Characterization of disease phenotype-associated gene dysregulation offers novel approaches for developing targeted, individualized therapy for recurrent and recalcitrant chronic disease. PMID:27488034

  19. Lentivirus delivery of IL-10 to promote and sustain macrophage polarization towards an anti-inflammatory phenotype.

    PubMed

    Boehler, R M; Kuo, R; Shin, S; Goodman, A G; Pilecki, M A; Gower, R M; Leonard, J N; Shea, L D

    2014-06-01

    Gene delivery from biomaterials can create an environment that promotes and guides tissue formation. However, the immune response induced upon biomaterial implantation can be detrimental to tissue regeneration. Macrophages play a central role in mediating early phases of this response, and functional "polarization" of macrophages towards M1 (inflammatory) or M2 (anti-inflammatory) phenotypes may bias the local immune state at the implant site. Since gene delivery from biomaterial scaffolds can confer transgene expression in macrophages in vivo, we investigated whether transduction of macrophages with an IL-10 encoding lentivirus can (1) induce macrophage polarization toward an M2 phenotype even in an pro-inflammatory environment, and (2) prevent a shift in polarization from M2 to M1 following exposure to pro-inflammatory stimuli. IL-10 lentivirus delivery to pre-polarized M1 macrophages reduced TNF-α production 1.5-fold when compared to cells treated with either a control virus or a bolus delivery of recombinant IL-10 protein. IL-10 lentivirus delivery to naïve macrophages reduced the amount of TNF-α produced following an inflammatory challenge by 2.5-fold compared to cells treated with both the control virus and recombinant IL-10. At a mechanistic level, IL-10 lentivirus delivery mediated sustained reduction in NF-κB activation and, accordingly, reduced transcription of TNF-α. In sum, lentiviral delivery of IL-10 to macrophages represents a promising strategy for directing and sustaining macrophage polarization towards an M2 phenotype in order to promote local immune responses that facilitate tissue engineering.

  20. Promoting a Functional Physical Self-Concept in Physical Education: Evaluation of a 10-Week Intervention

    ERIC Educational Resources Information Center

    Schmidt, Mirko; Valkanover, Stefan; Roebers, Claudia; Conzelmann, Achim

    2013-01-01

    Most physical education intervention studies on the positive effect of sports on self-concept development have attempted to "increase" schoolchildren's self-concept without taking the "veridicality" of the self-concept into account. The present study investigated whether a 10-week intervention in physical education would…

  1. An Instrument to Measure Elemental Energy Spectra of Cosmic Ray Nuclei Up to 10(exp 16) eV

    NASA Technical Reports Server (NTRS)

    Adams, J.; Bashindzhagyan, G.; Chilingarian, A.; Drury, L.; Egorov, N.; Golubkov,S.; Korotkova, N.; Panasyuk, M.; Podorozhnyi, D.; Procqureur, J.

    2000-01-01

    A longstanding goal of cosmic ray research is to measure the elemental energy spectra of cosmic rays up to and through the "knee" (approx. equal to 3 x 10 (exp 15) eV. It is not currently feasible to achieve this goal with an ionization calorimeter because the mass required to be deployed in Earth orbit is very large (at least 50 tonnes). An alternative method will be presented. This is based on measuring the primary particle energy by determining the angular distribution of secondaries produced in a target layer using silicon microstrip detector technology. The proposed technique can be used over a wide range of energies (10 (exp 11)- 10 (exp 16) eV) and gives an energy resolution of 60% or better. Based on this technique, a design for a new lightweight instrument with a large aperture (KLEM) will be described.

  2. Concentrations and source apportionment of PM10 and associated major and trace elements in the Rhodes Island, Greece.

    PubMed

    Argyropoulos, Georgios; Manoli, Evangelia; Kouras, Athanasios; Samara, Constantini

    2012-08-15

    Ambient concentrations of PM(10) and associated major and trace elements were measured over the cold and the warm season of 2007 at two sites located in the Rhodes Island (Greece), in Eastern Mediterranean, aimed at source apportionment by Chemical Mass Balance (CMB) receptor modeling. Source chemical profiles, necessary in CMB modeling, were obtained for a variety of emission sources that could possibly affect the study area, including sea spray, geological material, soot emissions from the nearby oil-fuelled thermal power plant, and other anthropogenic activities, such as vehicular traffic, residential oil combustion, wood burning, and uncontrolled open-air burning of agricultural biomass and municipal waste. Source apportionment of PM(10) and elemental components was carried out by employing an advanced CMB version, the Robotic Chemical Mass Balance model (RCMB). Vehicular emissions were found to be major PM(10) contributor accounting, on average, for 36.8% and 31.7% during the cold period, and for 40.9% and 39.2% in the warm period at the two sites, respectively. The second largest source of ambient PM(10), with minor seasonal variation, was secondary sulfates (mainly ammonium and calcium sulfates), with total average contribution around 16.5% and 18% at the two sites. Soil dust was also a remarkable source contributing around 22% in the warm period, whereas only around 10% in the cold season. Soot emitted from the thermal power plant was found to be negligible contributor to ambient PM(10) (<1%), however it appeared to appreciably contribute to the ambient V and Ni (11.3% and 5.1%, respectively) at one of the sites during the warm period, when electricity production is intensified. Trajectory analysis did not indicate any transport of Sahara dust; on the contrary, long range transport of soil dust from arid continental regions of Minor Asia and of biomass burning aerosol from the countries surrounding the Black Sea was considered possible.

  3. Ephedrine hydrochloride protects mice from LPS challenge by promoting IL-10 secretion and inhibiting proinflammatory cytokines.

    PubMed

    Zheng, Yuejuan; Guo, Ziyi; He, Weigang; Yang, Yang; Li, Yuhu; Zheng, Aoxiang; Li, Ping; Zhang, Yan; Ma, Jinzhu; Wen, Mingyue; Yang, Muyi; An, Huazhang; Ji, Guang; Yu, Yizhi

    2012-05-01

    Sepsis and its derivative endotoxic shock are still serious conditions with high mortality in the intensive care unit. The mechanisms that ensure the balance of proinflammatory cytokines and anti-inflammatory cytokine production are of particular importance. As an active α- and β-adrenergic agonist, ephedrine hydrochloride (EH) is a widely used agent for cardiovascular diseases, especially boosting blood pressure. Here we demonstrate that EH increased Toll-like receptor 4 (TLR4)-mediated production of interleukin 10 (IL-10) through p38 MAPK activation. Simultaneously, EH negatively regulated the production of proinflammatory cytokines. Consistently, EH increased lipopolysaccharide (LPS)-induced serum IL-10 and inhibited tumor necrotic factor-α (TNFα) production in vivo. As a result, EH treatment protected mice from endotoxic shock by lethal LPS challenge. In brief, our data demonstrated that EH could contribute to immune homeostasis by balancing the production of proinflammatory cytokines and anti-inflammatory cytokine in TLR4 signaling. This study provides a potential usage of EH in autoimmunologic diseases or other severe inflammations.

  4. Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.

    PubMed

    Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank

    2014-10-01

    Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression.

  5. Reduction of TIP30 in esophageal squamous cell carcinoma cells involves promoter methylation and microRNA-10b

    SciTech Connect

    Dong, Wenjie; Shen, Ruizhe; Cheng, Shidan

    2014-10-31

    Highlights: • TIP30 expression is frequently suppressed in ESCC. • TIP30 was hypermethylated in ESCC. • Reduction of TIP30 was significantly correlated with LN metastasis. • miR-10b is a direct regulator of TIP30. - Abstract: TIP30 is a putative tumor suppressor that can promote apoptosis and inhibit angiogenesis. However, the role of TIP30 in esophageal squamous cell carcinoma (ESCC) biology has not been investigated. Immunohistochemistry was used to investigate the expression of TIP30 in 70 ESCC. Hypermethylation of TIP30 was evaluated by the methylation specific PCR (MSP) method in ESCC (tumor and paired adjacent non-tumor tissues). Lost expression of TIP30 was observed in 50 of 70 (71.4%) ESCC. 61.4% (43 of 70) of primary tumors analyzed displayed TIP30 hypermethylation, indicating that this aberrant characteristic is common in ESCC. Moreover, a statistically significant inverse association was found between TIP30 methylation status and expression of the TIP30 protein in tumor tissues (p = 0.001). We also found that microRNA-10b (miR-10b) targets a homologous DNA region in the 3′untranslated region of the TIP30 gene and represses its expression at the transcriptional level. Reporter assay with 3′UTR of TIP30 cloned downstream of the luciferase gene showed reduced luciferase activity in the presence of miR-10b, providing strong evidence that miR-10b is a direct regulator of TIP30. These results suggest that TIP30 expression is regulated by promoter methylation and miR-10b in ESCC.

  6. Element distribution in the corrosion layer and cytotoxicity of alloy Mg-10Dy during in vitro biodegradation.

    PubMed

    Yang, Lei; Hort, Norbert; Laipple, Daniel; Höche, Daniel; Huang, Yuanding; Kainer, Karl Ulrich; Willumeit, Regine; Feyerabend, Frank

    2013-11-01

    The present work investigates the corrosion behaviour, the element distribution in the corrosion layer and the cytocompatibility of alloy Mg-10Dy. The corrosion experiments were performed in a cell culture medium (CCM) under cell culture conditions close to the in vivo environment. The element distribution on the surface as well as in cross-sections of the corrosion layer was investigated using scanning electron microscopy, energy-dispersive X-ray analysis, X-ray photoelectron spectroscopy and X-ray diffraction. The cytocompatibility of alloy Mg-10Dy with primary human osteoblasts was evaluated by MTT, cell adhesion and live/dead staining tests. The results show that the corrosion layer was enriched in Dy, while the P and Ca content gradually decreased from the surface to the bottom of the corrosion layer. In addition, large amounts of MgCO3·3H2O formed in the corrosion layer after 28 days immersion. Both extracts and the Dy-enriched corrosion layer of alloy Mg-10Dy showed no cytotoxicity to primary human osteoblasts.

  7. A reciprocal translocation dissects roles of Pax6 alternative promoters and upstream regulatory elements in the development of pancreas, brain, and eye.

    PubMed

    Elso, Colleen; Lu, Xiaochen; Weisner, Patricia A; Thompson, Heather L; Skinner, Andrea; Carver, Ethan; Stubbs, Lisa

    2013-09-01

    Pax6 encodes a transcription factor with key roles in the development of the pancreas, central nervous system, and eye. Gene expression is orchestrated by several alternative promoters and enhancer elements that are distributed over several hundred kilobases. Here, we describe a reciprocal translocation, called 1Gso, which disrupts the integrity of transcripts arising from the 5'-most promoter, P0, and separates downstream promoters from enhancers active in pancreas and eye. Despite this fact, 1Gso animals exhibit none of the dominant Pax6 phenotypes, and the translocation complements recessive brain and craniofacial phenotypes. However, 1Gso fails to complement Pax6 recessive effects in lacrimal gland, conjunctiva, lens, and pancreas. The 1Gso animals also express a corneal phenotype that is related to but distinct from that expressed by Pax6 null mutants, and an abnormal density and organization of retinal ganglion cell axons; these phenotypes may be related to a modest upregulation of Pax6 expression from downstream promoters that we observed during development. Our investigation maps the activities of Pax6 alternative promoters including a novel one in developing tissues, confirms the phenotypic consequences of upstream enhancer disruption, and limits the likely effects of the P0 transcript null mutation to recessive abnormalities in the pancreas and specific structures of the eye.

  8. Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells.

    PubMed

    Keller, M J; Wheeler, D G; Cooper, E; Meier, J L

    2003-06-01

    Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings.

  9. Solution structure of the biologically relevant G-quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization.

    PubMed

    Ambrus, Attila; Chen, Ding; Dai, Jixun; Jones, Roger A; Yang, Danzhou

    2005-02-15

    The nuclease hypersensitivity element III(1) (NHE III(1)) of the c-MYC promoter strongly controls the transcriptional activity of the c-MYC oncogene. The purine-rich strand of the NHE III(1) element has been shown to be a silencer element for c-MYC transcription upon formation of a G-quadruplex structure. We have determined the predominant G-quadruplex structure of this silencer element in potassium solution by NMR. The G-quadruplex structure adopts an intramolecular parallel-stranded quadruplex conformation with three guanine tetrads and three side loops, including two single-nucleotide side loops and one double-nucleotide side loop, that connect the four guanine strands. The three side loops are very stable and well-defined. The 3'-flanking sequence forms a stable fold-back stacking conformation capping the top end of the G-quadruplex structure. The 5'-flanking A and G bases cap the bottom end of the G-quadruplex, with the adenine stacking very well with the bottom tetrad. This paper reports the first solution structure of a G-quadruplex found to form in the promoter region of an oncogene (c-MYC). This G-quadruplex structure is extremely stable, with a similar melting temperature (>85 degrees C) to that of the wild-type 27-mer purine-rich NHE III(1) sequence of the c-MYC promoter. This predominant quadruplex structure has been shown to be biologically relevant, and the structural information revealed in this research provides an important basis for the design of new drug candidates that specifically target the c-MYC G-quadruplex structure and modulate gene expression. PMID:15697230

  10. Retrotransposons and their recognition of pol II promoters: a comprehensive survey of the transposable elements from the complete genome sequence of Schizosaccharomyces pombe.

    PubMed

    Bowen, Nathan J; Jordan, I King; Epstein, Jonathan A; Wood, Valerie; Levin, Henry L

    2003-09-01

    The complete DNA sequence of the genome of Schizosaccharomyces pombe provides the opportunity to investigate the entire complement of transposable elements (TEs), their association with specific sequences, their chromosomal distribution, and their evolution. Using homology-based sequence identification, we found that the sequenced strain of S. pombe contained only one family of full-length transposons. This family, Tf2, consisted of 13 full-length copies of a long terminal repeat (LTR) retrotransposon. We found that LTR-LTR recombination of previously existing transposons had resulted in extensive populations of solo LTRs. These included 35 solo LTRs of Tf2, as well as 139 solo LTRs from other Tf families. Phylogenetic analysis of solo Tf LTRs reveals that Tf1 and Tf2 were the most recently active elements within the genome. The solo LTRs also served as footprints for previous insertion events by the Tf retrotransposons. Analysis of 186 genomic insertion events revealed a close association with RNA polymerase II promoters. These insertions clustered in the promoter-proximal regions of genes, upstream of protein coding regions by 100 to 400 nucleotides. The association of Tf insertions with pol II promoters was very similar to the preference previously observed for Tf1 integration. We found that the recently active Tf elements were absent from centromeres and pericentromeric regions of the genome containing tandem tRNA gene clusters. In addition, our analysis revealed that chromosome III has twice the density of insertion events compared to the other two chromosomes. Finally we describe a novel repetitive sequence, wtf, which was also preferentially located on chromosome III, and was often located near solo LTRs of Tf elements. PMID:12952871

  11. Identification of two nuclear factor of activated T-cells (NFAT)-response elements in the 5'-upstream regulatory region of the ET-1 promoter.

    PubMed

    Strait, Kevin A; Stricklett, Peter K; Kohan, Rachel M; Kohan, Donald E

    2010-09-10

    Collecting duct-derived ET-1 regulates salt excretion and blood pressure. We have reported the presence of an inner medullary collecting duct (IMCD)-specific enhancer region in the 5'-upstream ET-1 promoter (Strait, K. A., Stricklett, P. K., Kohan, J. L., Miller, M. B., and Kohan, D. E. (2007) Am. J. Physiol. Renal Physiol. 293, F601-F606). The current studies provide further characterization of the ET-1 5'-upstream distal promoter to identify the IMCD-specific enhancer elements. Deletion studies identified two regions of the 5'-upstream ET-1 promoter, -1725 to -1319 bp and -1319 to -1026 bp, which were required for maximal promoter activity in transfected rat IMCD cells. Transcription factor binding site analysis of these regions identified two consensus nuclear factor of activated T-cells (NFAT) binding sites at -1263 and -1563. EMSA analysis using nuclear extracts from IMCD cells showed that both the -1263 and the -1563 NFAT sites in the ET-1 distal promoter competed for NFAT binding to previously identified NFAT sites in the IL-2 and TNF genes. Gel supershift analysis showed that each of the NFAT binding sites in the ET-1 promoter bound NFAT proteins derived from IMCD nuclear extracts, but they selectively bound different NFAT isoforms; ET-1263 bound NFATc1, whereas ET-1563 bound NFATc3. Site-directed mutagenesis of either the ET-1263 or the ET-1563 sites prevented NFAT binding and reduced ET-1 promoter activity. Thus, NFAT appears to be an important regulator of ET-1 transcription in IMCD cells, and thus, it may play a role in controlling blood pressure through ET-1 regulation of renal salt excretion.

  12. CD4+ T Cell-derived IL-10 Promotes Brucella abortus Persistence via Modulation of Macrophage Function

    PubMed Central

    Xavier, Mariana N.; Winter, Maria G.; Spees, Alanna M.; Nguyen, Kim; Atluri, Vidya L.; Silva, Teane M. A.; Bäumler, Andreas J.; Müller, Werner; Santos, Renato L.; Tsolis, Renée M.

    2013-01-01

    Evasion of host immune responses is a prerequisite for chronic bacterial diseases; however, the underlying mechanisms are not fully understood. Here, we show that the persistent intracellular pathogen Brucella abortus prevents immune activation of macrophages by inducing CD4+CD25+ T cells to produce the anti-inflammatory cytokine interleukin-10 (IL-10) early during infection. IL-10 receptor (IL-10R) blockage in macrophages resulted in significantly higher NF-kB activation as well as decreased bacterial intracellular survival associated with an inability of B. abortus to escape the late endosome compartment in vitro. Moreover, either a lack of IL-10 production by T cells or a lack of macrophage responsiveness to this cytokine resulted in an increased ability of mice to control B. abortus infection, while inducing elevated production of pro-inflammatory cytokines, which led to severe pathology in liver and spleen of infected mice. Collectively, our results suggest that early IL-10 production by CD25+CD4+ T cells modulates macrophage function and contributes to an initial balance between pro-inflammatory and anti-inflammatory cytokines that is beneficial to the pathogen, thereby promoting enhanced bacterial survival and persistent infection. PMID:23818855

  13. A meiotic chromosomal core consisting of cohesin complex proteins recruits DNA recombination proteins and promotes synapsis in the absence of an axial element in mammalian meiotic cells.

    PubMed

    Pelttari, J; Hoja, M R; Yuan, L; Liu, J G; Brundell, E; Moens, P; Santucci-Darmanin, S; Jessberger, R; Barbero, J L; Heyting, C; Höög, C

    2001-08-01

    The behavior of meiotic chromosomes differs in several respects from that of their mitotic counterparts, resulting in the generation of genetically distinct haploid cells. This has been attributed in part to a meiosis-specific chromatin-associated protein structure, the synaptonemal complex. This complex consist of two parallel axial elements, each one associated with a pair of sister chromatids, and a transverse filament located between the synapsed homologous chromosomes. Recently, a different protein structure, the cohesin complex, was shown to be associated with meiotic chromosomes and to be required for chromosome segregation. To explore the functions of the two different protein structures, the synaptonemal complex and the cohesin complex, in mammalian male meiotic cells, we have analyzed how absence of the axial element affects early meiotic chromosome behavior. We find that the synaptonemal complex protein 3 (SCP3) is a main determinant of axial-element assembly and is required for attachment of this structure to meiotic chromosomes, whereas SCP2 helps shape the in vivo structure of the axial element. We also show that formation of a cohesin-containing chromosomal core in meiotic nuclei does not require SCP3 or SCP2. Our results also suggest that the cohesin core recruits recombination proteins and promotes synapsis between homologous chromosomes in the absence of an axial element. A model for early meiotic chromosome pairing and synapsis is proposed. PMID:11463847

  14. A feedback control element near the transcription start site of the maize Shrunken gene determines promoter activity.

    PubMed Central

    Maas, C; Schaal, S; Werr, W

    1990-01-01

    The transcriptional activity of the Shrunken (Sh) promoter of Zea mays was monitored in transient expression assays using the neomycin phosphotransferase (NPT) II gene as a reporter in maize suspension protoplasts. Shortly after transfection, expression of this chimeric NPTII gene was negatively affected by high extracellular sucrose concentrations in the protoplast cultivation medium. However, 3-5 days after transfection an up to 405-fold increase in NPTII activity was observed. This could be blocked by dichlorobenzonitril (DCB) an inhibitor of cellulose biosynthesis. In the analysis of promoter deletions 20 bp upstream of the Sh transcription start site were sufficient to reproduce the expression profile and the activity of the full promoter. Surprisingly this start sequence does not include the natural TATA-box. Images Fig.1 Fig.2 Fig.3 Fig.4 PMID:2145150

  15. Thyroid hormones directly activate the expression of the human and mouse uncoupling protein-3 genes through a thyroid response element in the proximal promoter region

    PubMed Central

    2004-01-01

    The transcription of the human UCP3 (uncoupling protein-3) gene in skeletal muscle is tightly regulated by metabolic signals related to fatty acid availability. However, changes in thyroid status also modulate UCP3 gene expression, albeit by unknown mechanisms. We created transgenic mice bearing the entire human UCP3 gene to investigate the effect of thyroid hormones on human UCP3 gene expression. Treatment of human UCP3 transgenic mice with thyroid hormones induced the expression of the human gene in skeletal muscle. In addition, transient transfection experiments demonstrate that thyroid hormones activate the transcription of the human UCP3 gene promoter when MyoD and the TR (thyroid hormone receptor) were co-transfected. The action of thyroid hormones on UCP3 gene transcription is mediated by the binding of the TR to a proximal region in the UCP3 gene promoter that contains a direct repeat structure. An intact DNA sequence of this site is required for thyroid hormone responsiveness and TR binding. Chromatin immunoprecipitation assays revealed that the TR binds this element in vivo. The murine Ucp3 gene promoter was also dependent on MyoD and responsive to thyroid hormone in transient transfection assays. However, it was much less sensitive to thyroid hormone than the human UCP3 promoter. In summary, UCP3 gene transcription is activated by thyroid hormone treatment in vivo, and this activation is mediated by a TRE (thyroid hormone response element) in the proximal promoter region. Such regulation suggests a link between UCP3 gene expression and the effects of thyroid hormone on mitochondrial function in skeletal muscle. PMID:15496137

  16. Suppression of the pancreatic duodenal homeodomain transcription factor-1 (Pdx-1) promoter by sterol regulatory element-binding protein-1c (SREBP-1c).

    PubMed

    Amemiya-Kudo, Michiyo; Oka, Junko; Takeuchi, Yoshinori; Okazaki, Hiroaki; Yamamoto, Takashi; Yahagi, Naoya; Matsuzaka, Kaori; Okazaki, Sachiko; Osuga, Jun-ichi; Yamada, Nobuhiro; Murase, Toshio; Shimano, Hitoshi

    2011-08-12

    Overexpression of sterol regulatory element-binding protein-1c (SREBP-1c) in β cells causes impaired insulin secretion and β cell dysfunction associated with diminished pancreatic duodenal homeodomain transcription factor-1 (PDX-1) expression in vitro and in vivo. To identify the molecular mechanism responsible for this effect, the mouse Pdx-1 gene promoter (2.7 kb) was analyzed in β cell and non-β cell lines. Despite no apparent sterol regulatory element-binding protein-binding sites, the Pdx-1 promoter was suppressed by SREBP-1c in β cells in a dose-dependent manner. PDX-1 activated its own promoter. The E-box (-104/-99 bp) in the proximal region, occupied by ubiquitously expressed upstream stimulatory factors (USFs), was crucial for the PDX-1-positive autoregulatory loop through direct PDX-1·USF binding. This positive feedback activation was a prerequisite for SREBP-1c suppression of the promoter in non-β cells. SREBP-1c and PDX-1 directly interact through basic helix-loop-helix and homeobox domains, respectively. This robust SREBP-1c·PDX-1 complex interferes with PDX-1·USF formation and inhibits the recruitment of PDX-1 coactivators. SREBP-1c also inhibits PDX-1 binding to the previously described PDX-1-binding site (-2721/-2646 bp) in the distal enhancer region of the Pdx-1 promoter. Endogenous up-regulation of SREBP-1c in INS-1 cells through the activation of liver X receptor and retinoid X receptor by 9-cis-retinoic acid and 22-hydroxycholesterol inhibited PDX-1 mRNA and protein expression. Conversely, SREBP-1c RNAi restored Pdx-1 mRNA and protein levels. Through these multiple mechanisms, SREBP-1c, when induced in a lipotoxic state, repressed PDX-1 expression contributing to the inhibition of insulin expression and β cell dysfunction.

  17. The Behavior of Rare Earth and Other Trace Elements During Laboratory Melting of the Mantle at 1.0 GPa.

    NASA Astrophysics Data System (ADS)

    Johnston, A.; Schwab, B. E.; Witter, J. P.

    2002-12-01

    Earlier piston-cylinder experiments in our laboratory produced a collection of mantle melting run products that have now been analyzed by ion probe for selected REE, Ti, Cr, Rb, Sr, Y, Zr, and Nb. Starting materials consisted of five fertile to intermediate, lherzolitic to wehrlitic mixtures of natural ol, cpx, opx, and sp handpicked from fresh xenoliths. Samples were run in graphite-lined Pt capsules and the melt was separated from the residual minerals into a layer of vitreous carbon spheres (VCS) thus circumventing the problems of Fe-loss and quench modification of the melt. Major element compositions of all phases were determined previously by electron microprobe and least-squares inversion of these data yielded modes for all run products. The bulk starting materials were analyzed for trace and major elements by ICP-MS and-ES at Boston University. The principle goals of the study were to evaluate whether the trace element data support the conclusion reached previously from the major element data that these run products represent very close approaches to equilibrium, and to evaluate whether the glass data set could be inverted to yield meaningful mineral/melt kd's. With few exceptions, we were unable to get good data from the crystalline phases, primarily because of their small sizes or very low trace element abundances. However, the glass phase in 32 run products (representing F's from ~2-50 wt. percent) yielded excellent data that were remarkably homogenous from spot to spot and varied sensibly with changing melt fraction. Forward modeling using our modes and Co values in conjunction with published kd's for ol, cpx, opx, and sp (Kelemen et. al. EPSL. 120: 111-134, 1993) yield calculated trace element abundances that generally agree with our measurements to within 10-30 percent, about the precision of the ion probe measurements, given the small beam diameter we employed. However, our attempts to run the inverse problem using our measurements, modes, and Co

  18. Conserved promoter elements in the CYP6B gene family suggest common ancestry for cytochrome P450 monooxygenases mediating furanocoumarin detoxification.

    PubMed

    Hung, C F; Holzmacher, R; Connolly, E; Berenbaum, M R; Schuler, M A

    1996-10-29

    Despite the fact that Papilio glaucus and Papilio polyxenes share no single hostplant species, both species feed to varying extents on hostplants that contain furanocoumarins. P. glaucus contains two nearly identical genes, CYP6B4v2 and CYP6B5v1, and P. polyxenes contains two related genes, CYP6B1v3 and CYP6B3v2. Except for CYP6B3v2, the substrate specificity of which has not yet been defined, each of the encoded cytochrome P450 monooxygenases (P450s) metabolizes an array of linear furanocoumarins. All four genes are transcriptionally induced in larvae by exposure to the furanocoumarin xanthotoxin; several are also induced by other furanocoumarins. Comparisons of the organizational structures of these genes indicate that all have the same intron/exon arrangement. Sequences in the promoter regions of the P. glaucus CYP6B4v2/CYP6B5v1 genes and the P. polyxenes CYP6B3v2 gene are similar but not identical to the -146 to -97 region of CYP6B1v3 gene, which contains a xanthotoxin-responsive element (XRE-xan) important for basal and xanthotoxin-inducible transcription of CYP6B1v3. Complements of the xenobiotic-responsive element (XRE-AhR) in the dioxin-inducible human and rat CYP1A1 genes also exist in all four promoters, suggesting that these genes may be regulated by dioxin. Antioxidant-responsive elements (AREs) in mouse and rat glutathione S-transferase genes and the Barbie box element (Bar) in the bacterial CYP102 gene exist in the CYP6B1v3, CYP6B4v2, and CYP6B5v1 promoters. Similarities in the protein sequences, intron positions, and xanthotoxin- and xenobiotic-responsive promoter elements indicate that these insect CYP6B genes are derived from a common ancestral gene. Evolutionary comparisons between these P450 genes are the first available for a group of insect genes transcriptionally regulated by hostplant allelochemicals and provide insights into the process by which insects evolve specialized feeding habits.

  19. Specificity of a retinoic acid response element in the phosphoenolpyruvate carboxykinase gene promoter: consequences of both retinoic acid and thyroid hormone receptor binding.

    PubMed Central

    Lucas, P C; Forman, B M; Samuels, H H; Granner, D K

    1991-01-01

    The ability of a retinoic acid (RA) response element (RARE) in the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter to mediate effects of either RA or thyroid hormone (T3) on gene expression was studied. Fusion gene constructs consisting of PEPCK promoter sequences ligated to the chloramphenicol acetyltransferase (CAT) reporter gene were used for this analysis. While T3 induced CAT expression to a small degree (about twofold) when such constructs were transiently transfected into H4IIE rat hepatoma cells, along with an expression vector encoding the alpha subtype of the T3 receptor (TR), this effect was mediated by promoter sequences distinct from the PEPCK RARE. Although TRs were capable of binding the PEPCK RARE in the form of putative monomers, dimers, and heterodimers with RA receptors (RARs), this element failed to mediate any positive effect of T3 on gene expression. In contrast, the PEPCK RARE mediated six- to eightfold induction of CAT expression by RA. When TRs were coexpressed along with RARs in transfected H4IIE cells, this RA induction was substantially blunted in a T3-independent manner. This inhibitory effect may be due to the binding of nonfunctional TRs or TR-RAR heterodimers to the PEPCK RARE. A model is proposed to explain the previously observed in vivo effects of T3 on PEPCK gene expression. Images PMID:1656224

  20. The anaerobic responsive element contains two GC-rich sequences essential for binding a nuclear protein and hypoxic activation of the maize Adh1 promoter.

    PubMed Central

    Olive, M R; Peacock, W J; Dennis, E S

    1991-01-01

    We have identified a protein (GCBP-1) in nuclear extracts from maize suspension cell cultures that binds to specific sequences within the Anaerobic Responsive Element (ARE) of the maize Adh1 promoter. Competition analyses show that the GCBP-1 binding activity distinguishes ARE sequence motifs from other enhancer elements or pUC19 sequences. The binding activities of several mutant ARE sequences define two regions of the ARE important for GCBP-1 binding in vitro, between nucleotides -135 to -131 and nucleotides -120 to -112 of the maize Adh1 promoter. Both regions are required for efficient GCBP-1 binding to occur in vitro. The minimum consensus binding site for GCBP-1 is 5'-GC(G/C)CC-3'. This sequence is similar to a part of the binding site of the human transcription factor Sp1 (1). We demonstrate that maize GCBP-1 and human Sp1 have similar recognition properties. Using ARE mutants in a transient assay in maize protoplasts we have shown that mutation of the GCBP-1 binding sites prevents significant hypoxic activation of the maize Adh1 promoter. These results suggest a direct role for GCBP-1 in the hypoxic activation of Adh1 gene expression. GCBP-1 is present in both uninduced and induced nuclei, indicating that inducible gene expression is not dependent upon synthesis of GCBP-1 and suggesting that post-translational modification of bound GCBP-1 may be important for enhanced transcription to occur. Images PMID:1766868

  1. The Ewing sarcoma protein (EWS) binds directly to the proximal elements of the macrophage-specific promoter of the CSF-1 receptor (csf1r) gene.

    PubMed

    Hume, David A; Sasmono, Tedjo; Himes, S Roy; Sharma, Sudarshana M; Bronisz, Agnieszka; Constantin, Myrna; Ostrowski, Michael C; Ross, Ian L

    2008-05-15

    Many macrophage-specific promoters lack classical transcriptional start site elements such as TATA boxes and Sp1 sites. One example is the CSF-1 receptor (CSF-1R, CD115, c-fms), which is used as a model of the transcriptional regulation of macrophage genes. To understand the molecular basis of start site recognition in this gene, we identified cellular proteins binding specifically to the transcriptional start site (TSS) region. The mouse and human csf1r TSS were identified using cap analysis gene expression (CAGE) data. Conserved elements flanking the TSS cluster were analyzed using EMSAs to identify discrete DNA-binding factors in primary bone marrow macrophages as candidate transcriptional regulators. Two complexes were identified that bind in a highly sequence-specific manner to the mouse and human TSS proximal region and also to high-affinity sites recognized by myeloid zinc finger protein 1 (Mzf1). The murine proteins were purified by DNA affinity isolation from the RAW264.7 macrophage cell line and identified by mass spectrometry as EWS and FUS/TLS, closely related DNA and RNA-binding proteins. Chromatin immunoprecipitation experiments in bone marrow macrophages confirmed that EWS, but not FUS/TLS, was present in vivo on the CSF-1R proximal promoter in unstimulated primary macrophages. Transfection assays suggest that EWS does not act as a conventional transcriptional activator or repressor. We hypothesize that EWS contributes to start site recognition in TATA-less mammalian promoters.

  2. Tissue-specific expression of the PNZIP promoter is mediated by combinatorial interaction of different cis-elements and a novel transcriptional factor.

    PubMed

    Yang, Yu-Tao; Yu, Yan-Li; Yang, Guo-Dong; Zhang, Jie-Dao; Zheng, Cheng-Chao

    2009-05-01

    Recent studies demonstrated that PNZIP and its homologs encode a special cyclase and play an important role in chlorophyll biosynthesis in higher plants. To investigate the molecular mechanism governing the PNZIP gene, the PNZIP promoter was isolated and analyzed. Deletion analysis indicated that G-box is an important element in the regulation of the reporter gene expression. Further mutation assay demonstrated that G-box and GATACT elements are necessary and sufficient for the high and tissue-specific expression of the GUS gene. Using yeast one-hybrid screening, we have isolated a novel tobacco bZIP protein, NtbZIP, which can specifically recognize the G-box of the PNZIP promoter. The NtbZIP protein shares a limited amino acid homology to Arabidopsis ABI5 and AtAREB1 and very low homology to other bZIP proteins. Northern blot analysis showed that the NtbZIP gene is not induced by exogenous ABA and is expressed in different tobacco organs. Cotransformation assays showed that the NtbZIP protein could activate the transcription of the GUS gene driven by the PNZIP promoter. Transgenic tobaccos analysis demonstrated that constitutively expressing antisense NtbZIP gene resulted in a lower NTZIP synthesis and reduced chlorophyll levels. We suggest that NTZIP is a target gene of NtbZIP, which is involved in the regulation of chlorophyll biosynthesis.

  3. Tissue-specific expression of the PNZIP promoter is mediated by combinatorial interaction of different cis-elements and a novel transcriptional factor

    PubMed Central

    Yang, Yu-Tao; Yu, Yan-Li; Yang, Guo-Dong; Zhang, Jie-Dao; Zheng, Cheng-Chao

    2009-01-01

    Recent studies demonstrated that PNZIP and its homologs encode a special cyclase and play an important role in chlorophyll biosynthesis in higher plants. To investigate the molecular mechanism governing the PNZIP gene, the PNZIP promoter was isolated and analyzed. Deletion analysis indicated that G-box is an important element in the regulation of the reporter gene expression. Further mutation assay demonstrated that G-box and GATACT elements are necessary and sufficient for the high and tissue-specific expression of the GUS gene. Using yeast one-hybrid screening, we have isolated a novel tobacco bZIP protein, NtbZIP, which can specifically recognize the G-box of the PNZIP promoter. The NtbZIP protein shares a limited amino acid homology to Arabidopsis ABI5 and AtAREB1 and very low homology to other bZIP proteins. Northern blot analysis showed that the NtbZIP gene is not induced by exogenous ABA and is expressed in different tobacco organs. Cotransformation assays showed that the NtbZIP protein could activate the transcription of the GUS gene driven by the PNZIP promoter. Transgenic tobaccos analysis demonstrated that constitutively expressing antisense NtbZIP gene resulted in a lower NTZIP synthesis and reduced chlorophyll levels. We suggest that NTZIP is a target gene of NtbZIP, which is involved in the regulation of chlorophyll biosynthesis. PMID:19270069

  4. Molecular cloning of the rabbit interleukin 6 promoter: Functional characterization of rabbit hemorrhagic disease virus response elements in RK-13 cells.

    PubMed

    Liu, Xing; Hu, Bo; Wang, Fang; Song, Yanhua; Fan, Zhiyu; Wei, Houjun; Qiu, Rulong; Xu, Weizhong

    2016-12-01

    Infection with rabbit hemorrhagic disease virus (RHDV) can cause acute liver failure (ALF), leading to severe mortality in rabbits. Inflammatory response, especially the expression of inflammatory cytokines such as interleukin (IL)-1β, tumor necrosis factor (TNF)-α, and IL-6, may play major roles in mediating and amplifying the ALF. Among these cytokines, IL-6 is a multifunctional cytokine with a central role in various physiological inflammatory and immunological processes. In this study, we found that RHDV infection significantly upregulated IL-6 gene expression in vivo. Next, the rabbit IL-6 promoter was cloned and analyzed. Transfection of full-length RHDV cDNA in RK-13 cells upregulated the activity of the IL-6 promoter. A series of 5' deletion constructs demonstrated that AP-1 (activator protein 1), NF-IL6 (nuclear factor interleukin-6), and NF-κB (nuclear factor kappa B) elements were critical for RHDV-induced IL-6 transcription. Besides, the CREB (cAMP-response element binding protein) element may also play an accessory effect on RHDV-induced IL-6 transcription. Collectively, the results elucidate the mechanism of IL-6 induction, and enrich the RHDV pathogenesis in rabbit. PMID:27492646

  5. The use of olive-mill waste compost to promote the plant vegetation cover in a trace-element-contaminated soil.

    PubMed

    Pardo, Tania; Martínez-Fernández, Domingo; Clemente, Rafael; Walker, David J; Bernal, M Pilar

    2014-01-01

    The applicability of a mature compost as a soil amendment to promote the growth of native species for the phytorestoration of a mine-affected soil from a semi-arid area (SE Spain), contaminated with trace elements (As, Cd, Cu, Mn, Pb and Zn), was evaluated in a 2-year field experiment. The effects of an inorganic fertiliser were also determined for comparison. Bituminaria bituminosa was the selected native plant since it is a leguminous species adapted to the particular local pedoclimatic conditions. Compost addition increased total organic-C concentrations in soil with respect to the control and fertiliser treatments, maintained elevated available P concentrations throughout the duration of the experiment and stimulated soil microbial biomass, while trace elements extractability in the soil was rather low due to the calcareous nature of the soil and almost unaltered in the different treatments. Tissue concentrations of P and K in B. bituminosa increased after the addition of compost, associated with growth stimulation. Leaf Cu concentration was also increased by the amendments, although overall the trace elements concentrations can be considered non-toxic. In addition, the spontaneous colonisation of the plots by a total of 29 species of 15 different families at the end of the experiment produced a greater vegetation cover, especially in plots amended with compost. Therefore, the use of compost as a soil amendment appears to be useful for the promotion of a vegetation cover and the phytostabilisation of moderately contaminated soils under semi-arid conditions.

