Sample records for 15-lox-1 promoter dna

  1. DNA signals at isoform promoters

    PubMed Central

    Dai, Zhiming; Xiong, Yuanyan; Dai, Xianhua


    Transcriptional heterogeneity is extensive in the genome, and most genes express variable transcript isoforms. However, whether variable transcript isoforms of one gene are regulated by common promoter elements remain to be elucidated. Here, we investigated whether isoform promoters of one gene have separated DNA signals for transcription and translation initiation. We found that TATA box and nucleosome-disfavored DNA sequences are prevalent in distinct transcript isoform promoters of one gene. These DNA signals are conserved among species. Transcript isoform has a RNA-determined unstructured region around its start site. We found that these DNA/RNA features facilitate isoform transcription and translation. These results suggest a DNA-encoded mechanism by which transcript isoform is generated. PMID:27353836

  2. DNA signals at isoform promoters.


    Dai, Zhiming; Xiong, Yuanyan; Dai, Xianhua


    Transcriptional heterogeneity is extensive in the genome, and most genes express variable transcript isoforms. However, whether variable transcript isoforms of one gene are regulated by common promoter elements remain to be elucidated. Here, we investigated whether isoform promoters of one gene have separated DNA signals for transcription and translation initiation. We found that TATA box and nucleosome-disfavored DNA sequences are prevalent in distinct transcript isoform promoters of one gene. These DNA signals are conserved among species. Transcript isoform has a RNA-determined unstructured region around its start site. We found that these DNA/RNA features facilitate isoform transcription and translation. These results suggest a DNA-encoded mechanism by which transcript isoform is generated. PMID:27353836

  3. Autophagy promotes DNA-protein crosslink clearance.


    Mu, Haibo; Liu, Qianjin; Niu, Hong; Wang, Dongdong; Tang, Jiangjiang; Duan, Jinyou


    Toxic DNA-protein crosslinks (DPCs) can result from exposure to radiation or chemotherapeutic agents. DPCs can also accumulate during aging or stress. However, the cellular mechanisms underlying clearance of DPCs remain largely unknown. Here, we have identified an important role of autophagy in the processing of DPCs induced by three representative agents: formaldehyde, a chemical used widely in industry; UV light; and camptothecin, a cytotoxic anticancer drug. Autophagy inhibitors, 3-methyladenine (3-MA) or chloroquine (CQ), promoted the accumulation of DPCs in damaged cells and injured organs. siRNA-mediated silencing of Atg5 or Atg7, two essential components for the formation of the autophagosome, gave similar results. In contrast, the autophagy inducer rapamycin (RAP) attenuated DPCs in vitro and in vivo. Our findings reveal the importance of autophagy in controlling the level of DPCs, and may open up a new avenue for understanding the formation and clearance of this detrimental DNA adduct. PMID:26921017

  4. UV damage in DNA promotes nucleosome unwrapping.


    Duan, Ming-Rui; Smerdon, Michael J


    The association of DNA with histones in chromatin impedes DNA repair enzymes from accessing DNA lesions. Nucleosomes exist in a dynamic equilibrium in which portions of the DNA molecule spontaneously unwrap, transiently exposing buried DNA sites. Thus, nucleosome dynamics in certain regions of chromatin may provide the exposure time and space needed for efficient repair of buried DNA lesions. We have used FRET and restriction enzyme accessibility to study nucleosome dynamics following DNA damage by UV radiation. We find that FRET efficiency is reduced in a dose-dependent manner, showing that the presence of UV photoproducts enhances spontaneous unwrapping of DNA from histones. Furthermore, this UV-induced shift in unwrapping dynamics is associated with increased restriction enzyme accessibility of histone-bound DNA after UV treatment. Surprisingly, the increased unwrapping dynamics is even observed in nucleosome core particles containing a single UV lesion at a specific site. These results highlight the potential for increased "intrinsic exposure" of nucleosome-associated DNA lesions in chromatin to repair proteins. PMID:20562439

  5. In vitro footprinting of promoter regions within supercoiled plasmid DNA

    PubMed Central

    Sun, Daekyu


    Polypurine/polypyrimidine (pPU/pPY) tracts, which exist in the promoter regions of many growth-related genes, have been proposed to be very dynamic in their conformation. In this chapter, we describe a detailed protocol for DNase I and S1 nuclease footprinting experiments with supercoiled plasmid DNA containing such the promoter regions to probe whether there are conformational transitions to B-type DNA, melted DNA and G-quadruplex structures within this tract. This is demonstrated with the proximal promoter region of the human vascular endothelial growth factor (VEGF) gene, which also contains multiple binding sites for Sp1 and Egr-1 transcription factors. PMID:19997887

  6. Finding human promoter groups based on DNA physical properties

    NASA Astrophysics Data System (ADS)

    Zeng, Jia; Cao, Xiao-Qin; Zhao, Hongya; Yan, Hong


    DNA rigidity is an important physical property originating from the DNA three-dimensional structure. Although the general DNA rigidity patterns in human promoters have been investigated, their distinct roles in transcription are largely unknown. In this paper, we discover four highly distinct human promoter groups based on similarity of their rigidity profiles. First, we find that all promoter groups conserve relatively rigid DNAs at the canonical TATA box [a consensus TATA(A/T)A(A/T) sequence] position, which are important physical signals in binding transcription factors. Second, we find that the genes activated by each group of promoters share significant biological functions based on their gene ontology annotations. Finally, we find that these human promoter groups correlate with the tissue-specific gene expression.

  7. Equilibrious Strand Exchange Promoted by DNA Conformational Switching

    NASA Astrophysics Data System (ADS)

    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang


    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.

  8. Equilibrious Strand Exchange Promoted by DNA Conformational Switching

    PubMed Central

    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang


    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations. PMID:23350029

  9. Equilibrious strand exchange promoted by DNA conformational switching.


    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang


    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations. PMID:23350029

  10. Bayesian classification for promoter prediction in human DNA sequences

    NASA Astrophysics Data System (ADS)

    Bercher, J.-F.; Jardin, P.; Duriez, B.


    Many Computational methods are yet available for data retrieval and analysis of genomic sequences, but some functional sites are difficult to characterize. In this work, we examine the problem of promoter localization in human DNA sequences. Promoters are regulatory regions that governs the expression of genes, and their prediction is reputed difficult, so that this issue is still open. We present the Chaos Game representation (CGR) of DNA sequences which has many interesting properties, and the notion of `genomic signature' that proved relevant in phylogeny applications. Based on this notion, we develop a (naïve) bayesian classifier, evaluate its performances, and show that its adaptive implementation enable to reveal or assess core-promoter positions along a DNA sequence.

  11. Prediction of fine-tuned promoter activity from DNA sequence

    PubMed Central

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael


    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  12. Mechanism of promoter repression by Lac repressor-DNA loops.


    Becker, Nicole A; Peters, Justin P; Maher, L James; Lionberger, Troy A


    The Escherichia coli lactose (lac) operon encodes the first genetic switch to be discovered, and lac remains a paradigm for studying negative and positive control of gene expression. Negative control is believed to involve competition of RNA polymerase and Lac repressor for overlapping binding sites. Contributions to the local Lac repressor concentration come from free repressor and repressor delivered to the operator from remote auxiliary operators by DNA looping. Long-standing questions persist concerning the actual role of DNA looping in the mechanism of promoter repression. Here, we use experiments in living bacteria to resolve four of these questions. We show that the distance dependence of repression enhancement is comparable for upstream and downstream auxiliary operators, confirming the hypothesis that repressor concentration increase is the principal mechanism of repression loops. We find that as few as four turns of DNA can be constrained in a stable loop by Lac repressor. We show that RNA polymerase is not trapped at repressed promoters. Finally, we show that constraining a promoter in a tight DNA loop is sufficient for repression even when promoter and operator do not overlap. PMID:23143103

  13. Impaired DNA replication within progenitor cell pools promotes leukemogenesis.


    Bilousova, Ganna; Marusyk, Andriy; Porter, Christopher C; Cardiff, Robert D; DeGregori, James


    Impaired cell cycle progression can be paradoxically associated with increased rates of malignancies. Using retroviral transduction of bone marrow progenitors followed by transplantation into mice, we demonstrate that inhibition of hematopoietic progenitor cell proliferation impairs competition, promoting the expansion of progenitors that acquire oncogenic mutations which restore cell cycle progression. Conditions that impair DNA replication dramatically enhance the proliferative advantage provided by the expression of Bcr-Abl or mutant p53, which provide no apparent competitive advantage under conditions of healthy replication. Furthermore, for the Bcr-Abl oncogene the competitive advantage in contexts of impaired DNA replication dramatically increases leukemogenesis. Impaired replication within hematopoietic progenitor cell pools can select for oncogenic events and thereby promote leukemia, demonstrating the importance of replicative competence in the prevention of tumorigenesis. The demonstration that replication-impaired, poorly competitive progenitor cell pools can promote tumorigenesis provides a new rationale for links between tumorigenesis and common human conditions of impaired DNA replication such as dietary folate deficiency, chemotherapeutics targeting dNTP synthesis, and polymorphisms in genes important for DNA metabolism. PMID:16277552

  14. Promoting DNA loading on magnetic nanoparticles using a DNA condensation strategy.


    Shan, Zhi; Jiang, Youjun; Guo, Mengyu; Bennett, J Craig; Li, Xianghai; Tian, Hefeng; Oakes, Ken; Zhang, Xu; Zhou, Yi; Huang, Qianming; Chen, Huaping


    Maximizing DNA loading on magnetic nanoparticles (MNPs) is crucial for their successful utilization in gene transfer, DNA isolation, and bio-analytical applications. This enhancement is typically achieved by altering particle size and surfaces as well as charge density and ionic strength. We demonstrate a novel route for promoting DNA loading on amino-modified silica-coated magnetic nanoparticles (ASMNPs) by prior condensation of elongated DNA to a compact globule before adsorption. The enhanced DNA-loading capacity, as demonstrated by a reduction in the number of ASMNPs needed to achieve complexation, was presumably due to the elimination of DNA wrapping around nanoparticles and substantially reduced electrostatic interactions of DNA with nanoparticles because the compacted DNA globule conformation decreases its exposed surface charge. The maximum loading capacity of ASMNPs for condensed DNA was 4.4 times greater than that for elongated coiled DNA, achieving the highest ever reported value of 385 μg mg(-1). Practical applications for plasmid DNA isolation from cleared lysate confirmed the reliability of the proposed method. PMID:25454752

  15. Gadd45a promotes DNA demethylation through TDG.


    Li, Zheng; Gu, Tian-Peng; Weber, Alain R; Shen, Jia-Zhen; Li, Bin-Zhong; Xie, Zhi-Guo; Yin, Ruichuan; Guo, Fan; Liu, Xiaomeng; Tang, Fuchou; Wang, Hailin; Schär, Primo; Xu, Guo-Liang


    Growth arrest and DNA-damage-inducible protein 45 (Gadd45) family members have been implicated in DNA demethylation in vertebrates. However, it remained unclear how they contribute to the demethylation process. Here, we demonstrate that Gadd45a promotes active DNA demethylation through thymine DNA glycosylase (TDG) which has recently been shown to excise 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) generated in Ten-eleven-translocation (Tet)-initiated oxidative demethylation. The connection of Gadd45a with oxidative demethylation is evidenced by the enhanced activation of a methylated reporter gene in HEK293T cells expressing Gadd45a in combination with catalytically active TDG and Tet. Gadd45a interacts with TDG physically and increases the removal of 5fC and 5caC from genomic and transfected plasmid DNA by TDG. Knockout of both Gadd45a and Gadd45b from mouse ES cells leads to hypermethylation of specific genomic loci most of which are also targets of TDG and show 5fC enrichment in TDG-deficient cells. These observations indicate that the demethylation effect of Gadd45a is mediated by TDG activity. This finding thus unites Gadd45a with the recently defined Tet-initiated demethylation pathway. PMID:25845601

  16. Gadd45a promotes DNA demethylation through TDG

    PubMed Central

    Li, Zheng; Gu, Tian-Peng; Weber, Alain R.; Shen, Jia-Zhen; Li, Bin-Zhong; Xie, Zhi-Guo; Yin, Ruichuan; Guo, Fan; Liu, Xiaomeng; Tang, Fuchou; Wang, Hailin; Schär, Primo; Xu, Guo-Liang


    Growth arrest and DNA-damage-inducible protein 45 (Gadd45) family members have been implicated in DNA demethylation in vertebrates. However, it remained unclear how they contribute to the demethylation process. Here, we demonstrate that Gadd45a promotes active DNA demethylation through thymine DNA glycosylase (TDG) which has recently been shown to excise 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) generated in Ten-eleven-translocation (Tet)—initiated oxidative demethylation. The connection of Gadd45a with oxidative demethylation is evidenced by the enhanced activation of a methylated reporter gene in HEK293T cells expressing Gadd45a in combination with catalytically active TDG and Tet. Gadd45a interacts with TDG physically and increases the removal of 5fC and 5caC from genomic and transfected plasmid DNA by TDG. Knockout of both Gadd45a and Gadd45b from mouse ES cells leads to hypermethylation of specific genomic loci most of which are also targets of TDG and show 5fC enrichment in TDG-deficient cells. These observations indicate that the demethylation effect of Gadd45a is mediated by TDG activity. This finding thus unites Gadd45a with the recently defined Tet-initiated demethylation pathway. PMID:25845601

  17. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining

    PubMed Central

    Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom


    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724

  18. Promoter DNA demethylation of Keap1 gene in diabetic cardiomyopathy

    PubMed Central

    Liu, Zhong-Zhi; Zhao, Xiang-Zhi; Zhang, Xue-Song; Zhang, Mei


    Researches have shown that the onset of diabetes is closely associated with oxidative stress and the chronic exposure leads to the development of complications such as diabetic cardiomyopathy. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. The aim of the present study was to investigate the status of Nrf2 mediated antioxidant system in myocardial biopsies of non-diabetic (NDM) and type-2 diabetic (DM-T2) cardiomyopathy patients. The western blot analysis of antioxidant proteins, real-time PCR analysis of Nrf2/Keap1 gene and bisulphate DNA sequencing analysis to study the methylation status of the CpG islands of Keap1 promoter DNA were performed. The immunoblot analysis showed the decreased level of antioxidant proteins other than Keap1 in the diabetic cardiopathy patients. Similarly, mRNA levels of Keap1 showed 5-fold increase in diabetic patients. Further analysis on promoter region of Keap1 gene revealed 80% demethylation in diabetic patients. Altogether, our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the transcription of many antioxidant enzyme genes and alters the redox-balance up on diabetes. Thus, our study clearly demonstrates the failure of Nrf2 mediated antioxidant system revealed in biopsies of diabetic cardiomyopathy. PMID:25674242

  19. SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing

    NASA Astrophysics Data System (ADS)

    Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team

    Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.

  20. Stalled transcription complexes promote DNA repair at a distance

    PubMed Central

    Haines, Nia M.; Kim, Young-In T.; Smith, Abigail J.; Savery, Nigel J.


    Transcription-coupled nucleotide excision repair (TCR) accelerates the removal of noncoding lesions from the template strand of active genes, and hence contributes to genome-wide variations in mutation frequency. Current models for TCR suppose that a lesion must cause RNA polymerase (RNAP) to stall if it is to be a substrate for accelerated repair. We have examined the substrate requirements for TCR using a system in which transcription stalling and damage location can be uncoupled. We show that Mfd-dependent TCR in bacteria involves the formation of a damage search complex that can detect lesions downstream of a stalled RNAP, and that the strand specificity of the accelerated repair pathway is independent of the requirement for a lesion to stall RNAP. We also show that an ops (operon polarity suppressor) transcription pause site, which causes backtracking of RNAP, can promote the repair of downstream lesions when those lesions do not themselves cause the polymerase to stall. Our findings indicate that the transcription-repair coupling factor Mfd, which is an ATP-dependent superfamily 2 helicase that binds to RNAP, continues to translocate along DNA after RNAP has been displaced until a lesion in the template strand is located. The discovery that pause sites can promote the repair of nonstalling lesions suggests that TCR pathways may play a wider role in modulating mutation frequencies in different parts of the genome than has previously been suspected. PMID:24554077

  1. Identification of procollagen promoter DNA-binding proteins: effects of dexamethasone

    SciTech Connect

    Sweeney, C.; Cutroneo, K.R.


    Glucocorticoids selectively decrease procollagen synthesis by decreasing procollagen mRNA transcription. Dexamethasone coordinately decreased total cellular type I and type III procollagen mRNAs in mouse embryonic skin fibroblasts. Since sequence specific DNA-binding proteins are known to modulate eukaryotic gene expression the authors identified in mouse fibroblasts nuclear proteins which bind to types I and III procollagen promoter DNAs. Nuclear proteins were electrophoresed, blotted onto nitrocellulose and probed with /sup 32/P-end-labeled type I and type III procollagen promoter DNAs in the presence of equimolar amounts of /sup 32/P-end-labeled vector DNA. Differences in total DNA binding were noted by the densitometric scans of the nuclear proteins. Dexamethasone treatment enhanced total DNA binding. Increasing the NaCl concentration decreased the number of promoter DNA-binding proteins without altering the relative specificity for the promoter DNAs. Promoter DNA binding to nuclear proteins was also inhibited by increasing concentrations of E. coli DNA. The number of DNA-binding proteins was greater for type III procollagen promoter DNA. The effect of dexamethasone treatment on promoter DNA binding to nuclear proteins was determined.

  2. Promoters responsive to DNA bending: a common theme in prokaryotic gene expression.

    PubMed Central

    Pérez-Martín, J; Rojo, F; de Lorenzo, V


    The early notion of DNA as a passive target for regulatory proteins has given way to the realization that higher-order DNA structures and DNA-protein complexes are at the basis of many molecular processes, including control of promoter activity. Protein binding may direct the bending of an otherwise linear DNA, exacerbate the angle of an intrinsic bend, or assist the directional flexibility of certain sequences within prokaryotic promoters. The important, sometimes essential role of intrinsic or protein-induced DNA bending in transcriptional regulation has become evident in virtually every system examined. As discussed throughout this article, not every function of DNA bends is understood, but their presence has been detected in a wide variety of bacterial promoters subjected to positive or negative control. Nonlinear DNA structures facilitate and even determine proximal and distal DNA-protein and protein-protein contacts involved in the various steps leading to transcription initiation. PMID:8078436

  3. Genome-wide Mapping Reveals Conservation of Promoter DNA Methylation Following Chicken Domestication

    PubMed Central

    Li, Qinghe; Wang, Yuanyuan; Hu, Xiaoxiang; Zhao, Yaofeng; Li, Ning


    It is well-known that environment influences DNA methylation, however, the extent of heritable DNA methylation variation following animal domestication remains largely unknown. Using meDIP-chip we mapped the promoter methylomes for 23,316 genes in muscle tissues of ancestral and domestic chickens. We systematically examined the variation of promoter DNA methylation in terms of different breeds, differentially expressed genes, SNPs and genes undergo genetic selection sweeps. While considerable changes in DNA sequence and gene expression programs were prevalent, we found that the inter-strain DNA methylation patterns were highly conserved in promoter region between the wild and domestic chicken breeds. Our data suggests a global preservation of DNA methylation between the wild and domestic chicken breeds in either a genome-wide or locus-specific scale in chick muscle tissues. PMID:25735894

  4. Genistein promotes DNA demethylation of the steroidogenic factor 1 (SF-1) promoter in endometrial stromal cells

    SciTech Connect

    Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko


    Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.

  5. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.


    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong


    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  6. Bacterial promoter repression by DNA looping without protein-protein binding competition.


    Becker, Nicole A; Greiner, Alexander M; Peters, Justin P; Maher, L James


    The Escherichia coli lactose operon provides a paradigm for understanding gene control by DNA looping where the lac repressor (LacI) protein competes with RNA polymerase for DNA binding. Not all promoter loops involve direct competition between repressor and RNA polymerase. This raises the possibility that positioning a promoter within a tightly constrained DNA loop is repressive per se, an idea that has previously only been considered in vitro. Here, we engineer living E. coli bacteria to measure repression due to promoter positioning within such a tightly constrained DNA loop in the absence of protein-protein binding competition. We show that promoters held within such DNA loops are repressed ∼100-fold, with up to an additional ∼10-fold repression (∼1000-fold total) dependent on topological positioning of the promoter on the inner or outer face of the DNA loop. Chromatin immunoprecipitation data suggest that repression involves inhibition of both RNA polymerase initiation and elongation. These in vivo results show that gene repression can result from tightly looping promoter DNA even in the absence of direct competition between repressor and RNA polymerase binding. PMID:24598256

  7. Bacterial promoter repression by DNA looping without protein–protein binding competition

    PubMed Central

    Becker, Nicole A.; Greiner, Alexander M.; Peters, Justin P.; Maher, L. James


    The Escherichia coli lactose operon provides a paradigm for understanding gene control by DNA looping where the lac repressor (LacI) protein competes with RNA polymerase for DNA binding. Not all promoter loops involve direct competition between repressor and RNA polymerase. This raises the possibility that positioning a promoter within a tightly constrained DNA loop is repressive per se, an idea that has previously only been considered in vitro. Here, we engineer living E. coli bacteria to measure repression due to promoter positioning within such a tightly constrained DNA loop in the absence of protein–protein binding competition. We show that promoters held within such DNA loops are repressed ∼100-fold, with up to an additional ∼10-fold repression (∼1000-fold total) dependent on topological positioning of the promoter on the inner or outer face of the DNA loop. Chromatin immunoprecipitation data suggest that repression involves inhibition of both RNA polymerase initiation and elongation. These in vivo results show that gene repression can result from tightly looping promoter DNA even in the absence of direct competition between repressor and RNA polymerase binding. PMID:24598256

  8. DNA damage promotes Herpes Simplex Virus-1 protein expression in a neuroblastoma cell line

    PubMed Central

    Volcy, Ketna; Fraser, Nigel W.


    Although the induction of the cellular DNA damage response by Herpes simplex virus-1 (HSV-1) infection of epithelial cells in tissue culture promotes productive infection, there has been no experimental observation of the effect of the cellular DNA damage response on HSV-1 infection in vivo or in neuronal derived cell lines in tissue culture. Thus, it has been speculated that the lack of cellular DNA damage induction during infection of neurons may promote latency in these cells. This work examines the profile of HSV-1 promoter induction and protein expression, in the absence or presence of infection; using cellular DNA damage inducing topoisomerase inhibitors (Camptothecin and Etoposide) on a neuroblastoma cell line (C1300) in which HSV-1 infection fails to induce the DNA damage response. In the absence of infection, a plasmid expressing the immediate early ICP0 promoter was the most induced by the DNA damage drug treatments compared to the early (RR) and late (VP16) gene promoters. Similarly, drug treatment of C1300 cells infected with HSV-1 virus showed enhanced protein expression for ICP0, but not ICP4 and VP16 proteins. However, when the cells were infected with a HSV-1 virus defective in the immediate early gene trans-activator VP16 (in814) and treated with the DNA damaging drugs, there was enhanced expression of immediate early and late HSV-1 proteins. Although, viral infection of the neuroblastoma cell alone did not induce DNA damage, cellular DNA damage induced by drug treatments facilitated viral promoter induction and viral protein expression. This implicates a mechanism by which HSV-1 viral genes in a quiescent or latent state may become induced by cellular DNA damage in neuronal cells to facilitate productive infection. PMID:23354549

  9. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    PubMed Central

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai


    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  10. Characterization of a T-DNA promoter trap line of Arabidopsis thaliana uncovers a cryptic bi-directional promoter.


    Pratibha, Pritu; Singh, Sunil Kumar; Sharma, Isha; Kumar, Ravi; Srinivasan, Ramamurthy; Bhat, Shripad Ramachandra; Ahuja, Paramvir Singh; Sreenivasulu, Yelam


    Investigation of the transgenic Arabidopsis promoter trap line GFP-868 that showed GFP expression only in anthers revealed the T-DNA insertion at 461bp upstream to the hypothetical gene At4g10596 with the GFP reporter gene in head-to-head orientation to the At4g10596 gene. The expression of the At4g10596 gene in wild type and in GFP-868 plant homozygous for T-DNA insertion was comparable and found in all tissues tested, while the GFP expression was restricted to anthers of the GFP-868 plants suggesting that the 461bp fragment separating the two genes in the GFP-868 line is functioning as bi-directional promoter. This 461bp fragment was cloned upstream to the GUS gene in two orientations to test for bi-directional promoter activity. Transgenic Arabidopsis plants carrying either of these constructs showed GUS activity in anthers indicating that this fragment behaves as bi-directional promoter specific to anthers. These results were also supported by the presence of cis-acting motifs such as TATA box and POLLEN1LELAT52 (AGAAA) within the 461bp sequence in both orientations. However, transcripts corresponding to the upstream sequences beyond -461 nucleotides were not detected in the wild type suggesting that this 461bp fragment is a cryptic promoter. The significance of the promoter trap approach and the usefulness of this type of promoter are discussed. PMID:23612249

  11. Defective removal of ribonucleotides from DNA promotes systemic autoimmunity

    PubMed Central

    Günther, Claudia; Kind, Barbara; Reijns, Martin A.M.; Berndt, Nicole; Martinez-Bueno, Manuel; Wolf, Christine; Tüngler, Victoria; Chara, Osvaldo; Lee, Young Ae; Hübner, Norbert; Bicknell, Louise; Blum, Sophia; Krug, Claudia; Schmidt, Franziska; Kretschmer, Stefanie; Koss, Sarah; Astell, Katy R.; Ramantani, Georgia; Bauerfeind, Anja; Morris, David L.; Cunninghame Graham, Deborah S.; Bubeck, Doryen; Leitch, Andrea; Ralston, Stuart H.; Blackburn, Elizabeth A.; Gahr, Manfred; Witte, Torsten; Vyse, Timothy J.; Melchers, Inga; Mangold, Elisabeth; Nöthen, Markus M.; Aringer, Martin; Kuhn, Annegret; Lüthke, Kirsten; Unger, Leonore; Bley, Annette; Lorenzi, Alice; Isaacs, John D.; Alexopoulou, Dimitra; Conrad, Karsten; Dahl, Andreas; Roers, Axel; Alarcon-Riquelme, Marta E.; Jackson, Andrew P.; Lee-Kirsch, Min Ae


    Genome integrity is continuously challenged by the DNA damage that arises during normal cell metabolism. Biallelic mutations in the genes encoding the genome surveillance enzyme ribonuclease H2 (RNase H2) cause Aicardi-Goutières syndrome (AGS), a pediatric disorder that shares features with the autoimmune disease systemic lupus erythematosus (SLE). Here we determined that heterozygous parents of AGS patients exhibit an intermediate autoimmune phenotype and demonstrated a genetic association between rare RNASEH2 sequence variants and SLE. Evaluation of patient cells revealed that SLE- and AGS-associated mutations impair RNase H2 function and result in accumulation of ribonucleotides in genomic DNA. The ensuing chronic low level of DNA damage triggered a DNA damage response characterized by constitutive p53 phosphorylation and senescence. Patient fibroblasts exhibited constitutive upregulation of IFN-stimulated genes and an enhanced type I IFN response to the immunostimulatory nucleic acid polyinosinic:polycytidylic acid and UV light irradiation, linking RNase H2 deficiency to potentiation of innate immune signaling. Moreover, UV-induced cyclobutane pyrimidine dimer formation was markedly enhanced in ribonucleotide-containing DNA, providing a mechanism for photosensitivity in RNase H2–associated SLE. Collectively, our findings implicate RNase H2 in the pathogenesis of SLE and suggest a role of DNA damage–associated pathways in the initiation of autoimmunity. PMID:25500883

  12. Promoted electron transfer of mitoxantrone binding with DNA by cytochrome c

    SciTech Connect

    Li Nan; Yang Xiurong . E-mail:


    A promoted electron transfer of an antitumor drug, mitoxantrone (MTX), intercalating into DNA duplex was successfully obtained upon addition of cytochromes c (cyt. c) in NaAc-HAc buffer solution (pH 4.5). The experimental results suggested that co-existence of MTX and cyt. c in the DNA helix is an important factor for accelerated electron transfer of MTX, where the promoter, cyt. c, operated smoothly through the DNA bridge. The UV/Vis spectroscopic experiments further confirmed the interaction process. Furthermore, a possible mechanism of such reaction was also discussed in this paper.

  13. Polymer Multilayers that Promote the Rapid Release and Contact Transfer of DNA.


    Yu, Yan; Si, Yi; Bechler, Shane L; Liu, Bo; Lynn, David M


    We report a layer-by-layer approach to the fabrication of thin polymer-based multilayers that release DNA rapidly in physiologically relevant environments. This approach exploits the properties of a weak anionic polyelectrolyte [poly(acrylic acid); PAA] to disrupt ionic interactions and promote disassembly in coatings that otherwise erode slowly. We investigated this approach using multilayers fabricated from plasmid DNA and linear poly(ethylenimine) (LPEI), a model synthetic cationic polymer used widely for DNA delivery. LPEI/DNA multilayers erode and release DNA slowly over ∼4 days when incubated in PBS buffer. In contrast, substitution of every other layer of DNA with PAA lead to thin films that released DNA rapidly, with >60% being released in the first 5 min. These quick-release coatings release bioactive DNA and can be used to fabricate uniform coatings on a variety of objects, including the tips of inflatable balloon catheters. We demonstrate that these coatings can promote high levels of cell transfection in vitro and the robust contact transfer and expression of DNA in vascular tissue in vivo using a rat model of vascular injury. These materials provide useful alternatives to multilayers and other coatings that promote the prolonged release of DNA. More broadly, approaches that depart from the use of degradable polymers to promote film erosion create opportunities to design new gene delivery coatings using a broader range of polymer-based building blocks designed for other gene delivery applications. With further development, this approach could thus provide a new and useful platform for the rapid contact transfer of DNA to cells and tissues of interest in a range of fundamental and applied contexts. PMID:26285737

  14. DNA supercoiling and the leu-500 promoter mutation of Salmonella typhimurium.

    PubMed Central

    Richardson, S M; Higgins, C F; Lilley, D M


    DNA supercoiling is an important, but relatively poorly understood factor which influences promoter function. leu-500 is a point mutation in the promoter of the leucine operon of Salmonella typhimurium which confers leucine auxotrophy. It can be phenotypically suppressed by mutations in the topA gene, which encodes topoisomerase I, implicating DNA supercoiling in the regulation of this promoter. We have demonstrated that phenotypic suppression of this mutant promoter is transcriptional, and that topA mutations restore function to the mutant promoter. Transcription from the leu-500 promoter was examined in a series of strains harbouring topA and tos (presumptive gyr) mutations, each of which exhibits a different level of in vivo plasmid supercoiling. Promoter function did not correlate with the level of supercoiling but rather with the presence or absence of a functional topA gene. Furthermore, when cloned onto a multicopy plasmid, the leu-500 promoter failed to function, even in a topA background. Thus, local rather than global changes in DNA topology are implicated in the activation of this promoter. Images PMID:2844526

  15. Screening of promoters from rhizosphere metagenomic DNA using a promoter-trap vector and flow cytometric cell sorting.


    Lee, Se Hee; Kim, Jeong Myeong; Lee, Hyo Jung; Jeon, Che Ok


    We constructed a facilitative and efficient promoter-trap vector, pCM-EGFP, for capturing and analyzing functional promoters from environmental DNA. The pCM-EGFP vector showed good chloramphenicol sensitivity and no enhanced green fluorescent protein (EGFP) gene expression. Promoter libraries were constructed for screening promoters responding to naringenin, a key molecule released from plant roots. After electroporation, E. coli transformants were incubated in LB broth containing chloramphenicol (10 μg/ml) to select against transformants with no cloned promoter. E. coli cells were sorted using flow cytometry without naringenin, and then sorted again with high fluorescence after incubation in LB broth with naringenin (1 mM) at 28 °C for 12 h. The inducible properties of approximately 400 sorted cells were evaluated, with most cells showing only strong EGFP gene expression without inducible properties. Two clones (5-4E and 15-3D) displayed naringenin inducibility, and both contained a promoter bounded by a TetR-family regulator. The regulator knock-out mutant of the 5-4E clone lost its ability to be induced by naringenin. In conclusion, the pCM-EGFP vector may be used as an efficient promoter-trap vector and a combination of the vector with flow cytometric cell sorting was demonstrated to be an useful method for screening promoters responding to specific conditions or inducers. PMID:21259288

  16. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate–Vertebrate Boundary

    PubMed Central

    Keller, Thomas E.; Han, Priscilla; Yi, Soojin V.


    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate–vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate–vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. PMID:26715626

  17. Fission Yeast Pxd1 Promotes Proper DNA Repair by Activating Rad16XPF and Inhibiting Dna2

    PubMed Central

    Zhang, Jia-Min; Liu, Xiao-Man; Ding, Yue-He; Xiong, Liang-Yao; Ren, Jing-Yi; Zhou, Zhi-Xiong; Wang, Hai-Tao; Zhang, Mei-Jun; Yu, Yang; Dong, Meng-Qiu; Du, Li-Lin


    Structure-specific nucleases play crucial roles in many DNA repair pathways. They must be precisely controlled to ensure optimal repair outcomes; however, mechanisms of their regulation are not fully understood. Here, we report a fission yeast protein, Pxd1, that binds to and regulates two structure-specific nucleases: Rad16XPF-Swi10ERCC1 and Dna2-Cdc24. Strikingly, Pxd1 influences the activities of these two nucleases in opposite ways: It activates the 3′ endonuclease activity of Rad16-Swi10 but inhibits the RPA-mediated activation of the 5′ endonuclease activity of Dna2. Pxd1 is required for Rad16-Swi10 to function in single-strand annealing, mating-type switching, and the removal of Top1-DNA adducts. Meanwhile, Pxd1 attenuates DNA end resection mediated by the Rqh1-Dna2 pathway. Disabling the Dna2-inhibitory activity of Pxd1 results in enhanced use of a break-distal repeat sequence in single-strand annealing and a greater loss of genetic information. We propose that Pxd1 promotes proper DNA repair by differentially regulating two structure-specific nucleases. PMID:25203555

  18. Structural Basis for DNA-Hairpin Promoter Recognition by the Bacteriophage N4 Virion RNA Polymerase

    SciTech Connect

    Gleghorn, M.; Davydova, E; Rothman-Denes, L; Murakami, K


    Coliphage N4 virion-encapsidated RNA polymerase (vRNAP) is a member of the phage T7-like single-subunit RNA polymerase (RNAP) family. Its central domain (mini-vRNAP) contains all RNAP functions of the full-length vRNAP, which recognizes a 5 to 7 base pair stem and 3 nucleotide loop hairpin DNA promoter. Here, we report the X-ray crystal structures of mini-vRNAP bound to promoters. Mini-vRNAP uses four structural motifs to recognize DNA sequences at the hairpin loop and stem and to unwind DNA. Despite their low sequence similarity, three out of four motifs are shared with T7 RNAP that recognizes a double-stranded DNA promoter. The binary complex structure and results of engineered disulfide linkage experiments reveal that the plug and motif B loop, which block the access of template DNA to the active site in the apo-form mini-vRNAP, undergo a large-scale conformational change upon promoter binding, explaining the restricted promoter specificity that is critical for N4 phage early transcription.

  19. DNA damage-induced type I interferon promotes senescence and inhibits stem cell function

    PubMed Central

    Carbone, Christopher J.; Zhao, Bin; Katlinski, Kanstantsin V.; Zheng, Hui; Guha, Manti; Li, Ning; Chen, Qijun; Yang, Ting; Lengner, Christopher J.; Greenberg, Roger A.; Johnson, F. Brad; Fuchs, Serge Y.


    Expression of type I interferons (IFN) can be induced by DNA damaging agents but the mechanisms and significance of this regulation are not completely understood. We found that the transcription factor IRF3, activated in an ATM-IKKα/β dependent manner, stimulates cell-autonomous IFNβ expression in response to double-stranded DNA breaks. Cells and tissues with accumulating DNA damage produce endogenous IFNβ and stimulate IFN signaling in vitro and in vivo. In turn, IFN acts to amplify DNA damage responses, activate the p53 pathway, promote senescence and inhibit stem cells function in response to telomere shortening. Inactivation of the IFN pathway abrogates the development of diverse progeric phenotypes and extends the life span of Terc knockout mice. These data identify DNA damage response-induced IFN signaling as a critical mechanism that links accumulating DNA damage with senescence and premature aging. PMID:25921537

  20. DNA/Amphiphilic Block Copolymer Nanospheres Promote Low-dose DNA Vaccination

    PubMed Central

    McIlroy, Dorian; Barteau, Benoît; Cany, Jeannette; Richard, Peggy; Gourden, Clothilde; Conchon, Sophie; Pitard, Bruno


    Intramuscular (i.m.) DNA vaccination induces strong cellular immune responses in the mouse, but only at DNA doses that cannot be achieved in humans. Because antigen expression is weak after naked DNA injection, we screened five nonionic block copolymers of poly(ethyleneoxide)-poly(propyleneoxide) (PEO-PPO) for their ability to enhance DNA vaccination using a β-galactosidase (βGal) encoding plasmid, pCMV-βGal, as immunogen. At a high DNA dose, formulation with the tetrafunctional block copolymers 304 (molecular weight [MW] 1,650) and 704 (MW 5,500) and the triblock copolymer Lutrol (MW 8,600) increased βGal-specific interferon-γ enzyme-linked immunosorbent spot (ELISPOT) responses 2–2.5-fold. More importantly, 704 allowed significant reductions in the dose of antigen-encoding plasmid. A single injection of 2 µg pCMV-βGal with 704 gave humoral and ELISPOT responses equivalent to those obtained with 100 µg naked DNA and conferred protection in tumor vaccination models. However, 704 had no adjuvant properties for βGal protein, and immune responses were only elicited by low doses of pCMV-βGal formulated with 704 if noncoding carrier DNA was added to maintain total DNA dose at 20 µg. Overall, these results show that formulation with 704 and carrier DNA can reduce the dose of antigen-encoding plasmid by at least 50-fold. PMID:19417740

  1. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways.


    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina


    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP-DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly different conditions. Employing single-pair fluorescence resonance energy transfer, we monitored DNA bending by eukaryotic and archaeal TBPs in the absence and presence of TFB in real-time. We observed that the lifetime of the TBP-DNA interaction differs significantly between the archaeal and eukaryotic system. We show that the eukaryotic DNA-TBP interaction is characterized by a linear, stepwise bending mechanism with an intermediate state distinguished by a distinct bending angle. TF(II)B specifically stabilizes the fully bent TBP-promoter DNA complex and we identify this step as a regulatory checkpoint. In contrast, the archaeal TBP-DNA interaction is extremely dynamic and TBP from the archaeal organism Sulfolobus acidocaldarius strictly requires TFB for DNA bending. Thus, we demonstrate that transcription initiation follows diverse pathways on the way to the formation of the pre-initiation complex. PMID:24744242

  2. FBH1 promotes DNA double-strand breakage and apoptosis in response to DNA replication stress.


    Jeong, Yeon-Tae; Rossi, Mario; Cermak, Lukas; Saraf, Anita; Florens, Laurence; Washburn, Michael P; Sung, Patrick; Schildkraut, Carl L; Schildkraut, Carl; Pagano, Michele


    Proper resolution of stalled replication forks is essential for genome stability. Purification of FBH1, a UvrD DNA helicase, identified a physical interaction with replication protein A (RPA), the major cellular single-stranded DNA (ssDNA)-binding protein complex. Compared with control cells, FBH1-depleted cells responded to replication stress with considerably fewer double-strand breaks (DSBs), a dramatic reduction in the activation of ATM and DNA-PK and phosphorylation of RPA2 and p53, and a significantly increased rate of survival. A minor decrease in ssDNA levels was also observed. All these phenotypes were rescued by wild-type FBH1, but not a FBH1 mutant lacking helicase activity. FBH1 depletion had no effect on other forms of genotoxic stress in which DSBs form by means that do not require ssDNA intermediates. In response to catastrophic genotoxic stress, apoptosis prevents the persistence and propagation of DNA lesions. Our findings show that FBH1 helicase activity is required for the efficient induction of DSBs and apoptosis specifically in response to DNA replication stress. PMID:23319600

  3. Uracil-DNA Glycosylase UNG Promotes Tet-mediated DNA Demethylation.


    Xue, Jian-Huang; Xu, Gui-Fang; Gu, Tian-Peng; Chen, Guo-Dong; Han, Bin-Bin; Xu, Zhi-Mei; Bjørås, Magnar; Krokan, Hans E; Xu, Guo-Liang; Du, Ya-Rui


    In mammals, active DNA demethylation involves oxidation of 5-methylcytosine (5mC) into 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) by Tet dioxygenases and excision of these two oxidized bases by thymine DNA glycosylase (TDG). Although TDG is essential for active demethylation in embryonic stem cells and induced pluripotent stem cells, it is hardly expressed in mouse zygotes and dispensable in pronuclear DNA demethylation. To search for other factors that might contribute to demethylation in mammalian cells, we performed a functional genomics screen based on a methylated luciferase reporter assay. UNG2, one of the glycosylases known to excise uracil residues from DNA, was found to reduce DNA methylation, thus activating transcription of a methylation-silenced reporter gene when co-transfected with Tet2 into HEK293T cells. Interestingly, UNG2 could decrease 5caC from the genomic DNA and a reporter plasmid in transfected cells, like TDG. Furthermore, deficiency in Ung partially impaired DNA demethylation in mouse zygotes. Our results suggest that UNG might be involved in Tet-mediated DNA demethylation. PMID:26620559

  4. Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation

    PubMed Central

    Arab, Khelifa; Kienhöfer, Sabine; von Seggern, Annika; Niehrs, Christof


    DNA 5-methylcytosine is a dynamic epigenetic mark which plays important roles in development and disease. In the Tet-Tdg demethylation pathway, methylated cytosine is iteratively oxidized by Tet dioxygenases and unmodified cytosine is restored via thymine DNA glycosylase (Tdg). Here we show that human NEIL1 and NEIL2 DNA glycosylases coordinate abasic site processing during TET–TDG DNA demethylation. NEIL1 and NEIL2 cooperate with TDG during base excision: TDG occupies the abasic site and is displaced by NEILs, which further process the baseless sugar, thereby stimulating TDG substrate turnover. In early Xenopus embryos Neil2 cooperates with Tdg to remove oxidized methylcytosines and to specify neural crest development together with Tet3. Thus, Neils function as AP lyases in the coordinated AP site hand-over during oxidative DNA demethylation. PMID:26751644

  5. TDP1 promotes assembly of non-homologous end joining protein complexes on DNA.


    Heo, Jinho; Li, Jing; Summerlin, Matthew; Hays, Annette; Katyal, Sachin; McKinnon, Peter J; Nitiss, Karin C; Nitiss, John L; Hanakahi, Leslyn A


    The repair of DNA double-strand breaks (DSB) is central to the maintenance of genomic integrity. In tumor cells, the ability to repair DSBs predicts response to radiation and many cytotoxic anti-cancer drugs. DSB repair pathways include homologous recombination and non-homologous end joining (NHEJ). NHEJ is a template-independent mechanism, yet many NHEJ repair products carry limited genetic changes, which suggests that NHEJ includes mechanisms to minimize error. Proteins required for mammalian NHEJ include Ku70/80, the DNA-dependent protein kinase (DNA-PKcs), XLF/Cernunnos and the XRCC4:DNA ligase IV complex. NHEJ also utilizes accessory proteins that include DNA polymerases, nucleases, and other end-processing factors. In yeast, mutations of tyrosyl-DNA phosphodiesterase (TDP1) reduced NHEJ fidelity. TDP1 plays an important role in repair of topoisomerase-mediated DNA damage and 3'-blocking DNA lesions, and mutation of the human TDP1 gene results in an inherited human neuropathy termed SCAN1. We found that human TDP1 stimulated DNA binding by XLF and physically interacted with XLF to form TDP1:XLF:DNA complexes. TDP1:XLF interactions preferentially stimulated TDP1 activity on dsDNA as compared to ssDNA. TDP1 also promoted DNA binding by Ku70/80 and stimulated DNA-PK activity. Because Ku70/80 and XLF are the first factors recruited to the DSB at the onset of NHEJ, our data suggest a role for TDP1 during the early stages of mammalian NHEJ. PMID:25841101

  6. FANCM interacts with PCNA to promote replication traverse of DNA interstrand crosslinks.


    Rohleder, Florian; Huang, Jing; Xue, Yutong; Kuper, Jochen; Round, Adam; Seidman, Michael; Wang, Weidong; Kisker, Caroline


    FANCM is a highly conserved DNA remodeling enzyme that promotes the activation of the Fanconi anemia DNA repair pathway and facilitates replication traverse of DNA interstrand crosslinks. However, how FANCM interacts with the replication machinery to promote traverse remains unclear. Here, we show that FANCM and its archaeal homolog Hef from Thermoplasma acidophilum interact with proliferating cell nuclear antigen (PCNA), an essential co-factor for DNA polymerases in both replication and repair. The interaction is mediated through a conserved PIP-box; and in human FANCM, it is strongly stimulated by replication stress. A FANCM variant carrying a mutation in the PIP-box is defective in promoting replication traverse of interstrand crosslinks and is also inefficient in promoting FANCD2 monoubiquitination, a key step of the Fanconi anemia pathway. Our data reveal a conserved interaction mode between FANCM and PCNA during replication stress, and suggest that this interaction is essential for FANCM to aid replication machines to traverse DNA interstrand crosslinks prior to post-replication repair. PMID:26825464

  7. FANCM interacts with PCNA to promote replication traverse of DNA interstrand crosslinks

    PubMed Central

    Rohleder, Florian; Huang, Jing; Xue, Yutong; Kuper, Jochen; Round, Adam; Seidman, Michael; Wang, Weidong; Kisker, Caroline


    FANCM is a highly conserved DNA remodeling enzyme that promotes the activation of the Fanconi anemia DNA repair pathway and facilitates replication traverse of DNA interstrand crosslinks. However, how FANCM interacts with the replication machinery to promote traverse remains unclear. Here, we show that FANCM and its archaeal homolog Hef from Thermoplasma acidophilum interact with proliferating cell nuclear antigen (PCNA), an essential co-factor for DNA polymerases in both replication and repair. The interaction is mediated through a conserved PIP-box; and in human FANCM, it is strongly stimulated by replication stress. A FANCM variant carrying a mutation in the PIP-box is defective in promoting replication traverse of interstrand crosslinks and is also inefficient in promoting FANCD2 monoubiquitination, a key step of the Fanconi anemia pathway. Our data reveal a conserved interaction mode between FANCM and PCNA during replication stress, and suggest that this interaction is essential for FANCM to aid replication machines to traverse DNA interstrand crosslinks prior to post-replication repair. PMID:26825464

  8. Developmental- and differentiation-specific patterns of human gamma- and beta-globin promoter DNA methylation.


    Mabaera, Rodwell; Richardson, Christine A; Johnson, Kristin; Hsu, Mei; Fiering, Steven; Lowrey, Christopher H


    The mechanisms underlying the human fetal-to-adult beta-globin gene switch remain to be determined. While there is substantial experimental evidence to suggest that promoter DNA methylation is involved in this process, most data come from studies in nonhuman systems. We have evaluated human gamma- and beta-globin promoter methylation in primary human fetal liver (FL) and adult bone marrow (ABM) erythroid cells. Our results show that, in general, promoter methylation and gene expression are inversely related. However, CpGs at -162 of the gamma promoter and -126 of the beta promoter are hypomethylated in ABM and FL, respectively. We also studied gamma-globin promoter methylation during in vitro differentiation of erythroid cells. The gamma promoters are initially hypermethylated in CD34(+) cells. The upstream gamma promoter CpGs become hypomethylated during the preerythroid phase of differentiation and are then remethylated later, during erythropoiesis. The period of promoter hypomethylation correlates with transient gamma-globin gene expression and may explain the previously observed fetal hemoglobin production that occurs during early adult erythropoiesis. These results provide the first comprehensive survey of developmental changes in human gamma- and beta-globin promoter methylation and support the hypothesis that promoter methylation plays a role in human beta-globin locus gene switching. PMID:17456718

  9. APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.


    Nowarski, Roni; Kotler, Moshe


    High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. PMID:23598277

  10. Mesoscopic model and free energy landscape for protein-DNA binding sites: analysis of cyanobacterial promoters.


    Tapia-Rojo, Rafael; Mazo, Juan José; Hernández, José Ángel; Peleato, María Luisa; Fillat, María F; Falo, Fernando


    The identification of protein binding sites in promoter sequences is a key problem to understand and control regulation in biochemistry and biotechnological processes. We use a computational method to analyze promoters from a given genome. Our approach is based on a physical model at the mesoscopic level of protein-DNA interaction based on the influence of DNA local conformation on the dynamics of a general particle along the chain. Following the proposed model, the joined dynamics of the protein particle and the DNA portion of interest, only characterized by its base pair sequence, is simulated. The simulation output is analyzed by generating and analyzing the Free Energy Landscape of the system. In order to prove the capacity of prediction of our computational method we have analyzed nine promoters of Anabaena PCC 7120. We are able to identify the transcription starting site of each of the promoters as the most populated macrostate in the dynamics. The developed procedure allows also to characterize promoter macrostates in terms of thermo-statistical magnitudes (free energy and entropy), with valuable biological implications. Our results agree with independent previous experimental results. Thus, our methods appear as a powerful complementary tool for identifying protein binding sites in promoter sequences. PMID:25275384

  11. Mesoscopic Model and Free Energy Landscape for Protein-DNA Binding Sites: Analysis of Cyanobacterial Promoters

    PubMed Central

    Tapia-Rojo, Rafael; Mazo, Juan José; Hernández, José Ángel; Peleato, María Luisa; Fillat, María F.; Falo, Fernando


    The identification of protein binding sites in promoter sequences is a key problem to understand and control regulation in biochemistry and biotechnological processes. We use a computational method to analyze promoters from a given genome. Our approach is based on a physical model at the mesoscopic level of protein-DNA interaction based on the influence of DNA local conformation on the dynamics of a general particle along the chain. Following the proposed model, the joined dynamics of the protein particle and the DNA portion of interest, only characterized by its base pair sequence, is simulated. The simulation output is analyzed by generating and analyzing the Free Energy Landscape of the system. In order to prove the capacity of prediction of our computational method we have analyzed nine promoters of Anabaena PCC 7120. We are able to identify the transcription starting site of each of the promoters as the most populated macrostate in the dynamics. The developed procedure allows also to characterize promoter macrostates in terms of thermo-statistical magnitudes (free energy and entropy), with valuable biological implications. Our results agree with independent previous experimental results. Thus, our methods appear as a powerful complementary tool for identifying protein binding sites in promoter sequences. PMID:25275384

  12. Hepatoma-derived growth factor-related protein 2 promotes DNA repair by homologous recombination.


    Baude, Annika; Aaes, Tania Løve; Zhai, Beibei; Al-Nakouzi, Nader; Oo, Htoo Zarni; Daugaard, Mads; Rohde, Mikkel; Jäättelä, Marja


    We have recently identified lens epithelium-derived growth factor (LEDGF/p75, also known as PSIP1) as a component of the homologous recombination DNA repair machinery. Through its Pro-Trp-Trp-Pro (PWWP) domain, LEDGF/p75 binds to histone marks associated with active transcription and promotes DNA end resection by recruiting DNA endonuclease retinoblastoma-binding protein 8 (RBBP8/CtIP) to broken DNA ends. Here we show that the structurally related PWWP domain-containing protein, hepatoma-derived growth factor-related protein 2 (HDGFRP2), serves a similar function in homologous recombination repair. Its depletion compromises the survival of human U2OS osteosarcoma and HeLa cervix carcinoma cells and impairs the DNA damage-induced phosphorylation of replication protein A2 (RPA2) and the recruitment of DNA endonuclease RBBP8/CtIP to DNA double strand breaks. In contrast to LEDGF/p75, HDGFRP2 binds preferentially to histone marks characteristic for transcriptionally silent chromatin. Accordingly, HDGFRP2 is found in complex with the heterochromatin-binding chromobox homologue 1 (CBX1) and Pogo transposable element with ZNF domain (POGZ). Supporting the functionality of this complex, POGZ-depleted cells show a similar defect in DNA damage-induced RPA2 phosphorylation as HDGFRP2-depleted cells. These data suggest that HDGFRP2, possibly in complex with POGZ, recruits homologous recombination repair machinery to damaged silent genes or to active genes silenced upon DNA damage. PMID:26721387

  13. Hepatoma-derived growth factor-related protein 2 promotes DNA repair by homologous recombination

    PubMed Central

    Baude, Annika; Aaes, Tania Løve; Zhai, Beibei; Al-Nakouzi, Nader; Oo, Htoo Zarni; Daugaard, Mads; Rohde, Mikkel; Jäättelä, Marja


    We have recently identified lens epithelium-derived growth factor (LEDGF/p75, also known as PSIP1) as a component of the homologous recombination DNA repair machinery. Through its Pro-Trp-Trp-Pro (PWWP) domain, LEDGF/p75 binds to histone marks associated with active transcription and promotes DNA end resection by recruiting DNA endonuclease retinoblastoma-binding protein 8 (RBBP8/CtIP) to broken DNA ends. Here we show that the structurally related PWWP domain-containing protein, hepatoma-derived growth factor-related protein 2 (HDGFRP2), serves a similar function in homologous recombination repair. Its depletion compromises the survival of human U2OS osteosarcoma and HeLa cervix carcinoma cells and impairs the DNA damage-induced phosphorylation of replication protein A2 (RPA2) and the recruitment of DNA endonuclease RBBP8/CtIP to DNA double strand breaks. In contrast to LEDGF/p75, HDGFRP2 binds preferentially to histone marks characteristic for transcriptionally silent chromatin. Accordingly, HDGFRP2 is found in complex with the heterochromatin-binding chromobox homologue 1 (CBX1) and Pogo transposable element with ZNF domain (POGZ). Supporting the functionality of this complex, POGZ-depleted cells show a similar defect in DNA damage-induced RPA2 phosphorylation as HDGFRP2-depleted cells. These data suggest that HDGFRP2, possibly in complex with POGZ, recruits homologous recombination repair machinery to damaged silent genes or to active genes silenced upon DNA damage. PMID:26721387

  14. Differential DNA repair underlies mutation hotspots at active promoters in cancer genomes.


    Perera, Dilmi; Poulos, Rebecca C; Shah, Anushi; Beck, Dominik; Pimanda, John E; Wong, Jason W H


    Promoters are DNA sequences that have an essential role in controlling gene expression. While recent whole cancer genome analyses have identified numerous hotspots of somatic point mutations within promoters, many have not yet been shown to perturb gene expression or drive cancer development. As such, positive selection alone may not adequately explain the frequency of promoter point mutations in cancer genomes. Here we show that increased mutation density at gene promoters can be linked to promoter activity and differential nucleotide excision repair (NER). By analysing 1,161 human cancer genomes across 14 cancer types, we find evidence for increased local density of somatic point mutations within the centres of DNase I-hypersensitive sites (DHSs) in gene promoters. Mutated DHSs were strongly associated with transcription initiation activity, in which active promoters but not enhancers of equal DNase I hypersensitivity were most mutated relative to their flanking regions. Notably, analysis of genome-wide maps of NER shows that NER is impaired within the DHS centre of active gene promoters, while XPC-deficient skin cancers do not show increased promoter mutation density, pinpointing differential NER as the underlying cause of these mutation hotspots. Consistent with this finding, we observe that melanomas with an ultraviolet-induced DNA damage mutation signature show greatest enrichment of promoter mutations, whereas cancers that are not highly dependent on NER, such as colon cancer, show no sign of such enrichment. Taken together, our analysis has uncovered the presence of a previously unknown mechanism linking transcription initiation and NER as a major contributor of somatic point mutation hotspots at active gene promoters in cancer genomes. PMID:27075100

  15. Structures, folding patterns, and functions of intramolecular DNA G-quadruplexes found in eukaryotic promoter regions

    PubMed Central

    Qin, Yong; Hurley, Laurence H.