  6. Light-inducible and constitutively expressed DNA-binding proteins recognizing a plant promoter element with functional relevance in light responsiveness.

    PubMed Central

    Weisshaar, B; Armstrong, G A; Block, A; da Costa e Silva, O; Hahlbrock, K

    1991-01-01

    Four cis-acting elements, designated as Boxes I, II, III and IV, have previously been identified as functionally relevant components of the light-responsive chalcone synthase (CHS) promoter in parsley (Petroselinum crispum). This paper describes the isolation of three cDNAs encoding proteins which bind specifically to Box II, one of two cis-acting elements found within a 52 bp CHS promoter region shown here to be sufficient for light responsiveness in parsley. The deduced amino acid sequences of all three proteins reveal conserved basic and leucine zipper domains characteristic of transcription factors of the bZIP class. Nucleotide sequences recognized by these factors contain an ACGT motif common to many cis-acting elements. Therefore, we have termed the proteins CPRF-1, -2 and -3 (Common Plant Regulatory Factor). The characteristics of CPRF-1 binding to Box II and the timing of transient CPRF-1 mRNA accumulation during light exposure of previously dark-grown parsley cells are consistent with the hypothesis that this factor participates in the light-mediated activation of the CHS gene in parsley. Images PMID:2050115

  7. The use of olive-mill waste compost to promote the plant vegetation cover in a trace-element-contaminated soil.

    PubMed

    Pardo, Tania; Martínez-Fernández, Domingo; Clemente, Rafael; Walker, David J; Bernal, M Pilar

    2014-01-01

    The applicability of a mature compost as a soil amendment to promote the growth of native species for the phytorestoration of a mine-affected soil from a semi-arid area (SE Spain), contaminated with trace elements (As, Cd, Cu, Mn, Pb and Zn), was evaluated in a 2-year field experiment. The effects of an inorganic fertiliser were also determined for comparison. Bituminaria bituminosa was the selected native plant since it is a leguminous species adapted to the particular local pedoclimatic conditions. Compost addition increased total organic-C concentrations in soil with respect to the control and fertiliser treatments, maintained elevated available P concentrations throughout the duration of the experiment and stimulated soil microbial biomass, while trace elements extractability in the soil was rather low due to the calcareous nature of the soil and almost unaltered in the different treatments. Tissue concentrations of P and K in B. bituminosa increased after the addition of compost, associated with growth stimulation. Leaf Cu concentration was also increased by the amendments, although overall the trace elements concentrations can be considered non-toxic. In addition, the spontaneous colonisation of the plots by a total of 29 species of 15 different families at the end of the experiment produced a greater vegetation cover, especially in plots amended with compost. Therefore, the use of compost as a soil amendment appears to be useful for the promotion of a vegetation cover and the phytostabilisation of moderately contaminated soils under semi-arid conditions. PMID:23868726

  8. S-S synapsis during class switch recombination is promoted by distantly located transcriptional elements and activation-induced deaminase.

    PubMed

    Wuerffel, Robert; Wang, Lili; Grigera, Fernando; Manis, John; Selsing, Erik; Perlot, Thomas; Alt, Frederick W; Cogne, Michel; Pinaud, Eric; Kenter, Amy L

    2007-11-01

    Molecular mechanisms underlying synapsis of activation-induced deaminase (AID)-targeted S regions during class switch recombination (CSR) are poorly understood. By using chromosome conformation capture techniques, we found that in B cells, the Emicro and 3'Ealpha enhancers were in close spatial proximity, forming a unique chromosomal loop configuration. B cell activation led to recruitment of the germline transcript (GLT) promoters to the Emicro:3'Ealpha complex in a cytokine-dependent fashion. This structure facilitated S-S synapsis because Smicro was proximal to Emicro and a downstream S region was corecruited with the targeted GLT promoter to Emicro:3'Ealpha. We propose that GLT promoter association with the Emicro:3'Ealpha complex creates an architectural scaffolding that promotes S-S synapsis during CSR and that these interactions are stabilized by AID. Thus, the S-S synaptosome is formed as a result of the self-organizing transcription system that regulates GLT expression and may serve to guard against spurious chromosomal translocations.

  9. Recognition of distinct HLA-DQA1 promoter elements by a single nuclear factor containing Jun and Fos or antigenically related proteins.

    PubMed Central

    Neve Ombra, M; Autiero, M; DeLerma Barbaro, A; Barretta, R; Del Pozzo, G; Guardiola, J

    1993-01-01

    The activity of MHC class II promoters depends upon conserved regulatory signals one of which, the extended X-box, contains in its X2 subregion a sequence related to the cAMP response element, CRE and to the TPA response element, TRE. Accordingly, X2 is recognized by the AP-1 factor and by other c-Jun or c-Fos containing heterodimers. We report that the X-box dependent promoter activity of the HLA-DQA1 gene is down-modulated by an array of DNA elements each of which represented twice either in an invertedly or directly repeated orientation. In this frame, we describe a nuclear binding factor, namely DBF, promiscuously interacting with two of these additional signals, delta and sigma, and with a portion of the X-box, namely the X-core, devoid of X2. The presence of a single factor recognizing divergent DNA sequences was indicated by the finding that these activities were co-eluted from a heparin-Sepharose column and from DNA affinity columns carrying different DNA binding sites as ligands. Competition experiments made with oligonucleotides representing wild type and mutant DNA elements showed that each DNA element specifically inhibited the binding of the others, supporting the contention that DBF is involved in recognition of different targets. Furthermore, we found that DBF also exhibits CRE/TRE binding activity and that this activity can be competed out by addition of an excess of sigma, delta and X-core oligonucleotides. Anti-Jun peptide and anti-Fos peptide antibodies blocked not only the binding activity of DBF, but also its X-core and sigma binding; this blockade was removed by the addition of the Jun or Fos peptides against which the antibodies had been raised. In vitro synthesized Jun/Fos was able to bind to all these boxes, albeit with seemingly different affinities. The cooperativity of DBF interactions may explain the modulation of the X-box dependent promoter activity mediated by the accessory DNA elements described here. Images PMID:8493100

  10. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

    PubMed

    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2016-05-10

    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. PMID:26995610

  11. A universal algorithm for genome-wide in silicio identification of biologically significant gene promoter putative cis-regulatory-elements; identification of new elements for reactive oxygen species and sucrose signaling in Arabidopsis.

    PubMed

    Geisler, Matt; Kleczkowski, Leszek A; Karpinski, Stanislaw

    2006-02-01

    Short motifs of many cis-regulatory elements (CREs) can be found in the promoters of most Arabidopsis genes, and this raises the question of how their presence can confer specific regulation. We developed a universal algorithm to test the biological significance of CREs by first identifying every Arabidopsis gene with a CRE and then statistically correlating the presence or absence of the element with the gene expression profile on multiple DNA microarrays. This algorithm was successfully verified for previously characterized abscisic acid, ethylene, sucrose and drought responsive CREs in Arabidopsis, showing that the presence of these elements indeed correlates with treatment-specific gene induction. Later, we used standard motif sampling methods to identify 128 putative motifs induced by excess light, reactive oxygen species and sucrose. Our algorithm was able to filter 20 out of 128 novel CREs which significantly correlated with gene induction by either heat, reactive oxygen species and/or sucrose. The position, orientation and sequence specificity of CREs was tested in silicio by analyzing the expression of genes with naturally occurring sequence variations. In three novel CREs the forward orientation correlated with sucrose induction and the reverse orientation with sucrose suppression. The functionality of the predicted novel CREs was experimentally confirmed using Arabidopsis cell-suspension cultures transformed with short promoter fragments or artificial promoters fused with the GUS reporter gene. Our genome-wide analysis opens up new possibilities for in silicio verification of the biological significance of newly discovered CREs, and allows for subsequent selection of such CREs for experimental studies.

  12. Novel core promoter elements in the oomycete pathogen Phytophthora infestans and their influence on expression detected by genome-wide analysis

    PubMed Central

    2013-01-01

    Background The core promoter is the region flanking the transcription start site (TSS) that directs formation of the pre-initiation complex. Core promoters have been studied intensively in mammals and yeast, but not in more diverse eukaryotes. Here we investigate core promoters in oomycetes, a group within the Stramenopile kingdom that includes important plant and animal pathogens. Prior studies of a small collection of genes proposed that oomycete core promoters contain a 16 to 19 nt motif bearing an Initiator-like sequence (INR) flanked by a novel sequence named FPR, but this has not been extended to whole-genome analysis. Results We used expectation maximization to find over-represented motifs near TSSs of Phytophthora infestans, the potato blight pathogen. The motifs corresponded to INR, FPR, and a new element found about 25 nt downstream of the TSS called DPEP. TATA boxes were not detected. Assays of DPEP function by mutagenesis were consistent with its role as a core motif. Genome-wide searches found a well-conserved combined INR+FPR in only about 13% of genes after correcting for false discovery, which contradicted prior reports that INR and FPR are found together in most genes. INR or FPR were found alone near TSSs in 18% and 7% of genes, respectively. Promoters lacking the motifs had pyrimidine-rich regions near the TSS. The combined INR+FPR motif was linked to higher than average mRNA levels, developmentally-regulated transcription, and functions related to plant infection, while DPEP and FPR were over-represented in constitutively-expressed genes. The INR, FPR, and combined INR+FPR motifs were detected in other oomycetes including Hyaloperonospora arabidopsidis, Phytophthora sojae, Pythium ultimum, and Saprolegnia parasitica, while DPEP was found in all but S. parasitica. Only INR seemed present in a non-oomycete stramenopile. Conclusions The absence of a TATA box and presence of novel motifs show that the oomycete core promoter is diverged from that of

  13. The Activity of Sendai Virus Genomic and Antigenomic Promoters Requires a Second Element Past the Leader Template Regions: a Motif (GNNNNN)3 Is Essential for Replication

    PubMed Central

    Tapparel, Caroline; Maurice, Diane; Roux, Laurent

    1998-01-01

    The paramyxovirus genome, a nonsegmented, negative-polarity, single-stranded RNA of ∼15 kb, contains six transcription units flanked at the 3′ and 5′ ends by a short (∼ 50- to 60-nucleotide) extracistronic sequence, dubbed the positive and negative leader regions. These leader template regions, present at the 3′ end of the genome and the antigenome, have been shown to contain essential signals governing RNA replication activity. Whether they are sufficient to promote replication is still open to question. By using a series of Sendai virus defective interfering RNAs carrying a nested set of deletions in the promoter regions, it is shown here that for both the genomic and antigenomic promoters, a 3′-end RNA sequence of 96 nucleotides is required to allow replication. Sequence comparison of active and inactive promoters led to the identification of a set of three nucleotide hexamers (nucleotides 79 to 84, 85 to 90, and 91 to 96) containing a repeated motif RXXYXX [shown as 5′-3′ positive-strand]. Sequential mutation of each hexamer into its complementary sequence confirmed their essential role. The three hexamers are required, and their relative positioning is important, since displacing them by 6 nucleotides destroyed promoter function. RNAs carrying degenerate nucleotides in the three hexamers were used as replication templates. They led to the selection of actively replicating RNA species exclusively carrying the basic motif (GNNNNN)3 from nucleotides 79 to 96. These results clearly show that, apart from the region from nucleotides 1 to 31, previously identified as governing Sendai virus replication activity, a second element, spanning at the most nucleotides 79 to 96, appears essential. Thus, the paramyxovirus replication promoters are not confined to the leader template regions, as seems to be the case for the rhabdoviruses. PMID:9525637

  14. Sterol regulatory element binding protein-1 (SREBP-1)c promoter: Characterization and transcriptional regulation by mature SREBP-1 and liver X receptor α in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Wang, H P; Wang, H; Zhang, T Y; Tian, H B; Yao, D W; Loor, J J

    2016-02-01

    Sterol regulatory element binding protein-1 (SREBP-1) is a key transcription factor that regulates lipogenesis in rodent liver. Two isoforms (SREBP-1a and SREBP-1c) of SREBP-1 are transcribed by an alternative promoter on the same gene (SREBF1), and the isoforms differ only in their first exon. Although the regulatory effects of SREBP-1 on lipid and milk fat synthesis have received much attention in ruminants, SREBP-1c promoter and its regulatory mechanisms have not been characterized in the goat. In the present study, we cloned and sequenced a 2,012-bp fragment of the SREBP-1c 5'-flanking region from goat genomic DNA. A luciferase reporter assay revealed that SREBP-1c is transcriptionally activated by the liver X receptor α (LXRα) agonist T0901317, and is decreased by SREBP-1 small interfering (si)RNA. A 5' deletion analysis revealed a core promoter region located -395 to +1 bp upstream of the transcriptional start site (TSS). Site-directed mutagenesis of LXRα binding elements (LXRE1 and LXRE2) and sterol regulatory elements (SRE1 and SRE2) revealed that the full effects of T 4506585 require the presence of both LXRE and SRE. We also characterized a new SRE (SRE1) and demonstrated a direct role of SREBP-1 (auto-loop regulation) in maintaining its basal transcription activity. Results suggest that goat SREBP-1c gene is transcriptionally regulated by mature SREBP-1 (auto-loop circuit regulation) and LXRα in goat mammary epithelial cells. PMID:26709176

  15. Intronic DNA elements regulate Nrf-2 chemical responsiveness of the human microsomal epoxide hydrolase gene (EPHX1) through a far upstream alternative promoter

    PubMed Central

    Su, Shengzhong; Yang, Xi; Omiecinski, Curtis J.

    2014-01-01

    In humans, microsomal epoxide hydrolase (mEH) contributes important biological functions that underlie both detoxification and bioactivation fates arising from exposures to foreign chemicals. Previously, we discovered that human mEH gene transcription is initiated from alternative promoters. The respective transcripts are programmed with tissue specificity and the upstream E1b promoter contributes predominantly to mEH expression. The results presented demonstrate that exposures to the Nrf2 activators, sulforaphane (SFN) and tert-butylhydroquinone (tBHQ), markedly activate E1b transcription in human lung and liver cells. Genomic analyses identified two major DNase I hypersensitive regions (HS-1 and HS-2) within the ~15 kb intervening sequence separating E1b from the downstream E1 promoter. In BEAS-2B cells, the Nrf2 effectors, SFN and tBHQ, selectively activated the more distal HS-2 through an antioxidant-response element (ARE). An activator protein 1/12-O-tetradecanoylphorbol-13-acetate interaction was further identified within the HS-2 enhancer that functioned to additionally contribute to ARE-mediated induction responsiveness of the E1b promoter. The results demonstrate that ARE modulation, integrated with additional transcriptional complexes, regulates the tissue-specific expression of mEH and that these processes likely coordinate both the protective and bioactivation functions contributed by mEH activities in human tissues. PMID:24704207

  16. NRF2 Regulates Hyperoxia-induced NOX4 expression in Human Lung Endothelium: Identification of functional antioxidant response elements on NOX4 promoter

    PubMed Central

    Pendyala, Srikanth; Moitra, Jaideep; Kalari, Satish; Kleeberger, Steven R.; Zhao, Yutong; Reddy, Sekhar P.; Garcia, Joe G.N.; Natarajan, Viswanathan

    2011-01-01

    Reactive oxygen species (ROS) generated by vascular endothelial and smooth muscle cells contribute to the development and progression of vascular diseases. We have recently shown that hyperoxia enhances NADPH Oxidase 4 (NOX4) expression, which regulates lung endothelial cell migration and angiogenesis. Regulation of NOX4 is poorly understood in the vasculature. The objective of this study is to identify transcriptional factor(s) involved in regulation of endothelial NOX4. We found that hyperoxia induced NOX4 expression was markedly reduced in Nrf2-/- mice, compared to Nrf2+/+ mice. Exposure of human lung microvascular endothelial cells (HLMVECs) to hyperoxia stimulated NRF2 translocation from the cytoplasm to the nucleus and increased NOX4 expression. Knock down of NRF2 expression using a siRNA approach attenuated basal NOX4 expression; however, it enhanced superoxide/ROS generation under both normoxia and hyperoxia. In silico analysis revealed presence of at least three consensus sequences for the antioxidant response element (ARE) in the promoter region of NOX4. In transient transfections, hyperoxia stimulated NOX4promoter activity in HLMVECs, and deletion of -438 to -458 and -619 to -636 sequences markedly reduced hyperoxia-stimulated NOX4 promoter activation. ChIP analysis revealed an enhanced recruitment of NRF2 to endogenous NOX4 promoter spanning these two AREs following hyperoxic insult. Collectively, these results demonstrate, for the first time, a novel role of NRF2 in regulating hyperoxia-induced NOX4 transcription via AREs in lung endothelium. PMID:21443946

  17. Isolation of pig mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene promoter: characterization of a peroxisome proliferator-responsive element.

    PubMed Central

    Ortiz, J A; Mallolas, J; Nicot, C; Bofarull, J; Rodríguez, J C; Hegardt, F G; Haro, D; Marrero, P F

    1999-01-01

    Low expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene during development correlates with an unusually low hepatic ketogenic capacity and lack of hyperketonaemia in piglets. Here we report the isolation and characterization of the 5' end of the pig mitochondrial HMG-CoA synthase gene. The 581 bp region proximal to the transcription start site permits transcription of a reporter gene, confirming the function of the promoter. The pig mitochondrial HMG-CoA synthase promoter is trans-activated by the peroxisomal proliferator-activated receptor (PPAR), and a functional response element for PPAR (PPRE) has been localized in the promoter region. Pig PPRE is constituted by an imperfect direct repeat (DR-1) and a downstream sequence, both of which are needed to confer PPAR-sensitivity to a thymidine kinase promoter and to form complexes with PPAR.retinoid X receptor heterodimers. A role of PPAR trans-activation in starvation-associated induction of gene expression is suggested. PMID:9882632

  18. Proximal promoter elements of the human zeta-globin gene confer embryonic-specific expression on a linked reporter gene in transgenic mice.

    PubMed

    Pondel, M D; Sharpe, J A; Clark, S; Pearson, L; Wood, W G; Proudfoot, N J

    1996-11-01

    We have investigated the transcriptional regulation of the human embryonic zeta-globin gene promoter. First, we examined the effect that deletion of sequences 5' to zeta-globin's CCAAT box have on zeta-promoter activity in erythroid cell lines. Deletions of sequences between -116 and -556 (cap = 0) had little effect while further deletion to -84 reduced zeta-promoter activity by only 2-3-fold in both transiently and stably transfected erythroid cells. Constructs containing 67, 84 and 556 bp of zeta-globin 5' flanking region linked to a beta-galactosidase reporter gene (lacZ) and hypersensitive site -40 (HS-40) of the human alpha-globin gene cluster were then employed for the generation of transgenic mice. LacZ expression from all constructs, including a 67 bp zeta-globin promoter, was erythroid-specific and most active between 8.5 and 10.5 days post-fertilisation. By 16.5 days gestation, lacZ expression dropped 40-100-fold. These results suggest that embryonic-specific activation of the human zeta-globin promoter is conferred by a 67 bp zeta-promoter fragment containing only a CCAAT and TATA box. PMID:8932366

  19. Sclerostin expression is induced by BMPs in human Saos-2 osteosarcoma cells but not via direct effects on the sclerostin gene promoter or ECR5 element.

    PubMed

    Yu, Longchuan; van der Valk, Marissa; Cao, Jin; Han, Chun-Ya E; Juan, Todd; Bass, Michael B; Deshpande, Chetan; Damore, Michael A; Stanton, Richard; Babij, Philip

    2011-12-01

    Sclerostin is a secreted inhibitor of Wnt signaling and plays an essential role in the regulation of bone mass. The expression of sclerostin is largely restricted to osteocytes although its mode of transcriptional regulation is not well understood. We observed regulated expression of sclerostin mRNA and protein that was directly correlated with the mineralization response in cultured human Saos-2 osteosarcoma cells and rat primary calvarial cells. Sclerostin mRNA and protein levels were increased following treatment of cells with BMP2, BMP4 and BMP7. Analysis of deletion mutants from the -7.4 kb upstream region of the human sclerostin promoter did not reveal any specific regions that were responsive to BMPs, Wnt3a, PTH, TGFβ1 or Activin A in Saos-2 cells. The downstream ECR5 element did not show enhancer activity in Saos-2 cells and also was not affected when Saos-2 cells were treated with BMPs or PTH. Genome-wide microarray analysis of Saos-2 cells treated with BMP2 showed significant changes in expression of several transcription factors with putative consensus DNA binding sites in the region of the sclerostin promoter. However, whereas most factors tested showed either a range of inhibitory activity (DLX family, MSX2, HEY1, SMAD6/7) or lack of activity on the sclerostin promoter including SMAD9, only MEF2B showed a positive effect on both the promoter and ECR5 element. These results suggest that the dramatic induction of sclerostin gene expression by BMPs in Saos-2 cells occurs indirectly and is associated with late stage differentiation of osteoblasts and the mineralization process.

  20. The nuclear receptors NUR77 and SF1 play additive roles with c-JUN through distinct elements on the mouse Star promoter.

    PubMed

    Martin, Luc J; Tremblay, Jacques J

    2009-02-01

    The steroidogenic acute regulatory protein plays an essential role in steroid biosynthesis in steroidogenic cells. It is involved in the transport of cholesterol through the mitochondrial membrane where the first step of steroidogenesis occurs. Star gene expression in testicular Leydig cells is regulated by the pituitary LH through the cAMP signaling pathway. So far, several transcription factors have been implicated in the regulation of Star promoter activity in these cells. These include the nuclear receptors NUR77 and SF1, AP-1 family members (particularly c-JUN), GATA4, C/EBPbeta, DLX5/6, and CREB. Some of these factors were also shown to act in a cooperative manner to further enhance Star promoter activity. Here, we report that NUR77 and c-JUN have additive effects on the Star promoter. These effects were abolished only when both elements, NUR77 at -95 bp and AP-1 at -78 bp, were mutated. Consistent with this, in vitro co-immunoprecipitation revealed that NUR77 and c-JUN interact and that this interaction is mediated through part of the ligand binding domain of NUR77. Furthermore, we found that SF1 could cooperate with c-JUN on the mouse Star promoter but this cooperation involved different regulatory elements. Collectively, our data not only provide new insights into the molecular mechanisms that control mouse Star transcription in Leydig cells but also reveal a novel mechanism for the regulation of NR4A1-dependent genes in tissues where NUR77 and c-JUN factors are co-expressed.

  1. Analysis of the zebrafish sox9b promoter: Identification of elements that recapitulate organ-specific expression of sox9b.

    PubMed

    Burns, Felipe R; Lanham, Kevin A; Xiong, Kong M; Gooding, Alex J; Peterson, Richard E; Heideman, Warren

    2016-03-10

    The SRY-related high-mobility box 9 (SOX9) gene is expressed in many different tissues. To better understand the DNA elements that control tissue-specific expression, we cloned and sequenced a 2.5 kb fragment lying 5' to the zebrafish sox9b gene transcriptional start site. Three regions of this clone contained stable secondary structures that hindered cloning, sequencing, and amplification. This segment and smaller fragmentswere inserted 5' of an EGFP reporter and transgenic fish were raised with the different reporters. Reporter expression was also observed in embryos directly injected with the constructs to transiently express the reporter. Heart expression required only a very short 5' sequence, as a 0.6 kb sox9b fragment produced reporter expression in heart in transgenic zebrafish, and transient experiments showed heart expression from a minimal sox9b promoter region containing a conserved TATA box and an EGR2 element (-74/+29 bp). Reporter expression in transgenic skeletal muscle was consistently lower than in other tissues. Jaw, brain, and notochord expression was strong with the full-length clone, but was dramatically reduced as the size of the fragment driving the reporter decreased from approximately 1.8 to 0.9 kb. The 2.5 kb region 5' of the sox9b contained 7 conserved non-coding elements (CNEs) that included putative hypoxia inducible factor 1α (HIF1α), CAAT box (CCAAT), early growth response protein 2 (EGR2), and core promoter elements. While a synthetic fragment containing all 7 CNEs produced some degree of reporter expression in muscle, jaw, heart and brain, the degree of reporter expression was considerably lower than that produced by the full length clone. These results can account for the tissue-specific expression of sox9b in the developing zebrafish.

  2. Fine (PM2.5), coarse (PM2.5-10), and metallic elements of suspended particulates for incense burning at Tzu Yun Yen temple in central Taiwan.

    PubMed

    Fang, Guor-Cheng; Chang, Cheng-Nan; Chu, Chia-Chium; Wu, Yuh-Shen; Pi-Cheng Fu, Peter; Chang, Shyh-Chyi; Yang, I-Lin

    2003-06-01

    Ambient suspended particulate concentrations were measured at Tzu Yun Yen temple (120 degrees, 34('), 10(") E; 24 degrees, 16('), 12(") N) in this study. This is representative of incense burning and semi-open sampling sites. The Universal-sampler collected fine and coarse particle material was used to measure suspended particulate concentrations, and sampling periods were from 16/08/2001 to 2/1/2002 at Tzu Yun Yen temple. In addition, metallic element concentrations, compositions of PM(2.5) and PM(2.5-10) for incense burning at Tzu Yun Yen temple were also analyzed in this study. The PM(2.5)/PM(10) ratios ranged between 31% and 87% and averaged 70+/-11% during incense the burning period, respectively. The median metallic element concentration order for these elements is Fe>Zn>Cr>Cd>Pb>Mn>Ni>Cu in fine particles (PM(2.5)) at the Tzu Yun Yen temple sampling site. The median metallic element concentration order for these elements is Fe>Zn>Cr>Pb>Cd>Ni>Mn>Cu in coarse particle (PM(2.5-10)) at the Tzu Yun Yen temple sampling site. Fine particulates (PM(2.5)) are the main portion of PM(10) at Tzu Yun Yen temple in this study. From the point of view of PM(10), these data reflect that the elements Fe, Zn, and Cr were the major elements distributed at Tzu Yun Yen temple in this study.

  3. The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

    PubMed

    Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

    2014-01-01

    The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX. PMID:24834375

  4. Genetic variation in T-box binding element functionally affects SCN5A/SCN10A enhancer.

    PubMed

    van den Boogaard, Malou; Wong, L Y Elaine; Tessadori, Federico; Bakker, Martijn L; Dreizehnter, Lisa K; Wakker, Vincent; Bezzina, Connie R; 't Hoen, Peter A C; Bakkers, Jeroen; Barnett, Phil; Christoffels, Vincent M

    2012-07-01

    The contraction pattern of the heart relies on the activation and conduction of the electrical impulse. Perturbations of cardiac conduction have been associated with congenital and acquired arrhythmias as well as cardiac arrest. The pattern of conduction depends on the regulation of heterogeneous gene expression by key transcription factors and transcriptional enhancers. Here, we assessed the genome-wide occupation of conduction system-regulating transcription factors TBX3, NKX2-5, and GATA4 and of enhancer-associated coactivator p300 in the mouse heart, uncovering cardiac enhancers throughout the genome. Many of the enhancers colocalized with ion channel genes repressed by TBX3, including the clustered sodium channel genes Scn5a, essential for cardiac function, and Scn10a. We identified 2 enhancers in the Scn5a/Scn10a locus, which were regulated by TBX3 and its family member and activator, TBX5, and are functionally conserved in humans. We also provided evidence that a SNP in the SCN10A enhancer associated with alterations in cardiac conduction patterns in humans disrupts TBX3/TBX5 binding and reduces the cardiac activity of the enhancer in vivo. Thus, the identification of key regulatory elements for cardiac conduction helps to explain how genetic variants in noncoding regulatory DNA sequences influence the regulation of cardiac conduction and the predisposition for cardiac arrhythmias. PMID:22706305

  5. Psoriasis mutations disrupt CARD14 autoinhibition promoting BCL10-MALT1-dependent NF-κB activation.

    PubMed

    Howes, Ashleigh; O'Sullivan, Paul A; Breyer, Felix; Ghose, Ashavari; Cao, Li; Krappmann, Daniel; Bowcock, Anne M; Ley, Steven C

    2016-06-15

    Inherited and de novo mutations in the CARD14 gene promote the development of psoriasis, an inflammatory disease of the skin. Caspase recruitment domain-containing protein 14 (CARD14) is a member of the CARMA protein family that includes the structurally related CARD11 adaptor that mediates NF-κB activation by antigen receptors. We investigated the mechanism by which CARD14 mutation in psoriasis activates NF-κB. In contrast with wild-type CARD14, CARD14(E138A) and CARD14(G117S) psoriasis mutants interacted constitutively with BCL10 and MALT1, and triggered BCL10- and MALT1-dependent activation of NF-κB in keratinocytes. These alterations disrupted the inhibitory effect of the CARD14 linker region (LR) on NF-κB activation by facilitating BCL10 binding. Therefore, psoriasis mutations activated CARD14 by a mechanism analogous to oncogenic CARD11 mutations in non-Hodgkin B cell lymphomas. CARD14(E138A) also stimulated MALT1 paracaspase activity and activated both ERK1/2 and p38α MAP kinases. Inhibition of MALT1 with mepazine reduced CARD14(E138A)-induced expression of specific psoriasis-associated transcripts in keratinocytes. Our results establish the mechanism whereby gain-of-function CARD14 variants, which induce psoriatic disease in affected individuals, activate pro-inflammatory signalling. PMID:27071417

  6. Lentiviral vectors carrying enhancer elements of Hb9 promoter drive selective transgene expression in mouse spinal cord motor neurons.

    PubMed

    Peviani, Marco; Kurosaki, Mami; Terao, Mineko; Lidonnici, Dario; Gensano, Francesco; Battaglia, Elisa; Tortarolo, Massimo; Piva, Roberto; Bendotti, Caterina

    2012-03-30

    Recombinant lentiviral vectors (rLVs) have emerged as versatile tools for gene delivery applications due to a number of favorable features, such as the possibility to maintain long-term transgene expression, the flexibility in the design of the expression cassettes and recent improvements in their biosafety profile. Since rLVs are able to infect multiple cell types including post-mitotic cells such as neurons and skeletal muscle cells, several studies have been exploring their application for the study and cure of neurodegenerative diseases. In particular, the introduction of rLVs carrying cell-type specific promoters could restrict the transgene expression either to neuronal or glial cells, thus helping to better dissect in vivo the role played by these cell populations in several neurodegenerative processes. In this study we developed rLVs carrying motor neuron specific regulatory sequences derived from the promoter of homeobox gene Hb9, and demonstrated that these constructs can represent a suitable platform for selective gene-targeting of murine spinal cord motor neurons, in vivo. This tool could be instrumental in the dissection of the molecular mechanisms involved in the selective degeneration of motor neurons occurring in Motor Neuron Diseases.

  7. Chicken beta B1-crystallin gene expression: presence of conserved functional polyomavirus enhancer-like and octamer binding-like promoter elements found in non-lens genes.

    PubMed Central

    Roth, H J; Das, G C; Piatigorsky, J

    1991-01-01

    Expression of the chicken beta B1-crystallin gene was examined. Northern (RNA) blot and primer extension analyses showed that while abundant in the lens, the beta B1 mRNA is absent from the liver, brain, heart, skeletal muscle, and fibroblasts of the chicken embryo, suggesting lens specificity. Promoter fragments ranging from 434 to 126 bp of 5'-flanking sequence (plus 30 bp of exon 1) of the beta B1 gene fused to the bacterial chloramphenicol acetyltransferase gene functioned much more efficiently in transfected embryonic chicken lens epithelial cells than in transfected primary muscle fibroblasts or HeLa cells. Transient expression of recombinant plasmids in cultured lens cells, DNase I footprinting, in vitro transcription in a HeLa cell extract, and gel mobility shift assays were used to identify putative functional promoter elements of the beta B1-crystallin gene. Sequence analysis revealed a number of potential regulatory elements between positions -126 and -53 of the beta B1 promoter, including two Sp1 sites, two octamer binding sequence-like sites (OL-1 and OL-2), and two polyomavirus enhancer-like sites (PL-1 and PL-2). Deletion and site-specific mutation experiments established the functional importance of PL-1 (-116 to -102), PL-2 (-90 to -76), and OL-2 (-75 to -68). DNase I footprinting using a lens or a HeLa cell nuclear extract and gel mobility shifts using a lens nuclear extract indicated the presence of putative lens transcription factors binding to these DNA sequences. Competition experiments provided evidence that PL-1 and PL-2 recognize the same or very similar factors, while OL-2 recognizes a different factor. Our data suggest that the same or closely related transcription factors found in many tissues are used for expression of the chicken beta B1-crystallin gene in the lens. Images PMID:1996106

  8. p53 and Cell Cycle Dependent Transcription of kinesin family member 23 (KIF23) Is Controlled Via a CHR Promoter Element Bound by DREAM and MMB Complexes

    PubMed Central

    Quaas, Marianne; Hoffmann, Saskia; Knörck, Arne; Gumhold, Catalina; Rother, Karen

    2013-01-01

    The microtubule-dependent molecular motor KIF23 (Kinesin family member 23) is one of two components of the centralspindlin complex assembled during late stages of mitosis. Formation of this complex is known as an essential step for cytokinesis. Here, we identified KIF23 as a new transcriptional target gene of the tumor suppressor protein p53. We showed that p53 reduces expression of KIF23 on the mRNA as well as the protein level in different cell types. Promoter reporter assays revealed that this repression results from downregulation of KIF23 promoter activity. CDK inhibitor p21WAF1/CIP1 was shown to be necessary to mediate p53-dependent repression. Furthermore, we identified the highly conserved cell cycle genes homology region (CHR) in the KIF23 promoter to be strictly required for p53-dependent repression as well as for cell cycle-dependent expression of KIF23. Cell cycle- and p53-dependent regulation of KIF23 appeared to be controlled by differential binding of DREAM and MMB complexes to the CHR element. With this study, we describe a new mechanism for transcriptional regulation of KIF23. Considering the strongly supporting function of KIF23 in cytokinesis, its p53-dependent repression may contribute to the prevention of uncontrolled cell growth. PMID:23650552

  9. p53 and cell cycle dependent transcription of kinesin family member 23 (KIF23) is controlled via a CHR promoter element bound by DREAM and MMB complexes.

    PubMed

    Fischer, Martin; Grundke, Inga; Sohr, Sindy; Quaas, Marianne; Hoffmann, Saskia; Knörck, Arne; Gumhold, Catalina; Rother, Karen

    2013-01-01

    The microtubule-dependent molecular motor KIF23 (Kinesin family member 23) is one of two components of the centralspindlin complex assembled during late stages of mitosis. Formation of this complex is known as an essential step for cytokinesis. Here, we identified KIF23 as a new transcriptional target gene of the tumor suppressor protein p53. We showed that p53 reduces expression of KIF23 on the mRNA as well as the protein level in different cell types. Promoter reporter assays revealed that this repression results from downregulation of KIF23 promoter activity. CDK inhibitor p21(WAF1/CIP1) was shown to be necessary to mediate p53-dependent repression. Furthermore, we identified the highly conserved cell cycle genes homology region (CHR) in the KIF23 promoter to be strictly required for p53-dependent repression as well as for cell cycle-dependent expression of KIF23. Cell cycle- and p53-dependent regulation of KIF23 appeared to be controlled by differential binding of DREAM and MMB complexes to the CHR element. With this study, we describe a new mechanism for transcriptional regulation of KIF23. Considering the strongly supporting function of KIF23 in cytokinesis, its p53-dependent repression may contribute to the prevention of uncontrolled cell growth.

  10. Additive Promotion of Viral Internal Ribosome Entry Site-Mediated Translation by Far Upstream Element-Binding Protein 1 and an Enterovirus 71-Induced Cleavage Product

    PubMed Central

    Hung, Chuan-Tien; Kung, Yu-An; Li, Mei-Ling; Lee, Kuo-Ming; Liu, Shih-Tung; Shih, Shin-Ru

    2016-01-01

    The 5' untranslated region (5' UTR) of the enterovirus 71 (EV71) RNA genome contains an internal ribosome entry site (IRES) that is indispensable for viral protein translation. Due to the limited coding capacity of their RNA genomes, EV71 and other picornaviruses typically recruit host factors, known as IRES trans-acting factors (ITAFs), to mediate IRES-dependent translation. Here, we show that EV71 viral proteinase 2A is capable of cleaving far upstream element-binding protein 1 (FBP1), a positive ITAF that directly binds to the EV71 5' UTR linker region to promote viral IRES-driven translation. The cleavage occurs at the Gly-371 residue of FBP1 during the EV71 infection process, and this generates a functional cleavage product, FBP11-371. Interestingly, the cleavage product acts to promote viral IRES activity. Footprinting analysis and gel mobility shift assay results showed that FBP11-371 similarly binds to the EV71 5' UTR linker region, but at a different site from full-length FBP1; moreover, FBP1 and FBP11-371 were found to act additively to promote IRES-mediated translation and virus yield. Our findings expand the current understanding of virus-host interactions with regard to viral recruitment and modulation of ITAFs, and provide new insights into translational control during viral infection. PMID:27780225

  11. Promotion of breast cancer by β-Hexachlorocyclohexane in MCF10AT1 cells and MMTV-neu mice

    PubMed Central

    Wong, Patrick S; Matsumura, Fumio

    2007-01-01

    Background Exposure to β-Hexachlorocyclohexane (β-HCH), a contaminant of the hexachlorohexane pesticide lindane, has been implicated as a risk factor in the development of breast cancers in epidemiological studies. Previous studies in our laboratory have demonstrated the ability of β-HCH to elicit its actions via a ligand-independent activation of the estrogen receptor through increased c-Neu (= erbB2 or HER-2) expression and kinase activation in both the BG-1 and MCF-7 cell lines. In addition, long term exposure (33 passages) to β-HCH was shown to promote the selection of MCF-7 cells which exhibit a more metastatic phenotype. Methods In this current study, we decided to investigate the long-term effects of β-HCH in both the MCF10AT1 cell line which was derived from a normal epithelial cell line by stably transfecting a mutated c-Ha-ras and a MMTV-Neu mouse model for mammary cancer in vivo. MCF10AT1 cells were exposed for 20 passages with β-HCH, 4-OH-Tamoxifen (Tam), or 17-β-estradiol (E2) after which cells were analyzed for proliferation rates and mRNA expression by RT-PCR. In our in vivo studies, MMTV-Neu mice were injected with β-HCH and observed for tumor formation over a 70 week period. Results β-HCH and Tam selected MCF10AT1 cells demonstrated increased mRNA expression of MMP-13 (collagenase-3) a marker of increased invasiveness. β-HCH treatment was also seen to increase the expression in a number of proto-oncogenes (c-Neu, Cyclin D1, p27), cell status markers (Met-1, CK19), and the inflammatory marker NFκB. Previous studies, have demonstrated the role of these markers as evidence of malignant transformations, and further illustrate the ability of β-HCH to be carcinogenic. To demonstrate β-HCH's tumorigenic properties in an in vivo system, we used an MMTV-Neu mouse model. MMTV-Neu is a c-Neu overexpressing strain which has been shown to spontaneously develop mammary tumors at later stages of aging. In this experiment, β-HCH exposure was shown to

  12. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    SciTech Connect

    Ceccarelli, Simona; Cardinali, Giorgia; Aspite, Nicaela; Picardo, Mauro; Marchese, Cinzia; Torrisi, Maria Rosaria; Mancini, Patrizia . E-mail: patrizia.mancini@uniroma1.it

    2007-05-15

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10.

  13. Measurement of proton production cross sections of {sup 10}Be and {sup 26}Al from elements found in lunar rocks

    SciTech Connect

    Sisterson, J.M.; Kim, K.; Englert, P.A.J.

    1996-07-01

    Cosmic rays penetrate the lunar surface and interact with the lunar rocks to produce both radionuclides and stable nuclides. Production depth profiles for long-lived radionuclides produce in lunar rocks are measured using Accelerator Mass Spectrometry (AMS). For a particular radionuclide these production depth profiles can be interpreted to give an estimate for the solar proton flux over a time period characterized by the half life of the radionuclide under study. This analysis is possible if and only if all the cross sections for the interactions of all cosmic ray particles with all elements found in lunar rocks are well known. In practice, the most important cross sections needed are the proton production cross sections, because 98% of solar cosmic rays and {similar_to}87% of galactic cosmic rays are protons. The cross sections for the production of long-lived radionuclides were very difficult to measure before the development of AMS and only in recent years has significant progress been made in determining these essential cross sections. Oxygen and silicon are major constituents of lunar rocks. We have reported already {sup 14}C production cross sections from O and Si for proton energies 25-500 MeV, and O(p,x){sup 10}Be from 58 160 MeV[6]. Here we present new measurements for the cross sections O(p,x){sup 10}Be,O(p,x){sup 7}Be, Si(p,x){sup 7}Be,Si(p,x){sup 26}Al, and Si(p,x){sup 22}Na from {approximately}30 - 500 MeV.

  14. Measurement of proton production cross sections of (sup 10)Be and (sup 26)Al from elements found in lunar rocks

    NASA Technical Reports Server (NTRS)

    Sisterson, J. M.; Kim, K.; Englert, P. A. J.; Caffee, M.; Jull, A. J. T.; Donahue, D. J.; McHargue, L.; Castaneda, C.; Vincent, J.; Reedy, R. C.

    1996-01-01

    Cosmic rays penetrate the lunar surface and interact with the lunar rocks to produce both radionuclides and stable nuclides. Production depth profiles for long-lived radionuclides produce in lunar rocks are measured using Accelerator Mass Spectrometry (AMS). For a particular radionuclide these production depth profiles can be interpreted to give an estimate for the solar proton flux over a time period characterized by the half life of the radionuclide under study. This analysis is possible if and only if all the cross sections for the interactions of all cosmic ray particles with all elements found in lunar rocks are well known. In practice, the most important cross sections needed are the proton production cross sections, because 98% of solar cosmic rays and (similar to)87% of galactic cosmic rays are protons. The cross sections for the production of long-lived radionuclides were very difficult to measure before the development of AMS and only in recent years has significant progress been made in determining these essential cross sections. Oxygen and silicon are major constituents of lunar rocks. We have reported already C-14 production cross sections from O and Si for proton energies 25-500 MeV, and O(p,x)(sup 10)Be from 58 160 MeV[6]. Here we present new measurements for the cross sections O(p,x)Be-10,O(p,x)Be-7, Si(p,x)Be-7,Si(p,x)Al-26, and Si(p,x)Na-22 from approximately 30 - 500 MeV.

  15. Molecular cloning of a small DNA binding protein with specificity for a tissue-specific negative element within the rps1 promoter.

    PubMed Central

    Zhou, D X; Bisanz-Seyer, C; Mache, R

    1995-01-01

    A cDNA encoding a specific binding activity for the tissue-specific negative cis-element S1F binding site of spinach rps1 was isolated from a spinach cDNA expression library. This cDNA of 0.7 kb encodes an unusual small peptide of only 70 amino acids, with a basic domain which contains a nuclear localization signal and a putative DNA binding helix. This protein, named S1Fa, is highly conserved between dicotyledonous and monocotyledonous plants and may represent a novel class of DNA binding proteins. The corresponding mRNA is accumulated more in roots and in etiolated seedlings than in green leaves. This expression pattern is correlated with the tissue-specific function of the S1F binding site which represses the rps1 promoter preferentially in roots and in etiolated plants. Images PMID:7739894

  16. A Novel AP-1 Element in the CD95 Ligand Promoter Is Required for Induction of Apoptosis in Hepatocellular Carcinoma Cells upon Treatment with Anticancer Drugs

    PubMed Central

    Eichhorst, Sören T.; Müller, Martina; Li-Weber, Min; Schulze-Bergkamen, Henning; Angel, Peter; Krammer, Peter H.

    2000-01-01

    The CD95 (also called APO-1 or Fas) system plays a major role in the induction of apoptosis in lymphoid and nonlymphoid tissues in response to a variety of extracellular signals, including chemotherapeutic drugs. Here we report that the CD95 ligand (CD95L) is upregulated in hepatoma cells upon treatment with antineoplastic drugs. Upregulation by different chemotherapeutic drugs is functionally relevant for drug-induced apoptosis and is mediated by transcriptional mechanisms. The MEKK1/JNKK pathway and a novel AP-1 element in the CD95L promoter downstream of the TATA box are required for CD95L upregulation. Thus, understanding the mechanisms of CD95-mediated apoptosis through CD95L upregulation upon treatment of hepatocellular carcinomas with chemotherapeutic drugs may contribute to the improvement of anticancer chemotherapy. PMID:11003676

  17. The CXCL10/CXCR3 axis promotes cardiac microvascular endothelial cell migration via the p38/FAK pathway in a proliferation-independent manner.

    PubMed

    Xia, Jing-Bo; Mao, Cheng-Zhou; Chen, Zhuo-Ying; Liu, Guang-Hui; Wu, Hai-Yan; Zhou, Deng-Cheng; Park, Kyu-Sang; Zhao, Hui; Kim, Soo-Ki; Cai, Dong-Qing; Qi, Xu-Feng

    2016-04-01

    CXCL10 is a chemokine with potent chemotactic activity for immune and non-immune cells expressing its receptor CXCR3. Previous studies have demonstrated that CXCL10 is involved in myocardial infarction. However, the role of CXCL10 in cardiac microvascular endothelial cell (CMEC) regulation and related mechanisms remains unclear. In this study, we investigated the effects of CXCL10 on the CMEC migration and explored its potential molecular mechanism by wound healing, cell proliferation and viability analysis. Furthermore, migration-related signaling pathways, including FAK, Erk, p38 and Smad, were examined by Western blotting. We found that CXCL10 significantly promotes CMEC migration under normal conditions and during hypoxia/ischemia. However, no significant differences in CMEC proliferation and viability were observed with or without CXCL10 treatment. CXCL10-mediated CMEC migration was greatly blocked by treatment with an anti-CXCR3 antibody. Although CXCL10 treatment promoted phosphorylation and activation of the FAK, Erk, and p38 pathways during hypoxia/ischemia, CXCL10-mediated CMEC migration was significantly blocked by p38 and FAK inhibitors, but not by an Erk inhibitor. Furthermore, CXCL10-mediated FAK activation was suppressed by the p38 inhibitor. These findings indicated that the CXCL10/CXCR3 pathway promotes the migration of CMECs under normal conditions and during hypoxia/ischemia in a proliferation-independent manner, at least in part, through regulation of the p38/FAK pathways.

  18. A calmodulin like EF hand protein positively regulates oxalate decarboxylase expression by interacting with E-box elements of the promoter

    PubMed Central

    Kamthan, Ayushi; Kamthan, Mohan; Kumar, Avinash; Sharma, Pratima; Ansari, Sekhu; Thakur, Sarjeet Singh; Chaudhuri, Abira; Datta, Asis

    2015-01-01

    Oxalate decarboxylase (OXDC) enzyme has immense biotechnological applications due to its ability to decompose anti-nutrient oxalic acid. Flammulina velutipes, an edible wood rotting fungus responds to oxalic acid by induction of OXDC to maintain steady levels of pH and oxalate anions outside the fungal hyphae. Here, we report that upon oxalic acid induction, a calmodulin (CaM) like protein-FvCaMLP, interacts with the OXDC promoter to regulate its expression. Electrophoretic mobility shift assay showed that FvCamlp specifically binds to two non-canonical E-box elements (AACGTG) in the OXDC promoter. Moreover, substitutions of amino acids in the EF hand motifs resulted in loss of DNA binding ability of FvCamlp. F. velutipes mycelia treated with synthetic siRNAs designed against FvCaMLP showed significant reduction in FvCaMLP as well as OXDC transcript pointing towards positive nature of the regulation. FvCaMLP is different from other known EF hand proteins. It shows sequence similarity to both CaMs and myosin regulatory light chain (Cdc4), but has properties typical of a calmodulin, like binding of 45Ca2+, heat stability and Ca2+ dependent electrophoretic shift. Hence, FvCaMLP can be considered a new addition to the category of unconventional Ca2+ binding transcriptional regulators. PMID:26455820

  19. IL-10 Promotes Neurite Outgrowth and Synapse Formation in Cultured Cortical Neurons after the Oxygen-Glucose Deprivation via JAK1/STAT3 Pathway

    PubMed Central

    Chen, Hongbin; Lin, Wei; Zhang, Yixian; Lin, Longzai; Chen, Jianhao; Zeng, Yongping; Zheng, Mouwei; Zhuang, Zezhong; Du, Houwei; Chen, Ronghua; Liu, Nan

    2016-01-01

    As a classic immunoregulatory and anti-inflammatory cytokine, interleukin-10 (IL-10) provides neuroprotection in cerebral ischemia in vivo or oxygen-glucose deprivation (OGD)-induced injury in vitro. However, it remains blurred whether IL-10 promotes neurite outgrowth and synapse formation in cultured primary cortical neurons after OGD injury. In order to evaluate its effect on neuronal apoptosis, neurite outgrowth and synapse formation, we administered IL-10 or IL-10 neutralizing antibody (IL-10NA) to cultured rat primary cortical neurons after OGD injury. We found that IL-10 treatment activated the Janus kinase 1 (JAK1)/signal transducers and activators of transcription 3 (STAT3) signaling pathway. Moreover, IL-10 attenuated OGD-induced neuronal apoptosis by down-regulating the Bax expression and up-regulating the Bcl-2 expression, facilitated neurite outgrowth by increasing the expression of Netrin-1, and promoted synapse formation in cultured primary cortical neurons after OGD injury. These effects were partly abolished by JAK1 inhibitor GLPG0634. Contrarily, IL-10NA produced opposite effects on the cultured cortical neurons after OGD injury. Taken together, our findings suggest that IL-10 not only attenuates neuronal apoptosis, but also promotes neurite outgrowth and synapse formation via the JAK1/STAT3 signaling pathway in cultured primary cortical neurons after OGD injury. PMID:27456198

  20. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... history records checks and other elements of background checks for designated categories of individuals..., identification and criminal history records checks and other elements of background checks for designated... aforementioned persons who has undergone equivalent criminal history records and background checks to...

  1. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... history records checks and other elements of background checks for designated categories of individuals..., identification and criminal history records checks and other elements of background checks for designated... aforementioned persons who has undergone equivalent criminal history records and background checks to...

  2. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... history records checks and other elements of background checks for designated categories of individuals..., identification and criminal history records checks and other elements of background checks for designated... aforementioned persons who has undergone equivalent criminal history records and background checks to...

  3. Identification of a regulatory element responsible for salt induction of rice OsRAV2 through ex situ and in situ promoter analysis.

    PubMed

    Duan, Yong-Bo; Li, Juan; Qin, Rui-Ying; Xu, Rong-Fang; Li, Hao; Yang, Ya-Chun; Ma, Hui; Li, Li; Wei, Peng-Cheng; Yang, Jian-Bo

    2016-01-01

    Salt is a major environmental stress factor that can affect rice growth and yields. Recent studies suggested that members of the AP2/ERF domain-containing RAV (related to ABI3/VP1) TF family are involved in abiotic stress adaptation. However, the transcriptional response of rice RAV genes (OsRAVs) to salt has not yet been fully characterized. In this study, the expression patterns of all five OsRAVs were examined under salt stress. Only one gene, OsRAV2, was stably induced by high-salinity treatment. Further expression profile analyses indicated that OsRAV2 is transcriptionally regulated by salt, but not KCl, osmotic stress, cold or ABA (abscisic acid) treatment. To elucidate the regulatory mechanism of the stress response at the transcriptional level, we isolated and characterized the promoter region of OsRAV2 (P OsRAV2 ). Transgenic analysis indicated that P OsRAV2 is induced by salt stress but not osmotic stress or ABA treatment. Serial 5' deletions and site-specific mutations in P OsRAV2 revealed that a GT-1 element located at position -664 relative to the putative translation start site is essential for the salt induction of P OsRAV2 . The regulatory function of the GT-1 element in the salt induction of OsRAV2 was verified in situ in plants with targeted mutations generated using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) system. Taken together, our results indicate that the GT-1 element directly controls the salt response of OsRAV2. This study provides a better understanding of the putative functions of OsRAVs and the molecular regulatory mechanisms of plant genes under salt stress. PMID:26482477

  4. A sugar beet chlorophyll a/b binding protein promoter void of G-box like elements confers strong and leaf specific reporter gene expression in transgenic sugar beet

    PubMed Central

    Stahl, Dietmar J; Kloos, Dorothee U; Hehl, Reinhard

    2004-01-01

    Background Modification of leaf traits in sugar beet requires a strong leaf specific promoter. With such a promoter, expression in taproots can be avoided which may otherwise take away available energy resources for sugar accumulation. Results Suppression Subtractive Hybridization (SSH) was utilized to generate an enriched and equalized cDNA library for leaf expressed genes from sugar beet. Fourteen cDNA fragments corresponding to thirteen different genes were isolated. Northern blot analysis indicates the desired tissue specificity of these genes. The promoters for two chlorophyll a/b binding protein genes (Bvcab11 and Bvcab12) were isolated, linked to reporter genes, and transformed into sugar beet using promoter reporter gene fusions. Transient and transgenic analysis indicate that both promoters direct leaf specific gene expression. A bioinformatic analysis revealed that the Bvcab11 promoter is void of G-box like regulatory elements with a palindromic ACGT core sequence. The data indicate that the presence of a G-box element is not a prerequisite for leaf specific and light induced gene expression in sugar beet. Conclusions This work shows that SSH can be successfully employed for the identification and subsequent isolation of tissue specific sugar beet promoters. These promoters are shown to drive strong leaf specific gene expression in transgenic sugar beet. The application of these promoters for expressing resistance improving genes against foliar diseases is discussed. PMID:15579211

  5. Anthropogenic platinum group element (Pt, Pd, Rh) concentrations in PM10 and PM2.5 from Kolkata, India.

    PubMed

    Diong, Huey Ting; Das, Reshmi; Khezri, Bahareh; Srivastava, Bijayen; Wang, Xianfeng; Sikdar, Pradip K; Webster, Richard D

    2016-01-01

    This study investigates platinum group elements (PGEs) in the breathable (PM10) and respirable (PM2.5) fractions of air particulates from a heavily polluted Indian metro city. The samples were collected from traffic junctions at the heart of the city and industrial sites in the suburbs during winter and monsoon seasons of 2013-2014. PGE concentrations were determined by inductively coupled plasma-mass spectrometry (ICP-MS). The PGE concentrations in the samples from traffic junctions are within the range of 2.7-111 ng/m(3) for Pd, 0.86-12.3 ng/m(3) for Pt and 0.09-3.13 ng/m(3) for Rh, and from industrial sites are within the range of 3.12-32.3 ng/m(3) for Pd, 0.73-7.39 ng/m(3) for Pt and 0.1-0.69 ng/m(3) for Rh. Pt concentrations were lower in the monsoon compared to winter while Pd concentrations increased during monsoon and Rh stayed relatively unaffected across seasons. For all seasons and locations, concentrations of Pd > Pt > Rh, indicating dominance of Pd-containing exhaust converters. Most of the PGEs were concentrated in the PM2.5 fraction. A strong correlation (R ≥ 0.62) between the PGEs from traffic junction indicates a common emission source viz. catalytic converters, whereas a moderate to weak correlation (R ≤ 0.5) from the industrial sites indicate mixing of different sources like coal, raw materials used in the factories and automobile. A wider range of Pt/Pd, Pt/Rh and Pd/Rh ratios measured in the traffic junction possibly hint towards varying proportions of PGEs used for catalyst productions in numerous rising and established car brands. PMID:27536525

  6. Anthropogenic platinum group element (Pt, Pd, Rh) concentrations in PM10 and PM2.5 from Kolkata, India.

    PubMed

    Diong, Huey Ting; Das, Reshmi; Khezri, Bahareh; Srivastava, Bijayen; Wang, Xianfeng; Sikdar, Pradip K; Webster, Richard D

    2016-01-01

    This study investigates platinum group elements (PGEs) in the breathable (PM10) and respirable (PM2.5) fractions of air particulates from a heavily polluted Indian metro city. The samples were collected from traffic junctions at the heart of the city and industrial sites in the suburbs during winter and monsoon seasons of 2013-2014. PGE concentrations were determined by inductively coupled plasma-mass spectrometry (ICP-MS). The PGE concentrations in the samples from traffic junctions are within the range of 2.7-111 ng/m(3) for Pd, 0.86-12.3 ng/m(3) for Pt and 0.09-3.13 ng/m(3) for Rh, and from industrial sites are within the range of 3.12-32.3 ng/m(3) for Pd, 0.73-7.39 ng/m(3) for Pt and 0.1-0.69 ng/m(3) for Rh. Pt concentrations were lower in the monsoon compared to winter while Pd concentrations increased during monsoon and Rh stayed relatively unaffected across seasons. For all seasons and locations, concentrations of Pd > Pt > Rh, indicating dominance of Pd-containing exhaust converters. Most of the PGEs were concentrated in the PM2.5 fraction. A strong correlation (R ≥ 0.62) between the PGEs from traffic junction indicates a common emission source viz. catalytic converters, whereas a moderate to weak correlation (R ≤ 0.5) from the industrial sites indicate mixing of different sources like coal, raw materials used in the factories and automobile. A wider range of Pt/Pd, Pt/Rh and Pd/Rh ratios measured in the traffic junction possibly hint towards varying proportions of PGEs used for catalyst productions in numerous rising and established car brands.

  7. Direct interaction of Sox10 with the promoter of murine Dopachrome Tautomerase (Dct) and synergistic activation of Dct expression with Mitf.

    PubMed

    Jiao, Zhongxian; Mollaaghababa, Ramin; Pavan, William J; Antonellis, Anthony; Green, Eric D; Hornyak, Thomas J

    2004-08-01

    The murine dopachrome tautomerase (Dct) gene is expressed early in melanocyte development during embryogenesis, prior to other members of the tyrosinase gene family important for regulating pigmentation. We have used deletion mutants of the Dct promoter, transfections with developmentally relevant transcription factors, and gel shift assays to define transcriptional determinants of Dct expression. Deletion mutagenesis studies show that sequences within the proximal 459 nucleotides are critical for high level expression in melanocytic cells. This region of the promoter contains candidate binding sites for the transcription factors Sox10 and Mitf. Transfections into 293T and NIH3T3 cells show that Sox10 and Mitf independently activate Dct expression, and, when co-transfected, synergistically activate Dct expression. To support the notion that Sox10 acts directly upon the Dct promoter to activate gene expression, direct interaction of Sox10 was demonstrated using gel shifts of oligonucleotide probes derived from promoter sequences within the region required for Sox10-dependent induction. These results suggest that a combinatorial transcription factor interaction is important for expression of Dct in neural crest-derived melanocytes, and support a model for sequential gene activation in melanocyte development whereby Mitf, a Sox10-dependent transcription factor, is expressed initially before an early melanocyte differentiation gene, Dct, is expressed.

  8. Engagement and Nonusage Attrition With a Free Physical Activity Promotion Program: The Case of 10,000 Steps Australia

    PubMed Central

    Vandelanotte, Corneel; Kirwan, Morwenna

    2015-01-01

    Background Data from controlled trials indicate that Web-based interventions generally suffer from low engagement and high attrition. This is important because the level of exposure to intervention content is linked to intervention effectiveness. However, data from real-life Web-based behavior change interventions are scarce, especially when looking at physical activity promotion. Objective The aims of this study were to (1) examine the engagement with the freely available physical activity promotion program 10,000 Steps, (2) examine how the use of a smartphone app may be helpful in increasing engagement with the intervention and in decreasing nonusage attrition, and (3) identify sociodemographic- and engagement-related determinants of nonusage attrition. Methods Users (N=16,948) were grouped based on which platform (website, app) they logged their physical activity: Web only, app only, or Web and app. Groups were compared on sociodemographics and engagement parameters (duration of usage, number of individual and workplace challenges started, and number of physical activity log days) using ANOVA and chi-square tests. For a subsample of users that had been members for at least 3 months (n=11,651), Kaplan-Meier survival curves were estimated to plot attrition over the first 3 months after registration. A Cox regression model was used to determine predictors of nonusage attrition. Results In the overall sample, user groups differed significantly in all sociodemographics and engagement parameters. Engagement with the program was highest for Web-and-app users. In the subsample, 50.00% (5826/11,651) of users stopped logging physical activity through the program after 30 days. Cox regression showed that user group predicted nonusage attrition: Web-and-app users (hazard ratio=0.86, 95% CI 0.81-0.93, P<.001) and app-only users (hazard ratio=0.63, 95% CI 0.58-0.68, P<.001) showed a reduced attrition risk compared to Web-only users. Further, having a higher number of

  9. Dental pain among 10–15 year old children attending oral health promoting schools: A cross-sectional study

    PubMed Central

    Saheer, Abdul; Kousalya, Pallavi Swami; Raju, Rekha; Gubbihal, Radha

    2015-01-01

    Introduction: Dental pain is a major public health problem and one of the consequences of oral diseases which requires significant adjustments in life management leading to decreased quality of life. Objective: To assess prevalence of dental pain and its impact on daily life and to explore its relationship with oral health behavior and clinical oral status among 10-15 year old school children attending oral health promoting schools. Method: This cross sectional study was conducted in 6 schools serving low -middle socio economic strata in Bangalore, India. A total of 1237 children were surveyed for history of dental pain during past 3 month. Participants who reported dental pain completed self-reported oral health behaviour and Child dental pain questionnaire. Clinical oral examination included assessment of dental caries, periodontal status. Data was analyzed using t - test, Chi-square test, ANOVA and Regression Analysis. Results: Prevalence of dental pain was 15.6% (n = 194). Among children with pain, 17%, 43% and 40% reported mild, moderate and severe pain. Impact on daily activities was reported by 66%. Mean DMFT and DMFS was 1.80 and 2.11 Mean deft and defs was 2.47 and 3.41. Multiple logistic regression revealed that severity and impact of dental pain was associated with gender, frequency of tooth brushing, consumption of sweets and deciduous dental caries experience. Conclusion: Prevalence of Dental pain is associated with brushing behavior, consumption of sweets and deciduous dental caries experience, showing need for further attention to these conditions and a need to strengthen preventive and therapeutic dental services. PMID:26942112

  10. Activation of dioxin response element (DRE)-associated genes by benzo(a)pyrene 3,6-quinone and benzo(a)pyrene 1,6-quinone in MCF-10A human mammary epithelial cells

    SciTech Connect

    Burchiel, Scott W. . E-mail: SBurchiel@salud.unm.edu; Thompson, Todd A.; Lauer, Fredine T.; Oprea, Tudor I.

    2007-06-01

    Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known as electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress-associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1), PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor-associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion.

  11. ACTIVATION OF DIOXIN RESPONSE ELEMENT (DRE)-ASSOCIATED GENES BY BENZO(A)PYRENE 3,6-QUINONE AND BENZO(A)PYRENE 1,6-QUINONE IN MCF-10A HUMAN MAMMARY EPITHELIAL CELLS

    PubMed Central

    Burchiel, Scott W.; Thompson, Todd A.; Lauer, Fredine T.; Oprea, Tudor I.

    2007-01-01

    Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known and electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1) PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion. PMID:17466351

  12. Association Between IL-10 Gene Promoter Polymorphisms (-592 A/C, -819 T/C, -1082 A/G) and Susceptibility to HBV Infection in an Iranian Population

    PubMed Central

    Moudi, Bita; Heidari, Zahra; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad; Metanat, Malihe; Khosravi, Soheila; Farrokh, Parisa

    2016-01-01

    Background IL-10 can play a vital role in immune response against HBV. Three biallelic SNPs from the transcription start site control the transcription of the IL-10 gene. An association between susceptibility to HBV and IL-10 polymorphisms has been suggested in patients with HBV infection. Objectives The present study was designed to study the association between polymorphisms in interleukin-10 (-1082 A/G, -819 T/C and -592 A/C) promoter gene and chronic hepatitis B virus (HBV) infection. Patients and Methods 221 chronically infected patients and 200 healthy control subjects were enrolled in the study. Three biallelic (-1082 A/G, -819 T/C and -592 A/C) polymorphisms in the IL-10 promoter gene were determined by PCR-RFLP method. Results Persistent HBV infection was associated with IL-10-1082 AG (P = 0.001) and GG (P = 0.004) genotypes and G (P = 0.000) allele. IL-10-819 T/C and -592 A/C genotype and allele frequencies did not show any correlation with the risk of chronic hepatitis B infection. Conclusions These results suggest that polymorphisms in interleukin-10 gene promoter influence clinical outcome of HBV infection and susceptibility to HBV infection. PMID:27148384

  13. The red sport of 'Zaosu' pear and its red-striped pigmentation pattern are associated with demethylation of the PyMYB10 promoter.

    PubMed

    Qian, Minjie; Sun, Yongwang; Allan, Andrew C; Teng, Yuanwen; Zhang, Dong

    2014-11-01

    'Zaosu' pear, a hybrid of Pyrus pyrifolia and Pyrus communis, is a popular cultivar developed in China. 'Zaosu Red' is a bud sport of 'Zaosu' with red shoots, young leaves, and fruit. After grafting of 'Zaosu Red', reverse mutations in some branches lead to a loss of colour in leaves and stems. Also, the mature fruit of 'Zaosu Red' exhibits two phenotypes; fully red and striped. The aim of this study was to establish the mechanism of the red colour mutation in 'Zaosu' and the striped pigmentation pattern in fruit of 'Zaosu Red'. The accumulation of anthocyanins and transcript levels of the genes PpUFGT2 and PyMYB10 were highly correlated. The open reading frames (ORF) and promoter regions of these two key genes were cloned and compared between 'Zaosu' and its bud sports, but no sequence differences were found. The R2R3 MYB, PyMYB10, can activate expression of genes encoding enzymes of the anthocyanin biosynthetic pathway. A yeast one-hybrid assay showed that PyMYB10 was associated with the -658 to -172bp fragment of the PpUFGT2 promoter, probably via a MYB binding site (MBS) located at -466bp. The PyMYB10 promoter had lower methylation levels in anthocyanin-rich tissues, indicating that the red bud sport of 'Zaosu' pear and the striped pigmentation pattern of 'Zaosu Red' pear are associated with demethylation of the PyMYB10 promoter.

  14. Kerb and urban increment of highly time-resolved trace elements in PM10, PM2.5 and PM1.0 winter aerosol in London during ClearfLo 2012

    NASA Astrophysics Data System (ADS)

    Visser, S.; Slowik, J. G.; Furger, M.; Zotter, P.; Bukowiecki, N.; Dressler, R.; Flechsig, U.; Appel, K.; Green, D. C.; Tremper, A. H.; Young, D. E.; Williams, P. I.; Allan, J. D.; Herndon, S. C.; Williams, L. R.; Mohr, C.; Xu, L.; Ng, N. L.; Detournay, A.; Barlow, J. F.; Halios, C. H.; Fleming, Z. L.; Baltensperger, U.; Prévôt, A. S. H.

    2015-03-01

    Ambient concentrations of trace elements with 2 h time resolution were measured in PM10-2.5, PM2.5-1.0 and PM1.0-0.3 size ranges at kerbside, urban background and rural sites in London during winter 2012. Samples were collected using rotating drum impactors (RDIs) and subsequently analysed with synchrotron radiation-induced X-ray fluorescence spectrometry (SR-XRF). Quantification of kerb and urban increments (defined as kerb-to-urban and urban-to-rural concentration ratios, respectively), and assessment of diurnal and weekly variability provided insight into sources governing urban air quality and the effects of urban micro-environments on human exposure. Traffic-related elements yielded the highest kerb increments, with values in the range of 10.4 to 16.6 for SW winds (3.3-6.9 for NE) observed for elements influenced by brake wear (e.g. Cu, Sb, Ba) and 5.7 to 8.2 for SW (2.6-3.0 for NE) for other traffic-related processes (e.g. Cr, Fe, Zn). Kerb increments for these elements were highest in the PM10-2.5 mass fraction, roughly twice that of the PM1.0-0.3 fraction. These elements also showed the highest urban increments (~ 3.0), although no difference was observed between brake wear and other traffic-related elements. All elements influenced by traffic exhibited higher concentrations during morning and evening rush hours, and on weekdays compared to weekends, with the strongest trends observed at the kerbside site, and additionally enhanced by winds coming directly from the road, consistent with street canyon effects. Elements related to mineral dust (e.g. Al, Si, Ca, Sr) showed significant influences from traffic-induced resuspension, as evidenced by moderate kerb (3.4-5.4 for SW, 1.7-2.3 for NE) and urban (~ 2) increments and increased concentrations during peak traffic flow. Elements related to regional transport showed no significant enhancement at kerb or urban sites, with the exception of PM10-2.5 sea salt (factor of up to 2), which may be influenced by

  15. Single-molecule studies reveal that DEAD box protein DDX1 promotes oligomerization of HIV-1 Rev on the Rev response element.

    PubMed

    Robertson-Anderson, Rae M; Wang, Jun; Edgcomb, Stephen P; Carmel, Andrew B; Williamson, James R; Millar, David P

    2011-07-29

    Oligomeric assembly of Rev on the Rev response element (RRE) is essential for the nuclear export of unspliced and singly spliced human immunodeficiency virus type 1 viral mRNA transcripts. Several host factors, including the human DEAD box protein DDX1, are also known to be required for efficient Rev function. In this study, spontaneous assembly and dissociation of individual Rev-RRE complexes in the presence or absence of DDX1 were observed in real time via single-molecule total internal reflection fluorescence microscopy. Binding of up to eight fluorescently labeled Rev monomers to a single RRE molecule was visualized, and the event frequencies and corresponding binding and dissociation rates for the different Rev-RRE stoichiometries were determined. The presence of DDX1 eliminated a second kinetic phase present during the initial Rev binding step, attributed to nonproductive nucleation events, resulting in increased occurrence of higher-order Rev-RRE stoichiometries. This effect was further enhanced upon the addition of a non-hydrolyzable ATP analog (adenylyl-imidophosphate), whereas ADP had no effect beyond that of DDX1 alone. Notably, the first three Rev monomer binding events were accelerated in the presence of DDX1 and adenylyl-imidophosphate, while the dissociation rates remained unchanged. Measurements performed across a range of DDX1 concentrations suggest that DDX1 targets Rev rather than the RRE to promote oligomeric assembly. Moreover, DDX1 is able to restore the oligomerization activity of a Rev mutant that is otherwise unable to assemble on the RRE beyond a monomeric complex. Taken together, these results suggest that DDX1 acts as a cellular cofactor by promoting oligomerization of Rev on the RRE. PMID:21763499

  16. Long interspersed nucleotide acid element-1 ORF-1 protein promotes proliferation and invasion of human colorectal cancer LoVo cells through enhancing ETS-1 activity.

    PubMed

    Li, M Y; Zhu, M; Feng, F; Cai, F Y; Fan, K C; Jiang, H; Wang, Z Q; Linghu, E Q

    2014-04-14

    The human proto-oncogene long interspersed nucleotide acid element-1 (LINE-1) open reading frame-1 protein (ORF-1p) is involved in the progress of several cancers. The transcription factor ETS-1 can mediate the transcription of some downstream genes that play specific roles in the regulation of cancerous cell invasion and metastasis. In this study, the effects of LINE-1 ORF-1p on ETS-1 activity and on the proliferation and invasion of human colorectal cancer LoVo cells were investigated. Results showed that the overexpression of LINE-1 ORF-1p enhanced the transcription of ETS-1 downstream genes and increased their protein levels, and downregulation of the LINE-1 ORF-1p level by small interfering RNA (siRNA) reduced the transcriptional activation of ETS-1. In addition, overexpression of LINE-1 ORF-1p promoted LoVo cell proliferation and anchor-independent growth, and a knockdown of the LINE-1 protein level by siRNA reduced the proliferation and anchor-independent growth ability of LoVo cells. In vivo data revealed that LINE-1 ORF-1p overexpression increased LoVo tumor growth in nude mice, whereas the siRNA knockdown of endogenous LINE-1 ORF-1p expression decreased LoVo cell growth in nude mice. Therefore, LINE- 1 ORF-1p could promote LoVo cell proliferation and invasion both in vitro and in vivo, indicating that it might be a useful molecular target for the treatment of human colorectal cancer.

  17. Kerb and urban increment of highly time-resolved trace elements in PM10, PM2.5 and PM1.0 winter aerosol in London during ClearfLo 2012

    NASA Astrophysics Data System (ADS)

    Visser, S.; Slowik, J. G.; Furger, M.; Zotter, P.; Bukowiecki, N.; Dressler, R.; Flechsig, U.; Appel, K.; Green, D. C.; Tremper, A. H.; Young, D. E.; Williams, P. I.; Allan, J. D.; Herndon, S. C.; Williams, L. R.; Mohr, C.; Xu, L.; Ng, N. L.; Detournay, A.; Barlow, J. F.; Halios, C. H.; Fleming, Z. L.; Baltensperger, U.; Prévôt, A. S. H.

    2014-06-01

    Ambient concentrations of trace elements with 2 h time resolution were measured in PM10-2.5, PM2.5-1.0 and PM1.0-0.3 size ranges at kerbside, urban background and rural sites in London during winter 2012. Samples were collected using rotating drum impactors (RDIs) and subsequently analysed with synchrotron radiation-induced X-ray fluorescence spectrometry (SR-XRF). Quantification of kerb and urban increments (defined as kerb-to-urban and urban-to-rural concentration ratios, respectively), and assessment of diurnal and weekly variability provided insight into sources governing urban air quality and the effects of urban micro-environments on human exposure. Traffic-related elements yielded the highest kerb increments, with values in the range of 11.6 to 18.5 for SW winds (3.6-9.4 for NE) observed for elements influenced by brake wear (e.g. Cu, Sb, Ba) and 5.6 to 8.0 for SW (2.6-6.5 for NE) for other traffic-related processes (e.g. Cr, Fe, Zn). Kerb increments for these elements were highest in the PM10-2.5 mass fraction, roughly 3 times that of the PM1.0-0.3 fraction. These elements also showed the highest urban increments (∼3.0), although no difference was observed between brake wear and other traffic-related elements. Traffic-related elements exhibited higher concentrations during morning and evening rush hour, and on weekdays compared to weekends, with the strongest trends observed at the kerbside site, and additionally enhanced by winds coming directly from the road, consistent with street canyon effects. Elements related to mineral dust (e.g. Al, Ca, Sr) showed significant influences from traffic-induced resuspension, as evidenced by moderate kerb (2.0-4.1 for SW, 1.4-2.1 for NE) and urban (1.7-2.3) increments and increased concentrations during peak traffic flow. Elements related to regional transport showed no significant enhancement at kerb or urban sites, with the exception of PM10-2.5 sea salt (factor of 1.5-2.0), which may be influenced by traffic

  18. Single nucleotide polymorphism at −1087 locus of interleukin-10 gene promoter is associated with severe chronic periodontitis in nonsmoking patients

    PubMed Central

    Crena, Jasmine; Subramanian, Sangeetha; Victor, Dayanand John; Gnana, Prakash Ponnudurai Samuel; Ramanathan, Arvind

    2015-01-01

    Objective: Single nucleotide polymorphisms (SNPs) in the promoter region of interleukin (IL)-10 gene, which codes for the anti-inflammatory cytokine IL-10, have been associated with its level of production in chronic periodontitis. The prevalence of promoter SNP genotypes is known in other populations with chronic periodontitis, while its association in the Indian population is not known. Hence, the present study was designed to investigate the prevalence of IL-10 promoter polymorphism in a racially defined group of Indians with severe chronic periodontitis as the Indian population is known to be genetically diverse. Materials and Methods: Genomic deoxyribonucleic acid was extracted from 46 nonsmoking patients with severe chronic periodontitis and 45 subjects with healthy periodontium. A SNP locus at −1087 of IL-10 was chosen, as this locus has been frequently associated with chronic periodontitis in other population. Genotyping was carried out using allele-specific polymerase chain reaction (AS-PCR), and the frequencies of genotype were analyzed between the groups. Results: The distribution of genotype and allele frequencies showed significant differences between the study groups. The prevalence of genotype AA alleles at −1087 locus of IL-10 was significantly higher in severe chronic periodontitis patients compared to the healthy controls (P = 0.05). Conclusion: The study has identified a positive association between the occurrence of AA allele at −1087 locus of IL-10 gene and severe chronic periodontitis in nonsmoking patients. PMID:26430368

  19. Factors influencing the promotion of transformation in chemically-initiated C3H/10T1/2 Cl 8 mouse embryo fibroblasts.