    In its simplest form, a DNA G-quadruplex is a four-stranded DNA structure that is composed of stacked guanine tetrads. G-quadruplex-forming sequences have been identified in eukaryotic telomeres, as well as in non-telomeric genomic regions, such as gene promoters, recombination sites, and DNA tandem repeats. Of particular interest are the G-quadruplex structures that form in gene promoter regions, which have emerged as potential targets for anticancer drug development. Evidence for the formation of G-quadruplex structures in living cells continues to grow. In this review, we examine recent studies on intramolecular G-quadruplex structures that form in the promoter regions of some human genes in living cells and discuss the biological implications of these structures. The identification of G-quadruplex structures in promoter regions provides us with new insights into the fundamental aspects of G-quadruplex topology and DNA sequence–structure relationships. Progress in G-quadruplex structural studies and the validation of the biological role of these structures in cells will further encourage the development of small molecules that target these structures to specifically modulate gene transcription. PMID:18355457

  16. Effect of oxidative DNA damage in promoter elements on transcription factor binding.

    PubMed Central

    Ghosh, R; Mitchell, D L


    Reactive oxygen species produced by endogenous metabolic activity and exposure to a multitude of exogenous agents impact cells in a variety of ways. The DNA base damage 8-oxodeoxyguanosine (8-oxodG) is a prominent indicator of oxidative stress and has been well-characterized as a premutagenic lesion in mammalian cells and putative initiator of the carcinogenic process. Commensurate with the recent interest in epigenetic pathways of cancer causation we investigated how 8-oxodG alters the interaction between cis elements located on gene promoters and sequence-specific DNA binding proteins associated with these promoters. Consensus binding sequences for the transcription factors AP-1, NF-kappaB and Sp1 were modified site-specifically at guanine residues and electrophoretic mobility shift assays were performed to assess DNA-protein interactions. Our results indicate that whereas a single 8-oxodG was sufficient to inhibit transcription factor binding to AP-1 and Sp1 sequences it had no effect on binding to NF-kappaB, regardless of its position. We conclude from these data that minor alterations in base composition at a crucial position within some, but not all, promoter elements have the ability to disrupt transcription factor binding. The lack of inhibition by damaged NF-kappaB sequences suggests that DNA-protein contact sites may not be as determinative for stable p50 binding to this promoter as other, as yet undefined, structural parameters. PMID:10454620

  17. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA

    PubMed Central

    Orzalli, Megan H.; Conwell, Sara E.; Berrios, Christian; DeCaprio, James A.; Knipe, David M.


    Mammalian cells have evolved mechanisms to silence foreign DNA introduced by viruses or by transfection. Upon herpesviral infection of cells, the viral genome is chromatinized in an attempt by the host cell to restrict expression of the viral genome. HSV ICP0 acts to counter host-intrinsic and innate responses to viral infection. We have found that nuclear interferon (IFN)-inducible protein 16 (IFI16) acts as a restriction factor against ICP0-null herpes simplex virus 1 (HSV-1) to limit viral replication and immediate–early gene expression. IFI16 promoted the addition of heterochromatin marks and the reduction of euchromatin marks on viral chromatin. IFI16 also restricted the expression of plasmid DNAs introduced by transfection but did not restrict SV40 DNA introduced into the cellular nucleus in the form of nucleosomal chromatin by viral infection. These results argue that IFI16 restricts unchromatinized DNA when it enters the cell nucleus by promoting the loading of nucleosomes and the addition of heterochromatin marks. Furthermore, these results indicate that IFI16 provides a broad surveillance role against viral and transfected DNA by promoting restriction of gene expression from the exogenous DNA and inducing innate immune responses. PMID:24198334

  18. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA.


    Orzalli, Megan H; Conwell, Sara E; Berrios, Christian; DeCaprio, James A; Knipe, David M


    Mammalian cells have evolved mechanisms to silence foreign DNA introduced by viruses or by transfection. Upon herpesviral infection of cells, the viral genome is chromatinized in an attempt by the host cell to restrict expression of the viral genome. HSV ICP0 acts to counter host-intrinsic and innate responses to viral infection. We have found that nuclear interferon (IFN)-inducible protein 16 (IFI16) acts as a restriction factor against ICP0-null herpes simplex virus 1 (HSV-1) to limit viral replication and immediate-early gene expression. IFI16 promoted the addition of heterochromatin marks and the reduction of euchromatin marks on viral chromatin. IFI16 also restricted the expression of plasmid DNAs introduced by transfection but did not restrict SV40 DNA introduced into the cellular nucleus in the form of nucleosomal chromatin by viral infection. These results argue that IFI16 restricts unchromatinized DNA when it enters the cell nucleus by promoting the loading of nucleosomes and the addition of heterochromatin marks. Furthermore, these results indicate that IFI16 provides a broad surveillance role against viral and transfected DNA by promoting restriction of gene expression from the exogenous DNA and inducing innate immune responses. PMID:24198334

  19. Rep provides a second motor at the replisome to promote duplication of protein-bound DNA.


    Guy, Colin P; Atkinson, John; Gupta, Milind K; Mahdi, Akeel A; Gwynn, Emma J; Rudolph, Christian J; Moon, Peter B; van Knippenberg, Ingeborg C; Cadman, Chris J; Dillingham, Mark S; Lloyd, Robert G; McGlynn, Peter


    Nucleoprotein complexes present challenges to genome stability by acting as potent blocks to replication. One attractive model of how such conflicts are resolved is direct targeting of blocked forks by helicases with the ability to displace the blocking protein-DNA complex. We show that Rep and UvrD each promote movement of E. coli replisomes blocked by nucleoprotein complexes in vitro, that such an activity is required to clear protein blocks (primarily transcription complexes) in vivo, and that a polarity of translocation opposite that of the replicative helicase is critical for this activity. However, these two helicases are not equivalent. Rep but not UvrD interacts physically and functionally with the replicative helicase. In contrast, UvrD likely provides a general means of protein-DNA complex turnover during replication, repair, and recombination. Rep and UvrD therefore provide two contrasting solutions as to how organisms may promote replication of protein-bound DNA. PMID:19941825

  20. Compilation and analysis of DNA sequences associated with apparent streptomycete promoters.

    PubMed Central

    Strohl, W R


    The DNA sequences associated with 139 apparent streptomycete transcriptional start sites are compiled and compared. Of these, 29 promoters appeared to belong to a group which are similar to those recognized by eubacterial RNA polymerases containing sigma 70-like subunits. The other 110 putative promoter regions contain a wide diversity of sequences; several of these promoters have obvious sequence similarities in the -10 and/or -35 regions. The apparent Shine-Dalgarno regions of 44 streptomycete genes are also examined and compared. These were found to have a wide range of degree of complementarity to the 3' end of streptomycete 16S rRNA. Eleven streptomycete genes are described and compared in which transcription and translation are proposed to be initiated from the same or nearby nucleotide. An updated consensus sequence for the E sigma 70-like promoters is proposed and a potential group of promoter sequences containing guanine-rich -35 regions also is identified. PMID:1549509

  1. Mechanism of Microhomology-Mediated End-Joining Promoted by Human DNA Polymerase Theta

    PubMed Central

    Kent, Tatiana; Chandramouly, Gurushankar; McDevitt, Shane Michael; Ozdemir, Ahmet Y.; Pomerantz, Richard T.


    Microhomology-mediated end-joining (MMEJ) is an error-prone alternative double-strand break repair pathway that utilizes sequence microhomology to recombine broken DNA. Although MMEJ is implicated in cancer development, the mechanism of this pathway is unknown. We demonstrate that purified human DNA polymerase θ (Polθ) performs MMEJ of DNA containing 3’ single-strand DNA overhangs with two or more base-pairs of homology, including DNA modeled after telomeres, and show that MMEJ is dependent on Polθ in human cells. Our data support a mechanism whereby Polθ facilitates end-joining and microhomology annealing then utilizes the opposing overhang as a template in trans which stabilizes the DNA synapse. Polθ exhibits a preference for DNA containing a 5’-terminal phosphate, similar to polymerases involved in non-homologous end-joining. Lastly, we identify a conserved loop domain that is essential for MMEJ and higher-order structures of Polθ which likely promote DNA synapse formation. PMID:25643323

  2. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.


    Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong


    Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. PMID:27053724

  3. Epigenetic features in the oyster Crassostrea gigas suggestive of functionally relevant promoter DNA methylation in invertebrates.


    Rivière, Guillaume


    DNA methylation is evolutionarily conserved. Vertebrates exhibit high, widespread DNA methylation whereas invertebrate genomes are less methylated, predominantly within gene bodies. DNA methylation in invertebrates is associated with transcription level, alternative splicing, and genome evolution, but functional outcomes of DNA methylation remain poorly described in lophotrochozoans. Recent genome-wide approaches improve understanding in distant taxa such as molluscs, where the phylogenetic position, and life traits of Crassostrea gigas make this bivalve an ideal model to study the physiological and evolutionary implications of DNA methylation. We review the literature about DNA methylation in invertebrates and focus on DNA methylation features in the oyster. Indeed, though our MeDIP-seq results confirm predominant intragenic methylation, the profiles depend on the oyster's developmental and reproductive stage. We discuss the perspective that oyster DNA methylation could be biased toward the 5'-end of some genes, depending on physiological status, suggesting important functional outcomes of putative promoter methylation from cell differentiation during early development to sustained adaptation of the species to the environment. PMID:24778620

  4. Epigenetic features in the oyster Crassostrea gigas suggestive of functionally relevant promoter DNA methylation in invertebrates

    PubMed Central

    Rivière, Guillaume


    DNA methylation is evolutionarily conserved. Vertebrates exhibit high, widespread DNA methylation whereas invertebrate genomes are less methylated, predominantly within gene bodies. DNA methylation in invertebrates is associated with transcription level, alternative splicing, and genome evolution, but functional outcomes of DNA methylation remain poorly described in lophotrochozoans. Recent genome-wide approaches improve understanding in distant taxa such as molluscs, where the phylogenetic position, and life traits of Crassostrea gigas make this bivalve an ideal model to study the physiological and evolutionary implications of DNA methylation. We review the literature about DNA methylation in invertebrates and focus on DNA methylation features in the oyster. Indeed, though our MeDIP-seq results confirm predominant intragenic methylation, the profiles depend on the oyster's developmental and reproductive stage. We discuss the perspective that oyster DNA methylation could be biased toward the 5′-end of some genes, depending on physiological status, suggesting important functional outcomes of putative promoter methylation from cell differentiation during early development to sustained adaptation of the species to the environment. PMID:24778620

  5. Conserved Promoter Motif Is Required for Cell Cycle Timing of dnaX Transcription in Caulobacter

    PubMed Central

    Keiler, Kenneth C.; Shapiro, Lucy


    Cells use highly regulated transcriptional networks to control temporally regulated events. In the bacterium Caulobacter crescentus, many cellular processes are temporally regulated with respect to the cell cycle, and the genes required for these processes are expressed immediately before the products are needed. Genes encoding factors required for DNA replication, including dnaX, dnaA, dnaN, gyrB, and dnaK, are induced at the G1/S-phase transition. By analyzing mutations in the dnaX promoter, we identified a motif between the −10 and −35 regions that is required for proper timing of gene expression. This motif, named RRF (for repression of replication factors), is conserved in the promoters of other coordinately induced replication factors. Because mutations in the RRF motif result in constitutive gene expression throughout the cell cycle, this sequence is likely to be the binding site for a cell cycle-regulated transcriptional repressor. Consistent with this hypothesis, Caulobacter extracts contain an activity that binds specifically to the RRF in vitro. PMID:11466289

  6. DNA Polymerase δ Is Preferentially Recruited during Homologous Recombination To Promote Heteroduplex DNA Extension▿

    PubMed Central

    Maloisel, Laurent; Fabre, Francis; Gangloff, Serge


    DNA polymerases play a central role during homologous recombination (HR), but the identity of the enzyme(s) implicated remains elusive. The pol3-ct allele of the gene encoding the catalytic subunit of DNA polymerase δ (Polδ) has highlighted a role for this polymerase in meiotic HR. We now address the ubiquitous role of Polδ during HR in somatic cells. We find that pol3-ct affects gene conversion tract length during mitotic recombination whether the event is initiated by single-strand gaps following UV irradiation or by site-specific double-strand breaks. We show that the pol3-ct effects on gene conversion are completely independent of mismatch repair, indicating that shorter gene conversion tracts in pol3-ct correspond to shorter extensions of primed DNA synthesis. Interestingly, we find that shorter repair tracts do not favor synthesis-dependent strand annealing at the expense of double-strand-break repair. Finally, we show that the DNA polymerases that have been previously suspected to mediate HR repair synthesis (Polɛ and Polη) do not affect gene conversion during induced HR, including in the pol3-ct background. Our results argue strongly for the preferential recruitment of Polδ during HR. PMID:18086882

  7. Hematopoietic gene promoters subjected to a group-combinatorial study of DNA samples: identification of a megakaryocytic selective DNA signature

    PubMed Central

    Hazony, Yehonathan; Lu, Jun; St. Hilaire, Cynthia; Ravid, Katya


    Identification of common sub-sequences for a group of functionally related DNA sequences can shed light on the role of such elements in cell-specific gene expression. In the megakaryocytic lineage, no one single unique transcription factor was described as linage specific, raising the possibility that a cluster of gene promoter sequences presents a unique signature. Here, the megakaryocytic gene promoter group, which consists of both human and mouse 5′ non-coding regions, served as a case study. A methodology for group-combinatorial search has been implemented as a customized software platform. It extracts the longest common sequences for a group of related DNA sequences and allows for single gaps of varying length, as well as double- and multiple-gap sequences. The results point to common DNA sequences in a group of genes that is selectively expressed in megakaryocytes, and which does not appear in a large group of control, random and specific sequences. This suggests a role for a combination of these sequences in cell-specific gene expression in the megakaryocytic lineage. The data also point to an intrinsic cross-species difference in the organization of 5′ non-coding sequences within the mammalian genomes. This methodology may be used for the identification of regulatory sequences in other lineages. PMID:16936310

  8. APOBEC3 Cytidine Deaminases in Double-Strand DNA Break Repair and Cancer Promotion

    PubMed Central

    Nowarski, Roni; Kotler, Moshe


    High frequency of cytidine to thymidine conversions were identified in the genome of several types of cancer cells. In breast cancer cells these mutations are clustered in long DNA regions associated with ssDNA, double-strand DNA breaks (DSBs) and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs and clustered mutations. PMID:23598277

  9. The Transcription Factor TFII-I Promotes DNA Translesion Synthesis and Genomic Stability

    PubMed Central

    Fattah, Farjana J.; Hara, Kodai; Fattah, Kazi R.; Yang, Chenyi; Wu, Nan; Warrington, Ross; Chen, David J.; Zhou, Pengbo; Boothman, David A.; Yu, Hongtao


    Translesion synthesis (TLS) enables DNA replication through damaged bases, increases cellular DNA damage tolerance, and maintains genomic stability. The sliding clamp PCNA and the adaptor polymerase Rev1 coordinate polymerase switching during TLS. The polymerases Pol η, ι, and κ insert nucleotides opposite damaged bases. Pol ζ, consisting of the catalytic subunit Rev3 and the regulatory subunit Rev7, then extends DNA synthesis past the lesion. Here, we show that Rev7 binds to the transcription factor TFII-I in human cells. TFII-I is required for TLS and DNA damage tolerance. The TLS function of TFII-I appears to be independent of its role in transcription, but requires homodimerization and binding to PCNA. We propose that TFII-I bridges PCNA and Pol ζ to promote TLS. Our findings extend the general principle of component sharing among divergent nuclear processes and implicate TLS deficiency as a possible contributing factor in Williams-Beuren syndrome. PMID:24922507

  10. Architecture of the bacteriophage T4 activator MotA/promoter DNA interaction during sigma appropriation.


    Hsieh, Meng-Lun; James, Tamara D; Knipling, Leslie; Waddell, M Brett; White, Stephen; Hinton, Deborah M


    Gene expression can be regulated through factors that direct RNA polymerase to the correct promoter sequence at the correct time. Bacteriophage T4 controls its development in this way using phage proteins that interact with host RNA polymerase. Using a process called σ appropriation, the T4 co-activator AsiA structurally remodels the σ(70) subunit of host RNA polymerase, while a T4 activator, MotA, engages the C terminus of σ(70) and binds to a DNA promoter element, the MotA box. Structures for the N-terminal (NTD) and C-terminal (CTD) domains of MotA are available, but no structure exists for MotA with or without DNA. We report the first molecular map of the MotA/DNA interaction within the σ-appropriated complex, which we obtained by using the cleaving reagent, iron bromoacetamidobenzyl-EDTA (FeBABE). We conjugated surface-exposed, single cysteines in MotA with FeBABE and performed cleavage reactions in the context of stable transcription complexes. The DNA cleavage sites were analyzed using ICM Molsoft software and three-dimensional physical models of MotA(NTD), MotA(CTD), and the DNA to investigate shape complementarity between the protein and the DNA and to position MotA on the DNA. We found that the unusual "double wing" motif present within MotA(CTD) resides in the major groove of the MotA box. In addition, we have used surface plasmon resonance to show that MotA alone is in a very dynamic equilibrium with the MotA element. Our results demonstrate the utility of fine resolution FeBABE mapping to determine the architecture of protein-DNA complexes that have been recalcitrant to traditional structure analyses. PMID:23902794

  11. The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ.


    Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E; Takeda, Shunichi


    The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356

  12. XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation.


    Riballo, Enriqueta; Woodbine, Lisa; Stiff, Thomas; Walker, Sarah A; Goodarzi, Aaron A; Jeggo, Penny A


    XLF-Cernunnos (XLF) is a component of the DNA ligase IV-XRCC4 (LX) complex, which functions during DNA non-homologous end joining (NHEJ). Here, we use biochemical and cellular approaches to probe the impact of XLF on LX activities. We show that XLF stimulates adenylation of LX complexes de-adenylated by pyrophosphate or following LX decharging during ligation. XLF enhances LX ligation activity in an ATP-independent and dependent manner. ATP-independent stimulation can be attributed to enhanced end-bridging. Whilst ATP alone fails to stimulate LX ligation activity, addition of XLF and ATP promotes ligation in a manner consistent with XLF-stimulated readenylation linked to ligation. We show that XLF is a weakly bound partner of the tightly associated LX complex and, unlike XRCC4, is dispensable for LX stability. 2BN cells, which have little, if any, residual XLF activity, show a 3-fold decreased ability to repair DNA double strand breaks covering a range of complexity. These findings strongly suggest that XLF is not essential for NHEJ but promotes LX adenylation and hence ligation. We propose a model in which XLF, by in situ recharging DNA ligase IV after the first ligation event, promotes double stranded ligation by a single LX complex. PMID:19056826

  13. DNA strand annealing is promoted by the yeast Rad52 protein.

    PubMed Central

    Mortensen, U H; Bendixen, C; Sunjevaric, I; Rothstein, R


    The Saccharomyces cerevisiae RAD52 gene plays a pivotal role in genetic recombination. Here we demonstrate that yeast Rad52 is a DNA binding protein. To show that the interaction between Rad52 and DNA is direct and not mediated by other yeast proteins and to facilitate protein purification, a recombinant expression system was developed. The recombinant protein can bind both single- and double-stranded DNA and the addition of either Mg2+ or ATP does not enhance the binding of single-stranded DNA. Furthermore, a DNA binding domain was found in the evolutionary conserved N terminus of the protein. More importantly, we show that the protein stimulates DNA annealing even in the presence of a large excess of nonhomologous DNA. Rad52-promoted annealing follows second-order kinetics and the rate is 3500-fold faster than that of the spontaneous reaction. How this annealing activity relates to the genetic phenotype associated with rad52 mutant cells is discussed. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8855248

  14. Lamin A Is an Endogenous SIRT6 Activator and Promotes SIRT6-Mediated DNA Repair.


    Ghosh, Shrestha; Liu, Baohua; Wang, Yi; Hao, Quan; Zhou, Zhongjun


    The nuclear lamins are essential for various molecular events in the nucleus, such as chromatin organization, DNA replication, and provision of mechanical support. A specific point mutation in the LMNA gene creates a truncated prelamin A termed progerin, causing Hutchinson-Gilford progeria syndrome (HGPS). SIRT6 deficiency leads to defective genomic maintenance and accelerated aging similar to HGPS, suggesting a potential link between lamin A and SIRT6. Here, we report that lamin A is an endogenous activator of SIRT6 and facilitates chromatin localization of SIRT6 upon DNA damage. Lamin A promotes SIRT6-dependent DNA-PKcs (DNA-PK catalytic subunit) recruitment to chromatin, CtIP deacetylation, and PARP1 mono-ADP ribosylation in response to DNA damage. The presence of progerin jeopardizes SIRT6 activation and compromises SIRT6-mediated molecular events in response to DNA damage. These data reveal a critical role for lamin A in regulating SIRT6 activities, suggesting that defects in SIRT6 functions contribute to impaired DNA repair and accelerated aging in HGPS. PMID:26549451

  15. RAGE is a nucleic acid receptor that promotes inflammatory responses to DNA

    PubMed Central

    Sirois, Cherilyn M.; Jin, Tengchuan; Miller, Allison L.; Bertheloot, Damien; Nakamura, Hirotaka; Horvath, Gabor L.; Mian, Abubakar; Jiang, Jiansheng; Schrum, Jacob; Bossaller, Lukas; Pelka, Karin; Garbi, Natalio; Brewah, Yambasu; Tian, Jane; Chang, ChewShun; Chowdhury, Partha S.; Sims, Gary P.; Kolbeck, Roland; Coyle, Anthony J.; Humbles, Alison A.


    Recognition of DNA and RNA molecules derived from pathogens or self-antigen is one way the mammalian immune system senses infection and tissue damage. Activation of immune signaling receptors by nucleic acids is controlled by limiting the access of DNA and RNA to intracellular receptors, but the mechanisms by which endosome-resident receptors encounter nucleic acids from the extracellular space are largely undefined. In this study, we show that the receptor for advanced glycation end-products (RAGE) promoted DNA uptake into endosomes and lowered the immune recognition threshold for the activation of Toll-like receptor 9, the principal DNA-recognizing transmembrane signaling receptor. Structural analysis of RAGE–DNA complexes indicated that DNA interacted with dimers of the outermost RAGE extracellular domains, and could induce formation of higher-order receptor complexes. Furthermore, mice deficient in RAGE were unable to mount a typical inflammatory response to DNA in the lung, indicating that RAGE is important for the detection of nucleic acids in vivo. PMID:24081950

  16. In simple synthetic promoters YY1-induced DNA bending is important in transcription activation and repression.

    PubMed Central

    Kim, J; Shapiro, D J


    Depending on promoter context, YY1 can activate or repress transcription, or provide a site for transcription initiation. To investigate whether the ability of YY1 to induce DNA bending influenced its ability to activate and repress transcription, simple synthetic promoters were constructed in which the YY1 binding site was inserted between the TATA box and either the NF1 or AP1 recognition sequences. In transient transfections of COS cells, the NF1YY1TATA and NF1RYY1TATA promoters exhibited a dramatic 15-20-fold increase in correctly initiated transcription. These promoters exhibited even larger 60-80-fold increases in transcription in HeLa cells. Neither multiple copies of the YY1 binding site alone, nor placement of a YY1 site upstream of the NF1 site activated transcription. Deletion of 4 bp between the NF1 and YY1 sites, which changes the phase of the DNA bends, abolished the 16-fold activation of transcription by NF1YY1TATA. Insertion of the YY1 site between the AP1 site and the TATA box decreased transcription approximately 3-fold. Replacing the YY1 binding site with an intrinsic DNA bending sequence mimicked this transcription repression. Sequences of similar length which do not bend DNA fail to repress AP1-mediated transcription. Gel mobility shift assays were used to show that binding of YY1 to its recognition sequence did not repress binding of AP1 to its recognition sequences. Our data indicate that YY1-induced DNA bending may activate and repress transcription by changing the spatial relationships between transcription activators and components of the basal transcription apparatus. PMID:8932392

  17. Metal-responsive promoter DNA compaction by the ferric uptake regulator.


    Roncarati, Davide; Pelliciari, Simone; Doniselli, Nicola; Maggi, Stefano; Vannini, Andrea; Valzania, Luca; Mazzei, Luca; Zambelli, Barbara; Rivetti, Claudio; Danielli, Alberto


    Short-range DNA looping has been proposed to affect promoter activity in many bacterial species and operator configurations, but only few examples have been experimentally investigated in molecular detail. Here we present evidence for a metal-responsive DNA condensation mechanism controlled by the Helicobacter pylori ferric uptake regulator (Fur), an orthologue of the widespread Fur family of prokaryotic metal-dependent regulators. H. pylori Fur represses the transcription of the essential arsRS acid acclimation operon through iron-responsive oligomerization and DNA compaction, encasing the arsR transcriptional start site in a repressive macromolecular complex. A second metal-dependent regulator NikR functions as nickel-dependent anti-repressor at this promoter, antagonizing the binding of Fur to the operator elements responsible for the DNA condensation. The results allow unifying H. pylori metal ion homeostasis and acid acclimation in a mechanistically coherent model, and demonstrate, for the first time, the existence of a selective metal-responsive DNA compaction mechanism controlling bacterial transcriptional regulation. PMID:27558202

  18. Condensin promotes the juxtaposition of DNA flanking its loading site in Bacillus subtilis

    PubMed Central

    Wang, Xindan; Le, Tung B.K.; Lajoie, Bryan R.; Dekker, Job; Laub, Michael T.; Rudner, David Z.


    SMC condensin complexes play a central role in compacting and resolving replicated chromosomes in virtually all organisms, yet how they accomplish this remains elusive. In Bacillus subtilis, condensin is loaded at centromeric parS sites, where it encircles DNA and individualizes newly replicated origins. Using chromosome conformation capture and cytological assays, we show that condensin recruitment to origin-proximal parS sites is required for the juxtaposition of the two chromosome arms. Recruitment to ectopic parS sites promotes alignment of large tracks of DNA flanking these sites. Importantly, insertion of parS sites on opposing arms indicates that these “zip-up” interactions only occur between adjacent DNA segments. Collectively, our data suggest that condensin resolves replicated origins by promoting the juxtaposition of DNA flanking parS sites, drawing sister origins in on themselves and away from each other. These results are consistent with a model in which condensin encircles the DNA flanking its loading site and then slides down, tethering the two arms together. Lengthwise condensation via loop extrusion could provide a generalizable mechanism by which condensin complexes act dynamically to individualize origins in B. subtilis and, when loaded along eukaryotic chromosomes, resolve them during mitosis. PMID:26253537

  19. Metal-responsive promoter DNA compaction by the ferric uptake regulator

    PubMed Central

    Roncarati, Davide; Pelliciari, Simone; Doniselli, Nicola; Maggi, Stefano; Vannini, Andrea; Valzania, Luca; Mazzei, Luca; Zambelli, Barbara; Rivetti, Claudio; Danielli, Alberto


    Short-range DNA looping has been proposed to affect promoter activity in many bacterial species and operator configurations, but only few examples have been experimentally investigated in molecular detail. Here we present evidence for a metal-responsive DNA condensation mechanism controlled by the Helicobacter pylori ferric uptake regulator (Fur), an orthologue of the widespread Fur family of prokaryotic metal-dependent regulators. H. pylori Fur represses the transcription of the essential arsRS acid acclimation operon through iron-responsive oligomerization and DNA compaction, encasing the arsR transcriptional start site in a repressive macromolecular complex. A second metal-dependent regulator NikR functions as nickel-dependent anti-repressor at this promoter, antagonizing the binding of Fur to the operator elements responsible for the DNA condensation. The results allow unifying H. pylori metal ion homeostasis and acid acclimation in a mechanistically coherent model, and demonstrate, for the first time, the existence of a selective metal-responsive DNA compaction mechanism controlling bacterial transcriptional regulation. PMID:27558202

  20. Defined DNA sequences promote the assembly of a bacterial protein into distinct amyloid nanostructures

    PubMed Central

    Giraldo, Rafael


    RepA, the replication initiator protein of Pseudomonas pPS10 plasmid, is made of two winged-helix (WH) domains. RepA dimers undergo a structural transformation upon binding to origin DNA sequences (iterons), resulting in monomerization and α-helix into β-strand conversion. This affects the N-terminal domain (WH1) and generates a metastable intermediate. Here it is shown that the interaction of short dsDNA oligonucleotides, including iteron or operator RepA targets, with the isolated WH1 domain promotes the assembly of different nanostructures. These range from irregular aggregates to amyloid spheroids and fibers. Their intrinsic order inversely correlates with the extent of the transformation induced by each DNA sequence on RepA. However, DNA is not a constituent of the assembled fibers, in agreement with the protein-only principle for amyloid structure. Thus, the RepA-WH1 domain on DNA binding mimics the behavior of the mammalian prion protein. The stretch of amino acids responsible for WH1 aggregation has been identified, leading to the design of mutants with enhanced or reduced amyloidogenicity and the synthesis of a peptide that assembles into a cross-β structure. RepA amyloid assemblies could have a role in the negative regulation of plasmid replication. This article underlines the potential of specific nucleic acid sequences in promoting protein amyloidogenesis at nearly physiological conditions. PMID:17959784

  1. Condensin promotes the juxtaposition of DNA flanking its loading site in Bacillus subtilis.


    Wang, Xindan; Le, Tung B K; Lajoie, Bryan R; Dekker, Job; Laub, Michael T; Rudner, David Z


    SMC condensin complexes play a central role in compacting and resolving replicated chromosomes in virtually all organisms, yet how they accomplish this remains elusive. In Bacillus subtilis, condensin is loaded at centromeric parS sites, where it encircles DNA and individualizes newly replicated origins. Using chromosome conformation capture and cytological assays, we show that condensin recruitment to origin-proximal parS sites is required for the juxtaposition of the two chromosome arms. Recruitment to ectopic parS sites promotes alignment of large tracks of DNA flanking these sites. Importantly, insertion of parS sites on opposing arms indicates that these "zip-up" interactions only occur between adjacent DNA segments. Collectively, our data suggest that condensin resolves replicated origins by promoting the juxtaposition of DNA flanking parS sites, drawing sister origins in on themselves and away from each other. These results are consistent with a model in which condensin encircles the DNA flanking its loading site and then slides down, tethering the two arms together. Lengthwise condensation via loop extrusion could provide a generalizable mechanism by which condensin complexes act dynamically to individualize origins in B. subtilis and, when loaded along eukaryotic chromosomes, resolve them during mitosis. PMID:26253537

  2. cDNA cloning and promoter analysis of rat caspase-9.

    PubMed Central

    Nishiyama, J; Yi, X; Venkatachalam, M A; Dong, Z


    Caspase-9 is the apex caspase of the mitochondrial pathway of apoptosis, which plays a critical role in apoptotic initiation and progression. However, gene regulation of caspase-9 is largely unknown. This is in part due to the lack of information on the gene promoter. Here we have cloned the full-length cDNA of rat caspase-9 and have isolated promoter regions of this gene. The rat caspase-9 cDNA of 2058 bp predicts a protein of 454 amino acids, which contains a caspase-recruitment domain ('CARD') at the N-terminus and enzymic domains at the C-terminus. The enzyme's active site, with a characteristic motif of QACGG, was also identified. Overall, rat and human caspase-9 have 71% identity. With the cDNA sequence, we subsequently isolated the proximal 5'-flanking regions of rat caspase-9 by the procedure of genomic walking. The 2270 bp genomic segment is 'TATA-less', but contains several GC boxes. Elements binding known transcription factors such as Sp-1, Pit-1, CCAAT-enhancer-binding protein (C/EBP), glucocorticoid receptor and hypoxia-inducible factor 1 (HIF-1) were also identified. When cloned into reporter gene vectors, the genomic segment showed significant promoter activity, indicating that the 5'-flanking regions isolated by genomic walking contain the gene promoter of rat caspase-9. Of significance is that the cloned promoter segments were activated by severe hypoxia, conditions inducing caspase-9 transcription. Thus, the genomic sequences reported here contain not only the basal promoter of rat caspase-9 but also regulatory elements responsive to pathophysiological stimuli including hypoxia. PMID:11695991

  3. Cernunnos/XLF promotes the ligation of mismatched and noncohesive DNA ends.


    Tsai, Chun J; Kim, Sunny A; Chu, Gilbert


    Nonhomologous end-joining (NHEJ) repairs DNA double-strand breaks created by ionizing radiation or V(D)J recombination of the immunoglobulin genes. The breaks often leave mismatched or nonligatable ends, and NHEJ must repair the breaks with high efficiency and minimal nucleotide loss. Here, the NHEJ proteins Ku, DNA-dependent protein kinase catalytic subunit, XRCC4/Ligase IV, and Cernunnos/XRCC4-like factor joined mismatched and noncohesive DNA ends in the absence of processing factors. Depending on the mismatch, Cernunnos stimulated joining 8- to 150-fold. For substrates with a blunt end and a 3' overhanging end, Ku, XRCC4/Ligase IV, and Cernunnos ligated the 3' overhanging hydroxyl group to the 5' phosphate of the blunt end, leaving the other strand unjoined. This activity provides a mechanism for retaining 3' overhang sequences, as observed during V(D)J recombination in vivo. Thus, Cernunnos/XRCC4-like factor promotes a mismatched end (MEnd) DNA ligase activity to facilitate joining and to preserve DNA sequence. Furthermore, MEnd ligase activity may have applications in recombinant DNA technology. PMID:17470781

  4. Smad4 loss promotes lung cancer formation but increases sensitivity to DNA topoisomerase inhibitors.


    Haeger, S M; Thompson, J J; Kalra, S; Cleaver, T G; Merrick, D; Wang, X-J; Malkoski, S P


    Non-small-cell lung cancer (NSCLC) is a common malignancy with a poor prognosis. Despite progress targeting oncogenic drivers, there are no therapies targeting tumor-suppressor loss. Smad4 is an established tumor suppressor in pancreatic and colon cancer; however, the consequences of Smad4 loss in lung cancer are largely unknown. We evaluated Smad4 expression in human NSCLC samples and examined Smad4 alterations in large NSCLC data sets and found that reduced Smad4 expression is common in human NSCLC and occurs through a variety of mechanisms, including mutation, homozygous deletion and heterozygous loss. We modeled Smad4 loss in lung cancer by deleting Smad4 in airway epithelial cells and found that Smad4 deletion both initiates and promotes lung tumor development. Interestingly, both Smad4(-/-) mouse tumors and human NSCLC samples with reduced Smad4 expression demonstrated increased DNA damage, whereas Smad4 knockdown in lung cancer cells reduced DNA repair and increased apoptosis after DNA damage. In addition, Smad4-deficient NSCLC cells demonstrated increased sensitivity to both chemotherapeutics that inhibit DNA topoisomerase and drugs that block double-strand DNA break repair by non-homologous end joining. In sum, these studies establish Smad4 as a lung tumor suppressor and suggest that the defective DNA repair phenotype of Smad4-deficient tumors can be exploited by specific therapeutic strategies. PMID:25893305

  5. Distal enhancer regulation by promoter derepression in topologically constrained DNA in vitro

    PubMed Central

    Barton, Michelle Craig; Madani, Navid; Emerson, Beverly M.


    Long-range promoter–enhancer interactions are a crucial regulatory feature of many eukaryotic genes yet little is known about the mechanisms involved. Using cloned chicken βA-globin genes, either individually or within the natural chromosomal locus, enhancer-dependent transcription is achieved in vitro at a distance of 2 kb with developmentally staged erythroid extracts. This occurs by promoter derepression and is critically dependent upon DNA topology. In the presence of the enhancer, genes must exist in a supercoiled conformation to be actively transcribed, whereas relaxed or linear templates are inactive. Distal protein–protein interactions in vitro may be favored on supercoiled DNA because of topological constraints. In this system, enhancers act primarily to increase the probability of rapid and efficient transcription complex formation and initiation. Repressor and activator proteins binding within the promoter, including erythroid-specific GATA-1, mediate this process. PMID:9207078

  6. Condensin Promotes Position Effects within Tandem DNA Repeats via the RITS complex

    PubMed Central

    He, Haijin; Zhang, Shu; Wang, Danni; Hochwagen, Andreas; Li, Fei


    Summary Tandem repetitive DNA is highly abundant in eukaryotic genomes, and contributes to transcription control and genome stability. However, how the individual sequences within tandem repeats behave remains largely unknown. Here we develop a collection of fission yeast strains with a reporter gene inserted at different units in a tandem repeat array. We show that, contrary to what is usually assumed, transcriptional silencing and replication timing among the individual repeats differ significantly. RNAi-mediated H3K9 methylation is essential for the silencing position effect. A short hairpin RNA of ura4+ induces silencing in trans within the tandem array in a position-dependent manner. Importantly, the position effect depends on the condensin subunit, cut3+. Cut3 promotes the position effect via interaction with the RNA-induced transcriptional silencing (RITS) complex. This study reveals variations in silencing within tandem DNA repeats and provides mechanistic insights into how DNA repeats at the individual level are regulated. PMID:26832414

  7. Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival

    PubMed Central

    Tinkum, Kelsey L.; Stemler, Kristina M.; White, Lynn S.; Loza, Andrew J.; Jeter-Jones, Sabrina; Michalski, Basia M.; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S.; Piwnica-Worms, David; Piwnica-Worms, Helen


    Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy. PMID:26644583

  8. TH17 cells promote microbial killing and innate immune sensing of DNA via interleukin 26

    PubMed Central

    Meller, Stephan; Domizio, Jeremy Di; Voo, Kui S; Friedrich, Heike C; Chamilos, Georgios; Ganguly, Dipyaman; Conrad, Curdin; Gregorio, Josh; Roy, Didier Le; Roger, Thierry; Ladbury, John E; Homey, Bernhard; Watowich, Stanley; Modlin, Robert L; Kontoyiannis, Dimitrios P; Liu, Yong-Jun; Arold, Stefan T; Gilliet, Michel


    Interleukin 17–producing helper T cells (TH17 cells) have a major role in protection against infections and in mediating autoimmune diseases, yet the mechanisms involved are incompletely understood. We found that interleukin 26 (IL-26), a human TH17 cell–derived cytokine, is a cationic amphipathic protein that kills extracellular bacteria via membrane-pore formation. Furthermore, TH17 cell–derived IL-26 formed complexes with bacterial DNA and self-DNA released by dying bacteria and host cells. The resulting IL-26–DNA complexes triggered the production of type I interferon by plasmacytoid dendritic cells via activation of Toll-like receptor 9, but independently of the IL-26 receptor. These findings provide insights into the potent antimicrobial and proinflammatory function of TH17 cells by showing that IL-26 is a natural human antimicrobial that promotes immune sensing of bacterial and host cell death. PMID:26168081

  9. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    PubMed Central

    Li, Deming; Fan, Jinyu; Li, Ziwei; Xu, Cunshuan


    Epidermal growth factor (EGF), a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH) rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration. PMID:25071410

  10. Was cDNA sequences modulate transgene expression of was promoter-driven lentiviral vectors.


    Toscano, Miguel G; Benabdellah, Karim; Muñoz, Pilar; Frecha, Cecilia; Cobo, Marién; Martín, Francisco


    Abstract The development of vectors that express a therapeutic transgene efficiently and specifically in hematopoietic cells (HCs) is an important goal for gene therapy of hematological disorders. We have previously shown that a 500-bp fragment from the proximal Was gene promoter in a lentiviral vector (LV) was sufficient to achieve more than 100-fold higher levels of Wiskott-Aldrich syndrome protein in HCs than in nonhematopoietic cells (non-HCs). We show now that this differential was reduced up to 10 times when the enhanced green fluorescent protein gene (eGFP) was expressed instead of Was in the same LV backbone. Insertion of Was cDNA sequences downstream of eGFP in these LVs had a negative effect on transgene expression. This effect varied in different cell types but, overall, Was cDNA sequences increased the hematopoietic specificity of Was promoter-driven LV. We have characterized the minimal fragment required to increase hematopoietic specificity and have demonstrated that the mechanism involves Was promoter regulation and RNA processing. In addition, we have shown that Was cDNA sequences interfere with the enhancer activity of the woodchuck posttranscriptional regulatory element. These results represent the first data showing the role of Was intragenic sequences in gene regulation. PMID:19630517

  11. Rescue of Newcastle disease virus from cloned cDNA using an RNA polymerase II promoter.


    Li, Bao-Yu; Li, Xue-Rui; Lan, Xi; Yin, Xiang-Pin; Li, Zhi-Yong; Yang, Bin; Liu, Ji-Xing


    A new system was developed to improve the efficiency and simplify the procedure of recovery of Newcastle disease virus (NDV) from cloned cDNA. A full-length cDNA clone of mesogenic NDV vaccine strain Mukteswar was assembled from five subgenomic cDNA fragments and cloned into a plasmid allowing transcription driven by cellular RNA polymerase II. The full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta virus ribozyme (HdvRz) sequences, resulted in the synthesis of antigenomic RNA with exact termini. Without supplying T7 RNA polymerase, infectious NDV could be generated efficiently in some eukaryotic cell lines by simultaneous transcription of antigenomic RNA from the full-length plasmid and expression of NP, P and L proteins from helper plasmids introduced by cotransfection. The efficiency of recovery with the conventional T7 promoter system based on BRS-T7 cells and the cytomegalovirus (CMV) promoter system was compared, and the results demonstrate that the new system facilitates the generation of recombinant NDV and more efficient than the T7 rescue system using BRS-T7. PMID:21327786

  12. Use of yeast nuclear DNA sequences to define the mitochondrial RNA polymerase promoter in vitro.

    PubMed Central

    Marczynski, G T; Schultz, P W; Jaehning, J A


    We have extended an earlier observation that the TATA box for the nuclear GAL10 gene serves as a promoter for the mitochondrial RNA polymerase in in vitro transcription reactions (C. S. Winkley, M. J. Keller, and J. A. Jaehning, J. Biol. Chem. 260:14214-14223, 1985). In this work, we demonstrate that other nuclear genes also have upstream sequences that function in vitro as mitochondrial RNA polymerase promoters. These genes include the GAL7 and MEL1 genes, which are regulated in concert with the GAL10 gene, the sigma repetitive element, and the 2 microns plasmid origin of replication. We used in vitro transcription reactions to test a large number of nuclear DNA sequences that contain critical mitochondrial promoter sequences as defined by Biswas et al. (T. K. Biswas, J. C. Edwards, M. Rabinowitz, and G. S. Getz, J. Biol. Chem. 262:13690-13696, 1987). The results of these experiments allowed us to extend the definition of essential promoter elements. This extended sequence, -ACTATAAACGatcATAG-, was frequently found in the upstream regulatory regions of nuclear genes. On the basis of these observations, we hypothesized that either (i) a catalytic RNA polymerase related to the mitochondrial enzyme functions in the nucleus of the yeast cell or (ii) a DNA sequence recognition factor is shared by the two genetic compartments. By using cells deficient in the catalytic core of the mitochondrial RNA polymerase (rpo41-) and sensitive assays for transcripts initiating from the nuclear promoter sequences, we have conclusively ruled out a role for the catalytic RNA polymerase in synthesizing transcripts from all of the nuclear sequences analyzed. The possibility that a DNA sequence recognition factor functions in both the nucleus and the mitochondria remains to be tested. Images PMID:2677667

  13. Sequence Features and Transcriptional Stalling within Centromere DNA Promote Establishment of CENP-A Chromatin

    PubMed Central

    Catania, Sandra; Pidoux, Alison L.; Allshire, Robin C.


    Centromere sequences are not conserved between species, and there is compelling evidence for epigenetic regulation of centromere identity, with location being dictated by the presence of chromatin containing the histone H3 variant CENP-A. Paradoxically, in most organisms CENP-A chromatin generally occurs on particular sequences. To investigate the contribution of primary DNA sequence to establishment of CENP-A chromatin in vivo, we utilised the fission yeast Schizosaccharomyces pombe. CENP-ACnp1 chromatin is normally assembled on ∼10 kb of central domain DNA within these regional centromeres. We demonstrate that overproduction of S. pombe CENP-ACnp1 bypasses the usual requirement for adjacent heterochromatin in establishing CENP-ACnp1 chromatin, and show that central domain DNA is a preferred substrate for de novo establishment of CENP-ACnp1 chromatin. When multimerised, a 2 kb sub-region can establish CENP-ACnp1 chromatin and form functional centromeres. Randomization of the 2 kb sequence to generate a sequence that maintains AT content and predicted nucleosome positioning is unable to establish CENP-ACnp1 chromatin. These analyses indicate that central domain DNA from fission yeast centromeres contains specific information that promotes CENP-ACnp1 incorporation into chromatin. Numerous transcriptional start sites were detected on the forward and reverse strands within the functional 2 kb sub-region and active promoters were identified. RNAPII is enriched on central domain DNA in wild-type cells, but only low levels of transcripts are detected, consistent with RNAPII stalling during transcription of centromeric DNA. Cells lacking factors involved in restarting transcription—TFIIS and Ubp3—assemble CENP-ACnp1 on central domain DNA when CENP-ACnp1 is at wild-type levels, suggesting that persistent stalling of RNAPII on centromere DNA triggers chromatin remodelling events that deposit CENP-ACnp1. Thus, sequence-encoded features of centromeric DNA create an

  14. Bidirectional promoter trapping T-DNA for insertional mutagenesis in Verticillium dahliae.


    Deng, Sheng; Wang, Cai-yue; Zhang, Xin; Lin, Ling


    Transfer DNA (T-DNA)-based random insertional mutagenesis is a universal forward genetic approach for gene identification and cloning in many phytopathogenic fungi. In a large number of randomly selected transformants, screening for mutants with a specific phenotype is laborious, especially for pathogenicity-defective mutants. To accelerate mutant screening and gene identification, a bidirectional promoter-trapping Ti binary vector, 1300-bisGFP-hyg, was constructed and deployed in this study. More than 6000 Verticillium dahliae transformants were obtained by the mediation of Agrobacterium tumefaciens carrying the vector. One thousand randomly selected transformants were cultured on Czapek-Dox and on Czapek-Dox plus cotton root extract media plates. The cultured transformants with green fluorescent protein (GFP) expression or changes in phenotype were selected and used in virulence or promoter-trapping assays. Based on the virulence assay of 60 transformants, the pathogenicity of 17 of these mutants was compromised. Ten pathogenicity-defective mutants were found with GFP expression, and 6 with expression in Czapek-Dox plus cotton root extract media specifically. Using TAIL-PCR (thermal asymmetric interlaced polymerase chain reaction), the T-DNA insertion sites were identified in 8 GFP-expressing transformants, including 5 pathogenicity-defective mutants and 3 unaffected transformants. Promoters of 6 genes were successfully trapped using the T-DNA method in this study. The nonpathogenic transformant 24C9 was the subject of additional investigation. It displayed strong GFP expression on water agar medium supplemented with cotton root extracts and on cotton seedling stems. The results obtained by Southern blot and quantitative real-time PCR confirmed that the transcription level of VdUGPU (encoding UTP-glucose-1-phosphate uridylyltransferase) was significantly reduced owing to T-DNA insertion in the gene promoter region. These results indicate that the bidirectional

  15. Structure of the FoxM1 DNA-recognition domain bound to a promoter sequence

    PubMed Central

    Littler, D. R.; Alvarez-Fernández, M.; Stein, A.; Hibbert, R. G.; Heidebrecht, T.; Aloy, P.; Medema, R. H.; Perrakis, A.


    FoxM1 is a member of the Forkhead family of transcription factors and is implicated in inducing cell proliferation and some forms of tumorigenesis. It binds promoter regions with a preference for tandem repeats of a consensus ‘TAAACA’ recognition sequence. The affinity of the isolated FoxM1 DNA-binding domain for this site is in the micromolar range, lower than observed for other Forkhead proteins. To explain these FoxM1 features, we determined the crystal structure of its DNA-binding domain in complex with a tandem recognition sequence. FoxM1 adopts the winged-helix fold, typical of the Forkhead family. Neither ‘wing’ of the fold however, makes significant contacts with the DNA, while the second, C-terminal, wing adopts an unusual ordered conformation across the back of the molecule. The lack of standard DNA–‘wing’ interactions may be a reason for FoxM1’s relatively low affinity. The role of the ‘wings’ is possibly undertaken by other FoxM1 regions outside the DBD, that could interact with the target DNA directly or mediate interactions with other binding partners. Finally, we were unable to show a clear preference for tandem consensus site recognition in DNA-binding, transcription activation or bioinformatics analysis; FoxM1's moniker, ‘Trident’, is not supported by our data. PMID:20360045

  16. A novel DNA replication origin identified in the human heat shock protein 70 gene promoter.

    PubMed Central

    Taira, T; Iguchi-Ariga, S M; Ariga, H


    A general and sensitive method for the mapping of initiation sites of DNA replication in vivo, developed by Vassilev and Johnson, has revealed replication origins in the region of simian virus 40 ori, in the regions upstream from the human c-myc gene and downstream from the Chinese hamster dihydrofolate reductase gene, and in the enhancer region of the mouse immunoglobulin heavy-chain gene. Here we report that the region containing the promoter of the human heat shock protein 70 (hsp70) gene was identified as a DNA replication origin in HeLa cells by this method. Several segments of the region were cloned into pUC19 and examined for autonomously replicating sequence (ARS) activity. The plasmids carrying the segments replicated episomally and semiconservatively when transfected into HeLa cells. The segments of ARS activity contained the sequences previously identified as binding sequences for a c-myc protein complex (T. Taira, Y. Negishi, F. Kihara, S. M. M. Iguchi-Ariga, and H. Ariga, Biochem. Biophys. Acta 1130:166-174, 1992). Mutations introduced within the c-myc protein complex binding sequences abolished the ARS activity. Moreover, the ARS plasmids stably replicated at episomal state for a long time in established cell lines. The results suggest that the promoter region of the human hsp70 gene plays a role in DNA replication as well as in transcription. Images PMID:8065368

  17. The complete sequence of soybean chlorotic mottle virus DNA and the identification of a novel promoter.


    Hasegawa, A; Verver, J; Shimada, A; Saito, M; Goldbach, R; Van Kammen, A; Miki, K; Kameya-Iwaki, M; Hibi, T


    The complete nucleotide sequence of an infectious clone of soybean chlorotic mottle virus (SoyCMV) DNA was determined and compared with those of three other caulimoviruses, cauliflower mosaic virus (CaMV), carnation etched ring virus and figwort mosaic virus. The double-stranded DNA genome of SoyCMV (8,175 bp) contained nine open reading frames (ORFs) and one large intergenic region. The primer binding sites, gene organization and size of ORFs were similar to those of the other caulimoviruses, except for ORF I, which was split into ORF Ia and Ib. The amino acid sequences deduced from each ORF showed only short, highly homologous regions in several of the corresponding ORFs of the three other caulimoviruses. A promoter fragment of 378 bp in SoyCMV ORF III showed a strong expression activity, comparable to that of the CaMV 35S promoter, in tobacco mesophyll protoplasts as determined by a beta-glucuronidase assay using electrotransfection. The fragment contained CAAT and TATA boxes but no transcriptional enhancer signal as reported for the CaMV 35S promoter. Instead, it had sequences homologous to a part of the translational enhancer signal reported for the 5'-leader sequence of tobacco mosaic virus RNA. PMID:2602148

  18. Stimulation of DNA synthesis in rat and mouse liver by various tumor promoters.


    Büsser, M T; Lutz, W K


    In order to investigate whether the stimulation of liver DNA synthesis might be used to detect one class of hepatic tumor promoters, the incorporation of orally administered radiolabelled thymidine into liver DNA was determined in rats and mice 24 h after a single oral gavage of test compounds at various dose levels. Three DNA-binding hepatocarcinogens, aflatoxin B1, benzidine and carbon tetrachloride, did not stimulate but rather inhibited DNA synthesis (not for CCl4). Four hepatic tumor promoters, clofibrate, DDT, phenobarbital and thioacetamide, gave rise to a stimulation in a dose-dependent manner. Single oral doses between 0.02 and 0.3 mmol/kg were required to double the level of thymidine incorporation into liver DNA (= doubling dose, DD). Differences between species or sex as observed in long-term carcinogenicity studies were reflected by a different stimulation of liver DNA synthesis. In agreement with the bioassay data, aldrin was positive only in male mice (DD = 0.007 mmol/kg) but not in male rats of female mice. 2,3,7,8-TCDD was positive in male mice (DD = 10(-6) mmol/kg) and in female rats (DD = 2 X 10(-6) mmol/kg) but not in male rats. The assay was also able to distinguish between structural isomers with different carcinogenicities. [alpha]Hexachlorocyclohexane stimulated liver DNA synthesis with a doubling dose of about 0.2 mmol/kg in male rats whereas the [gamma]-isomer was ineffective even at 1 mmol/kg. So far, only one result was inconsistent with carcinogenicity bioassay data. The different carcinogenicity of di(2-ethylhexyl)adipate (negative in rats) and di(2-ethylhexyl)phthalate (positive) was not detectable. Both plasticizers were positive in this short-term system with DD's of 0.7 mmol/kg for DEHA and 0.5 mmol/kg for DEHP. The proposed assay is discussed as an attempt to devise short-term assays for carcinogens not detected by the routine genotoxicity test systems. PMID:2443263

  19. Metallothionein cDNA, promoter, and genomic sequences of the tropical green mussel, Perna viridis.


    Khoo, H W; Patel, K H


    The primary structure of the cDNA and metallothionein (MT) genomic sequences of the tropical green mussel (Perna viridis) was determined. The complete cDNA sequences were obtained using degenerate primers designed from known metallothionein consensus amino acid sequences from the temperate species Mytilus edulis. The amino acid sequences of P. viridis metallothionein deduced from the coding region consisted of 72 amino acids with 21 cysteine residues and 9 Cys-X-Cys motifs corresponding to Type I MT class of other species. Two different genomic sequences coding for the same mRNA were obtained. Each putative gene contained a unique 5'UTR and two unique introns located at the same splice sites. The promoters for both genes were different in length and both contained metal responsive elements and active protein-binding sites. The structures of the genomic clones were compared with those of other species. J. Exp. Zool. 284:445-453, 1999. PMID:10451422

  20. DNA bending and binding factors of the human. beta. -actin promoter

    SciTech Connect

    Kawamoto, Takeshi; Makino, Kozo; Orita, Satoshi; Nakata, Atsuo; Kakunaga, Takeo )


    Transcription of the {beta}-actin gene is rapidly inducible in response to serum stimulation. To determine the regions responsible for serum inducible and basal level expression, the human {beta}-actin promoter was subjected to mutational analysis. Two distinct elements, the CCAAT homology and the {beta}-actin specific conserved sequences, were found by a chloramphenicol acetyltransferase expression assay and sequence comparisons, and then analyzed for possible functions. Using a DNA bend assay, it was shown that the conserved sequences included the core of a sequence-directed bend of DNA. Gel mobility shift and DNase I protection assays revealed that the conserved sequences and the CCAAT homology were recognized by binding factors in HeLa cell extracts.