    PubMed

    Frazelle, J H; Abernethy, D J; Boreiko, C J

    1983-01-01

    Treatment of low density asynchronous cultures of C3H/10T1/2 Cl 8 mouse embryo fibroblasts with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) initiates the process of transformation and produces significant numbers of transformed foci only when treated cultures are subsequently exposed to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). Cell culture variables which influence the outcome of this initiation and promotion system were studied. A TPA concentration of 0.25 micrograms/ml was found to be optimal for the promotion of focus production and the presence of TPA was required both during logarithmic growth and throughout confluence. The lot of fetal calf serum used to cultivate the cells also played a determining role in focus production. Of nine serum lots purchased from four different suppliers, only two were suited for initiation and promotion studies with MNNG and TPA. In contrast, seven of these lots were adequate for transformation studies with 3-methylcholanthrene. Factors which adversely influenced focus production included the use of fungizone or the use of high passage stock cultures. These studies demonstrate that cell culture variables which influence promotion in these cells can be controlled and that this system can be successfully used in studies of the cellular mechanism of in vitro promotion and for the detection of genotoxic substances.

  20. Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor. beta. 1 and by the retinoblastoma gene product

    SciTech Connect

    Pietenpol, J.A.; Stein, R.W.; Moses, H.L. ); Muenger, K.; Howley, P.M. )

    1991-11-15

    Previous studies have shown that transforming growth factor {beta}1 (TGF-{beta}1) inhibition of keratinocyte proliferation involves suppression of c-myc transcription, and indirect evidence has suggested that the retinoblastoma gene product (pRB) may be involved in this process. In this study, transient expression of pRB in skin keratinocytes was shown to repress transcription of the human c-myc promoter region was required for regulation by both TGF-{beta}1 and pRB. These sequences, termed the TGF-{beta} control element (TCE), lie between positions {minus}86 and {minus}63 relative to the P1 transcription start site. Oligonucleotides containing the TCE bound to several nuclear factors in mobility-shift assays using extracts from cells with or without normal pRB. Binding of some factors was inhibited by TGF-{beta}1 treatment of TGF-{beta}-sensitive but not TGF-{beta}-insensitive cells. These data indicate that pRB can suppress c-myc transcription and growth inhibition.

  1. Gel mobility shift scanning of pectin-inducible promoter from Penicillium griseoroseum reveals the involvement of a CCAAT element in the expression of a polygalacturonase gene

    PubMed Central

    2009-01-01

    Previous reports have described pgg2, a polygalacturonase-encoding gene of Penicillium griseoroseum, as an attractive model for transcriptional regulation studies, due to its high expression throughout several in vitro growth conditions, even in the presence of non-inducing sugars such as sucrose. A search for regulatory motifs in the 5' upstream regulatory sequence of pgg2 identified a putative CCAAT box that could justify this expression profile. This element, located 270 bp upstream of the translational start codon, was tested as binding target for regulatory proteins. Analysis of a 170 bp promoter fragment by electrophoretic mobility shift assay (EMSA) with nuclear extracts prepared from mycelia grown in pectin-containing culture medium revealed a high mobility complex that was subsequently confirmed by analyzing it with a double-stranded oligonucleotide spanning the CCAAT motif. A substitution in the core sequence for GTAGG partially abolished the formation of specific complexes, showing the involvement of the CCAAT box in the regulation of the polygalacturonase gene studied. PMID:21637657

  2. Selective catalytic reduction of sulfur dioxide to elemental sulfur. Quarterly technical progress report No. 10, October 1994--December 1994

    SciTech Connect

    Liu, W.; Flytzani-Stephanopoulos, M.; Sarofim, A.F.

    1995-03-01

    Elemental sulfur recovery from SO{sub 2}-containing gas stream is highly attractive as it produces a salable product and no waste. However, commercially available schemes are complex and involve multi-stage reactors, such as, most notably in the Resox (reduction of SO{sub 2} with coke) and Claus plant (reaction of SO{sub 2} with H{sub 2}S over catalyst). This project will investigate a cerium oxide catalyst for the single stage selective reduction of SO{sub 2} to elemental sulfur by a reductant, such as carbon monoxide. Cerium oxide has been identified in recent work at MIT as a superior catalyst for SO{sub 2} reduction by CO to elemental sulfur because its high activity and high selectivity to sulfur over COS over a wide temperature range (400-650{degrees}C). The detailed kinetic and parametric studies of SO{sub 2} reduction planned in this work over various CeO{sub 2}-formulations will provide the necessary basis for development of a very simplified process, namely that of a single-stage elemental sulfur recovery scheme from variable concentration gas streams. The potential cost- and energy-efficiency benefits from this approach cannot be overstated. A first apparent application is treatment of a regenerator off-gases in power plants using regenerative flue gas desulfurization. Such a simple catalytic converter may offer the long-sought {open_quotes}Claus-alternative{close_quotes} for coal-fired power plant applications.

  3. 10 CFR 73.59 - Relief from fingerprinting, identification and criminal history records checks and other elements...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 73.2: (a) An employee of the Commission or the Executive Branch of the United States government who.... Government criminal history records check; (e) The Governor of a State or his or her designated State... history records checks and other elements of background checks for designated categories of...

  4. Best Short Stories. Middle Level. 10 Stories for Young Adults--With Lessons for Teaching the Basic Elements of Literature.

    ERIC Educational Resources Information Center

    Harris, Raymond

    This workbook contains ten short stories by modern masters aimed at young adult readers, with each story followed by a concise lesson on a basic element of literature (such as plot, setting, or mood) clearly illustrated in the story. Some of the authors represented in the book are John Updike, Isaac Bashevis Singer, Carson McCullers, and Ray…

  5. 10 CFR Appendix O to Part 110 - Illustrative List of Fuel Element Fabrication Plant Equipment and Components Under NRC's Export...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... NRC's Export Licensing Authority Note: Nuclear fuel elements are manufactured from source or special nuclear material. For oxide fuels, the most common type of fuel equipment for pressing pellets, sintering... the integrity of completed fuel pins (or rods). This item typically includes equipment for: (i)...

  6. Mass concentration and elemental composition of indoor PM 2.5 and PM 10 in University rooms in Thessaloniki, northern Greece

    NASA Astrophysics Data System (ADS)

    Gemenetzis, Panagiotis; Moussas, Panagiotis; Arditsoglou, Anastasia; Samara, Constantini

    The mass concentration and the elemental composition of PM 2.5 and PM 10 were measured in 40 rooms (mainly offices or mixed office-lab rooms, and photocopying places) of the Aristotle University of Thessaloniki, northern Greece. A total of 27 major, minor and trace elements were determined by ED-XRF analysis. The PM 2.5/PM 10 concentration ratios averaged 0.8±0.2, while the corresponding elemental ratios ranged between 0.4±0.2 and 0.9±0.2. The concentrations of PM 2.5 and PM 10 were significantly higher (by 70% and 50%, respectively) in the smokers' rooms compared to the non-smokers' places. The total elemental concentrations were also higher in the smokers' rooms (11.5 vs 8.2 μg m -3 for PM 2.5, and 10.3 vs 7.6 μg m -3 for PM 2.5-10). Fine particle concentrations (PM 2.5) were found to be quite proportional to smoking strength. On the contrary, the two environments exhibited similar coarse (PM 2.5-10) particle fractions not related to the number of cigarettes smoked. A slight decrease of particle concentrations with increasing the floor level was also observed, particularly for PM 2.5, suggesting that high-level floors are less impacted by near ground-level sources like traffic emissions. Finally, the removal efficiency of air purification systems was evaluated.

  7. Matrix Metalloproteinase-10 Promotes Kras-Mediated Bronchio-Alveolar Stem Cell Expansion and Lung Cancer Formation

    PubMed Central

    Regala, Roderick P.; Justilien, Verline; Walsh, Michael P.; Weems, Capella; Khoor, Andras; Murray, Nicole R.; Fields, Alan P.

    2011-01-01

    Matrix metalloproteinase 10 (MMP-10; stromelysin 2) is a member of a large family of structurally related matrix metalloproteinases, many of which have been implicated in tumor progression, invasion and metastasis. We recently identified Mmp10 as a gene that is highly induced in tumor-initiating lung bronchioalveolar stem cells (BASCs) upon activation of oncogenic Kras in a mouse model of lung adenocarcinoma. However, the potential role of Mmp10 in lung tumorigenesis has not been addressed. Here, we demonstrate that Mmp10 is overexpressed in lung tumors induced by either the smoke carcinogen urethane or oncogenic Kras. In addition, we report a significant reduction in lung tumor number and size after urethane exposure or genetic activation of oncogenic Kras in Mmp10 null (Mmp10−/−) mice. This inhibitory effect is reflected in a defect in the ability of Mmp10-deficient BASCs to expand and undergo transformation in response to urethane or oncogenic Kras in vivo and in vitro, demonstrating a role for Mmp10 in the tumor-initiating activity of Kras-transformed lung stem cells. To determine the potential relevance of MMP10 in human cancer we analyzed Mmp10 expression in publicly-available gene expression profiles of human cancers. Our analysis reveals that MMP10 is highly overexpressed in human lung tumors. Gene set enhancement analysis (GSEA) demonstrates that elevated MMP10 expression correlates with both cancer stem cell and tumor metastasis genomic signatures in human lung cancer. Finally, Mmp10 is elevated in many human tumor types suggesting a widespread role for Mmp10 in human malignancy. We conclude that Mmp10 plays an important role in lung tumor initiation via maintenance of a highly tumorigenic, cancer-initiating, stem-like cell population, and that Mmp10 expression is associated with stem-like, highly metastatic genotypes in human lung cancers. These results indicate that Mmp10 may represent a novel therapeutic approach to target lung cancer stem cells

  8. Adeno-associated virus Rep78/Rep68 promotes localized melting of the rep binding element in the absence of adenosine triphosphate.

    PubMed

    Lou, Hua Jane; Brister, J Rodney; Li, Jianwei Jeffery; Chen, Weijun; Muzyczka, Nicholas; Tan, Weihong

    2004-03-01

    We have applied fluorescence anisotropy and molecular beacon fluorescence methods to study the interactions between the Adeno-associated virus Rep78/Rep68 protein and the 23-bp Rep binding element (RBE). Rep78/Rep68 stably interacted with both the single- and double-stranded conformations of the RBE, but the interaction mechanisms of single- and double-stranded DNA appeared to be fundamentally different. The stoichiometry of Rep78 association with both the separate top and bottom strands of the RBE was 1:1, and the relative dissociation constant (K(D)) values of these associations were calculated to be 2.3x10(-8) and 3.2x10(-8) M, respectively. In contrast, the stoichiometry of Rep78 association with the double-stranded RBE was 2:1, and the dissociation constant was determined to be 4.2x10(-15) M(2). Moreover, Rep78/Rep68 interaction with the 23-bp duplex RBE appeared to cause localized melting of the double-stranded DNA substrate in the absence of adenosine triphosphate (ATP). This melting activity showed slower kinetics than binding and may contribute to the initiation of ATP-dependent Rep78 helicase activity.

  9. Transcription initiation at the TATA-less spliced leader RNA gene promoter requires at least two DNA-binding proteins and a tripartite architecture that includes an initiator element.

    PubMed

    Luo, H; Gilinger, G; Mukherjee, D; Bellofatto, V

    1999-11-01

    Eukaryotic transcriptional regulatory signals, defined as core and activator promoter elements, have yet to be identified in the earliest diverging group of eukaryotes, the primitive protozoans, which include the Trypanosomatidae family of parasites. The divergence within this family is highlighted by the apparent absence of the "universal" transcription factor TATA-binding protein. To understand gene expression in these protists, we have investigated spliced leader RNA gene transcription. The RNA product of this gene provides an m(7)G cap and a 39-nucleotide leader sequence to all cellular mRNAs via a trans-splicing reaction. Regulation of spliced leader RNA synthesis is controlled by a tripartite promoter located exclusively upstream from the transcription start site. Proteins PBP-1 and PBP-2 bind to two of the three promoter elements in the trypanosomatid Leptomonas seymouri. They represent the first trypanosome transcription factors with typical double-stranded DNA binding site recognition. These proteins ensure efficient transcription. However, accurate initiation is determined an initiator element with a a loose consensus of CYAC/AYR (+1), which differs from that found in metazoan initiator elements as well as from that identified in one of the earliest diverging protozoans, Trichomonas vaginalis. Trypanosomes may utilize initiator element-protein interactions, and not TATA sequence-TATA-binding protein interactions, to direct proper transcription initiation by RNA polymerase II.

  10. A conserved 30 base pair element in the Wnt-5a promoter is sufficient both to drive its' early embryonic expression and to mediate its' repression by otx2.

    PubMed

    Morgan, R; Hooiveld, M H; In der Reiden, P; Durston, A J

    1999-07-01

    We have characterised a short (30 base pair) element from the Xenopus Wnt-5a promoter which is nearly identical to one located in the human Wnt-5a promoter, and has the same position relative to the transcription start site. When placed in front of a LacZ gene, this element can reproduce the same expression pattern observed for Wnt-5a at the late gastrula stage. Further we show that gastrula stage Wnt-5a expression is repressed by otx2, something which is reflected by the mutually exclusive expression patterns of these two genes. The isolated promoter sequence contains an OTX- consensus binding site and its' activity in embryos is repressed by ectopically expressed otx2.

  11. Overexpression of IL-10 in C2D macrophages promotes a macrophage phenotypic switch in adipose tissue environments.

    PubMed

    Xie, Linglin; Fu, Qiang; Ortega, Teresa M; Zhou, Lun; Rasmussen, Dane; O'Keefe, Jacy; Zhang, Ke K; Chapes, Stephen K

    2014-01-01

    Adipose tissue macrophages are a heterogeneous collection of classically activated (M1) and alternatively activated (M2) macrophages. Interleukin 10 (IL-10) is an anti-inflammatory cytokine, secreted by a variety of cell types including M2 macrophages. We generated a macrophage cell line stably overexpressing IL-10 (C2D-IL10) and analyzed the C2D-IL10 cells for several macrophage markers after exposure to adipocytes compared to C2D cells transfected with an empty vector (C2D-vector). C2D-IL10 macrophage cells expressed more CD206 when co-cultured with adipocytes than C2D-vector cells; while the co-cultured cell mixture also expressed higher levels of Il4, Il10, Il1β and Tnf. Since regular C2D cells traffic to adipose tissue after adoptive transfer, we explored the impact of constitutive IL-10 expression on C2D-IL10 macrophages in adipose tissue in vivo. Adipose tissue-isolated C2D-IL10 cells increased the percentage of CD206(+), CD301(+), CD11c(-)CD206(+) (M2) and CD11c(+)CD206(+) (M1b) on their cell surface, compared to isolated C2D-vector cells. These data suggest that the expression of IL-10 remains stable, alters the C2D-IL10 macrophage cell surface phenotype and may play a role in regulating macrophage interactions with the adipose tissue.

  12. Monocyte- and Neutrophil-Derived CXCL10 Impairs Efficient Control of Blood-Stage Malaria Infection and Promotes Severe Disease.

    PubMed

    Ioannidis, Lisa J; Nie, Catherine Q; Ly, Ann; Ryg-Cornejo, Victoria; Chiu, Chris Y; Hansen, Diana S

    2016-02-01

    CXCL10, or IFN-γ-inducible protein 10, is a biomarker associated with increased risk for Plasmodium falciparum-mediated cerebral malaria (CM). Consistent with this, we have previously shown that CXCL10 neutralization or genetic deletion alleviates brain intravascular inflammation and protects Plasmodium berghei ANKA-infected mice from CM. In addition to organ-specific effects, the absence of CXCL10 during infection was also found to reduce parasite biomass. To identify the cellular sources of CXCL10 responsible for these processes, we irradiated and reconstituted wild-type (WT) and CXCL10(-/-) mice with bone marrow from either WT or CXCL10(-/-) mice. Similar to CXCL10(-/-) mice, chimeras unable to express CXCL10 in hematopoietic-derived cells controlled infection more efficiently than WT controls. In contrast, expression of CXCL10 in knockout mice reconstituted with WT bone marrow resulted in high parasite biomass levels, higher brain parasite and leukocyte sequestration rates, and increased susceptibility to CM. Neutrophils and inflammatory monocytes were identified as the main cellular sources of CXCL10 responsible for the induction of these processes. The improved control of parasitemia observed in the absence of CXCL10-mediated trafficking was associated with a preferential accumulation of CXCR3(+)CD4(+) T follicular helper cells in the spleen and enhanced Ab responses to infection. These results are consistent with the notion that some inflammatory responses elicited in response to malaria infection contribute to the development of high parasite densities involved in the induction of severe disease in target organs.

  13. Increased interleukin-10 and interferon-γ levels in Plasmodium vivax malaria suggest a reciprocal regulation which is not altered by IL-10 gene promoter polymorphism

    PubMed Central

    2011-01-01

    Background In human malaria, the naturally-acquired immune response can result in either the elimination of the parasite or a persistent response mediated by cytokines that leads to immunopathology. The cytokines are responsible for all the symptoms, pathological alterations and the outcome of the infection depends on the reciprocal regulation of the pro and anti-inflammatory cytokines. IL-10 and IFN-gamma are able to mediate this process and their production can be affected by single nucleotide polymorphisms (SNPs) on gene of these cytokines. In this study, the relationship between cytokine IL-10/IFN-gamma levels, parasitaemia, and their gene polymorphisms was examined and the participation of pro-inflammatory and regulatory balance during a natural immune response in Plasmodium vivax-infected individuals was observed. Methods The serum levels of the cytokines IL-4, IL-12, IFN-gamma and IL-10 from 132 patients were evaluated by indirect enzyme-linked immunosorbent assays (ELISA). The polymorphism at position +874 of the IFN-gamma gene was identified by allele-specific polymerase chain reaction (ASO-PCR) method, and the polymorphism at position -1082 of the IL-10 gene was analysed by PCR-RFLP (PCR-Restriction Fragment Length Polymorphism). Results The levels of a pro- (IFN-gamma) and an anti-inflammatory cytokine (IL-10) were significantly higher in P. vivax-infected individuals as compared to healthy controls. The IFN-gamma levels in primoinfected patients were significantly higher than in patients who had suffered only one and more than one previous episode. The mutant alleles of both IFN-gamma and IL-10 genes were more frequent than the wild allele. In the case of the IFNG+874 polymorphism (IFN-gamma) the frequencies of the mutant (A) and wild (T) alleles were 70.13% and 29.87%, respectively. Similar frequencies were recorded in IL-10-1082, with the mutant (A) allele returning a frequency of 70.78%, and the wild (G) allele a frequency of 29.22%. The frequencies

  14. A Two-dimensional finite-element model study of backwater and flow distribution at the I-10 crossing of the Pearl River near Slidell, Louisiana

    USGS Publications Warehouse

    Lee, J.K.; Froelich, D.C.; Gilbert, J.J.; Wiche, G.J.

    1982-01-01

    A two-dimensional finite-element surface-water flow modeling system was used to study the effect of Interstate Highway 10 on water-surface elevations and flow distribution during the flood on the Pearl River on April 2, 1980, near Slidell, La. A finite-element network was designed to represent the topography and vegetative cover of the study reach. Hydrographic data collected for the 1980 flood were used to calibrate the flow model. The finite-element network was then modified to represent conditions prior to roadway construction, and the hydraulic impact of I-10 was determined by comparing ' before ' and ' after ' results. Upstream from the roadway, maximum backwater at the west edge of the flood plain (1.5 ft) is greater than maximum backwater at the east edge (1.1 ft). Backwater ranging from 0.6 to 0.2 ft. extends more than a mile downstream from the Pearl River bridge opening in I-10 at the east edge of the flood plain, and drawdown of 0.2 ft. or more occurs along approximately 2 miles of the west edge of the flood plain downstream from I-10. The capability of the modeling system to simulate the significant features of steady-state flow in a complicated multi-channel river-flood-plain system with variable topography and vegetative was successfully demonstrated in this study. (USGS)

  15. Activation of the rat follicle-stimulating hormone receptor promoter by steroidogenic factor 1 is blocked by protein kinase a and requires upstream stimulatory factor binding to a proximal E box element.

    PubMed

    Heckert, L L

    2001-05-01

    The receptor for the pituitary glycoprotein hormone FSH (FSHR) and the nuclear hormone receptor steroidogenic factor 1 (SF-1) play important roles in control of the hypothalamic-pituitary- gonadal axis. FSHR is essential for integrating the pituitary FSH signal to gonadal response, while SF-1 is an important transcriptional regulator of many genes that function within this axis and is essential for the development of gonads and adrenal glands. Given the critical role of SF-1 in regulation of the gonads and the coexpression of FSHR and SF-1 in Sertoli and granulosa cells, we examined the ability of SF-1 to regulate transcription of the FSHR gene. We found that SF-1 stimulated rat FSHR promoter activity in a dose-dependent and promoter-specific manner. Examination of various promoter deletion mutants indicated that SF-1 acts through the proximal promoter region and upstream promoter sequences. An E box element within the proximal promoter is essential for activation of the FSHR promoter by SF-1. This element binds the transcriptional regulators USF1 and USF2 (upstream stimulatory factors 1 and 2) but not SF-1, as shown by electrophoretic mobility shift assays. In addition, functional studies identified a requirement for the USF proteins in SF-1 activation of FSHR and mapped an important regulatory domain within exons 4 and 5 of USF2. Cotransfection studies revealed that activation of protein kinase A leads to inhibition of SF-1-stimulated transcription of FSHR, while it synergized with SF-1 to activate the equine LH beta-promoter (ebeta). Thus, stimulation of the cAMP pathway differentially regulates SF-1 activation of the FSHR and ebeta-promoters.

  16. Evaluation of elemental status of ancient human bone samples from Northeastern Hungary dated to the 10th century AD by XRF

    NASA Astrophysics Data System (ADS)

    János, I.; Szathmáry, L.; Nádas, E.; Béni, A.; Dinya, Z.; Máthé, E.

    2011-11-01

    The present study is a multielemental analysis of bone samples belonging to skeletal individuals originating from two contemporaneous (10th century AD) cemeteries (Tiszavasvári Nagy-Gyepáros and Nagycserkesz-Nádasibokor sites) in Northeastern Hungary, using the XRF analytical technique. Emitted X-rays were detected in order to determine the elemental composition of bones and to appreciate the possible influence of the burial environment on the elemental content of the human skeletal remains. Lumbar vertebral bodies were used for analysis. Applying the ED(P)XRF technique concentration of the following elements were determined: P, Ca, K, Na, Mg, Al, Cl, Mn, Fe, Zn, Br and Sr. The results indicated post mortem mineral exchange between the burial environment (soil) and bones (e.g. the enhanced levels of Fe and Mn) and referred to diagenetic alteration processes during burials. However, other elements such as Zn, Sr and Br seemed to be accumulated during the past life. On the basis of statistical analysis, clear separation could not be observed between the two excavation sites in their bone elemental concentrations which denoted similar diagenetic influences, environmental conditions. The enhanced levels of Sr might be connected with the past dietary habits, especially consumption of plant food.

  17. Energy spectra of elements with 18 or = Z or = 28 between 10 and 300 GeV/amu

    NASA Technical Reports Server (NTRS)

    Jones, M. D.; Klarmann, J.; Stone, E. C.; Waddington, C. J.; Binns, W. R.; Garrard, T. L.; Israel, M. H.

    1985-01-01

    The HEAO-3 Heavy Nuclei Experiment is composed of ionization chambers above and below a plastic Cerenkov counter. The energy dependence of the abundances of elements with atomic number, Z, between 18 and 28 at very high energies where they are rare and thus need the large area x time are measured. The measurements of the Danish-French HEAO-3 experiment (Englemann,, et al., 1983) are extended to higher energies, using the relativistic rise of ionization signal as a measure of energy. Source abundances for Ar and Ca were determined.

  18. FELIX-1.0: A finite element solver for the time dependent generator coordinate method with the Gaussian overlap approximation

    SciTech Connect

    Regnier, D.; Verriere, M.; Dubray, N.; Schunck, N.

    2015-11-30

    In this study, we describe the software package FELIX that solves the equations of the time-dependent generator coordinate method (TDGCM) in NN-dimensions (N ≥ 1) under the Gaussian overlap approximation. The numerical resolution is based on the Galerkin finite element discretization of the collective space and the Crank–Nicolson scheme for time integration. The TDGCM solver is implemented entirely in C++. Several additional tools written in C++, Python or bash scripting language are also included for convenience. In this paper, the solver is tested with a series of benchmarks calculations. We also demonstrate the ability of our code to handle a realistic calculation of fission dynamics.

  19. FELIX-1.0: A finite element solver for the time dependent generator coordinate method with the Gaussian overlap approximation

    NASA Astrophysics Data System (ADS)

    Regnier, D.; Verrière, M.; Dubray, N.; Schunck, N.

    2016-03-01

    We describe the software package FELIX that solves the equations of the time-dependent generator coordinate method (TDGCM) in N-dimensions (N ≥ 1) under the Gaussian overlap approximation. The numerical resolution is based on the Galerkin finite element discretization of the collective space and the Crank-Nicolson scheme for time integration. The TDGCM solver is implemented entirely in C++. Several additional tools written in C++, Python or bash scripting language are also included for convenience. In this paper, the solver is tested with a series of benchmarks calculations. We also demonstrate the ability of our code to handle a realistic calculation of fission dynamics.

  20. A set of fluorescent protein-based markers expressed from constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal elements in Medicago truncatula.

    PubMed

    Ivanov, Sergey; Harrison, Maria J

    2014-12-01

    Medicago truncatula is widely used for analyses of arbuscular mycorrhizal (AM) symbiosis and nodulation. To complement the genetic and genomic resources that exist for this species, we generated fluorescent protein fusions that label the nucleus, endoplasmic reticulum, Golgi apparatus, trans-Golgi network, plasma membrane, apoplast, late endosome/multivesicular bodies (MVB), transitory late endosome/ tonoplast, tonoplast, plastids, mitochondria, peroxisomes, autophagosomes, plasmodesmata, actin, microtubules, periarbuscular membrane (PAM) and periarbuscular apoplastic space (PAS) and expressed them from the constitutive AtUBQ10 promoter and the AM symbiosis-specific MtBCP1 promoter. All marker constructs showed the expected expression patterns and sub-cellular locations in M. truncatula root cells. As a demonstration of their utility, we used several markers to investigate AM symbiosis where root cells undergo major cellular alterations to accommodate their fungal endosymbiont. We demonstrate that changes in the position and size of the nuclei occur prior to hyphal entry into the cortical cells and do not require DELLA signaling. Changes in the cytoskeleton, tonoplast and plastids also occur in the colonized cells and in contrast to previous studies, we show that stromulated plastids are abundant in cells with developing and mature arbuscules, while lens-shaped plastids occur in cells with degenerating arbuscules. Arbuscule development and secretion of the PAM creates a periarbuscular apoplastic compartment which has been assumed to be continuous with apoplast of the cell. However, fluorescent markers secreted to the periarbuscular apoplast challenge this assumption. This marker resource will facilitate cell biology studies of AM symbiosis, as well as other aspects of legume biology.

  1. Uranyl mediated photofootprinting reveals strong E. coli RNA polymerase--DNA backbone contacts in the +10 region of the DeoP1 promoter open complex.

    PubMed Central

    Jeppesen, C; Nielsen, P E

    1989-01-01

    Employing a newly developed uranyl photofootprinting technique (Nielsen et al. (1988) FEBS Lett. 235, 122), we have analyzed the structure of the E. coli RNA polymerase deoP1 promoter open complex. The results show strong polymerase DNA backbone contacts in the -40, -10, and most notably in the +10 region. These results suggest that unwinding of the -12 to +3 region of the promoter in the open complex is mediated through polymerase DNA backbone contacts on both sides of this region. The pattern of bases that are hyperreactive towards KMnO4 or uranyl within the -12 to +3 region furthermore argues against a model in which this region is simply unwound and/or single stranded. The results indicate specific protein contacts and/or a fixed DNA conformation within the -12 to +3 region. Images PMID:2503811

  2. Runx1 and Runx3 Are Downstream Effectors of Nanog in Promoting Osteogenic Differentiation of the Mouse Mesenchymal Cell Line C3H10T1/2.

    PubMed

    Saito, Tadahito; Ohba, Shinsuke; Yano, Fumiko; Seto, Ichiro; Yonehara, Yoshiyuki; Takato, Tsuyoshi; Ogasawara, Toru

    2015-06-01

    Previously, we reported that the transcription factor Nanog, which maintains the self-renewal of embryonic stem cells (ESCs), promotes the osteogenic differentiation of the mouse mesenchymal cell line C3H10T1/2 through a genome reprogramming process. In the present study, to clarify the mechanism underlying the multipotency of mesenchymal stem cells (MSCs) and to develop a novel approach to bone regenerative medicine, we attempted to identify the downstream effectors of Nanog in promoting osteogenic differentiation of mouse mesenchymal cells. We demonstrated that Runx1 and Runx3 are the downstream effectors of Nanog, especially in the early and intermediate osteogenic differentiation of the mouse mesenchymal cell line C3H10T1/2. PMID:26053522

  3. Monocyte- and Neutrophil-Derived CXCL10 Impairs Efficient Control of Blood-Stage Malaria Infection and Promotes Severe Disease.

    PubMed

    Ioannidis, Lisa J; Nie, Catherine Q; Ly, Ann; Ryg-Cornejo, Victoria; Chiu, Chris Y; Hansen, Diana S

    2016-02-01

    CXCL10, or IFN-γ-inducible protein 10, is a biomarker associated with increased risk for Plasmodium falciparum-mediated cerebral malaria (CM). Consistent with this, we have previously shown that CXCL10 neutralization or genetic deletion alleviates brain intravascular inflammation and protects Plasmodium berghei ANKA-infected mice from CM. In addition to organ-specific effects, the absence of CXCL10 during infection was also found to reduce parasite biomass. To identify the cellular sources of CXCL10 responsible for these processes, we irradiated and reconstituted wild-type (WT) and CXCL10(-/-) mice with bone marrow from either WT or CXCL10(-/-) mice. Similar to CXCL10(-/-) mice, chimeras unable to express CXCL10 in hematopoietic-derived cells controlled infection more efficiently than WT controls. In contrast, expression of CXCL10 in knockout mice reconstituted with WT bone marrow resulted in high parasite biomass levels, higher brain parasite and leukocyte sequestration rates, and increased susceptibility to CM. Neutrophils and inflammatory monocytes were identified as the main cellular sources of CXCL10 responsible for the induction of these processes. The improved control of parasitemia observed in the absence of CXCL10-mediated trafficking was associated with a preferential accumulation of CXCR3(+)CD4(+) T follicular helper cells in the spleen and enhanced Ab responses to infection. These results are consistent with the notion that some inflammatory responses elicited in response to malaria infection contribute to the development of high parasite densities involved in the induction of severe disease in target organs. PMID:26718341

  4. Source Apportionment and Elemental Composition of PM2.5 and PM10 in Jeddah City, Saudi Arabia

    PubMed Central

    Khodeir, Mamdouh; Shamy, Magdy; Alghamdi, Mansour; Zhong, Mianhua; Sun, Hong; Costa, Max; Chen, Lung-Chi; Maciejczyk, Polina

    2014-01-01

    This paper presents the first comprehensive investigation of PM2.5 and PM10 composition and sources in Saudi Arabia. We conducted a multi-week multiple sites sampling campaign in Jeddah between June and September, 2011, and analyzed samples by XRF. The overall mean mass concentration was 28.4 ± 25.4 μg/m3 for PM2.5 and 87.3 ± 47.3 μg/m3 for PM10, with significant temporal and spatial variability. The average ratio of PM2.5/PM10 was 0.33. Chemical composition data were modeled using factor analysis with varimax orthogonal rotation to determine five and four particle source categories contributing significant amount of for PM2.5 and PM10 mass, respectively. In both PM2.5 and PM10 sources were (1) heavy oil combustion characterized by high Ni and V; (2) resuspended soil characterized by high concentrations of Ca, Fe, Al, and Si; and (3) marine aerosol. The two other sources in PM2.5 were (4) Cu/Zn source; (5) traffic source identified by presence of Pb, Br, and Se; while in PM10 it was a mixed industrial source. To estimate the mass contributions of each individual source category, the CAPs mass concentration was regressed against the factor scores. Cumulatively, resuspended soil and oil combustion contributed 77 and 82% mass of PM2.5 and PM10, respectively. PMID:24634602

  5. Ultra-small lipid nanoparticles promote the penetration of coenzyme Q10 in skin cells and counteract oxidative stress.

    PubMed

    Lohan, Silke B; Bauersachs, Sonja; Ahlberg, Sebastian; Baisaeng, Nuttakorn; Keck, Cornelia M; Müller, Rainer H; Witte, Ellen; Wolk, Kerstin; Hackbarth, Steffen; Röder, Beate; Lademann, Jürgen; Meinke, Martina C

    2015-01-01

    UV irradiation leads to the formation of reactive oxygen species (ROS). An imbalance between the antioxidant system and ROS can lead to cell damage, premature skin aging or skin cancer. To counteract these processes, antioxidants such as coenzyme Q10 (CoQ10) are contained in many cosmetics. To improve and optimize cell/tissue penetration properties of the lipophilic CoQ10, ultra-small lipid nanoparticles (usNLC) were developed. The antioxidant effectiveness of CoQ10-loaded usNLC compared to conventional nanocarriers was investigated in the human keratinocyte cell line HaCaT. Using confocal laser scanning microscopy investigations of the carriers additionally loaded with nile red showed a clear uptake into cells and their distribution within the cytoplasm. By use of the XTT cell viability test, CoQ10 concentrations of 10-50 μg/ml were shown to be non-toxic, and the antioxidant potential of 10 μg/ml CoQ10 loaded usNLC in the HaCaT cells was analyzed via electron paramagnetic resonance spectroscopy after cellular exposure to UVA (1J/cm(2)) and UVB (18 mJ/cm(2)) irradiation. In comparison with the CoQ10-loaded conventional carriers, usNLC-CoQ10 demonstrated the strongest reduction of the radical formation; reaching up to 23% compared to control cells without nanocarrier treatment. Therefore, usNLC-CoQ10 are very suitable to increase the antioxidant potential of skin.

  6. GTP hydrolysis of TC10 promotes neurite outgrowth through exocytic fusion of Rab11- and L1-containing vesicles by releasing exocyst component Exo70.

    PubMed

    Fujita, Akane; Koinuma, Shingo; Yasuda, Sayaka; Nagai, Hiroyuki; Kamiguchi, Hiroyuki; Wada, Naoyuki; Nakamura, Takeshi

    2013-01-01

    The use of exocytosis for membrane expansion at nerve growth cones is critical for neurite outgrowth. TC10 is a Rho family GTPase that is essential for specific types of vesicular trafficking to the plasma membrane. Recent studies have shown that TC10 and its effector Exo70, a component of the exocyst tethering complex, contribute to neurite outgrowth. However, the molecular mechanisms of the neuritogenesis-promoting functions of TC10 remain to be established. Here, we propose that GTP hydrolysis of vesicular TC10 near the plasma membrane promotes neurite outgrowth by accelerating vesicle fusion by releasing Exo70. Using Förster resonance energy transfer (FRET)-based biosensors, we show that TC10 activity at the plasma membrane decreased at extending growth cones in hippocampal neurons and nerve growth factor (NGF)-treated PC12 cells. In neuronal cells, TC10 activity at vesicles was higher than its activity at the plasma membrane, and TC10-positive vesicles were found to fuse to the plasma membrane in NGF-treated PC12 cells. Therefore, activity of TC10 at vesicles is presumed to be inactivated near the plasma membrane during neuronal exocytosis. Our model is supported by functional evidence that constitutively active TC10 could not rescue decrease in NGF-induced neurite outgrowth induced by TC10 depletion. Furthermore, TC10 knockdown experiments and colocalization analyses confirmed the involvement of Exo70 in TC10-mediated trafficking in neuronal cells. TC10 frequently resided on vesicles containing Rab11, which is a key regulator of recycling pathways and implicated in neurite outgrowth. In growth cones, most of the vesicles containing the cell adhesion molecule L1 had TC10. Exocytosis of Rab11- and L1-positive vesicles may play a central role in TC10-mediated neurite outgrowth. The combination of this study and our previous work on the role of TC10 in EGF-induced exocytosis in HeLa cells suggests that the signaling machinery containing TC10 proposed here may be

  7. High-fat diet intake accelerates aging, increases expression of Hsd11b1, and promotes lipid accumulation in liver of SAMP10 mouse.

    PubMed

    Honma, Taro; Shinohara, Nahoko; Ito, Junya; Kijima, Ryo; Sugawara, Soko; Arai, Tatsuya; Tsuduki, Tsuyoshi; Ikeda, Ikuo

    2012-04-01

    An understanding of the mechanisms of aging is important for prevention of age-related diseases. In this study, we examined age-dependent changes in lipid metabolism in the senescence-accelerated mouse (SAM)P10 fed a high-fat diet to investigate the effects of high-fat intake and aging. Tissue weights and biological parameters in plasma and liver were measured at 6 and 12 months old in SAMP10 mice fed a high-fat diet. These mice showed marked increases in liver triacylglycerol and plasma insulin levels with intake of a high-fat diet intake and aging. Lipid accumulation in hepatocytes and morphological aberrations and hypertrophy in pancreatic islets were also promoted by a high-fat diet and aging. To investigate the underlying mechanisms, the activities and mRNA levels for enzymes associated with lipid metabolism in liver were measured. The results indicated that the lipid metabolic system was activated by a high-fat diet and aging. Liver mRNA level for hydroxysteroid 11-beta dehydrogenase 1 (Hsd11b1), which exhibit age-dependent increases and promote insulin secretion, was also markedly increased. These results suggest that a high-fat diet accelerated aging in the liver of SAMP10 mice by increasing liver mRNA level for Hsd11b1, increasing insulin secretion, and promoting lipid accumulation in the liver.

  8. Colonization of Morus alba L. by the plant-growth-promoting and antagonistic bacterium Burkholderia cepacia strain Lu10-1

    PubMed Central

    2010-01-01

    Background Anthracnose, caused by Colletotrichum dematium, is a serious threat to the production and quality of mulberry leaves in susceptible varieties. Control of the disease has been a major problem in mulberry cultivation. Some strains of Burkholderia cepacia were reported to be useful antagonists of plant pests and could increase the yields of several crop plants. Although B. cepacia Lu10-1 is an endophytic bacterium obtained from mulberry leaves, it has not been deployed to control C. dematium infection in mulberry nor its colonization patterns in mulberry have been studied using GFP reporter or other reporters. The present study sought to evaluate the antifungal and plant-growth-promoting properties of strain Lu10-1, to clarify its specific localization within a mulberry plant, and to better understand its potential as a biocontrol and growth-promoting agent. Results Lu10-1 inhibited conidial germination and mycelial growth of C. dematium in vitro; when applied on leaves or to the soil, Lu10-1 also inhibited the development of anthracnose in a greenhouse, but the effectiveness varied with the length of the interval between the strain treatment and inoculation with the pathogen. Strain Lu10-1 could survive in both sterile and non-sterile soils for more than 60 days. The strain produced auxins, contributed to P solubilization and nitrogenase activity, and significantly promoted the growth of mulberry seedlings. The bacteria infected mulberry seedlings through cracks formed at junctions of lateral roots with the main root and in the zone of differentiation and elongation, and the cells were able to multiply and spread, mainly to the intercellular spaces of different tissues. The growth in all the tissues was around 1-5 × 105 CFU per gram of fresh plant tissue. Conclusions Burkholderia cepacia strain Lu10-1 is an endophyte that can multiply and spread in mulberry seedlings rapidly and efficiently. The strain is antagonistic to C. dematium and acts as an

  9. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    PubMed

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses.

  10. Human Bladder Uroepithelial Cells Synergize with Monocytes to Promote IL-10 Synthesis and Other Cytokine Responses to Uropathogenic Escherichia coli

    PubMed Central

    Duell, Benjamin L.; Carey, Alison J.; Dando, Samantha J.; Schembri, Mark A.; Ulett, Glen C.

    2013-01-01

    Urinary tract infections are a major source of morbidity for women and the elderly, with Uropathogenic Escherichia coli (UPEC) being the most prevalent causative pathogen. Studies in recent years have defined a key anti-inflammatory role for Interleukin-10 (IL-10) in urinary tract infection mediated by UPEC and other uropathogens. We investigated the nature of the IL-10-producing interactions between UPEC and host cells by utilising a novel co-culture model that incorporated lymphocytes, mononuclear and uroepithelial cells in histotypic proportions. This co-culture model demonstrated synergistic IL-10 production effects between monocytes and uroepithelial cells following infection with UPEC. Membrane inserts were used to separate the monocyte and uroepithelial cell types during infection and revealed two synergistic IL-10 production effects based on contact-dependent and soluble interactions. Analysis of a comprehensive set of immunologically relevant biomarkers in monocyte-uroepithelial cell co-cultures highlighted that multiple cytokine, chemokine and signalling factors were also produced in a synergistic or antagonistic fashion. These results demonstrate that IL-10 responses to UPEC occur via multiple interactions between several cells types, implying a complex role for infection-related IL-10 during UTI. Development and application of the co-culture model described in this study is thus useful to define the degree of contact dependency of biomarker production to UPEC, and highlights the relevance of histotypic co-cultures in studying complex host-pathogen interactions. PMID:24155979

  11. Human bladder uroepithelial cells synergize with monocytes to promote IL-10 synthesis and other cytokine responses to uropathogenic Escherichia coli.

    PubMed

    Duell, Benjamin L; Carey, Alison J; Dando, Samantha J; Schembri, Mark A; Ulett, Glen C

    2013-01-01

    Urinary tract infections are a major source of morbidity for women and the elderly, with Uropathogenic Escherichia coli (UPEC) being the most prevalent causative pathogen. Studies in recent years have defined a key anti-inflammatory role for Interleukin-10 (IL-10) in urinary tract infection mediated by UPEC and other uropathogens. We investigated the nature of the IL-10-producing interactions between UPEC and host cells by utilising a novel co-culture model that incorporated lymphocytes, mononuclear and uroepithelial cells in histotypic proportions. This co-culture model demonstrated synergistic IL-10 production effects between monocytes and uroepithelial cells following infection with UPEC. Membrane inserts were used to separate the monocyte and uroepithelial cell types during infection and revealed two synergistic IL-10 production effects based on contact-dependent and soluble interactions. Analysis of a comprehensive set of immunologically relevant biomarkers in monocyte-uroepithelial cell co-cultures highlighted that multiple cytokine, chemokine and signalling factors were also produced in a synergistic or antagonistic fashion. These results demonstrate that IL-10 responses to UPEC occur via multiple interactions between several cells types, implying a complex role for infection-related IL-10 during UTI. Development and application of the co-culture model described in this study is thus useful to define the degree of contact dependency of biomarker production to UPEC, and highlights the relevance of histotypic co-cultures in studying complex host-pathogen interactions.

  12. Loss of p27 phosphorylation at Ser10 accelerates early atherogenesis by promoting leukocyte recruitment via RhoA/ROCK.

    PubMed

    Molina-Sánchez, P; Chèvre, R; Rius, C; Fuster, J J; Andrés, V

    2015-07-01

    Reduced phosphorylation of the tumor suppressor p27(Kip1) (p27) at serine 10 (Ser10) is a hallmark of advanced human and mouse atherosclerosis. Apolipoprotein E-null mice defective for this posttranslational modification (apoE(-/-)p27Ser10Ala) exhibited increased atherosclerosis burden at late disease states. Here, we investigated the regulation of p27 phosphorylation in Ser10 at the very initial stages of atherosclerosis and its impact on endothelial-leukocyte interaction and early plaque formation. Hypercholesterolemia in fat-fed apoE(-/-) mice is associated with a rapid downregulation of p27-phospho-Ser10 in primary endothelial cells (ECs) and in aorta prior to the development of macroscopically-visible lesions. We find that lack of p27 phosphorylation at Ser10 enhances the expression of adhesion molecules in aorta of apoE(-/-) mice and ECs, and augments endothelial-leukocyte interactions and leukocyte recruitment in vivo. These effects correlated with increased RhoA/Rho-associated coiled-coil containing protein kinase (ROCK) signaling in ECs, and inhibition of this pathway with fasudil reduced leukocyte-EC interactions to control levels in the microvasculature of p27Ser10Ala mice. Moreover, apoE(-/-)p27Ser10Ala mice displayed increased leukocyte recruitment and homing to atherosusceptible arteries and augmented early plaque development, which could be blunted with fasudil. In conclusion, our studies demonstrate a very rapid reduction in p27-phospho-Ser10 levels at the onset of atherogenesis, which contributes to early plaque build-up through RhoA/ROCK-induced integrin expression in ECs and enhanced leukocyte recruitment.

  13. EBV-miR-BART10-3p facilitates epithelial-mesenchymal transition and promotes metastasis of nasopharyngeal carcinoma by targeting BTRC

    PubMed Central

    Yan, Qijia; Zeng, Zhaoyang; Gong, Zhaojian; Zhang, Wenling; Li, Xiayu; He, Baoyu; Song, Yali; Li, Qiao; Zeng, Yong; Liao, Qianjin; Chen, Pan; Shi, Lei; Fan, Songqing; Xiang, Bo; Ma, Jian; Zhou, Ming; Li, Xiaoling; Yang, Jianbo; Xiong, Wei; Li, Guiyuan

    2015-01-01

    Epstein-Barr virus (EBV) infection is closely associated with tumorigenesis and development of nasopharyngeal carcinoma (NPC), but the underlying molecular mechanisms remain poorly understood. It has been recently reported that EBV encodes 44 mature miRNAs, some of which were found to promote tumor development by targeting virus-infected host genes or self-viral genes. However, few targets of EBV encoded-miRNAs that are related to NPC development have been identified to date. In this study, we revealed that in NPC cells, EBV-miR-BART10-3p directly targets BTRC gene that encodes βTrCP (beta-transducin repeat containing E3 ubiquitin protein ligase). We found that EBV-miR-BART10-3p expression in clinical samples from a cohort of 106 NPC patients negatively correlated with BTRC expression levels. Over-expression of EBV-miR-BART10-3p and down-regulation of BTRC were associated with poor prognosis in NPC patients. EBV-miR-BART10-3p promoted the invasion and migration cabilities of NPC cells through the targeting of BTRC and regulation of the expression of the downstream substrates β-catenin and Snail. As a result, EBV-miR-BART10-3p facilitated epithelial-mesenchymal transition of NPC. Our study presents an unreported mechanism underlying EBV infection in NPC carcinogenesis, and provides a potential novel biomarker for NPC diagnosis, treatment and prognosis. PMID:26497204

  14. Effect of the third element on the structure of liquid Mg65Cu25Y10 alloy

    NASA Astrophysics Data System (ADS)

    Liu, Dan; Zhu, Xun Ming; Qin, Jing Yu; Duan, Jun Peng; Wang, Ai Min; Gu, Ting Kun

    2016-08-01

    The liquid structures of Mg65Cu25Y10 and its three homologous binary liquid alloys are investigated via ab initio molecular dynamics in the present work. The chemical and topological environments in all four liquid alloys are analyzed using pair distribution function, coordination number, and the Voronoi polyhedron. It shows that the Cu atoms play significant role in deciding the chemical and topological short-range orders of the Mg65Cu25Y10 liquid alloy. The Voronoi polyhedra in the ternary liquid alloy illustrate less varieties and longer lifetime. Moreover, the diffusion coefficients are decreased significantly in the ternary liquid alloys according to the mean square displacements. All above offer a deeper insight into how the three species work in the Mg65Cu25Y10 liquid alloy.

  15. Radiofrequency ablation-increased CXCL10 is associated with earlier recurrence of hepatocellular carcinoma by promoting stemness.

    PubMed

    Ouyang, Yabo; Liu, Kai; Hao, Meijun; Zheng, Rongling; Zhang, Chunmiao; Wu, Yanning; Zhang, Xiaofeng; Li, Ning; Zheng, Jiasheng; Chen, Dexi

    2016-03-01

    Radiofrequency ablation (RFA) represents a valuable choice in hepatocellular carcinoma (HCC); however, local recurrence of HCC is common after RFA. Here, 20 primary HCC patients treated by RFA were enrolled. Before (termed 0d) and after RFA treatment for 1 and 7 days (termed 1d and 7d, respectively), plasma and noncancerous tissue were collected. ELISA assay showed that plasma C-X-C motif chemokine 10 (CXCL10) was increased in ten patients (type I patients) but decreased in the other 10 patients (type II patients). The mean interval for HCC recurrence in type I patients was less than the mean interval in type II patients. Interestingly, a significant negative correlation between interval for HCC recurrence and fold change of plasma CXCL10 (1d/0d or 7d/0d) was identified, suggesting that RFA-induced CXCL10 is associated with earlier HCC recurrence. Immunofluorescence assay showed that the receptor of CXCL10, chemokine (C-X-C motif) receptor 3 (CXCR3), was significantly increased in type I, but not type II, patients after RFA. In vitro assay demonstrated that CXCL10 stimulus increased the rate of CD133(+) cancer stem cells (CSCs) in HepG2 cells by binding to CXCR3 and then inducing c-Myc expression. Many studies have reported that induction of CD133(+) CSCs contributes to HCC recurrence. Thus, CXCL10-increased CD133(+) CSCs by activating CXCR3/c-Myc pathway might accelerate HCC recurrence after RFA. These data might have potential implications for HCC therapy.

  16. NAD+ regulates Treg cell fate and promotes allograft survival via a systemic IL-10 production that is CD4+ CD25+ Foxp3+ T cells independent

    PubMed Central

    Elkhal, Abdallah; Rodriguez Cetina Biefer, Hector; Heinbokel, Timm; Uehara, Hirofumi; Quante, Markus; Seyda, Midas; Schuitenmaker, Jeroen M.; Krenzien, Felix; Camacho, Virginia; de la Fuente, Miguel A.; Ghiran, Ionita; Tullius, Stefan G.

    2016-01-01

    CD4+ CD25+ Foxp3+ Tregs have been shown to play a central role in immune homeostasis while preventing from fatal inflammatory responses, while Th17 cells have traditionally been recognized as pro-inflammatory mediators implicated in a myriad of diseases. Studies have shown the potential of Tregs to convert into Th17 cells, and Th17 cells into Tregs. Increasing evidence have pointed out CD25 as a key molecule during this transdifferentiation process, however molecules that allow such development remain unknown. Here, we investigated the impact of NAD+ on the fate of CD4+ CD25+ Foxp3+ Tregs in-depth, dissected their transcriptional signature profile and explored mechanisms underlying their conversion into IL-17A producing cells. Our results demonstrate that NAD+ promotes Treg conversion into Th17 cells in vitro and in vivo via CD25 cell surface marker. Despite the reduced number of Tregs, known to promote homeostasis, and an increased number of pro-inflammatory Th17 cells, NAD+ was able to promote an impressive allograft survival through a robust systemic IL-10 production that was CD4+ CD25+ Foxp3+ independent. Collectively, our study unravels a novel immunoregulatory mechanism of NAD+ that regulates Tregs fate while promoting allograft survival that may have clinical applications in alloimmunity and in a wide spectrum of inflammatory conditions. PMID:26928119

  17. Lymphoid-Tissue-Resident Commensal Bacteria Promote Members of the IL-10 Cytokine Family to Establish Mutualism.

    PubMed

    Fung, Thomas C; Bessman, Nicholas J; Hepworth, Matthew R; Kumar, Nitin; Shibata, Naoko; Kobuley, Dmytro; Wang, Kelvin; Ziegler, Carly G K; Goc, Jeremy; Shima, Tatsuichiro; Umesaki, Yoshinori; Sartor, R Balfour; Sullivan, Kaede V; Lawley, Trevor D; Kunisawa, Jun; Kiyono, Hiroshi; Sonnenberg, Gregory F

    2016-03-15

    Physical separation between the mammalian immune system and commensal bacteria is necessary to limit chronic inflammation. However, selective species of commensal bacteria can reside within intestinal lymphoid tissues of healthy mammals. Here, we demonstrate that lymphoid-tissue-resident commensal bacteria (LRC) colonized murine dendritic cells and modulated their cytokine production. In germ-free and antibiotic-treated mice, LRCs colonized intestinal lymphoid tissues and induced multiple members of the IL-10 cytokine family, including dendritic-cell-derived IL-10 and group 3 innate lymphoid cell (ILC3)-derived IL-22. Notably, IL-10 limited the development of pro-inflammatory Th17 cell responses, and IL-22 production enhanced LRC colonization in the steady state. Furthermore, LRC colonization protected mice from lethal intestinal damage in an IL-10-IL-10R-dependent manner. Collectively, our data reveal a unique host-commensal-bacteria dialog whereby selective subsets of commensal bacteria interact with dendritic cells to facilitate tissue-specific responses that are mutually beneficial for both the host and the microbe. PMID:26982365

  18. SEM in situ MiniCantilever Beam Bending of U-10Mo/Zr/Al Fuel Elements

    SciTech Connect

    Mook, William; Baldwin, Jon K.; Martinez, Ricardo M.; Mara, Nathan A.

    2014-06-16

    In this work, the fracture behavior of Al/Zr and Zr/dU-10Mo interfaces was measured via the minicantilever bend technique. The energy dissipation rates were found to be approximately 3.7-5 mj/mm2 and 5.9 mj/mm2 for each interface, respectively. It was found that in order to test the Zr/U-10Mo interface, location of the hinge of the cantilever was a key parameter. While this test could be adapted to hot cell use through careful alignment fixturing and measurement of crack lengths with an optical microscope (as opposed to SEM, which was used here out of convenience), machining of the cantilevers via MiniMill in such a way as to locate the interfaces at the cantilever hinge, as well as proper placement of a femtosecond laser notch will continue to be key challenges in a hot cell environment.

  19. CXCL10/CXCR3 axis promotes the invasion of gastric cancer via PI3K/AKT pathway-dependent MMPs production.

    PubMed

    Zhou, Hongfeng; Wu, Jin; Wang, Tianjiao; Zhang, Xufeng; Liu, Dan

    2016-08-01

    CXCR3, a G-protein coupled chemokine receptor, has been found to be overexpressed in many tumors and act as an independent prognostic marker. However, it is still unclear whether CXCR3 is involved in gastric cancer progression. In this study, we found that CXCR3 was markedly expressed in gastric cancer cells and tissues. High CXCR3 expression correlated with advanced tumor stage, vascular invasion, lymph node metastasis and poor survival of gastric cancer patients. Activation of CXCR3 by one of its ligands CXCL10 promoted the invasion and migration of gastric cancer BGC-823 and MGC-803 cells, and increased the secretion and activities of MMP-2 and MMP-9. However, the effects of CXCL10 on gastric cancer cells were attenuated by CXCR3 siRNA transfection. Furthermore, overexpression of CXCR3 enhanced CXCL10-mediated cell invasion and migration of gastric cancer MKN28 cells. In addition, CXCR3 time-dependently induced activation of AKT. PI3K/AKT pathway was required for CXCR3-mediated gastric cancer cell invasion, migration and MMP-2/9 production. Together, our findings suggest that CXCL10/CXCR3 axis promotes gastric cancer cell invasion and migration by upregulating MMP-2 and MMP-9 production via PI3K/AKT pathway. Thus, CXCR3 could be a potential target for the gastric cancer treatment.

  20. Enacting Dialogue: The Impact of Promoting Philosophy for Children on the Literate Thinking of Identified Poor Readers, Aged 10

    ERIC Educational Resources Information Center

    Jenkins, Philip; Lyle, Sue

    2010-01-01

    The Philosophy for Children in Schools Project (P4CISP) is a research project to monitor and evaluate the impact of Philosophy for Children (P4C) on classroom practices. In this paper the impact of P4C on the thinking skills of four children aged 10 is examined. Standardised tests indicated the children had below-average reading ages. The pupils…

  1. Interleukin-10 deficiency impairs regulatory T cell-derived neuropilin-1 functions and promotes Th1 and Th17 immunity

    PubMed Central

    Wang, Shimin; Gao, Xiang; Shen, Guobo; Wang, Wei; Li, Jingyu; Zhao, Jingyi; Wei, Yu-Quan; Edwards, Carl K.

    2016-01-01

    Regulatory T cells (Tregs) expand in peripheral lymphoid organs and can produce immunosuppressive cytokines to support tumor growth. IL-10 abrogation efficiently induces Treg formation but dampens tumoral neuropilin-1 (Nrp-1) Treg signaling, which simultaneously augments Th1 and Th17 immunity. These effects are associated with the plasticity and stability of Tregs and effector T cell functions that can limit tumorigenesis. Within the tumor microenvironment, there appears to be a “mutual antagonism” between immunoenhancement and immunosuppression mechanisms, eventually leading to decreased metastasis. In contrast, tumor progression is paralleled by a reduction in Nrp-1-producing Tregs controlled by the IL-10 and TGF-β1 levels. However, Th1, Th17 and Treg immunity is primarily regulated by IL-10 or Nrp-1 and not TGF-β1 except when combined with IL-10. These results emphasize the important implications for the therapeutic use of Tregs. The number of Treg cells must be maintained in a healthy and dynamic homeostatic range to prevent malignant diseases. Moreover, Treg-mediated immunosuppression can be limited by reducing tumor-derived Treg Nrp-1 levels. PMID:27075020

  2. Octyl Gallate Markedly Promotes Anti-Amyloidogenic Processing of APP through Estrogen Receptor-Mediated ADAM10 Activation

    PubMed Central

    Zhang, She-Qing; Sawmiller, Darrell; Li, Song; Rezai-Zadeh, Kavon; Hou, Huayan; Zhou, Shufeng; Shytle, Douglas; Giunta, Brian; Fernandez, Frank; Mori, Takashi; Tan, Jun

    2013-01-01

    Our previous studies showed that the green tea-derived polyphenolic compound (−)-epigallocatechin-3 gallate (EGCG) reduces amyloid-β (Aβ) production in both neuronal and mouse Alzheimer’s disease (AD) models in concert with activation of estrogen receptor-α/phosphatidylinositide 3-kinase/protein kinase B (ERα/PI3K/Akt) signaling and anti-amyloidogenic amyloid precursor protein (APP) α-secretase (a disintegrin and metallopeptidase domain-10, ADAM10) processing. Since the gallate moiety in EGCG may correspond to the 7α position of estrogen, thereby facilitating ER binding, we extensively screened the effect of other gallate containing phenolic compounds on APP anti-amyloidogenic processing. Octyl gallate (OG; 10 µM), drastically decreased Aβ generation, in concert with increased APP α-proteolysis, in murine neuron-like cells transfected with human wild-type APP or “Swedish” mutant APP. OG markedly increased production of the neuroprotective amino-terminal APP cleavage product, soluble APP-α (sAPPα). In accord with our previous study, these cleavage events were associated with increased ADAM10 maturation and reduced by blockade of ERα/PI3k/Akt signaling. To validate these findings in vivo, we treated Aβ-overproducing Tg2576 mice with OG daily for one week by intracerebroventricular injection and found decreased Aβ levels associated with increased sAPPα. These data indicate that OG increases anti-amyloidogenic APP α-secretase processing by activation of ERα/PI3k/Akt signaling and ADAM10, suggesting that this compound may be an effective treatment for AD. PMID:23977176

  3. Loss of the repressor REST in uterine fibroids promotes aberrant G protein-coupled receptor 10 expression and activates mammalian target of rapamycin pathway.

    PubMed

    Varghese, Binny V; Koohestani, Faezeh; McWilliams, Michelle; Colvin, Arlene; Gunewardena, Sumedha; Kinsey, William H; Nowak, Romana A; Nothnick, Warren B; Chennathukuzhi, Vargheese M

    2013-02-01

    Uterine fibroids (leiomyomas) are the most common tumors of the female reproductive tract, occurring in up to 77% of reproductive-aged women, yet molecular pathogenesis remains poorly understood. A role for atypically activated mammalian target of rapamycin (mTOR) pathway in the pathogenesis of uterine fibroids has been suggested in several studies. We identified that G protein-coupled receptor 10 [GPR10, a putative signaling protein upstream of the phosphoinositide 3-kinase-protein kinase B/AKT-mammalian target of rapamycin (PI3K/AKT-mTOR) pathway] is aberrantly expressed in uterine fibroids. The activation of GPR10 by its cognate ligand, prolactin releasing peptide, promotes PI3K-AKT-mTOR pathways and cell proliferation specifically in cultured primary leiomyoma cells. Additionally, we report that RE1 suppressing transcription factor/neuron-restrictive silencing factor (REST/NRSF), a known tumor suppressor, transcriptionally represses GPR10 in the normal myometrium, and that the loss of REST in fibroids permits GPR10 expression. Importantly, mice overexpressing human GPR10 in the myometrium develop myometrial hyperplasia with excessive extracellular matrix deposition, a hallmark of uterine fibroids. We demonstrate previously unrecognized roles for GPR10 and its upstream regulator REST in the pathogenesis of uterine fibroids. Importantly, we report a unique genetically modified mouse model for a gene that is misexpressed in uterine fibroids. PMID:23284171

  4. A polymorphic autoregulatory hormone response element in the human estrogen-related receptor alpha (ERRalpha) promoter dictates peroxisome proliferator-activated receptor gamma coactivator-1alpha control of ERRalpha expression.

    PubMed

    Laganière, Josée; Tremblay, Gilles B; Dufour, Catherine R; Giroux, Sylvie; Rousseau, François; Giguère, Vincent

    2004-04-30

    The orphan nuclear estrogen-related receptor alpha (ERRalpha) and transcriptional cofactor peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1alpha) are involved in the regulation of energy metabolism. Recently, extensive cross-talk between PGC-1alpha and ERRalpha has been demonstrated. The presence of PGC-1alpha is associated with an elevated expression of ERRalpha, and the two proteins can influence the transcriptional activities of one another. Using a candidate gene approach to detect regulatory variants within genes encoding nuclear receptors, we have identified a 23-bp sequence (ESRRA23) containing two nuclear receptor recognition half-site motifs that is present in 1-4 copies within the promoter of the human ESRRA gene encoding ERRalpha. The ESRRA23 sequence contains a functional ERR response element that is specifically bound by ERRalpha, and chromatin immunoprecipitation shows that endogenous ERRalpha occupies its own promoter in vivo. Strikingly, introduction of PGC-1alpha in HeLa cells by transient transfection induces the activity of the ESRRA promoter in a manner that is dependent on the presence of the ESRRA23 element and on its dosage. Coexpression of ERRalpha and PGC-1alpha results in a synergistic activation of the ESRRA promoter. In experiments using ERRalpha null fibroblasts, the ability of PGC-1alpha to stimulate the ESRRA promoter is considerably reduced but can be restored by addition of ERRalpha. Taken together, these results demonstrate that an interdependent ERRalpha/PGC-1alpha-based transcriptional pathway targets the ESRRA23 element to dictate the level of ERRalpha expression. This study further suggests that this regulatory polymorphism may provide differential responses to ERRalpha/PGC-1alpha-mediated metabolic cues in the human population.

  5. 1,10-Phenanthroline promotes copper complexes into tumor cells and induces apoptosis by inhibiting the proteasome activity.

    PubMed

    Zhang, Zhen; Bi, Caifeng; Schmitt, Sara M; Fan, Yuhua; Dong, Lili; Zuo, Jian; Dou, Q Ping

    2012-12-01

    Indole-3-acetic acid and indole-3-propionic acid, two potent natural plant growth hormones, have attracted attention as promising prodrugs in cancer therapy. Copper is known to be a cofactor essential for tumor angiogenesis. We have previously reported that taurine, L-glutamine, and quinoline-2-carboxaldehyde Schiff base copper complexes inhibit cell proliferation and proteasome activity in human cancer cells. In the current study, we synthesized two types of copper complexes, dinuclear complexes and ternary complexes, to investigate whether a certain structure could easily carry copper into cancer cells and consequently inhibit tumor proteasome activity and induce apoptosis. We observed that ternary complexes binding with 1,10-phenanthroline are more potent proteasome inhibitors and apoptosis inducers than dinuclear complexes in PC-3 human prostate cancer cells. Furthermore, the ternary complexes potently inhibit proteasome activity before induction of apoptosis in MDA-MB-231 human breast cancer cells, but not in nontumorigenic MCF-10A cells. Our results suggest that copper complexes binding with 1,10-phenanthroline as the third ligand could serve as potent, selective proteasome inhibitors and apoptosis inducers in tumor cells, and that the ternary complexes may be good potential anticancer drugs.

  6. 1,10-Phenanthroline promotes copper complexes into tumor cells and induces apoptosis by inhibiting the proteasome activity.

    PubMed

    Zhang, Zhen; Bi, Caifeng; Schmitt, Sara M; Fan, Yuhua; Dong, Lili; Zuo, Jian; Dou, Q Ping

    2012-12-01

    Indole-3-acetic acid and indole-3-propionic acid, two potent natural plant growth hormones, have attracted attention as promising prodrugs in cancer therapy. Copper is known to be a cofactor essential for tumor angiogenesis. We have previously reported that taurine, L-glutamine, and quinoline-2-carboxaldehyde Schiff base copper complexes inhibit cell proliferation and proteasome activity in human cancer cells. In the current study, we synthesized two types of copper complexes, dinuclear complexes and ternary complexes, to investigate whether a certain structure could easily carry copper into cancer cells and consequently inhibit tumor proteasome activity and induce apoptosis. We observed that ternary complexes binding with 1,10-phenanthroline are more potent proteasome inhibitors and apoptosis inducers than dinuclear complexes in PC-3 human prostate cancer cells. Furthermore, the ternary complexes potently inhibit proteasome activity before induction of apoptosis in MDA-MB-231 human breast cancer cells, but not in nontumorigenic MCF-10A cells. Our results suggest that copper complexes binding with 1,10-phenanthroline as the third ligand could serve as potent, selective proteasome inhibitors and apoptosis inducers in tumor cells, and that the ternary complexes may be good potential anticancer drugs. PMID:23053530

  7. ras oncogene-dependent activation of the P4 promoter of minute virus of mice through a proximal P4 element interacting with the Ets family of transcription factors.

    PubMed Central

    Fuks, F; Deleu, L; Dinsart, C; Rommelaere, J; Faisst, S

    1996-01-01

    The P4 promoter of parvovirus minute virus of mice (MVMp) directs transcription of the genes coding for nonstructural proteins. The activity of promoter P4 is regulated by several cis-acting DNA elements. Among these, a promoter-proximal GC box was shown to be essential for P4 activity (J.K. Ahn, B.J. Gavin, G. Kumar, and D.C. Ward, J. Virol. 63:5425-5439, 1989). In this study, a motif homologous to an Ets transcription factor-binding site (EBS), located immediately upstream from the GC box, was found to be required for the full activity of promoter P4 in the ras-transformed rat fibroblast cell line FREJ4. In normal parental FR3T3 cells, the transcriptional function of P4 EBS was insignificant but could be restored by transient cell transfection with the c-Ha-ras oncogene. P4 EBS may thus contribute to the stimulation of promoter P4 in ras-transformed cells. Electrophoretic mobility shift assays using crude extracts from FREJ4 cells revealed the binding of a member(s) of the Ets family of transcription factors to the P4 EBS, as well as the interaction of two members of the Sp1 family, Sp1 and Sp3, with the adjacent GC box. When produced in Drosophila melanogaster SL2 cells, Ets-1 and Sp1 proteins acted synergistically to transactivate promoter P4 through their respective cognate sites. PMID:8627649

  8. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factor 1, CCAAT/enhancer-binding protein alpha, liver activator protein, and D-element-binding protein.

    PubMed Central

    van Ooij, C; Snyder, R C; Paeper, B W; Duester, G

    1992-01-01

    The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113

  9. Capsicum annuum WRKYb transcription factor that binds to the CaPR-10 promoter functions as a positive regulator in innate immunity upon TMV infection.

    PubMed

    Lim, Jee Hyuck; Park, Chang-Jin; Huh, Sung Un; Choi, La Mee; Lee, Gil Je; Kim, Young Jin; Paek, Kyung-Hee

    2011-08-01

    In plant, some WRKY transcription factors are known to play an important role in the transcriptional reprogramming associated with the immune response. By using WRKY-domain-specific differential display procedure, we isolated CaWRKYb gene, which is rapidly induced during an incompatible interaction between hot pepper and Tobacco mosaic virus (TMV) pathotype P(0) infection. The recombinant CaWRKYb bound to the W box-containing CaPR-10 promoter probes efficiently and the specificity of binding was confirmed by mutant study and competition with cold oligonucleotides. Also, in GUS reporter activity assay using Arabidopsis protoplasts with the CaPR-10 promoter, GUS activity was increased in the presence of CaWRKYb. And CaWRKYb-knockdown plant showed reduced number of hypersensitive response local lesions upon TMV-P(0) infection. Furthermore, CaWRKYb-knockdown plant exhibited compromised resistance to TMV-P(0) by accumulating more TMV, apparently through decreased expression of CaPR-10, CaPR-1, and CaPR-5. These results suggest that CaWRKYb is involved as a positive transcription factor in defense-related signal transduction pathways in hot pepper.

  10. Elemental characterization of PM2.5 and PM10 emitted from light duty vehicles in the Washburn Tunnel of Houston, Texas: release of rhodium, palladium, and platinum.

    PubMed

    Bozlaker, Ayşe; Spada, Nicholas J; Fraser, Matthew P; Chellam, Shankararaman

    2014-01-01

    We report the elemental composition, including Rh, Pd, and Pt, of total (i.e., tailpipe and nontailpipe) PM2.5 and PM10 emissions from predominantly gasoline-driven light-duty vehicles (LDVs) traversing the Washburn Tunnel in Houston, Texas during November and December, 2012. Using a novel sample preparation and dynamic reaction cell-quadrupole-inductively coupled plasma-mass spectrometry technique, we quantify the emission of numerous representative, transition, and lanthanoid elements. Two sets of time integrated PM samples were collected over 3-4week duration both inside the tunnel as well as from the tunnel ventilation air supply to derive accurate LDV source profiles incorporating three platinum group elements (PGEs) for the first time. Average Rh, Pd, and Pt concentrations from the tunnel ventilation air supply were 1.5, 11.1, and 4.5pgm(-3) in PM2.5 and 3.8, 23.1, and 15.1pgm(-3) in PM10, respectively. Rh, Pd, and Pt levels were elevated inside the Washburn Tunnel reaching 12.5, 91.1, and 30.1pgm(-3) in PM2.5 and 36.3, 214, and 61.1pgm(-3) in PM10, respectively. Significantly higher enrichment factors of Cu, Zr, Rh, Pd, Sb, and Pt (referenced to Ti in the upper continental crust) inside the tunnel compared with the ventilation air supply suggested that they are unique elemental tracers of PM derived from gasoline-driven LDVs. This highlights the importance of advancing methods to quantify the trace level PGE emissions as a technique to more accurately estimate LDVs' contributions to airborne PM. Using the emission profile based on PGEs and ambient quantification, mass balancing revealed that approximately half the fine PM mass in the tunnel could be attributed to tailpipe emissions, approximately one-quarter to road dust, with smaller contributions from brake (7%) and tire (3%) wear. On the other hand, PM10 mostly originated from resuspended road dust (∼50%), with progressively lower contributions from tailpipe emissions (14%), brake wear (9%), and tire

  11. Identification of ligands for the Tau exon 10 splicing regulatory element RNA by using dynamic combinatorial chemistry.

    PubMed

    López-Senín, Paula; Gómez-Pinto, Irene; Grandas, Anna; Marchán, Vicente

    2011-02-01

    We describe the use of dynamic combinatorial chemistry (DCC) to identify ligands for the stem-loop structure located at the exon 10-5'-intron junction of Tau pre-mRNA, which is involved in the onset of several tauopathies including frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17). A series of ligands that combine the small aminoglycoside neamine and heteroaromatic moieties (azaquinolone and two acridines) have been identified by using DCC. These compounds effectively bind the stem-loop RNA target (the concentration required for 50% RNA response (EC(50)): 2-58 μM), as determined by fluorescence titration experiments. Importantly, most of them are able to stabilize both the wild-type and the +3 and +14 mutated sequences associated with the development of FTDP-17 without producing a significant change in the overall structure of the RNA (as analyzed by circular dichroism (CD) spectroscopy), which is a key factor for recognition by the splicing regulatory machinery. A good correlation has been found between the affinity of the ligands for the target and their ability to stabilize the RNA secondary structure.

  12. Simultaneous Determination of 10 Ultratrace Elements in Infant Formula, Adult Nutritionals, and Milk Products by ICP/MS After Pressure Digestion: Single-Laboratory Validation.

    PubMed

    Dubascoux, Stephane; Nicolas, Marine; Rime, Celine Fragniere; Payot, Janique Richoz; Poitevin, Eric

    2015-01-01

    A single-laboratory validation (SLV) is presented for the simultaneous determination of 10 ultratrace elements (UTEs) including aluminum (Al), arsenic (As), cadmium (Cd), cobalt (Co), chromium (Cr), mercury (Hg), molybdenum (Mo), lead (Pb), selenium (Se), and tin (Sn) in infant formulas, adult nutritionals, and milk based products by inductively coupled plasma (ICP)/MS after acidic pressure digestion. This robust and routine multielemental method is based on several official methods with modifications of sample preparation using either microwave digestion or high pressure ashing and of analytical conditions using ICP/MS with collision cell technology. This SLV fulfills AOAC method performance criteria in terms of linearity, specificity, sensitivity, precision, and accuracy and fully answers most international regulation limits for trace contaminants and/or recommended nutrient levels established for 10 UTEs in targeted matrixes. PMID:26268978

  13. Simultaneous Determination of 10 Ultratrace Elements in Infant Formula, Adult Nutritionals, and Milk Products by ICP/MS After Pressure Digestion: Single-Laboratory Validation.

    PubMed

    Dubascoux, Stephane; Nicolas, Marine; Rime, Celine Fragniere; Payot, Janique Richoz; Poitevin, Eric

    2015-01-01

    A single-laboratory validation (SLV) is presented for the simultaneous determination of 10 ultratrace elements (UTEs) including aluminum (Al), arsenic (As), cadmium (Cd), cobalt (Co), chromium (Cr), mercury (Hg), molybdenum (Mo), lead (Pb), selenium (Se), and tin (Sn) in infant formulas, adult nutritionals, and milk based products by inductively coupled plasma (ICP)/MS after acidic pressure digestion. This robust and routine multielemental method is based on several official methods with modifications of sample preparation using either microwave digestion or high pressure ashing and of analytical conditions using ICP/MS with collision cell technology. This SLV fulfills AOAC method performance criteria in terms of linearity, specificity, sensitivity, precision, and accuracy and fully answers most international regulation limits for trace contaminants and/or recommended nutrient levels established for 10 UTEs in targeted matrixes.

  14. A Conserved C-terminal Element in the Yeast Doa10 and Human MARCH6 Ubiquitin Ligases Required for Selective Substrate Degradation.