    PubMed Central



    Degradation of the extracellular matrix by elevated matrix metalloproteinase (MMP) activity following ischemia/reperfusion is implicated in blood–brain barrier disruption and neuronal death. In contrast to their characterized extracellular roles, we previously reported that elevated intranuclear MMP-2 and -9 (gelatinase) activity degrades nuclear DNA repair proteins and promotes accumulation of oxidative DNA damage in neurons in rat brain at 3-h reperfusion after ischemic stroke. Here, we report that treatment with a broad-spectrum MMP inhibitor significantly reduced neuronal apoptosis in rat ischemic hemispheres at 48-h reperfusion after a 90-min middle cerebral artery occlusion (MCAO). Since extracellular gelatinases in brain tissue are known to be neurotoxic during acute stroke, the contribution of intranuclear MMP-2 and -9 activities in neurons to neuronal apoptosis has been unclear. To confirm and extend our in vivo observations, oxygen–glucose deprivation (OGD), an in vitro model of ischemia/reperfusion, was employed. Primary cortical neurons were subjected to 2-h OGD with reoxygenation. Increased intranuclear gelatinase activity was detected immediately after reoxygenation onset and was maximal at 24 h, while extracellular gelatinase levels remained unchanged. We detected elevated levels of both MMP-2 and -9 in neuronal nuclear extracts and gelatinase activity in neurons co-localized primarily with MMP-2. We found a marked decrease in PARP1, XRCC1, and OGG1, and decreased PARP1 activity. Pretreatment of neurons with selective MMP-2/9 inhibitor II significantly decreased gelatinase activity and downregulation of DNA repair enzymes, decreased accumulation of oxidative DNA damage, and promoted neuronal survival after OGD. Our results confirm the nuclear localization of gelatinases and their nuclear substrates observed in an animal stroke model, further supporting a novel role for intranuclear gelatinase activity in an intrinsic apoptotic pathway in neurons

  2. Use of liposome-mediated DNA transfection to determine promoter activity in smooth muscle cells.


    Fabunmi, R P


    The transfer and expression of DNA plasmids containing promoter fragments of heterologous genes linked to reporter cDNAs in mammalian cells has become an invaluable technique for studying the regulation of gene expression. Several reporter genes such as luciferase, β-galactosidase, chloramphenicol acetyl transferase, and green flourescent protein are ideal to study promoter activities as their gene products are not endogenous to smooth muscle cells (SMC) and their expression can be readily detected using convenient assays (1). Among these genes, a popular choice is the firefly luciferase, as its expression can be easily detected in cells using a highly sensitive chemiluminescent assay (2). The firefly luciferase catalyses a rapid, ATP-dependent oxidation of the substrate, luciferin, which then emits light. Reactions catalyzed by firefly luciferase are: [Formula: see text]. PMID:21341022

  3. Crystallization and preliminary X-ray analysis of phage Mu activator protein C in a complex with promoter DNA

    SciTech Connect

    Shanmuganatham, Karthik K.; Ravichandran, Manimekalai; Howe, Martha M.; Park, Hee-Won


    The isolation and preliminary X-ray analysis of crystals of phage Mu activator protein C bound to promoter DNA are reported. Bacteriophage Mu C protein is an activator of the four Mu late promoters that drive the expression of genes encoding DNA-modification as well as phage head and tail morphogenesis proteins. This report describes the purification and cocrystallization of wild-type and selenomethionine-substituted C protein with a synthetic late promoter P{sub sym}, together with preliminary X-ray diffraction data analysis using SAD phasing. The selenomethionine peak data set was collected from a single crystal which diffracted to 3.1 Å resolution and belonged to space group P4{sub 1} or P4{sub 3}, with unit-cell parameters a = 68.9, c = 187.6 Å and two complexes per asymmetric unit. The structure will reveal the amino acid–DNA interactions and any conformational changes associated with DNA binding.

  4. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    PubMed Central

    La, Honggui; Ding, Bo; Mishra, Gyan P.; Zhou, Bo; Yang, Hongmei; Bellizzi, Maria del Rosario; Chen, Songbiao; Meyers, Blake C.; Peng, Zhaohua; Zhu, Jian-Kang; Wang, Guo-Liang


    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counteract transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli. PMID:21896764

  5. Altered DNA conformations detected by mung bean nuclease occur in promoter and terminator regions of supercoiled pBR322 DNA.

    PubMed Central

    Sheflin, L G; Kowalski, D


    Mung bean nuclease was used to probe for recognizable DNA unwinding and unpairing in the plasmid pBR322. In negatively supercoiled DNA, but not relaxed DNA, cleavages occurred preferentially in non-coding regions of the genome. The types of nucleotide sequences cleaved and which non-coding regions were cleaved depended upon environmental conditions. At 37 degrees C, cleavages occurred in an 84 bp A+T-rich sequence in the terminator region of the ampicillin-resistance gene. Recognition is likely based on a novel DNA conformation which occurs in the longest, most dA+dT-rich region of pBR322. In the presence of 1 mM Mg2+, cleavages occurred in inverted repeated sequences in the promoter regions of the RNA primer for DNA replication and ampicillin- and tetracycline-resistance genes as well as the terminator of RNA-1. Potential loops of hairpin (cruciform) structures were cleaved. At 27 degrees C, cleavages occurred near a promoter activated by cAMP receptor protein in vitro and in the 3' non-coding region of the tetracycline-resistance gene. Thus, in supercoiled pBR322 DNA, recognizable DNA unwinding and unpairing occurs preferentially in regulatory regions for transcription and DNA replication. Images PMID:2995917

  6. The N-terminus of TDP-43 promotes its oligomerization and enhances DNA binding affinity

    SciTech Connect

    Chang, Chung-ke; Wu, Tzong-Huah; Wu, Chu-Ya; Chiang, Ming-hui; Toh, Elsie Khai-Woon; Hsu, Yin-Chih; Lin, Ku-Feng; Liao, Yu-heng; Huang, Tai-huang; Huang, Joseph Jen-Tse


    Highlights: Black-Right-Pointing-Pointer The N-terminus of TDP-43 contains an independently folded structural domain (NTD). Black-Right-Pointing-Pointer The structural domains of TDP-43 are arranged in a beads-on-a-string fashion. Black-Right-Pointing-Pointer The NTD promotes TDP-43 oligomerization in a concentration-dependent manner. Black-Right-Pointing-Pointer The NTD may assist nucleic acid-binding activity of TDP-43. -- Abstract: TDP-43 is a DNA/RNA-binding protein associated with different neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD-U). Here, the structural and physical properties of the N-terminus on TDP-43 have been carefully characterized through a combination of nuclear magnetic resonance (NMR), circular dichroism (CD) and fluorescence anisotropy studies. We demonstrate for the first time the importance of the N-terminus in promoting TDP-43 oligomerization and enhancing its DNA-binding affinity. An unidentified structural domain in the N-terminus is also disclosed. Our findings provide insights into the N-terminal domain function of TDP-43.

  7. The use of polyethylenimine-DNA to topically deliver hTERT to promote hair growth.


    Jan, H-M; Wei, M-F; Peng, C-L; Lin, S-J; Lai, P-S; Shieh, M-J


    The present study investigates the efficacy of polyethylenimine (PEI)-DNA complex that expressed human telomerase reverse transcriptase (hTERT) to transfect hair follicle stem cells and produce sufficient hTERT to stimulate hair growth. Transfection with pLC-hTERT-DNA-PEI complex (D+P group) in vitro induced expression of proliferating cell nuclear antigen in 35.8% of the purified stem cell population, suggesting enhanced cell proliferation. In vivo transfection efficiency of rat dorsal skin was determined by staining for β-gal activity. Cells positive for β-gal were located in the bulge region and dermal sheath of hair follicles. The follicles in the hTERT-transfected region entered anagenon day 15 after transfection, whereas non-transfected (Neg) controls remained in telogen. The similar effect was observed in 50-day-old rat dorsal skin. D+P group displayed a specific expression of hTERT and sufficient to initiate a transition to the anagen phase and promote new hair synthesis 18 days after the transfection. hTERT promoted follicle neogenesis following wounding. In all, 60 days after wounding, tissues of the D+P group showed more newly regenerating hair follicles (83±52 regenerated follicles per rat) in contrast to control group tissues (15±15 regenerated follicles per rat). These studies provide a potential approach for gene therapy of skin disease. PMID:21593794

  8. Endothelial cells mitigate DNA damage and promote the regeneration of hematopoietic stem cells after radiation injury

    PubMed Central

    Zachman, Derek K.; Leon, Ronald P.; Das, Prerna; Goldman, Devorah C.; Hamlin, Kimberly L.; Guha, Chandan; Fleming, William H.


    Endothelial cells (ECs) are an essential component of the hematopoietic microenvironment, which maintains and regulates hematopoietic stem cells (HSCs). Although ECs can support the regeneration of otherwise lethally-irradiated HSCs, the mechanisms are not well understood. To further understand this phenomenon, we studied HSC regeneration from irradiated bone marrow using co-culture with human aortic endothelial cells (HAECs). Co-culture with HAECs induced a 24-fold expansion of long-term HSCs (CD150+, lineagelo, Sca-1+, c-Kit+; CD150+LSK cells) in vitro. These cells gave rise to functional hematopoietic stem and progenitor cells (HSPCs) with colony-forming activity, multilineage reconstitution and serial transplantation potential. Furthermore, HAECs significantly reduced DNA damage in irradiated LSK cells within 24 hours. Remarkably, we were able to delay the exposure of irradiated bone marrow to the regenerative, HAEC-derived signals for up to 48 hours and still rescue functional HSCs. G-CSF is the gold standard for promoting hematopoietic regeneration in vivo. However, when compared to HAECs, in vitro G-CSF treatment promoted lineage differentiation and regenerated 5-fold fewer CD150+LSK cells. Together, our results show that HAECs are powerful, direct mitigators of HSC injury and DNA damage. Identification of the HAEC-derived factors that rescue HSCs may lead to improved therapies for hematopoietic regeneration after radiation injury. PMID:23939266

  9. DNA-histone interactions are sufficient to position a single nucleosome juxtaposing Drosophila Adh adult enhancer and distal promoter.

    PubMed Central

    Jackson, J R; Benyajati, C


    The alcohol dehydrogenase gene (Adh) of Drosophila melanogaster is transcribed from two tandem promoters in distinct developmental and tissue-specific patterns. Both promoters are regulated by separate upstream enhancer regions. In its wild-type context the adult enhancer specifically stimulates only the distal promoter, approximately 400 bp downstream, and not the proximal promoter, which is approximately 700 bp further downstream. Genomic footprinting and micrococcal nuclease analyses have revealed a specifically positioned nucleosome between the distal promoter and adult enhancer. In vitro reconstitution of this nucleosome demonstrated that DNA-core histone interactions alone are sufficient to position the nucleosome. Based on this observation and sequence periodicities in the underlying DNA, the mechanism of positioning appears to involve specific DNA structural features (ie flexibility or curvature). We have observed this nucleosome positioned early during development, before tissue differentiation, and before non-histone protein-DNA interactions are established at the distal promoter or adult enhancer. This nucleosome positioning element in the Adh regulatory region could be involved in establishing a specific tertiary nucleoprotein structure that facilitates specific cis-element accessibility and/or distal promoter-adult enhancer interactions. Images PMID:8451195

  10. Cigarette Smoking, BPDE-DNA Adducts, and Aberrant Promoter Methylations of Tumor Suppressor Genes (TSGs) in NSCLC from Chinese Population.


    Jin, Yongtang; Xu, Peiwei; Liu, Xinneng; Zhang, Chunye; Tan, Cong; Chen, Chunmei; Sun, Xiaoyu; Xu, Yingchun


    Non-small cell lung cancer (NSCLC) is related to the genetic and epigenetic factors. The goal of this study was to determine association of cigarette smoking and BPDE-DNA adducts with promoter methylations of several genes in NSCLC. Methylation of the promoters of p16, RARβ, DAPK, MGMT, and TIMP-3 genes of tumor tissues from 199 lung cancer patients was analyzed with methylation-specific PCR (MSP), and BPDE-DNA adduct level in lung cancer tissue was obtained by ELISA. Level of BPDE-DNA adduct increased significantly in males, aged people (over 60 years), and smokers; however, no significant difference was found while comparing the BPDE-DNA adduct levels among different tumor types, locations, and stages. Cigarette smoking was also associated with increased BPDE-DNA adducts level (OR = 2.43, p > .05) and increased methylation level in at least 1 gene (OR = 5.22, p < .01), both in dose-response manner. Similarly, cigarette smoking also significantly increase the risk of p16 or DAPK methylation (OR = 3.02, p < .05 for p16, and 3.66, p < .05 for DAPK). The highest risk of BPDE-DNA adducts was detected among individuals with cigarette smoking for more than 40 pack-years (OR = 4.21, p < .01). Furthermore, the present study did not show that BPDE-DNA adducts are significantly associated with abnormal TSGs methylations in NSCLC, including SCC and AdO, respectively. Conclusively, cigarette smoking is significantly associated with the increase of BPDE-DNA adduct level, promoter hypermethylation of p16 and DAPK genes, while BPDE-DNA adduct was not significantly related to abnormal promoter hypermethylation in TSGs, suggesting that BPDE-DNA adducts and TSGs methylations play independent roles in NSCLC. PMID:27042875

  11. Inhibition of DNA methylation promotes breast tumor sensitivity to netrin-1 interference.


    Grandin, Mélodie; Mathot, Pauline; Devailly, Guillaume; Bidet, Yannick; Ghantous, Akram; Favrot, Clementine; Gibert, Benjamin; Gadot, Nicolas; Puisieux, Isabelle; Herceg, Zdenko; Delcros, Jean-Guy; Bernet, Agnès; Mehlen, Patrick; Dante, Robert


    In a number of human cancers, NTN1 upregulation inhibits apoptosis induced by its so-called dependence receptors DCC and UNC5H, thus promoting tumor progression. In other cancers however, the selective inhibition of this dependence receptor death pathway relies on the silencing of pro-apoptotic effector proteins. We show here that a substantial fraction of human breast tumors exhibits simultaneous DNA methylation-dependent loss of expression of NTN1 and of DAPK1, a serine threonine kinase known to transduce the netrin-1 dependence receptor pro-apoptotic pathway. The inhibition of DNA methylation by drugs such as decitabine restores the expression of both NTN1 and DAPK1 in netrin-1-low cancer cells. Furthermore, a combination of decitabine with NTN1 silencing strategies or with an anti-netrin-1 neutralizing antibody potentiates tumor cell death and efficiently blocks tumor growth in different animal models. Thus, combining DNA methylation inhibitors with netrin-1 neutralizing agents may be a valuable strategy for combating cancer. PMID:27378792

  12. Asymmetric Arginine dimethylation of Epstein-Barr virus nuclear antigen 2 promotes DNA targeting

    SciTech Connect

    Gross, Henrik; Barth, Stephanie; Mamiani, Alfredo; Zimber-Strobl, Ursula; West, Michelle J.; Kremmer, Elisabeth; Graesser, Friedrich A.


    The Epstein-Barr virus (EBV) growth-transforms B-lymphocytes. The virus-encoded nuclear antigen 2 (EBNA2) is essential for transformation and activates gene expression by association with DNA-bound transcription factors such as RBPJkappa (CSL/CBF1). We have previously shown that EBNA2 contains symmetrically dimethylated Arginine (sDMA) residues. Deletion of the RG-repeat results in a reduced ability of the virus to immortalise B-cells. We now show that the RG repeat also contains asymmetrically dimethylated Arginines (aDMA) but neither non-methylated (NMA) Arginines nor citrulline residues. We demonstrate that only aDMA-containing EBNA2 is found in a complex with DNA-bound RBPJkappa in vitro and preferentially associates with the EBNA2-responsive EBV C, LMP1 and LMP2A promoters in vivo. Inhibition of methylation in EBV-infected cells results in reduced expression of the EBNA2-regulated viral gene LMP1, providing additional evidence that methylation is a prerequisite for DNA-binding by EBNA2 via association with the transcription factor RBPJkappa.

  13. HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.


    Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael


    Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges. PMID:27184763

  14. Arabidopsis EDM2 promotes IBM1 distal polyadenylation and regulates genome DNA methylation patterns

    PubMed Central

    Lei, Mingguang; La, Honggui; Lu, Kun; Wang, Pengcheng; Miki, Daisuke; Ren, Zhizhong; Duan, Cheng-Guo; Wang, Xingang; Tang, Kai; Zeng, Liang; Yang, Lan; Zhang, Heng; Nie, Wenfeng; Liu, Pan; Zhou, Jianping; Liu, Renyi; Zhong, Yingli; Liu, Dong; Zhu, Jian-Kang


    DNA methylation is important for the silencing of transposons and other repetitive elements in many higher eukaryotes. However, plant and mammalian genomes have evolved to contain repetitive elements near or inside their genes. How these genes are kept from being silenced by DNA methylation is not well understood. A forward genetics screen led to the identification of the putative chromatin regulator Enhanced Downy Mildew 2 (EDM2) as a cellular antisilencing factor and regulator of genome DNA methylation patterns. EDM2 contains a composite Plant Homeo Domain that recognizes both active and repressive histone methylation marks at the intronic repeat elements in genes such as the Histone 3 lysine 9 demethylase gene Increase in BONSAI Methylation 1 (IBM1) and is necessary for maintaining the expression of these genes by promoting mRNA distal polyadenylation. Because of its role in maintaining IBM1 expression, EDM2 is required for preventing CHG methylation in the bodies of thousands of genes. Our results thus increase the understanding of antisilencing, genome methylation patterns, and regulation of alternative RNA processing by intronic heterochromatin. PMID:24248388

  15. Infrared A radiation promotes survival of human melanocytes carrying ultraviolet radiation-induced DNA damage.


    Kimeswenger, Susanne; Schwarz, Agatha; Födinger, Dagmar; Müller, Susanne; Pehamberger, Hubert; Schwarz, Thomas; Jantschitsch, Christian


    The link between solar radiation and melanoma is still elusive. Although infrared radiation (IR) accounts for over 50% of terrestrial solar energy, its influence on human skin is not well explored. There is increasing evidence that IR influences the expression patterns of several molecules independently of heat. A previous in vivo study revealed that pretreatment with IR might promote the development of UVR-induced non-epithelial skin cancer and possibly of melanoma in mice. To expand on this, the aim of the present study was to evaluate the impact of IR on UVR-induced apoptosis and DNA repair in normal human epidermal melanocytes. The balance between these two effects is a key factor of malignant transformation. Human melanocytes were exposed to physiologic doses of IR and UVR. Compared to cells irradiated with UVR only, simultaneous exposure to IR significantly reduced the apoptotic rate. However, IR did not influence the repair of UVR-induced DNA damage. IR partly reversed the pro-apoptotic effects of UVR via modification of the expression and activity of proteins mainly of the extrinsic apoptotic pathway. In conclusion, IR enhances the survival of melanocytes carrying UVR-induced DNA damage and thereby might contribute to melanomagenesis. PMID:26844814

  16. DNA polymorphisms and mutations of the tumor necrosis factor-alpha (TNF-alpha) promoter in Langerhans cell histiocytosis (LCH).


    Wu, W S; McClain, K L


    Langerhans cell histiocytosis (LCH) is a clonal proliferation of dendritic histiocytes expressing elevated levels of tumor necrosis factor-alpha (TNF-alpha), interferon-gamma (IFN-gamma) granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-1 (IL-1), and leukemia inhibitory factor (LIF). The cause of the increased cytokine levels is unknown, but DNA sequence changes in promoters could alter expression. The TNF-alpha and IFN-gamma promoter DNA sequences of 12 LCH patients were studied and compared with normal individuals by dideoxy fingerprinting and DNA sequencing. Functional consequences of polymorphic or mutated sequences were assessed by cloning altered and control promoter sequences into a luciferase reporter gene vector. Electrophoretic mobility shifts (EMSA) after binding of nuclear extracts from a macrophage cell line (U-937) by mutated promoters were compared with controls. Five of 12 LCH patients had alterations in the TNF-alpha promoter DNA sequence. None were found in the IFN-gamma gene promoter. Of the 5 with TNF-alpha DNA alterations, 2 were at position -308, which has been described as a G-A polymorphism associated with upregulation of TNF-alpha in some patients with infections or immune-mediated diseases. The polymorphism at -308 but not the other TNF-alpha promoter mutations caused a 3-fold to 7-fold increased production of the luciferase reporter gene. EMSA showed that the -308 mutant promoters bound fewer nuclear proteins than normals. Polymorphisms of the TNF-alpha promoter in LCH patients could increase the production of that cytokine. PMID:9355965

  17. DAF-16/FoxO and EGL-27/GATA promote developmental growth in response to persistent somatic DNA damage

    PubMed Central

    Babu, Vipin; Ermolaeva, Maria A.; Müller, Roman-Ulrich; Frommolt, Peter; Williams, Ashley B.; Greiss, Sebastian; Schneider, Jennifer I.; Benzing, Thomas; Schermer, Bernhard; Schumacher, Björn


    Genome maintenance defects cause complex disease phenotypes characterized by developmental failure, cancer susceptibility, and premature aging. It remains poorly understood how DNA damage responses function during organismal development and maintain tissue functionality when DNA damage accumulates with aging. Here we show that the FoxO transcription factor DAF-16 is activated in response to DNA damage during development while the DNA damage responsiveness of DAF-16 declines with aging. We find that in contrast to its established role in mediating starvation arrest, DAF-16 alleviates DNA damage-induced developmental arrest and even in the absence of DNA repair promotes developmental growth and enhances somatic tissue functionality. We demonstrate that the GATA transcription factor EGL-27 co-regulates DAF-16 target genes in response to DNA damage and together with DAF-16 promotes developmental growth. We propose that EGL-27/GATA activity specifies DAF-16 mediated DNA damage responses to enable developmental progression and to prolong tissue functioning when DNA damage persists. PMID:25419847

  18. Src Family Kinases Promote Silencing of ATR-Chk1 Signaling in Termination of DNA Damage Checkpoint*

    PubMed Central

    Fukumoto, Yasunori; Morii, Mariko; Miura, Takahito; Kubota, Sho; Ishibashi, Kenichi; Honda, Takuya; Okamoto, Aya; Yamaguchi, Noritaka; Iwama, Atsushi; Nakayama, Yuji; Yamaguchi, Naoto


    The DNA damage checkpoint arrests cell cycle progression to allow time for repair. Once DNA repair is completed, checkpoint signaling is terminated. Currently little is known about the mechanism by which checkpoint signaling is terminated, and the disappearance of DNA lesions is considered to induce the end of checkpoint signaling; however, here we show that the termination of checkpoint signaling is an active process promoted by Src family tyrosine kinases. Inhibition of Src activity delays recovery from the G2 phase DNA damage checkpoint following DNA repair. Src activity is required for the termination of checkpoint signaling, and inhibition of Src activity induces persistent activation of ataxia telangiectasia mutated (ATM)- and Rad3-related (ATR) and Chk1 kinases. Src-dependent nuclear protein tyrosine phosphorylation and v-Src expression suppress the ATR-mediated Chk1 and Rad17 phosphorylation induced by DNA double strand breaks or DNA replication stress. Thus, Src family kinases promote checkpoint recovery through termination of ATR- and Chk1-dependent G2 DNA damage checkpoint. These results suggest a model according to which Src family kinases send a termination signal between the completion of DNA repair and the initiation of checkpoint termination. PMID:24634213

  19. SUVH1, a Su(var)3-9 family member, promotes the expression of genes targeted by DNA methylation.


    Li, Shaofang; Liu, Lin; Li, Shengben; Gao, Lei; Zhao, Yuanyuan; Kim, Yun Ju; Chen, Xuemei


    Transposable elements are found throughout the genomes of all organisms. Repressive marks such as DNA methylation and histone H3 lysine 9 (H3K9) methylation silence these elements and maintain genome integrity. However, how silencing mechanisms are themselves regulated to avoid the silencing of genes remains unclear. Here, an anti-silencing factor was identified using a forward genetic screen on a reporter line that harbors a LUCIFERASE (LUC) gene driven by a promoter that undergoes DNA methylation. SUVH1, a Su(var)3-9 homolog, was identified as a factor promoting the expression of the LUC gene. Treatment with a cytosine methylation inhibitor completely suppressed the LUC expression defects of suvh1, indicating that SUVH1 is dispensable for LUC expression in the absence of DNA methylation. SUVH1 also promotes the expression of several endogenous genes with promoter DNA methylation. However, the suvh1 mutation did not alter DNA methylation levels at the LUC transgene or on a genome-wide scale; thus, SUVH1 functions downstream of DNA methylation. Histone H3 lysine 4 (H3K4) trimethylation was reduced in suvh1; in contrast, H3K9 methylation levels remained unchanged. This work has uncovered a novel, anti-silencing function for a member of the Su(var)3-9 family that has previously been associated with silencing through H3K9 methylation. PMID:26400170

  20. SUVH1, a Su(var)3–9 family member, promotes the expression of genes targeted by DNA methylation

    PubMed Central

    Li, Shaofang; Liu, Lin; Li, Shengben; Gao, Lei; Zhao, Yuanyuan; Kim, Yun Ju; Chen, Xuemei


    Transposable elements are found throughout the genomes of all organisms. Repressive marks such as DNA methylation and histone H3 lysine 9 (H3K9) methylation silence these elements and maintain genome integrity. However, how silencing mechanisms are themselves regulated to avoid the silencing of genes remains unclear. Here, an anti-silencing factor was identified using a forward genetic screen on a reporter line that harbors a LUCIFERASE (LUC) gene driven by a promoter that undergoes DNA methylation. SUVH1, a Su(var)3–9 homolog, was identified as a factor promoting the expression of the LUC gene. Treatment with a cytosine methylation inhibitor completely suppressed the LUC expression defects of suvh1, indicating that SUVH1 is dispensable for LUC expression in the absence of DNA methylation. SUVH1 also promotes the expression of several endogenous genes with promoter DNA methylation. However, the suvh1 mutation did not alter DNA methylation levels at the LUC transgene or on a genome-wide scale; thus, SUVH1 functions downstream of DNA methylation. Histone H3 lysine 4 (H3K4) trimethylation was reduced in suvh1; in contrast, H3K9 methylation levels remained unchanged. This work has uncovered a novel, anti-silencing function for a member of the Su(var)3–9 family that has previously been associated with silencing through H3K9 methylation. PMID:26400170

  1. Chromatin inactivation precedes de novo dna methylation during the progressive epigenetic silencing of the rassf1a promoter

    SciTech Connect

    Strunnikova Maria; Schagdarsurengin, Undraga; Kehlen, Astrid; Garbe, James C.; Stampfer, Martha R.; Dammann, Reinhard


    Epigenetic inactivation of the RASSF1A tumor suppressor by CpG island methylation was frequently detected in cancer. However, the mechanisms of this aberrant DNA methylation are unknown. In the RASSF1A promoter, we characterized four Sp1 sites, which are frequently methylated in cancer. We examined the functional relationship between DNA methylation, histone modification, Sp1 binding, and RASSF1A expression in proliferating human mammary epithelial cells. With increasing passages, the transcription of RASSF1A was dramatically silenced. This inactivation was associated with deacetylation and lysine 9 trimethylation of histone H3 and an impaired binding of Sp1 at the RASSF1A promoter. In mammary epithelial cells that had overcome a stress-associated senescence barrier, a spreading of DNA methylation in the CpG island promoter was observed. When the RASSF1A-silenced cells were treated with inhibitors of DNA methyltransferase and histone deacetylase, binding of Sp1 and expression of RASSF1 A reoccurred. In summary, we observed that histone H3 deacetylation and H3 lysine 9 trimethylation occur in the same time window as gene inactivation and precede DNA methylation. Our data suggest that in epithelial cells, histone inactivation may trigger de novo DNA methylation of the RASSF1A promoter and this system may serve as a model for CpG island inactivation of tumor suppressor genes.

  2. High-frequency deletion in recovered retrovirus vectors containing exogenous DNA with promoters.

    PubMed Central

    Emerman, M; Temin, H M


    We previously described infectious retrovirus vectors constructed from spleen necrosis virus which contain the herpes simplex virus thymidine kinase gene and the mouse alpha-globin gene (K. Shimotohno and H. M. Temin, Nature [London] 299:255-268, 1982). In the present study we report that when TK- chicken cells infected with a virus containing the mouse alpha-globin promoter and other 5' noncoding sequences in addition to the alpha-globin coding sequences were selected for thymidine kinase (TK) activity, all virus-producing TK+ cell clones shed virus with a deletion. These deletions were of different sizes and included the mouse alpha-globin coding sequences and the mouse alpha-globin transcriptional promoter. One of the deleted viruses was molecularly cloned. DNA sequencing showed that the deleted sequences are flanked by a short direct repeat. This deleted virus was also shown to have an advantage over the nondeleted parent both in multiplication and in its specific TK-transforming unit titer. In contrast to the results described above, TK+ cell clones established with viruses that contained only the coding sequences from the mouse alpha-globin gene did not delete and were stable over many cell passages. The implications of the high-frequency deletion of the viruses with internal promoters are discussed in terms of the evolution of retroviruses and the construction of retrovirus vectors. Images PMID:6321798

  3. Compilation and analysis of Bacillus subtilis sigma A-dependent promoter sequences: evidence for extended contact between RNA polymerase and upstream promoter DNA.

    PubMed Central

    Helmann, J D


    Sequence analysis of 236 promoters recognized by the Bacillus subtilis sigma A-RNA polymerase reveals an extended promoter structure. The most highly conserved bases include the -35 and -10 hexanucleotide core elements and a TG dinucleotide at position -15, -14. In addition, several weakly conserved A and T residues are present upstream of the -35 region. Analysis of dinucleotide composition reveals A2- and T2-rich sequences in the upstream promoter region (-36 to -70) which are phased with the DNA helix: An tracts are common near -43, -54 and -65; Tn tracts predominate at the intervening positions. When compared with larger regions of the genome, upstream promoter regions have an excess of An and Tn sequences for n > 4. These data indicate that an RNA polymerase binding site affects DNA sequence as far upstream as -70. This sequence conservation is discussed in light of recent evidence that the alpha subunits of the polymerase core bind DNA and that the promoter may wrap around RNA polymerase. PMID:7630711

  4. MAPK15 upregulation promotes cell proliferation and prevents DNA damage in male germ cell tumors

    PubMed Central

    Ilardi, Gennaro; Acunzo, Mario; Nigita, Giovanni; Sasdelli, Federica; Celetti, Angela; Strambi, Angela; Staibano, Stefania; Croce, Carlo Maria; Chiariello, Mario


    Germ cell tumors (GCT) are the most common malignancies in males between 15 and 35 years of age. Despite the high cure rate, achieved through chemotherapy and/or surgery, the molecular basis of GCT etiology is still largely obscure. Here, we show a positive correlation between MAPK15 (ERK8; ERK7) expression and specific GCT subtypes, with the highest levels found in the aggressive embryonal carcinomas (EC). Indeed, in corresponding cellular models for EC, MAPK15 enhanced tumorigenicity in vivo and promoted cell proliferation in vitro, supporting a role for this kinase in human GCT. At molecular level, we demonstrated that endogenous MAPK15 is necessary to sustain cell cycle progression of EC cells, by limiting p53 activation and preventing the triggering of p53-dependent mechanisms resulting in cell cycle arrest. To understand MAPK15-dependent mechanisms impinging on p53 activation, we demonstrate that this kinase efficiently protects cells from DNA damage. Moreover, we show that the ability of MAPK15 to control the autophagic process is necessary for basal management of DNA damage and for tumor formation controlled by the kinase. In conclusion, our findings suggest that MAPK15 overexpression may contribute to the malignant transformation of germ cells by controlling a “stress support” autophagic pathway, able to prevent DNA damage and the consequent activation of the p53 tumor suppressor. Moreover, in light of these results, MAPK15-specific inhibitors might represent new tools to enhance the therapeutic index of cytotoxic therapy in GCT treatment, and to increase the sensitivity to DNA-damaging drugs in other chemotherapy-resistant human tumors. PMID:26988910

  5. MAPK15 upregulation promotes cell proliferation and prevents DNA damage in male germ cell tumors.


    Rossi, Matteo; Colecchia, David; Ilardi, Gennaro; Acunzo, Mario; Nigita, Giovanni; Sasdelli, Federica; Celetti, Angela; Strambi, Angela; Staibano, Stefania; Croce, Carlo Maria; Chiariello, Mario


    Germ cell tumors (GCT) are the most common malignancies in males between 15 and 35 years of age. Despite the high cure rate, achieved through chemotherapy and/or surgery, the molecular basis of GCT etiology is still largely obscure. Here, we show a positive correlation between MAPK15 (ERK8; ERK7) expression and specific GCT subtypes, with the highest levels found in the aggressive embryonal carcinomas (EC). Indeed, in corresponding cellular models for EC, MAPK15 enhanced tumorigenicity in vivo and promoted cell proliferation in vitro, supporting a role for this kinase in human GCT. At molecular level, we demonstrated that endogenous MAPK15 is necessary to sustain cell cycle progression of EC cells, by limiting p53 activation and preventing the triggering of p53-dependent mechanisms resulting in cell cycle arrest.To understand MAPK15-dependent mechanisms impinging on p53 activation, we demonstrate that this kinase efficiently protects cells from DNA damage. Moreover, we show that the ability of MAPK15 to control the autophagic process is necessary for basal management of DNA damage and for tumor formation controlled by the kinase.In conclusion, our findings suggest that MAPK15 overexpression may contribute to the malignant transformation of germ cells by controlling a "stress support" autophagic pathway, able to prevent DNA damage and the consequent activation of the p53 tumor suppressor. Moreover, in light of these results, MAPK15-specific inhibitors might represent new tools to enhance the therapeutic index of cytotoxic therapy in GCT treatment, and to increase the sensitivity to DNA-damaging drugs in other chemotherapy-resistant human tumors. PMID:26988910

  6. Mitochondrial DNA Polymerase POLG1 Disease Mutations and Germline Variants Promote Tumorigenic Properties

    PubMed Central

    Singh, Bhupendra; Owens, Kjerstin M.; Bajpai, Prachi; Desouki, Mohamed Mokhtar; Srinivasasainagendra, Vinodh; Tiwari, Hemant K.; Singh, Keshav K.


    Germline mutations in mitochondrial DNA polymerase gamma (POLG1) induce mitochondrial DNA (mtDNA) mutations, depletion, and decrease oxidative phosphorylation. Earlier, we identified somatic mutations in POLG1 and the contribution of these mutations in human cancer. However, a role for germline variations in POLG1 in human cancers is unknown. In this study, we examined a role for disease associated germline variants of POLG1, POLG1 gene expression, copy number variation and regulation in human cancers. We analyzed the mutations, expression and copy number variation in POLG1 in several cancer databases and validated the analyses in primary breast tumors and breast cancer cell lines. We discovered 5-aza-2'-deoxycytidine led epigenetic regulation of POLG1, mtDNA-encoded genes and increased mitochondrial respiration. We conducted comprehensive race based bioinformatics analyses of POLG1 gene in more than 33,000 European-Americans and 5,000 African-Americans. We identified a mitochondrial disease causing missense variation in polymerase domain of POLG1 protein at amino acid 1143 (E1143G) to be 25 times more prevalent in European-Americans (allele frequency 0.03777) when compared to African-American (allele frequency 0.00151) population. We identified T251I and P587L missense variations in exonuclease and linker region of POLG1 also to be more prevalent in European-Americans. Expression of these variants increased glucose consumption, decreased ATP production and increased matrigel invasion. Interestingly, conditional expression of these variants revealed that matrigel invasion properties conferred by these germline variants were reversible suggesting a role of epigenetic regulators. Indeed, we identified a set of miRNA whose expression was reversible after variant expression was turned off. Together, our studies demonstrate altered genetic and epigenetic regulation of POLG1 in human cancers and suggest a role for POLG1 germline variants in promoting tumorigenic

  7. DNA duplex stability as discriminative characteristic for Escherichia coli σ(54)- and σ(28)- dependent promoter sequences.


    de Avila e Silva, Scheila; Forte, Franciele; T S Sartor, Ivaine; Andrighetti, Tahila; J L Gerhardt, Günther; Longaray Delamare, Ana Paula; Echeverrigaray, Sergio


    The advent of modern high-throughput sequencing has made it possible to generate vast quantities of genomic sequence data. However, the processing of this volume of information, including prediction of gene-coding and regulatory sequences remains an important bottleneck in bioinformatics research. In this work, we integrated DNA duplex stability into the repertoire of a Neural Network (NN) capable of predicting promoter regions with augmented accuracy, specificity and sensitivity. We took our method beyond a simplistic analysis based on a single sigma subunit of RNA polymerase, incorporating the six main sigma-subunits of Escherichia coli. This methodology employed successfully re-discovered known promoter sequences recognized by E. coli RNA polymerase subunits σ(24), σ(28), σ(32), σ(38), σ(54) and σ(70), with highlighted accuracies for σ(28)- and σ(54)- dependent promoter sequences (values obtained were 80% and 78.8%, respectively). Furthermore, the discrimination of promoters according to the σ factor made it possible to extract functional commonalities for the genes expressed by each type of promoter. The DNA duplex stability rises as a distinctive feature which improves the recognition and classification of σ(28)- and σ(54)- dependent promoter sequences. The findings presented in this report underscore the usefulness of including DNA biophysical parameters into NN learning algorithms to increase accuracy, specificity and sensitivity in promoter beyond what is accomplished based on sequence alone. PMID:24172230

  8. Establishment of a promoter-based chromatin architecture on recently replicated DNA can accommodate variable inter-nucleosome spacing

    PubMed Central

    Fennessy, Ross T.; Owen-Hughes, Tom


    Nucleosomes, the fundamental subunits of eukaryotic chromatin, are organized with respect to transcriptional start sites. A major challenge to the persistence of this organization is the disassembly of nucleosomes during DNA replication. Here, we use complimentary approaches to map the locations of nucleosomes on recently replicated DNA. We find that nucleosomes are substantially realigned with promoters during the minutes following DNA replication. As a result, the nucleosomal landscape is largely re-established before newly replicated chromosomes are partitioned into daughter cells and can serve as a platform for the re-establishment of gene expression programmes. When the supply of histones is disrupted through mutation of the chaperone Caf1, a promoter-based architecture is generated, but with increased inter-nucleosomal spacing. This indicates that the chromatin remodelling enzymes responsible for spacing nucleosomes are capable of organizing nucleosomes with a range of different linker DNA lengths. PMID:27106059

  9. Tunable DNA cleavage activity promoted by copper(ii) ternary complexes with N-donor heterocyclic ligands.


    Bortolotto, T; Silva-Caldeira, P P; Pich, C T; Pereira-Maia, E C; Terenzi, H


    Several small molecules have the capacity to cleave DNA promptly at high yields, even under mild conditions. Usually, this activity has no constraints, occurring without external or user control. Here, we demonstrate that UV-light exposure can greatly enhance the DNA cleavage activity promoted by four ternary copper(ii) complexes. A remarkable photocontrolled activity was achieved, which may be interesting for chemical and biochemical applications. PMID:27168172

  10. Interleukin-6 Promotes Tumorigenesis by Altering DNA Methylation in Oral Cancer Cells

    PubMed Central

    Gasche, Jacqueline A.; Hoffmann, Jürgen; Boland, C. Richard; Goel, Ajay


    Worldwide oral squamous cell carcinoma (OSCC) accounts for more than 100,000 deaths each year. Chronic inflammation constitutes one of the key risk factors for OSCC. Accumulating evidence suggests that aberrant DNA methylation may contribute to OSCC tumorigenesis. This study investigated whether chronic inflammation alters DNA methylation and expression of cancer-associated genes in OSCC. We established an in-vitro model of interleukin (IL)-6 mediating chronic inflammation in OSCC cell lines. Thereafter, we measured the ability of IL-6 to induce global hypomethylation of LINE-1 sequences, as well as CpG methylation changes using multiple methodologies including quantitative pyrosequencing, methylation-specific multiplex ligation-dependent probe amplification, and sensitive melting analysis after real-time methylation specific PCR. Gene expression was investigated by quantitative Reverse Transcriptase-PCR. IL-6 induced significant global LINE-1 hypomethylation (p=0.016) in our in-vitro model of inflammatory stress in OSCC cell lines. Simultaneously, IL-6 induced CpG promoter methylation changes in several important putative tumor suppressor genes including CHFR, GATA5, and PAX6. Methylation changes correlated inversely with the changes in the expression of corresponding genes. Our results indicate that IL-6-induced inflammation promotes tumorigenesis in the oral cavity by altering global LINE-1 hypomethylation. In addition, concurrent hypermethylation of multiple tumor suppressor genes by IL-6 suggests that epigenetic gene silencing may be an important consequence of chronic inflammation in the oral cavity. These findings have clinical relevance, as both methylation and inflammation are suitable targets for developing novel preventive and therapeutic measures. PMID:21710491

  11. Histone Methyltransferase Enhancer of Zeste Homolog 2-Mediated ABCA1 Promoter DNA Methylation Contributes to the Progression of Atherosclerosis

    PubMed Central

    Wan, Wei; Yao, Feng; He, Ping-Ping; Xie, Wei; Mo, Zhong-Cheng; Shi, Jin-Feng; Wu, Jian-Feng; Peng, Juan; Liu, Dan; Cayabyab, Francisco S.; Zheng, Xi-Long; Tang, Xiang-Yang; Ouyang, Xin-Ping; Tang, Chao-Ke


    ATP-binding cassette transporter A1 (ABCA1) plays a critical role in maintaining cellular cholesterol homeostasis. The purpose of this study is to identify the molecular mechanism(s) underlying ABCA1 epigenetic modification and determine its potential impact on ABCA1 expression in macrophage-derived foam cell formation and atherosclerosis development. DNA methylation induced foam cell formation from macrophages and promoted atherosclerosis in apolipoprotein E-deficient (apoE−/−) mice. Bioinformatics analyses revealed a large CpG island (CGI) located in the promoter region of ABCA1. Histone methyltransferase enhancer of zeste homolog 2 (EZH2) downregulated ABCA1 mRNA and protein expression in THP-1 and RAW264.7 macrophage-derived foam cells. Pharmacological inhibition of DNA methyltransferase 1 (DNMT1) with 5-Aza-dC or knockdown of DNMT1 prevented the downregulation of macrophage ABCA1 expression, suggesting a role of DNA methylation in ABCA1 expression. Polycomb protein EZH2 induced DNMT1 expression and methyl-CpG-binding protein-2 (MeCP2) recruitment, and stimulated the binding of DNMT1 and MeCP2 to ABCA1 promoter, thereby promoting ABCA1 gene DNA methylation and atherosclerosis. Knockdown of DNMT1 inhibited EZH2-induced downregulation of ABCA1 in macrophages. Conversely, EZH2 overexpression stimulated DNMT1-induced ABCA1 gene promoter methylation and atherosclerosis. EZH2-induced downregulation of ABCA1 gene expression promotes foam cell formation and the development of atherosclerosis by DNA methylation of ABCA1 gene promoter. PMID:27295295

  12. Histone Methyltransferase Enhancer of Zeste Homolog 2-Mediated ABCA1 Promoter DNA Methylation Contributes to the Progression of Atherosclerosis.


    Lv, Yun-Cheng; Tang, Yan-Yan; Zhang, Ping; Wan, Wei; Yao, Feng; He, Ping-Ping; Xie, Wei; Mo, Zhong-Cheng; Shi, Jin-Feng; Wu, Jian-Feng; Peng, Juan; Liu, Dan; Cayabyab, Francisco S; Zheng, Xi-Long; Tang, Xiang-Yang; Ouyang, Xin-Ping; Tang, Chao-Ke


    ATP-binding cassette transporter A1 (ABCA1) plays a critical role in maintaining cellular cholesterol homeostasis. The purpose of this study is to identify the molecular mechanism(s) underlying ABCA1 epigenetic modification and determine its potential impact on ABCA1 expression in macrophage-derived foam cell formation and atherosclerosis development. DNA methylation induced foam cell formation from macrophages and promoted atherosclerosis in apolipoprotein E-deficient (apoE-/-) mice. Bioinformatics analyses revealed a large CpG island (CGI) located in the promoter region of ABCA1. Histone methyltransferase enhancer of zeste homolog 2 (EZH2) downregulated ABCA1 mRNA and protein expression in THP-1 and RAW264.7 macrophage-derived foam cells. Pharmacological inhibition of DNA methyltransferase 1 (DNMT1) with 5-Aza-dC or knockdown of DNMT1 prevented the downregulation of macrophage ABCA1 expression, suggesting a role of DNA methylation in ABCA1 expression. Polycomb protein EZH2 induced DNMT1 expression and methyl-CpG-binding protein-2 (MeCP2) recruitment, and stimulated the binding of DNMT1 and MeCP2 to ABCA1 promoter, thereby promoting ABCA1 gene DNA methylation and atherosclerosis. Knockdown of DNMT1 inhibited EZH2-induced downregulation of ABCA1 in macrophages. Conversely, EZH2 overexpression stimulated DNMT1-induced ABCA1 gene promoter methylation and atherosclerosis. EZH2-induced downregulation of ABCA1 gene expression promotes foam cell formation and the development of atherosclerosis by DNA methylation of ABCA1 gene promoter. PMID:27295295

  13. Interaction of Individual Structural Domains of hnRNP LL with the BCL2 Promoter i-Motif DNA.


    Roy, Basab; Talukder, Poulami; Kang, Hyun-Jin; Tsuen, Shujian S; Alam, Mohammad P; Hurley, Laurence H; Hecht, Sidney M


    The recently discovered role of the BCL2 (B-cell lymphoma 2 gene) promoter i-motif DNA in modulation of gene expression via interaction with the ribonucleoprotein hnRNP L-like (hnRNP LL) has prompted a more detailed study of the nature of this protein-DNA interaction. The RNA recognition motifs (RRMs) of hnRNP LL were expressed individually, and both RRM1 and RRM2 were found to bind efficiently to the BCL2 i-motif DNA, as well as being critical for transcriptional activation, whereas RRM3-4 bound only weakly to this DNA. Binding was followed by unfolding of the DNA as monitored by changes in the CD spectrum. Mutational analysis of the i-motif DNA revealed that binding involved primarily the lateral loops of the i-motif. The kinetics of binding of the DNA with RRM1 was explored by recording CD spectra at predetermined times following admixture of the protein and DNA. The change in molar ellipticity was readily apparent after 30 s and largely complete within 1 min. A more detailed view of protein-DNA interaction was obtained by introducing the fluorescence donor 6-CNTrp in RRM1 at position 137, and the acceptor 4-aminobenzo[g]quinazoline-2-one (Cf) in lieu of cytidine22 in the i-motif DNA. The course of binding of the two species was monitored by FRET, which reflected a steady increase in energy transfer over a period of several minutes. The FRET signal could be diminished by the further addition of (unlabeled) RRM2, no doubt reflecting competition for binding to the i-motif DNA. These experiments using the individual RRM domains from hnRNP LL confirm the role of this transcription factor in activation of BCL2 transcription via the i-motif in the promoter element. PMID:27483029

  14. Association between early promoter-specific DNA methylation changes and outcome in older acute myeloid leukemia patients.


    Achille, Nicholas J; Othus, Megan; Phelan, Kathleen; Zhang, Shubin; Cooper, Kathrine; Godwin, John E; Appelbaum, Frederick R; Radich, Jerald P; Erba, Harry P; Nand, Sucha; Zeleznik-Le, Nancy J


    Treatment options for older patients with acute myeloid leukemia (AML) range from supportive care alone to full-dose chemotherapy. Identifying factors that predict response to therapy may help increase efficacy and avoid toxicity. The phase II SWOG S0703 study investigated the use of hydroxyurea and azacitidine with gemtuzumab ozogamicin in the elderly AML population and found survival rates similar to those expected with standard AML regimens, with less toxicity. As part of this study, global DNA methylation along with promoter DNA methylation and expression analysis of six candidate genes (CDKN2A, CDKN2B, HIC1, RARB, CDH1 and APAF1) were determined before and during therapy to investigate whether very early changes are prognostic for clinical response. Global DNA methylation was not associated with a clinical response. Samples after 3 or 4 days of treatment with azacitidine showed significantly decreased CDKN2A promoter DNA methylation in patients achieving complete remission (CR) compared to those who did not. Samples from day 7 of treatment showed significantly decreased RARB, CDKN2B and CDH1 promoter DNA methylation in responders compared to nonresponders. Gene-specific DNA methylation analysis of peripheral blood samples may help early identification of those older AML patients most likely to benefit from demethylating agent therapy. PMID:26818573

  15. Tousled-like kinases phosphorylate Asf1 to promote histone supply during DNA replication

    NASA Astrophysics Data System (ADS)

    Klimovskaia, Ilnaz M.; Young, Clifford; Strømme, Caroline B.; Menard, Patrice; Jasencakova, Zuzana; Mejlvang, Jakob; Ask, Katrine; Ploug, Michael; Nielsen, Michael L.; Jensen, Ole N.; Groth, Anja


    During DNA replication, nucleosomes are rapidly assembled on newly synthesized DNA to restore chromatin organization. Asf1, a key histone H3-H4 chaperone required for this process, is phosphorylated by Tousled-like kinases (TLKs). Here, we identify TLK phosphorylation sites by mass spectrometry and dissect how phosphorylation has an impact on human Asf1 function. The divergent C-terminal tail of Asf1a is phosphorylated at several sites, and this is required for timely progression through S phase. Consistent with this, biochemical analysis of wild-type and phospho-mimetic Asf1a shows that phosphorylation enhances binding to histones and the downstream chaperones CAF-1 and HIRA. Moreover, we find that TLK phosphorylation of Asf1a is induced in cells experiencing deficiency of new histones and that TLK interaction with Asf1a involves its histone-binding pocket. We thus propose that TLK signalling promotes histone supply in S phase by targeting histone-free Asf1 and stimulating its ability to shuttle histones to sites of chromatin assembly.

  16. [DNA bend sites in the promoter region of the human estrogen receptor alpha gene].


    Kuwabara, K; Sakuma, Y


    DNA bend sites in the promoter region of the human estrogen receptor a gene were determined by the circular permutation assay. Among a total of five sites (ERB -4 to -1, and ERB + 1) mapped in the 3 kb region, three matched with the positions of the predicted periodicity while the other two did not. Most of the sites were accompanied by the short poly (dA)-poly (dT) tracts including the potential bend core sequence A2N8A2N8A2 (A/A/A). Fine mapping of the ERB-2 site indicated that this A/A/A and the immediate franking sequences contained motifs for the estrogen response element. This region had a higher affinity for the nuclear scaffold and was included in the core region of the nucleosome structure. However, binding of the nuclear factor(s) to the motifs and disruption of nucleosome structure occurred without ATP. These results suggest that a class of periodic bent DNA could act as a site of multiple interactions among the nuclear scaffold, core histones and nuclear factors. PMID:9893449

  17. Differentiated, Promoter-specific Response of [4Fe-4S] NsrR DNA Binding to Reaction with Nitric Oxide*

    PubMed Central

    Crack, Jason C.; Svistunenko, Dimitri A.; Munnoch, John; Thomson, Andrew J.; Hutchings, Matthew I.; Le Brun, Nick E.