    PubMed

    Zattas, Dimitrios; Berk, Jason M; Kreft, Stefan G; Hochstrasser, Mark

    2016-06-01

    Specific proteins are modified by ubiquitin at the endoplasmic reticulum (ER) and are degraded by the proteasome, a process referred to as ER-associated protein degradation. In Saccharomyces cerevisiae, two principal ER-associated protein degradation ubiquitin ligases (E3s) reside in the ER membrane, Doa10 and Hrd1. The membrane-embedded Doa10 functions in the degradation of substrates in the ER membrane, nuclear envelope, cytoplasm, and nucleoplasm. How most E3 ligases, including Doa10, recognize their protein substrates remains poorly understood. Here we describe a previously unappreciated but highly conserved C-terminal element (CTE) in Doa10; this cytosolically disposed 16-residue motif follows the final transmembrane helix. A conserved CTE asparagine residue is required for ubiquitylation and degradation of a subset of Doa10 substrates. Such selectivity suggests that the Doa10 CTE is involved in substrate discrimination and not general ligase function. Functional conservation of the CTE was investigated in the human ortholog of Doa10, MARCH6 (TEB4), by analyzing MARCH6 autoregulation of its own degradation. Mutation of the conserved Asn residue (N890A) in the MARCH6 CTE stabilized the normally short lived enzyme to the same degree as a catalytically inactivating mutation (C9A). We also report the localization of endogenous MARCH6 to the ER using epitope tagging of the genomic MARCH6 locus by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated genome editing. These localization and CTE analyses support the inference that MARCH6 and Doa10 are functionally similar. Moreover, our results with the yeast enzyme suggest that the CTE is involved in the recognition and/or ubiquitylation of specific protein substrates. PMID:27068744

  15. Source apportionment by PMF on elemental concentrations obtained by PIXE analysis of PM10 samples collected at the vicinity of lignite power plants and mines in Megalopolis, Greece

    NASA Astrophysics Data System (ADS)

    Manousakas, M.; Diapouli, E.; Papaefthymiou, H.; Migliori, A.; Karydas, A. G.; Padilla-Alvarez, R.; Bogovac, M.; Kaiser, R. B.; Jaksic, M.; Bogdanovic-Radovic, I.; Eleftheriadis, K.

    2015-04-01

    Particulate matter (PM) is an important constituent of atmospheric pollution especially in areas under the influence of industrial emissions. Megalopolis is a small city of 10,000 inhabitants located in central Peloponnese in close proximity to three coal opencast mines and two lignite fired power plants. 50 PM10 samples were collected in Megalopolis during the years 2009-11 for elemental and multivariate analysis. For the elemental analysis PIXE was used as one of the most effective techniques in APM analytical characterization. Altogether, the concentrations of 22 elements (Z = 11-33), whereas Black Carbon was also determined for each sample using a reflectometer. Factorization software was used (EPA PMF 3.0) for source apportionment analysis. The analysis revealed that major emission sources were soil dust 33% (7.94 ± 0.27 μg/m3), biomass burning 19% (4.43 ± 0.27 μg/m3), road dust 15% (3.63 ± 0.37 μg/m3), power plant emissions 13% (3.01 ± 0.44 μg/m3), traffic 12% (2.82 ± 0.37 μg/m3), and sea spray 8% (1.99 ± 0.41 μg/m3). Wind trajectories have suggested that metals associated with emission from the power plants came mainly from west and were connected with the locations of the lignite mines located in this area. Soil resuspension, road dust and power plant emissions increased during the warm season of the year, while traffic/secondary, sea spray and biomass burning become dominant during the cold season.

  16. Sphingosine-1-phosphate-enhanced Wnt5a promotes osteogenic differentiation in C3H10T1/2 cells.

    PubMed

    Hashimoto, Yoko; Kobayashi, Mari; Matsuzaki, Etsuko; Higashi, Katsumasa; Takahashi-Yanaga, Fumi; Takano, Aiko; Hirata, Masato; Nishimura, Fusanori

    2016-10-01

    In this study, we investigated the involvement of Wnt signaling in sphingosine-1-phosphate (S1P)-enhanced osteogenic differentiation of C3H10T1/2 pluripotent stem cells. We found that S1P enhanced the expression of Wnt5a and low-density lipoprotein receptor-related protein 5 or 6 (LRP5/6) during osteogenic differentiation. Wnt5a-neutralizing antibody inhibited S1P-enhanced expression of LRP5/6 and alkaline phosphatase, which are essential for osteogenic differentiation. Conversely, S1P did not affect endogenous canonical Wnt signaling. Taken together, S1P-enhanced Wnt5a promotes LRP5/6 expression, resulting in the trigger of osteogenic differentiation of C3H10T1/2 cells. These findings suggest a potential beneficial role for S1P in bone regeneration. PMID:27486054

  17. Sphingosine-1-phosphate-enhanced Wnt5a promotes osteogenic differentiation in C3H10T1/2 cells.

    PubMed

    Hashimoto, Yoko; Kobayashi, Mari; Matsuzaki, Etsuko; Higashi, Katsumasa; Takahashi-Yanaga, Fumi; Takano, Aiko; Hirata, Masato; Nishimura, Fusanori

    2016-10-01

    In this study, we investigated the involvement of Wnt signaling in sphingosine-1-phosphate (S1P)-enhanced osteogenic differentiation of C3H10T1/2 pluripotent stem cells. We found that S1P enhanced the expression of Wnt5a and low-density lipoprotein receptor-related protein 5 or 6 (LRP5/6) during osteogenic differentiation. Wnt5a-neutralizing antibody inhibited S1P-enhanced expression of LRP5/6 and alkaline phosphatase, which are essential for osteogenic differentiation. Conversely, S1P did not affect endogenous canonical Wnt signaling. Taken together, S1P-enhanced Wnt5a promotes LRP5/6 expression, resulting in the trigger of osteogenic differentiation of C3H10T1/2 cells. These findings suggest a potential beneficial role for S1P in bone regeneration.

  18. The Cyst Nematode Effector Protein 10A07 Targets and Recruits Host Posttranslational Machinery to Mediate Its Nuclear Trafficking and to Promote Parasitism in Arabidopsis

    PubMed Central

    Hewezi, Tarek; Juvale, Parijat S.; Piya, Sarbottam; Maier, Tom R.; Rambani, Aditi; Rice, J. Hollis; Mitchum, Melissa G.; Davis, Eric L.; Hussey, Richard S.; Baum, Thomas J.

    2015-01-01

    Plant-parasitic cyst nematodes synthesize and secrete effector proteins that are essential for parasitism. One such protein is the 10A07 effector from the sugar beet cyst nematode, Heterodera schachtii, which is exclusively expressed in the nematode dorsal gland cell during all nematode parasitic stages. Overexpression of H. schachtii 10A07 in Arabidopsis thaliana produced a hypersusceptible phenotype in response to H. schachtii infection along with developmental changes reminiscent of auxin effects. The 10A07 protein physically associates with a plant kinase and the IAA16 transcription factor in the cytoplasm and nucleus, respectively. The interacting plant kinase (IPK) phosphorylates 10A07 at Ser-144 and Ser-231 and mediates its trafficking from the cytoplasm to the nucleus. Translocation to the nucleus is phosphorylation dependent since substitution of Ser-144 and Ser-231 by alanine resulted in exclusive cytoplasmic accumulation of 10A07. IPK and IAA16 are highly upregulated in the nematode-induced syncytium (feeding cells), and deliberate manipulations of their expression significantly alter plant susceptibility to H. schachtii in an additive fashion. An inactive variant of IPK functioned antagonistically to the wild-type IPK and caused a dominant-negative phenotype of reduced plant susceptibility. Thus, exploitation of host processes to the advantage of the parasites is one mechanism by which cyst nematodes promote parasitism of host plants. PMID:25715285

  19. The cyst nematode effector protein 10A07 targets and recruits host posttranslational machinery to mediate its nuclear trafficking and to promote parasitism in Arabidopsis.

    PubMed

    Hewezi, Tarek; Juvale, Parijat S; Piya, Sarbottam; Maier, Tom R; Rambani, Aditi; Rice, J Hollis; Mitchum, Melissa G; Davis, Eric L; Hussey, Richard S; Baum, Thomas J

    2015-03-01

    Plant-parasitic cyst nematodes synthesize and secrete effector proteins that are essential for parasitism. One such protein is the 10A07 effector from the sugar beet cyst nematode, Heterodera schachtii, which is exclusively expressed in the nematode dorsal gland cell during all nematode parasitic stages. Overexpression of H. schachtii 10A07 in Arabidopsis thaliana produced a hypersusceptible phenotype in response to H. schachtii infection along with developmental changes reminiscent of auxin effects. The 10A07 protein physically associates with a plant kinase and the IAA16 transcription factor in the cytoplasm and nucleus, respectively. The interacting plant kinase (IPK) phosphorylates 10A07 at Ser-144 and Ser-231 and mediates its trafficking from the cytoplasm to the nucleus. Translocation to the nucleus is phosphorylation dependent since substitution of Ser-144 and Ser-231 by alanine resulted in exclusive cytoplasmic accumulation of 10A07. IPK and IAA16 are highly upregulated in the nematode-induced syncytium (feeding cells), and deliberate manipulations of their expression significantly alter plant susceptibility to H. schachtii in an additive fashion. An inactive variant of IPK functioned antagonistically to the wild-type IPK and caused a dominant-negative phenotype of reduced plant susceptibility. Thus, exploitation of host processes to the advantage of the parasites is one mechanism by which cyst nematodes promote parasitism of host plants.

  20. The cyst nematode effector protein 10A07 targets and recruits host posttranslational machinery to mediate its nuclear trafficking and to promote parasitism in Arabidopsis.

    PubMed

    Hewezi, Tarek; Juvale, Parijat S; Piya, Sarbottam; Maier, Tom R; Rambani, Aditi; Rice, J Hollis; Mitchum, Melissa G; Davis, Eric L; Hussey, Richard S; Baum, Thomas J

    2015-03-01

    Plant-parasitic cyst nematodes synthesize and secrete effector proteins that are essential for parasitism. One such protein is the 10A07 effector from the sugar beet cyst nematode, Heterodera schachtii, which is exclusively expressed in the nematode dorsal gland cell during all nematode parasitic stages. Overexpression of H. schachtii 10A07 in Arabidopsis thaliana produced a hypersusceptible phenotype in response to H. schachtii infection along with developmental changes reminiscent of auxin effects. The 10A07 protein physically associates with a plant kinase and the IAA16 transcription factor in the cytoplasm and nucleus, respectively. The interacting plant kinase (IPK) phosphorylates 10A07 at Ser-144 and Ser-231 and mediates its trafficking from the cytoplasm to the nucleus. Translocation to the nucleus is phosphorylation dependent since substitution of Ser-144 and Ser-231 by alanine resulted in exclusive cytoplasmic accumulation of 10A07. IPK and IAA16 are highly upregulated in the nematode-induced syncytium (feeding cells), and deliberate manipulations of their expression significantly alter plant susceptibility to H. schachtii in an additive fashion. An inactive variant of IPK functioned antagonistically to the wild-type IPK and caused a dominant-negative phenotype of reduced plant susceptibility. Thus, exploitation of host processes to the advantage of the parasites is one mechanism by which cyst nematodes promote parasitism of host plants. PMID:25715285

  1. The association of three promoter polymorphisms in interleukin-10 gene with the risk for colorectal cancer and hepatocellular carcinoma: A meta-analysis

    PubMed Central

    Shi, Yan-Hui; Zhao, Dong-Mei; Wang, Yue-Fei; Li, Xue; Ji, Man-Ru; Jiang, Dan-Na; Xu, Bai-Ping; Zhou, Li; Lu, Chang-Zhu; Wang, Bin

    2016-01-01

    Mounting evidence supports a potent inhibitory role of interleukin-10 (IL-10) in tumor carcinogenesis, angiogenesis and metastasis. This meta-analysis was designed to examine the association of three promoter polymorphisms (−592C > A, −819C > T and −1082G > A) in IL-10 gene with the risk for colorectal cancer and hepatocellular carcinoma. Qualification assessment and data collection were completed by two authors independently. The random-effects model using the DerSimonian and Laird method was fitted by the STATA software. Twenty-five articles involving 5933 cases and 9724 controls were meta-analyzed. Overall comparisons of the mutant alleles (−592A, −819T and −1082A) of three promoter polymorphisms with alternative wild alleles failed to reveal any statistical significance for both colorectal cancer and hepatocellular carcinoma (P > 0.05), and the likelihood of heterogeneity was low (I2 < 50%). For −592C > A polymorphism, a significant risk for colorectal cancer was identified when analysis was restricted to East Asians (odds ratio or OR = 1.41, 95% confidence interval or CI: 1.18–1.68, P < 0.001) and retrospective studies (OR = 1.23, 95% CI: 1.09–1.39, P = 0.001). As weighed by the Egger’s test and the fill-and-trim method, there was a low probability of publication bias for all studied polymorphisms. Our findings collectively suggest that the −592C > A polymorphism in IL-10 gene might be a susceptibility locus for colorectal cancer in East Asians. PMID:27489033

  2. Elemental characterization and source apportionment of PM10 and PM2.5 in the western coastal area of central Taiwan.

    PubMed

    Hsu, Chin-Yu; Chiang, Hung-Che; Lin, Sheng-Lun; Chen, Mu-Jean; Lin, Tzu-Yu; Chen, Yu-Cheng

    2016-01-15

    This study investigated seasonal variations in PM10 and PM2.5 mass and associated trace metal concentrations in a residential area in proximity to the crude oil refinery plants and industrial parks of central Taiwan. Particle measurements were conducted during winter, spring and summer in 2013 and 2014. Twenty-six trace metals in PM10 and PM2.5 were analyzed using ICP-MS. Multiple approaches of the backward trajectory model, enrichment factor (EF), Lanthanum enrichment and positive matrix fraction (PMF) were used to identify potential sources of particulate metals. Mean concentrations of PM10 in winter, spring and summer were 76.4 ± 22.6, 33.2 ± 9.9 and 37.4 ± 17.0 μg m(-3), respectively, while mean levels of PM2.5 in winter, spring and summer were 47.8 ± 20.0, 23.9 ± 11.2 and 16.3 ± 8.2 μg m(-3), respectively. The concentrations of carcinogenic metals (Ni, As and adjusted Cr(VI)) in PM10 and PM2.5 exceeded the guideline limits published by WHO. The result of EF analysis confirmed that Mo, Sb, Cd, Zn, Mg, Cr, As, Pb, Cu, Ni and V were attributable to anthropogenic emission. PMF analysis demonstrated that trace metals in PM10 and PM2.5 were from the similar sources, such as coal combustion, oil combustion and traffic-related emission, except for soil dust and crustal element emissions only observed in PM10 and secondary aluminum smelter only observed in PM2.5. Considering health-related particulate metals, the traffic-related emission and coal combustion for PM10 and PM2.5, respectively, are important to control for reducing potential carcinogenic risk. The results could aid efforts to clarify the impact of source-specific origins on human health.

  3. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    SciTech Connect

    Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori . E-mail: aaohta@mail.ecc.u-tokyo.ac.jp

    2005-04-01

    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism.

  4. Functional cyclic AMP response element in the breast cancer resistance protein (BCRP/ABCG2) promoter modulates epidermal growth factor receptor pathway- or androgen withdrawal-mediated BCRP/ABCG2 transcription in human cancer cells.

    PubMed

    Xie, Yi; Nakanishi, Takeo; Natarajan, Karthika; Safren, Lowell; Hamburger, Anne W; Hussain, Arif; Ross, Douglas D

    2015-03-01

    Phosphorylated cyclic-AMP (cAMP) response element binding protein (p-CREB) is a downstream effector of a variety of important signaling pathways. We investigated whether the human BCRP promoter contains a functional cAMP response element (CRE). 8Br-cAMP, a cAMP analogue, increased the activity of a BCRP promoter reporter construct and BCRP mRNA in human carcinoma cells. Epidermal growth factor receptor (EGFR) pathway activation also led to an increase in p-CREB and in BCRP promoter reporter activity via two major downstream EGFR signaling pathways: the phosphotidylinositol-3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. EGF treatment increased the phosphorylation of EGFR, AKT, ERK and CREB, while simultaneously enhancing BCRP mRNA and functional protein expression. EGF-stimulated CREB phosphorylation and BCRP induction were diminished by inhibition of EGFR, PI3K/AKT or RAS/MAPK signaling. CREB silencing using RNA interference reduced basal levels of BCRP mRNA and diminished the induction of BCRP by EGF. Chromatin immunoprecipitation assays confirmed that a putative CRE site on the BCRP promoter bound p-CREB by a point mutation of the CRE site abolished EGF-induced stimulation of BCRP promoter reporter activity. Furthermore, the CREB co-activator, cAMP-regulated transcriptional co-activator (CRTC2), is involved in CREB-mediated BCRP transcription: androgen depletion of LNCaP human prostate cancer cells increased both CREB phosphorylation and CRTC2 nuclear translocation, and enhanced BCRP expression. Silencing CREB or CRTC2 reduced basal BCRP expression and BCRP induction under androgen-depletion conditions. This novel CRE site plays a central role in mediating BCRP gene expression in several human cancer cell lines following activation of multiple cancer-relevant signaling pathways. PMID:25615818

  5. Three sequence-specific DNA-protein complexes are formed with the same promoter element essential for expression of the rat somatostatin gene.

    PubMed Central

    Andrisani, O M; Pot, D A; Zhu, Z; Dixon, J E

    1988-01-01

    We identified three sequence-specific DNA-protein complexes which are formed after in vitro binding of nuclear extracts, derived from neuronal (CA-77, rat brain) or non-neuronal (HeLa) cells, to positions -70 to -29 of the rat somatostatin promoter. The protein(s) responsible for the formation of the three sequence-specific complexes was fractionated from rat brain whole cell extracts by DEAE-Sepharose chromatography. The critical contact residues of the factor(s) in each complex, as determined by methylation interference analyses, are located within positions -59 to -35, which is protected from DNase I digestion; these include the G residues of a TGACGTCA consensus also found in the cAMP-responsive human enkephalin (positions -105 to -76) and E1A-inducible adenovirus type 5 E3 (positions -72 to -42) promoters. Competition assays with these heterologous promoters reveal that the factor(s) of each complex displays approximately 50-fold greater affinity for the somatostatin promoter-binding site. Synthetic oligonucleotides spanning positions -70 to -29 of the somatostatin promoter and containing single-base substitutions of the G residues in the TGACGTCA consensus were utilized in competition assays. The G residues located in the center of the module are the most critical determinants in the formation of the three sequence-specific complexes. Deletions disrupting the TGACGTCA consensus abolish not only formation of the three complexes in vitro but also expression of the somatostatin promoter in vivo, suggesting that formation of one or more of these complexes is essential for transcription of the rat somatostatin gene. Images PMID:2898727

  6. Hahb-10, a sunflower homeobox-leucine zipper gene, is regulated by light quality and quantity, and promotes early flowering when expressed in Arabidopsis.

    PubMed

    Rueda, Eva C; Dezar, Carlos A; Gonzalez, Daniel H; Chan, Raquel L

    2005-12-01

    Homeodomain-leucine zipper proteins constitute a family of transcription factors found only in plants. Expression patterns of the sunflower homeobox-leucine zipper gene Hahb-10 (Helianthus annuus homeobox-10), that belongs to the HD-Zip II subfamily, were analysed. Northern blots showed that Hahb-10 is expressed primarily in mature leaves, although expression is clearly detectable in younger leaves and also in stems. Considerably higher expression levels were detected in etiolated seedlings compared with light-grown seedlings. Induction of Hahb-10 expression was observed when seedlings were subjected to treatment with gibberellins. Transgenic Arabidopsis thaliana plants that express Hahb-10 under the 35S cauliflower mosaic virus promoter show special phenotypic characteristics such as darker cotyledons and planar leaves. A reduction in the life cycle of about 25% allowing earlier seed collection was also observed, and this phenomenon is clearly related to a shortened flowering time. When the number of plants per pot increased, the difference in developmental rate between transgenic and non-transformed individuals became larger. After gibberellin treatment, the relative difference in life cycle duration was considerably reduced. Several light-regulated genes have been tested as possible target genes of Hahb-10. One of them, PsbS, shows a different response to illumination conditions in transgenic plants compared with the response in wild-type plants while the other genes behave similarly in both genotypes. We propose that Hahb-10 functions in a signalling cascade(s) that control(s) plant responses to light quality and quantity, and may also be involved in gibberellin transduction pathways. PMID:16215272

  7. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  8. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  9. Early and late promoters of BK polyomavirus, Merkel cell polyomavirus, Trichodysplasia spinulosa-associated polyomavirus and human polyomavirus 12 are among the strongest of all known human polyomaviruses in 10 different cell lines.

    PubMed

    Moens, Ugo; Van Ghelue, Marijke; Ludvigsen, Maria; Korup-Schulz, Sarah; Ehlers, Bernhard

    2015-08-01

    Recently, 11 new human polyomaviruses (HPyVs) have been isolated and named KI, WU, Merkel cell polyomavirus (MCPyV), HPyV6,  -7,  -9,  -10 and  -12, Trichodysplasia spinulosa-associated polyomavirus (TSPyV), STLPyV and NJPyV-2013. Little is known about cell tropism of the novel HPyVs, and cell cultures allowing virus propagation are lacking. Because viral tropism partially depends on the interaction of cellular transcription factors with the viral promoter, we monitored the promoter activity of all known HPyVs. Therefore, we compared the relative early and late promoter activity of the BK polyomavirus (BKPyV) (WW strain) with the corresponding activities of the other HPyVs in 10 different cell lines derived from brain, colon, kidney, liver, lung, the oral cavity and skin. Our results show that the BKPyV, MCPyV, TSPyV and HPyV12 early promoters displayed the strongest activity in most cell lines tested, while the remaining HPyV had relative low early promoter activity. HPyV12 showed the highest late promoter activity of all HPyVs in most cell lines, but also the BKPyV, MCPyV and TSPyV late promoters belonged to the stronger ones among HPyVs. The HPyVs with weak early promoter activity had in general also weak late promoter activity, except for HPyV10 whose late promoter was relatively strong in six of the 10 cell lines. A 20 bp deletion in the promoter of an HPyV12 variant significantly affected both early and late promoter activity in most cell lines. In conclusion, our findings suggest which cell lines may be suitable for virus propagation and may give an indication of the cell tropism of the HPyVs.

  10. To grow or defend? Low red : far-red ratios reduce jasmonate sensitivity in Arabidopsis seedlings by promoting DELLA degradation and increasing JAZ10 stability.

    PubMed

    Leone, Melisa; Keller, Mercedes M; Cerrudo, Ignacio; Ballaré, Carlos L

    2014-10-01

    How plants balance resource allocation between growth and defense under conditions of competitive stress is a key question in plant biology. Low red : far-red (R : FR) ratios, which signal a high risk of competition in plant canopies, repress jasmonate-induced defense responses. The mechanism of this repression is not well understood. We addressed this problem in Arabidopsis by investigating the role of DELLA and JASMONATE ZIM domain (JAZ) proteins. We showed that a quintuple della mutant and a phyB mutant were insensitive to jasmonate for several physiological readouts. Inactivation of the photoreceptor phyB by low R : FR ratios rapidly reduced DELLA protein abundance, and the inhibitory effect of FR on jasmonate signaling was missing in the gai-1 mutant, which encodes a stable version of the GAI DELLA protein. We also demonstrated that low R : FR ratios and the phyB mutation stabilized the protein JAZ10. Furthermore, we demonstrated that JAZ10 was required for the inhibitory effect of low R : FR on jasmonate responses, and that the jaz10 mutation restored jasmonate sensitivity to the phyB mutant. We conclude that, under conditions of competition for light, plants redirect resource allocation from defense to rapid elongation by promoting DELLA degradation and enhancing JAZ10 stability.

  11. Ty1 Integrase Interacts with RNA Polymerase III-specific Subcomplexes to Promote Insertion of Ty1 Elements Upstream of Polymerase (Pol) III-transcribed Genes.

    PubMed

    Cheung, Stephanie; Ma, Lina; Chan, Patrick H W; Hu, Hui-Lan; Mayor, Thibault; Chen, Hung-Ta; Measday, Vivien

    2016-03-18

    Retrotransposons are eukaryotic mobile genetic elements that transpose by reverse transcription of an RNA intermediate and are derived from retroviruses. The Ty1 retrotransposon of Saccharomyces cerevisiae belongs to the Ty1/Copia superfamily, which is present in every eukaryotic genome. Insertion of Ty1 elements into the S. cerevisiae genome, which occurs upstream of genes transcribed by RNA Pol III, requires the Ty1 element-encoded integrase (IN) protein. Here, we report that Ty1-IN interacts in vivo and in vitro with RNA Pol III-specific subunits to mediate insertion of Ty1 elements upstream of Pol III-transcribed genes. Purification of Ty1-IN from yeast cells followed by mass spectrometry (MS) analysis identified an enrichment of peptides corresponding to the Rpc82/34/31 and Rpc53/37 Pol III-specific subcomplexes. GFP-Trap purification of multiple GFP-tagged RNA Pol III subunits from yeast extracts revealed that the majority of Pol III subunits co-purify with Ty1-IN but not two other complexes required for Pol III transcription, transcription initiation factors (TF) IIIB and IIIC. In vitro binding studies with bacterially purified RNA Pol III proteins demonstrate that Rpc31, Rpc34, and Rpc53 interact directly with Ty1-IN. Deletion of the N-terminal 280 amino acids of Rpc53 abrogates insertion of Ty1 elements upstream of the hot spot SUF16 tRNA locus and abolishes the interaction of Ty1-IN with Rpc37. The Rpc53/37 complex therefore has an important role in targeting Ty1-IN to insert Ty1 elements upstream of Pol III-transcribed genes. PMID:26797132

  12. A 9 bp cis-element in the promoters of class I small heat shock protein genes on chromosome 3 in rice mediates L-azetidine-2-carboxylic acid and heat shock responses

    PubMed Central

    Guan, Jiahn-Chou; Yeh, Ching-Hui; Lin, Ya-Ping; Ke, Yi-Ting; Chen, Ming-Tse; You, Jia-Wen; Liu, Yi-Hsin; Lu, Chung-An; Wu, Shaw-Jye; Lin, Chu-Yung

    2010-01-01

    In rice, the class I small heat shock protein (sHSP-CI) genes were found to be selectively induced by L-azetidine-2-carboxylic acid (AZC) on chromosome 3 but not chromosome 1. Here it is shown that a novel cis-responsive element contributed to the differential regulation. By serial deletion and computational analysis, a 9 bp putative AZC-responsive element (AZRE), GTCCTGGAC, located between nucleotides –186 and –178 relative to the transcription initiation site of Oshsp17.3 was revealed. Deletion of this putative AZRE from the promoter abolished its ability to be induced by AZC. Moreover, electrophoretic mobility shift assay (EMSA) revealed that the AZRE interacted specifically with nuclear proteins from AZC-treated rice seedlings. Two AZRE–protein complexes were detected by EMSA, one of which could be competed out by a canonical heat shock element (HSE). Deletion of the AZRE also affected the HS response. Furthermore, transient co-expression of the heat shock factor OsHsfA4b with the AZRE in the promoter of Oshsp17.3 was effective. The requirement for the putative AZRE for AZC and HS responses in transgenic Arabidopsis was also shown. Thus, AZRE represents an alternative form of heat HSE, and its interaction with canonical HSEs through heat shock factors may be required to respond to HS and AZC. PMID:20643810

  13. TH-C-12A-08: New Compact 10 MV S-Band Linear Accelerator: 3D Finite-Element Design and Monte Carlo Dose Simulations

    SciTech Connect

    Baillie, D; St Aubin, J; Fallone, B; Steciw, S

    2014-06-15

    Purpose: To design a new compact S-band linac waveguide capable of producing a 10 MV x-ray beam, while maintaining the length (27.5 cm) of current 6 MV waveguides. This will allow higher x-ray energies to be used in our linac-MRI systems with the same footprint. Methods: Finite element software COMSOL Multiphysics was used to design an accelerator cavity matching one published in an experiment breakdown study, to ensure that our modeled cavities do not exceed the threshold electric fields published. This cavity was used as the basis for designing an accelerator waveguide, where each cavity of the full waveguide was tuned to resonate at 2.997 GHz by adjusting the cavity diameter. The RF field solution within the waveguide was calculated, and together with an electron-gun phase space generated using Opera3D/SCALA, were input into electron tracking software PARMELA to compute the electron phase space striking the x-ray target. This target phase space was then used in BEAM Monte Carlo simulations to generate percent depth doses curves for this new linac, which were then used to re-optimize the waveguide geometry. Results: The shunt impedance, Q-factor, and peak-to-mean electric field ratio were matched to those published for the breakdown study to within 0.1% error. After tuning the full waveguide, the peak surface fields are calculated to be 207 MV/m, 13% below the breakdown threshold, and a d-max depth of 2.42 cm, a D10/20 value of 1.59, compared to 2.45 cm and 1.59, respectively, for the simulated Varian 10 MV linac and brehmsstrahlung production efficiency 20% lower than a simulated Varian 10 MV linac. Conclusion: This work demonstrates the design of a functional 27.5 cm waveguide producing 10 MV photons with characteristics similar to a Varian 10 MV linac.

  14. AKARI observations of brown dwarfs. IV. Effect of elemental abundances on near-infrared spectra between 1.0 and 5.0 μm

    SciTech Connect

    Sorahana, S.; Yamamura, I.

    2014-09-20

    The detection of the CO{sub 2} absorption band at 4.2 μm in brown dwarf spectra by AKARI has made it possible to discuss CO{sub 2} molecular abundance in brown dwarf atmospheres. In our previous studies, we found an excess in the 4.2 μm CO{sub 2} absorption band of three brown dwarf spectra, and suggested that these deviations were caused by high C and O elemental abundances in their atmospheres. To validate this hypothesis, we have constructed a set of models of brown dwarf atmospheres with various elemental abundance patterns, and we investigate the variations of the molecular composition and the thermal structure, and how they affect the near-infrared spectra between 1.0 and 5.0 μm. The 4.2 μm CO{sub 2} absorption band in some late-L and T dwarfs taken by AKARI is stronger or weaker than predicted by corresponding models with solar abundance. By comparing the CO{sub 2} band in the model spectra to the observed near-infrared spectra, we confirm possible elemental abundance variations among brown dwarfs. We find that the band strength is especially sensitive to O abundance, but C is also needed to reproduce the entire near-infrared spectra. This result indicates that both the C and O abundances should increase and decrease simultaneously for brown dwarfs. We find that a weaker CO{sub 2} absorption band in a spectrum can also be explained by a model with lower 'C and O' abundances.

  15. Efficiency of Iepsilon promoter-directed switch recombination in GFP expression-based switch constructs works synergistically with other promoter and/or enhancer elements but is not tightly linked to the strength of transcription.

    PubMed

    Zhang, Ke; Zhang, Ling; Yamada, Takechiyo; Vu, Michael; Lee, Anna; Saxon, Andrew

    2002-02-01

    One key unresolved issue in immunoglobulin class switch recombination (CSR) is how the accessibility of the switch region for CSR is controlled. To better understand the nature of accessibility control for human Ig CSR, we developed a novel inducible switch recombination assay based on expression of green fluorescence protein (GFP) from switch constructs undergoing substrate switch recombination (SSR). Efficient SSR depends on the cytokine-inducible Iepsilon promoter and co-stimulation with IL-4+anti-CD40. Characterization of SSR reveals that both S-S deletional recombination and S-S inversion occur. We show that the IL-4-inducible Iepsilon promoter (pIepsilon) selectively determines the efficiency of the accessibility for SSR. However, the pIepsilon-induced transcription, by itself,is not sufficient to direct efficient SSR. For efficient SSR, both pIepsilon-driven transcriptional activity and an additional promoter/enhancer-derived activity are required. The efficiency of SSR is not tightly correlated with the strength of the combined transcriptional activity. Our results suggest that the mechanism(s) underlying the transcriptional activity, e.g. DNA modification is important for controlling the accessibility for efficient switch recombination.

  16. Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.

    PubMed

    Hattori, T; Terada, T; Hamasuna, S

    1995-06-01

    Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

  17. Characterization of regulatory elements within the coat protein (CP) coding region of Tobacco mosaic virus affecting subgenomic transcription and green fluorescent protein expression from the CP subgenomic RNA promoter.

    PubMed

    Man, Michal; Epel, Bernard L

    2004-06-01

    A replicon based on Tobacco mosaic virus that was engineered to express the open reading frame (ORF) of the green fluorescent protein (GFP) gene in place of the native coat protein (CP) gene from a minimal CP subgenomic (sg) RNA promoter was found to accumulate very low levels of GFP. Regulatory regions within the CP ORF were identified that, when presented as untranslated regions flanking the GFP ORF, enhanced or inhibited sg transcription and GFP expression. Full GFP expression from the CP sgRNA promoter required more than the first 20 nt of the CP ORF but not beyond the first 56 nt. Further analysis indicated the presence of an enhancer element between nt +25 and +55 with respect to the CP translation start site. The inclusion of this enhancer sequence upstream of the GFP ORF led to elevated sg transcription and to a 50-fold increase in GFP accumulation in comparison with a minimal CP promoter in which the entire CP ORF was displaced by the GFP ORF. Inclusion of the 3'-terminal 22 nt had a minor positive effect on GFP accumulation, but the addition of extended untranslated sequences from the 3' terminus of the CP ORF downstream of the GFP ORF was basically found to inhibit sg transcription. Secondary structure analysis programs predicted the CP sgRNA promoter to reside within two stable stem-loop structures, which are followed by an enhancer region.

  18. Elemental composition of strawberry plants inoculated with the plant growth-promoting bacterium Azospirillum brasilense REC3, assessed with scanning electron microscopy and energy dispersive X-ray analysis.

    PubMed

    Guerrero-Molina, M F; Lovaisa, N C; Salazar, S M; Díaz-Ricci, J C; Pedraza, R O

    2014-07-01

    The elemental composition of strawberry plants (Fragaria ananassa cv. Macarena) inoculated with the plant growth-promoting bacterium Azospirillum brasilense REC3, and non-inoculated controls, was studied using scanning electron microscopy (SEM) and energy dispersive X-ray (EDS) analysis. This allowed simultaneous semi-quantification of different elements in a small, solid sample. Plants were inoculated and grown hydroponically in 50% or 100% Hoagland solution, corresponding to limited or optimum nutrient medium, respectively. Bacteria-inoculated plants increased the growth index 45% and 80% compared to controls when grown in 100% and 50% Hoagland solution, respectively. Thus, inoculation with A. brasilense REC3 in a nutrient-limited medium had the strongest effect in terms of increasing both shoot and root biomass and growth index, as already described for Azospirillum inoculated into nutrient-poor soils. SEM-EDS spectra and maps showed the elemental composition and relative distribution of nutrients in strawberry tissues. Leaves contained C, O, N, Na, P, K, Ca and Cu, while roots also had Si and Cl. The organic fraction (C, O and N) accounted for over 96.3% of the total chemical composition; of the mineral fraction, Na had higher accumulation in both leaves and roots. Azospirillum-inoculated and control plants had similar elemental quantities; however, in bacteria-inoculated roots, P was significantly increased (34.33%), which constitutes a major benefit for plant nutrition, while Cu content decreased (35.16%).

  19. Characterization of the promoter of the human gene encoding the high-affinity IgG receptor: Transcriptional induction by. gamma. -interferon is mediated through common DNA response elements

    SciTech Connect

    Pearse, R.N.; Feinman, R.; Ravetch, J.V. )

    1991-12-15

    Expression of the high-affinity receptor for IgG (Fc{sub {gamma}}RI) is restricted to cells of myeloid lineage and is induced by {gamma}-interferon (IFN-{gamma}) but not by IFN-{alpha}/{beta}. The organization of the human Fc{sub {gamma}}RI gene has been determined and the DNA elements governing its cell type-restricted transcription and IFN-{gamma} induction are reported here. A 39-nucleotide sequence (IFN-{gamma} response region, or GRR) is defined that is both necessary and sufficient for IFN-{gamma} inducibility. Sequence analysis of the GRR reveals the presence of promoter elements initially defined for the major histocompatibility complex class 2 genes: i.e., X, H, and {gamma}-IRE sequences. Comparison of a number of genes whose expression is induced selectively by IFN-{gamma} indicated that the presence of these elements is a general feature of IFN-{gamma}-responsive genes. The studies suggest that the combination of X, H, and {gamma}-IRE elements is a common motif in the pathway of transcriptional induction by this lymphokine.

  20. A bipartite operator interacts with a heat shock element to mediate early meiotic induction of Saccharomyces cerevisiae HSP82

    SciTech Connect

    Szent-Gyorgyi, C.

    1995-12-01

    This report seeks to characterize the activation of meiotic gene in terms of cis-acting DNA elements and their associated factors in Saccharomyces cerevisiae. It was found that vegetative repression and meiotic induction depend on interactions of the promoter-proximal heat shock element with a nearby bipartite repression element. The experiments described explore how two different regulatory pathways induce transcription by stimulating a single classical activation element, a nonspecific heat shock element. 81 refs., 10 figs., 1 tab.

  1. Identification of a lactose-responsive element upstream of the promoter of Bacillus megaterium beta-galactosidase-encoding gene mbgA.

    PubMed

    Li, Jen-Ming; Chiou, Chih-Yung; Lee, Tian-Ren; Chen, Yuan-Shou; Shaw, Gwo-Chyuan

    2005-07-01

    The Bacillus megaterium mbgA gene encodes a lactose-hydrolyzing beta-galactosidase. An AraC/XylS-type activator BgaR can activate mbgA transcription in response to lactose. In this report, we show by various deletion analyses and point mutagenesis analyses that an inverted repeat centered at position -60.5 relative to the mbgA transcriptional initiation site is the cis-acting element responsible for lactose induction of mbgA expression. PMID:15971092

  2. Cold induction of Arabidopsis CBF genes involves multiple ICE (inducer of CBF expression) promoter elements and a cold-regulatory circuit that is desensitized by low temperature.