    NsrR is an iron-sulfur cluster protein that regulates the nitric oxide (NO) stress response of many bacteria. NsrR from Streptomyces coelicolor regulates its own expression and that of only two other genes, hmpA1 and hmpA2, which encode HmpA enzymes predicted to detoxify NO. NsrR binds promoter DNA with high affinity only when coordinating a [4Fe-4S] cluster. Here we show that reaction of [4Fe-4S] NsrR with NO affects DNA binding differently depending on the gene promoter. Binding to the hmpA2 promoter was abolished at ∼2 NO per cluster, although for the hmpA1 and nsrR promoters, ∼4 and ∼8 NO molecules, respectively, were required to abolish DNA binding. Spectroscopic and kinetic studies of the NO reaction revealed a rapid, multi-phase, non-concerted process involving up to 8–10 NO molecules per cluster, leading to the formation of several iron-nitrosyl species. A distinct intermediate was observed at ∼2 NO per cluster, along with two further intermediates at ∼4 and ∼6 NO. The NsrR nitrosylation reaction was not significantly affected by DNA binding. These results show that NsrR regulates different promoters in response to different concentrations of NO. Spectroscopic evidence indicates that this is achieved by different NO-FeS complexes. PMID:26887943

  18. Differentiated, Promoter-specific Response of [4Fe-4S] NsrR DNA Binding to Reaction with Nitric Oxide.


    Crack, Jason C; Svistunenko, Dimitri A; Munnoch, John; Thomson, Andrew J; Hutchings, Matthew I; Le Brun, Nick E


    NsrR is an iron-sulfur cluster protein that regulates the nitric oxide (NO) stress response of many bacteria. NsrR from Streptomyces coelicolor regulates its own expression and that of only two other genes, hmpA1 and hmpA2, which encode HmpA enzymes predicted to detoxify NO. NsrR binds promoter DNA with high affinity only when coordinating a [4Fe-4S] cluster. Here we show that reaction of [4Fe-4S] NsrR with NO affects DNA binding differently depending on the gene promoter. Binding to the hmpA2 promoter was abolished at ∼2 NO per cluster, although for the hmpA1 and nsrR promoters, ∼4 and ∼8 NO molecules, respectively, were required to abolish DNA binding. Spectroscopic and kinetic studies of the NO reaction revealed a rapid, multi-phase, non-concerted process involving up to 8-10 NO molecules per cluster, leading to the formation of several iron-nitrosyl species. A distinct intermediate was observed at ∼2 NO per cluster, along with two further intermediates at ∼4 and ∼6 NO. The NsrR nitrosylation reaction was not significantly affected by DNA binding. These results show that NsrR regulates different promoters in response to different concentrations of NO. Spectroscopic evidence indicates that this is achieved by different NO-FeS complexes. PMID:26887943

  19. BRUCE regulates DNA double-strand break response by promoting USP8 deubiquitination of BRIT1

    PubMed Central

    Ge, Chunmin; Che, Lixiao; Ren, Jinyu; Pandita, Raj K.; Lu, Jing; Li, Kaiyi; Pandita, Tej K.; Du, Chunying


    The DNA damage response (DDR) is crucial for genomic integrity. BRIT1 (breast cancer susceptibility gene C terminus-repeat inhibitor of human telomerase repeat transcriptase expression), a tumor suppressor and early DDR factor, is recruited to DNA double-strand breaks (DSBs) by phosphorylated H2A histone family, member X (γ-H2AX), where it promotes chromatin relaxation by recruiting the switch/sucrose nonfermentable (SWI–SNF) chromatin remodeler to facilitate DDR. However, regulation of BRIT1 recruitment is not fully understood. The baculovirus IAP repeat (BIR)-containing ubiquitin-conjugating enzyme (BRUCE) is an inhibitor of apoptosis protein (IAP). Here, we report a non-IAP function of BRUCE in the regulation of the BRIT1–SWI–SNF DSB-response pathway and genomic stability. We demonstrate that BRIT1 is K63 ubiquitinated in unstimulated cells and that deubiquitination of BRIT1 is a prerequisite for its recruitment to DSB sites by γ-H2AX. We show mechanistically that BRUCE acts as a scaffold, bridging the ubiquitin-specific peptidase 8 (USP8) and BRIT1 in a complex to coordinate USP8-catalyzed deubiquitination of BRIT1. Loss of BRUCE or USP8 impairs BRIT1 deubiquitination, BRIT1 binding with γ-H2AX, the formation of BRIT1 DNA damage foci, and chromatin relaxation. Moreover, BRUCE-depleted cells display reduced homologous recombination repair, and BRUCE-mutant mice exhibit repair defects and genomic instability. These findings identify BRUCE and USP8 as two hitherto uncharacterized critical DDR regulators and uncover a deubiquitination regulation of BRIT1 assembly at damaged chromatin for efficient DDR and genomic stability. PMID:25733871

  20. Genome-wide study predicts promoter-G4 DNA motifs regulate selective functions in bacteria: radioresistance of D. radiodurans involves G4 DNA-mediated regulation

    PubMed Central

    Beaume, Nicolas; Pathak, Rajiv; Yadav, Vinod Kumar; Kota, Swathi; Misra, Hari S.; Gautam, Hemant K.; Chowdhury, Shantanu


    A remarkable number of guanine-rich sequences with potential to adopt non-canonical secondary structures called G-quadruplexes (or G4 DNA) are found within gene promoters. Despite growing interest, regulatory role of quadruplex DNA motifs in intrinsic cellular function remains poorly understood. Herein, we asked whether occurrence of potential G4 (PG4) DNA in promoters is associated with specific function(s) in bacteria. Using a normalized promoter-PG4-content (PG4P) index we analysed >60 000 promoters in 19 well-annotated species for (a) function class(es) and (b) gene(s) with enriched PG4P. Unexpectedly, PG4-associated functional classes were organism specific, suggesting that PG4 motifs may impart specific function to organisms. As a case study, we analysed radioresistance. Interestingly, unsupervised clustering using PG4P of 21 genes, crucial for radioresistance, grouped three radioresistant microorganisms including Deinococcus radiodurans. Based on these predictions we tested and found that in presence of nanomolar amounts of the intracellular quadruplex-binding ligand N-methyl mesoporphyrin (NMM), radioresistance of D. radiodurans was attenuated by ∼60%. In addition, important components of the RecF recombinational repair pathway recA, recF, recO, recR and recQ genes were found to harbour promoter-PG4 motifs and were also down-regulated in presence of NMM. Together these results provide first evidence that radioresistance may involve G4 DNA-mediated regulation and support the rationale that promoter-PG4s influence selective functions. PMID:23161683

  1. Threonine phosphorylation prevents promoter DNA binding of the Group B Streptococcus response regulator CovR.


    Lin, Wan-Jung; Walthers, Don; Connelly, James E; Burnside, Kellie; Jewell, Kelsea A; Kenney, Linda J; Rajagopal, Lakshmi


    All living organisms communicate with the external environment for their survival and existence. In prokaryotes, communication is achieved by two-component systems (TCS) comprising histidine kinases and response regulators. In eukaryotes, signalling is accomplished by serine/threonine and tyrosine kinases. Although TCS and serine/threonine kinases coexist in prokaryotes, direct cross-talk between these families was first described in Group B Streptococcus (GBS). A serine/threonine kinase (Stk1) and a TCS (CovR/CovS) co-regulate toxin expression in GBS. Typically, promoter binding of regulators like CovR is controlled by phosphorylation of the conserved active site aspartate (D53). In this study, we show that Stk1 phosphorylates CovR at threonine 65. The functional consequence of threonine phosphorylation of CovR in GBS was evaluated using phosphomimetic and silencing substitutions. GBS encoding the phosphomimetic T65E allele are deficient for CovR regulation unlike strains encoding the non-phosphorylated T65A allele. Further, compared with wild-type or T65A CovR, the T65E CovR is unable to bind promoter DNA and is decreased for phosphorylation at D53, similar to Stk1-phosphorylated CovR. Collectively, we provide evidence for a novel mechanism of response regulator control that enables GBS (and possibly other prokaryotes) to fine-tune gene expression for environmental adaptation. PMID:19170889

  2. A dynamic CTCF chromatin binding landscape promotes DNA hydroxymethylation and transcriptional induction of adipocyte differentiation.


    Dubois-Chevalier, Julie; Oger, Frédérik; Dehondt, Hélène; Firmin, François F; Gheeraert, Céline; Staels, Bart; Lefebvre, Philippe; Eeckhoute, Jérôme


    CCCTC-binding factor (CTCF) is a ubiquitously expressed multifunctional transcription factor characterized by chromatin binding patterns often described as largely invariant. In this context, how CTCF chromatin recruitment and functionalities are used to promote cell type-specific gene expression remains poorly defined. Here, we show that, in addition to constitutively bound CTCF binding sites (CTS), the CTCF cistrome comprises a large proportion of sites showing highly dynamic binding patterns during the course of adipogenesis. Interestingly, dynamic CTCF chromatin binding is positively linked with changes in expression of genes involved in biological functions defining the different stages of adipogenesis. Importantly, a subset of these dynamic CTS are gained at cell type-specific regulatory regions, in line with a requirement for CTCF in transcriptional induction of adipocyte differentiation. This relates to, at least in part, CTCF requirement for transcriptional activation of both the nuclear receptor peroxisome proliferator-activated receptor gamma (PPARG) and its target genes. Functionally, we show that CTCF interacts with TET methylcytosine dioxygenase (TET) enzymes and promotes adipogenic transcriptional enhancer DNA hydroxymethylation. Our study reveals a dynamic CTCF chromatin binding landscape required for epigenomic remodeling of enhancers and transcriptional activation driving cell differentiation. PMID:25183525

  3. A dynamic CTCF chromatin binding landscape promotes DNA hydroxymethylation and transcriptional induction of adipocyte differentiation

    PubMed Central

    Dubois-Chevalier, Julie; Oger, Frédérik; Dehondt, Hélène; Firmin, François F.; Gheeraert, Céline; Staels, Bart; Lefebvre, Philippe; Eeckhoute, Jérôme


    CCCTC-binding factor (CTCF) is a ubiquitously expressed multifunctional transcription factor characterized by chromatin binding patterns often described as largely invariant. In this context, how CTCF chromatin recruitment and functionalities are used to promote cell type-specific gene expression remains poorly defined. Here, we show that, in addition to constitutively bound CTCF binding sites (CTS), the CTCF cistrome comprises a large proportion of sites showing highly dynamic binding patterns during the course of adipogenesis. Interestingly, dynamic CTCF chromatin binding is positively linked with changes in expression of genes involved in biological functions defining the different stages of adipogenesis. Importantly, a subset of these dynamic CTS are gained at cell type-specific regulatory regions, in line with a requirement for CTCF in transcriptional induction of adipocyte differentiation. This relates to, at least in part, CTCF requirement for transcriptional activation of both the nuclear receptor peroxisome proliferator-activated receptor gamma (PPARG) and its target genes. Functionally, we show that CTCF interacts with TET methylcytosine dioxygenase (TET) enzymes and promotes adipogenic transcriptional enhancer DNA hydroxymethylation. Our study reveals a dynamic CTCF chromatin binding landscape required for epigenomic remodeling of enhancers and transcriptional activation driving cell differentiation. PMID:25183525

  4. TFIIIB subunit locations on U6 gene promoter DNA mapped by site-specific protein-DNA photo-cross-linking.


    Kang, Jin Joo; Kang, Yoon Soon; Stumph, William E


    RNA polymerase III-transcribed U6 snRNA genes have gene-external promoters that contain TATA boxes. U6 TATA sequences are bound by TFIIIB that in Drosophila contains the three subunits TBP, Brf1, and Bdp1. The overall structure of TFIIIB is still not well understood. We have therefore studied the mode of TFIIIB binding to DNA by site-specific protein-DNA photo-cross-linking. The results indicate that a portion of Brf1 is sandwiched between Bdp1 and TBP upstream of the TATA box. Furthermore, Bdp1 traverses the DNA under the N-terminal stirrup of TBP to interact with the DNA (and very likely Brf1) downstream of the TATA sequence. PMID:27112515

  5. The roles of DNA polymerase ζ and the Y family DNA polymerases in promoting or preventing genome instability

    PubMed Central

    Sharma, Shilpy; Helchowski, Corey M.; Canman, Christine E.


    Cancer cells display numerous abnormal characteristics which are initiated and maintained by elevated mutation rates and genome instability. Chromosomal DNA is continuously surveyed for the presence of damage or blocked replication forks by the DNA Damage Response (DDR) network. The DDR is complex and includes activation of cell cycle checkpoints, DNA repair, gene transcription, and induction of apoptosis. Duplicating a damaged genome is associated with elevated risks to fork collapse and genome instability. Therefore, the DNA Damage Tolerance (DDT) pathway is also employed to enhance survival and involves the recruitment of translesion DNA synthesis (TLS) polymerases to sites of replication fork blockade or single stranded DNA gaps left after the completion of replication in order to restore DNA to its double stranded form before mitosis. TLS polymerases are specialized for inserting nucleotides opposite DNA adducts, abasic sites, or DNA crosslinks. By definition, the DDT pathway is not involved in the actual repair of damaged DNA, but provides a mechanism to tolerate DNA lesions during replication thereby increasing survival and lessening the chance for genome instability. However this may be associated with increased mutagenesis. In this review, we will describe the specialized functions of Y family polymerases (Rev1, Polη, Polι and Polκ) and DNA polymerase ζ in lesion bypass, mutagenesis, and prevention of genome instability, the latter due to newly appreciated roles in DNA repair. The recently described role of the Fanconi anemia pathway in regulating Rev1 and Polζ-dependent TLS is also discussed in terms of their involvement in TLS, interstrand crosslink repair, and homologous recombination. PMID:23195997

  6. Naturally Extended CT · AG Repeats Increase H-DNA Structures and Promoter Activity in the Smooth Muscle Myosin Light Chain Kinase Gene▿

    PubMed Central

    Han, Yoo-Jeong; de Lanerolle, Primal


    Naturally occurring repeat sequences capable of adopting H-DNA structures are abundant in promoters of disease-related genes. In support of this, we found (CT)22 · (AG)22 repeats in the promoter of smooth muscle myosin light chain kinase (smMLCK), a key regulator of vascular smooth muscle function. We also found an insertion mutation that adds another six pairs of CT · AG repeats and increases smMLCK promoter activity in spontaneously hypertensive rats (SHR). Therefore, we used the smMLCK promoters from normotensive and hypertensive rats as a model system to determine how CT · AG repeats form H-DNA, an intramolecular triplex, and regulate promoter activity. High-resolution mapping with a chemical probe selective for H-DNA showed that the CT · AG repeats adopt H-DNA structures at a neutral pH. Importantly, the SHR promoter forms longer H-DNA structures than the promoter from normotensive rats. Reconstituting nucleosomes on the promoters, in vitro, showed no difference in nucleosome positioning between the two promoters. However, chromatin immunoprecipitation analyses revealed that histone acetylations are greater in the hypertensive promoter. Thus, our findings suggest that the extended CT · AG repeats in the SHR promoter increase H-DNA structures, histone modifications, and promoter activity of the smMLCK, perhaps contributing to vascular disorders in hypertension. PMID:17991897

  7. Promotion

    PubMed Central

    Alam, Hasan B.


    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed. PMID:24436683


    PubMed Central

    Tewary, Poonam; dela Rosa, Gonzalo; Sharma, Neeraj; Rodriguez, Luis G; Tarasov, Sergey G; Howard, OM Zack; Shirota, Hidekazu; Steinhagen, Folkert; Klinman, Dennis M.; Yang, De; Oppenheim, Joost J.


    Alarmins are a group of structurally diverse host defense antimicrobial peptides that are important immune activators. Here we present a novel role of two potent alarmins, human beta defensin 2 and 3 (HBD2 and 3) in promoting IFN-α production by human plasmacytoid DCs (pDCs). We demonstrate that HBD2 and 3 activate pDCs by enhancing the intracellular uptake of CpG and self DNA and promote DNA induced IFN-α production in a TLR9 dependent manner. Both CpG and host DNA form aggregates that resemble DNA nets when combined with HBD2 and 3. Isothermal Titration Calorimetry (ITC) studies to elucidate the nature of HBD3-CpG complexes demonstrates involvement of enthalpy driven interactions in addition to hydrophobic interactions with the formation of complexes at a molar ratio of 2:1 defensin/CpG. Intravenous administration of HBD3-CpG complexes induced proinflammatory cytokines like IL-12, IFN-γ, IL-6, IFN-α and IL-10 in serum associated with an increased recruitment of antigen presenting cells (APCs) in the spleen. Subcutaneous injections of these complexes showed enhanced infiltration of inflammatory cells at injection site indicating a potential pathophysiological role of alarmin/DNA complexes in contributing to inflammation. Intraperitoneal immunization of HBD3/CpG complexes with OVA enhanced both cellular and humoral responses in response to OVA as compared to OVA/HBD3 or OVA/CPG alone, indicative of a much more potent adjuvant effect of the HBD3/CpG complexes. Thus the ability of defensins to enhance cellular uptake of nucleic acids can lead to improved vaccine formulations by promoting their uptake by various cells resulting in an enhanced immune response. PMID:23776172

  9. Crystal Structure of Mouse Elf3 C-terminal DNA-binding Domain in Complex with Type II TGF-[beta] Receptor Promoter DNA

    SciTech Connect

    Agarkar, Vinod B.; Babayeva, Nigar D.; Wilder, Phillip J.; Rizzino, Angie; Tahirov, Tahir H.


    The Ets family of transcription factors is composed of more than 30 members. One of its members, Elf3, is expressed in virtually all epithelial cells as well as in many tumors, including breast tumors. Several studies observed that the promoter of the type II TGF-{beta} receptor gene (T{beta}R-II) is strongly stimulated by Elf3 via two adjacent Elf3 binding sites, the A-site and the B-site. Here, we report the 2.2 {angstrom} resolution crystal structure of a mouse Elf3 C-terminal fragment, containing the DNA-binding Ets domain, in complex with the B-site of mouse type II TGF-{beta} receptor promoter DNA (mT{beta}R-II{sub DNA}). Elf3 contacts the core GGAA motif of the B-site from a major groove similar to that of known Ets proteins. However, unlike other Ets proteins, Elf3 also contacts sequences of the A-site from the minor groove of the DNA. DNA binding experiments and cell-based transcription studies indicate that minor groove interaction by Arg349 located in the Ets domain is important for Elf3 function. Equally interesting, previous studies have shown that the C-terminal region of Elf3, which flanks the Ets domain, is required for Elf3 binding to DNA. In this study, we determined that Elf3 amino acid residues within this flanking region, including Trp361, are important for the structural integrity of the protein as well as for the Efl3 DNA binding and transactivation activity.

  10. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.


    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay


    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  11. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    SciTech Connect

    Fukumoto, Yasunori Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto


    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint.

  12. Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.

    PubMed Central

    Katsani, K R; Hajibagheri, M A; Verrijzer, C P


    The POZ domain is a conserved protein-protein interaction motif present in a variety of transcription factors involved in development, chromatin remodelling and human cancers. Here, we study the role of the POZ domain of the GAGA transcription factor in promoter recognition. Natural target promoters for GAGA typically contain multiple GAGA-binding elements. Our results show that the POZ domain mediates strong co-operative binding to multiple sites but inhibits binding to single sites. Protein cross-linking and gel filtration chromatography experiments established that the POZ domain is required for GAGA oligomerization into higher order complexes. Thus, GAGA oligomerization increases binding specificity by selecting only promoters with multiple sites. Electron microscopy revealed that GAGA binds to multiple sites as a large oligomer and induces bending of the promoter DNA. Our results indicate a novel mode of DNA binding by GAGA, in which a large GAGA complex binds multiple GAGA elements that are spread out over a region of a few hundred base pairs. We suggest a model in which the promoter DNA is wrapped around a GAGA multimer in a conformation that may exclude normal nucleosome formation. PMID:9927429

  13. Progranulin promotes Temozolomide resistance of glioblastoma by orchestrating DNA repair and tumor stemness.


    Bandey, I; Chiou, S-H; Huang, A-P; Tsai, J-C; Tu, P-h


    Glioblastoma multiforme (GBM) is the most common malignant brain tumor in adults with a dismal prognosis. Current therapy of surgical removal combined with Temozolomide (TMZ) and radiation therapy only slightly prolongs the survival of GBM patients. Thus, it is essential to elucidate mechanism underlying its highly malignant properties in order to develop efficacious therapeutic regimens. In this study, we showed that progranulin (PGRN) was overexpressed in most GBM cell lines and the majority of human tumor samples. PGRN overexpression conferred GBM cells with tumorigenic properties and TMZ resistance by upregulating DNA repair (PARP, ATM, BRCA1, Rad51, XRCC1 and so on) and cancer stemness (CD133, CD44, ABCG2) genes, in part via an AP-1 transcription factor, specifically cFos/JunB. Curcumin, an AP-1 inhibitor, was also found to regulate PGRN promoter activity and expression including its downstream effectors aforementioned. These data suggested a feedforward loop between PGRN signaling and AP-1. PGRN depletion significantly decreased unlimited self-renewal and multilineage differentiation and the malignant properties of GBMs cells S1R1, and enhanced their vulnerability to TMZ. In addition, S1R1 depleted of PGRN also lost the ability to form tumor in an orthotopic xenograft mouse model. In conclusion, PGRN had a critical role in the pathogenesis and chemoresistance of GBM and functioned at the top of the hierarchy of cellular machinery that modulates both DNA repair pathways and cancer stemness. Our data suggest that a new strategy combining current regimens with compounds targeting PGRN/AP-1 loop like curcumin may significantly improve the therapeutic outcome of GBM. PMID:24793792

  14. DNA Methylation in the Neuropeptide S Receptor 1 (NPSR1) Promoter in Relation to Asthma and Environmental Factors

    PubMed Central

    Reinius, Lovisa E.; Gref, Anna; Sääf, Annika; Acevedo, Nathalie; Joerink, Maaike; Kupczyk, Maciej; D'Amato, Mauro; Bergström, Anna; Melén, Erik; Scheynius, Annika; Dahlén, Sven-Erik; Pershagen, Göran; Söderhäll, Cilla; Kere, Juha


    Asthma and allergy are complex disorders influenced by both inheritance and environment, a relationship that might be further clarified by epigenetics. Neuropeptide S Receptor 1 (NPSR1) has been associated with asthma and allergy and a study suggested modulation of the genetic risk by environmental factors. We aimed to study DNA methylation in the promoter region of NPSR1 in relation to asthma and environmental exposures. Electrophoretic Mobility Shift Assay (EMSA) was used to investigate potential functional roles of both genotypes and methylation status in the NPSR1 promoter. DNA methylation was analysed using EpiTYPER in blood samples from two well-characterized cohorts; the BIOAIR study of severe asthma in adults and the Swedish birth cohort BAMSE. We observed that DNA methylation and genetic variants in the promoter influenced the binding of nuclear proteins to DNA, suggesting functional relevance. Significant, although small, differences in methylation were related to both adult severe asthma (p = 0.0001) and childhood allergic asthma (p = 0.01). Furthermore, DNA methylation was associated with exposures such as current smoking in adults for two CpG sites (p = 0.005 and 0.04), parental smoking during infancy in the children (p = 0.02) and in which month the sample was taken (p = 0.01). In summary, DNA methylation levels in the promoter of NPSR1 showed small but significant associations with asthma, both in adults and in children, and to related traits such as allergy and certain environmental exposures. Both genetic variation and the methylated state of CpG sites seem to have an effect on the binding of nuclear proteins in the regulatory region of NPSR1 suggesting complex regulation of this gene in asthma and allergy. PMID:23372674

  15. Rapid release of plasmid DNA from surfaces coated with polyelectrolyte multilayers promoted by the application of electrochemical potentials.


    Aytar, Burcu S; Prausnitz, Mark R; Lynn, David M


    We report an approach to the rapid release of DNA based on the application of electrochemical potentials to surfaces coated with polyelectrolyte-based thin films. We fabricated multilayered polyelectrolyte films (or "polyelectrolyte multilayers", PEMs) using plasmid DNA and a model hydrolytically degradable cationic poly(β-amino ester) (polymer 1) on stainless steel substrates using a layer-by-layer approach. The application of continuous reduction potentials in the range of -1.1 to -0.7 V (vs a Ag/AgCl electrode) to film-coated electrodes in PBS at 37 °C resulted in the complete release of DNA over a period of 1-2 min. Film-coated electrodes incubated under identical conditions in the absence of applied potentials required 1-2 days for complete release. Control over the magnitude of the applied potential provided control over the rate at which DNA was released. The results of these and additional physical characterization experiments are consistent with a mechanism of film disruption that is promoted by local increases in pH at the film/electrode interface (resulting from electrochemical reduction of water or dissolved oxygen) that disrupt ionic interactions in these materials. The results of cell-based experiments demonstrated that DNA was released in a form that remains intact and able to promote transgene expression in mammalian cells. Finally, we demonstrate that short-term (i.e., non-continuous) electrochemical treatments can also be used to promote faster film erosion (e.g., over 1-2 h) once the potential is removed. Past studies demonstrate that PEMs fabricated using polymer 1 can promote surface-mediated transfection of cells and tissues in vitro and in vivo. With further development, the electrochemical approaches reported here could thus provide new methods for the rapid, triggered, or spatially patterned transfer of DNA (or other agents) from surfaces of interest in a variety of fundamental and applied contexts. PMID:22551230

  16. Indirubin derivatives alter DNA binding activity of the transcription factor NF-Y and inhibit MDR1 gene promoter.


    Tanaka, Toru; Ohashi, Sachiyo; Saito, Hiroaki; Higuchi, Takashi; Tabata, Keiichi; Kosuge, Yasuhiro; Suzuki, Takashi; Miyairi, Shinichi; Kobayashi, Shunsuke


    Indirubin derivatives exert antitumor activity. However, their effects on the expression of multidrug resistance gene 1 (MDR1) have not been investigated. Here we found three derivatives that inhibit the MDR1 gene promoter. To investigate the effects of indirubins on the DNA binding of NF-Y, a major MDR1 gene transcription factor that recognizes an inverted CCAAT element in the promoter, gel mobility shift assay was performed using the element as a probe with nuclear extracts from NG108-15, MCF7, HepG2, C2C12, and SK-N-SH cells. Among 17 compounds, 5-methoxyindirubin inhibited the DNA binding of NF-Y significantly, whereas indirubin-3'-oxime and 7-methoxyindirubin 3'-oxime increased the binding considerably. After evaluating a suitable concentration of each compound for transcription analysis using living tumor cells, we performed a reporter gene assay using a reporter DNA plasmid containing EGFP cDNA fused to the MDR1 gene promoter region. Indirubin-3'-oxime exerted a significant inhibitory effect on the MDR1 promoter activity in MCF7 and HepG2 cells, and 5-methoxyindirubin inhibited the activity only in MCF7 cells; 7-methoxyindirubin 3'-oxime suppressed the activity in all of the cell lines. We further confirmed that the compounds reduced endogenous MDR1 transcription without any inhibitory effect on NF-Y expression. Moreover, each compound increased the doxorubicin sensitivity of MCF7 cells. These results indicate that each indirubin derivative acts on the DNA binding of NF-Y and represses the MDR1 gene promoter with tumor cell-type specificity. PMID:25066113

  17. A critical re-assessment of DNA repair gene promoter methylation in non-small cell lung carcinoma

    PubMed Central

    Do, Hongdo; Wong, Nicholas C.; Murone, Carmel; John, Thomas; Solomon, Benjamin; Mitchell, Paul L.; Dobrovic, Alexander


    DNA repair genes that have been inactivated by promoter methylation offer potential therapeutic targets either by targeting the specific repair deficiency, or by synthetic lethal approaches. This study evaluated promoter methylation status for eight selected DNA repair genes (ATM, BRCA1, ERCC1, MGMT, MLH1, NEIL1, RAD23B and XPC) in 56 non-small cell lung cancer (NSCLC) tumours and 11 lung cell lines using the methylation-sensitive high resolution melting (MS-HRM) methodology. Frequent methylation in NEIL1 (42%) and infrequent methylation in ERCC1 (2%) and RAD23B (2%) are reported for the first time in NSCLC. MGMT methylation was detected in 13% of the NSCLCs. Contrary to previous studies, methylation was not detected in ATM, BRCA1, MLH1 and XPC. Data from The Cancer Genome Atlas (TCGA) was consistent with these findings. The study emphasises the importance of using appropriate methodology for accurate assessment of promoter methylation. PMID:24569633

  18. DNA affinity labeling of adenovirus type 2 upstream promoter sequence-binding factors identifies two distinct proteins

    SciTech Connect

    Safer, B.; Cohen, R.B.; Garfinkel, S.; Thompson, J.A.


    A rapid affinity labeling procedure with enhanced specificity was developed to identify DNA-binding proteins. /sup 32/P was first introduced at unique phosphodiester bonds within the DNA recognition sequence. UV light-dependent cross-linking of pyrimidines to amino acid residues in direct contact at the binding site, followed by micrococcal nuclease digestion, resulted in the transfer of /sup 32/P to only those specific protein(s) which recognized the binding sequence. This method was applied to the detection and characterization of proteins that bound to the upstream promoter sequence (-50 to -66) of the human adenovirus type 2 major late promoter. We detected two distinct proteins with molecular weights of 45,000 and 116,000 that interacted with this promoter element. The two proteins differed significantly in their chromatographic and cross-linking behaviors.

  19. Hepatitis B virus basal core promoter mutations show lower replication fitness associated with cccDNA acetylation status.


    Koumbi, Lemonica; Pollicino, Teresa; Raimondo, Giovanni; Stampoulis, Dimitrios; Khakoo, Salim; Karayiannis, Peter


    In chronic hepatitis B virus (HBV) infection, variants with mutations in the basal core promoter (BCP) and precore region predominate and associate with more severe disease forms. Studies on their effect on viral replication remain controversial. Increasing evidence shows that epigenetic modifications of cccDNA regulate HBV replication and disease outcome. Here we determined the transcription and viral replication efficiency of well-defined BCP and precore mutations and their effect on cccDNA epigenetic control. HBV monomers bearing BCP mutations A1762T/G1764A and A1762T/G1764A/C1766T, and precore mutations G1896A, G1899A and G1896A/G1899A, were transfected into HepG2 cells using a plasmid-free approach. Viral RNA transcripts were detected by Northern blot hybridization and RT PCR, DNA replicative intermediates by Southern blotting and RT PCR, and viral release was measured by ELISA. Acetylation of cccDNA-bound histones was assessed by Chromatin ImmunoPrecipitation (ChIP) assay and methylation of cccDNA by bisulfite sequencing. BCP mutations resulted in low viral release, mRNA transcription and pgRNA/cccDNA ratios that paralleled the acetylation of cccDNA-bound H4 histone and inversely correlated with the HDAC1 recruitment onto cccDNA. Independently of the mutations, cccDNA was a target for methylation, accompanied by the upregulation of DNMT1 expression and DNMT1 recruitment onto cccDNA. Our results suggest that BCP mutations decrease viral replication capacity possibly by modulating the acetylation and deacetylation of cccDNA-bound histones while precore mutations do not have a significant effect on viral replication. These data provide evidence that epigenetic factors contribute to the regulation of HBV viral replication. PMID:27132039

  20. TP53INP2/DOR, a mediator of cell autophagy, promotes rDNA transcription via facilitating the assembly of the POLR1/RNA polymerase I preinitiation complex at rDNA promoters.


    Xu, Yinfeng; Wan, Wei; Shou, Xin; Huang, Rui; You, Zhiyuan; Shou, Yanhong; Wang, Lingling; Zhou, Tianhua; Liu, Wei


    Cells control their metabolism through modulating the anabolic and catabolic pathways. TP53INP2/DOR (tumor protein p53 inducible nuclear protein 2), participates in cell catabolism by serving as a promoter of autophagy. Here we uncover a novel function of TP53INP2 in protein synthesis, a major biosynthetic and energy-consuming anabolic process. TP53INP2 localizes to the nucleolus through its nucleolar localization signal (NoLS) located at the C-terminal domain. Chromatin immunoprecipitation (ChIP) assays detected an association of TP53INP2 with the ribosomal DNA (rDNA), when exclusion of TP53INP2 from the nucleolus repressed rDNA promoter activity and the production of ribosomal RNA (rRNA) and proteins. The removal of TP53INP2 also impaired the association of the POLR1/RNA polymerase I preinitiation complex (PIC) with rDNA. Further, TP53INP2 interacts directly with POLR1 PIC, and is required for the assembly of the complex. These data indicate that TP53INP2 promotes ribosome biogenesis through facilitating rRNA synthesis at the nucleolus, suggesting a dual role of TP53INP2 in cell metabolism, assisting anabolism on the nucleolus, and stimulating catabolism off the nucleolus. PMID:27172002

  1. Preliminary crystallographic analysis of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-[beta] receptor promoter DNA

    SciTech Connect

    Agarkar, Vinod B.; Babayeva, Nigar D.; Rizzino, Angie; Tahirov, Tahir H.


    Ets proteins are transcription factors that activate or repress the expression of genes that are involved in various biological processes, including cellular proliferation, differentiation, development, transformation and apoptosis. Like other Ets-family members, Elf3 functions as a sequence-specific DNA-binding transcriptional factor. A mouse Elf3 C-terminal fragment (amino-acid residues 269-371) containing the DNA-binding domain has been crystallized in complex with mouse type II TGF-{beta} receptor promoter (TR-II) DNA. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 42.66, b = 52, c = 99.78 {angstrom}, and diffracted to a resolution of 2.2 {angstrom}.

  2. Tissue-specific Leptin promoter DNA methylation is associated with maternal and infant perinatal factors.


    Lesseur, Corina; Armstrong, David A; Paquette, Alison G; Koestler, Devin C; Padbury, James F; Marsit, Carmen J


    Leptin a regulator of body weight is involved in reproductive and developmental functions. Leptin promoter DNA methylation (LEP) regulates gene expression in a tissue-specific manner and has been linked to adverse pregnancy outcomes. In non-pathologic human pregnancies, we assessed LEP methylation, genotyped the single nucleotide polymorphism (SNP) rs2167270 in placental (n=81), maternal and cord blood samples (n=60), and examined the association between methylation, genotype, and perinatal factors. Maternal blood LEP methylation was lower in pre-pregnancy obese women (P=0.01). Cord blood LEP methylation was higher in small for gestational age (SGA) (P=4.6×10(-3)) and A/A genotype (P=1.6×10(-4)), lower (-1.47, P=0.03) in infants born to pre-pregnancy obese mothers and correlated (P=0.01) with maternal blood LEP. Gender was associated with placental LEP methylation (P=0.05). These results suggest that LEP epigenetic control may be influenced by perinatal factors including: maternal obesity, infant growth, genotype and gender in a tissue-specific manner and may have multigenerational implications. PMID:23911897

  3. Promoter-cDNA-directed heterologous protein expression in Xenopus laevis oocytes.

    PubMed Central

    Swick, A G; Janicot, M; Cheneval-Kastelic, T; McLenithan, J C; Lane, M D


    Heterologous proteins can be expressed in Xenopus laevis oocytes by cytoplasmic microinjection of mRNA. To circumvent limitations inherent in this approach we investigate direct nuclear injection of strong viral expression vectors to drive transcription and subsequent translation of cDNAs encoding cytoplasmic, secreted, and plasma membrane proteins. After several viral promoters had been tested, the pMT2 vector was found to be a superior expression vector for X. laevis oocytes capable of directing expression of high levels of functional heterologous proteins. Typically the amount of protein derived from transcription-translation of the microinjected cDNA accounts for approximately 1% of total non-yolk protein. Moreover, the inefficiency usually associated with nuclear injections was overcome by coinjection of pMT2 driving expression of a secreted alkaline phosphatase as an internal control to select positive-expressing oocytes. Using this method, we have successfully expressed high levels of chloramphenicol acetyltransferase, the adipocyte-specific cytosolic 422(aP2) protein, and the membrane-associated glucose transporter GLUT1. The system described should be applicable to a wide variety of proteins for which cDNAs are available. Hence, the cumbersome and often inefficient in vitro synthesis of mRNA for studying ion channels, receptors, and transporters as well as for expression cloning in Xenopus oocytes should no longer be necessary. Images PMID:1542676

  4. Gastric cancer associated variant of DNA polymerase beta (Leu22Pro) promotes DNA replication associated double strand breaks

    PubMed Central

    Rozacky, Jenna; Nemec, Antoni A.; Sweasy, Joann B.; Kidane, Dawit


    DNA polymerase beta (Pol β) is a key enzymefor the protection against oxidative DNA lesions via itsrole in base excision repair (BER). Approximately 1/3 of tumors studied to date express Pol β variant proteins, and several tumors overexpress Pol β. Pol β possesses DNA polymerase and dRP lyase activities, both of which are known to be important for efficient BER. The dRP lyase activity resides within the 8kDa amino terminal domain of Pol β, is responsible for removal of the 5′ phosphate group (5′-dRP). The DNA polymerase subsequently fills the gaps. Previously, we demonstrated that the human gastric cancer-associated variant of Pol β (Leu22Pro (L22P)) lacks dRP lyase function in vitro. Here, we report that L22P-expressing cells harbor significantly increased replication associated DNA double strand breaks (DSBs) and defective maintenance of the nascent DNA strand (NDS) during replication stress. Moreover, L22P-expressing cells are sensitive to PARP1 inhibitors, which suggests trapped PARP1 binds to the 5′-dRP group and blocks replications forks, resulting in fork collapse and DSBs. Our data suggest that the normal function of the dRP lyase is critical to maintain replication fork integrity and prevent replication fork collapse to DSBs and cellular transformation. PMID:26090616

  5. Gastric cancer associated variant of DNA polymerase beta (Leu22Pro) promotes DNA replication associated double strand breaks.


    Rozacky, Jenna; Nemec, Antoni A; Sweasy, Joann B; Kidane, Dawit


    DNA polymerase beta (Pol β) is a key enzyme for the protection against oxidative DNA lesions via its role in base excision repair (BER). Approximately 1/3 of tumors studied to date express Pol β variant proteins, and several tumors overexpress Pol β. Pol β possesses DNA polymerase and dRP lyase activities, both of which are known to be important for efficient BER. The dRP lyase activity resides within the 8kDa amino terminal domain of Pol β, is responsible for removal of the 5' phosphate group (5'-dRP). The DNA polymerase subsequently fills the gaps. Previously, we demonstrated that the human gastric cancer-associated variant of Pol β (Leu22Pro (L22P)) lacks dRP lyase function in vitro. Here, we report that L22P-expressing cells harbor significantly increased replication associated DNA double strand breaks (DSBs) and defective maintenance of the nascent DNA strand (NDS) during replication stress. Moreover, L22P-expressing cells are sensitive to PARP1 inhibitors, which suggests trapped PARP1 binds to the 5'-dRP group and blocks replications forks, resulting in fork collapse and DSBs. Our data suggest that the normal function of the dRP lyase is critical to maintain replication fork integrity and prevent replication fork collapse to DSBs and cellular transformation. PMID:26090616

  6. Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-β receptor promoter DNA

    PubMed Central

    Agarkar, Vinod B.; Babayeva, Nigar D.; Wilder, Phillip J.; Rizzino, Angie; Tahirov, Tahir H.


    The Ets family of transcription factors is composed of more than 30 members. One of its members, Elf3, is expressed in virtually all epithelial cells as well as in many tumors, including breast tumors. Several studies observed that the promoter of the type II TGF-β receptor gene (TβR-II) is strongly stimulated by Elf3 via two adjacent Elf3 binding sites, A-site and B-site. Here we report the 2.2 Å resolution crystal structure of a mouse Elf3 C-terminal fragment, containing the DNA-binding Ets domain, in complex with the B-site of mouse type II TGF-β receptor promoter DNA (mTβR-IIDNA). Elf3 contacts the core GGAA motif of the B-site from major groove similar to that of known Ets proteins. However, unlike other Ets proteins, Elf3 also contacts sequences of the A-site from the minor groove of the DNA. DNA binding experiments and cell-based transcription studies indicate that minor groove interaction by Arg349 located in the Ets domain is important for Elf3 function. Equally interesting, previous studies have shown that the C-terminal region of Elf3, which flanks the Ets domain, is required for Elf3 binding to DNA. In this study, we determined that Elf3 amino acid residues within this flanking region, including Trp361, are important for the structural integrity of the protein as well as for the Efl3 DNA binding and transactivation activity. PMID:20079749

  7. Enhanced GSH synthesis by Bisphenol A exposure promoted DNA methylation process in the testes of adult rare minnow Gobiocypris rarus.


    Yuan, Cong; Zhang, Yingying; Liu, Yan; Zhang, Ting; Wang, Zaizhao


    DNA methylation is a commonly studied epigenetic modification. The mechanism of BPA on DNA methylation is poorly understood. The present study aims to explore whether GSH synthesis affects DNA methylation in the testes of adult male rare minnow Gobiocypris rarus in response to Bisphenol A (BPA). Male G. rarus was exposed to 1, 15 and 225μgL(-1) BPA for 7 days. The levels of global DNA methylation, hydrogen peroxide (H2O2) and glutathione (GSH) in the testes were analyzed. Meanwhile, the levels of enzymes involved in DNA methylation and de novo GSH synthesis, and the substrate contents for GSH production were measured. Furthermore, gene expression profiles of the corresponding genes of all studied enzymes were analyzed. Results indicated that BPA at 15 and 225μgL(-1) caused hypermethylation of global DNA in the testes. The 15μgL(-1) BPA resulted in significant decrease of ten-eleven translocation proteins (TETs) while 225μgL(-1) BPA caused significant increase of DNA methyltransferase proteins (DNMTs). Moreover, 225μgL(-1) BPA caused significant increase of H2O2 and GSH levels, and the de novo GSH synthesis was enhanced. These results indicated that the significant decrease of the level of TETs may be sufficient to cause the DNA hypermethylation by 15μgL(-1) BPA. However, the significantly increased of DNMTs contributed to the significant increase of DNA methylation levels by 225μgL(-1) BPA. Moreover, the elevated de novo GSH synthesis may promote the DNA methylation process. PMID:27474941

  8. The downregulation of the RNA-binding protein Staufen2 in response to DNA damage promotes apoptosis.


    Zhang, Xin; Trépanier, Véronique; Beaujois, Remy; Viranaicken, Wildriss; Drobetsky, Elliot; DesGroseillers, Luc


    Staufen2 (Stau2) is an RNA-binding protein involved in cell fate decision by controlling several facets of mRNA processing including localization, splicing, translation and stability. Herein we report that exposure to DNA-damaging agents that generate replicative stress such as camptothecin (CPT), 5-fluoro-uracil (5FU) and ultraviolet radiation (UVC) causes downregulation of Stau2 in HCT116 colorectal cancer cells. In contrast, other agents such as doxorubicin and ionizing radiation had no effect on Stau2 expression. Consistently, Stau2 expression is regulated by the ataxia telangiectasia and Rad3-related (ATR) signaling pathway but not by the DNA-PK or ataxia telangiectasia mutated/checkpoint kinase 2 pathways. Stau2 downregulation is initiated at the level of transcription, independently of apoptosis induction. Promoter analysis identified a short 198 bp region which is necessary and sufficient for both basal and CPT-regulated Stau2 expression. The E2F1 transcription factor regulates Stau2 in untreated cells, an effect that is abolished by CPT treatment due to E2F1 displacement from the promoter. Strikingly, Stau2 downregulation enhances levels of DNA damage and promotes apoptosis in CPT-treated cells. Taken together our results suggest that Stau2 is an anti-apoptotic protein that could be involved in DNA replication and/or maintenance of genome integrity and that its expression is regulated by E2F1 via the ATR signaling pathway. PMID:26843428

  9. The downregulation of the RNA-binding protein Staufen2 in response to DNA damage promotes apoptosis

    PubMed Central

    Zhang, Xin; Trépanier, Véronique; Beaujois, Remy; Viranaicken, Wildriss; Drobetsky, Elliot; DesGroseillers, Luc


    Staufen2 (Stau2) is an RNA-binding protein involved in cell fate decision by controlling several facets of mRNA processing including localization, splicing, translation and stability. Herein we report that exposure to DNA-damaging agents that generate replicative stress such as camptothecin (CPT), 5-fluoro-uracil (5FU) and ultraviolet radiation (UVC) causes downregulation of Stau2 in HCT116 colorectal cancer cells. In contrast, other agents such as doxorubicin and ionizing radiation had no effect on Stau2 expression. Consistently, Stau2 expression is regulated by the ataxia telangiectasia and Rad3-related (ATR) signaling pathway but not by the DNA-PK or ataxia telangiectasia mutated/checkpoint kinase 2 pathways. Stau2 downregulation is initiated at the level of transcription, independently of apoptosis induction. Promoter analysis identified a short 198 bp region which is necessary and sufficient for both basal and CPT-regulated Stau2 expression. The E2F1 transcription factor regulates Stau2 in untreated cells, an effect that is abolished by CPT treatment due to E2F1 displacement from the promoter. Strikingly, Stau2 downregulation enhances levels of DNA damage and promotes apoptosis in CPT-treated cells. Taken together our results suggest that Stau2 is an anti-apoptotic protein that could be involved in DNA replication and/or maintenance of genome integrity and that its expression is regulated by E2F1 via the ATR signaling pathway. PMID:26843428

  10. A novel fluorescent biosensor for detection of target DNA fragment from the transgene cauliflower mosaic virus 35S promoter.


    Qiu, Bin; Zhang, Ya-shan; Lin, Yi-bing; Lu, Yu-Jing; Lin, Zhen-yu; Wong, Kwok-Yin; Chen, Guo-nan


    In this paper, we reported a convenient fluorescence method for the detection of genetically modified organisms (GMOs). As it is known that the cauliflower mosaic virus (CaMV) 35S promoter is widely used in most transgenic plants (Schnurr and Guerra, 2000), we thus design a simple method based on the detection of a section target DNA (DNA-T) from the transgene CaMV 35S promoter. In this method, the full-length guanine-rich single-strand sequences were split into fragments (Probe 1 and 2) and each part of the fragment possesses two GGG repeats. In the presence of K(+) ion and berberine, if a complementary target DNA of the CaMV 35S promoter was introduced to hybridize with Probe 1 and 2, a G-quadruplex-berberine complex was thus formed and generated a strong fluorescence signal. The generation of fluorescence signal indicates the presence of CaMV 35S promoter. This method is able to identify and quantify Genetically Modified Organisms (GMOs), and it shows wide linear ranges from 5.0×10(-9) to 9.0×10(-7) mol/L with a detection limit of 2.0×10(-9) mol/L. PMID:22959013

  11. EGFR tyrosine kinase inhibitors promote pro-caspase-8 dimerization that sensitizes cancer cells to DNA-damaging therapy.


    Li, Yun-Tian; Qian, Xiao-Jun; Yu, Yan; Li, Zhen-Hua; Wu, Rui-Yan; Ji, Jiao; Jiao, Lin; Li, Xuan; Kong, Peng-Fei; Chen, Wen-Dan; Feng, Gong-Kan; Deng, Rong; Zhu, Xiao-Feng


    The combination of time and order-dependent chemotherapeutic strategies has demonstrated enhanced efficacy in killing cancer cells while minimizing adverse effects. However, the precise mechanism remains elusive. Our results showed that pre-treatment of MCF-7 and MDA-MB-468 cells with epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor erlotinib or lapatinib significantly enhanced the cytotoxic effects of DNA-damaging agents compared to coadministration of the EGFR inhibitor and DNA-damaging agent. Sequential application of erlotinib and doxorubicin increased activated caspase-8 by promoting pro-caspase-8 homodimerization and autocatalytical cleavage, whereas coadministration did not. We found that EGFR inhibitors promoted pro-caspase-8 homodimerization by inhibiting ERK pathway signaling, while doxorubicin promoted it. Our data highlight that ERK has the potential to inhibit the formation of pro-caspase-8 homodimers by phosphorylating pro-caspase-8 at S387. In conclusion, the pretreatment of EGFR tyrosine kinase inhibitors promote pro-caspase-8 dimerization that sensitizes cancer cells to DNA-damaging agents. Our findings provide rationale for novel strategies for the implementation of combined targeted and cytotoxic chemotherapy within a new framework of time and order-dependent therapy. PMID:26036637

  12. Structure and dynamics of polymyxin-resistance-associated response regulator PmrA in complex with promoter DNA

    PubMed Central

    Lou, Yuan-Chao; Weng, Tsai-Hsuan; Li, Yi-Chuan; Kao, Yi-Fen; Lin, Wei-Feng; Peng, Hwei-Ling; Chou, Shan-Ho; Hsiao, Chwan-Deng; Chen, Chinpan


    PmrA, an OmpR/PhoB family response regulator, manages genes for antibiotic resistance. Phosphorylation of OmpR/PhoB response regulator induces the formation of a symmetric dimer in the N-terminal receiver domain (REC), promoting two C-terminal DNA-binding domains (DBDs) to recognize promoter DNA to elicit adaptive responses. Recently, determination of the KdpE–DNA complex structure revealed an REC–DBD interface in the upstream protomer that may be necessary for transcription activation. Here, we report the 3.2-Å-resolution crystal structure of the PmrA–DNA complex, which reveals a similar yet different REC–DBD interface. However, NMR studies show that in the DNA-bound state, two domains tumble separately and an REC–DBD interaction is transiently populated in solution. Reporter gene analyses of PmrA variants with altered interface residues suggest that the interface is not crucial for supporting gene expression. We propose that REC–DBD interdomain dynamics and the DBD–DBD interface help PmrA interact with RNA polymerase holoenzyme to activate downstream gene transcription. PMID:26564787

  13. EBV-LMP1 suppresses the DNA damage response through DNA-PK/AMPK signaling to promote radioresistance in nasopharyngeal carcinoma.


    Lu, Jingchen; Tang, Min; Li, Hongde; Xu, Zhijie; Weng, Xinxian; Li, Jiangjiang; Yu, Xinfang; Zhao, Luqing; Liu, Hongwei; Hu, Yongbin; Tan, Zheqiong; Yang, Lifang; Zhong, Meizuo; Zhou, Jian; Fan, Jia; Bode, Ann M; Yi, Wei; Gao, Jinghe; Sun, Lunquan; Cao, Ya


    We conducted this research to explore the role of latent membrane protein 1 (LMP1) encoded by the Epstein-Barr virus (EBV) in modulating the DNA damage response (DDR) and its regulatory mechanisms in radioresistance. Our results revealed that LMP1 repressed the repair of DNA double strand breaks (DSBs) by inhibiting DNA-dependent protein kinase (DNA-PK) phosphorylation and activity. Moreover, LMP1 reduced the phosphorylation of AMP-activated protein kinase (AMPK) and changed its subcellular location after irradiation, which appeared to occur through a disruption of the physical interaction between AMPK and DNA-PK. The decrease in AMPK activity was associated with LMP1-mediated glycolysis and resistance to apoptosis induced by irradiation. The reactivation of AMPK significantly promoted radiosensitivity both in vivo and in vitro. The AMPKα (Thr172) reduction was associated with a poorer clinical outcome of radiation therapy in NPC patients. Our data revealed a new mechanism of LMP1-mediated radioresistance and provided a mechanistic rationale in support of the use of AMPK activators for facilitating NPC radiotherapy. PMID:27255972

  14. Pif1 helicase and Polδ promote recombination-coupled DNA synthesis via bubble migration

    PubMed Central

    Wilson, Marenda A.; Kwon, YoungHo; Xu, Yuanyuan; Chung, Woo-Hyun; Chi, Peter; Niu, Hengyao; Mayle, Ryan; Chen, Xuefeng; Malkova, Anna; Sung, Patrick; Ira, Grzegorz


    During DNA repair by homologous recombination (HR), DNA synthesis copies information from a template DNA molecule. Multiple DNA polymerases have been implicated in repair-specific DNA synthesis1–3, but it has remained unclear whether a DNA helicase is involved in this reaction. A good candidate is Pif1, an evolutionarily conserved helicase in S. cerevisiae important for break-induced replication (BIR)4 as well as HR-dependent telomere maintenance in the absence of telomerase5 found in 10–15% of all cancers6. Pif1 plays a role in DNA synthesis across hard-to-replicate sites7, 8 and in lagging strand synthesis with Polδ9–11. Here we provide evidence that Pif1 stimulates DNA synthesis during BIR and crossover recombination. The initial steps of BIR occur normally in Pif1-deficient cells, but Polδ recruitment and DNA synthesis are decreased, resulting in premature resolution of DNA intermediates into half crossovers. Purified Pif1 protein strongly stimulates Polδ-mediated DNA synthesis from a D-loop made by the Rad51 recombinase. Importantly, Pif1 liberates the newly synthesized strand to prevent the accumulation of topological constraint and to facilitate extensive DNA synthesis via the establishment of a migrating D-loop structure. Our results uncover a novel function of Pif1 and provide insights into the mechanism of HR. PMID:24025768

  15. Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.


    Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni


    Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. PMID:26427337

  16. Orientation-Specific Joining of AID-initiated DNA Breaks Promotes Antibody Class Switching

    PubMed Central

    Zhang, Yu; Hu, Jiazhi; Volpi, Sabrina A.; Meyers, Robin M.; Ho, Yu-Jui; Du, Zhou; Robbiani, Davide F.; Meng, Feilong; Gostissa, Monica; Nussenzweig, Michel C.; Manis, John P.; Alt, Frederick W.


    During B cell development, RAG endonuclease cleaves immunoglobulin heavy chain (IgH) V, D, and J gene segments and orchestrates their fusion as deletional events that assemble a V(D)J exon in the same transcriptional orientation as adjacent Cμ constant region exons1,2. In mice, six additional sets of constant region exons (CHs) lie 100-200 kb downstream in the same transcriptional orientation as V(D)J and Cμ exons2. Long repetitive switch (S) regions precede Cμ and downstream CHs. In mature B cells, class switch recombination (CSR) generates different antibody classes by replacing Cμ with a downstream CH2. Activation-Induced Cytidine Deaminase (AID) initiates CSR by promoting deamination lesions within Sμ and a downstream acceptor S region2,3; these lesions are converted into DNA double-strand breaks (DSBs) by general DNA repair factors3. Productive CSR must occur in a deletional orientation by joining the upstream end of an Sμ DSB to the downstream end of an acceptor S region DSB (Fig. 1a). However, the relative frequency of deletional to inversional CSR junctions had not been measured. Thus, whether orientation-specific joining is a programmed mechanistic feature of CSR as it is for V(D)J recombination and, if so, how this is achieved was unknown. To address this question, we adapted high-throughput genome-wide translocation sequencing (HTGTS)4 into a highly sensitive DSB end-joining assay and applied it to endogenous AID-initiated S region DSBs. We find that CSR indeed is programmed to occur in a productive deletional orientation and does so via an unprecedented mechanism that involves in cis IgH organizational features in combination with frequent S region DSBs initiated by AID. We further implicate ATM-dependent DSB response (DSBR) factors in enforcing this mechanism and provide a solution to the enigma of why CSR is so reliant on the 53BP1 DSBR factor. PMID:26308889

  17. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley

    PubMed Central

    Solís, María-Teresa; El-Tantawy, Ahmed-Abdalla; Cano, Vanesa; Risueño, María C.; Testillano, Pilar S.


    Microspores are reprogrammed by stress in vitro toward embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC) cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5-methyl-deoxy-cytidine (5mdC) immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/decondensation) by light and electron microscopy. Four days of AzaC treatments (2.5 μM) increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC, and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition, and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition. Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs. PMID:26161085

  18. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley.


    Solís, María-Teresa; El-Tantawy, Ahmed-Abdalla; Cano, Vanesa; Risueño, María C; Testillano, Pilar S


    Microspores are reprogrammed by stress in vitro toward embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC) cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5-methyl-deoxy-cytidine (5mdC) immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/decondensation) by light and electron microscopy. Four days of AzaC treatments (2.5 μM) increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC, and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition, and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition. Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs. PMID:26161085

  19. Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress

    PubMed Central

    Santos, Efrén; Remy, Serge; Thiry, Els; Windelinckx, Saskia; Swennen, Rony; Sági, László


    Background Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored in real time. Results Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26°C followed by a gradual decrease to 8°C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. Conclusion This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate promoters even in a multicopy T-DNA

  20. Δ113p53/Δ133p53 converts P53 from a repressor to a promoter of DNA double-stand break repair

    PubMed Central

    Gong, Lu; Chen, Jun


    ABSTRACT In response to DNA damage, p53 (TP53, best known as p53) is quickly activated leading to cell cycle arrest or apoptosis to ensure genomic integrity; however, this represses DNA double-strand break (DSB) repair. Our recent work revealed that Δ113p53/Δ133p53 protein is accumulated at a later stage upon DNA DSB stress to switch p53 signaling from repression to promotion of DNA DSB repair. PMID:27308550

  1. Structure elucidation of the Pribnow box consensus promoter sequence by racemic DNA crystallography.


    Mandal, Pradeep K; Collie, Gavin W; Srivastava, Suresh C; Kauffmann, Brice; Huc, Ivan


    It has previously been shown that the use of racemic mixtures of naturally chiral macromolecules such as protein and DNA can significantly aid the crystallogenesis process, thereby addressing one of the major bottlenecks to structure determination by X-ray crystallographic methods-that of crystal growth. Although previous studies have provided convincing evidence of the applicability of the racemic crystallization technique to DNA through the study of well-characterized DNA structures, we sought to apply this method to a historically challenging DNA sequence. For this purpose we chose a non-self-complementary DNA duplex containing the biologically-relevant Pribnow box consensus sequence 'TATAAT'. Four racemic crystal structures of this previously un-crystallizable DNA target are reported (with resolutions in the range of 1.65-2.3 Å), with further crystallographic studies and structural analysis providing insight into the racemic crystallization process as well as structural details of this highly pertinent DNA sequence. PMID:27137886

  2. Local generation of fumarate promotes DNA repair through inhibition of histone H3 demethylation

    PubMed Central

    Jiang, Yuhui; Qian, Xu; Shen, Jianfeng; Wang, Yugang; Li, Xinjian; Liu, Rui; Xia, Yan; Chen, Qianming; Peng, Guang; Lin, Shiaw-Yih; Lu, Zhimin


    Histone methylation regulates DNA repair. However, the mechanisms that underlie the regulation of histone methylation during this repair remain to be further defined. Here, we show that ionizing radiation (IR) induces DNA-PK-dependent phosphorylation of nuclear fumarase at T236, which leads to an interaction between fumarase and the histone variant H2A.Z at DNA double-strand break (DSB) regions. Locally generated fumarate inhibits KDM2B histone demethylase activity, resulting in enhanced dimethylation of histone H3 K36; in turn, this increases the accumulation of the Ku70-containing DNA-PK at DSB regions for non-homologous end joining (NHEJ) DNA repair and cell survival. These findings reveal a feedback mechanism that underlies DNA-PK regulation by chromatin-associated fumarase and an instrumental function of fumarase in regulating histone H3 methylation and DNA repair. PMID:26237645

  3. Systematic E2 screening reveals a UBE2D-RNF138-CtIP axis promoting DNA repair.


    Schmidt, Christine K; Galanty, Yaron; Sczaniecka-Clift, Matylda; Coates, Julia; Jhujh, Satpal; Demir, Mukerrem; Cornwell, Matthew; Beli, Petra; Jackson, Stephen P


    Ubiquitylation is crucial for proper cellular responses to DNA double-strand breaks (DSBs). If unrepaired, these highly cytotoxic lesions cause genome instability, tumorigenesis, neurodegeneration or premature ageing. Here, we conduct a comprehensive, multilayered screen to systematically profile all human ubiquitin E2 enzymes for impacts on cellular DSB responses. With a widely applicable approach, we use an exemplary E2 family, UBE2Ds, to identify ubiquitylation-cascade components downstream of E2s. Thus, we uncover the nuclear E3 ligase RNF138 as a key homologous recombination (HR)-promoting factor that functions with UBE2Ds in cells. Mechanistically, UBE2Ds and RNF138 accumulate at DNA-damage sites and act at early resection stages by promoting CtIP ubiquitylation and accrual. This work supplies insights into regulation of DSB repair by HR. Moreover, it provides a rich information resource on E2s that can be exploited by follow-on studies. PMID:26502057

  4. Systematic E2 screening reveals a UBE2D-RNF138-CtIP axis promoting DNA repair

    PubMed Central

    Sczaniecka-Clift, Matylda; Coates, Julia; Jhujh, Satpal; Demir, Mukerrem; Cornwell, Matthew; Beli, Petra; Jackson, Stephen P


    Ubiquitylation is crucial for proper cellular responses to DNA double-strand breaks (DSBs). If unrepaired, these highly cytotoxic lesions cause genome instability, tumourigenesis, neurodegeneration or premature ageing. Here, we conduct a comprehensive, multilayered screen to systematically profile all human ubiquitin E2-enzymes for impacts on cellular DSB responses. Applying a widely applicable approach, we use an exemplary E2 family, UBE2Ds, to identify ubiquitylation-cascade components downstream of E2s. Thus, we uncover the nuclear E3-ligase RNF138 as a key homologous recombination (HR)-promoting factor that functions with UBE2Ds in cells. Mechanistically, UBE2Ds and RNF138 accumulate at DNA-damage sites and act at early resection stages by promoting CtIP ubiquitylation and accrual. This work supplies insights into regulation of DSB repair by HR. Moreover, it provides a rich information resource on E2s that can be exploited by follow-on studies. PMID:26502057

  5. Rev1 promotes replication through UV lesions in conjunction with DNA polymerases η, ι, and κ but not DNA polymerase ζ

    PubMed Central

    Yoon, Jung-Hoon; Park, Jeseong; Conde, Juan; Wakamiya, Maki; Prakash, Louise; Prakash, Satya


    Translesion synthesis (TLS) DNA polymerases (Pols) promote replication through DNA lesions; however, little is known about the protein factors that affect their function in human cells. In yeast, Rev1 plays a noncatalytic role as an indispensable component of Polζ, and Polζ together with Rev1 mediates a highly mutagenic mode of TLS. However, how Rev1 functions in TLS and mutagenesis in human cells has remained unclear. Here we determined the role of Rev1 in TLS opposite UV lesions in human and mouse fibroblasts and showed that Rev1 is indispensable for TLS mediated by Polη, Polι, and Polκ but is not required for TLS by Polζ. In contrast to its role in mutagenic TLS in yeast, Rev1 promotes predominantly error-free TLS opposite UV lesions in humans. The identification of Rev1 as an indispensable scaffolding component for Polη, Polι, and Polκ, which function in TLS in highly specialized ways opposite a diverse array of DNA lesions and act in a predominantly error-free manner, implicates a crucial role for Rev1 in the maintenance of genome stability in humans. PMID:26680302

  6. Rev1 promotes replication through UV lesions in conjunction with DNA polymerases η, ι, and κ but not DNA polymerase ζ.


    Yoon, Jung-Hoon; Park, Jeseong; Conde, Juan; Wakamiya, Maki; Prakash, Louise; Prakash, Satya


    Translesion synthesis (TLS) DNA polymerases (Pols) promote replication through DNA lesions; however, little is known about the protein factors that affect their function in human cells. In yeast, Rev1 plays a noncatalytic role as an indispensable component of Polζ, and Polζ together with Rev1 mediates a highly mutagenic mode of TLS. However, how Rev1 functions in TLS and mutagenesis in human cells has remained unclear. Here we determined the role of Rev1 in TLS opposite UV lesions in human and mouse fibroblasts and showed that Rev1 is indispensable for TLS mediated by Polη, Polι, and Polκ but is not required for TLS by Polζ. In contrast to its role in mutagenic TLS in yeast, Rev1 promotes predominantly error-free TLS opposite UV lesions in humans. The identification of Rev1 as an indispensable scaffolding component for Polη, Polι, and Polκ, which function in TLS in highly specialized ways opposite a diverse array of DNA lesions and act in a predominantly error-free manner, implicates a crucial role for Rev1 in the maintenance of genome stability in humans. PMID:26680302

  7. PAXX, a paralog of XRCC4 and XLF, interacts with Ku to promote DNA double-strand break repair**

    PubMed Central

    Coates, Julia; Jhujh, Satpal; Mehmood, Shahid; Tamura, Naoka; Travers, Jon; Wu, Qian; Draviam, Viji M.; Robinson, Carol V.; Blundell, Tom L.; Jackson, Stephen P.


    XRCC4 and XLF are two structurally-related proteins that function in DNA double-strand break (DSB) repair. Here, we identify human PAXX (PAralog of XRCC4 and XLF; also called C9orf142) as a new XRCC4-superfamily member, and show that its crystal structure resembles that of XRCC4. PAXX interacts directly with the DSB-repair protein Ku and is recruited to DNA-damage sites in cells. Using RNA interference and CRISPR-Cas9 to generate PAXX−/− cells, we demonstrate that PAXX functions with XRCC4 and XLF to mediate DSB repair and cell survival in response to DSB-inducing agents. Finally, we reveal that PAXX promotes Ku-dependent DNA ligation in vitro, and assembly of core non-homologous end-joining (NHEJ) factors on damaged chromatin in cells. These findings identify PAXX as a new component of the NHEJ machinery. PMID:25574025

  8. Ca2+ Promoted the Low Transformation Efficiency of Plasmid DNA Exposed to PAH Contaminants

    PubMed Central

    Gao, Yanzheng; Long, Jian; Wang, Qian


    The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs) on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca2+ during the transformation. Plasmid DNA exposed to the test PAHs demonstrated low transformation efficiency. In the absence of PAHs, the transformation efficiency was 4.7 log units; however, the efficiency decreased to 3.72–3.14 log units with phenanthrene/pyrene exposures of 50 µg·L–1. The addition of Ca2+ enhanced the low transformation efficiency of DNA exposed to PAHs. Based on the co-sorption of Ca2+ and phenanthrene/pyrene by DNA, we employed Fourier-transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), and mass spectrometry (MS) to determine the mechanisms involved in PAH-induced DNA transformation. The observed low transformation efficiency of DNA exposed to either phenanthrene or pyrene can be attributed to a broken hydrogen bond in the double helix caused by planar PAHs. Added Ca2+ formed strong electrovalent bonds with “–POO––” groups in the DNA, weakening the interaction between PAHs and DNA based on weak molecular forces. This decreased the damage of PAHs to hydrogen bonds in double-stranded DNA by isolating DNA molecules from PAHs and consequently enhanced the transformation efficiency of DNA exposed to PAH contaminants. The findings provide insight into the effects of anthropogenic trace PAHs on DNA transfer in natural environments. PMID:23484001

  9. Ca2+ promoted the low transformation efficiency of plasmid DNA exposed to PAH contaminants.


    Kang, Fuxing; Wang, Hong; Gao, Yanzheng; Long, Jian; Wang, Qian


    The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs) on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca(2+) during the transformation. Plasmid DNA exposed to the test PAHs demonstrated low transformation efficiency. In the absence of PAHs, the transformation efficiency was 4.7 log units; however, the efficiency decreased to 3.72-3.14 log units with phenanthrene/pyrene exposures of 50 µg · L(-1). The addition of Ca(2+) enhanced the low transformation efficiency of DNA exposed to PAHs. Based on the co-sorption of Ca(2+) and phenanthrene/pyrene by DNA, we employed Fourier-transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), and mass spectrometry (MS) to determine the mechanisms involved in PAH-induced DNA transformation. The observed low transformation efficiency of DNA exposed to either phenanthrene or pyrene can be attributed to a broken hydrogen bond in the double helix caused by planar PAHs. Added Ca(2+) formed strong electrovalent bonds with "-POO(-)-" groups in the DNA, weakening the interaction between PAHs and DNA based on weak molecular forces. This decreased the damage of PAHs to hydrogen bonds in double-stranded DNA by isolating DNA molecules from PAHs and consequently enhanced the transformation efficiency of DNA exposed to PAH contaminants. The findings provide insight into the effects of anthropogenic trace PAHs on DNA transfer in natural environments. PMID:23484001

  10. Inactivation of ATM/ATR DNA Damage Checkpoint Promotes Androgen Induced Chromosomal Instability in Prostate Epithelial Cells

    PubMed Central

    Chiu, Yung-Tuen; Liu, Ji; Tang, Kaidun; Wong, Yong-Chuan; Khanna, Kum Kum; Ling, Ming-Tat


    The ATM/ATR DNA damage checkpoint functions in the maintenance of genetic stability and some missense variants of the ATM gene have been shown to confer a moderate increased risk of prostate cancer. However, whether inactivation of this checkpoint contributes directly to prostate specific cancer predisposition is still unknown. Here, we show that exposure of non-malignant prostate epithelial cells (HPr-1AR) to androgen led to activation of the ATM/ATR DNA damage response and induction of cellular senescence. Notably, knockdown of the ATM gene expression in HPr-1AR cells can promote androgen-induced TMPRSS2: ERG rearrangement, a prostate-specific chromosome translocation frequently found in prostate cancer cells. Intriguingly, unlike the non-malignant prostate epithelial cells, the ATM/ATR DNA damage checkpoint appears to be defective in prostate cancer cells, since androgen treatment only induced a partial activation of the DNA damage response. This mechanism appears to preserve androgen induced autophosphorylation of ATM and phosphorylation of H2AX, lesion processing and repair pathway yet restrain ATM/CHK1/CHK2 and p53 signaling pathway. Our findings demonstrate that ATM/ATR inactivation is a crucial step in promoting androgen-induced genomic instability and prostate carcinogenesis. PMID:23272087

  11. Rad51/Dmc1 paralogs and mediators oppose DNA helicases to limit hybrid DNA formation and promote crossovers during meiotic recombination.


    Lorenz, Alexander; Mehats, Alizée; Osman, Fekret; Whitby, Matthew C


    During meiosis programmed DNA double-strand breaks (DSBs) are repaired by homologous recombination using the sister chromatid or the homologous chromosome (homolog) as a template. This repair results in crossover (CO) and non-crossover (NCO) recombinants. Only CO formation between homologs provides the physical linkages guiding correct chromosome segregation, which are essential to produce healthy gametes. The factors that determine the CO/NCO decision are still poorly understood. Using Schizosaccharomyces pombe as a model we show that the Rad51/Dmc1-paralog complexes Rad55-Rad57 and Rdl1-Rlp1-Sws1 together with Swi5-Sfr1 play a major role in antagonizing both the FANCM-family DNA helicase/translocase Fml1 and the RecQ-type DNA helicase Rqh1 to limit hybrid DNA formation and promote Mus81-Eme1-dependent COs. A common attribute of these protein complexes is an ability to stabilize the Rad51/Dmc1 nucleoprotein filament, and we propose that it is this property that imposes constraints on which enzymes gain access to the recombination intermediate, thereby controlling the manner in which it is processed and resolved. PMID:25414342

  12. XLF interacts with the XRCC4-DNA ligase IV complex to promote DNA nonhomologous end-joining.


    Ahnesorg, Peter; Smith, Philippa; Jackson, Stephen P


    DNA nonhomologous end-joining (NHEJ) is a predominant pathway of DNA double-strand break repair in mammalian cells, and defects in it cause radiosensitivity at the cellular and whole-organism levels. Central to NHEJ is the protein complex containing DNA Ligase IV and XRCC4. By searching for additional XRCC4-interacting factors, we identified a previously uncharacterized 33 kDa protein, XRCC4-like factor (XLF, also named Cernunnos), that has weak sequence homology with XRCC4 and is predicted to display structural similarity to XRCC4. We show that XLF directly interacts with the XRCC4-Ligase IV complex in vitro and in vivo and that siRNA-mediated downregulation of XLF in human cell lines leads to radiosensitivity and impaired NHEJ. Furthermore, we establish that NHEJ-deficient 2BN cells derived from a radiosensitive and immune-deficient patient lack XLF due to an inactivating frameshift mutation in its gene, and that reintroduction of wild-type XLF into such cells corrects their radiosensitivity and NHEJ defects. XLF thus constitutes a novel core component of the mammalian NHEJ apparatus. PMID:16439205

  13. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    SciTech Connect

    Kiran, Shashi; Oddi, Vineesha; Ramakrishna, Gayatri


    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  14. Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof

    PubMed Central

    Ranjan, Rajiv; Patro, Sunita; Pradhan, Bhubaneswar; Kumar, Alok; Maiti, Indu B.; Dey, Nrisingha


    Background Development of novel synthetic promoters with enhanced regulatory activity is of great value for a diverse range of plant biotechnology applications. Methodology Using the Figwort mosaic virus full-length transcript promoter (F) and the sub-genomic transcript promoter (FS) sequences, we generated two single shuffled promoter libraries (LssF and LssFS), two multiple shuffled promoter libraries (LmsFS-F and LmsF-FS), two hybrid promoters (FuasFScp and FSuasFcp) and two hybrid-shuffled promoter libraries (LhsFuasFScp and LhsFSuasFcp). Transient expression activities of approximately 50 shuffled promoter clones from each of these libraries were assayed in tobacco (Nicotiana tabacum cv. Xanthi) protoplasts. It was observed that most of the shuffled promoters showed reduced activity compared to the two parent promoters (F and FS) and the CaMV35S promoter. In silico studies (computer simulated analyses) revealed that the reduced promoter activities of the shuffled promoters could be due to their higher helical stability. On the contrary, the hybrid promoters FuasFScp and FSuasFcp showed enhanced activities compared to F, FS and CaMV 35S in both transient and transgenic Nicotiana tabacum and Arabidopsis plants. Northern-blot and qRT-PCR data revealed a positive correlation between transcription and enzymatic activity in transgenic tobacco plants expressing hybrid promoters. Histochemical/X-gluc staining of whole transgenic seedlings/tissue-sections and fluorescence images of ImaGene Green™ treated roots and stems expressing the GUS reporter gene under the control of the FuasFScp and FSuasFcp promoters also support the above findings. Furthermore, protein extracts made from protoplasts expressing the human defensin (HNP-1) gene driven by hybrid promoters showed enhanced antibacterial activity compared to the CaMV35S promoter. Significance/Conclusion Both shuffled and hybrid promoters developed in the present study can be used as molecular tools to study the

  15. Fundamental differences in promoter CpG island DNA hypermethylation between human cancer and genetically engineered mouse models of cancer

    PubMed Central

    Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J


    Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development. PMID:24107773

  16. Differential promoter methylation of kinesin family member 1a in plasma is associated with breast cancer and DNA repair capacity.


    Guerrero-Preston, Rafael; Hadar, Tal; Ostrow, Kimberly Laskie; Soudry, Ethan; Echenique, Miguel; Ili-Gangas, Carmen; Pérez, Gabriela; Perez, Jimena; Brebi-Mieville, Priscilla; Deschamps, José; Morales, Luisa; Bayona, Manuel; Sidransky, David; Matta, Jaime


    Methylation alterations of CpG islands, CpG island shores and first exons are key events in the formation and progression of human cancer, and an increasing number of differentially methylated regions and genes have been identified in breast cancer. Recent studies of the breast cancer methylome using deep sequencing and microarray platforms are providing a novel insight on the different roles aberrant methylation plays in molecular subtypes of breast cancer. Accumulating evidence from a subset of studies suggests that promoter methylation of tumor-suppressor genes associated with breast cancer can be quantified in circulating DNA. However, there is a paucity of studies that examine the combined presence of genetic and epigenetic alterations associated with breast cancer using blood-based assays. Dysregulation of DNA repair capacity (DRC) is a genetic risk factor for breast cancer that has been measured in lymphocytes. We isolated plasma DNA from 340 participants in a breast cancer case control project to study promoter methylation levels of five genes previously shown to be associated with breast cancer in frozen tissue and in cell line DNA: MAL, KIF1A, FKBP4, VGF and OGDHL. Methylation of at least one gene was found in 49% of the cases compared to 20% of the controls. Three of the four genes had receiver characteristic operator curve values of ≥ 0.50: MAL (0.64), KIF1A (0.51) and OGDHL (0.53). KIF1A promoter methylation was associated with breast cancer and inversely associated with DRC. This is the first evidence of a significant association between genetic and epigenetic alterations in breast cancer using blood-based tests. The potential diagnostic utility of these biomarkers and their relevance for breast cancer risk prediction should be examined in larger cohorts. PMID:24927296

  17. Large sex differences in chicken behavior and brain gene expression coincide with few differences in promoter DNA-methylation.


    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per


    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

  18. Large Sex Differences in Chicken Behavior and Brain Gene Expression Coincide with Few Differences in Promoter DNA-Methylation

    PubMed Central

    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per


    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

  19. Evaluation of INK4A promoter methylation using pyrosequencing and circulating cell-free DNA from patients with hepatocellular carcinoma

    PubMed Central

    Kirk, Jason L.; Merwat, Shehzad N.; Ju, Hyunsu; Soloway, Roger D.; Wieck, Lucas R.; Li, Albert; Okorodudu, Anthony O.; Petersen, John R.; Abdulla, Nihal E.; Duchini, Andrea; Cicalese, Luca; Rastellini, Cristiana; Hu, Peter C.; Dong, Jianli


    Background Hyper-methylation of CpG dinucleotides in the promoter region of inhibitor of cyclin-dependent kinase 4A (INK4A) has been reported in 60%–80% of hepatocellular carcinoma (HCC). As INK4A promoter hypermethylation event occurs early in HCC progression, the quantification of INK4A promoter methylation in blood sample may represent a useful biomarker for non-invasive diagnosis and prediction of response to therapy. Methods We examined INK4A promoter methylation using circulating cell-free DNA (ccfDNA) in a total of 109 serum specimens, including 66 HCC and 43 benign chronic liver diseases. Methylation of the individual seven CpG sites was examined using pyrosequencing. Results Our results showed that there were significantly higher levels of methylated INK4A in HCC specimens than controls and that the seven CpG sites had different levels of methylation and might exist in different PCR amplicons. The area under receiver operating characteristic (ROC) curve was 0.82, with 65.3% sensitivity and 87.2% specificity at 5% (LOD), 39.0% sensitivity and 96.5% specificity at 7% LOD, and 20.3% sensitivity and 98.8% specificity at 10% LOD, respectively. Conclusions Our results support additional studies incorporating INK4A methylation testing of ccfDNA to further validate the diagnostic, predictive, and prognostic characteristics of this biomarker in HCC patients. The knowledge of the existence of epi-alleles should help improve assay design to maximize detection. PMID:24406287

  20. Prenatal stress-induced programming of genome-wide promoter DNA methylation in 5-HTT-deficient mice

    PubMed Central

    Schraut, K G; Jakob, S B; Weidner, M T; Schmitt, A G; Scholz, C J; Strekalova, T; El Hajj, N; Eijssen, L M T; Domschke, K; Reif, A; Haaf, T; Ortega, G; Steinbusch, H W M; Lesch, K P; Van den Hove, D L


    The serotonin transporter gene (5-HTT/SLC6A4)-linked polymorphic region has been suggested to have a modulatory role in mediating effects of early-life stress exposure on psychopathology rendering carriers of the low-expression short (s)-variant more vulnerable to environmental adversity in later life. The underlying molecular mechanisms of this gene-by-environment interaction are not well understood, but epigenetic regulation including differential DNA methylation has been postulated to have a critical role. Recently, we used a maternal restraint stress paradigm of prenatal stress (PS) in 5-HTT-deficient mice and showed that the effects on behavior and gene expression were particularly marked in the hippocampus of female 5-Htt+/− offspring. Here, we examined to which extent these effects are mediated by differential methylation of DNA. For this purpose, we performed a genome-wide hippocampal DNA methylation screening using methylated-DNA immunoprecipitation (MeDIP) on Affymetrix GeneChip Mouse Promoter 1.0 R arrays. Using hippocampal DNA from the same mice as assessed before enabled us to correlate gene-specific DNA methylation, mRNA expression and behavior. We found that 5-Htt genotype, PS and their interaction differentially affected the DNA methylation signature of numerous genes, a subset of which showed overlap with the expression profiles of the corresponding transcripts. For example, a differentially methylated region in the gene encoding myelin basic protein (Mbp) was associated with its expression in a 5-Htt-, PS- and 5-Htt × PS-dependent manner. Subsequent fine-mapping of this Mbp locus linked the methylation status of two specific CpG sites to Mbp expression and anxiety-related behavior. In conclusion, hippocampal DNA methylation patterns and expression profiles of female prenatally stressed 5-Htt+/− mice suggest that distinct molecular mechanisms, some of which are promoter methylation-dependent, contribute to the behavioral effects of the 5-Htt

  1. Structure elucidation of the Pribnow box consensus promoter sequence by racemic DNA crystallography

    PubMed Central

    Mandal, Pradeep K.; Collie, Gavin W.; Srivastava, Suresh C.; Kauffmann, Brice; Huc, Ivan


    It has previously been shown that the use of racemic mixtures of naturally chiral macromolecules such as protein and DNA can significantly aid the crystallogenesis process, thereby addressing one of the major bottlenecks to structure determination by X-ray crystallographic methods—that of crystal growth. Although previous studies have provided convincing evidence of the applicability of the racemic crystallization technique to DNA through the study of well-characterized DNA structures, we sought to apply this method to a historically challenging DNA sequence. For this purpose we chose a non-self-complementary DNA duplex containing the biologically-relevant Pribnow box consensus sequence ‘TATAAT’. Four racemic crystal structures of this previously un-crystallizable DNA target are reported (with resolutions in the range of 1.65–2.3 Å), with further crystallographic studies and structural analysis providing insight into the racemic crystallization process as well as structural details of this highly pertinent DNA sequence. PMID:27137886

  2. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.


    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A


    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071

  3. Homocysteine Triggers Inflammatory Responses in Macrophages through Inhibiting CSE-H2S Signaling via DNA Hypermethylation of CSE Promoter

    PubMed Central

    Li, Jiao-Jiao; Li, Qian; Du, Hua-Ping; Wang, Ya-Li; You, Shou-Jiang; Wang, Fen; Xu, Xing-Shun; Cheng, Jian; Cao, Yong-Jun; Liu, Chun-Feng; Hu, Li-Fang


    Hyperhomocysteinemia (HHcy) is an independent risk factor of atherosclerosis and other cardiovascular diseases. Unfortunately, Hcy-lowering strategies were found to have limited effects in reducing cardiovascular events. The underlying mechanisms remain unclear. Increasing evidence reveals a role of inflammation in the pathogenesis of HHcy. Homocysteine (Hcy) is a precursor of hydrogen sulfide (H2S), which is formed via the transsulfuration pathway catalyzed by cystathionine β-synthase and cystathionine γ-lyase (CSE) and serves as a novel modulator of inflammation. In the present study, we showed that methionine supplementation induced mild HHcy in mice, associated with the elevations of TNF-α and IL-1β in the plasma and reductions of plasma H2S level and CSE expression in the peritoneal macrophages. H2S-releasing compound GYY4137 attenuated the increases of TNF-α and IL-1β in the plasma of HHcy mice and Hcy-treated raw264.7 cells while CSE inhibitor PAG exacerbated it. Moreover, the in vitro study showed that Hcy inhibited CSE expression and H2S production in macrophages, accompanied by the increases of DNA methyltransferase (DNMT) expression and DNA hypermethylation in cse promoter region. DNMT inhibition or knockdown reversed the decrease of CSE transcription induced by Hcy in macrophages. In sum, our findings demonstrate that Hcy may trigger inflammation through inhibiting CSE-H2S signaling, associated with increased promoter DNA methylation and transcriptional repression of cse in macrophages. PMID:26047341

  4. TIPRL Inhibits Protein Phosphatase 4 Activity and Promotes H2AX Phosphorylation in the DNA Damage Response

    PubMed Central

    Rosales, Kimberly Romero; Reid, Michael A.; Yang, Ying; Tran, Thai Q.; Wang, Wen-I; Lowman, Xazmin; Pan, Min; Kong, Mei


    Despite advances in our understanding of protein kinase regulation in the DNA damage response, the mechanism that controls protein phosphatase activity in this pathway is unclear. Unlike kinases, the activity and specificity of serine/threonine phosphatases is governed largely by their associated proteins. Here we show that Tip41-like protein (TIPRL), an evolutionarily conserved binding protein for PP2A-family phosphatases, is a negative regulator of protein phosphatase 4 (PP4). Knockdown of TIPRL resulted in increased PP4 phosphatase activity and formation of the active PP4-C/PP4R2 complex known to dephosphorylate γ-H2AX. Thus, overexpression of TIPRL promotes phosphorylation of H2AX, and increases γ-H2AX positive foci in response to DNA damage, whereas knockdown of TIPRL inhibits γ-H2AX phosphorylation. In correlation with γ-H2AX levels, we found that TIPRL overexpression promotes cell death in response to genotoxic stress, and knockdown of TIPRL protects cells from genotoxic agents. Taken together, these data demonstrate that TIPRL inhibits PP4 activity to allow for H2AX phosphorylation and the subsequent DNA damage response. PMID:26717153

  5. Nongenic, bidirectional transcription precedes and may promote developmental DNA deletion in Tetrahymena thermophila

    PubMed Central

    Chalker, Douglas L.; Yao, Meng-Chao


    A large number of DNA segments are excised from the chromosomes of the somatic nucleus during development of Tetrahymena thermophila. How these germline-limited sequences are recognized and excised is still poorly understood. We have found that many of these noncoding DNAs are transcribed during nuclear development. Transcription of the germline-limited M element occurs from both DNA strands and results in heterogeneous transcripts of < 200 b to > 1 kb. Transcripts are most abundant when developing micro- and macronuclei begin their differentiation. Transcription is normally restricted to unrearranged DNA of micronuclei and/or developing nuclei, but germline-limited DNAs can induce their own transcription when placed into somatic macronuclei. Brief actinomycin D treatment of conjugating cells blocked M-element excision, providing evidence that transcription is important for efficient DNA rearrangement. We propose that transcription targets these germline-limited sequences for elimination by altering chromatin to ensure their accessibility to the excision machinery. PMID:11358871

  6. Surface-promoted aggregation of amphiphilic quadruplex ligands drives their selectivity for alternative DNA structures.


    Laguerre, Aurélien; Chang, Yi; Pirrotta, Marc; Desbois, Nicolas; Gros, Claude P; Lesniewska, Eric; Monchaud, David


    Scientists are currently truly committed to enhance the specificity of chemotherapeutics that target DNA. To this end, sequence-specific drugs have progressively given way to structure-specific therapeutics. However, while numerous strategies have been implemented to design high-affinity candidates, strategies devoted to the design of high-selectivity ligands are still rare. Here we report on such an approach via the study of an amphiphilic compound, TEGPy, that self-assembles at a liquid/solid interface to provide nanosized objects that are stable in water. The resulting aggregates, identified through atomic force microscopy measurements, were found to disassemble upon interaction with DNA in a structure-specific manner (quadruplex- versus duplex-DNA). Our results provide a fertile ground for devising new strategies aiming at concomitantly enhancing DNA structural specificity and the water-solubility of aggregation-prone ligands. PMID:26040925

  7. Lamin A/C-dependent interaction with 53BP1 promotes cellular responses to DNA damage

    PubMed Central

    Gibbs-Seymour, Ian; Markiewicz, Ewa; Bekker-Jensen, Simon; Mailand, Niels; Hutchison, Christopher J


    Lamins A/C have been implicated in DNA damage response pathways. We show that the DNA repair protein 53BP1 is a lamin A/C binding protein. In undamaged human dermal fibroblasts (HDF), 53BP1 is a nucleoskeleton protein. 53BP1 binds to lamins A/C via its Tudor domain, and this is abrogated by DNA damage. Lamins A/C regulate 53BP1 levels and consequently lamin A/C-null HDF display a 53BP1 null-like phenotype. Our data favour a model in which lamins A/C maintain a nucleoplasmic pool of 53BP1 in order to facilitate its rapid recruitment to sites of DNA damage and could explain why an absence of lamin A/C accelerates aging. PMID:25645366

  8. A DNA break- and phosphorylation-dependent positive feedback loop promotes immunoglobulin class-switch recombination.


    Vuong, Bao Q; Herrick-Reynolds, Kayleigh; Vaidyanathan, Bharat; Pucella, Joseph N; Ucher, Anna J; Donghia, Nina M; Gu, Xiwen; Nicolas, Laura; Nowak, Urszula; Rahman, Numa; Strout, Matthew P; Mills, Kevin D; Stavnezer, Janet; Chaudhuri, Jayanta


    The ability of activation-induced cytidine deaminase (AID) to efficiently mediate class-switch recombination (CSR) is dependent on its phosphorylation at Ser38; however, the trigger that induces AID phosphorylation and the mechanism by which phosphorylated AID drives CSR have not been elucidated. Here we found that phosphorylation of AID at Ser38 was induced by DNA breaks. Conversely, in the absence of AID phosphorylation, DNA breaks were not efficiently generated at switch (S) regions in the immunoglobulin heavy-chain locus (Igh), consistent with a failure of AID to interact with the endonuclease APE1. Additionally, deficiency in the DNA-damage sensor ATM impaired the phosphorylation of AID at Ser38 and the interaction of AID with APE1. Our results identify a positive feedback loop for the amplification of DNA breaks at S regions through the phosphorylation- and ATM-dependent interaction of AID with APE1. PMID:24097111

  9. Polyelectrolyte Multilayers Promote Stent-Mediated Delivery of DNA to Vascular Tissue

    PubMed Central

    Saurer, Eric M.; Jewell, Christopher M.; Roenneburg, Drew A.; Bechler, Shane L.; Torrealba, Jose R.


    We report an approach to deliver DNA to vascular tissue in vivo using intravascular stents coated with degradable, DNA-containing polyelectrolyte multilayers (PEMs). Ionically-crosslinked multilayers ~120 nm thick were fabricated layer-by-layer on the surfaces of balloon-mounted stainless steel stents using plasmid DNA and a hydrolytically degradable poly(β-amino ester) (polymer 1). Characterization of stents coated using a fluorescently end-labeled analog of polymer 1 revealed film erosion to be uniform across the surfaces of the stents; differential stresses experienced upon balloon expansion did not lead to faster film erosion or dose dumping of DNA in areas near stent joints when stents were incubated in physiologically relevant media. The ability of film-coated stents to transfer DNA and transfect arterial tissue in vivo was then investigated in pigs and rabbits. Stents coated with films fabricated using fluorescently labeled DNA resulted in uniform transfer of DNA to sub-endothelial tissue in the arteries of pigs in patterns corresponding to the locations and geometries of stent struts. Stents coated with films fabricated using polymer 1 and plasmid DNA encoding EGFP resulted in expression of EGFP in the medial layers of stented tissue in both pigs and rabbits two days after implantation. The results of this study, combined with the modular and versatile nature of layer-by-layer assembly, provide a polymer-based platform that is well suited for fundamental studies of stent-mediated gene transfer. With further development, this approach could also prove useful for the design of non-viral, gene-based approaches to preventing complications that arise from the implantation of stents and other implantable interventional devices. PMID:23597075

  10. Baculoviruses Modulate a Proapoptotic DNA Damage Response To Promote Virus Multiplication

    PubMed Central

    Mitchell, Jonathan K.


    The baculovirus Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) initiates apoptosis in diverse insects through events triggered by virus DNA (vDNA) replication. To define the proapoptotic pathway and its role in antivirus defense, we investigated the link between the host's DNA damage response (DDR) and apoptosis. We report here that AcMNPV elicits a DDR in the model insect Drosophila melanogaster. Replication of vDNA activated DDR kinases, as evidenced by ATM-driven phosphorylation of the Drosophila histone H2AX homolog (H2Av), a critical regulator of the DDR. Ablation or inhibition of ATM repressed H2Av phosphorylation and blocked virus-induced apoptosis. The DDR kinase inhibitors caffeine and KU55933 also prevented virus-induced apoptosis in cells derived from the permissive AcMNPV host, Spodoptera frugiperda. This block occurred at a step upstream of virus-mediated depletion of the cellular inhibitor-of-apoptosis protein, an event that initiates apoptosis in Spodoptera and Drosophila. Thus, the DDR is a conserved, proapoptotic response to baculovirus infection. DDR inhibition also repressed vDNA replication and reduced virus yields 100,000-fold, demonstrating that the DDR contributes to virus production, despite its recognized antivirus role. In contrast to virus-induced phosphorylation of Drosophila H2Av, AcMNPV blocked phosphorylation of the Spodoptera H2AX homolog (SfH2AX). Remarkably, AcMNPV also suppressed SfH2AX phosphorylation following pharmacologically induced DNA damage. These findings indicate that AcMNPV alters canonical DDR signaling in permissive cells. We conclude that AcMNPV triggers a proapoptotic DDR that is subsequently modified, presumably to stimulate vDNA replication. Thus, manipulation of the DDR to facilitate multiplication is an evolutionarily conserved strategy among DNA viruses of insects and mammals. PMID:23035220

  11. Polyelectrolyte multilayers promote stent-mediated delivery of DNA to vascular tissue.


    Saurer, Eric M; Jewell, Christopher M; Roenneburg, Drew A; Bechler, Shane L; Torrealba, Jose R; Hacker, Timothy A; Lynn, David M


    We report an approach to deliver DNA to vascular tissue in vivo using intravascular stents coated with degradable, DNA-containing polyelectrolyte multilayers (PEMs). Ionically cross-linked multilayers ∼120 nm thick were fabricated layer-by-layer on the surfaces of balloon-mounted stainless steel stents using plasmid DNA and a hydrolytically degradable poly(β-amino ester) (polymer 1). Characterization of stents coated using a fluorescently end-labeled analog of polymer 1 revealed film erosion to be uniform across the surfaces of the stents; differential stresses experienced upon balloon expansion did not lead to faster film erosion or dose dumping of DNA in areas near stent joints when stents were incubated in physiologically relevant media. The ability of film-coated stents to transfer DNA and transfect arterial tissue in vivo was then investigated in pigs and rabbits. Stents coated with films fabricated using fluorescently labeled DNA resulted in uniform transfer of DNA to sub-endothelial tissue in the arteries of pigs in patterns corresponding to the locations and geometries of stent struts. Stents coated with films fabricated using polymer 1 and plasmid DNA encoding EGFP resulted in expression of EGFP in the medial layers of stented tissue in both pigs and rabbits two days after implantation. The results of this study, combined with the modular and versatile nature of layer-by-layer assembly, provide a polymer-based platform that is well suited for fundamental studies of stent-mediated gene transfer. With further development, this approach could also prove useful for the design of nonviral, gene-based approaches for prevention of complications that arise from the implantation of stents and other implantable interventional devices. PMID:23597075

  12. Role of Bacillus subtilis Error Prevention Oxidized Guanine System in Counteracting Hexavalent Chromium-Promoted Oxidative DNA Damage

    PubMed Central

    Santos-Escobar, Fernando; Gutiérrez-Corona, J. Félix


    Chromium pollution is potentially detrimental to bacterial soil communities, compromising carbon and nitrogen cycles that are essential for life on earth. It has been proposed that intracellular reduction of hexavalent chromium [Cr(VI)] to trivalent chromium [Cr(III)] may cause bacterial death by a mechanism that involves reactive oxygen species (ROS)-induced DNA damage; the molecular basis of the phenomenon was investigated in this work. Here, we report that Bacillus subtilis cells lacking a functional error prevention oxidized guanine (GO) system were significantly more sensitive to Cr(VI) treatment than cells of the wild-type (WT) strain, suggesting that oxidative damage to DNA is involved in the deleterious effects of the oxyanion. In agreement with this suggestion, Cr(VI) dramatically increased the ROS concentration and induced mutagenesis in a GO-deficient B. subtilis strain. Alkaline gel electrophoresis (AGE) analysis of chromosomal DNA of WT and ΔGO mutant strains subjected to Cr(VI) treatment revealed that the DNA of the ΔGO strain was more susceptible to DNA glycosylase Fpg attack, suggesting that chromium genotoxicity is associated with 7,8-dihydro-8-oxodeoxyguanosine (8-oxo-G) lesions. In support of this notion, specific monoclonal antibodies detected the accumulation of 8-oxo-G lesions in the chromosomes of B. subtilis cells subjected to Cr(VI) treatment. We conclude that Cr(VI) promotes mutagenesis and cell death in B. subtilis by a mechanism that involves radical oxygen attack of DNA, generating 8-oxo-G, and that such effects are counteracted by the prevention and repair GO system. PMID:24973075

  13. Role of Bacillus subtilis error prevention oxidized guanine system in counteracting hexavalent chromium-promoted oxidative DNA damage.


    Santos-Escobar, Fernando; Gutiérrez-Corona, J Félix; Pedraza-Reyes, Mario


    Chromium pollution is potentially detrimental to bacterial soil communities, compromising carbon and nitrogen cycles that are essential for life on earth. It has been proposed that intracellular reduction of hexavalent chromium [Cr(VI)] to trivalent chromium [Cr(III)] may cause bacterial death by a mechanism that involves reactive oxygen species (ROS)-induced DNA damage; the molecular basis of the phenomenon was investigated in this work. Here, we report that Bacillus subtilis cells lacking a functional error prevention oxidized guanine (GO) system were significantly more sensitive to Cr(VI) treatment than cells of the wild-type (WT) strain, suggesting that oxidative damage to DNA is involved in the deleterious effects of the oxyanion. In agreement with this suggestion, Cr(VI) dramatically increased the ROS concentration and induced mutagenesis in a GO-deficient B. subtilis strain. Alkaline gel electrophoresis (AGE) analysis of chromosomal DNA of WT and ΔGO mutant strains subjected to Cr(VI) treatment revealed that the DNA of the ΔGO strain was more susceptible to DNA glycosylase Fpg attack, suggesting that chromium genotoxicity is associated with 7,8-dihydro-8-oxodeoxyguanosine (8-oxo-G) lesions. In support of this notion, specific monoclonal antibodies detected the accumulation of 8-oxo-G lesions in the chromosomes of B. subtilis cells subjected to Cr(VI) treatment. We conclude that Cr(VI) promotes mutagenesis and cell death in B. subtilis by a mechanism that involves radical oxygen attack of DNA, generating 8-oxo-G, and that such effects are counteracted by the prevention and repair GO system. PMID:24973075

  14. A Transcriptional Repressor ZBTB1 Promotes Chromatin Remodeling and Translesion DNA Synthesis

    PubMed Central

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A.; D’Andrea, Alan D.


    SUMMARY Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for PCNA monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for PCNA monoubiquitination, by localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a new ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair. PMID:24657165

  15. APOBEC3G enhances lymphoma cell radioresistance by promoting cytidine deaminase-dependent DNA repair.


    Nowarski, Roni; Wilner, Ofer I; Cheshin, Ori; Shahar, Or D; Kenig, Edan; Baraz, Leah; Britan-Rosich, Elena; Nagler, Arnon; Harris, Reuben S; Goldberg, Michal; Willner, Itamar; Kotler, Moshe


    APOBEC3 proteins catalyze deamination of cytidines in single-stranded DNA (ssDNA), providing innate protection against retroviral replication by inducing deleterious dC > dU hypermutation of replication intermediates. APOBEC3G expression is induced in mitogen-activated lymphocytes; however, no physiologic role related to lymphoid cell proliferation has yet to be determined. Moreover, whether APOBEC3G cytidine deaminase activity transcends to processing cellular genomic DNA is unknown. Here we show that lymphoma cells expressing high APOBEC3G levels display efficient repair of genomic DNA double-strand breaks (DSBs) induced by ionizing radiation and enhanced survival of irradiated cells. APOBEC3G transiently accumulated in the nucleus in response to ionizing radiation and was recruited to DSB repair foci. Consistent with a direct role in DSB repair, inhibition of APOBEC3G expression or deaminase activity resulted in deficient DSB repair, whereas reconstitution of APOBEC3G expression in leukemia cells enhanced DSB repair. APOBEC3G activity involved processing of DNA flanking a DSB in an integrated reporter cassette. Atomic force microscopy indicated that APOBEC3G multimers associate with ssDNA termini, triggering multimer disassembly to multiple catalytic units. These results identify APOBEC3G as a prosurvival factor in lymphoma cells, marking APOBEC3G as a potential target for sensitizing lymphoma to radiation therapy. PMID:22645179

  16. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.


    Carrolo, Margarida; Frias, Maria João; Pinto, Francisco Rodrigues; Melo-Cristino, José; Ramirez, Mário


    Streptococcus pneumoniae (pneumococcus) is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages) residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA) is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population. PMID:21187931

  17. Osmotic pressure: resisting or promoting DNA ejection from phage? Internal capsid-pressure dependence of viral infection

    NASA Astrophysics Data System (ADS)

    Evilevitch, Alex; Jeembaeva, Meerim; Koester, Sarah; Castelnovo, Martin; Weitz, David


    Recent in vitro experiments have shown that DNA ejection from phage can be partially stopped by surrounding osmotic pressure when ejected DNA is digested by DNase I on the course of ejection. We argue in this work by combination of experimental techniques (UV absorbance, pulse-field electrophoresis, and cryo-EM) that intact genome (i.e. undigested) ejection in a crowded environment is, on the contrary, enhanced or eventually complete with the help of a pulling force resulting from DNA condensation induced by the osmotic stress itself. This demonstrates that in vivo, the osmotically stressed cell cytoplasm will promote phage DNA ejection rather than resisting it. While, in vitro, the ejection depends sensitively on internal pressure within the virus capsid, the effect of internal pressure on infection of bacteria is unknown. We use microfluidics to monitor individual cells and determine the distribution of lysis due to infection as the capsid pressure is varied. The lysis probability decreases markedly with decreased capsid pressure.

  18. FANCD2 Maintains Fork Stability in BRCA1/2-Deficient Tumors and Promotes Alternative End-Joining DNA Repair.


    Kais, Zeina; Rondinelli, Beatrice; Holmes, Amie; O'Leary, Colin; Kozono, David; D'Andrea, Alan D; Ceccaldi, Raphael


    BRCA1/2 proteins function in homologous recombination (HR)-mediated DNA repair and cooperate with Fanconi anemia (FA) proteins to maintain genomic integrity through replication fork stabilization. Loss of BRCA1/2 proteins results in DNA repair deficiency and replicative stress, leading to genomic instability and enhanced sensitivity to DNA-damaging agents. Recent studies have shown that BRCA1/2-deficient tumors upregulate Polθ-mediated alternative end-joining (alt-EJ) repair as a survival mechanism. Whether other mechanisms maintain genomic integrity upon loss of BRCA1/2 proteins is currently unknown. Here we show that BRCA1/2-deficient tumors also upregulate FANCD2 activity. FANCD2 is required for fork protection and fork restart in BRCA1/2-deficient tumors. Moreover, FANCD2 promotes Polθ recruitment at sites of damage and alt-EJ repair. Finally, loss of FANCD2 in BRCA1/2-deficient tumors enhances cell death. These results reveal a synthetic lethal relationship between FANCD2 and BRCA1/2, and they identify FANCD2 as a central player orchestrating DNA repair pathway choice at the replication fork. PMID:27264184

  19. RhoB Promotes γH2AX Dephosphorylation and DNA Double-Strand Break Repair

    PubMed Central

    Mamouni, Kenza; Cristini, Agnese; Guirouilh-Barbat, Josée; Monferran, Sylvie; Lemarié, Anthony; Faye, Jean-Charles; Lopez, Bernard S.


    Unlike other Rho GTPases, RhoB is rapidly induced by DNA damage, and its expression level decreases during cancer progression. Because inefficient repair of DNA double-strand breaks (DSBs) can lead to cancer, we investigated whether camptothecin, an anticancer drug that produces DSBs, induces RhoB expression and examined its role in the camptothecin-induced DNA damage response. We show that in camptothecin-treated cells, DSBs induce RhoB expression by a mechanism that depends notably on Chk2 and its substrate HuR, which binds to RhoB mRNA and protects it against degradation. RhoB-deficient cells fail to dephosphorylate γH2AX following camptothecin removal and show reduced efficiency of DSB repair by homologous recombination. These cells also show decreased activity of protein phosphatase 2A (PP2A), a phosphatase for γH2AX and other DNA damage and repair proteins. Thus, we propose that DSBs activate a Chk2-HuR-RhoB pathway that promotes PP2A-mediated dephosphorylation of γH2AX and DSB repair. Finally, we show that RhoB-deficient cells accumulate endogenous γH2AX and chromosomal abnormalities, suggesting that RhoB loss increases DSB-mediated genomic instability and tumor progression. PMID:24912678

  20. Extensive RPA2 hyperphosphorylation promotes apoptosis in response to DNA replication stress in CHK1 inhibited cells.


    Zuazua-Villar, Pedro; Ganesh, Anil; Phear, Geraldine; Gagou, Mary E; Meuth, Mark


    The replication protein A (RPA)-ssDNA complex formed at arrested replication forks recruits key proteins to activate the ATR-CHK1 signalling cascade. When CHK1 is inhibited during DNA replication stress, RPA2 is extensively hyperphosphorylated. Here, we investigated the role of RPA2 hyperphosphorylation in the fate of cells when CHK1 is inhibited. We show that proteins normally involved in DNA repair (RAD51) or control of RPA phosphorylation (the PP4 protein phosphatase complex) are not recruited to the genome after treatment with CHK1 and DNA synthesis inhibitors. This is not due to RPA2 hyperphosphorylation as suppression of this response does not restore loading suggesting that recruitment requires active CHK1. To determine whether RPA2 hyperphosphorylation protects stalled forks from collapse or induction of apoptosis in CHK1 inhibited cells during replication stress, cells expressing RPA2 genes mutated at key phosphorylation sites were characterized. Mutant RPA2 rescued cells from RPA2 depletion and reduced the level of apoptosis induced by treatment with CHK1 and replication inhibitors however the incidence of double strand breaks was not affected. Our data indicate that RPA2 hyperphosphorylation promotes cell death during replication stress when CHK1 function is compromised but does not appear to be essential for replication fork integrity. PMID:26271993

  1. Analysis of the spacer DNA between the cyclic AMP receptor protein binding site and the lac promoter.

    PubMed Central

    Flatow, U; Rajendrakumar, G V; Garges, S


    The role of the spacer region DNA between the cyclic AMP receptor protein (CRP) site and the RNA polymerase in the lac promoter was examined. We wanted to determine whether the wild-type DNA sequence of this region was an absolute requirement for CRP activation of lac transcription. The sequence of a 9-bp stretch of the spacer, from -41 to -49 relative to the start of transcription, was randomized, and the effect of randomization on lac expression was investigated in vitro and in vivo. We found that the spacer contains no specific sequence determinants for CRP activation of lac transcription; fewer than 1% of the mutants displayed greater than a 50% decrease in CRP activation of lac transcription. PMID:8636052

  2. The Vaccine Adjuvant Chitosan Promotes Cellular Immunity via DNA Sensor cGAS-STING-Dependent Induction of Type I Interferons.