    PubMed

    Zarka, Daniel G; Vogel, Jonathan T; Cook, Daniel; Thomashow, Michael F

    2003-10-01

    The Arabidopsis CBF1, 2, and 3 genes (also known as DREB1b, c, and a, respectively) encode transcriptional activators that have a central role in cold tolerance. CBF1-3 are rapidly induced upon exposing plants to low temperature, followed by expression of CBF-targeted genes, the CBF regulon, resulting in an increase in plant freezing tolerance. At present, little is known about the cold-sensing mechanism that controls CBF expression. Results presented here indicate that this mechanism does not require a cold shock to bring about the accumulation of CBF transcripts, but instead, absolute temperature is monitored with a greater degree of input, i.e. lower temperature, resulting in a greater output, i.e. higher levels of CBF transcripts. Temperature-shift experiments also indicate that the cold-sensing mechanism becomes desensitized to a given low temperature, such as 4 degrees C, and that resensitization to that temperature requires between 8 and 24 h at warm temperature. Gene fusion experiments identified a 125-bp section of the CBF2 promoter that is sufficient to impart cold-responsive gene expression. Mutational analysis of this cold-responsive region identified two promoter segments that work in concert to impart robust cold-regulated gene expression. These sequences, designated ICEr1 and ICEr2 (induction of CBF expression region 1 or 2), were also shown to stimulate transcription in response to mechanical agitation and the protein synthesis inhibitor, cycloheximide.

  3. Continuous in vitro evolution of bacteriophage RNA polymerase promoters

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Banerji, A.; Joyce, G. F.

    1994-01-01

    Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

  4. A carbon source-responsive promoter element necessary for activation of the isocitrate lyase gene ICL1 is common to genes of the gluconeogenic pathway in the yeast Saccharomyces cerevisiae.

    PubMed Central

    Schöler, A; Schüller, H J

    1994-01-01

    The expression of yeast genes encoding gluconeogenic enzymes depends strictly on the carbon source available in the growth medium. We have characterized the control region of the isocitrate lyase gene ICL1, which is derepressed more than 200-fold after transfer of cells from fermentative to nonfermentative growth conditions. Deletion analysis of the ICL1 promoter led to the identification of an upstream activating sequence element, UASICL1 (5' CATTCATCCG 3'), necessary and sufficient for conferring carbon source-dependent regulation on a heterologous reporter gene. Similar sequence motifs were also found in the upstream regions of coregulated genes involved in gluconeogenesis. This carbon source-responsive element (CSRE) interacts with a protein factor, designated Ang1 (activator of nonfermentative growth), detectable only in extracts derived from derepressed cells. Gene activation mediated by the CSRE requires the positively acting derepression genes CAT1 (= SNF1 and CCR1) and CAT3 (= SNF4). In the respective mutants, Ang1-CSRE interaction was no longer observed under repressing or derepressing conditions. Since binding of Ang1 factor to the CSRE could be competed for by an upstream sequence derived from the fructose-1,6-bisphosphatase gene FBP1, we propose that the CSRE functions as a UAS element common to genes of the gluconeogenic pathway. Images PMID:8196607

  5. First-principles study of site occupancy of 3d, 4d and 5d transition-metal elements in L10TiAl

    SciTech Connect

    Jiang, Chao

    2008-01-01

    Using a statistical-mechanical Wagner-Schottky model parametrized by first-principles density-functional (DFT-GGA) calculations on 32-atom supercells, we predict the lattice site occupancy of 3d (Ti-Cu), 4d (Zr-Ag) and 5d (Hf-Au) transition-metal elements in L10 TiAl intermetallic compound as a function of both alloy composition and temperature. The effects of local atomic relaxations, anisotropic lattice distortions, as well as magnetism on point defect energetics are fully taken into account. Our calculations show that, at all alloy compositions and temperatures, Zr and Hf consistently show a preference for the Ti sublattice, while Co, Ru, Rh, Pd, Ag, Re, Os, Ir, Pt and Au consistently show a preference for the Al sublattice. In contrast, the site preference of V, Cr, Mn, Fe, Ni, Cu, Nb, Mo, Tc, Ta and W strongly depend on both alloy stoichiometry and temperature. Our calculated results compare favorably with the existing theoretical and experimental studies in the literature.

  6. Association of MMP7 -181A→G Promoter Polymorphism with Gastric Cancer Risk: INFLUENCE OF NICOTINE IN DIFFERENTIAL ALLELE-SPECIFIC TRANSCRIPTION VIA INCREASED PHOSPHORYLATION OF cAMP-RESPONSE ELEMENT-BINDING PROTEIN (CREB).

    PubMed

    Kesh, Kousik; Subramanian, Lakshmi; Ghosh, Nillu; Gupta, Vinayak; Gupta, Arnab; Bhattacharya, Samir; Mahapatra, Nitish R; Swarnakar, Snehasikta

    2015-06-01

    Elevated expression of matrix metalloproteinase7 (MMP7) has been demonstrated to play a pivotal role in cancer invasion. The -181A→G (rs11568818) polymorphism in the MMP7 promoter modulates gene expression and possibly affects cancer progression. Here, we evaluated the impact of -181A→G polymorphism on MMP7 promoter activity and its association with gastric cancer risk in eastern Indian case-control cohorts (n = 520). The GG genotype as compared with the AA genotype was predisposed (p = 0.02; odds ratio = 1.9, 95% confidence interval = 1.1-3.3) to gastric cancer risk. Stratification analysis showed that tobacco addiction enhanced gastric cancer risk in GG subjects when compared with AA subjects (p = 0.03, odds ratio = 2.46, and 95% confidence interval = 1.07-5.68). Meta-analysis revealed that tobacco enhanced the risk for cancer more markedly in AG and GG carriers. Activity and expression of MMP7 were significantly higher in GG than in AA carriers. In support, MMP7 promoter-reporter assays showed greater transcriptional activity toward A to G transition under basal/nicotine-induced/cAMP-response element-binding protein (CREB) overexpressed conditions in gastric adenocarcinoma cells. Moreover, nicotine (a major component of tobacco) treatment significantly up-regulated MMP7 expression due to enhanced CREB phosphorylation followed by its nuclear translocation in gastric adenocarcinoma cells. Furthermore, chromatin immunoprecipitation experiments revealed higher binding of phosphorylated CREB with the -181G than the -181A allele. Altogether, specific binding of phosphorylated CREB to the G allele-carrying promoter enhances MMP7 gene expression that is further augmented by nicotine due to increased CREB phosphorylation and thereby increases the risk for gastric cancer.

  7. Concentrations and source apportionment of PM10 and associated elemental and ionic species in a lignite-burning power generation area of southern Greece.

    PubMed

    Argyropoulos, G; Grigoratos, Th; Voutsinas, M; Samara, C

    2013-10-01

    Ambient concentrations of PM10 and associated elemental and ionic species were measured over the cold and the warm months of 2010 at an urban and two rural sites located in the lignite-fired power generation area of Megalopolis in Peloponnese, southern Greece. The PM10 concentrations at the urban site (44.2 ± 33.6 μg m(-3)) were significantly higher than those at the rural sites (23.7 ± 20.4 and 22.7 ± 26.9 μg m(-3)). Source apportionment of PM10 and associated components was accomplished by an advanced computational procedure, the robotic chemical mass balance model (RCMB), using chemical profiles for a variety of local fugitive dust sources (power plant fly ash, flue gas desulfurization wet ash, feeding lignite, infertile material from the opencast mines, paved and unpaved road dusts, soil), which were resuspended and sampled through a PM10 inlet onto filters and then chemically analyzed, as well as of other common sources such as vehicular traffic, residential oil combustion, biomass burning, uncontrolled waste burning, marine aerosol, and secondary aerosol formation. Geological dusts (road/soil dust) were found to be major PM10 contributors in both the cold and warm periods of the year, with average annual contribution of 32.6 % at the urban site vs. 22.0 and 29.0 % at the rural sites. Secondary aerosol also appeared to be a significant source, contributing 22.1 % at the urban site in comparison to 30.6 and 28.7 % at the rural sites. At all sites, the contribution of biomass burning was most significant in winter (28.2 % at the urban site vs. 14.6 and 24.6 % at the rural sites), whereas vehicular exhaust contribution appeared to be important mostly in the summer (21.9 % at the urban site vs. 11.5 and 10.5 % at the rural sites). The highest contribution of fly ash (33.2 %) was found at the rural site located to the north of the power plants during wintertime, when winds are favorable. In the warm period, the highest contribution of fly ash was found at the

  8. Preliminary Finnish Measures of Eating Competence Suggest Association with Health-Promoting Eating Patterns and Related Psychobehavioral Factors in 10–17 Year Old Adolescents

    PubMed Central

    Tanja, Tilles-Tirkkonen; Outi, Nuutinen; Sakari, Suominen; Jarmo, Liukkonen; Kaisa, Poutanen; Leila, Karhunen

    2015-01-01

    Eating competence is an attitudinal and behavioral concept, based on The Satter Eating Competence Model. In adults, it has been shown to be associated with a higher quality of diet. Eating competence or its association with the quality of diet has not been studied in adolescents. The aim of the current study was to explore the utility of using a preliminary Finnish translation of the ecSI 2.0 for evaluating presumed eating competence and its association with food selection, meal patterns and related psychobehavioral factors in 10–17 year old adolescents. Altogether 976 10–17 years old Finnish adolescents filled in the study questionnaire. When exploring the construct validity of ecSI 2.0, the confirmatory factor analysis (CFA) indicated acceptable model fit and all four components of the ecSI 2.0 (eating attitudes, food acceptance, internal regulation of food intake, management of eating context) correlated with each other and were internally consistent. Over half (58%) of the adolescents scored 32 or higher and were thus classified as presumably eating competent (pEC). Eating competence was associated with greater meal frequency, more frequent consumption of vegetables and fruits, and more health-promoting family eating patterns. In addition the pEC, adolescents more often perceived their body size as appropriate, had less often tried to lose weight and had a higher self-esteem and a stronger sense of coherence than the not pEC ones. Family eating patterns and self-esteem were the main underlying factors of eating competence. In conclusion, this preliminary study suggests eating competence could be a useful concept to characterize eating patterns and related behaviors and attitudes in adolescents. However, these preliminary findings need to be confirmed in further studies with an instrument fully validated for this age group. PMID:26007335

  9. Analysis of E. coli promoter sequences.

    PubMed Central

    Harley, C B; Reynolds, R P

    1987-01-01

    We have compiled and analyzed 263 promoters with known transcriptional start points for E. coli genes. Promoter elements (-35 hexamer, -10 hexamer, and spacing between these regions) were aligned by a program which selects the arrangement consistent with the start point and statistically most homologous to a reference list of promoters. The initial reference list was that of Hawley and McClure (Nucl. Acids Res. 11, 2237-2255, 1983). Alignment of the complete list was used for reference until successive analyses did not alter the structure of the list. In the final compilation, all bases in the -35 (TTGACA) and -10 (TATAAT) hexamers were highly conserved, 92% of promoters had inter-region spacing of 17 +/- 1 bp, and 75% of the uniquely defined start points initiated 7 +/- 1 bases downstream of the -10 region. The consensus sequence of promoters with inter-region spacing of 16, 17 or 18 bp did not differ. This compilation and analysis should be useful for studies of promoter structure and function and for programs which identify potential promoter sequences. PMID:3550697

  10. Crystallization and X-ray analysis of the transcription-activator protein C1 of bacteriophage P22 in complex with the PRE promoter element.

    PubMed

    Mondal, Avisek; Chattopadhyaya, Rajagopal; Datta, Ajit Bikram; Parrack, Pradeep

    2015-10-01

    The transcription-activator protein C1 of the temperate phage P22 of Salmonella typhimurium plays a key role in the lytic versus lysogenic switch of the phage. A homotetramer of 92-residue polypeptides, C1 binds to an approximate direct repeat similar to the transcription activator CII of coliphage λ. Despite this and several other similarities, including 57% sequence identity to coliphage CII, many biochemical observations on P22 C1 cannot be explained based on the structure of CII. To understand the molecular basis of these differences, C1 was overexpressed and purified and subjected to crystallization trials. Although no successful hits were obtained for the apoprotein, crystals could be obtained when the protein was subjected to crystallization trials in complex with a 23-mer promoter DNA fragment (PRE). These crystals diffracted very well at the home source, allowing the collection of a 2.2 Å resolution data set. The C1-DNA crystals belonged to space group P21, with unit-cell parameters a = 87.27, b = 93.58, c = 111.16 Å, β = 94.51°. Solvent-content analysis suggests that the asymmetric unit contains three tetramer-DNA complexes. The three-dimensional structure is expected to shed light on the mechanism of activation by C1 and the molecular basis of its specificity. PMID:26457520

  11. Imaging transcription in vivo: distinct regulatory effects of fast and slow activity patterns on promoter elements from vertebrate troponin I isoform genes

    PubMed Central

    Rana, Zaheer A; Gundersen, Kristian; Buonanno, Andres; Vullhorst, Detlef

    2005-01-01

    Firing patterns typical of slow motor units activate genes for slow isoforms of contractile proteins, but it remains unclear if there is a distinct pathway for fast isoforms or if their expression simply occurs in the absence of slow activity. Here we first show that denervation in adult soleus and EDL muscles reverses the postnatal increase in expression of troponin I (TnI) isoforms, suggesting that high-level transcription of both genes in mature muscles is under neural control. We then use a combination of in vivo transfection, live muscle imaging and fluorescence quantification to investigate the role of patterned electrical activity in the transcriptional control of troponin I slow (TnIs) and fast (TnIf) regulatory sequences by directly stimulating denervated muscles with pattern that mimic fast and slow motor units. Rat soleus muscles were electroporated with green fluorescent protein (GFP) reporter constructs harbouring 2.7 and 2.1 kb of TnIs and TnIf regulatory sequences, respectively. One week later, electrodes were implanted and muscles stimulated for 12 days. The change in GFP fluorescence of individual muscle fibres before and after the stimulation was used as a measure for transcriptional responses to different patterns of action potentials. Our results indicate that the response of TnI promoter sequences to electrical stimulation is consistent with the regulation of the endogenous genes. The TnIf and TnIs enhancers were activated by matching fast and slow activity patterns, respectively. Removal of nerve-evoked activity by denervation, or stimulation with a mismatching pattern reduced transcriptional activity of both enhancers. These results strongly suggest that distinct signalling pathways couple both fast and slow patterns of activity to enhancers that regulate transcription from the fast and slow troponin I isoforms. PMID:15528243

  12. Transgenic expression of medicago truncatula PR10 and PR5 promoters in alfalfa shows pathogen-induced up-regulation of transgene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic modification of alfalfa to introduce novel traits requires promoters for controlling gene expression. Promoters that are constitutively activated for expression of genes that enhance disease resistance pose a great energy load on the plant and exert a strong selective pressure on the pathoge...

  13. Binding of NF-kappaB p65 subunit to the promoter elements is involved in LPS-induced transactivation of miRNA genes in human biliary epithelial cells

    PubMed Central

    Zhou, Rui; Hu, Guoku; Gong, Ai-Yu; Chen, Xian-Ming

    2010-01-01

    The majority of human miRNA genes is transcribed by polymerase II and can be classified as class II genes similar to protein-coding genes. Whereas current research on miRNAs has focused on the physiological and pathological functions, the molecular mechanisms underlying their transcriptional regulation are largely unknown. We recently reported that lipopolysaccharide (LPS) alters mature miRNA expression profile in human biliary epithelial cells. In this study, we tested the role of transcription factor NF-κB in LPS-induced transcription of select miRNA genes. Of the majority of LPS-up-regulated mature miRNAs in cultured human biliary epithelial cells, potential NF-κB binding sites were identified in the putative promoter elements of their corresponding genes. Inhibition of NF-κB activation by SC-514, an IKK2 inhibitor, blocked LPS-induced up-regulation of a subset of pri-miRNAs, including pri-miR-17-92, pri-miR-125b-1, pri-miR-21, pri-miR-23b-27b-24-1, pri-miR-30b, pri-miR-130a and pri-miR-29a. Moreover, direct binding of NF-κB p65 subunit to the promoter elements of mir-17-92, mir-125b-1, mir-21, mir-23b-27b-24-1, mir-30b and mir-130a genes was identified by chromatin immunoprecipitation analysis and confirmed by the luciferase reporter assay. Thus, a subset of miRNA genes is regulated in human biliary epithelial cells through NF-κB activation induced by LPS, suggesting a role of the NF-κB pathway in the transcriptional regulation of miRNA genes. PMID:20144951

  14. DNA element downstream of the κB site in the Lcn2 promoter is required for transcriptional activation by IκBζ and NF-κB p50.

    PubMed

    Kohda, Akira; Yamazaki, Soh; Sumimoto, Hideki

    2014-08-01

    The nuclear protein IκBζ activates transcription of a subset of NF-κB-dependent innate immune genes such as Lcn2 encoding the antibacterial protein lipocalin-2. IκBζ functions as a coactivator via its interaction with NF-κB p50, which contains a DNA-binding Rel-homology domain but lacks a transcriptional activation domain. However cis-regulatory elements involved in IκBζ function have remained unknown. Here, we show that, although IκBζ by itself is unable to associate with the Lcn2 promoter, IκBζ interacts with the promoter via p50 binding to the NF-κB-binding site (κB site) and the interaction also requires the pyrimidine-rich site (CCCCTC) that localizes seven bases downstream of the κB site. The pyrimidine-rich site is also essential for IκBζ-mediated activation of the Lcn2 gene. Introduction of both sites into an IκBζ-independent gene culminates in IκBζ-p50-DNA complex formation and transcriptional activation. Furthermore, spacing between the two sites is crucial for both IκBζ-DNA interaction and IκBζ-mediated gene activation. Thus, the pyrimidine-rich IκBζ-responsive site plays an essential role in productive interaction of IκBζ with the p50-DNA complex.

  15. Analyses of Ca2+ dynamics using a ubiquitin-10 promoter-driven Yellow Cameleon 3.6 indicator reveal reliable transgene expression and differences in cytoplasmic Ca2+ responses in Arabidopsis and rice (Oryza sativa) roots.

    PubMed

    Behera, Smrutisanjita; Wang, Nili; Zhang, Chunxia; Schmitz-Thom, Ina; Strohkamp, Sarah; Schültke, Stefanie; Hashimoto, Kenji; Xiong, Lizhong; Kudla, Jörg

    2015-04-01

    Ca(2+) signatures are central to developmental processes and adaptive responses in plants. However, high-resolution studies of Ca(2+) dynamics using genetically encoded Ca(2+) indicators (GECIs) such as Yellow Cameleon (YC) proteins have so far not been conducted in important model crops such as rice (Oryza sativa). We conducted a comparative study of 35S and ubiquitin-10 (UBQ10) promoter functionality in Arabidopsis thaliana and O. sativa plants expressing the Ca(2+) indicator Yellow Cameleon 3.6 (YC3.6) under control of the UBQ10 or 35S promoter. Ca(2+) signatures in roots of both species were analyzed during exposure to hyperpolarization/depolarization cycles or in response to application of the amino acid glutamate. We found a superior performance of the UBQ10 promoter with regard to expression pattern, levels and expression stabilities in both species. We observed remarkable differences between the two species in the spatiotemporal parameters of the observed Ca(2+) signatures. Rice appeared in general to respond with a lower maximal signal amplitude but greatly increased signal duration when compared with Arabidopsis. Our results identify important advantages to using the UBQ10 promoter in Arabidopsis and rice and in T-DNA mutant backgrounds. Moreover, the observed differences in Ca(2+) signaling in the two species underscore the need for comparative studies to achieve a comprehensive understanding of Ca(2+) signaling in plants.

  16. Porcine circovirus type 2 activates PI3K/Akt and p38 MAPK pathways to promote interleukin-10 production in macrophages via Cap interaction of gC1qR

    PubMed Central

    Wang, Tongtong; Zhang, Xiujuan; Chen, Yu; Cui, Beibei; Li, Delong; Zhao, Xiaomin; Zhang, Wenlong; Chang, Lingling; Tong, Dewen

    2016-01-01

    Porcine circovirus type 2 (PCV2) infection caused PCV2-associated diseases (PCVAD) is one of the major emerging immunosuppression diseases in pig industry. In this study, we investigated how PCV2 inoculation increases interleukin (IL)-10 expression in porcine alveolar macrophages (PAMs). PCV2 inoculation significantly upregulated IL-10 expression compared with PCV1. Upon initial PCV2 inoculation, PI3K/Akt cooperated with NF-κB pathways to promote IL-10 transcription via p50, CREB and Ap1 transcription factors, whereas inhibition of PI3K/Akt activation blocked Ap1 and CREB binding to the il10 promoter, and decreased the binding level of NF-κB1 p50 with il10 promoter, leading to great reduction in early IL-10 transcription. In the later phase of inoculation, PCV2 further activated p38 MAPK and ERK pathways to enhance IL-10 production by promoting Sp1 binding to the il10 promoter. For PCV2-induced IL-10 production in macrophages, PCV2 capsid protein Cap, but not the replicase Rep or ORF3, was the critical component. Cap activated PI3K/Akt, p38 MAPK, and ERK signaling pathways to enhance IL-10 expression. In the whole process, gC1qR mediated PCV2-induced PI3K/Akt and p38 MAPK activation to enhance IL-10 induction by interaction with Cap. Depletion of gC1qR blocked PI3K/Akt and p38 MAPK activation, resulting in significant decrease in IL-10 production in PCV2-inoculated cells. Thus, gC1qR might be a critical functional receptor for PCV2-induced IL-10 production. Taken together, these data demonstrated that Cap protein binding with host gC1qR induction of PI3K/Akt and p38 MAPK signalings activation is a critical process in enhancing PCV2-induced IL-10 production in porcine alveolar macrophages. PMID:26883107

  17. Porcine circovirus type 2 activates PI3K/Akt and p38 MAPK pathways to promote interleukin-10 production in macrophages via Cap interaction of gC1qR.

    PubMed

    Du, Qian; Huang, Yong; Wang, Tongtong; Zhang, Xiujuan; Chen, Yu; Cui, Beibei; Li, Delong; Zhao, Xiaomin; Zhang, Wenlong; Chang, Lingling; Tong, Dewen

    2016-04-01

    Porcine circovirus type 2 (PCV2) infection caused PCV2-associated diseases (PCVAD) is one of the major emerging immunosuppression diseases in pig industry. In this study, we investigated how PCV2 inoculation increases interleukin (IL)-10 expression in porcine alveolar macrophages (PAMs). PCV2 inoculation significantly upregulated IL-10 expression compared with PCV1. Upon initial PCV2 inoculation, PI3K/Akt cooperated with NF-κB pathways to promote IL-10 transcription via p50, CREB and Ap1 transcription factors, whereas inhibition of PI3K/Akt activation blocked Ap1 and CREB binding to the il10 promoter, and decreased the binding level of NF-κB1 p50 with il10 promoter, leading to great reduction in early IL-10 transcription. In the later phase of inoculation, PCV2 further activated p38 MAPK and ERK pathways to enhance IL-10 production by promoting Sp1 binding to the il10 promoter. For PCV2-induced IL-10 production in macrophages, PCV2 capsid protein Cap, but not the replicase Rep or ORF3, was the critical component. Cap activated PI3K/Akt, p38 MAPK, and ERK signaling pathways to enhance IL-10 expression. In the whole process, gC1qR mediated PCV2-induced PI3K/Akt and p38 MAPK activation to enhance IL-10 induction by interaction with Cap. Depletion of gC1qR blocked PI3K/Akt and p38 MAPK activation, resulting in significant decrease in IL-10 production in PCV2-inoculated cells. Thus, gC1qR might be a critical functional receptor for PCV2-induced IL-10 production. Taken together, these data demonstrated that Cap protein binding with host gC1qR induction of PI3K/Akt and p38 MAPK signalings activation is a critical process in enhancing PCV2-induced IL-10 production in porcine alveolar macrophages. PMID:26883107

  18. Evidence that the Dictyostelium STAT protein Dd-STATa plays a role in the differentiation of inner basal disc cells and identification of a promoter element essential for expression in these cells.

    PubMed

    Shimada, Nao; Maruo, Toshinari; Maeda, Mineko; Urushihara, Hideko; Kawata, Takefumi

    2005-02-01

    Dd-STATa, a Dictyostelium homolog of the metazoan STAT (signal transducers and activators of transcription) proteins, is necessary in the slug for correct entry into culmination. Dd-STATa-null mutant fails to culminate and its phenotype correlates with the loss of a funnel-shaped core region, the pstAB core region, which expresses both the ecmA and ecmB genes. To understand how the differentiation of pstAB core cells is regulated, we identified an EST that is expressed in the core cells of normal slugs but down-regulated in the Dd-STATa-null mutant. This EST, SSK348, encodes a close homolog of the Dictyostelium acetyl-CoA synthetase (ACS). A promoter fragment of the cognate gene, aslA (acetyl-CoA synthetase-like A), was fused to a lacZ reporter and the expression pattern determined. As expected from the behavior of the endogenous aslA gene, the aslA::lacZ fusion gene is not expressed in Dd-STATa-null slugs. In parental cells, the aslA promoter is first activated in the funnel-shaped core cells located at the slug anterior, the "pstAB core." During culmination, the pstAB core cells move down, through the prespore cells, to form the inner part of the basal disc. As the spore mass climbs the stalk, the aslA gene comes to be expressed in cells of the upper and lower cups, structures that cradle the spore head. Deletion and point mutation analyses of the promoter identified an AT-rich sequence that is necessary for expression in the pstAB core. This acts in combination with repressor regions that prevent ectopic aslA expression in the pre-stalk regions of slugs and the stalks of culminants. Thus, this study confirms that Dd-STATa is necessary for the differentiation of pstAB core cells, by showing that it is needed for the activation of the aslA gene. It also identifies aslA promoter elements that are likely to be regulated, directly or indirectly, by Dd-STATa.

  19. High-level expression of a sweet potato sporamin gene promoter: beta-glucuronidase (GUS) fusion gene in the stems of transgenic tobacco plants is conferred by multiple cell type-specific regulatory elements.

    PubMed

    Ohta, S; Hattori, T; Morikami, A; Nakamura, K

    1991-03-01

    Genes coding for sporamin, the most abundant protein of the tuberous root of the sweet potato, are expressed at a high levels in the stems of plantlets cultured axenically on sucrose-containing medium. Their expression is also induced in leaf-petiole explants by high concentrations of sucrose. A fusion gene comprising of the 1 kb 5' upstream region of the gSPO-A1 gene coding for the A-type sporamin and the coding sequence of bacterial beta-glucuronidase (GUS) was introduced into the tobacco genome by Agrobacterium-mediated transformation. Transgenic tobacco plants cultured axenically on sucrose-containing medium expressed GUS activity predominantly in their stems. Histochemical examination of GUS activity using a chromogenic substrate showed a distinct spatial pattern of GUS staining in the stem. Strong GUS activity was detected in the internal phloem of the vascular system and at the node, especially at the base of the axillary bud. Relatively weaker GUS activity was also detected in pith parenchyma. A 5' deletion of the promoter to nucleotide -305, relative to the transcription start site, did not alter significantly the level of GUS activity or the spatial pattern of GUS staining in the stem. However, further deletions to -237 and -192 resulted in a decrease in the level of GUS activity in the stem that occurred simultaneously with the loss of GUS staining in both the internal phloem and at the base of the axillary bud. However, plants with these deletion constructs still exhibited the predominant expression pattern of GUS activity in the stem and GUS staining in the pith parenchyma cells. Deletion to -94 completely abolished the expression of GUS activity. These results indicate that a sequence between -305 and -237 contains a cis-regulatory element(s) that is required for expression of the GUS reporter gene in both the internal phloem and at the base of the axillary bud, while a sequence between -192 and -94 contains a cis-acting element(s) that is required

  20. Radical and Non-Radical States of the [Os(PIQ)] Core (PIQ = 9,10-Phenanthreneiminoquinone): Iminosemiquinone to Iminoquinone Conversion Promoted o-Metalation Reaction.

    PubMed

    Bera, Sachinath; Mondal, Sandip; Maity, Suvendu; Weyhermüller, Thomas; Ghosh, Prasanta

    2016-05-16

    The coordination and redox chemistry of 9,10-phenanthreneiminoquinone (PIQ) with osmium ion authenticating the [Os(II)(PIQ(•-))], [Os(III)(PIQ(•-))], [Os(III)(C,N-PIQ)], [Os(III)(PIQ)], and [Os(III)(PIQ(2-)) ] states of the [Os(PIQ)] core in the complexes of types trans-[Os(II)(PIQ(•-))(PPh3)2(CO)Br] (1), trans-[Os(III)(PIQ(•-))(PPh3)2Br2] (2), trans-[Os(III)(C,N-PIQ)(PPh3)2Br2]·2CH2Cl2 (3·2CH2Cl2), trans-[Os(III)(C,N-PIQ(Br))(PPh3)2Br2]·2CH2Cl2 (4·2CH2Cl2), trans-[Os(III)(C,N-PIQ(Cl2))(PPh3)2Br2] (6), trans-[Os(III)(PIQ(•-))(PPh3)2Br2](+)1/2I3(-)1/2Br(-) (1(+)1/2I3(-)1/2Br(-)), [Os(III)(PIQ)(PPh3)2Br2](+) (2(+)), and [Os(III)(PIQ(2-))(PPh3)2Br2](-) (2(-)) are reported (PIQ(•-) = 9,10-phenanthreneiminosemiquinonate anion radical; C,N-PIQ = ortho-metalated PIQ, C,N-PIQ(Br) = ortho-metalated 4-bromo PIQ, and C,N-PIQ(Cl2) = ortho-metalated 3,4-dichloro PIQ). Reduction of PIQ by [Os(II)(PPh3)3(H)(CO)Br] affords 1, while the reaction of PIQ with [Os(II)(PPh3)3Br2] furnishes 2. Oxidation of 1 with I2 affords 1(+)1/2I3(-)1/2Br(-), while the similar reactions of 2 with X2 (X = I, Br, Cl) produce the ortho-metalated derivatives 3·2CH2Cl2, 4·2CH2Cl2, and 6. PIQ and PIQ(2-) complexes of osmium(III), 2(+) and 2(-), are generated by constant-potential electrolysis. However, 2(+) ion is unstable in solution and slowly converts to 3 and partially hydrolyzes to trans-[Os(III)(PQ(•-))(PPh3)2Br2] (2PQ), a PQ(•-) analogue of 2. Conversion of 2(+) → 3 in solution excludes the formation of aryl halide as an intermediate for this unique ortho-metalation reaction at 295 K, where PIQ acts as a redox-noninnocent ambidentate ligand. In the complexes, the PIQ(•-) state where the atomic spin is more localized on the nitrogen atom is stable and is more abundant. The reaction of 2PQ, with I2 does not promote any ortho-metalation reaction and yields a PQ complex of type trans-[Os(III)(PQ)(PPh3)2Br2](+)I5(-)·2CH2Cl2 (5(+)I5(-)·2CH2Cl2). The molecular and electronic

  1. o,p'-DDT induces cyclooxygenase-2 gene expression in murine macrophages: Role of AP-1 and CRE promoter elements and PI3-kinase/Akt/MAPK signaling pathways

    SciTech Connect

    Han, Eun Hee; Kim, Ji Young; Kim, Hyung-Kyun; Hwang, Yong Pil; Jeong, Hye Gwang

    2008-12-01

    Dichlorodiphenyltrichloroethane (DDT) has been used as an insecticide to prevent the devastation of malaria in tropical zones. However, many reports suggest that DDT may act as an endocrine disruptor and may have possible carcinogenic effects. Cyclooxygenase-2 (COX-2) acts as a link between inflammation and carcinogenesis through its involvement in tumor promotion. In the present study, we examined the effect of o,p'-DDT on COX-2 gene expression and analyzed the molecular mechanism of its activity in murine RAW 264.7 macrophages. Exposure to o,p'-DDT markedly enhanced the production of prostaglandin E{sub 2} (PGE{sub 2}), a major COX-2 metabolite, in murine macrophages. Furthermore, o,p'-DDT dose-dependently increased the levels of COX-2 protein and mRNA. Transfection with human COX-2 promoter construct, electrophoretic mobility shift assays and DNA-affinity protein-binding assay experiments revealed that o,p'-DDT activated the activator protein 1 (AP-1) and cyclic AMP response element (CRE) sites, but not the NF-{kappa}B site. Phosphatidylinositol 3 (PI3)-kinase, its downstream signaling molecule, Akt, and mitogen-activated protein kinases (MAPK) were also significantly activated by the o,p'-DDT-induced AP-1 and CRE activation. These results demonstrate that o,p'-DDT induced COX-2 expression via AP-1 and CRE activation through the PI3-K/Akt/ERK, JNK, and p38 MAP kinase pathways. These findings provide further insight into the signal transduction pathways involved in the carcinogenic effects of o,p'-DDT.

  2. Androgens Up-regulate Transcription of the Notch Inhibitor Numb in C2C12 Myoblasts via Wnt/β-Catenin Signaling to T Cell Factor Elements in the Numb Promoter*

    PubMed Central

    Liu, Xin-Hua; Wu, Yong; Yao, Shen; Levine, Alice C.; Kirschenbaum, Alexander; Collier, Lauren; Bauman, William A.; Cardozo, Christopher P.

    2013-01-01

    Androgen signaling via the androgen receptor is a key pathway that contributes to development, cell fate decisions, and differentiation, including that of myogenic progenitors. Androgens and synthetic steroids have well established anabolic actions on skeletal muscle. Wnt and Notch signaling pathways are also essential to myogenic cell fate decisions during development and tissue repair. However, the interactions among these pathways are largely unknown. Androgenic regulation of Wnt signaling has been reported. Nandrolone, an anabolic steroid, has been shown to inhibit Notch signaling and up-regulate Numb, a Notch inhibitor. To elucidate the mechanisms of interaction between nandrolone and Wnt/Notch signaling, we investigated the effects of nandrolone on Numb expression and Wnt signaling and determined the roles of Wnt signaling in nandrolone-induced Numb expression in C2C12 myoblasts. Nandrolone increased Numb mRNA and protein levels and T cell factor (Tcf) transcriptional activity via inhibition of glycogen synthase kinase 3β. Up-regulation of Numb expression by nandrolone was blocked by the Wnt inhibitors, sFRP1 and DKK1, whereas Wnt3a increased Numb mRNA and protein expression. In addition, we observed that the proximal promoter of the Numb gene had functional Tcf binding elements to which β-catenin was recruited in a manner enhanced by both nandrolone and Wnt3a. Moreover, site-directed mutagenesis indicated that the Tcf binding sites in the Numb promoter are required for the nandrolone-induced Numb transcriptional activation in this cell line. These results reveal a novel molecular mechanism underlying up-regulation of Numb transcription with a critical role for increased canonical Wnt signaling. In addition, the data identify Numb as a novel target gene of the Wnt signaling pathway by which Wnts would be able to inhibit Notch signaling. PMID:23649620

  3. Insulin induces a transcriptional activation of epiregulin, HB-EGF and amphiregulin, by a PI3K-dependent mechanism: Identification of a specific insulin-responsive promoter element

    SciTech Connect

    Ornskov, Dorthe; Nexo, Ebba; Sorensen, Boe S. . E-mail: boess@as.aaa.dk

    2007-03-23

    Previously we have shown that insulin-stimulation of RT4 bladder cancer cells leads to increased proliferation, which require HER1 activation, and is accompanied by increased mRNA expression of the EGF-ligands heparin-binding EGF-like growth factor (HB-EGF), amphiregulin (AR), and epiregulin (EPI) [D. Ornskov, E. Nexo, B.S. Sorensen, Insulin-induced proliferation of bladder cancer cells is mediated through activation of the epidermal growth factor system, FEBS J. 273 (2006) 5479-5489]. In the present paper, we have investigated the molecular mechanism leading to this insulin-induced expression. We monitored the decay of mRNA after inhibiting transcription with Actinomycin D and demonstrated that the insulin-mediated increase was not caused by enhanced mRNA stability. In untreated cells, HB-EGF mRNA was the least stable, whereas AR and EPI mRNA decayed with slower kinetics. However, promoter analysis of HB-EGF and EPI demonstrated that insulin stimulated transcription. Studies on the EPI promoter identified the insulin-responsive element to be located in the region -564 to -365 bp. This region contains potential binding sites for the transcription factors SP1, AP1, and NF-{kappa}B. Interestingly, all three transcription factors can be activated by PI3K. We demonstrate that the insulin-induced expression of HB-EGF, AR, and EPI mRNA is completely prevented by the specific PI3K inhibitor Wortmannin, suggesting an involvement of the PI3K.

  4. Promoting Positive Learning in Australian Students Aged 10- to 12-Years-Old Using Attribution Retraining and Cognitive Behavioral Therapy: A Pilot Study

    ERIC Educational Resources Information Center

    Chodkiewicz, Alicia R; Boyle, Christopher

    2016-01-01

    This study piloted an intervention using attribution retraining and cognitive behavioral therapy techniques to promote positive learning experiences and outcomes for students. This research is an important step to revitalise the dwindling field of attribution retraining research by assessing whether these techniques effectively improve student…

  5. Activation of EGFR promotes squamous carcinoma SCC10A cell migration and invasion via inducing EMT-like phenotype change and MMP-9-mediated degradation of E-cadherin.

    PubMed

    Zuo, Jian-Hong; Zhu, Wei; Li, Mao-Yu; Li, Xin-Hui; Yi, Hong; Zeng, Gu-Qing; Wan, Xun-Xun; He, Qiu-Yan; Li, Jian-Huang; Qu, Jia-Quan; Chen, Yu; Xiao, Zhi-Qiang

    2011-09-01

    EGFR is a potent stimulator of invasion and metastasis in head and neck squamous cell carcinomas (HNSCC). However, the mechanism by which EGFR may stimulate tumor cell invasion and metastasis still need to be elucidated. In this study, we showed that activation of EGFR by EGF in HNSCC cell line SCC10A enhanced cell migration and invasion, and induced loss of epitheloid phenotype in parallel with downregulation of E-cadherin and upregulation of N-cadherin and vimentin, indicating that EGFR promoted SCC10A cell migration and invasion possibly by an epithelial to mesenchymal transition (EMT)-like phenotype change. Interestingly, activation of EGFR by EGF induced production of matrix metalloproteinase-9 (MMP-9) and soluble E-cadherin (sE-cad), and knockdown of MMP-9 by siRNA inhibited sE-cad production induced by EGF in SCC10A. Moreover, both MMP-9 knockdown and E-cadherin overexpression inhibited cell migration and invasion induced by EGF in SCC10A. The results indicate that EGFR activation promoted cell migration and invasion through inducing MMP-9-mediated degradation of E-cadherin into sE-cad. Pharmacologic inhibition of EGFR, MEK, and PI3K kinase activity in SCC10A reduced phosphorylated levels of ERK-1/2 and AKT, production of MMP-9 and sE-cad, cell migration and invasion, and expressional changes of EMT markers (E-cadherin and N-cadherin) induced by EGF, indicating that EGFR activation promotes cell migration and invasion via ERK-1/2 and PI3K-regulated MMP-9/E-cadherin signaling pathways. Taken together, the data suggest that EGFR activation promotes HNSCC SCC10A cell migration and invasion by inducing EMT-like phenotype change and MMP-9-mediated degradation of E-cadherin into sE-cad related to activation of ERK-1/2 and PI3K signaling pathways.