    Carroll, Elizabeth C; Jin, Lei; Mori, Andres; Muñoz-Wolf, Natalia; Oleszycka, Ewa; Moran, Hannah B T; Mansouri, Samira; McEntee, Craig P; Lambe, Eimear; Agger, Else Marie; Andersen, Peter; Cunningham, Colm; Hertzog, Paul; Fitzgerald, Katherine A; Bowie, Andrew G; Lavelle, Ed C


    The cationic polysaccharide chitosan is an attractive candidate adjuvant capable of driving potent cell-mediated immunity, but the mechanism by which it acts is not clear. We show that chitosan promotes dendritic cell maturation by inducing type I interferons (IFNs) and enhances antigen-specific T helper 1 (Th1) responses in a type I IFN receptor-dependent manner. The induction of type I IFNs, IFN-stimulated genes and dendritic cell maturation by chitosan required the cytoplasmic DNA sensor cGAS and STING, implicating this pathway in dendritic cell activation. Additionally, this process was dependent on mitochondrial reactive oxygen species and the presence of cytoplasmic DNA. Chitosan-mediated enhancement of antigen specific Th1 and immunoglobulin G2c responses following vaccination was dependent on both cGAS and STING. These findings demonstrate that a cationic polymer can engage the STING-cGAS pathway to trigger innate and adaptive immune responses. PMID:26944200

  3. Guanylate-binding proteins promote AIM2 inflammasome activation during Francisella novicida infection by inducing cytosolic bacteriolysis and DNA release

    PubMed Central

    Dreier, Roland F.; Costanzo, Stéphanie; Anton, Leonie; Rühl, Sebastian; Dussurgey, Sébastien; Dick, Mathias S.; Kistner, Anne; Rigard, Mélanie; Degrandi, Daniel; Pfeffer, Klaus; Yamamoto, Masahiro; Henry, Thomas; Broz, Petr


    The AIM2 inflammasome detects double-stranded DNA in the cytosol and induces caspase-1-dependent pyroptosis as well as release of the inflammatory cytokines IL-1β and IL-18. AIM2 is critical for host defense against DNA viruses and bacteria that replicate in the cytosol, such as Francisella novicida. AIM2 activation by F. novicida requires bacteriolysis, yet whether this process is accidental or a host-driven immune mechanism remained unclear. Using siRNA screening for nearly 500 interferon-stimulated genes, we identified guanylate-binding proteins GBP2 and GBP5 as key AIM2 activators during F. novicida infection. Their prominent role was validated in vitro and in a mouse model of tularemia. Mechanistically, these two GBPs target cytosolic F. novicida and promote bacteriolysis. Thus, besides their role in host defense against vacuolar pathogens, GBPs also facilitate the presentation of ligands by directly attacking cytosolic bacteria. PMID:25774716

  4. Sex-dichotomous effects of NOS1AP promoter DNA methylation on intracranial aneurysm and brain arteriovenous malformation.


    Wang, Zhepei; Zhao, Jikuang; Sun, Jie; Nie, Sheng; Li, Keqing; Gao, Feng; Zhang, Tiefeng; Duan, Shiwei; Di, Yazhen; Huang, Yi; Gao, Xiang


    The goal of this study was to investigate the contribution of NOS1AP-promoter DNA methylation to the risk of intracranial aneurysm (IA) and brain arteriovenous malformation (BAVM) in a Han Chinese population. A total of 48 patients with IAs, 22 patients with BAVMs, and 26 control individuals were enrolled in the study. DNA methylation was tested using bisulfite pyrosequencing technology. We detected significantly higher DNA methylation levels in BAVM patients than in IA patients based on the multiple testing correction (CpG4-5 methylation: 5.86±1.04% vs. 4.37±2.64%, P=0.006). In women, CpG4-5 methylation levels were much lower in IA patients (3.64±1.97%) than in BAVM patients (6.11±1.20%, P<0.0001). However, in men, CpG1-3 methylation levels were much higher in the controls (6.92±0.78%) than in BAVM patients (5.99±0.70%, P=0.008). Additionally, there was a gender-based difference in CpG1 methylation within the controls (men vs. women: 5.75±0.50% vs. 4.99±0.53%, P=0.003) and BAVM patients (men vs. women: 4.70±0.74% vs. 5.50±0.87%, P=0.026). A subgroup analysis revealed significantly higher CpG3 methylation in patients who smoked than in those who did not (P=0.041). Our results suggested that gender modulated the interaction between NOS1AP promoter DNA methylation in IA and BAVM patients. Our results also confirmed that regular tobacco smoking was associated with increased NOS1AP methylation in humans. Additional studies with larger sample sizes are required to replicate and extend these findings. PMID:27080431

  5. Frataxin Deficiency Promotes Excess Microglial DNA Damage and Inflammation that Is Rescued by PJ34

    PubMed Central

    Shen, Yan; McMackin, Marissa Z.; Shan, Yuxi; Raetz, Alan; David, Sheila; Cortopassi, Gino


    An inherited deficiency in the frataxin protein causes neurodegeneration of the dorsal root ganglia and Friedreich's ataxia (FA). Frataxin deficiency leads to oxidative stress and inflammatory changes in cell and animal models; however, the cause of the inflammatory changes, and especially what causes brain microglial activation is unclear. Here we investigated: 1) the mechanism by which frataxin deficiency activates microglia, 2) whether a brain-localized inflammatory stimulus provokes a greater microglial response in FA animal models, and 3) whether an anti-inflammatory treatment improves their condition. Intracerebroventricular administration of LPS induced higher amounts of microglial activation in the FA mouse model vs controls. We also observed an increase in oxidative damage in the form of 8-oxoguanine (8-oxo-G) and the DNA repair proteins MUTYH and PARP-1 in cerebellar microglia of FA mutant mice. We hypothesized that frataxin deficiency increases DNA damage and DNA repair genes specifically in microglia, activating them. siRNA-mediated frataxin knockdown in microglial BV2 cells clearly elevated DNA damage and the expression of DNA repair genes MUTYH and PARP-1. Frataxin knockdown also induced a higher level of PARP-1 in MEF cells, and this was suppressed in MUTYH-/- knockout cells. Administration of the PARP-1 inhibitor PJ34 attenuated the microglial activation induced by intracerebroventricular injection of LPS. The combined administration of LPS and angiotensin II provoke an even stronger activation of microglia and neurobehavioral impairment. PJ34 treatment attenuated the neurobehavioral impairments in FA mice. These results suggest that the DNA repair proteins MUTYH and PARP-1 may form a pathway regulating microglial activation initiated by DNA damage, and inhibition of microglial PARP-1 induction could be an important therapeutic target in Friedreich's ataxia. PMID:26954031

  6. Frataxin Deficiency Promotes Excess Microglial DNA Damage and Inflammation that Is Rescued by PJ34.


    Shen, Yan; McMackin, Marissa Z; Shan, Yuxi; Raetz, Alan; David, Sheila; Cortopassi, Gino


    An inherited deficiency in the frataxin protein causes neurodegeneration of the dorsal root ganglia and Friedreich's ataxia (FA). Frataxin deficiency leads to oxidative stress and inflammatory changes in cell and animal models; however, the cause of the inflammatory changes, and especially what causes brain microglial activation is unclear. Here we investigated: 1) the mechanism by which frataxin deficiency activates microglia, 2) whether a brain-localized inflammatory stimulus provokes a greater microglial response in FA animal models, and 3) whether an anti-inflammatory treatment improves their condition. Intracerebroventricular administration of LPS induced higher amounts of microglial activation in the FA mouse model vs controls. We also observed an increase in oxidative damage in the form of 8-oxoguanine (8-oxo-G) and the DNA repair proteins MUTYH and PARP-1 in cerebellar microglia of FA mutant mice. We hypothesized that frataxin deficiency increases DNA damage and DNA repair genes specifically in microglia, activating them. siRNA-mediated frataxin knockdown in microglial BV2 cells clearly elevated DNA damage and the expression of DNA repair genes MUTYH and PARP-1. Frataxin knockdown also induced a higher level of PARP-1 in MEF cells, and this was suppressed in MUTYH-/- knockout cells. Administration of the PARP-1 inhibitor PJ34 attenuated the microglial activation induced by intracerebroventricular injection of LPS. The combined administration of LPS and angiotensin II provoke an even stronger activation of microglia and neurobehavioral impairment. PJ34 treatment attenuated the neurobehavioral impairments in FA mice. These results suggest that the DNA repair proteins MUTYH and PARP-1 may form a pathway regulating microglial activation initiated by DNA damage, and inhibition of microglial PARP-1 induction could be an important therapeutic target in Friedreich's ataxia. PMID:26954031

  7. Histone chaperone Anp32e removes H2A.Z from DNA double-strand breaks and promotes nucleosome reorganization and DNA repair

    PubMed Central

    Gursoy-Yuzugullu, Ozge; Ayrapetov, Marina K.; Price, Brendan D.


    The repair of DNA double-strand breaks (DSBs) requires open, flexible chromatin domains. The NuA4–Tip60 complex creates these flexible chromatin structures by exchanging histone H2A.Z onto nucleosomes and promoting acetylation of histone H4. Here, we demonstrate that the accumulation of H2A.Z on nucleosomes at DSBs is transient, and that rapid eviction of H2A.Z is required for DSB repair. Anp32e, an H2A.Z chaperone that interacts with the C-terminal docking domain of H2A.Z, is rapidly recruited to DSBs. Anp32e functions to remove H2A.Z from nucleosomes, so that H2A.Z levels return to basal within 10 min of DNA damage. Further, H2A.Z removal by Anp32e disrupts inhibitory interactions between the histone H4 tail and the nucleosome surface, facilitating increased acetylation of histone H4 following DNA damage. When H2A.Z removal by Anp32e is blocked, nucleosomes at DSBs retain elevated levels of H2A.Z, and assume a more stable, hypoacetylated conformation. Further, loss of Anp32e leads to increased CtIP-dependent end resection, accumulation of single-stranded DNA, and an increase in repair by the alternative nonhomologous end joining pathway. Exchange of H2A.Z onto the chromatin and subsequent rapid removal by Anp32e are therefore critical for creating open, acetylated nucleosome structures and for controlling end resection by CtIP. Dynamic modulation of H2A.Z exchange and removal by Anp32e reveals the importance of the nucleosome surface and nucleosome dynamics in processing the damaged chromatin template during DSB repair. PMID:26034280

  8. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sha...

  9. Modulation of Promoter Occupancy by Cooperative DNA Binding and Activation-Domain Function is a Major Determinant of Transcriptional Regulation by Activators in vivo

    NASA Astrophysics Data System (ADS)

    Tanaka, Masafumi


    Binding of transcriptional activators to a promoter is a prerequisite process in transcriptional activation. It is well established that the efficiency of activator binding to a promoter is determined by the affinity of direct interactions between the DNA-binding domain of an activator and its specific target sequences. However, I describe here that activator binding to a promoter is augmented in vivo by the effects of two other determinants that have not been generally appreciated: (i) the number of activator binding sites present in a promoter and (ii) the potency of activation domains of activators. Multiple sites within a promoter can cooperatively recruit cognate factors regardless of whether they contain an effective activation domain. This cooperativity can result in the synergistic activation of transcription. The second effect is the enhancement of activator binding to a promoter by the presence of activation domains. In this case, activation domains are not simply tethered to the promoter by the DNA-binding domain but instead assist the DNA-binding domain being tethered onto the promoter. This effect of activation domains on DNA binding is instrumental in determining how potent activators can induce steep transcriptional increases at low concentrations.

  10. The Rad9 protein enhances survival and promotes DNA repair following exposure to ionizing radiation

    SciTech Connect

    Brandt, Patrick D.; Helt, Christopher E.; Keng, Peter C.; Bambara, Robert A. . E-mail:


    Following DNA damage cells initiate cell cycle checkpoints to allow time to repair sustained lesions. Rad9, Rad1, and Hus1 proteins form a toroidal complex, termed the 9-1-1 complex, that is involved in checkpoint signaling. 9-1-1 shares high structural similarity to the DNA replication protein proliferating cell nuclear antigen (PCNA) and 9-1-1 has been shown in vitro to stimulate steps of the repair process known as long patch base excision repair. Using a system that allows conditional repression of the Rad9 protein in human cell culture, we show that Rad9, and by extension, the 9-1-1 complex, enhances cell survival, is required for efficient exit from G2-phase arrest, and stimulates the repair of damaged DNA following ionizing radiation. These data provide in vivo evidence that the human 9-1-1 complex participates in DNA repair in addition to its previously described role in DNA damage sensing.

  11. UV-Induced Charge Transfer States in DNA Promote Sequence Selective Self-Repair.


    Bucher, Dominik Benjamin; Kufner, Corinna Lucia; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang


    Absorption of UV-radiation in nucleotides initiates a number of photophysical and photochemical processes, which may finally cause DNA damage. One major decay channel of photoexcited DNA leads to reactive charge transfer states. This study shows that these states trigger self-repair of DNA photolesions. The experiments were performed by UV spectroscopy and HPLC on different single and double stranded oligonucleotides containing a cyclobutane pyrimidine dimer (CPD) lesion. In a first experiment we show that photoexcitation of adenine adjacent to a CPD has no influence on this lesion. However, excitation of a guanine (G) adenine (A) sequence leads to reformation of the intact thymine (T) bases. The involvement of two bases for the repair points to a long-living charge transfer state between G and A to be responsible for the repair. The negatively charged A radical anion donates an electron to the CPD, inducing ring splitting and repair. In contrast, a TA sequence, having an inverted charge distribution (T radical anion, A radical cation), is not able to repair the CPD lesion. The investigations show that the presence of an adjacent radical ion is not sufficient for repair. More likely it is the driving power represented by the oxidation potential of the radical ion, which controls the repair. Thus, repair capacities are strongly sequence-dependent, creating DNA regions with different tendencies of self-repair. This self-healing activity represents the simplest sequence-dependent DNA repair system. PMID:26651219

  12. Smoking-promoted oxidative DNA damage response is highly correlated to lung carcinogenesis

    PubMed Central

    Li, Miao; Zhou, Hongbin; Lv, Dan; Deng, Zaichun; Ying, Songmin; Chen, Zhihua; Li, Wen; Shen, Huahao


    Oxidative stress induced by tobacco smoking is one of the main causes of DNA damage and is known to be involved in various cancers. Smoking is the leading cause of lung cancer, while the role of cigarette smoke-induced oxidative DNA damage response during lung carcinogenesis is largely unknown. In this study, we investigated oxidative DNA damage response levels in smoking and nonsmoking patients with lung cancer, and evaluated the potential diagnostic value of 8-OHdG for lung cancer. We observed a higher level of 8-OHdG expression and secretion in airways of lung cancer patients than that of noncancer controls. 8-OHdG expression was associated with the TNM stages. Additionally, cigarette smoke-induced oxidative DNA damage response was observed in bronchial epithelial cells in vitro and in vivo. A statistical significance correlation was found between the levels of 8-OHdG and smoking index. With a cut-off value of 2.86 ng/ml, 8-OHdG showed a sensitivity and specificity of 70.0% and 73.7%, respectively, to identify a patient with lung cancer. These findings not only underscore the importance of smoking in oxidative DNA damage response of lung cancer patients, but also suggest 8-OHdG as a potential diagnostic biomarker for lung cancer. PMID:26942876

  13. In vitro incubation of human spermatozoa promotes reactive oxygen species generation and DNA fragmentation.


    Cicaré, J; Caille, A; Zumoffen, C; Ghersevich, S; Bahamondes, L; Munuce, M J


    The aim of this study was to investigate the oxidative process associated with sperm capacitation and its impact on DNA fragmentation and sperm function. Redox activity and lipid peroxidation were analysed in human spermatozoa after 3, 6 and 22 h of incubation in Ham's F10 medium plus bovine albumin at 37° and 5% CO2 for capacitation. DNA status, tyrosine phosphorylation pattern and induced acrosome reaction were evaluated after capacitating conditions. At 22 h of incubation, there was a significant (P < 0.05) increase in oxygen-free radicals and lipid peroxidation, with no effect on sperm viability. There also was a significant (P < 0.001) increase in fragmented DNA in capacitated spermatozoa compared to semen values with higher rates being found after the occurrence of the induced acrosome reaction. Protein tyrosine phosphorylation pattern confirms that capacitation took place in parallel with the occurrence of DNA fragmentation. These results indicate that when spermatozoa are incubated for several hours (22 h), a common practice in assisted reproductive techniques, an increase in oxidative sperm metabolism and in the proportion of fragmented DNA should be expected. However, there was no effect on any of the other functional parameters associated with sperm fertilising capacity. PMID:25233794

  14. Improvement and induction property of radiation-responsive promoter through DNA shuffling of 5′-flanking regions of the human p21 gene

    PubMed Central

    Kagiya, Go; Ogawa, Ryohei; Cook, John A.; Choudhuri, Rajani; Hatashita, Masanori; Tanaka, Yoshikazu; DeGraff, Bill G.; Mitchell, James B.


    A promoter that augments gene expression in response to stimulation of ionizing radiation would be a desired tool for radiogenetic therapy, a combination of radiotherapy and gene therapy. Although various promoters occurring naturally or artificially have been used for researches, one showing higher reactivity to ionizing radiation is desirable. In the present study, we attempted to improve a radiation-responsive promoter of the p21 through a technique called DNA shuffling. A library of DNA fragments was constructed by re-ligation of randomly digested promoter fragments and improved promoters were chosen out of the library. We repeated this process twice to obtain a promoter showing 2.6 fold better reactivity to ionizing radiation compared with its parent, p21 promoter after 10 Gy γ-ray irradiation. Nucleotide sequence analyses revealed that the obtained promoter was densely packed with some of the cis-acting elements including binding sites for p53, NF-κB, NRF-2, AP-1 and NF-Y more than p21 promoter. In addition, it was shown that its induction by ionizing radiation was dependent upon p53 status of a cell line, suggesting that the promoter retained properties of the p21 promoter. This technique is simple and efficient to improve a promoter responsive to other stimulus of interest besides IR. PMID:20541129

  15. ATRX loss promotes tumor growth and impairs nonhomologous end joining DNA repair in glioma.


    Koschmann, Carl; Calinescu, Anda-Alexandra; Nunez, Felipe J; Mackay, Alan; Fazal-Salom, Janet; Thomas, Daniel; Mendez, Flor; Kamran, Neha; Dzaman, Marta; Mulpuri, Lakshman; Krasinkiewicz, Johnathon; Doherty, Robert; Lemons, Rosemary; Brosnan-Cashman, Jacqueline A; Li, Youping; Roh, Soyeon; Zhao, Lili; Appelman, Henry; Ferguson, David; Gorbunova, Vera; Meeker, Alan; Jones, Chris; Lowenstein, Pedro R; Castro, Maria G


    Recent work in human glioblastoma (GBM) has documented recurrent mutations in the histone chaperone protein ATRX. We developed an animal model of ATRX-deficient GBM and showed that loss of ATRX reduces median survival and increases genetic instability. Further, analysis of genome-wide data for human gliomas showed that ATRX mutation is associated with increased mutation rate at the single-nucleotide variant (SNV) level. In mouse tumors, ATRX deficiency impairs nonhomologous end joining and increases sensitivity to DNA-damaging agents that induce double-stranded DNA breaks. We propose that ATRX loss results in a genetically unstable tumor, which is more aggressive when left untreated but is more responsive to double-stranded DNA-damaging agents, resulting in improved overall survival. PMID:26936505

  16. RNF4 interacts with both SUMO and nucleosomes to promote the DNA damage response.


    Groocock, Lynda M; Nie, Minghua; Prudden, John; Moiani, Davide; Wang, Tao; Cheltsov, Anton; Rambo, Robert P; Arvai, Andrew S; Hitomi, Chiharu; Tainer, John A; Luger, Karolin; Perry, J Jefferson P; Lazzerini-Denchi, Eros; Boddy, Michael N


    The post-translational modification of DNA repair and checkpoint proteins by ubiquitin and small ubiquitin-like modifier (SUMO) critically orchestrates the DNA damage response (DDR). The ubiquitin ligase RNF4 integrates signaling by SUMO and ubiquitin, through its selective recognition and ubiquitination of SUMO-modified proteins. Here, we define a key new determinant for target discrimination by RNF4, in addition to interaction with SUMO. We identify a nucleosome-targeting motif within the RNF4 RING domain that can bind DNA and thereby enables RNF4 to selectively ubiquitinate nucleosomal histones. Furthermore, RNF4 nucleosome-targeting is crucially required for the repair of TRF2-depleted dysfunctional telomeres by 53BP1-mediated non-homologous end joining. PMID:24714598

  17. Heterogeneous DNA Methylation Patterns in the GSTP1 Promoter Lead to Discordant Results between Assay Technologies and Impede Its Implementation as Epigenetic Biomarkers in Breast Cancer.


    Alnaes, Grethe I Grenaker; Ronneberg, Jo Anders; Kristensen, Vessela N; Tost, Jörg


    Altered DNA methylation patterns are found in many diseases, particularly in cancer, where the analysis of DNA methylation holds the promise to provide diagnostic, prognostic and predictive information of great clinical value. Methylation of the promoter-associated CpG island of GSTP1 occurs in many hormone-sensitive cancers, has been shown to be a biomarker for the early detection of cancerous lesions and has been associated with important clinical parameters, such as survival and response to treatment. In the current manuscript, we assessed the performance of several widely-used sodium bisulfite conversion-dependent methods (methylation-specific PCR, MethyLight, pyrosequencing and MALDI mass-spectrometry) for the analysis of DNA methylation patterns in the GSTP1 promoter. We observed large discordances between the results obtained by the different technologies. Cloning and sequencing of the investigated region resolved single-molecule DNA methylation patterns and identified heterogeneous DNA methylation patterns as the underlying cause of the differences. Heterogeneous DNA methylation patterns in the GSTP1 promoter constitute a major obstacle to the implementation of DNA methylation-based analysis of GSTP1 and might explain some of the contradictory findings in the analysis of the significance of GSTP1 promoter methylation in breast cancer. PMID:26393654

  18. Heterogeneous DNA Methylation Patterns in the GSTP1 Promoter Lead to Discordant Results between Assay Technologies and Impede Its Implementation as Epigenetic Biomarkers in Breast Cancer

    PubMed Central

    Grenaker Alnaes, Grethe I.; Ronneberg, Jo Anders; Kristensen, Vessela N.; Tost, Jörg


    Altered DNA methylation patterns are found in many diseases, particularly in cancer, where the analysis of DNA methylation holds the promise to provide diagnostic, prognostic and predictive information of great clinical value. Methylation of the promoter-associated CpG island of GSTP1 occurs in many hormone-sensitive cancers, has been shown to be a biomarker for the early detection of cancerous lesions and has been associated with important clinical parameters, such as survival and response to treatment. In the current manuscript, we assessed the performance of several widely-used sodium bisulfite conversion-dependent methods (methylation-specific PCR, MethyLight, pyrosequencing and MALDI mass-spectrometry) for the analysis of DNA methylation patterns in the GSTP1 promoter. We observed large discordances between the results obtained by the different technologies. Cloning and sequencing of the investigated region resolved single-molecule DNA methylation patterns and identified heterogeneous DNA methylation patterns as the underlying cause of the differences. Heterogeneous DNA methylation patterns in the GSTP1 promoter constitute a major obstacle to the implementation of DNA methylation-based analysis of GSTP1 and might explain some of the contradictory findings in the analysis of the significance of GSTP1 promoter methylation in breast cancer. PMID:26393654

  19. ATM-dependent Phosphorylation of the Fanconi Anemia Protein PALB2 Promotes the DNA Damage Response.


    Guo, Yingying; Feng, Wanjuan; Sy, Shirley M H; Huen, Michael S Y


    The Fanconi anemia protein PALB2, also known as FANCN, protects genome integrity by regulating DNA repair and cell cycle checkpoints. Exactly how PALB2 functions may be temporally coupled with detection and signaling of DNA damage is not known. Intriguingly, we found that PALB2 is transformed into a hyperphosphorylated state in response to ionizing radiation (IR). IR treatment specifically triggered PALB2 phosphorylation at Ser-157 and Ser-376 in manners that required the master DNA damage response kinase Ataxia telangiectasia mutated, revealing potential mechanistic links between PALB2 and the Ataxia telangiectasia mutated-dependent DNA damage responses. Consistently, dysregulated PALB2 phosphorylation resulted in sustained activation of DDRs. Full-blown PALB2 phosphorylation also required the breast and ovarian susceptible gene product BRCA1, highlighting important roles of the BRCA1-PALB2 interaction in orchestrating cellular responses to genotoxic stress. In summary, our phosphorylation analysis of tumor suppressor protein PALB2 uncovers new layers of regulatory mechanisms in the maintenance of genome stability and tumor suppression. PMID:26420486


    EPA Science Inventory

    Studies with regenerating liver and hepatocyte cultures have shown that the a-1 adrenergic receptor (A1AR) is involved in the early events which transmit a mitogenic signal to hepatocytes after 2/3 partial hepatectomy. n this study, we investigated the role of A1AR in DNA synthes...

  1. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans.


    Quilez, Javier; Guilmatre, Audrey; Garg, Paras; Highnam, Gareth; Gymrek, Melissa; Erlich, Yaniv; Joshi, Ricky S; Mittelman, David; Sharp, Andrew J


    Despite representing an important source of genetic variation, tandem repeats (TRs) remain poorly studied due to technical difficulties. We hypothesized that TRs can operate as expression (eQTLs) and methylation (mQTLs) quantitative trait loci. To test this we analyzed the effect of variation at 4849 promoter-associated TRs, genotyped in 120 individuals, on neighboring gene expression and DNA methylation. Polymorphic promoter TRs were associated with increased variance in local gene expression and DNA methylation, suggesting functional consequences related to TR variation. We identified >100 TRs associated with expression/methylation levels of adjacent genes. These potential eQTL/mQTL TRs were enriched for overlaps with transcription factor binding and DNaseI hypersensitivity sites, providing a rationale for their effects. Moreover, we showed that most TR variants are poorly tagged by nearby single nucleotide polymorphisms (SNPs) markers, indicating that many functional TR variants are not effectively assayed by SNP-based approaches. Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping TR variants are required to fully ascertain functional variation in the genome. PMID:27060133

  2. Inactivation of nuclear GSK3β by Ser(389) phosphorylation promotes lymphocyte fitness during DNA double-strand break response.


    Thornton, Tina M; Delgado, Pilar; Chen, Liang; Salas, Beatriz; Krementsov, Dimitry; Fernandez, Miriam; Vernia, Santiago; Davis, Roger J; Heimann, Ruth; Teuscher, Cory; Krangel, Michael S; Ramiro, Almudena R; Rincón, Mercedes


    Variable, diversity and joining (V(D)J) recombination and immunoglobulin class switch recombination (CSR) are key processes in adaptive immune responses that naturally generate DNA double-strand breaks (DSBs) and trigger a DNA repair response. It is unclear whether this response is associated with distinct survival signals that protect T and B cells. Glycogen synthase kinase 3β (GSK3β) is a constitutively active kinase known to promote cell death. Here we show that phosphorylation of GSK3β on Ser(389) by p38 MAPK (mitogen-activated protein kinase) is induced selectively by DSBs through ATM (ataxia telangiectasia mutated) as a unique mechanism to attenuate the activity of nuclear GSK3β and promote survival of cells undergoing DSBs. Inability to inactivate GSK3β through Ser(389) phosphorylation in Ser(389)Ala knockin mice causes a decrease in the fitness of cells undergoing V(D)J recombination and CSR. Preselection-Tcrβ repertoire is impaired and antigen-specific IgG antibody responses following immunization are blunted in Ser(389)GSK3β knockin mice. Thus, GSK3β emerges as an important modulator of the adaptive immune response. PMID:26822034

  3. Inactivation of nuclear GSK3β by Ser389 phosphorylation promotes lymphocyte fitness during DNA double-strand break response

    PubMed Central

    Thornton, Tina M.; Delgado, Pilar; Chen, Liang; Salas, Beatriz; Krementsov, Dimitry; Fernandez, Miriam; Vernia, Santiago; Davis, Roger J.; Heimann, Ruth; Teuscher, Cory; Krangel, Michael S.; Ramiro, Almudena R.; Rincón, Mercedes


    Variable, diversity and joining (V(D)J) recombination and immunoglobulin class switch recombination (CSR) are key processes in adaptive immune responses that naturally generate DNA double-strand breaks (DSBs) and trigger a DNA repair response. It is unclear whether this response is associated with distinct survival signals that protect T and B cells. Glycogen synthase kinase 3β (GSK3β) is a constitutively active kinase known to promote cell death. Here we show that phosphorylation of GSK3β on Ser389 by p38 MAPK (mitogen-activated protein kinase) is induced selectively by DSBs through ATM (ataxia telangiectasia mutated) as a unique mechanism to attenuate the activity of nuclear GSK3β and promote survival of cells undergoing DSBs. Inability to inactivate GSK3β through Ser389 phosphorylation in Ser389Ala knockin mice causes a decrease in the fitness of cells undergoing V(D)J recombination and CSR. Preselection-Tcrβ repertoire is impaired and antigen-specific IgG antibody responses following immunization are blunted in Ser389GSK3β knockin mice. Thus, GSK3β emerges as an important modulator of the adaptive immune response. PMID:26822034

  4. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans

    PubMed Central

    Quilez, Javier; Guilmatre, Audrey; Garg, Paras; Highnam, Gareth; Gymrek, Melissa; Erlich, Yaniv; Joshi, Ricky S.; Mittelman, David; Sharp, Andrew J.


    Despite representing an important source of genetic variation, tandem repeats (TRs) remain poorly studied due to technical difficulties. We hypothesized that TRs can operate as expression (eQTLs) and methylation (mQTLs) quantitative trait loci. To test this we analyzed the effect of variation at 4849 promoter-associated TRs, genotyped in 120 individuals, on neighboring gene expression and DNA methylation. Polymorphic promoter TRs were associated with increased variance in local gene expression and DNA methylation, suggesting functional consequences related to TR variation. We identified >100 TRs associated with expression/methylation levels of adjacent genes. These potential eQTL/mQTL TRs were enriched for overlaps with transcription factor binding and DNaseI hypersensitivity sites, providing a rationale for their effects. Moreover, we showed that most TR variants are poorly tagged by nearby single nucleotide polymorphisms (SNPs) markers, indicating that many functional TR variants are not effectively assayed by SNP-based approaches. Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping TR variants are required to fully ascertain functional variation in the genome. PMID:27060133

  5. PML induces compaction, TRF2 depletion and DNA damage signaling at telomeres and promotes their alternative lengthening.


    Osterwald, Sarah; Deeg, Katharina I; Chung, Inn; Parisotto, Daniel; Wörz, Stefan; Rohr, Karl; Erfle, Holger; Rippe, Karsten


    The alternative lengthening of telomeres (ALT) mechanism allows cancer cells to escape senescence and apoptosis in the absence of active telomerase. A characteristic feature of this pathway is the assembly of ALT-associated promyelocytic leukemia (PML) nuclear bodies (APBs) at telomeres. Here, we dissected the role of APBs in a human ALT cell line by performing an RNA interference screen using an automated 3D fluorescence microscopy platform and advanced 3D image analysis. We identified 29 proteins that affected APB formation, which included proteins involved in telomere and chromatin organization, protein sumoylation and DNA repair. By integrating and extending these findings, we found that APB formation induced clustering of telomere repeats, telomere compaction and concomitant depletion of the shelterin protein TRF2 (also known as TERF2). These APB-dependent changes correlated with the induction of a DNA damage response at telomeres in APBs as evident by a strong enrichment of the phosphorylated form of the ataxia telangiectasia mutated (ATM) kinase. Accordingly, we propose that APBs promote telomere maintenance by inducing a DNA damage response in ALT-positive tumor cells through changing the telomeric chromatin state to trigger ATM phosphorylation. PMID:25908860

  6. Promoter DNA Methylation of Farnesoid X Receptor and Pregnane X Receptor Modulates the Intrahepatic Cholestasis of Pregnancy Phenotype

    PubMed Central

    Cabrerizo, Romina; Castaño, Gustavo O.; Burgueño, Adriana L.; Fernández Gianotti, Tomas; Gonzalez Lopez Ledesma, María Mora; Flichman, Diego; Pirola, Carlos J.; Sookoian, Silvia


    The intrahepatic cholestasis of pregnancy (ICP) is a multifactorial liver disorder which pathogenesis involves the interplay among abnormal bile acid (BA) levels, sex hormones, environmental factors, and genetic susceptibility. The dynamic nature of ICP that usually resolves soon after delivery suggests the possibility that its pathobiology is under epigenetic modulation. We explored the status of white blood peripheral cells-DNA methylation of CpG-enriched sites at the promoter of targeted genes (FXR/NR1H4, PXR/NR1I2, NR1I3, ESR1, and ABCC2) in a sample of 88 ICP patients and 173 healthy pregnant women in the third trimester of their pregnancies. CpG dinucleotides at the gene promoter of nuclear receptors subfamily 1 members and ABCC2 transporter were highly methylated during healthy pregnancy. We observed significant differences at the distal (−1890) and proximal promoter (−358) CpG sites of the FXR/NR1H4 and at the distal PXR/NR1I2 (−1224) promoter, which were consistently less methylated in ICP cases when compared with controls. In addition, we observed that methylation at FXR/NR1H4-1890 and PXR/NR1I2-1224 promoter sites was highly and positively correlated with BA profiling, particularly, conjugated BAs. Conversely, methylation level at the proximal FXR/NR1H4-358 CpG site was significantly and negatively correlated with the primary cholic and secondary deoxycholic acid. In vitro exploration showed that epiallopregnanolone sulfate, a reported FXR inhibitor, regulates the transcriptional activity of FXR/NR1H4 but seems to be not involved in the methylation changes. In conclusion, the identification of epigenetic marks in target genes provides a basis for the understanding of adverse liver-related pregnancy outcomes, including ICP. PMID:24498169

  7. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing.


    Kon, Tatsuya; Yoshikawa, Nobuyuki


    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  8. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar


    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  9. Induction of the lac promoter in the absence of DNA loops and the stoichiometry of induction.


    Oehler, Stefan; Alberti, Siegfried; Müller-Hill, Benno


    In vivo induction of the Escherichia coli lactose operon as a function of inducer concentration generates a sigmoidal curve, indicating a non-linear response. Suggested explanations for this dependence include a 2:1 inducer-repressor stoichiometry of induction, which is the currently accepted view. It is, however, known for decades that, in vitro, operator binding as a function of inducer concentration is not sigmoidal. This discrepancy between in vivo and in vitro data has so far not been resolved. We demonstrate that the in vivo non-linearity of induction is due to cooperative repression of the wild-type lac operon through DNA loop formation. In the absence of DNA loops, in vivo induction curves are hyperbolic. In the light of this result, we re-address the question of functional molecular inducer-repressor stoichiometry in induction of the lac operon. PMID:16432263

  10. DNA promoter methylation as a diagnostic and therapeutic biomarker in gallbladder cancer

    PubMed Central


    Gallbladder cancer is an infrequent neoplasia with noticeable geographical variations in its incidence around the world. In Chile, it is the main cause of death owing to cancer in women over 40 years old, with mortality rates up to 16.5 per 100,000 cases. The prognosis is poor with few therapeutic options; in advanced cases there is only a 10% survival at 5 years. Several studies mention the possible role of DNA methylation in gallbladder carcinogenesis. This epigenetic modification affects tumor suppressor genes involved in regulation pathways, cell cycle control, cell adhesion and extracellular matrix degradation, in a sequential and cumulative way. Determining DNA methylation patterns would allow them to be used as biomarkers for the early detection, diagnosis, prognosis and/or therapeutic selection in gallbladder cancer. PMID:22794276

  11. DNA hairpins promote temperature controlled cargo encapsulation in a truncated octahedral nanocage structure family

    NASA Astrophysics Data System (ADS)

    Franch, Oskar; Iacovelli, Federico; Falconi, Mattia; Juul, Sissel; Ottaviani, Alessio; Benvenuti, Claudia; Biocca, Silvia; Ho, Yi-Ping; Knudsen, Birgitta R.; Desideri, Alessandro


    In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous demonstration of temperature controlled reversible encapsulation of the cargo enzyme, horseradish peroxidase, in the cage with four hairpin forming strands. However, in this previous study the mechanism of cargo uptake was not directly addressed (Juul, et al., Temperature-Controlled Encapsulation and Release of an Active Enzyme in the Cavity of a Self-Assembled DNA Nanocage, ACS Nano, 2013, 7, 9724-9734). In the present study we use a combination of molecular dynamics simulations and in vitro analyses to unravel the mechanism of cargo uptake in hairpin containing DNA cages. We find that two hairpin forming strands are necessary and sufficient to facilitate efficient cargo uptake, which argues against a full opening-closing of one corner of the structure being responsible for encapsulation. Molecular dynamics simulations were carried out to evaluate the atomistic motions responsible for encapsulation and showed that the two hairpin forming strands facilitated extension of at least one of the face surfaces of the cage scaffold, allowing entrance of the cargo protein into the cavity of the structure. Hence, the presented data demonstrate that cargo uptake does not involve a full opening of the structure. Rather, the uptake mechanism represents a feature of increased flexibility integrated in this nanocage structure upon the addition of at least two hairpin-forming strands.In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous

  12. Conjugative DNA transfer induces the bacterial SOS response and promotes antibiotic resistance development through integron activation.


    Baharoglu, Zeynep; Bikard, David; Mazel, Didier


    Conjugation is one mechanism for intra- and inter-species horizontal gene transfer among bacteria. Conjugative elements have been instrumental in many bacterial species to face the threat of antibiotics, by allowing them to evolve and adapt to these hostile conditions. Conjugative plasmids are transferred to plasmidless recipient cells as single-stranded DNA. We used lacZ and gfp fusions to address whether conjugation induces the SOS response and the integron integrase. The SOS response controls a series of genes responsible for DNA damage repair, which can lead to recombination and mutagenesis. In this manuscript, we show that conjugative transfer of ssDNA induces the bacterial SOS stress response, unless an anti-SOS factor is present to alleviate this response. We also show that integron integrases are up-regulated during this process, resulting in increased cassette rearrangements. Moreover, the data we obtained using broad and narrow host range plasmids strongly suggests that plasmid transfer, even abortive, can trigger chromosomal gene rearrangements and transcriptional switches in the recipient cell. Our results highlight the importance of environments concentrating disparate bacterial communities as reactors for extensive genetic adaptation of bacteria. PMID:20975940

  13. Cyclin A2 promotes DNA repair in the brain during both development and aging.


    Gygli, Patrick E; Chang, Joshua C; Gokozan, Hamza N; Catacutan, Fay P; Schmidt, Theresa A; Kaya, Behiye; Goksel, Mustafa; Baig, Faisal S; Chen, Shannon; Griveau, Amelie; Michowski, Wojciech; Wong, Michael; Palanichamy, Kamalakannan; Sicinski, Piotr; Nelson, Randy J; Czeisler, Catherine; Otero, José J


    Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential requirements of distinct brain regions for Cyclin A2, we utilized neuroanatomical, transgenic mouse, and mathematical modeling techniques to generate testable hypotheses that provide insight into how Cyclin A2 loss results in compensatory forebrain growth during late embryonic development. Using unbiased measurements of the forebrain stem cell niche, we parameterized a mathematical model whereby logistic growth instructs progenitor cells as to the cell-types of their progeny. Our data was consistent with prior findings that progenitors proliferate along an auto-inhibitory growth curve. The growth retardation inCCNA2-null brains corresponded to cell cycle lengthening, imposing a developmental delay. We hypothesized that Cyclin A2 regulates DNA repair and that CCNA2-null progenitors thus experienced lengthened cell cycle. We demonstrate that CCNA2-null progenitors suffer abnormal DNA repair, and implicate Cyclin A2 in double-strand break repair. Cyclin A2's DNA repair functions are conserved among cell lines, neural progenitors, and hippocampal neurons. We further demonstrate that neuronal CCNA2 ablation results in learning and memory deficits in aged mice. PMID:27425845

  14. Cyclin A2 promotes DNA repair in the brain during both development and aging

    PubMed Central

    Gygli, Patrick E.; Chang, Joshua C.; Gokozan, Hamza N.; Catacutan, Fay P.; Schmidt, Theresa A.; Kaya, Behiye; Goksel, Mustafa; Baig, Faisal S.; Chen, Shannon; Griveau, Amelie; Michowski, Wojciech; Wong, Michael; Palanichamy, Kamalakannan; Sicinski, Piotr; Nelson, Randy J.; Czeisler, Catherine; Otero, José J.


    Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential requirements of distinct brain regions for Cyclin A2, we utilized neuroanatomical, transgenic mouse, and mathematical modeling techniques to generate testable hypotheses that provide insight into how Cyclin A2 loss results in compensatory forebrain growth during late embryonic development. Using unbiased measurements of the forebrain stem cell niche, we parameterized a mathematical model whereby logistic growth instructs progenitor cells as to the cell-types of their progeny. Our data was consistent with prior findings that progenitors proliferate along an auto-inhibitory growth curve. The growth retardation in CCNA2-null brains corresponded to cell cycle lengthening, imposing a developmental delay. We hypothesized that Cyclin A2 regulates DNA repair and that CCNA2-null progenitors thus experienced lengthened cell cycle. We demonstrate that CCNA2-null progenitors suffer abnormal DNA repair, and implicate Cyclin A2 in double-strand break repair. Cyclin A2's DNA repair functions are conserved among cell lines, neural progenitors, and hippocampal neurons. We further demonstrate that neuronal CCNA2 ablation results in learning and memory deficits in aged mice. PMID:27425845

  15. DNaseI-hypersensitive sites at promoter-like sequences in the spacer of Xenopus laevis and Xenopus borealis ribosomal DNA.

    PubMed Central

    La Volpe, A; Taggart, M; McStay, B; Bird, A


    We have detected a DNAseI hypersensitive site in the ribosomal DNA spacer of Xenopus laevis and Xenopus borealis. The site is present in blood and embryonic nuclei of each species. In interspecies hybrids, however, the site is absent in unexpressed borealis rDNA, but is present normally in expressed laevis rDNA. Hypersensitive sites are located well upstream (over lkb) of the pre-ribosomal RNA promoter. Sequencing of the hypersensitive region in borealis rDNA, however, shows extensive homology with the promoter sequence, and with the hypersensitive region in X. laevis. Of two promoter-like duplications in each spacer, only the most upstream copy is associated with hypersensitivity to DNAaseI. Unlike DNAaseI, Endo R. MspI digests the rDNA of laevis blood nuclei at a domain extending downstream from the hypersensitive site to near the 40S promoter. Since the organisation of conserved sequence elements within this "proximal domain" is similar in three Xenopus species whose spacers have otherwise evolved rapidly, we conclude that this domain plays an important role in rDNA function. Images PMID:6310495

  16. A Conserved DNA Repeat Promotes Selection of a Diverse Repertoire of Trypanosoma brucei Surface Antigens from the Genomic Archive.


    Hovel-Miner, Galadriel; Mugnier, Monica R; Goldwater, Benjamin; Cross, George A M; Papavasiliou, F Nina


    African trypanosomes are mammalian pathogens that must regularly change their protein coat to survive in the host bloodstream. Chronic trypanosome infections are potentiated by their ability to access a deep genomic repertoire of Variant Surface Glycoprotein (VSG) genes and switch from the expression of one VSG to another. Switching VSG expression is largely based in DNA recombination events that result in chromosome translocations between an acceptor site, which houses the actively transcribed VSG, and a donor gene, drawn from an archive of more than 2,000 silent VSGs. One element implicated in these duplicative gene conversion events is a DNA repeat of approximately 70 bp that is found in long regions within each BES and short iterations proximal to VSGs within the silent archive. Early observations showing that 70-bp repeats can be recombination boundaries during VSG switching led to the prediction that VSG-proximal 70-bp repeats provide recombinatorial homology. Yet, this long held assumption had not been tested and no specific function for the conserved 70-bp repeats had been demonstrated. In the present study, the 70-bp repeats were genetically manipulated under conditions that induce gene conversion. In this manner, we demonstrated that 70-bp repeats promote access to archival VSGs. Synthetic repeat DNA sequences were then employed to identify the length, sequence, and directionality of repeat regions required for this activity. In addition, manipulation of the 70-bp repeats allowed us to observe a link between VSG switching and the cell cycle that had not been appreciated. Together these data provide definitive support for the long-standing hypothesis that 70-bp repeats provide recombinatorial homology during switching. Yet, the fact that silent archival VSGs are selected under these conditions suggests the 70-bp repeats also direct DNA pairing and recombination machinery away from the closest homologs (silent BESs) and toward the rest of the archive. PMID

  17. A Conserved DNA Repeat Promotes Selection of a Diverse Repertoire of Trypanosoma brucei Surface Antigens from the Genomic Archive

    PubMed Central

    Hovel-Miner, Galadriel; Mugnier, Monica R.; Goldwater, Benjamin; Cross, George A. M.; Papavasiliou, F. Nina


    African trypanosomes are mammalian pathogens that must regularly change their protein coat to survive in the host bloodstream. Chronic trypanosome infections are potentiated by their ability to access a deep genomic repertoire of Variant Surface Glycoprotein (VSG) genes and switch from the expression of one VSG to another. Switching VSG expression is largely based in DNA recombination events that result in chromosome translocations between an acceptor site, which houses the actively transcribed VSG, and a donor gene, drawn from an archive of more than 2,000 silent VSGs. One element implicated in these duplicative gene conversion events is a DNA repeat of approximately 70 bp that is found in long regions within each BES and short iterations proximal to VSGs within the silent archive. Early observations showing that 70-bp repeats can be recombination boundaries during VSG switching led to the prediction that VSG-proximal 70-bp repeats provide recombinatorial homology. Yet, this long held assumption had not been tested and no specific function for the conserved 70-bp repeats had been demonstrated. In the present study, the 70-bp repeats were genetically manipulated under conditions that induce gene conversion. In this manner, we demonstrated that 70-bp repeats promote access to archival VSGs. Synthetic repeat DNA sequences were then employed to identify the length, sequence, and directionality of repeat regions required for this activity. In addition, manipulation of the 70-bp repeats allowed us to observe a link between VSG switching and the cell cycle that had not been appreciated. Together these data provide definitive support for the long-standing hypothesis that 70-bp repeats provide recombinatorial homology during switching. Yet, the fact that silent archival VSGs are selected under these conditions suggests the 70-bp repeats also direct DNA pairing and recombination machinery away from the closest homologs (silent BESs) and toward the rest of the archive. PMID

  18. Interaction of a rhizobial DNA-binding protein with the promoter region of a plant leghemoglobin gene

    SciTech Connect

    Welters, P.; Metz, B.; Felix, G.; Palme, K. ); Szczyglowski, K. ); Bruijn, F.J. de Michigan State Univ., East Lansing, MI )


    A nucleotide sequence was identified approximately 650 bp upstream of the Sesbania rostrata leghemoglobin gene Srglb3 start codon, which interacts specifically with a proteinaceous DNA-binding factor found in nodule extracts but not in extracts from leaves or root. The binding site for this factor was delimited using footprinting techniques. The DNA-binding activity of this factor was found to be heat stable, dependent on divalent cations, and derived from the (infecting) Azorhizobium caulinodans bacteria or bacteroids (A. caulinodans bacterial binding factor 1, AcBBF1). A 9- to 10-kD protein was isolated from a free-living culture of A. caulinodans that co-purifies with the DNA-binding activity (A. caulinodans bacterial binding protein 1, AcBBP1) and interacts specifically with its target (S. rostrata bacterial binding site 1, SrBBS1). The amino acid sequence of the N-terminal 27 residues of AcBBP1 was determined and was found to share significant similarity (46% identity; 68% similarity) with a domain of the herpes simplex virus major DNA-binding protein infected cell protein 8(ICP8). An insertion mutation in the SrBBS1 was found to result in a substantial reduction of the expression of a Srglb3-gus reporter gene fusion in nodules of transgenic Lotus corniculatus plants, suggesting a role for this element in Srglb3 promoter activity. Based on these results, the authors propose that (a) bacterial transacting factor(s) may play a role in infected cell-specific expression of the symbiotically induced plant lb genes. 70 refs., 11 figs.

  19. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary


    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  20. Kaposi's sarcoma-associated herpesvirus Rta tetramers make high-affinity interactions with repetitive DNA elements in the Mta promoter to stimulate DNA binding of RBP-Jk/CSL.