  6. Study of the chemical elements and polycyclic aromatic hydrocarbons in atmospheric particles of PM 10 and PM 2.5 in the urban and rural areas of South Brazil

    NASA Astrophysics Data System (ADS)

    Dallarosa, Juliana; Calesso Teixeira, Elba; Meira, Lindolfo; Wiegand, Flavio

    2008-07-01

    The purpose of this work is to study the chemical elements and PAHs associated with atmospheric particulate in samples of PM 10 collected in the Metropolitan Area of Porto Alegre—MAPA, Rio Grande do Sul, Brazil. In addition, to study the chemical elements associated with particles of different fractions of PM 10-2.5 and PM 2.5 using dichotomous sampling, in urban (MAPA) and rural areas. Two types of samplers were used: HV PM 10 and Dichotomous (PM 10-2.5 and PM 2.5). Samples were collected during 2002 and 2005. The concentration of the elements Si, S, Cl, K, Ca, Ti, V, Cr, Mn, Fe, Ni, Cu, and Zn was determined by PIXE (Particle-Induced X-ray Emission), while the concentrations of 16 major PAHs were determined according to EPA with a gas chromatograph coupled to a mass spectrometer (GS/MS). Results showed that elements of anthropogenic origin (V, Zn, Cr, Ni, Cu, and S) were mainly associated with the fraction PM 2.5, while the soil dust (Si, Al, Ti and Fe) were found mainly on fraction PM 10-2.5. In samples of PM 10, the most frequent PAHs found were Bgp, Flt, BaA, Chr, B(b + k)F, BaP and Dba. The types of emission and their association with the atmospheric parameters were studied applying the statistical analysis of the principal component method. The main sources found in the area under study were vehicles, industries (steel mills and a coal-fired power station), dust, sea breeze, and burning.

  7. It's elemental

    NASA Astrophysics Data System (ADS)

    The Periodic Table of the elements will now have to be updated. An international team of researchers has added element 110 to the Earth's armory of elements. Though short-lived—of the order of microseconds, element 110 bottoms out the list as the heaviest known element on the planet. Scientists at the Heavy Ion Research Center in Darmstadt, Germany, made the 110-proton element by colliding a lead isotope with nickel atoms. The element, which is yet to be named, has an atomic mass of 269.

  8. TamiR1123 originated from a family of miniature inverted-repeat transposable elements (MITE) including one inserted in the Vrn-A1a promoter in wheat.

    PubMed

    Yu, Ming; Carver, Brett F; Yan, Liuling

    2014-02-01

    More than half of spring wheat cultivars have a dominant Vrn-A1a allele that has an insertion of a miniature inverted-repeat transposable element (MITE) in its promoter. In this study, we found that the MITE present in the Vrn-A1a gene (MITE_VRN) is a nearly perfect palindrome and it can form highly stable hairpin loops when expressed as RNA. MITE_VRN also possessed sequences of a microRNA in Triticum aestivum (TamiR1123). The P(32) labeled TamiR1123 probe detected two RNA molecules on a small RNA gel blot, one expected for MITE_VRN, and the other expected for TamiR1123. These results demonstrated that MITE_VRN was expressed as RNAs and TamiR1123 was originated from the MITE_VRN family. The isogenic line TDD carrying the dominant Vrn-A1a allele with MITE_VRN showed higher TamiR1123 and Vrn-A1a transcript levels than the isogenic line TDE carrying the recessive vrn-A1a allele without MITE_VRN. TamiR1123 were greatly up-regulated by plant age but slightly down-regulated by low temperature and short days. These findings have pointed to alternative regulatory mechanisms for plant development governed by Vrn-A1a in spring wheat.

  9. Homologues of sox8 and sox10 in the orange-spotted grouper Epinephelus coioides: sequences, expression patterns, and their effects on cyp19a1a promoter activities in vitro.

    PubMed

    Liu, Qiongyou; Lu, Huijie; Zhang, Lihong; Xie, Jun; Shen, Wenying; Zhang, Weimin

    2012-09-01

    Sox8 and Sox10 are members of group E Sox proteins involved in a wide range of developmental processes including sex determination and neurogenesis in vertebrates. The orange-spotted grouper sox8a and sox10a homologues were isolated and characterized in the present study. Both sox8a and sox10a genes contain three exons and two introns, and encode putative proteins with typical structures of group E Sox. Sox8a was expressed in diverse tissues including the central nervous system and some peripheral tissues. In contrast, sox10a mRNA was detected primarily in the central nervous system. During embryogenesis, sox8a mRNA seemed to be de novo synthesized in the embryos from otic vesicle stage. However, sox10a mRNA was only detectable in juvenile fish 35 days post hatching and thereafter. The mRNA levels of sox8a in the gonads were not significantly different among ovarian developmental stages but increased in the testis. In vitro transfection assays showed that the Sox10a but not Sox8a up-regulated cyp19a1a promoter activities. Taken together, these results suggested that the sox8a may play roles in diverse tissues and during embryogenesis, whereas sox10a may be mainly involved in the neural regulation of juvenile and adult fish, and that certain Sox homologues may regulate the orange-spotted grouper cyp19a1a promoter.

  10. Senescence responsive transcriptional element

    DOEpatents

    Campisi, Judith; Testori, Alessandro

    1999-01-01

    Recombinant polynucleotides have expression control sequences that have a senescence responsive element and a minimal promoter, and which are operatively linked to a heterologous nucleotide sequence. The molecules are useful for achieving high levels of expression of genes in senescent cells. Methods of inhibiting expression of genes in senescent cells also are provided.

  11. Senescence responsive transcriptional element

    SciTech Connect

    Campisi, J.; Testori, A.

    1999-10-12

    Recombinant polynucleotides have expression control sequences that have a senescence responsive element and a minimal promoter, and which are operatively linked to a heterologous nucleotide sequence. The molecules are useful for achieving high levels of expression of genes in senescent cells. Methods of inhibiting expression of genes in senescent cells also are provided.

  12. Production of IL-10 by CD4+ regulatory T cells during the resolution of infection promotes the maturation of memory CD8+ T cells

    PubMed Central

    Laidlaw, Brian J; Cui, Weiguo; Amezquita, Robert A; Gray, Simon M; Guan, Tianxia; Lu, Yisi; Kobayashi, Yasushi; Flavell, Richard A; Kleinstein, Steven H; Craft, Joe; Kaech, Susan M

    2016-01-01

    Memory CD8+ T cells are critical for host defense upon reexposure to intracellular pathogens. We found that interleukin 10 (IL-10) derived from CD4+ regulatory T cells (Treg cells) was necessary for the maturation of memory CD8+ T cells following acute infection with lymphocytic choriomeningitis virus (LCMV). Treg cell–derived IL-10 was most important during the resolution phase, calming inflammation and the activation state of dendritic cells. Adoptive transfer of IL-10-sufficient Treg cells during the resolution phase ‘restored’ the maturation of memory CD8+ T cells in IL-10-deficient mice. Our data indicate that Treg cell–derived IL-10 is needed to insulate CD8+ T cells from inflammatory signals, and reveal that the resolution phase of infection is a critical period that influences the quality and function of developing memory CD8+ T cells. PMID:26147684

  13. Variable production windows for porcine trypsinogen employing synthetic inducible promoter variants in Pichia pastoris.

    PubMed

    Ruth, C; Zuellig, T; Mellitzer, A; Weis, R; Looser, V; Kovar, K; Glieder, A

    2010-09-01

    Natural tools for recombinant protein production show technological limitations. Available natural promoters for gene expression in Pichia pastoris are either constitutive, weak or require the use of undesirable substances or procedures for induction. Here we show the application of deletion variants based on the well known methanol inducible AOX1 promoter and small synthetic promoters, where cis-acting elements were fused to core promoter fragments. They enable differently regulated target protein expression and at the same time to replace methanol induction by a glucose or glycerol feeding strategy. Trypsinogen, the precursor of the serine protease trypsin, was expressed using these different promoters. Depending on the applied promoter the production window (i.e. the time of increasing product concentration) changed significantly. In fedbatch processes trypsinogen yields before induction with methanol were up to 10 times higher if variants of the AOX1 promoter were applied. In addition, the starting point of autoproteolytic product degradation can be predetermined by the promoter choice.

  14. TIS10, a phorbol ester tumor promoter-inducible mRNA from Swiss 3T3 cells, encodes a novel prostaglandin synthase/cyclooxygenase homologue.

    PubMed

    Kujubu, D A; Fletcher, B S; Varnum, B C; Lim, R W; Herschman, H R

    1991-07-15

    TIS10 is a primary response gene whose cDNA was cloned as a result of its rapid, superinducible expression in Swiss 3T3 cells in response to 12-O-Tetradecanoylphorbol-13-acetate. The 5'-untranslated region of the 3.9-kilobase TIS10 message contains only 124 nucleotides, whereas the 3'-untranslated region is almost 2 kilobases in length. Within this long 3' region, there are multiple repeats of the sequence ATTTA, a sequence often present in rapidly degraded mRNA species. Primer extension revealed that the TIS10 cDNA begins 16 base pairs downstream of the transcription start site for the TIS10 gene. The TIS10 cDNA encodes a predicted protein of 604 amino acids. A computer search identified striking similarities between the predicted TIS10 protein product and the murine, sheep, and human prostaglandin synthase/cyclooxygenase proteins. The TIS10 protein has many of the same conserved amino acids that are thought to be important for cyclooxygenase function. TIS10 mRNA is undetectable by Northern analysis in quiescent 3T3 cells. The TIS10 gene is rapidly and transiently induced by forskolin and serum, as well as by 12-O-tetradecanoylphorbol-13-acetate, in Swiss 3T3 cells. These agents elicit far more dramatic changes in TIS10 mRNA levels than in cyclooxygenase mRNA levels. The expression of the TIS10 gene appears to be highly cell type-restricted in cultured cell lines; of 12 cell lines tested under superinducing conditions, only the rodent embryonic Swiss 3T3 and Rat1 cell lines expressed TIS10 gene.

  15. Rn3D: A finite element code for simulating gas flow and radon transport in variably saturated, nonisothermal porous media. User`s manual, Version 1.0

    SciTech Connect

    Holford, D.J.

    1994-01-01

    This document is a user`s manual for the Rn3D finite element code. Rn3D was developed to simulate gas flow and radon transport in variably saturated, nonisothermal porous media. The Rn3D model is applicable to a wide range of problems involving radon transport in soil because it can simulate either steady-state or transient flow and transport in one-, two- or three-dimensions (including radially symmetric two-dimensional problems). The porous materials may be heterogeneous and anisotropic. This manual describes all pertinent mathematics related to the governing, boundary, and constitutive equations of the model, as well as the development of the finite element equations used in the code. Instructions are given for constructing Rn3D input files and executing the code, as well as a description of all output files generated by the code. Five verification problems are given that test various aspects of code operation, complete with example input files, FORTRAN programs for the respective analytical solutions, and plots of model results. An example simulation is presented to illustrate the type of problem Rn3D is designed to solve. Finally, instructions are given on how to convert Rn3D to simulate systems other than radon, air, and water.

  16. Sensitivity and uncertainty in the measurement of H*(10) in neutron fields using an REM500 and a multi-element TEPC.

    PubMed

    Waker, Anthony; Taylor, Graeme

    2014-10-01

    The REM500 is a commercial instrument based on a tissue-equivalent proportional counter (TEPC) that has been successfully deployed as a hand-held neutron monitor, although its sensitivity is regarded by some workers as low for nuclear power plant radiation protection work. Improvements in sensitivity can be obtained using a multi-element proportional counter design in which a large number of small detecting cavities replace the single large volume cavity of conventional TEPCs. In this work, the authors quantify the improvement in uncertainty that can be obtained by comparing the ambient dose equivalent measured with a REM500, which utilises a 5.72 cm (2(1/4) inch) diameter Rossi counter, with that of a multi-element TEPC designed to have the sensitivity of a 12.7 cm (5 inch) spherical TEPC. The results obtained also provide some insight into the influence of other design features of TEPCs, such as geometry and gas filling, on the measurement of ambient dose equivalent.

  17. Light-element Nucleosynthesis in a Molecular Cloud Interacting with a Supernova Remnant and the Origin of Beryllium-10 in the Protosolar Nebula

    NASA Astrophysics Data System (ADS)

    Tatischeff, Vincent; Duprat, Jean; de Séréville, Nicolas

    2014-12-01

    The presence of short-lived radionuclides (t 1/2 < 10 Myr) in the early solar system provides important information about the astrophysical environment in which the solar system formed. The discovery of now extinct 10Be (t 1/2 = 1.4 Myr) in calcium-aluminum-rich inclusions (CAIs) with Fractionation and Unidentified Nuclear isotope anomalies (FUN-CAIs) suggests that a baseline concentration of 10Be in the early solar system was inherited from the protosolar molecular cloud. In this paper, we investigate various astrophysical contexts for the nonthermal nucleosynthesis of 10Be by cosmic-ray-induced reactions. We first show that the 10Be recorded in FUN-CAIs cannot have been produced in situ by irradiation of the FUN-CAIs themselves. We then show that trapping of Galactic cosmic rays (GCRs) in the collapsing presolar cloud core induced a negligible 10Be contamination of the protosolar nebula, the inferred 10Be/9Be ratio being at least 40 times lower than that recorded in FUN-CAIs (10Be/9Be ~ 3 × 10-4). Irradiation of the presolar molecular cloud by background GCRs produced a steady-state 10Be/9Be ratio <~ 1.3 × 10-4 at the time of the solar system formation, which suggests that the presolar cloud was irradiated by an additional source of CRs. Considering a detailed model for CR acceleration in a supernova remnant (SNR), we find that the 10Be abundance recorded in FUN-CAIs can be explained within two alternative scenarios: (1) the irradiation of a giant molecular cloud by CRs produced by >~ 50 supernovae exploding in a superbubble of hot gas generated by a large star cluster of at least 20,000 members, and (2) the irradiation of the presolar molecular cloud by freshly accelerated CRs escaped from an isolated SNR at the end of the Sedov-Taylor phase. In the second picture, the SNR resulted from the explosion of a massive star that ran away from its parent OB association, expanded during most of its adiabatic phase in an intercloud medium of density of about 1 H

  18. Lycopene metabolite, apo-10'-lycopenoic acid, inhibits diethylnitrosamine-initiated, high fat diet-promoted hepatic inflammation and tumorigenesis in mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Obesity is associated with increased risk in hepatocellular carcinoma (HCC) development and mortality. An important disease control strategy is the prevention of obesity-related hepatic inflammation and tumorigenesis by dietary means. Here, we report that apo-10'-lycopenoic acid (APO10LA), a cleavag...

  19. IL-10 administration reduces PGE-2 levels and promotes CR3-mediated clearance of Escherichia coli K1 by phagocytes in meningitis

    PubMed Central

    Mittal, Rahul; Gonzalez-Gomez, Ignacio; Panigrahy, Ashok; Goth, Kerstin; Bonnet, Richard

    2010-01-01

    Ineffectiveness of antibiotics in treating neonatal Escherichia coli K1 meningitis and the emergence of antibiotic-resistant strains evidently warrants new prevention strategies. We observed that administration of interleukin (IL)-10 during high-grade bacteremia clears antibiotic-sensitive and -resistant E. coli from blood of infected mice. Micro-CT studies of brains from infected animals displayed gross morphological changes similar to those observed in infected human neonates. In mice, IL-10, but not antibiotic or anti-TNF antibody treatment prevented brain damage caused by E. coli. IL-10 administration elevated CR3 expression in neutrophils and macrophages of infected mice, whereas infected and untreated mice displayed increased expression of FcγRI and TLR2. Neutrophils or macrophages pretreated with IL-10 ex vivo exhibited a significantly greater microbicidal activity against E. coli compared with cells isolated from wild-type or IL-10−/− mice. The protective effect of IL-10 was abrogated when CR3 was knocked-down in vivo by siRNA. The increased expression of CR3 in phagocytes was caused by inhibition of prostaglandin E-2 (PGE-2) levels, which were significantly increased in neutrophils and macrophages upon E. coli infection. These findings describe a novel modality of IL-10–mediated E. coli clearance by diverting the entry of bacteria via CR3 and preventing PGE-2 formation in neonatal meningitis. PMID:20498022

  20. IL-10 administration reduces PGE-2 levels and promotes CR3-mediated clearance of Escherichia coli K1 by phagocytes in meningitis.

    PubMed

    Mittal, Rahul; Gonzalez-Gomez, Ignacio; Panigrahy, Ashok; Goth, Kerstin; Bonnet, Richard; Prasadarao, Nemani V

    2010-06-01

    Ineffectiveness of antibiotics in treating neonatal Escherichia coli K1 meningitis and the emergence of antibiotic-resistant strains evidently warrants new prevention strategies. We observed that administration of interleukin (IL)-10 during high-grade bacteremia clears antibiotic-sensitive and -resistant E. coli from blood of infected mice. Micro-CT studies of brains from infected animals displayed gross morphological changes similar to those observed in infected human neonates. In mice, IL-10, but not antibiotic or anti-TNF antibody treatment prevented brain damage caused by E. coli. IL-10 administration elevated CR3 expression in neutrophils and macrophages of infected mice, whereas infected and untreated mice displayed increased expression of FcgammaRI and TLR2. Neutrophils or macrophages pretreated with IL-10 ex vivo exhibited a significantly greater microbicidal activity against E. coli compared with cells isolated from wild-type or IL-10-/- mice. The protective effect of IL-10 was abrogated when CR3 was knocked-down in vivo by siRNA. The increased expression of CR3 in phagocytes was caused by inhibition of prostaglandin E-2 (PGE-2) levels, which were significantly increased in neutrophils and macrophages upon E. coli infection. These findings describe a novel modality of IL-10-mediated E. coli clearance by diverting the entry of bacteria via CR3 and preventing PGE-2 formation in neonatal meningitis. PMID:20498022

  1. Elemental ZOO

    NASA Astrophysics Data System (ADS)

    Helser, Terry L.

    2003-04-01

    This puzzle uses the symbols of 39 elements to spell the names of 25 animals found in zoos. Underlined spaces and the names of the elements serve as clues. To solve the puzzle, students must find the symbols that correspond to the elemental names and rearrange them into the animals' names.

  2. EGCG functions through estrogen receptor-mediated activation of ADAM10 in the promotion of non-amyloidogenic processing of APP

    PubMed Central

    Fernandez, Jamie Winderbaum; Rezai-Zadeh, Kavon; Obregon, Demian; Tan, Jun

    2010-01-01

    Estrogen depletion following menopause has been correlated with an increased risk of developing Alzheimer’s disease (AD). We previously explored the beneficial effect of (-)-epigallocatechin-3-gallate (EGCG) on AD mice and found increased non-amyloidogenic processing of amyloid precursor protein (APP) through the α-secretase a-disintegrin-and-metallopeptidase-domain 10 (ADAM10). Our results in this study suggest that EGCG-mediated enhancement of non-amyloidogenic processing of APP is mediated by the maturation of ADAM10 via an estrogen receptor-α (ERα)/PI3K/Akt dependent mechanism, independent of furin-mediated ADAM10 activation. These data support prior assertions that central selective estrogen receptor modulation could be a therapeutic target for AD and support the use of EGCG as a well-tolerated alternative to estrogen therapy in the prophylaxis and treatment of this disease. PMID:20849853

  3. Ultrasound promoted selective synthesis of 1,1'-binaphthyls catalyzed by Fe impregnated pillared Montmorillonite K10 in presence of TBHP as an oxidant.

    PubMed

    Bhor, Malhari D; Nandurkar, Nitin S; Bhanushali, Mayur J; Bhanage, Bhalchandra M

    2008-03-01

    Naphthols were selectively coupled under sonication using Fe(+3) impregnated pillared Montmorillonite K10 and TBHP as an oxidant. Considerable enhancement in the reaction rate was observed under sonication as compared to the reaction performed under silent condition. The activity of catalyst was compared with other Fe clay catalysts. Various parameters like solvent, catalyst and TBHP concentration has been studied. The heterogeneous active catalyst K10-FePLS120 was recycled without loss in activity and selectivity performance. PMID:17493859

  4. Light-element nucleosynthesis in a molecular cloud interacting with a supernova remnant and the origin of beryllium-10 in the protosolar nebula

    SciTech Connect

    Tatischeff, Vincent; Duprat, Jean; De Séréville, Nicolas

    2014-12-01

    The presence of short-lived radionuclides (t {sub 1/2} < 10 Myr) in the early solar system provides important information about the astrophysical environment in which the solar system formed. The discovery of now extinct {sup 10}Be (t {sub 1/2} = 1.4 Myr) in calcium-aluminum-rich inclusions (CAIs) with Fractionation and Unidentified Nuclear isotope anomalies (FUN-CAIs) suggests that a baseline concentration of {sup 10}Be in the early solar system was inherited from the protosolar molecular cloud. In this paper, we investigate various astrophysical contexts for the nonthermal nucleosynthesis of {sup 10}Be by cosmic-ray-induced reactions. We first show that the {sup 10}Be recorded in FUN-CAIs cannot have been produced in situ by irradiation of the FUN-CAIs themselves. We then show that trapping of Galactic cosmic rays (GCRs) in the collapsing presolar cloud core induced a negligible {sup 10}Be contamination of the protosolar nebula, the inferred {sup 10}Be/{sup 9}Be ratio being at least 40 times lower than that recorded in FUN-CAIs ({sup 10}Be/{sup 9}Be ∼ 3 × 10{sup –4}). Irradiation of the presolar molecular cloud by background GCRs produced a steady-state {sup 10}Be/{sup 9}Be ratio ≲ 1.3 × 10{sup –4} at the time of the solar system formation, which suggests that the presolar cloud was irradiated by an additional source of CRs. Considering a detailed model for CR acceleration in a supernova remnant (SNR), we find that the {sup 10}Be abundance recorded in FUN-CAIs can be explained within two alternative scenarios: (1) the irradiation of a giant molecular cloud by CRs produced by ≳ 50 supernovae exploding in a superbubble of hot gas generated by a large star cluster of at least 20,000 members, and (2) the irradiation of the presolar molecular cloud by freshly accelerated CRs escaped from an isolated SNR at the end of the Sedov-Taylor phase. In the second picture, the SNR resulted from the explosion of a massive star that ran away from its parent OB

  5. Dual effects of N-acetyl-L-cysteine dependent on NQO1 activity: Suppressive or promotive of 9,10-phenanthrenequinone-induced toxicity

    SciTech Connect

    Toyooka, Tatsushi; Shinmen, Takuya; Aarts, Jac M.M.J.G.; Ibuki, Yuko

    2012-11-01

    A typical antioxidant, N-acetyl-L-cysteine (NAC) generally protects cells from oxidative damage induced by reactive oxygen species (ROS). 9,10-Phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust particles, produces ROS in redox cycling following two-electron reduction by NAD(P)H:quinone oxidoreductase 1 (NQO1), which has been considered as a cause of its cyto- and genotoxicity. In this study, we show that NAC unexpectedly augments the toxicity of 9,10-PQ in cells with low NQO1 activity. In four human skin cell lines, the expression and the activity of NQO1 were lower than in human adenocarcinoma cell lines, A549 and MCF7. In the skin cells, the cytotoxicity of 9,10-PQ was significantly enhanced by addition of NAC. The formation of DNA double strand breaks accompanying phosphorylation of histone H2AX, was also remarkably augmented. On the other hand, the cyto- and genotoxicity were suppressed by addition of NAC in the adenocarcinoma cells. Two contrasting experiments: overexpression of NQO1 in CHO-K1 cells which originally expressed low NQO1 levels, and knock‐down of NQO1 in the adenocarcinoma cell line A549 by transfection of RNAi, also showed that NAC suppressed 9,10-PQ-induced toxicity in cell lines expressing high NQO1 activity and enhanced it in cell lines with low NQO1 activity. The results suggested that dual effects of NAC on the cyto- and genotoxicity of 9,10-PQ were dependent on tissue-specific NQO1 activity. -- Highlights: ► NAC augmented the cytotoxicity of 9,10-PQ in skin cell lines. ► 9,10-PQ-induced DSBs accompanying γ-H2AX were also augmented by NAC. ► NAC suppressed the cyto- and genotoxicity of 9,10-PQ in adenocarcinoma cell lines. ► The dual effects of NAC on toxicity of 9,10-PQ were dependent on NQO1 activity.

  6. Structural analysis of the human hydroxyindole-O-methyltransferase gene. Presence of two distinct promoters.

    PubMed

    Rodriguez, I R; Mazuruk, K; Schoen, T J; Chader, G J

    1994-12-16

    Hydroxyindole-O-methyltransferase (HIOMT) catalyzes the last step in the metabolic pathway that synthesizes the hormone melatonin. We have found HIOMT mRNA present in small amounts in human retina and in relatively high abundance in the pineal gland. Two distinct 5' ends were found in human retina using a solid-phase 5'-rapid amplification of cDNA ends technique. The two 5' regions appear to originate from two distinct putative promoters. Although many similarities exist between the two promoters, they contain distinctive elements. Putative promoter A, for example, contains a recently discovered photoreceptor-conserved element (PCE-1, CAATTAAG) at -27 not found in promoter B, while promoter B contains an Ap1 site (ATGAGTCAA) at -166 and an octamer site (ATGCAAT) at -59 not found in promoter A. The HIOMT messages are also alternatively spliced in between exons 6 and 8, generating three distinct messages. One of the alternatively spliced messages contains a line-1 repetitive element that is spliced into the mRNA precisely as exon 6. Importantly, the downstream open reading frame is not altered by any of these splicing combinations. The gene is approximately 35 kilobases long containing either 9 or 10 exons (including the line-1 element) depending on which promoter is active. All of the splice sites follow the GT/AG rule. The dual promoters and opportunities for alternative splicing suggest a variety of mechanisms for control of HIOMT expression and biological activity in different tissues not previously recognized.

  7. Supramolecular arrangement promoted in trans-[PdCl2(HONC10H14O)2]·2H2O by hydrogen bonding

    NASA Astrophysics Data System (ADS)

    Galvão, Adelino M.; Carvalho, M. Fernanda N. N.; Grilo, António L.

    2014-05-01

    Palladium(II) complexes trans-[PdCl2(3-HONC10H14O)2]ṡ2H2O and trans-[PdCl2(2-HONC10H16)2] with similar formulations and molecular geometries display considerably different supramolecular arrangements due to hydrogen bonding involving the oxime substituent (NOH) of the camphor ligand, the halide co-ligand of adjacent molecules and H2O outer-sphere molecules in the case of trans-[PdCl2(3-HONC10H14O)2]ṡ2H2O. The discussion is based on data collected by X-ray diffraction analysis and DFT calculations.

  8. Cosmic-ray energy spectra between 10 and several hundred GeV per atomic mass unit for elements from Ar-18 to Ni-28 - Results from HEAO 3

    NASA Technical Reports Server (NTRS)

    Binns, W. R.; Israel, M. H.; Jones, Michael D.; Kamionkowski, M. P.; Garrard, T. L.

    1988-01-01

    Results from the Heavy Nuclei experiment on HEAO 3 are used to determine the primary abundances of Ni and Fe. Ni and Fe are found to have nearly constant relative abundances over the interval of 10 to about 500 GeV per amu. Individual secondary elements derived principally from interactions of primary Fe nuclei are shown to display a power-law decrease in relative abundance up to about 150 GeV per amu. Ar/Fe and Ca/Fe ratios of 2.6 + or - 0.7 percent and 8.8 + or - 0.7 percent, respectively, are found, confirming a fractionation of source abundances in which elements with high values of the first ionization potential are depleted relative to those with low first ionization potential.

  9. Male-Biased Aganglionic Megacolon in the TashT Mouse Line Due to Perturbation of Silencer Elements in a Large Gene Desert of Chromosome 10

    PubMed Central

    Touré, Aboubacrine M.; Béland, Mélanie; Raiwet, Diana L.; Silversides, David W.; Pilon, Nicolas

    2015-01-01

    Neural crest cells (NCC) are a transient migratory cell population that generates diverse cell types such as neurons and glia of the enteric nervous system (ENS). Via an insertional mutation screen for loci affecting NCC development in mice, we identified one line—named TashT—that displays a partially penetrant aganglionic megacolon phenotype in a strong male-biased manner. Interestingly, this phenotype is highly reminiscent of human Hirschsprung’s disease, a neurocristopathy with a still unexplained male sex bias. In contrast to the megacolon phenotype, colonic aganglionosis is almost fully penetrant in homozygous TashT animals. The sex bias in megacolon expressivity can be explained by the fact that the male ENS ends, on average, around a “tipping point” of minimal colonic ganglionosis while the female ENS ends, on average, just beyond it. Detailed analysis of embryonic intestines revealed that aganglionosis in homozygous TashT animals is due to slower migration of enteric NCC. The TashT insertional mutation is localized in a gene desert containing multiple highly conserved elements that exhibit repressive activity in reporter assays. RNAseq analyses and 3C assays revealed that the TashT insertion results, at least in part, in NCC-specific relief of repression of the uncharacterized gene Fam162b; an outcome independently confirmed via transient transgenesis. The transcriptional signature of enteric NCC from homozygous TashT embryos is also characterized by the deregulation of genes encoding members of the most important signaling pathways for ENS formation—Gdnf/Ret and Edn3/Ednrb—and, intriguingly, the downregulation of specific subsets of X-linked genes. In conclusion, this study not only allowed the identification of Fam162b coding and regulatory sequences as novel candidate loci for Hirschsprung’s disease but also provides important new insights into its male sex bias. PMID:25786024

  10. Copper-promoted cyanation of a boron cluster: synthesis, X-ray structure, and reactivity of 12-CN-closo-CHB11H10-.

    PubMed

    Rosenbaum, Aaron J; Juers, Douglas H; Juhasz, Marcus A

    2013-10-01

    Microwave-assisted cross-coupling reactions of boron-iodinated derivatives of 1-carba-closo-dodecaborate(1-) (1) with CuCN is shown to cyanate boron vertices of this anion. Clusters with one or two CN groups can be prepared: syntheses of 12-CN-CHB11H10(-) (3) and 7,12-(CN)2-CHB11H9(-) (6) gave yields of 80% and 81%, respectively. The [Et4N](+) salts of 3 and 6 were characterized by NMR, IR, and mass spectroscopies, and the crystal structure of [Et4N]3 was determined by single-crystal X-ray diffraction. Hydrolysis of 3 gave the carboxylic acid 12-COOH-CHB11H10(-) (7).

  11. PB2-588 V promotes the mammalian adaptation of H10N8, H7N9 and H9N2 avian influenza viruses.

    PubMed

    Xiao, Chencheng; Ma, Wenjun; Sun, Na; Huang, Lihong; Li, Yaling; Zeng, Zhaoyong; Wen, Yijun; Zhang, Zaoyue; Li, Huanan; Li, Qian; Yu, Yuandi; Zheng, Yi; Liu, Shukai; Hu, Pingsheng; Zhang, Xu; Ning, Zhangyong; Qi, Wenbao; Liao, Ming

    2016-01-01

    Human infections with avian influenza H7N9 or H10N8 viruses have been reported in China, raising concerns that they might cause human epidemics and pandemics. However, how these viruses adapt to mammalian hosts is unclear. Here we show that besides the commonly recognized viral polymerase subunit PB2 residue 627 K, other residues including 87E, 292 V, 340 K, 588 V, 648 V, and 676 M in PB2 also play critical roles in mammalian adaptation of the H10N8 virus. The avian-origin H10N8, H7N9, and H9N2 viruses harboring PB2-588 V exhibited higher polymerase activity, more efficient replication in mammalian and avian cells, and higher virulence in mice when compared to viruses with PB2-588 A. Analyses of available PB2 sequences showed that the proportion of avian H9N2 or human H7N9 influenza isolates bearing PB2-588 V has increased significantly since 2013. Taken together, our results suggest that the substitution PB2-A588V may be a new strategy for an avian influenza virus to adapt mammalian hosts. PMID:26782141

  12. The dynamics of mobile promoters: Enhanced stability in promoter regions.

    PubMed

    Rabbani, Mahnaz; Wahl, Lindi M

    2016-10-21

    Mobile promoters are emerging as a new class of mobile genetic elements, first identified by examining prokaryote genome sequences, and more recently confirmed by experimental observations in bacteria. Recent datasets have identified over 40,000 putative mobile promoters in sequenced prokaryote genomes, however only one-third of these are in regions of the genome directly upstream from coding sequences, that is, in promoter regions. The presence of many promoter sequences in non-promoter regions is unexplained. Here we develop a general mathematical model for the dynamics of mobile promoters, extending previous work to capture the dynamics both within and outside promoter regions. From this general model, we apply rigorous model selection techniques to identify which parameters are statistically justified in describing the available mobile promoter data, and find best-fit values of these parameters. Our results suggest that high rates of horizontal gene transfer maintain the population of mobile promoters in promoter regions, and that once established at these sites, mobile promoters are rarely lost, but are commonly copied to other genomic regions. In contrast, mobile promoter copies in non-promoter regions are more numerous and more volatile, experiencing substantially higher rates of duplication, loss and diversification. PMID:27460588

  13. Characterisation of gamma-interferon responsive promoters in fish.

    PubMed

    Castro, Rosario; Martin, Samuel A M; Bird, Steve; Lamas, Jesús; Secombes, Christopher J

    2008-07-01

    Reporter constructs of three interferon (IFN)-gamma-induced rainbow trout genes were generated to examine specificity to type I or type II IFN. Constructs included gammaIP-10, LMP2 and TAP2 and were used to transfect trout fibroblast cells (RTG-2) which were then exposed to rainbow trout rIFNs. The gammaIP-10 construct showed high reporter activity even in the absence of rIFNs. The LMP2 promoter contained one GAS element and two double ISRE elements, of four constructs made, only those with ISRE elements showed significant reporter activity following rIFN-gamma stimulation. The TAP2 regulatory region contained two GAS, two ISRE and one C/EBP element from which four constructs were made. Reporter expression for the construct containing all five elements showed an 11- and 2-fold increase in response to rIFN-gamma and type I rIFN, respectively. Constructs containing only the GAS elements did not respond to rIFNs. The TAP2 construct with two ISRE and the C/EBP gave the greatest dose-dependent reporter response to rIFN-gamma, with no significant response to type I rIFN. These data suggest that the ISRE elements, or elements nearby, are essential for the induction of type II IFN responsive genes in trout. The TAP2 construct is a candidate to develop a IFN-gamma reporter stable cell line. PMID:18457879

  14. The ratio of constitutive androstane receptor to pregnane X receptor determines the activity of guggulsterone against the Cyp2b10 promoter.

    PubMed

    Ding, Xunshan; Staudinger, Jeff L

    2005-07-01

    Guggulsterone is the active ingredient in gugulipid, an organic extract of the Commiphora mukul plant. Gugulipid has been used for nearly 3000 years in Ayurvedic medicine, mainly as a treatment for arthritis. Herbal practitioners currently use gugulipid therapy in conditions as diverse as rheumatism, coronary artery disease, arthritis, hyperlipidemia, acne, and obesity. The active ingredient in gugulipid is guggulsterone, a plant sterol compound recently identified as a pregnane X receptor (PXR; NR1I2) ligand. We show herein that guggulsterone treatment represses the expression of cytochrome P450 2b10 (Cyp2b10) gene expression by inhibiting constitutive androstane receptor (CAR; NR1I3) activity in hepatocytes lacking functional PXR (PXR-knockout). We also show that PXR-CAR cross-talk determines the net activity of guggulsterone treatment toward Cyp2b10 gene expression. Using mammalian two-hybrid assays, we show that treatment with guggulsterone differentially affects protein cofactor recruitment to these two nuclear receptors. These data identify guggulsterone as an inverse agonist of the nuclear receptor CAR. When viewed together with the data showing that PXR and CAR expression is highly variable in different ethnic populations and that CAR expression is under the control of a circadian rhythm, our data provide important insight into the molecular mechanism of interindividual variability of drug metabolism. These data, together with the recent resolution of the crystal structures of PXR and CAR, will likely aid in the rational design of more specific CAR inverse agonists that are currently viewed as potential antiobesity drugs. PMID:15833898

  15. Elemental health

    SciTech Connect

    Tonneson, L.C.

    1997-01-01

    Trace elements used in nutritional supplements and vitamins are discussed in the article. Relevant studies are briefly cited regarding the health effects of selenium, chromium, germanium, silicon, zinc, magnesium, silver, manganese, ruthenium, lithium, and vanadium. The toxicity and food sources are listed for some of the elements. A brief summary is also provided of the nutritional supplements market.

  16. Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding dEF1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an estrogen receptor-enhanced cell line when treated with estrogen. This promoter-enhancer also binds unidentified proteins that recognize a consens...

  17. [Novel bidirectional promoter from human genome].

    PubMed

    Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

    2011-01-01

    In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells.

  18. [Novel bidirectional promoter from human genome].

    PubMed

    Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

    2011-01-01

    In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells. PMID:21790010

  19. Genetic association of G-607C Located at wnt10b promoter with bi-sup type among Korean cerebral infarction patients

    PubMed Central

    Ko, Mi Mi; Lee, Myeong Soo; Cha, Min Ho

    2015-01-01

    Obesity is a disease threatening health and is known one of risk factors cau