    Palmeri, Diana; Carroll, Kyla Driscoll; Gonzalez-Lopez, Olga; Lukac, David M


    Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus 8 [HHV-8]) is the etiologic agent of Kaposi's sarcoma (KS) and lymphoproliferative diseases. We previously demonstrated that the KSHV lytic switch protein Rta stimulates DNA binding of the cellular RBP-Jk/CSL protein, the nuclear component of the Notch pathway, on Rta target promoters. In the current study, we define the promoter requirements for formation of transcriptionally productive Rta/RBP-Jk/DNA complexes. We show that highly pure Rta footprints 7 copies of a previously undescribed repetitive element in the promoter of the essential KSHV Mta gene. We have termed this element the "CANT repeat." CANT repeats are found on both strands of DNA and have a consensus sequence of ANTGTAACANT(A/T)(A/T)T. We demonstrate that Rta tetramers make high-affinity interactions (i.e., nM) with 64 bp of the Mta promoter but not single CANT units. The number of CANT repeats, their presence in palindromes, and their positions relative to the RBP-Jk binding site determine the optimal target for Rta stimulation of RBP-Jk DNA binding and formation of ternary Rta/RBP-Jk/DNA complexes. DNA binding and tetramerization mutants of Rta fail to stimulate RBP-Jk DNA binding. Our chromatin immunoprecipitation assays show that RBP-Jk DNA binding is broadly, but selectively, stimulated across the entire KSHV genome during reactivation. We propose a model in which tetramerization of Rta allows it to straddle RBP-Jk and contact repeat units on both sides of RBP-Jk. Our study integrates high-affinity Rta DNA binding with the requirement for a cellular transcription factor in Rta transactivation. PMID:21880753

  1. Brusatol Enhances the Radiosensitivity of A549 Cells by Promoting ROS Production and Enhancing DNA Damage.


    Sun, Xiaohui; Wang, Qin; Wang, Yan; Du, Liqing; Xu, Chang; Liu, Qiang


    NF-E2-related factor 2 (Nrf2) has been identified as a master regulatory factor in the protection of cells from oxidative and electrophilic stress. However, overexpression of Nrf2 in lung cancer may cause chemoresistance, as well as radioresistance. In this study, we examined the relationship between radioresistance and Nrf2 protein levels in H1299, A549, and H460 cells, and finally chose the A549 cell line to continue with due to its strong radioresistance and high Nrf2 protein levels. We found that the Nrf2 inhibitor, brusatol, could prevent the increase and accumulation of Nrf2 after exposure to irradiation. Additionally, following treatment with 80 nM brusatol, A549 cells became sensitive to irradiation, suffering severe DNA damage. Combination treatment with brusatol and ionizing radiation (IR) can distinctly increase the level of reactive oxygen species in A549 cells, causing a 1.8-fold increase compared with the control, and a 1.4-fold increase compared with IR alone. In fact, in the treatment with both brusatol and IR, lung cancer cell proliferation is halted, gradually leading to cell death. Because Nrf2 is closely linked to DNA damage repair, inhibiting the function of Nrf2, as in brusatol treatment, may increase the DNA damage caused by radiotherapy or chemotherapy, possibly enhancing the efficacy of chemotherapeutic drugs. Our study is the first to demonstrate brusatol's ability to enhance the responsiveness of lung cancer cells to irradiation, and its potential application as a natural sensitizer in radiotherapy. PMID:27347930

  2. Brusatol Enhances the Radiosensitivity of A549 Cells by Promoting ROS Production and Enhancing DNA Damage

    PubMed Central

    Sun, Xiaohui; Wang, Qin; Wang, Yan; Du, Liqing; Xu, Chang; Liu, Qiang


    NF-E2-related factor 2 (Nrf2) has been identified as a master regulatory factor in the protection of cells from oxidative and electrophilic stress. However, overexpression of Nrf2 in lung cancer may cause chemoresistance, as well as radioresistance. In this study, we examined the relationship between radioresistance and Nrf2 protein levels in H1299, A549, and H460 cells, and finally chose the A549 cell line to continue with due to its strong radioresistance and high Nrf2 protein levels. We found that the Nrf2 inhibitor, brusatol, could prevent the increase and accumulation of Nrf2 after exposure to irradiation. Additionally, following treatment with 80 nM brusatol, A549 cells became sensitive to irradiation, suffering severe DNA damage. Combination treatment with brusatol and ionizing radiation (IR) can distinctly increase the level of reactive oxygen species in A549 cells, causing a 1.8-fold increase compared with the control, and a 1.4-fold increase compared with IR alone. In fact, in the treatment with both brusatol and IR, lung cancer cell proliferation is halted, gradually leading to cell death. Because Nrf2 is closely linked to DNA damage repair, inhibiting the function of Nrf2, as in brusatol treatment, may increase the DNA damage caused by radiotherapy or chemotherapy, possibly enhancing the efficacy of chemotherapeutic drugs. Our study is the first to demonstrate brusatol’s ability to enhance the responsiveness of lung cancer cells to irradiation, and its potential application as a natural sensitizer in radiotherapy. PMID:27347930

  3. SIRT6 promotes DNA repair under stress by activating PARP1.


    Mao, Zhiyong; Hine, Christopher; Tian, Xiao; Van Meter, Michael; Au, Matthew; Vaidya, Amita; Seluanov, Andrei; Gorbunova, Vera


    Sirtuin 6 (SIRT6) is a mammalian homolog of the yeast Sir2 deacetylase. Mice deficient for SIRT6 exhibit genome instability. Here, we show that in mammalian cells subjected to oxidative stress SIRT6 is recruited to the sites of DNA double-strand breaks (DSBs) and stimulates DSB repair, through both nonhomologous end joining and homologous recombination. Our results indicate that SIRT6 physically associates with poly[adenosine diphosphate (ADP)-ribose] polymerase 1 (PARP1) and mono-ADP-ribosylates PARP1 on lysine residue 521, thereby stimulating PARP1 poly-ADP-ribosylase activity and enhancing DSB repair under oxidative stress. PMID:21680843

  4. PICH and BLM limit histone association with anaphase centromeric DNA threads and promote their resolution.


    Ke, Yuwen; Huh, Jae-Wan; Warrington, Ross; Li, Bing; Wu, Nan; Leng, Mei; Zhang, Junmei; Ball, Haydn L; Li, Bing; Yu, Hongtao


    Centromeres nucleate the formation of kinetochores and are vital for chromosome segregation during mitosis. The SNF2 family helicase PICH (Plk1-interacting checkpoint helicase) and the BLM (the Bloom's syndrome protein) helicase decorate ultrafine histone-negative DNA threads that link the segregating sister centromeres during anaphase. The functions of PICH and BLM at these threads are not understood, however. Here, we show that PICH binds to BLM and enables BLM localization to anaphase centromeric threads. PICH- or BLM-RNAi cells fail to resolve these threads in anaphase. The fragmented threads form centromeric-chromatin-containing micronuclei in daughter cells. Anaphase threads in PICH- and BLM-RNAi cells contain histones and centromere markers. Recombinant purified PICH has nucleosome remodelling activities in vitro. We propose that PICH and BLM unravel centromeric chromatin and keep anaphase DNA threads mostly free of nucleosomes, thus allowing these threads to span long distances between rapidly segregating centromeres without breakage and providing a spatiotemporal window for their resolution. PMID:21743438

  5. ATM regulates 3-Methylpurine-DNA glycosylase and promotes therapeutic resistance to alkylating agents

    PubMed Central

    Agnihotri, Sameer; Burrell, Kelly; Buczkowicz, Pawel; Remke, Marc; Golbourn, Brian; Chornenkyy, Yevgen; Gajadhar, Aaron; Fernandez, Nestor A.; Clarke, Ian D.; Barszczyk, Mark S.; Pajovic, Sanja; Ternamian, Christian; Head, Renee; Sabha, Nesrin; Sobol, Robert W.; Taylor, Michael D; Rutka, James T.; Jones, Chris; Dirks, Peter B.; Zadeh, Gelareh; Hawkins, Cynthia


    Alkylating agents are a frontline therapy for the treatment of several aggressive cancers including pediatric glioblastoma, a lethal tumor in children. Unfortunately, many tumors are resistant to this therapy. We sought to identify ways of sensitizing tumor cells to alkylating agents while leaving normal cells unharmed; increasing therapeutic response while minimizing toxicity. Using a siRNA screen targeting over 240 DNA damage response genes, we identified novel sensitizers to alkylating agents. In particular the base excision repair (BER) pathway, including 3-methylpurine-DNA glycosylase (MPG), as well as ataxia telangiectasia mutated (ATM) were identified in our screen. Interestingly, we identified MPG as a direct novel substrate of ATM. ATM-mediated phosphorylation of MPG was required for enhanced MPG function. Importantly, combined inhibition or loss of MPG and ATM resulted in increased alkylating agent-induced cytotoxicity in vitro and prolonged survival in vivo. The discovery of the ATM-MPG axis will lead to improved treatment of alkylating agent-resistant tumors. PMID:25100205

  6. PICH and BLM limit histone association with anaphase centromeric DNA threads and promote their resolution

    PubMed Central

    Ke, Yuwen; Huh, Jae-Wan; Warrington, Ross; Li, Bing; Wu, Nan; Leng, Mei; Zhang, Junmei; Ball, Haydn L; Li, Bing; Yu, Hongtao


    Centromeres nucleate the formation of kinetochores and are vital for chromosome segregation during mitosis. The SNF2 family helicase PICH (Plk1-interacting checkpoint helicase) and the BLM (the Bloom's syndrome protein) helicase decorate ultrafine histone-negative DNA threads that link the segregating sister centromeres during anaphase. The functions of PICH and BLM at these threads are not understood, however. Here, we show that PICH binds to BLM and enables BLM localization to anaphase centromeric threads. PICH- or BLM-RNAi cells fail to resolve these threads in anaphase. The fragmented threads form centromeric-chromatin-containing micronuclei in daughter cells. Anaphase threads in PICH- and BLM-RNAi cells contain histones and centromere markers. Recombinant purified PICH has nucleosome remodelling activities in vitro. We propose that PICH and BLM unravel centromeric chromatin and keep anaphase DNA threads mostly free of nucleosomes, thus allowing these threads to span long distances between rapidly segregating centromeres without breakage and providing a spatiotemporal window for their resolution. PMID:21743438

  7. PHD3-dependent hydroxylation of HCLK2 promotes the DNA damage response.


    Xie, Liang; Pi, Xinchun; Mishra, Ashutosh; Fong, Guohua; Peng, Junmin; Patterson, Cam


    The DNA damage response (DDR) is a complex regulatory network that is critical for maintaining genome integrity. Posttranslational modifications are widely used to ensure strict spatiotemporal control of signal flow, but how the DDR responds to environmental cues, such as changes in ambient oxygen tension, remains poorly understood. We found that an essential component of the ATR/CHK1 signaling pathway, the human homolog of the Caenorhabditis elegans biological clock protein CLK-2 (HCLK2), associated with and was hydroxylated by prolyl hydroxylase domain protein 3 (PHD3). HCLK2 hydroxylation was necessary for its interaction with ATR and the subsequent activation of ATR/CHK1/p53. Inhibiting PHD3, either with the pan-hydroxylase inhibitor dimethyloxaloylglycine (DMOG) or through hypoxia, prevented activation of the ATR/CHK1/p53 pathway and decreased apoptosis induced by DNA damage. Consistent with these observations, we found that mice lacking PHD3 were resistant to the effects of ionizing radiation and had decreased thymic apoptosis, a biomarker of genomic integrity. Our identification of HCLK2 as a substrate of PHD3 reveals the mechanism through which hypoxia inhibits the DDR, suggesting hydroxylation of HCLK2 is a potential therapeutic target for regulating the ATR/CHK1/p53 pathway. PMID:22797300

  8. Kr-pok increases FASN expression by modulating the DNA binding of SREBP-1c and Sp1 at the proximal promoter[S

    PubMed Central

    Jeon, Bu-Nam; Kim, Yeon-Sook; Choi, Won-Il; Koh, Dong-In; Kim, Min-Kyeong; Yoon, Jae-Hyeon; Kim, Min-Young; Hur, Benjamin; Paik, Philip Dong-Hyun; Hur, Man-Wook


    Kr-pok (kidney cancer-related POZ domain and Krüppel-like protein) is a new proto-oncogenic POZ-domain transcription factor. Fatty acid synthase gene (FASN) encodes one of the key enzymes in fatty acids synthesis and is the only enzyme that synthesizes fatty acids in cancer cells. Sp1 and SREBP-1c are the two major transcription activators of FASN. We investigated whether Kr-pok modulates transcription of the FASN. FASN expression is significantly decreased in Kr-pok knockout murine embryonic fibroblasts. Coimmunoprecipitation, GST fusion protein pull-down, and immunocytochemistry assays show that the zinc-finger domain of Kr-pok interacts directly with the bZIP DNA binding domain of SREBP-1. Electrophoretic mobility shift assay, oligonucleotide pull-down, and chromatin immunoprecipitation assays showed that Kr-pok changes the transcription factor binding dynamics of Sp1 and SREBP-1c to the SRE/E-box elements of the proximal promoter. We found that Kr-pok expression increased during 3T3-L1 preadipocyte differentiation and that FASN expression is decreased by the knockdown of Kr-pok. Kr-pok facilitates the SREBP-1c-mediated preadipocyte differentiation and/or fatty acid synthesis. Kr-pok may act as an important regulator of fatty acid synthesis and may induce rapid cancer cell proliferation by increasing palmitate synthesis. PMID:22331133

  9. Modeling and analysis of MH1 domain of Smads and their interaction with promoter DNA sequence motif.


    Makkar, Pooja; Metpally, Raghu Prasad R; Sangadala, Sreedhara; Reddy, Boojala Vijay B


    The Smads are a group of related intracellular proteins critical for transmitting the signals to the nucleus from the transforming growth factor-beta (TGF-beta) superfamily of proteins at the cell surface. The prototypic members of the Smad family, Mad and Sma, were first described in Drosophila and Caenorhabditis elegans, respectively. Related proteins in Xenopus, Humans, Mice and Rats were subsequently identified, and are now known as Smads. Smad protein family members act downstream in the TGF-beta signaling pathway mediating various biological processes, including cell growth, differentiation, matrix production, apoptosis and development. Smads range from about 400-500 amino acids in length and are grouped into the receptor-regulated Smads (R-Smads), the common Smads (Co-Smads) and the inhibitory Smads (I-Smads). There are eight Smads in mammals, Smad1/5/8 (bone morphogenetic protein regulated) and Smad2/3 (TGF-beta/activin regulated) are termed R-Smads, Smad4 is denoted as Co-Smad and Smad6/7 are inhibitory Smads. A typical Smad consists of a conserved N-terminal Mad Homology 1 (MH1) domain and a C-terminal Mad Homology 2 (MH2) domain connected by a proline rich linker. The MH1 domain plays key role in DNA recognition and also facilitates the binding of Smad4 to the phosphorylated C-terminus of R-Smads to form activated complex. The MH2 domain exhibits transcriptional activation properties. In order to understand the structural basis of interaction of various Smads with their target proteins and the promoter DNA, we modeled MH1 domain of the remaining mammalian Smads based on known crystal structures of Smad3-MH1 domain bound to GTCT Smad box DNA sequence (1OZJ). We generated a B-DNA structure using average base-pair parameters of Twist, Tilt, Roll and base Slide angles. We then modeled interaction pose of the MH1 domain of Smad1/5/8 to their corresponding DNA sequence motif GCCG. These models provide the structural basis towards understanding functional

  10. Methylglyoxal induces endoplasmic reticulum stress and DNA demethylation in the Keap1 promoter of human lens epithelial cells and age-related cataracts

    PubMed Central

    Palsamy, Periyasamy; Bidasee, Keshore R.; Ayaki, Masahiko; Augusteyn, Robert C.; Chan, Jefferson Y.; Shinohara, Toshimichi


    Age-related cataracts are a leading cause of blindness. Previously, we have demonstrated the association of unfolded protein response with various cataractogenic stressors. However, DNA methylation alterations leading to suppression of lenticular antioxidant protection remains unclear. Here, we report the methylglyoxal-mediated sequential events responsible for Keap1 promoter DNA demethylation in human lens epithelial cells, because Keap1 is a negative regulatory protein that regulates the Nrf2 antioxidant protein. Methylglyoxal induces the ER stress and activates the unfolded protein response leading to overproduction of ROS prior to human lens epithelial cells death. Methylglyoxal also suppresses the Nrf2 and DNA methyltransferases but activates the DNA demethylation pathway enzyme, TET1. Bisulfite genomic DNA sequencing confirms the methylglyoxal-mediated Keap1 promoter DNA demethylation leading to over-expression of Keap1 mRNA and protein. Similarly, bisulfite genomic DNA sequencing of human clear lenses (n=15) slowly lose 5-methylcytosine in the Keap1 promoter throughout life, at a rate of 1% per year. By contrast, diabetic cataractous lenses (n=21) lose an average of 90% of the 5-methylcytosine regardless of the age. Over-expressed Keap1 protein is responsible for decreasing the Nrf2 by proteasomal degradation, thereby suppressing the Nrf2 dependent stress protection. This study demonstrates for the first time about the associations of unfolded protein response activation, Nrf2 dependent antioxidant system failure and loss of Keap1 promoter methylation because of altered active and passive DNA demethylation pathway enzymes in human lens epithelial cells by methylglyoxal. As an outcome, cellular redox balance is altered towards lens oxidation and cataract formation. PMID:24746615

  11. Murine cystathionine γ-lyase: complete cDNA and genomic sequences, promoter activity, tissue distribution and developmental expression

    PubMed Central


    Cystathionine γ-lyase (CSE) is the last key enzyme in the trans-sulphuration pathway for biosynthesis of cysteine from methionine. Cysteine could be provided through diet; however, CSE has been shown to be important for the adequate supply of cysteine to synthesize glutathione, a major intracellular antioxidant. With a view to determining physiological roles of CSE in mice, we report the sequence of a complete mouse CSE cDNA along with its associated genomic structure, generation of specific polyclonal antibodies, and the tissue distribution and developmental expression patterns of CSE in mice. A 1.8 kb full-length cDNA containing an open reading frame of 1197 bp, which encodes a 43.6 kDa protein, was isolated from adult mouse kidney. A 35 kb mouse genomic fragment was obtained by λ genomic library screening. It contained promoter regions, 12 exons, ranging in size from 53 to 579 bp, spanning over 30 kb, and exon/intron boundaries that were conserved with rat and human CSE. The GC-rich core promoter contained canonical TATA and CAAT motifs, and several transcription factor-binding consensus sequences. The CSE transcript, protein and enzymic activity were detected in liver, kidney, and, at much lower levels, in small intestine and stomach of both rats and mice. In developing mouse liver and kidney, the expression levels of CSE protein and activity gradually increased with age until reaching their peak value at 3 weeks of age, following which the expression levels in liver remained constant, whereas those in kidney decreased significantly. Immunohistochemical analyses revealed predominant CSE expression in hepatocytes and kidney cortical tubuli. These results suggest important physiological roles for CSE in mice. PMID:15038791

  12. DNA methyltransferase 3A promotes cell proliferation by silencing CDK inhibitor p18INK4C in gastric carcinogenesis

    PubMed Central

    Cui, He; Zhao, Chengcheng; Gong, Pihai; Wang, Ling; Wu, Huazhang; Zhang, Kun; Zhou, Rongping; Wang, Li; Zhang, Ting; Zhong, Sheng; Fan, Hong


    Little is known about the roles of DNA methyltransferase 3A (DNMT3A) in gastric carcinogenesis. Here, we reported that the exogenous expression of DNMT3A promoted gastric cancer (GC) cell proliferation by accelerating the G1/S transition. Subsequently, p18INK4C was identified as a downstream target of DNMT3A. The elevated expression of DNMT3A suppressed p18INK4C at least at the transcriptional level. Depletion of p18INK4C expression in GC cells induced cell cycle progression, whereas its re-expression alleviated the effect of DNMT3A overexpression on G1/S transition. Furthermore, we found that DNMT3A modulated p18INK4C by directly binding to and silencing the p18INK4C gene via promoter hypermethylation. In clinical GC tissue specimens analyzed, the level of methylation of p18INK4C detected in tumor tissues was significantly higher than that in paired non-tumor tissues. Moreover, elevated level of DNMT3A expression was associated with the differentiation of GC tissues and was negatively correlated with the p18INK4C expression level. Taken together, our results found that DNMT3A contributes to the dysregulation of the cell cycle by repressing p18INK4C in a DNA methylation-dependent manner, suggesting that DNMT3A-p18INK4C axis involved in GC. These findings provide new insights into gastric carcinogenesis and a potential therapeutic target for GC that may be further investigated in the future. PMID:26350239

  13. DNA binding and regulatory effects of transcription factors SP1 and USF at the rat amyloid precursor protein gene promoter.

    PubMed Central

    Hoffman, P W; Chernak, J M


    Two DNA elements which we have termed SAA and GAG have been shown to control expression of the rat amyloid precursor protein (APP) gene, and the region containing the SAA element has been shown to interact with nuclear proteins [Hoffman and Chernak (1994) Biochem. Biophys. Res. Commun. 201, 610-617]. In this report we study DNA sequences and proteins which influence the activity of the SAA element. An oligonucleotide containing the SAA element is specifically bound by nuclear proteins derived from rat PC12 cells, consistently forming four complexes designated C25, C30, C35 and C40 in electrophoretic mobility shift assays (EMSAs). We demonstrate that the C25, C30 and C40 complexes involve the binding of nuclear proteins to an SP1 consensus sequence located within the SAA element and that the C25 complex contains a protein antigenically related to the human SP1 protein. We establish further that the C35 complex requires a USF recognition site located within the SAA element and contains a protein antigenically related to the human upstream stimulatory factor (USF) protein. Using APP promoter/luciferase reporter gene constructs, we demonstrate that both the SP1 and the USF sites can play a role in the transcriptional activity of the SAA element. Finally, we show that complexes similar to the C25, C30 and C35 complexes are formed by rat cortex nuclear extracts and the SAA element in EMSA experiments, suggesting the relevance of our in vitro observations to the in vivo functioning of the rat APP promoter. Images PMID:7610052

  14. Acute dosing and p53-deficiency promote cellular sensitivity to DNA methylating agents.


    Chapman, Katherine E; Doak, Shareen H; Jenkins, Gareth J S


    Risk assessment of human exposure to chemicals is crucial for understanding whether such agents can cause cancer. The current emphasis on avoidance of animal testing has placed greater importance on in vitro tests for the identification of genotoxicants. Selection of an appropriate in vitro dosing regime is imperative in determining the genotoxic effects of test chemicals. Here, the issue of dosing approaches was addressed by comparing acute and chronic dosing, uniquely using low-dose experiments. Acute 24 h exposures were compared with equivalent dosing every 24 h over 5-day, fractionated treatment periods. The in vitro micronucleus assay was used to measure clastogenicity induced by methyl methanesulfonate (MMS) and N-methyl-N-nitrosourea (MNU) in human lymphoblastoid cell line, TK6. Quantitative real-time (qRT) PCR was used to measure mRNA level induction of DNA repair enzymes. Lowest observed genotoxic effect levels (LOGELs) for MMS were obtained at 0.7 µg/ml for the acute study and 1.0 µg/ml for the chronic study. For acute MNU dosing, a LOGEL was observed at 0.46 µg/ml, yet genotoxicity was completely removed following the chronic study. Interestingly, acute MNU dosing demonstrated a statistically significant decrease at 0.009 µg/ml. Levels of selected DNA repair enzymes did not change significantly following doses tested. However, p53 deficiency (using the TK6-isogenic cell line, NH32) increased sensitivity to MMS during chronic dosing, causing this LOGEL to equate to the acute treatment LOGEL. In the context of the present data for 2 alkylating agents, chronic dosing could be a valuable in vitro supplement to acute dosing and could contribute to reduction of unnecessary in vivo follow-up tests. PMID:25595616

  15. A novel activity of HMG domains: promotion of the triple-stranded complex formation between DNA containing (GGA/TCC)11 and d(GGA)11 oligonucleotides.

    PubMed Central

    Suda, T; Mishima, Y; Takayanagi, K; Asakura, H; Odani, S; Kominami, R


    The high mobility group protein (HMG)-box is a DNA-binding domain found in many proteins that bind preferentially to DNA of irregular structures in a sequence-independent manner and can bend the DNA. We show here that GST-fusion proteins of HMG domains from HMG1 and HMG2 promote a triple-stranded complex formation between DNA containing the (GGA/TCC)11 repeat and oligonucleotides of d(GGA)11 probably due to G:G base pairing. The activity is to reduce association time and requirements of Mg2+ and oligonucleotide concentrations. The HMG box of SRY, the protein determining male-sex differentiation, also has the activity, suggesting that it is not restricted to the HMG-box domains derived from HMG1/2 but is common to those from other members of the HMG-box family of proteins. Interestingly, the box-AB and box-B of HMG1 bend DNA containing the repeat, but SRY fails to bend in a circularization assay. The difference suggests that the two activities of association-promotion and DNA bending are distinct. These results suggest that the HMG-box domain has a novel activity of promoting the association between GGA repeats which might be involved in higher-order architecture of chromatin. PMID:8972860

  16. Activation of the pleiotropic drug resistance pathway can promote mitochondrial DNA retention by fusion-defective mitochondria in Saccharomyces cerevisiae.


    Mutlu, Nebibe; Garipler, Görkem; Akdoğan, Emel; Dunn, Cory D


    Genetic and microscopic approaches using Saccharomyces cerevisiae have identified many proteins that play a role in mitochondrial dynamics, but it is possible that other proteins and pathways that play a role in mitochondrial division and fusion remain to be discovered. Mutants lacking mitochondrial fusion are characterized by rapid loss of mitochondrial DNA. We took advantage of a petite-negative mutant that is unable to survive mitochondrial DNA loss to select for mutations that allow cells with fusion-deficient mitochondria to maintain the mitochondrial genome on fermentable medium. Next-generation sequencing revealed that all identified suppressor mutations not associated with known mitochondrial division components were localized to PDR1 or PDR3, which encode transcription factors promoting drug resistance. Further studies revealed that at least one, if not all, of these suppressor mutations dominantly increases resistance to known substrates of the pleiotropic drug resistance pathway. Interestingly, hyperactivation of this pathway did not significantly affect mitochondrial shape, suggesting that mitochondrial division was not greatly affected. Our results reveal an intriguing genetic connection between pleiotropic drug resistance and mitochondrial dynamics. PMID:24807265

  17. Targeted expression of transforming growth factor-beta 1 in intracardiac grafts promotes vascular endothelial cell DNA synthesis.

    PubMed Central

    Koh, G Y; Kim, S J; Klug, M G; Park, K; Soonpaa, M H; Field, L J


    Intracardiac grafts comprised of genetically modified skeletal myoblasts were assessed for their ability to effect long-term delivery of recombinant transforming growth factor-beta (TGF-beta) to the heart. C2C12 myoblasts were stably transfected with a construct comprised of an inducible metallothionein promoter fused to a modified TGF-beta 1 cDNA. When cultured in medium supplemented with zinc sulfate, cells carrying this transgene constitutively secrete active TGF-beta 1. These genetically modified myoblasts were used to produce intracardiac grafts in syngeneic C3Heb/FeJ hosts. Viable grafts were observed as long as three months after implantation, and immunohistological analyses of mice maintained on water supplemented with zinc sulfate revealed the presence of grafted cells which stably expressed TGF-beta 1. Regions of apparent neovascularization, as evidenced by tritiated thymidine incorporation into vascular endothelial cells, were observed in the myocardium which bordered grafts expressing TGF-beta 1. The extent of vascular endothelial cell DNA synthesis could be modulated by altering dietary zinc. Similar effects on the vascular endothelial cells were not seen in mice with grafts comprised of nontransfected cells. This study indicates that genetically modified skeletal myoblast grafts can be used to effect the local, long-term delivery of recombinant molecules to the heart. Images PMID:7529257

  18. DNA damage–inducible SUMOylation of HERC2 promotes RNF8 binding via a novel SUMO-binding Zinc finger

    PubMed Central

    Danielsen, Jannie Rendtlew; Povlsen, Lou Klitgaard; Villumsen, Bine Hare; Streicher, Werner; Nilsson, Jakob; Wikström, Mats; Bekker-Jensen, Simon


    Nonproteolytic ubiquitylation of chromatin surrounding deoxyribonucleic acid (DNA) double-strand breaks (DSBs) by the RNF8/RNF168/HERC2 ubiquitin ligases facilitates restoration of genome integrity by licensing chromatin to concentrate genome caretaker proteins near the lesions. In parallel, SUMOylation of so-far elusive upstream DSB regulators is also required for execution of this ubiquitin-dependent chromatin response. We show that HERC2 and RNF168 are novel DNA damage–dependent SUMOylation targets in human cells. In response to DSBs, both HERC2 and RNF168 were specifically modified with SUMO1 at DSB sites in a manner dependent on the SUMO E3 ligase PIAS4. SUMOylation of HERC2 was required for its DSB-induced association with RNF8 and for stabilizing the RNF8–Ubc13 complex. We also demonstrate that the ZZ Zinc finger in HERC2 defined a novel SUMO-specific binding module, which together with its concomitant SUMOylation and T4827 phosphorylation promoted binding to RNF8. Our findings provide novel insight into the regulatory complexity of how ubiquitylation and SUMOylation cooperate to orchestrate protein interactions with DSB repair foci. PMID:22508508

  19. DNA damage-inducible SUMOylation of HERC2 promotes RNF8 binding via a novel SUMO-binding Zinc finger.


    Danielsen, Jannie Rendtlew; Povlsen, Lou Klitgaard; Villumsen, Bine Hare; Streicher, Werner; Nilsson, Jakob; Wikström, Mats; Bekker-Jensen, Simon; Mailand, Niels


    Nonproteolytic ubiquitylation of chromatin surrounding deoxyribonucleic acid (DNA) double-strand breaks (DSBs) by the RNF8/RNF168/HERC2 ubiquitin ligases facilitates restoration of genome integrity by licensing chromatin to concentrate genome caretaker proteins near the lesions. In parallel, SUMOylation of so-far elusive upstream DSB regulators is also required for execution of this ubiquitin-dependent chromatin response. We show that HERC2 and RNF168 are novel DNA damage-dependent SUMOylation targets in human cells. In response to DSBs, both HERC2 and RNF168 were specifically modified with SUMO1 at DSB sites in a manner dependent on the SUMO E3 ligase PIAS4. SUMOylation of HERC2 was required for its DSB-induced association with RNF8 and for stabilizing the RNF8-Ubc13 complex. We also demonstrate that the ZZ Zinc finger in HERC2 defined a novel SUMO-specific binding module, which together with its concomitant SUMOylation and T4827 phosphorylation promoted binding to RNF8. Our findings provide novel insight into the regulatory complexity of how ubiquitylation and SUMOylation cooperate to orchestrate protein interactions with DSB repair foci. PMID:22508508

  20. DNA Methylation in Cosmc Promoter Region and Aberrantly Glycosylated IgA1 Associated with Pediatric IgA Nephropathy

    PubMed Central

    Sun, Qiang; Zhang, Jianqian; Zhou, Nan; Liu, Xiaorong; Shen, Ying


    IgA nephropathy (IgAN) is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc) is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26), other renal diseases (n = 11) and healthy children (n = 13). B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2’-deoxycytidine (AZA). The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113), but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001) or AZA (P<0.0001). Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001). The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001). After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001) with more markedly decreased Cosmc mRNA content (P<0.0001). After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001), while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001). The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated IgA1

  1. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants

    PubMed Central

    Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap


    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10–32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

  2. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.


    Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap


    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

  3. A switch between DNA polymerases δ and λ promotes error-free bypass of 8-oxo-G lesions.


    Markkanen, Enni; Castrec, Benoît; Villani, Giuseppe; Hübscher, Ulrich


    7,8-Dihydro-8-oxoguanine (8-oxo-G) is a highly abundant and mutagenic lesion. Replicative DNA polymerases (pols) are slowed down at 8-oxo-G and insert both correct cytosine (C) and incorrect adenine (A) opposite 8-oxo-G, but they preferentially extend A:8-oxo-G mispairs. Nevertheless, 8-oxo-G bypass is fairly accurate in vivo. Thus, the question how correct bypass of 8-oxo-G lesions is accomplished despite the poor extension of C:8-oxo-G base pairs by replicative pols remains unanswered. Here we show that replicative pol δ pauses in front of 8-oxo-G and displays difficulties extending from correct C:8-oxo-G in contrast to extension from incorrect A:8-oxo-G. This leads to stalling of pol δ at 8-oxo-G after incorporation of correct C. This stalling at C:8-oxo-G can be overcome by a switch from pol δ to pols λ, β, or η, all of which are able to assist pol δ in 8-oxo-G bypass by translesion synthesis (TLS). Importantly, however, only pol λ selectively catalyzes the correct TLS past 8-oxo-G, whereas pols β and η show no selectivity and even preferentially enhance incorrect TLS. The selectivity of pol λ to promote the correct bypass depends on its N-terminal domain. Furthermore, pol λ(-/-) mouse embryonic fibroblast extracts display reduced 8-oxo-G TLS. Finally, the correct bypass of 8-oxo-G in gapped plasmids in mouse embryonic fibroblasts and HeLa cells is promoted in the presence of pol λ. Our findings suggest that even though 8-oxo-G is not a blocking lesion per se, correct replication over 8-oxo-G is promoted by a pol switch between pols δ and λ. PMID:23175785

  4. DNA promoter hypermethylation contributes to down-regulation of galactocerebrosidase gene in lung and head and neck cancers

    PubMed Central

    Peng, Jiangzhou; Chen, Baishen; Shen, Zhuojian; Deng, Heran; Liu, Degang; Xie, Xuan; Gan, Xiangfeng; Xu, Xia; Huang, Zhiquan; Chen, Ju


    Galactocerebrosidase (GALC) is a lysosomal enzyme responsible for glycosphingolipids degradation byproducts of which are important for synthesis of apoptosis mediator ceramide. Reduced expression of GALC has been identified in human malignancies; however, molecular mechanisms underlying down-regulation of GALC expression in cancer remain unknown. We performed methylation and expression analysis on GALC gene in a panel of head and neck cancer (HNC) and lung cancer cell lines, attempting to understand the regulation of GALC in human cancer. QRT-PCR and western blot analysis were performed to detect the expression of GALC in HNC. Bisulfite DNA sequencing and real-time qMSP were used to detect the methylation of GALC in HNC and lung cancer cell lines. 5aza-dC treatment assay was used to analysis the functional effect of GALC methylation on GALC expression in HNC. Reduction or complete absence of GALC expression was observed in more than a half of the tested HNC cell lines (8/14). 7 out of 8 cell lines with down-regulated expression harbored heavy CpG island methylation, while all cell lines with abundant expression of the gene contained no methylation. Hypermethylation was also found in primary HNC tumor tissues and lung cancer cell lines whereas absent in normal oral mucosa tissues. Demethylating treatment demonstrated that 5aza-dC significantly restored GALC expression in cell lines with methylated promoter while showed no effect on cell lines without promoter hypermethylation. Our findings for the first time demonstrated that promoter hypermethylation contributed to down-regulation of GALC Gene, implicating epigenetic inactivation of GALC may play a role in tumorigenesis of cancer. PMID:26617822

  5. KAP-1 Promotes Resection of Broken DNA Ends Not Protected by γ-H2AX and 53BP1 in G1-Phase Lymphocytes

    PubMed Central

    Tubbs, Anthony T.; Dorsett, Yair; Chan, Elizabeth; Helmink, Beth; Lee, Baeck-Seung; Hung, Putzer; George, Rosmy; Bredemeyer, Andrea L.; Mittal, Anuradha; Pappu, Rohit V.; Chowdhury, Dipanjan; Mosammaparast, Nima; Krangel, Michael S.


    The resection of broken DNA ends is required for DNA double-strand break (DSB) repair by homologous recombination (HR) but can inhibit normal repair by nonhomologous end joining (NHEJ), the main DSB repair pathway in G1-phase cells. Antigen receptor gene assembly proceeds through DNA DSB intermediates generated in G1-phase lymphocytes by the RAG endonuclease. These DSBs activate ATM, which phosphorylates H2AX, forming γ-H2AX in flanking chromatin. γ-H2AX prevents CtIP from initiating resection of RAG DSBs. Whether there are additional proteins required to promote resection of these DNA ends is not known. KRAB-associated protein 1 (KAP-1) (TRIM28) is a transcriptional repressor that modulates chromatin structure and has been implicated in the repair of DNA DSBs in heterochromatin. Here, we show that in murine G1-phase lymphocytes, KAP-1 promotes resection of DSBs that are not protected by H2AX and its downstream effector 53BP1. In these murine cells, KAP-1 activity in DNA end resection is attenuated by a single-amino-acid change that reflects a KAP-1 polymorphism between primates and other mammalian species. These findings establish KAP-1 as a component of the machinery that can resect DNA ends in G1-phase cells and suggest that there may be species-specific features to this activity. PMID:24842905

  6. Promoter hijack reveals pericentrin functions in mitosis and the DNA damage response

    PubMed Central

    Wang, Yifan; Dantas, Tiago J.; Lalor, Pierce; Dockery, Peter; Morrison, Ciaran G.


    Centrosomes, the principal microtubule-organizing centers of animal somatic cells, consist of two centrioles embedded in the pericentriolar material (PCM). Pericentrin is a large PCM protein that is required for normal PCM assembly. Mutations in PCNT cause primordial dwarfism. Pericentrin has also been implicated in the control of DNA damage responses. To test how pericentrin is involved in cell cycle control after genotoxic stress, we disrupted the Pcnt locus in chicken DT40 cells. Pericentrin-deficient cells proceeded through mitosis more slowly, with a high level of monopolar spindles, and were more sensitive to spindle poisons than controls. Centriole structures appeared normal by light and electron microscopy, but the PCM did not recruit γ-tubulin efficiently. Cell cycle delays after ionizing radiation (IR) treatment were normal in pericentrin-deficient cells. However, pericentrin disruption in Mcph1−/− cells abrogated centrosome hyperamplification after IR. We conclude that pericentrin controls genomic stability by both ensuring appropriate mitotic spindle activity and centrosome regulation. PMID:23324397

  7. CSB interacts with SNM1A and promotes DNA interstrand crosslink processing

    PubMed Central

    Iyama, Teruaki; Lee, Sook Y.; Berquist, Brian R.; Gileadi, Opher; Bohr, Vilhelm A.; Seidman, Michael M.; McHugh, Peter J.; Wilson, David M.


    Cockayne syndrome (CS) is a premature aging disorder characterized by photosensitivity, impaired development and multisystem progressive degeneration, and consists of two strict complementation groups, A and B. Using a yeast two-hybrid approach, we identified the 5′-3′ exonuclease SNM1A as one of four strong interacting partners of CSB. This direct interaction was confirmed using purified recombinant proteins—with CSB able to modulate the exonuclease activity of SNM1A on oligonucleotide substrates in vitro—and the two proteins were shown to exist in a common complex in human cell extracts. CSB and SNM1A were also found, using fluorescently tagged proteins in combination with confocal microscopy and laser microirradiation, to be recruited to localized trioxsalen-induced ICL damage in human cells, with accumulation being suppressed by transcription inhibition. Moreover, SNM1A recruitment was significantly reduced in CSB-deficient cells, suggesting coordination between the two proteins in vivo. CSB-deficient neural cells exhibited increased sensitivity to DNA crosslinking agents, particularly, in a non-cycling, differentiated state, as well as delayed ICL processing as revealed by a modified Comet assay and γ-H2AX foci persistence. The results indicate that CSB coordinates the resolution of ICLs, possibly in a transcription-associated repair mechanism involving SNM1A, and that defects in the process could contribute to the post-mitotic degenerative pathologies associated with CS. PMID:25505141

  8. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts.


    Lerner, Chad A; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K; Elder, Alison; Rahman, Irfan


    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. PMID:27343559

  9. Effects of temperature on excluded volume-promoted cyclization and concatemerization of cohesive-ended DNA longer than 0.04 Mb.

    PubMed Central

    Louie, D; Serwer, P


    The 0.048502 megabase (Mb), primarily double-stranded DNA of bacteriophage lambda has single-stranded, complementary termini (cohesive ends) that undergo either spontaneous intramolecular joining to form open circular DNA or spontaneous intermolecular joining to form linear, end-to-end oligomeric DNAs (concatemers); concatemers also cyclize. In the present study, the effects of polyethylene glycol (PEG) on the cyclization and concatemerization of lambda DNA are determined at temperatures that, in the absence of PEG, favor dissociation of cohesive ends. Circular and linear lambda DNA, monomeric and concatemeric, are observed by use of pulsed field agarose gel (PFG) electrophoresis. During preparation of lambda DNA for these studies, hydrodynamic shear-induced, partial dissociation of joined cohesive ends is fortuitously observed. Although joined lambda cohesive ends progressively dissociate as their temperature is raised in the buffer used here (0.1 M NaCl, 0.01 M sodium phosphate, pH 7.4, 0.001 M EDTA), when PEG is added to this buffer, raising the temperature sometimes promotes joining of cohesive ends. Conditions for promotion of primarily either cyclization or concatemerization are described. Open circular DNAs as long as a 7-mer are produced and resolved. The concentration of PEG required to promote joining of cohesive ends decreases as the molecular weight of the PEG increases. The rate of cyclization is brought, the first time, to values that are high enough to be comparable to the rate observed in vivo. For double-stranded DNA bacteriophages that have a linear replicative form of DNA (bacteriophage T7, for example), a suppression, sometimes observed here, of cyclization mimics a suppression of cyclization previously observed in vivo. The PEG, temperature effects on DNA joining are explained by both the excluded volume of PEG random coils and an increase in this excluded volume that occurs when temperature increases. Images PMID:1829160

  10. Developmental changes in DNA methylation and covalent histone modifications of chromatin associated with the epsilon-, gamma-, and beta-globin gene promoters in Papio anubis.


    Lavelle, Donald; Vaitkus, Kestis; Hankewych, Maria; Singh, Mahipal; DeSimone, Joseph


    The baboon is a suitable and relevant animal model to study the mechanism of human globin gene switching. This investigation addresses the role of DNA methylation and histone coding in globin gene switching in the baboon, Papio anubis. Bisulfite sequencing and chromatin immunoprecipitation studies were performed in erythroid cells purified from fetuses of varying gestational ages and from adult bone marrow to analyze the manner that changes in DNA methylation of the epsilon-, gamma-, and beta-globin promoters and association of ac-H3, ac-H4, H3-dimeK4, H3-dimeK36, and H3-dimeK79 with the epsilon-, gamma-, and beta-globin promoters occur during development. Changes in DNA methylation of the epsilon- and gamma-globin gene promoters during transitional stages of globin gene switching were consistent with the stochastic model of methylation and a role of DNA methylation in gene silencing. Enrichment of ac-H3, ac-H4, and pol II at the promoters of developmentally active genes was observed, while the pattern of distribution of H3-dimeK4 and H3-dimeK79 suggests that these modifications are found near both currently and formerly active promoters. Enrichment of H3-dimeK36 at the silenced epsilon-globin gene promoter was observed. These studies demonstrate that coordinated epigenetic modifications in the chromatin structure of the beta-like globin gene promoters accompany the highly regulated changes in expression patterns of these genes during development. PMID:16527500

  11. Transgenic cassava resistance to African cassava mosaic virus is enhanced by viral DNA-A bidirectional promoter-derived siRNAs.


    Vanderschuren, Hervé; Akbergenov, Rashid; Pooggin, Mikhail M; Hohn, Thomas; Gruissem, Wilhelm; Zhang, Peng


    Expression of double-stranded RNA (dsRNA) homologous to virus sequences can effectively interfere with RNA virus infection in plant cells by triggering RNA silencing. Here we applied this approach against a DNA virus, African cassava mosaic virus (ACMV), in its natural host cassava. Transgenic cassava plants were developed to express small interfering RNAs (siRNA) from a CaMV 35S promoter-controlled, intron-containing dsRNA cognate to the common region-containing bidirectional promoter of ACMV DNA-A. In two of three independent transgenic lines, accelerated plant recovery from ACMV-NOg infection was observed, which correlates with the presence of transgene-derived siRNAs 21-24 nt in length. Overall, cassava mosaic disease symptoms were dramatically attenuated in these two lines and less viral DNA accumulation was detected in their leaves than in those of wild-type plants. In a transient replication assay using leaf disks from the two transgenic lines, strongly reduced accumulation of viral single-stranded DNA was observed. Our study suggests that a natural RNA silencing mechanism targeting DNA viruses through production of virus-derived siRNAs is turned on earlier and more efficiently in transgenic plants expressing dsRNA cognate to the viral promoter and common region. PMID:17492253

  12. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.


    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  13. Uranyl mediated photofootprinting reveals strong E. coli RNA polymerase--DNA backbone contacts in the +10 region of the DeoP1 promoter open complex.

    PubMed Central

    Jeppesen, C; Nielsen, P E


    Employing a newly developed uranyl photofootprinting technique (Nielsen et al. (1988) FEBS Lett. 235, 122), we have analyzed the structure of the E. coli RNA polymerase deoP1 promoter open complex. The results show strong polymerase DNA backbone contacts in the -40, -10, and most notably in the +10 region. These results suggest that unwinding of the -12 to +3 region of the promoter in the open complex is mediated through polymerase DNA backbone contacts on both sides of this region. The pattern of bases that are hyperreactive towards KMnO4 or uranyl within the -12 to +3 region furthermore argues against a model in which this region is simply unwound and/or single stranded. The results indicate specific protein contacts and/or a fixed DNA conformation within the -12 to +3 region. Images PMID:2503811

  14. Specific contacts of the −35 region of the galP1 promoter by RNA polymerase inhibit GalR-mediated DNA looping repression

    PubMed Central

    Csiszovszki, Zsolt; Lewis, Dale E. A.; Le, Phuoc; Sneppen, Kim; Semsey, Szabolcs


    The P1 promoter of the galactose operon in Escherichia coli is one of the best studied examples of ‘extended −10’ promoters. Recognition of the P1 promoter does not require specific contacts between RNA polymerase and its poor −35 element. To investigate whether specific recognition of the −35 element would affect the regulation of P1 by GalR, we mutagenized the −35 element of P1, isolated variants of the −35 element and studied the regulation of the mutant promoters by in vitro transcription assays and by mathematical modeling. The results show that the GalR-mediated DNA loop is less efficient in repressing P1 transcription when RNA polymerase binds to the −10 and −35 elements concomitantly. Our results suggest that promoters that lack specific −35 element recognition allow decoupling of local chromosome structure from transcription initiation. PMID:22941635

  15. Specific contacts of the -35 region of the galP1 promoter by RNA polymerase inhibit GalR-mediated DNA looping repression.


    Csiszovszki, Zsolt; Lewis, Dale E A; Le, Phuoc; Sneppen, Kim; Semsey, Szabolcs


    The P1 promoter of the galactose operon in Escherichia coli is one of the best studied examples of 'extended -10' promoters. Recognition of the P1 promoter does not require specific contacts between RNA polymerase and its poor -35 element. To investigate whether specific recognition of the -35 element would affect the regulation of P1 by GalR, we mutagenized the -35 element of P1, isolated variants of the -35 element and studied the regulation of the mutant promoters by in vitro transcription assays and by mathematical modeling. The results show that the GalR-mediated DNA loop is less efficient in repressing P1 transcription when RNA polymerase binds to the -10 and -35 elements concomitantly. Our results suggest that promoters that lack specific -35 element recognition allow decoupling of local chromosome structure from transcription initiation. PMID:22941635

  16. Structure of the Trichomonas vaginalis Myb3 DNA-binding domain bound to a promoter sequence reveals a unique C-terminal β-hairpin conformation.


    Wei, Shu-Yi; Lou, Yuan-Chao; Tsai, Jia-Yin; Ho, Meng-Ru; Chou, Chun-Chi; Rajasekaran, M; Hsu, Hong-Ming; Tai, Jung-Hsiang; Hsiao, Chwan-Deng; Chen, Chinpan


    Trichomonas vaginalis Myb3 transcription factor (tvMyb3) recognizes the MRE-1 promoter sequence and regulates ap65-1 gene, which encodes a hydrogenosomal malic enzyme that may play a role in the cytoadherence of the parasite. Here, we identified tvMyb3(53-180) as the essential fragment for DNA recognition and report the crystal structure of tvMyb3(53-180) bound to MRE-1 DNA. The N-terminal fragment adopts the classical conformation of an Myb DNA-binding domain, with the third helices of R2 and R3 motifs intercalating in the major groove of DNA. The C-terminal extension forms a β-hairpin followed by a flexible tail, which is stabilized by several interactions with the R3 motif and is not observed in other Myb proteins. Interestingly, this unique C-terminal fragment does not stably connect with DNA in the complex structure but is involved in DNA binding, as demonstrated by NMR chemical shift perturbation, (1)H-(15)N heteronuclear-nuclear Overhauser effect and intermolecular paramagnetic relaxation enhancement. Site-directed mutagenesis also revealed that this C-terminal fragment is crucial for DNA binding, especially the residue Arg(153) and the fragment K(170)KRK(173). We provide a structural basis for MRE-1 DNA recognition and suggest a possible post-translational regulation of tvMyb3 protein. PMID:21908401

  17. NuMA promotes homologous recombination repair by regulating the accumulation of the ISWI ATPase SNF2h at DNA breaks

    PubMed Central

    Vidi, Pierre-Alexandre; Liu, Jing; Salles, Daniela; Jayaraman, Swaathi; Dorfman, George; Gray, Matthew; Abad, Patricia; Moghe, Prabhas V.; Irudayaraj, Joseph M.; Wiesmüller, Lisa; Lelièvre, Sophie A.


    Chromatin remodeling factors play an active role in the DNA damage response by shaping chromatin to facilitate the repair process. The spatiotemporal regulation of these factors is key to their function, yet poorly understood. We report that the structural nuclear protein NuMA accumulates at sites of DNA damage in a poly[ADP-ribose]ylation-dependent manner and functionally interacts with the ISWI ATPase SNF2h/SMARCA5, a chromatin remodeler that facilitates DNA repair. NuMA coimmunoprecipitates with SNF2h, regulates its diffusion in the nucleoplasm and controls its accumulation at DNA breaks. Consistent with NuMA enabling SNF2h function, cells with silenced NuMA exhibit reduced chromatin decompaction after DNA cleavage, lesser focal recruitment of homologous recombination repair factors, impaired DNA double-strand break repair in chromosomal (but not in episomal) contexts and increased sensitivity to DNA cross-linking agents. These findings reveal a structural basis for the orchestration of chromatin remodeling whereby a scaffold protein promotes genome maintenance by directing a remodeler to DNA breaks. PMID:24753406

  18. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao


    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  19. Effects on specific promoter DNA methylation in zebrafish embryos and larvae following benzo[a]pyrene exposure☛

    PubMed Central

    Corrales, J.; Fang, X.; Thornton, C.; Mei, W.; Barbazuk, W.B.; Duke, M.; Scheffler, B.E.; Willett, K.L.


    Benzo[a]pyrene (BaP) is an established carcinogen and reproductive and developmental toxicant. BaP exposure in humans and animals has been linked to infertility and multigenerational health consequences. DNA methylation is the most studied epigenetic mechanism that regulates gene expression, and mapping of methylation patterns has become an important tool for understanding pathologic gene expression events. The goal of this study was to investigate aberrant changes in promoter DNA methylation in zebrafish embryos and larvae following a parental and continued embryonic waterborne BaP exposure. A total of 21 genes known for their role in human diseases were selected to measure percent methylation by multiplex deep sequencing. At 96 hours post fertilization (hpf) compared to 3.3 hpf, dazl, nqo1, sox3, cyp1b1, and gstp1 had higher methylation percentages while c-fos and cdkn1a had decreased CG methylation. BaP exposure significantly reduced egg production and offspring survival. Moreover, BaP decreased global methylation and altered CG, CHH, and CHG methylation both at 3.3 and 96 hpf. CG methylation changed by 10% or more due to BaP in six genes (c-fos, cdkn1a, dazl, nqo1, nrf2, and sox3) at 3.3 hpf and in ten genes (c-fos, cyp1b1, dazl, gstp1, mlh1, nqo1, pten, p53, sox2, and sox3) at 96 hpf. BaP also induced gene expression of cyp1b1 and gstp1 at 96 hpf which were found to be hypermethylated. Further studies are needed to link aberrant CG, CHH, and CHG methylation to heritable epigenetic consequences associated with disease in later life. PMID:24576477

  20. Placental DNA methylation of peroxisome-proliferator-activated receptor-γ co-activator-1α promoter is associated with maternal gestational glucose level.


    Xie, Xuemei; Gao, Hongjie; Zeng, Wanjiang; Chen, Suhua; Feng, Ling; Deng, Dongrui; Qiao, Fu-yuan; Liao, Lihong; McCormick, Kenneth; Ning, Qin; Luo, Xiaoping


    Intrauterine exposure to hyperglycaemia may increase the risk of later-life metabolic disorders. Although the underlying mechanism is not fully understood, epigenetic dysregulation in fetal programming has been implicated. With regard to energy homoeostasis, PGC-1α (peroxisome-proliferator-activated receptor γ co-activator-1α, encoded by the PPARGC1A gene) plays a regulatory role in several biochemical processes. We hypothesized that maternal gestational glucose levels would positively correlate with DNA methylation of the PPARGC1A promoter in placental tissue. We undertook a cross-sectional study of 58 mothers who underwent uncomplicated Caesarean delivery in a university hospital. Maternal gestational glucose concentration was determined after a 75-g OGTT (oral glucose tolerance test) at 24-28 weeks of gestation. Placenta tissue and cord blood were collected immediately after delivery. Genomic DNA was extracted and thereafter bisulfite conversion was performed. After PCR amplification, the DNA methylation of the PPARGC1A promoter was quantified using a pyrosequencing technique. The protein level of PGC-1α was evaluated by Western blotting. For all participants as a whole, including the GDM (gestational diabetes mellitus) and normoglycaemia groups, the maternal gestational glucose level was positively correlated with placental DNA methylation, and negatively correlated with cord blood DNA methylation of the PPARGC1A promoter in a CpG site-specific manner. In the GDM group alone, the placental CpG site-specific methylation of the PPARGC1A promoter strongly correlated with gestational 2-h post-OGTT glycaemia. Epigenetic alteration of the PPAGRC1A promoter may be one of the potential mechanisms underlying the metabolic programming in offspring exposed to intrauterine hyperglycaemia. PMID:25875376

  1. Precise assignment of the heavy-strand promoter of mouse mitochondrial DNA: cognate start sites are not required for transcriptional initiation.

    PubMed Central

    Chang, D D; Clayton, D A


    Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226

  2. DNA targeting polyaza macrobicyclic dizinc(II) complexes promoting high in vitro caspase dependent anti-proliferative activity against human carcinoma cancer cells.


    Anbu, Sellamuthu; Ravishankaran, Rajendran; Karande, Anjali A; Kandaswamy, Muthusamy


    A series of macrobicyclic dizinc(II) complexes [Zn(2)L(1-2)B](ClO(4))(4) (1-6) have been synthesized and characterized (L(1-2) are polyaza macrobicyclic binucleating ligands, and B is the N,N-donor heterocyclic base (viz. 2,2'-bipyridine (bipy) and 1,10-phenanthroline (phen)). The DNA and protein binding, DNA hydrolysis and anticancer activity of these complexes were investigated. The interactions of complexes 1-6 with calf thymus DNA were studied by spectroscopic techniques, including absorption, fluorescence and CD spectroscopy. The DNA binding constant values of the complexes were found to range from 2.80 × 10(5) to 5.25 × 10(5) M(-1), and the binding affinities are in the following order: 3 > 6 > 2 > 5 > 1 > 4. All the dizinc(II) complexes 1-6 are found to effectively promote the hydrolytic cleavage of plasmid pBR322 DNA under anaerobic and aerobic conditions. Kinetic data for DNA hydrolysis promoted by 3 and 6 under physiological conditions give observed rate constants (k(obs)) of 5.56 ± 0.1 and 5.12 ± 0.2 h(-1), respectively, showing a 10(7)-fold rate acceleration over the uncatalyzed reaction of dsDNA. Remarkably, the macrobicyclic dizinc(II) complexes 1-6 bind and cleave bovine serum albumin (BSA), and effectively promote the caspase-3 and caspase-9 dependent deaths of HeLa and BeWo cancer cells. The cytotoxicity of the complexes was further confirmed by lactate dehydrogenase enzyme levels in cancer cell lysate and content media. PMID:22992594

  3. Monitoring DNA triplex formation using multicolor fluorescence and application to insulin-like growth factor I promoter downregulation.


    Hégarat, Nadia; Novopashina, Darya; Fokina, Alesya A; Boutorine, Alexandre S; Venyaminova, Alya G; Praseuth, Danièle; François, Jean-Christophe


    Inhibition of insulin-like growth factor I (IGF-I) signaling is a promising antitumor strategy and nucleic acid-based approaches have been investigated to target genes in the pathway. Here, we sought to modulate IGF-I transcriptional activity using triple helix formation. The IGF-I P1 promoter contains a purine/pyrimidine (R/Y) sequence that is pivotal for transcription as determined by deletion analysis and can be targeted with a triplex-forming oligonucleotide (TFO). We designed modified purine- and pyrimidine-rich TFOs to bind to the R/Y sequence. To monitor TFO binding, we developed a fluorescence-based gel-retardation assay that allowed independent detection of each strand in three-stranded complexes using end-labeling with Alexa 488, cyanine (Cy)3 and Cy5 fluorochromes. We characterized TFOs for their ability to inhibit restriction enzyme activity, compete with DNA-binding proteins and inhibit IGF-I transcription in reporter assays. TFOs containing modified nucleobases, 5-methyl-2'-deoxycytidine and 5-propynyl-2'-deoxyuridine, specifically inhibited restriction enzyme cleavage and formed triplexes on the P1 promoter fragment. In cells, deletion of the R/Y-rich sequence led to 48% transcriptional inhibition of a reporter gene. Transfection with TFOs inhibited reporter gene activity to a similar extent, whereas transcription from a mutant construct with an interrupted R/Y region was unaffected, strongly suggesting the involvement of triplex formation in the inhibitory mechanisms. Our results indicate that nuclease-resistant TFOs will likely inhibit endogenous IGF-I gene function in cells. PMID:24423253

  4. Effects of parturition and dexamethasone on DNA methylation patterns of IFN-γ and IL-4 promoters in CD4+ T-lymphocytes of Holstein dairy cows

    PubMed Central

    Paibomesai, Marlene; Hussey, Brendan; Nino-Soto, Maria; Mallard, Bonnie A.


    This study investigated epigenetic mechanisms by which DNA methylation affects the function of bovine adaptive immune system cells, particularly during the peripartum period, when shifts in type 1 and type 2 immune response (IR) biases are thought to occur. Stimulation of CD4+ T-lymphocytes isolated from 5 Holstein dairy cows before and after parturition with concanavalin A (ConA) and stimulation of CD4+ T-lymphocytes isolated from 3 Holstein dairy cows in mid-lactation with ConA alone or ConA plus dexamethasone (Dex) had significant effects on production of the cytokines interferon gamma (IFN-γ, type 1) and interleukin 4 (IL-4, type 2) that were consistent with DNA methylation profiles of the IFN-γ gene promoter region but not consistent for the IL-4 promoter region. ConA stimulation increased the production of both cytokines before and after parturition. It decreased DNA methylation in the IFN-γ promoter region but increased for IL-4 promoter region. Parturition was associated with an increase in IFN-γ production in ConA-stimulated cells that approached significance. Overall, DNA methylation in both promoter regions increased between the prepartum and postpartum periods, although this did not correlate with secreted cytokine concentrations. Dexamethasone treated cells acted in a manner consistent with the glucocorticoid’s immunosuppressive activity, which mimicked the change at the IFN-γ promoter region observed during parturition. These results support pregnancy as type 2 IR biased, with increases of IFN-γ occurring after parturition and an increase in IL-4 production before calving. It is likely that these changes may be epigenetically controlled. PMID:23814356

  5. Low miR-145 silenced by DNA methylation promotes NSCLC cell proliferation, migration and invasion by targeting mucin 1

    PubMed Central

    Ye, Zhiqiang; Shen, Ning; Weng, Yimin; Li, Kai; Hu, Liu; Liao, Hongyin; An, Jun; Liu, Libao; Lao, Sen; Cai, Songwang


    MiR-145 has been implicated in the progression of non-small cell lung cancer (NSCLC); however, its exact mechanism is not well established. Here, we report that miR-145 expression is decreased in NSCLC cell lines and tumor tissues and that this low level of expression is associated with DNA methylation. MiR-145 methylation in NSCLC was correlated with a more aggressive tumor phenotype and was associated with poor survival time, as shown by Kaplan-Meier analysis. Additional multivariate Cox regression analysis indicated that miR-145 methylation was an independent prognostic factor for poor survival in patients with NSCLC. Furthermore, we found that restoration of miR-145 expression inhibited proliferation, migration and invasion of NSCLC by the direct targeting of mucin 1 by miR-145. Our results indicate that low miR-145 expression, due to methylation, promotes NSCLC cell proliferation, migration and invasion by targeting mucin 1. Therefore, miR-145 may be a valuable therapeutic target for NSCLC. PMID:25961369

  6. The presence of an RNA:DNA hybrid that is prone to slippage promotes termination by T7 RNA polymerase.


    Molodtsov, Vadim; Anikin, Michael; McAllister, William T


    Intrinsic termination signals for multisubunit bacterial RNA polymerases (RNAPs) encode a GC-rich stem-loop structure followed by a polyuridine [poly(U)] tract, and it has been proposed that steric clash of the stem-loop with the exit pore of the RNAP imposes a shearing force on the RNA in the downstream RNA:DNA hybrid, resulting in misalignment of the active site. The structurally unrelated T7 RNAP terminates at a similar type of signal (TΦ), suggesting a common mechanism for termination. In the absence of a hairpin (passive conditions), T7 RNAP slips efficiently in both homopolymeric A and U tracts, and we have found that replacement of the U tract in TΦ with a slippage-prone A tract still allows efficient termination. Under passive conditions, incorporation of a single G residue following a poly(U) tract (which is the situation during termination at TΦ) results in a "locked" complex that is unable to extend the transcript. Our results support a model in which transmission of the shearing force generated by steric clash of the hairpin with the exit pore is promoted by the presence of a slippery tracts downstream, resulting in alterations in the active site and the formation of a locked complex that represents an early step in the termination pathway. PMID:24976131

  7. S/MAR-containing DNA nanoparticles promote persistent RPE gene expression and improvement in RPE65-associated LCA

    PubMed Central

    Koirala, Adarsha; Makkia, Rasha S.; Conley, Shannon M.; Cooper, Mark J.; Naash, Muna I.


    Mutations in genes in the retinal pigment epithelium (RPE) cause or contribute to debilitating ocular diseases, including Leber's congenital amaurosis (LCA). Genetic therapies, particularly adeno-associated viruses (AAVs), are a popular choice for monogenic diseases; however, the limited payload capacity of AAVs combined with the large number of retinal disease genes exceeding that capacity make the development of alternative delivery methods critical. Here, we test the ability of compacted DNA nanoparticles (NPs) containing a plasmid with a scaffold matrix attachment region (S/MAR) and vitelliform macular dystrophy 2 (VMD2) promoter to target the RPE, drive long-term, tissue-specific gene expression and mediate proof-of-principle rescue in the rpe65−/− model of LCA. We show that the S/MAR-containing plasmid exhibited reporter gene expression levels several fold higher than plasmid or NPs without S/MARs. Importantly, this expression was highly persistent, lasting up to 2 years (last timepoint studied). We therefore selected this plasmid for testing in the rpe65−/− mouse model and observe that NP or plasmid VMD2-hRPE65-S/MAR led to structural and functional improvements in the LCA disease phenotype. These results indicate that the non-viral delivery of hRPE65 vectors can result in persistent, therapeutically efficacious gene expression in the RPE. PMID:23335596

  8. DNA damage induces GDNF secretion in the tumor microenvironment with paracrine effects promoting prostate cancer treatment resistance

    PubMed Central

    Huber, Roland M.; Lucas, Jared M.; Gomez-Sarosi, Luis A.; Coleman, Ilsa; Zhao, Song; Coleman, Roger; Nelson, Peter S.


    Though metastatic cancers often initially respond to genotoxic therapeutics, acquired resistance is common. In addition to cytotoxic effects on tumor cells, DNA damaging agents such as ionizing radiation and chemotherapy induce injury in benign cells of the tumor microenvironment resulting in the production of paracrine-acting factors capable of promoting tumor resistance phenotypes. In studies designed to characterize the responses of prostate and bone stromal cells to genotoxic stress, we found that transcripts encoding glial cell line-derived neurotrophic factor (GDNF) increased several fold following exposures to cytotoxic agents including radiation, the topoisomerase inhibitor mitoxantrone and the microtubule poison docetaxel. Fibroblast GDNF exerted paracrine effects toward prostate cancer cells resulting in enhanced tumor cell proliferation and invasion, and these effects were concordant with the expression of known GDNF receptors GFRA1 and RET. Exposure to GDNF also induced tumor cell resistance to mitoxantrone and docetaxel chemotherapy. Together, these findings support an important role for tumor microenvironment damage responses in modulating treatment resistance and identify the GDNF signaling pathway as a potential target for improving responses to conventional genotoxic therapeutics. PMID:25575823

  9. Size and positional effects of promoter RNA segments on virus-induced RNA-directed DNA methylation and transcriptional gene silencing

    PubMed Central

    Otagaki, Shungo; Kawai, Miou; Masuta, Chikara; Kanazawa, Akira


    DNA methylation at a gene promoter can be triggered by double-stranded RNAs (dsRNAs) through the RNA-directed DNA methylation (RdDM) pathway and induces transcriptional gene silencing (TGS). Although genes involved in the RdDM pathway have been identified, whether dsRNAs of different promoter regions have different extent of effects on RdDM and/or TGS is unknown. Here, we addressed this question by targeting the CaMV 35S promoter in the plant genome using a recombinant Cucumber mosaic virus that contained various portions of the promoter. The efficiency of the induction of TGS depended on the length of the promoter segment triggering the RdDM; the lower size limit for TGS induction was 81-91 nt. TGS was induced when 70-nt fragments were connected in tandem, none of which solely induced TGS. TGS induction did not simply depend on the production of small interfering RNAs corresponding to the promoter. Along with the induction of RdDM, spreading of DNA methylation from the originally targeted site toward the adjacent regions was detected. The maintenance of TGS in the progeny that lacks an RNA trigger depended on the promoter segments triggering the RdDM in the former generation and was correlated with the number of cytosines at symmetrical sites in the targeted region. These results indicate that both the length of dsRNA above the threshold and the frequency of cytosines at symmetric sites in the region targeted by dsRNA are the major factors that allow induction of heritable TGS via RdDM. PMID:21610318

  10. An RNA polymerase II transcription factor has an associated DNA-dependent ATPase (dATPase) activity strongly stimulated by the TATA region of promoters.

    PubMed Central

    Conaway, R C; Conaway, J W


    A transcription factor required for synthesis of accurately initiated run-off transcripts by RNA polymerase II has been purified and shown to have an associated DNA-dependent ATPase (dATPase) activity that is strongly stimulated by the TATA region of promoters. This transcription factor, designated delta, was purified more than 3000-fold from extracts of crude rat liver nuclei and has a native molecular mass of approximately 230 kDa. DNA-dependent ATPase (dATPase) and transcription activities copurify when delta is analyzed by hydrophobic interaction and ion-exchange HPLC, arguing that transcription factor delta possesses an ATPase (dATPase) activity. ATPase (dATPase) is specific for adenine nucleotides; ATP and dATP, but not CTP, UTP, or GTP, are hydrolyzed. ATPase (dATPase) is stimulated by both double-stranded and single-stranded DNAs, including pUC18, ssM13, and poly(dT); however, DNA fragments containing the TATA region of either the adenovirus 2 major late or mouse interleukin 3 promoters stimulate ATPase as much as 10-fold more effectively than DNA fragments containing nonpromoter sequences. These data suggest the intriguing possibility that delta plays a critical role in the ATP (dATP)-dependent activation of run-off transcription through a direct interaction with the TATA region of promoters. Images PMID:2552440

  11. 15-Lipoxygenase-1 suppression of colitis-associated colon cancer through inhibition of the IL-6/STAT3 signaling pathway.


    Mao, Fei; Xu, Min; Zuo, Xiangsheng; Yu, Jiang; Xu, Weiguo; Moussalli, Micheline J; Elias, Elias; Li, Haiyan S; Watowich, Stephanie S; Shureiqi, Imad


    The IL-6/signal transducer and activator of transcription 3 (STAT3) pathway is a critical signaling pathway for colitis-associated colorectal cancer (CAC). Peroxisome proliferator-activated receptor (PPAR)-δ, a lipid nuclear receptor, up-regulates IL-6. 15-Lipoxygenase-1 (15-LOX-1), which is crucial to production of lipid signaling mediators to terminate inflammation, down-regulates PPAR-δ. 15-LOX-1 effects on IL-6/STAT3 signaling and CAC tumorigenesis have not been determined. We report that intestinally targeted transgenic 15-LOX-1 expression in mice inhibited azoxymethane- and dextran sodium sulfate-induced CAC, IL-6 expression, STAT3 phosphorylation, and IL-6/STAT3 downstream target (Notch3 and MUC1) expression. 15-LOX-1 down-regulation was associated with IL-6 up-regulation in human colon cancer mucosa. Reexpression of 15-LOX-1 in human colon cancer cells suppressed IL-6 mRNA expression, STAT3 phosphorylation, IL-6 promoter activity, and PPAR-δ mRNA and protein expression. PPAR-δ overexpression in colonic epithelial cells promoted CAC tumorigenesis in mice and increased IL-6 expression and STAT3 phosphorylation, whereas concomitant 15-LOX-1 expression in colonic epithelial cells (15-LOX-1-PPAR-δ-Gut mice) suppressed these effects: the number of tumors per mouse (mean ± sem) was 4.22 ± 0.68 in wild-type littermates, 6.67 ± 0.83 in PPAR-δ-Gut mice (P = 0.026), and 2.25 ± 0.25 in 15-LOX-1-PPAR-δ-Gut mice (P = 0.0006). Identification of 15-LOX-1 suppression of PPAR-δ to inhibit IL-6/STAT3 signaling-driven CAC tumorigenesis provides mechanistic insights that can be used to molecularly target CAC. PMID:25713055

  12. Hypoxia-induced DNA hypermethylation in human pulmonary fibroblasts is associated with Thy-1 promoter methylation and the development of a pro-fibrotic phenotype

    PubMed Central


    Background Pulmonary fibrosis is a debilitating and lethal disease with no effective treatment options. Understanding the pathological processes at play will direct the application of novel therapeutic avenues. Hypoxia has been implicated in the pathogenesis of pulmonary fibrosis yet the precise mechanism by which it contributes to disease progression remains to be fully elucidated. It has been shown that chronic hypoxia can alter DNA methylation patterns in tumour-derived cell lines. This epigenetic alteration can induce changes in cellular phenotype with promoter methylation being associated with gene silencing. Of particular relevance to idiopathic pulmonary fibrosis (IPF) is the observation that Thy-1 promoter methylation is associated with a myofibroblast phenotype where loss of Thy-1 occurs alongside increased alpha smooth muscle actin (α-SMA) expression. The initial aim of this study was to determine whether hypoxia regulates DNA methylation in normal human lung fibroblasts (CCD19Lu). As it has been reported that hypoxia suppresses Thy-1 expression during lung development we also studied the effect of hypoxia on Thy-1 promoter methylation and gene expression. Methods CCD19Lu were grown for up to 8 days in hypoxia and assessed for global changes in DNA methylation using flow cytometry. Real-time PCR was used to quantify expression of Thy-1, α-SMA, collagen I and III. Genomic DNA was bisulphite treated and methylation specific PCR (MSPCR) was used to examine the methylation status of the Thy-1 promoter. Results Significant global hypermethylation was detected in hypoxic fibroblasts relative to normoxic controls and was accompanied by increased expression of myofibroblast markers. Thy-1 mRNA expression was suppressed in hypoxic cells, which was restored with the demethylating agent 5-aza-2′-deoxycytidine. MSPCR revealed that Thy-1 became methylated following fibroblast exposure to 1% O2. Conclusion These data suggest that global and gene-specific changes in

  13. 3-Methylcholanthrene elicits DNA adduct formation in the CYP1A1 promoter region and attenuates reporter gene expression in rat H4IIE cells

    SciTech Connect

    Moorthy, Bhagavatula . E-mail:; Muthiah, Kathirvel; Fazili, Inayat S.; Kondraganti, Sudha R.; Wang Lihua; Couroucli, Xanthi I.; Jiang Weiwu


    Cytochrome CYP1A (CYP1A) enzymes catalyze bioactivation of 3-methylcholanthrene (MC) to genotoxic metabolites. Here, we tested the hypothesis that CYP1A2 catalyzes formation of MC-DNA adducts that are preferentially formed in the promoter region of CYP1A1, resulting in modulation of CYP1A1 gene expression. MC bound covalently to plasmid DNA (50 {mu}g) containing human CYP1A1 promoter (pGL3-1A1), when incubated with wild-type (WT) liver microsomes (2 mg) and NAPPH 37 {sup o}C for 2 h, giving rise to 9 adducts, as determined by {sup 32}P-postlabeling. Eighty percent of adducts was located in the promoter region. Transient transfection of the adducted plasmids into rat hepatoma (H4IIE) cells for 16 h, followed by MC (1 {mu}M) treatment for 24 h inhibited reporter (luciferase) gene expression by 75%, compared to unadducted controls. Our results suggest that CYP1A2 plays a key role in sequence-specific MC-DNA adduct formation in the CYP1A1 promoter region, leading to attenuation of CYP1A1 gene expression.

  14. Effects of DNA strand breaks on transcription by RNA polymerase III: insights into the role of TFIIIB and the polarity of promoter opening.


    Kassavetis, George A; Grove, Anne; Geiduschek, E Peter


    Certain deletion mutants of the Brf1 and Bdp1 subunits of transcription factor (TF) IIIB retain the ability to recruit RNA polymerase (pol) III to its promoters, but fail to support promoter opening: deletions within an internal Bdp1 segment interfere with initiation of DNA strand separation, and an N-terminal Brf1 deletion blocks propagation of promoter opening past the transcriptional start site. The ability of DNA strand breaks to restore pol III transcription activity to these defective TFIIIB assemblies has been analyzed using U6 snRNA gene constructs. Breaks in a 21 bp segment spanning the transcriptional start rescue transcription in DNA strand-specific and subunit/mutation-specific patterns. A cluster of Bdp1 internal deletions also reverses the inactivation of transcription with wild-type TFIIIB generated by certain transcribed (template) strand breaks near the transcriptional start site. A structure-based model and topological considerations interpret these observations, explain how Bdp1 and Brf1 help to enforce the general upstream--> downstream polarity of promoter opening and specify requirements for polarity reversal. PMID:12374751

  15. Effects of DNA strand breaks on transcription by RNA polymerase III: insights into the role of TFIIIB and the polarity of promoter opening

    PubMed Central

    Kassavetis, George A.; Grove, Anne; Geiduschek, E.Peter


    Certain deletion mutants of the Brf1 and Bdp1 subunits of transcription factor (TF) IIIB retain the ability to recruit RNA polymerase (pol) III to its promoters, but fail to support promoter opening: deletions within an internal Bdp1 segment interfere with initiation of DNA strand separation, and an N-terminal Brf1 deletion blocks propagation of promoter opening past the transcriptional start site. The ability of DNA strand breaks to restore pol III transcription activity to these defective TFIIIB assemblies has been analyzed using U6 snRNA gene constructs. Breaks in a 21 bp segment spanning the transcriptional start rescue transcription in DNA strand-specific and subunit/mutation-specific patterns. A cluster of Bdp1 internal deletions also reverses the inactivation of transcription with wild-type TFIIIB generated by certain transcribed (template) strand breaks near the transcriptional start site. A structure-based model and topological considerations interpret these observations, explain how Bdp1 and Brf1 help to enforce the general upstream→ downstream polarity of promoter opening and specify requirements for polarity reversal. PMID:12374751

  16. DNA Cytosine Methylation in the Bovine Leukemia Virus Promoter Is Associated with Latency in a Lymphoma-derived B-cell Line

    PubMed Central

    Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine


    Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2′-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5′-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator TaxBLV decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267LTaxSN 5′-LTR compared with the L267 5′-LTR. Interestingly, DNA methylation inhibitors and TaxBLV synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the −154 or −129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at −129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5′-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency. PMID:20413592

  17. Antipsychotic drugs attenuate aberrant DNA methylation of DTNBP1 (dysbindin) promoter in saliva and post-mortem brain of patients with schizophrenia and Psychotic bipolar disorder.


    Abdolmaleky, Hamid M; Pajouhanfar, Sara; Faghankhani, Masoomeh; Joghataei, Mohammad Taghi; Mostafavi, Ashraf; Thiagalingam, Sam


    Due to the lack of genetic association between individual genes and schizophrenia (SCZ) pathogenesis, the current consensus is to consider both genetic and epigenetic alterations. Here, we report the examination of DNA methylation status of DTNBP1 promoter region, one of the most credible candidate genes affected in SCZ, assayed in saliva and post-mortem brain samples. The Illumina DNA methylation profiling and bisulfite sequencing of representative samples were used to identify methylation status of the DTNBP1 promoter region. Quantitative methylation specific PCR (qMSP) was employed to assess methylation of DTNBP1 promoter CpGs flanking a SP1 binding site in the saliva of SCZ patients, their first-degree relatives and control subjects (30, 15, and 30/group, respectively) as well as in post-mortem brains of patients with SCZ and bipolar disorder (BD) versus controls (35/group). qRT-PCR was used to assess DTNBP1 expression. We found DNA hypermethylation of DTNBP1 promoter in the saliva of SCZ patients (∼12.5%, P = 0.036), particularly in drug-naïve patients (∼20%, P = 0.011), and a trend toward hypermethylation in their first-degree relatives (P = 0.085) versus controls. Analysis of post-mortem brain samples revealed an inverse correlation between DTNBP1 methylation and expression, and normalization of this epigenetic change by classic antipsychotic drugs. Additionally, BD patients with psychotic depression exhibited higher degree of methylation versus other BD patients (∼80%, P = 0.025). DTNBP1 promoter DNA methylation may become a key element in a panel of biomarkers for diagnosis, prevention, or therapy in SCZ and at risk individuals pending confirmatory studies with larger sample sizes to attain a higher degree of significance. PMID:26285059

  18. Inter-individual variation in DNA repair capacity: a need for multi-pathway functional assays to promote translational DNA repair research.

    PubMed Central

    Nagel, Zachary D.; Chaim, Isaac. A.; Samson, Leona D.


    Why does a constant barrage of DNA damage lead to disease in some individuals, while others remain healthy? This article surveys current work addressing the implications of inter-individual variation in DNA repair capacity for human health, and discusses the status of DNA repair assays as potential clinical tools for personalized prevention or treatment of disease. In particular, we highlight research showing that there are significant inter-individual variations in DNA Repair Capacity (DRC), and that measuring these differences provides important biological insight regarding disease susceptibility and cancer treatment efficacy. We emphasize work showing that it is important to measure repair capacity in multiple pathways, and that functional assays are required to fill a gap left by genome wide association studies, global gene expression and proteomics. Finally, we discuss research that will be needed to overcome barriers that currently limit the use of DNA repair assays in the clinic. PMID:24780560

  19. Inter-individual variation in DNA repair capacity: a need for multi-pathway functional assays to promote translational DNA repair research.


    Nagel, Zachary D; Chaim, Isaac A; Samson, Leona D


    Why does a constant barrage of DNA damage lead to disease in some individuals, while others remain healthy? This article surveys current work addressing the implications of inter-individual variation in DNA repair capacity for human health, and discusses the status of DNA repair assays as potential clinical tools for personalized prevention or treatment of disease. In particular, we highlight research showing that there are significant inter-individual variations in DNA repair capacity (DRC), and that measuring these differences provides important biological insight regarding disease susceptibility and cancer treatment efficacy. We emphasize work showing that it is important to measure repair capacity in multiple pathways, and that functional assays are required to fill a gap left by genome wide association studies, global gene expression and proteomics. Finally, we discuss research that will be needed to overcome barriers that currently limit the use of DNA repair assays in the clinic. PMID:24780560

  20. Mycobacterium RbpA cooperates with the stress-response σB subunit of RNA polymerase in promoter DNA unwinding

    PubMed Central

    Hu, Yangbo; Morichaud, Zakia; Sudalaiyadum Perumal, Ayyappasamy; Roquet-Baneres, Françoise; Brodolin, Konstantin


    RbpA, a transcriptional activator that is essential for Mycobacterium tuberculosis replication and survival during antibiotic treatment, binds to RNA polymerase (RNAP) in the absence of promoter DNA. It has been hypothesized that RbpA stimulates housekeeping gene expression by promoting assembly of the σA subunit with core RNAP. Here, using a purified in vitro transcription system of M. tuberculosis, we show that RbpA functions in a promoter-dependent manner as a companion of RNAP essential for promoter DNA unwinding and formation of the catalytically active open promoter complex (RPo). Screening for RbpA activity using a full panel of the M. tuberculosis σ subunits demonstrated that RbpA targets σA and stress-response σB, but not the alternative σ subunits from the groups 3 and 4. In contrast to σA, the σB subunit activity displayed stringent dependency upon RbpA. These results suggest that RbpA-dependent control of RPo formation provides a mechanism for tuning gene expression during the switch between different physiological states, and in the stress response. PMID:25122744

  1. The Tyrosine Kinase c-Abl Promotes Homeodomain-interacting Protein Kinase 2 (HIPK2) Accumulation and Activation in Response to DNA Damage.


    Reuven, Nina; Adler, Julia; Porat, Ziv; Polonio-Vallon, Tilman; Hofmann, Thomas G; Shaul, Yosef


    The non-receptor tyrosine kinase c-Abl is activated in response to DNA damage and induces p73-dependent apoptosis. Here, we investigated c-Abl regulation of the homeodomain-interacting protein kinase 2 (HIPK2), an important regulator of p53-dependent apoptosis. c-Abl phosphorylated HIPK2 at several sites, and phosphorylation by c-Abl protected HIPK2 from degradation mediated by the ubiquitin E3 ligase Siah-1. c-Abl and HIPK2 synergized in activating p53 on apoptotic promoters in a reporter assay, and c-Abl was required for endogenous HIPK2 accumulation and phosphorylation of p53 at Ser(46) in response to DNA damage by γ- and UV radiation. Accumulation of HIPK2 in nuclear speckles and association with promyelocytic leukemia protein (PML) in response to DNA damage were also dependent on c-Abl activity. At high cell density, the Hippo pathway inhibits DNA damage-induced c-Abl activation. Under this condition, DNA damage-induced HIPK2 accumulation, phosphorylation of p53 at Ser(46), and apoptosis were attenuated. These data demonstrate a new mechanism for the induction of DNA damage-induced apoptosis by c-Abl and illustrate network interactions between serine/threonine and tyrosine kinases that dictate cell fate. PMID:25944899

  2. Promoter methylation status of tumor suppressor genes and inhibition of expression of DNA methyltransferase 1 in non-small cell lung cancer.


    Liu, Bangqing; Song, Jianfei; Luan, Jiaqiang; Sun, Xiaolin; Bai, Jian; Wang, Haiyong; Li, Angui; Zhang, Lifei; Feng, Xiaoyan; Du, Zhenzong


    DNA methylation is an epigenetic DNA modification catalyzed by DNA methyltransferase 1 (DNMT1). The purpose of this study was to investigate DNMT1 gene and protein expression and the effects of methylation status on tumor suppressor genes in human non-small cell lung cancer (NSCLC) cell lines grown in vitro and in vivo Human lung adenocarcinoma cell lines, A549 and H838, were grown in vitro and inoculated subcutaneously into nude mice to form tumors and were then treated with the DNA methylation inhibitor, 5-aza-2'-deoxycytidine, with and without treatment with the benzamide histone deacetylase inhibitor, entinostat (MS-275). DNMT1 protein expression was quantified by Western blot. Promoter methylation status of tumor suppressor genes (RASSF1A, ASC, APC, MGMT, CDH13, DAPK, ECAD, P16, and GATA4) was evaluated by methylation-specific polymerase chain reaction. Methylation status of the tumor suppressor genes was regulated by the DNMT1 gene, with the decrease of DNMT1 expression following DNA methylation treatment. Demethylation of tumor suppressor genes (APC, ASC, and RASSF1A) restored tumor growth in nude mice. The results of this study support a role for methylation of DNA as a potential epigenetic clinical biomarker of prognosis or response to therapy and for DNMT1 as a potential therapeutic target in NSCLC. PMID:27190263

  3. Rad18 is required for functional interactions between FANCD2, BRCA2, and Rad51 to repair DNA topoisomerase 1-poisons induced lesions and promote fork recovery

    PubMed Central

    Tripathi, Kaushlendra; Mani, Chinnadurai; Clark, David W; Palle, Komaraiah


    Camptothecin (CPT) and its analogues are chemotherapeutic agents that covalently and reversibly link DNA Topoisomerase I to its nicked DNA intermediate eliciting the formation of DNA double strand breaks (DSB) during replication. The repair of these DSB involves multiple DNA damage response and repair proteins. Here we demonstrate that CPT-induced DNA damage promotes functional interactions between BRCA2, FANCD2, Rad18, and Rad51 to repair the replication-associated DSB through homologous recombination (HR). Loss of any of these proteins leads to equal disruption of HR repair, causes chromosomal aberrations and sensitizes cells to CPT. Rad18 appears to function upstream in this repair pathway as its downregulation prevents activation of FANCD2, diminishes BRCA2 and Rad51 protein levels, formation of nuclear foci of all three proteins and recovery of stalled or collapsed replication forks in response to CPT. Taken together this work further elucidates the complex interplay of DNA repair proteins in the repair of replication-associated DSB. PMID:26871286

  4. The β2 clamp in the Mycobacterium tuberculosis DNA polymerase III αβ2ε replicase promotes polymerization and reduces exonuclease activity

    PubMed Central

    Gu, Shoujin; Li, Wenjuan; Zhang, Hongtai; Fleming, Joy; Yang, Weiqiang; Wang, Shihua; Wei, Wenjing; Zhou, Jie; Zhu, Guofeng; Deng, Jiaoyu; Hou, Jian; Zhou, Ying; Lin, Shiqiang; Zhang, Xian-En; Bi, Lijun


    DNA polymerase III (DNA pol III) is a multi-subunit replication machine responsible for the accurate and rapid replication of bacterial genomes, however, how it functions in Mycobacterium tuberculosis (Mtb) requires further investigation. We have reconstituted the leading-strand replication process of the Mtb DNA pol III holoenzyme in vitro, and investigated the physical and functional relationships between its key components. We verify the presence of an αβ2ε polymerase-clamp-exonuclease replicase complex by biochemical methods and protein-protein interaction assays in vitro and in vivo and confirm that, in addition to the polymerase activity of its α subunit, Mtb DNA pol III has two potential proofreading subunits; the α and ε subunits. During DNA replication, the presence of the β2 clamp strongly promotes the polymerization of the αβ2ε replicase and reduces its exonuclease activity. Our work provides a foundation for further research on the mechanism by which the replication machinery switches between replication and proofreading and provides an experimental platform for the selection of antimicrobials targeting DNA replication in Mtb. PMID:26822057

  5. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    PubMed Central


    Background Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Methods Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Results Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Conclusion Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment. PMID:24495356

  6. Sox17 promoter methylation in plasma DNA is associated with poor survival and can be used as a prognostic factor in breast cancer.


    Fu, Deyuan; Ren, Chuanli; Tan, Haosheng; Wei, Jinli; Zhu, Yuxiang; He, Chunlan; Shao, Wenxi; Zhang, Jiaxin


    Aberrant DNA methylation that leads to the inactivation of tumor suppressor genes is known to play an important role in the development and progression of breast cancer. Methylation status of cancer-related genes is considered to be a promising biomarker for the early diagnosis and prognosis of tumors. This study investigated the methylation status of the Sox17 gene in breast cancer tissue and its corresponding plasma DNA to evaluate the association of methylation levels with clinicopathological parameters and prognosis.The methylation status of the Sox17 gene promoter was evaluated with methylation-specific polymerase chain reaction (MSP) in 155 paired breast cancer tissue and plasma samples and in 60 paired normal breast tissue and plasma samples. Association of Sox17 methylation status with clinicopathological parameters was analyzed by χ tests. Overall and disease-free survival (DFS) curves were calculated using Kaplan-Meier analysis, and the differences between curves were analyzed by log-rank tests.The frequency of Sox17 gene methylation was 72.9% (113/155) in breast cancer tissues and 58.1% (90/155) in plasma DNA. Sox17 gene methylation was not found in normal breast tissues or in their paired plasma DNA. There was a significant correlation of Sox17 methylation between corresponding tumor tissues and paired plasma DNA (r = 0.688, P < 0.001). Aberrant Sox17 methylation in cancer tissues and in plasma DNA was significantly associated with the tumor node metastasis stage (P = 0.035 and P = 0.001, respectively) and with lymph node metastasis (P < 0.001 and P = 0.001, respectively). Kaplan-Meier survival curves showed that aberrant Sox17 promoter methylation in cancer tissues and plasma DNA was associated with poor DFS (P < 0.005) and overall survival (OS) (P < 0.005). Multivariate analysis showed that Sox17 methylation in plasma DNA was an independent prognostic factor in breast cancer for both DFS (P = 0.020; hazard ratio [HR] = 2.142; 95% confidence

  7. Negative superhelicity promotes ATP-dependent binding of yeast RAD3 protein to ultraviolet-damaged DNA.


    Sung, P; Watkins, J F; Prakash, L; Prakash, S


    The RAD3 gene of Saccharomyces cerevisiae is required for excision repair of UV-damaged DNA and is essential for cell viability. Remarkable homology exists between RAD3 and the human excision repair gene XPD, whose mutational inactivation underlies the cancer-prone disorder in xeroderma pigmentosum group D patients. Our previous work demonstrated that RAD3-encoded protein contains a DNA helicase activity. Here, we show that RAD3 binds preferentially to UV-damaged DNA over nondamaged DNA. Removal of pyrimidine dimers from damaged DNA by enzymatic photoreactivation does not affect binding, suggesting an affinity of RAD3 for pyrimidine (6-4) pyrimidone photoproducts. Damage-specific binding by RAD3 is strongly dependent on ATP and on the degree of negative superhelicity in DNA. The requirement of superhelicity in damage binding may target RAD3 to regions of DNA undergoing transcription, resulting in the preferential repair of these regions. The rad3 Arg-48 mutant protein, which lacks the DNA helicase activity, also binds UV-damaged DNA preferentially, indicating that DNA helicase and damage binding are two distinct and separable functional entities in RAD3. PMID:8132553

  8. DNA bending is induced by a transcription factor that interacts with the human c-FOS and alpha-actin promoters.

    PubMed Central

    Gustafson, T A; Taylor, A; Kedes, L


    Conserved sequence elements in the human cardiac and skeletal alpha-actin promoters that contain the CC(A + T-rich)6GG motif have been shown to regulate transcription of these genes. A similar sequence is found in the serum response element of the human c-FOS gene. In this study, we demonstrate that indistinguishable proteins bind to each of five CC(A + T-rich)6GG elements examined in the human cardiac and skeletal alpha-actin promoters and the c-FOS serum response element. Using electrophoretic techniques, we show that these factors induce a stable bend in the DNA upon binding, and the bend center is shown to coincide with the CC(A + T-rich)6GG element. In addition, the ability to bend DNA is retained by a small proteolytic fragment of the protein, suggesting that the DNA-binding domain of the protein is resistant to proteases and is sufficient to bend DNA. Images PMID:2494661

  9. Heterogeneous nuclear ribonucleoprotein K and nucleolin as transcriptional activators of the vascular endothelial growth factor promoter through interaction with secondary DNA structures

    PubMed Central

    Uribe, Diana J.; Guo, Kexiao; Shin, Yoon-Joo; Sun, Daekyu


    The human vascular endothelial growth factor (VEGF) promoter contains a polypurine/polypyrimidine (pPu/pPy) tract that is known to play a critical role in its transcriptional regulation. This pPu/pPy tract undergoes a conformational transition between B-DNA, single stranded DNA and atypical secondary DNA structures such as G-quadruplexes and i-motifs. We studied the interaction of the cytosine-rich (C-rich) and guanine-rich (G-rich) strands of this tract with transcription factors heterogeneous nuclear ribonucleoprotein (hnRNP) K and nucleolin, respectively, both in vitro and in vivo and their potential role in the transcriptional control of VEGF. Using chromatin immunoprecipitation (ChIP) assay for our in vivo studies and electrophoretic mobility shift assay (EMSA) for our in vitro studies, we demonstrated that both nucleolin and hnRNP K bind selectively to the G- and C-rich sequences, respectively, in the pPu/pPy tract of the VEGF promoter. The small interfering RNA (siRNA)-mediated silencing of either nucleolin or hnRNP K resulted in the down-regulation of basal VEGF gene, suggesting that they act as activators of VEGF transcription. Taken together, the identification of transcription factors that can recognize and bind to atypical DNA structures within the pPu/pPy tract will provide new insight into mechanisms of transcriptional regulation of the VEGF gene. PMID:21466159

  10. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

    PubMed Central

    Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela


    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  11. An oxidative DNA "damage" and repair mechanism localized in the VEGF promoter is important for hypoxia-induced VEGF mRNA expression.


    Pastukh, Viktor; Roberts, Justin T; Clark, David W; Bardwell, Gina C; Patel, Mita; Al-Mehdi, Abu-Bakr; Borchert, Glen M; Gillespie, Mark N


    In hypoxia, mitochondria-generated reactive oxygen species not only stimulate accumulation of the transcriptional regulator of hypoxic gene expression, hypoxia inducible factor-1 (Hif-1), but also cause oxidative base modifications in hypoxic response elements (HREs) of hypoxia-inducible genes. When the hypoxia-induced base modifications are suppressed, Hif-1 fails to associate with the HRE of the VEGF promoter, and VEGF mRNA accumulation is blunted. The mechanism linking base modifications to transcription is unknown. Here we determined whether recruitment of base excision DNA repair (BER) enzymes in response to hypoxia-induced promoter modifications was required for transcription complex assembly and VEGF mRNA expression. Using chromatin immunoprecipitation analyses in pulmonary artery endothelial cells, we found that hypoxia-mediated formation of the base oxidation product 8-oxoguanine (8-oxoG) in VEGF HREs was temporally associated with binding of Hif-1α and the BER enzymes 8-oxoguanine glycosylase 1 (Ogg1) and redox effector factor-1 (Ref-1)/apurinic/apyrimidinic endonuclease 1 (Ape1) and introduction of DNA strand breaks. Hif-1α colocalized with HRE sequences harboring Ref-1/Ape1, but not Ogg1. Inhibition of BER by small interfering RNA-mediated reduction in Ogg1 augmented hypoxia-induced 8-oxoG accumulation and attenuated Hif-1α and Ref-1/Ape1 binding to VEGF HRE sequences and blunted VEGF mRNA expression. Chromatin immunoprecipitation-sequence analysis of 8-oxoG distribution in hypoxic pulmonary artery endothelial cells showed that most of the oxidized base was localized to promoters with virtually no overlap between normoxic and hypoxic data sets. Transcription of genes whose promoters lost 8-oxoG during hypoxia was reduced, while those gaining 8-oxoG was elevated. Collectively, these findings suggest that the BER pathway links hypoxia-induced introduction of oxidative DNA modifications in promoters of hypoxia-inducible genes to transcriptional

  12. Inhibitors of Histone Deacetylase and DNA Methyltransferase Synergistically Activate the Methylated Metallothionein I Promoter by Activating the Transcription Factor MTF-1 and Forming an Open Chromatin Structure

    PubMed Central

    Ghoshal, Kalpana; Datta, Jharna; Majumder, Sarmila; Bai, Shoumei; Dong, Xiaocheng; Parthun, Mark; Jacob, Samson T.


    Inhibitors of DNA methyltransferase (Dnmt) and histone deacetylases (HDAC) synergistically activate the methylated metallothionein I gene (MT-I) promoter in mouse lymphosarcoma cells. The cooperative effect of these two classes of inhibitors on MT-I promoter activity was robust following demethylation of only a few CpG dinucleotides by brief exposure to 5-azacytidine (5-AzaC) but persisted even after prolonged treatment with the nucleoside analog. HDAC inhibitors (trichostatin A [TSA] and depsipeptide) either alone or in combination with 5-AzaC did not facilitate demethylation of the MT-I promoter. Treatment of cells with HDAC inhibitors increased accumulation of multiply acetylated forms of H3 and H4 histones that remained unaffected after treatment with 5-AzaC. Chromatin immunoprecipitation (ChIP) assay showed increased association of acetylated histone H4 and lysine 9 (K9)-acetyl H3 with the MT-I promoter after treatment with TSA, which was not affected following treatment with 5-AzaC. In contrast, the association of K9-methyl histone H3 with the MT-I promoter decreased significantly after treatment with 5-AzaC and TSA. ChIP assay with antibodies specific for methyl-CpG binding proteins (MBDs) demonstrated that only methyl-CpG binding protein 2 (MeCP2) was associated with the MT-I promoter, which was significantly enhanced after TSA treatment. Association of histone deacetylase 1 (HDAC1) with the promoter decreased after treatment with TSA or 5-AzaC and was abolished after treatment with both inhibitors. Among the DNA methyltransferases, both Dnmt1 and Dnmt3a were associated with the MT-I promoter in the lymphosarcoma cells, and association of Dnmt1 decreased with time after treatment with 5-AzaC. Treatment of these cells with HDAC inhibitors also increased expression of the MTF-1 (metal transcription factor-1) gene as well as its DNA binding activity. In vivo genomic footprinting studies demonstrated increased occupancy of MTF-1 to metal response elements of

  13. Differential Roles of Cell Death-inducing DNA Fragmentation Factor-α-like Effector (CIDE) Proteins in Promoting Lipid Droplet Fusion and Growth in Subpopulations of Hepatocytes.


    Xu, Wenyi; Wu, Lizhen; Yu, Miao; Chen, Feng-Jung; Arshad, Muhammad; Xia, Xiayu; Ren, Hao; Yu, Jinhai; Xu, Li; Xu, Dijin; Li, John Zhong; Li, Peng; Zhou, Linkang


    Lipid droplets (LDs) are dynamic subcellular organelles whose growth is closely linked to obesity and hepatic steatosis. Cell death-inducing DNA fragmentation factor-α-like effector (CIDE) proteins, including Cidea, Cideb, and Cidec (also called Fsp27), play important roles in lipid metabolism. Cidea and Cidec are LD-associated proteins that promote atypical LD fusion in adipocytes. Here, we find that CIDE proteins are all localized to LD-LD contact sites (LDCSs) and promote lipid transfer, LD fusion, and growth in hepatocytes. We have identified two types of hepatocytes, one with small LDs (small LD-containing hepatocytes, SLHs) and one with large LDs (large LD-containing hepatocytes, LLHs) in the liver. Cideb is localized to LDCSs and promotes lipid exchange and LD fusion in both SLHs and LLHs, whereas Cidea and Cidec are specifically localized to the LDCSs and promote lipid exchange and LD fusion in LLHs. Cideb-deficient SLHs have reduced LD sizes and lower lipid exchange activities. Fasting dramatically induces the expression of Cidea/Cidec and increases the percentage of LLHs in the liver. The majority of the hepatocytes from the liver of obese mice are Cidea/Cidec-positive LLHs. Knocking down Cidea or Cidec significantly reduced lipid storage in the livers of obese animals. Our data reveal that CIDE proteins play differential roles in promoting LD fusion and lipid storage; Cideb promotes lipid storage under normal diet conditions, whereas Cidea and Cidec are responsible for liver steatosis under fasting and obese conditions. PMID:26733203

  14. Anatomic localization of O6-methylguanine DNA methyltransferase (MGMT) promoter methylated and unmethylated tumors: a radiographic study in 358 de novo human glioblastomas.


    Ellingson, Benjamin M; Cloughesy, Timothy F; Pope, Whitney B; Zaw, Taryar M; Phillips, Heidi; Lalezari, Shadi; Nghiemphu, Phioanh L; Ibrahim, Hassana; Naeini, Kourosh M; Harris, Robert J; Lai, Albert


    Promoter methylation of O6-methylguanine DNA methyltransferase (MGMT) is associated with a favorable prognosis in glioblastoma multiforme (GBM) and has been hypothesized to occur early in tumor transformation of glial cells. Thus, a possible link exists between the site of malignant transformation and MGMT promoter methylation status. Using the Analysis of Differential Involvement (ADIFFI) statistical mapping technique in a total of 358 patients with GBM, we demonstrate that human de novo GBMs occur in a high frequency contiguous with the posterior subventricular zone (SVZ); MGMT promoter methylated GBMs are lateralized to the left hemisphere, while MGMT unmethylated GBMs are lateralized to the right hemisphere; and tumors near the left temporal lobe have a significantly longer overall survival compared with tumors occurring elsewhere, independent of treatment or MGMT methylation status. PMID:22001163

  15. The Nuclear DNA Sensor IFI16 Acts as a Restriction Factor for Human Papillomavirus Replication through Epigenetic Modifications of the Viral Promoters

    PubMed Central

    Lo Cigno, Irene; De Andrea, Marco; Borgogna, Cinzia; Albertini, Silvia; Landini, Manuela M.; Peretti, Alberto; Johnson, Karen E.; Chandran, Bala; Landolfo, Santo


    ABSTRACT The human interferon-inducible IFI16 protein, an innate immune sensor of intracellular DNA, was recently demonstrated to act as a restriction factor for human cytomegalovirus (HCMV) and herpes simplex virus 1 (HSV-1) infection by inhibiting both viral-DNA replication and transcription. Through the use of two distinct cellular models, this study provides strong evidence in support of the notion that IFI16 can also restrict human papillomavirus 18 (HPV18) replication. In the first model, an immortalized keratinocyte cell line (NIKS) was used, in which the IFI16 protein was knocked down through the use of small interfering RNA (siRNA) technology and overexpressed following transduction with the adenovirus IFI16 (AdVIFI16) vector. The second model consisted of U2OS cells transfected by electroporation with HPV18 minicircles. In differentiated IFI16-silenced NIKS-HPV18 cells, viral-load values were significantly increased compared with differentiated control cells. Consistent with this, IFI16 overexpression severely impaired HPV18 replication in both NIKS and U2OS cells, thus confirming its antiviral restriction activity. In addition to the inhibition of viral replication, IFI16 was also able to reduce viral transcription, as demonstrated by viral-gene expression analysis in U2OS cells carrying episomal HPV18 minicircles and HeLa cells. We also provide evidence that IFI16 promotes the addition of heterochromatin marks and the reduction of euchromatin marks on viral chromatin at both early and late promoters, thus reducing both viral replication and transcription. Altogether, these results argue that IFI16 restricts chromatinized HPV DNA through epigenetic modifications and plays a broad surveillance role against viral DNA in the nucleus that is not restricted to herpesviruses. IMPORTANCE Intrinsic immunity is mediated by cellular restriction factors that are constitutively expressed and active even before a pathogen enters the cell. The host nuclear factor IFI

  16. Escherichia coli Fis and DnaA proteins bind specifically to the nrd promoter region and affect expression of an nrd-lac fusion.

    PubMed Central

    Augustin, L B; Jacobson, B A; Fuchs, J A


    The Escherichia coli nrd operon contains the genes encoding the two subunits of ribonucleoside diphosphate reductase. The regulation of the nrd operon has been observed to be very complex. The specific binding of two proteins to the nrd regulatory region and expression of mutant nrd-lac fusions that do not bind these proteins are described. A partially purified protein from an E. coli cell extract was previously shown to bind to the promoter region and to regulate transcription of the nrd operon (C. K. Tuggle and J. A. Fuchs, J. Bacteriol. 172:1711-1718, 1990). We have purified this protein to homogeneity by affinity chromatography and identified it as the E. coli factor for inversion stimulation (Fis). Cu-phenanthroline footprinting experiments showed that Fis binds to a site centered 156 bp upstream of the start of nrd transcription. Mutants with deletion and site-directed mutations that do not bind Fis at this site have two- to threefold-lower expression of an nrd-lac fusion. The previously reported negative regulatory nature of this site (C. K. Tuggle and J. A. Fuchs, J. Bacteriol. 172:1711-1718, 1990) was found to be due to a change in polarity in the vectors used to construct promoter fusions. Two nine-base sequences with homology to the DnaA consensus binding sequence are located immediately upstream of the nrd putative -35 RNA polymerase binding site. Binding of DnaA to these sequences on DNA fragments containing the nrd promoter region was confirmed by in vitro Cu-phenanthroline footprinting. Footprinting experiments on fragments with each as well as both of the mutated 9-mers suggests cooperativity between the two sites in binding DnaA. Assay of in vivo expression from wild-type and DnaA box-mutated nrd promoter fragments fused to lacZ on single-copy plasmids indicates a positive effect of DnaA binding on expression of nrd. Images PMID:8288532

  17. Identification of the Ω4406 Regulatory Region, a Developmental Promoter of Myxococcus xanthus, and a DNA Segment Responsible for Chromosomal Position-Dependent Inhibition of Gene Expression

    PubMed Central

    Loconto, Jennifer; Viswanathan, Poorna; Nowak, Scott J.; Gloudemans, Monica; Kroos, Lee


    When starved, Myxococcus xanthus cells send signals to each other that coordinate their movements, gene expression, and differentiation. C-signaling requires cell-cell contact, and increasing contact brought about by cell alignment in aggregates is thought to increase C-signaling, which induces expression of many genes, causing rod-shaped cells to differentiate into spherical spores. C-signaling involves the product of the csgA gene. A csgA mutant fails to express many genes that are normally induced after about 6 h into the developmental process. One such gene was identified by insertion of Tn5 lac at site Ω4406 in the M. xanthus chromosome. Tn5 lac fused transcription of lacZ to the upstream Ω4406 promoter. In this study, the Ω4406 promoter region was identified by analyzing mRNA and by testing different upstream DNA segments for the ability to drive developmental lacZ expression in M. xanthus. The 5′ end of Ω4406 mRNA mapped to approximately 1.3 kb upstream of the Tn5 lac insertion. A 1.0-kb DNA segment from 0.8 to 1.8 kb upstream of the Tn5 lac insertion, when fused to lacZ and integrated at a phage attachment site in the M. xanthus chromosome, showed a similar pattern of developmental expression as Tn5 lac Ω4406. The DNA sequence upstream of the putative transcriptional start site was strikingly similar to promoter regions of other C-signal-dependent genes. Developmental lacZ expression from the 1.0-kb segment was abolished in a csgA mutant but was restored upon codevelopment of the csgA mutant with wild-type cells, which supply C-signal, demonstrating that the Ω4406 promoter responds to extracellular C-signaling. Interestingly, the 0.8-kb DNA segment immediately upstream of Tn5 lac Ω4406 inhibited expression of a downstream lacZ reporter in transcriptional fusions integrated at a phage attachment site in the chromosome but not at the normal Ω4406 location. To our knowledge, this is the first example in M. xanthus of a chromosomal position

  18. Opposing role of condensin hinge against replication protein A in mitosis and interphase through promoting DNA annealing

    PubMed Central

    Akai, Yuko; Kurokawa, Yumiko; Nakazawa, Norihiko; Tonami-Murakami, Yuko; Suzuki, Yuki; Yoshimura, Shige H.; Iwasaki, Hiroshi; Shiroiwa, Yoshiharu; Nakamura, Takahiro; Shibata, Eri; Yanagida, Mitsuhiro


    Condensin is required for chromosome dynamics and diverse DNA metabolism. How condensin works, however, is not well understood. Condensin contains two structural maintenance of chromosomes (SMC) subunits with the terminal globular domains connected to coiled-coil that is interrupted by the central hinge. Heterotrimeric non-SMC subunits regulate SMC. We identified a novel fission yeast SMC hinge mutant, cut14-Y1, which displayed defects in DNA damage repair and chromosome segregation. It contains an amino acid substitution at a conserved hinge residue of Cut14/SMC2, resulting in diminished DNA binding and annealing. A replication protein A mutant, ssb1-418, greatly alleviated the repair and mitotic defects of cut14-Y1. Ssb1 protein formed nucleolar foci in cut14-Y1 cells, but the number of foci was diminished in cut14-Y1 ssb1-418 double mutants. Consistent with the above results, Ssb1 protein bound to single-strand DNA was removed by condensin or the SMC dimer through DNA reannealing in vitro. Similarly, RNA hybridized to DNA may be removed by the SMC dimer. Thus, condensin may wind up DNA strands to unload chromosomal components after DNA repair and prior to mitosis. We show that 16 suppressor mutations of cut14-Y1 were all mapped within the hinge domain, which surrounded the original L543 mutation site. PMID:22645654

  19. Forkhead transcription factor FoxF1 interacts with Fanconi anemia protein complexes to promote DNA damage response

    PubMed Central

    Pradhan, Arun; Ustiyan, Vladimir; Zhang, Yufang; Kalin, Tanya V.; Kalinichenko, Vladimir V.


    Forkhead box F1 (Foxf1) transcription factor is an important regulator of embryonic development but its role in tumor cells remains incompletely understood. While 16 proteins were characterized in Fanconi anemia (FA) core complex, its interactions with cellular transcriptional machinery remain poorly characterized. Here, we identified FoxF1 protein as a novel interacting partner of the FA complex proteins. Using multiple human and mouse tumor cell lines and Foxf1+/− mice we demonstrated that FoxF1 physically binds to and increases stability of FA proteins. FoxF1 co-localizes with FANCD2 in DNA repair foci in cultured cells and tumor tissues obtained from cisplatin-treated mice. In response to DNA damage, FoxF1-deficient tumor cells showed significantly reduced FANCD2 monoubiquitination and FANCM phosphorylation, resulting in impaired formation of DNA repair foci. FoxF1 knockdown caused chromosomal instability, nuclear abnormalities, and increased tumor cell death in response to DNA-damaging agents. Overexpression of FoxF1 in DNA-damaged cells improved stability of FA proteins, decreased chromosomal and nuclear aberrations, restored formation of DNA repair foci and prevented cell death after DNA damage. These findings demonstrate that FoxF1 is a key component of FA complexes and a critical mediator of DNA damage response in tumor cells. PMID:26625197

  20. Interaction of the Neisseria gonorrhoeae PilA protein with the pilE promoter involves multiple sites on the DNA.


    Arvidson, C G; So, M


    PilA is the putative DNA-binding component of a two-component system that regulates transcription of the pilin expression locus (pilE) of Neisseria gonorrhoeae. Here we report the purification of the PilA protein and characterization of its DNA-binding activity. PilA was overproduced in Escherichia coli with an isopropyl-beta-D-thiogalactopyranoside (IPTG)-inducible expression vector. Cell extracts were prepared by sonication and fractionated by anion-exchange chromotography, followed by dye affinity chromatography with Cibacron Blue. Proteins were eluted by using a gradient of KCl, and PilA-containing fractions were identified by immunoblot analysis with a polyclonal anti-PilA antiserum. Purified PilA was judged to be > 90% pure, as determined by Coomassie blue staining and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. PilA purified in this manner was used to develop a gel retardation assay with a 301-bp fragment containing the pilE promoter (PpilE) and upstream sequences as a probe. A fragment of similar size containing the E. coli aroH promoter was used as a negative control. Competition experiments using a 100- to 1,000-fold excess of unlabelled DNA fragments confirmed the specificity of PilA binding to the pilE promoter. To localize the PilA binding site within the 301-bp PpilE fragment, stepwise deletions were generated by PCR and the fragments were examined in the gel shift assay. The results of these experiments show that there are two regions upstream of PpilE that are required for binding by PilA. Taken together, these data indicate that while PilA binds specifically to the upstream region of the pilE gene, this interaction is complex and likely involves multiple regions of this DNA sequence. PMID:7730283

  1. Interaction of the Neisseria gonorrhoeae PilA protein with the pilE promoter involves multiple sites on the DNA.

    PubMed Central

    Arvidson, C G; So, M


    PilA is the putative DNA-binding component of a two-component system that regulates transcription of the pilin expression locus (pilE) of Neisseria gonorrhoeae. Here we report the purification of the PilA protein and characterization of its DNA-binding activity. PilA was overproduced in Escherichia coli with an isopropyl-beta-D-thiogalactopyranoside (IPTG)-inducible expression vector. Cell extracts were prepared by sonication and fractionated by anion-exchange chromotography, followed by dye affinity chromatography with Cibacron Blue. Proteins were eluted by using a gradient of KCl, and PilA-containing fractions were identified by immunoblot analysis with a polyclonal anti-PilA antiserum. Purified PilA was judged to be > 90% pure, as determined by Coomassie blue staining and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. PilA purified in this manner was used to develop a gel retardation assay with a 301-bp fragment containing the pilE promoter (PpilE) and upstream sequences as a probe. A fragment of similar size containing the E. coli aroH promoter was used as a negative control. Competition experiments using a 100- to 1,000-fold excess of unlabelled DNA fragments confirmed the specificity of PilA binding to the pilE promoter. To localize the PilA binding site within the 301-bp PpilE fragment, stepwise deletions were generated by PCR and the fragments were examined in the gel shift assay. The results of these experiments show that there are two regions upstream of PpilE that are required for binding by PilA. Taken together, these data indicate that while PilA binds specifically to the upstream region of the pilE gene, this interaction is complex and likely involves multiple regions of this DNA sequence. PMID:7730283

  2. TLR9 promotes tolerance by restricting survival of anergic anti-DNA B cells, yet is also required for their activation.


    Nickerson, Kevin M; Christensen, Sean R; Cullen, Jaime L; Meng, Wenzhao; Luning Prak, Eline T; Shlomchik, Mark J


    Nucleic acid-reactive B cells frequently arise in the bone marrow but are tolerized by mechanisms including receptor editing, functional anergy, and/or deletion. TLR9, a sensor of endosomal dsDNA, both promotes and regulates systemic autoimmunity in vivo, but the precise nature of its apparently contradictory roles in autoimmunity remained unclear. In this study, using the 3H9 anti-DNA BCR transgene in the autoimmune-prone MRL.Fas(lpr) mouse model of systemic lupus erythematosus, we identify the stages at which TLR9 contributes to establishing and breaking B cell tolerance. Although TLR9 is dispensable for L chain editing during B cell development in the bone marrow, TLR9 limits anti-DNA B cell life span in the periphery and is thus tolerogenic. In the absence of TLR9, anti-DNA B cells have much longer life spans and accumulate in the follicle, neither activated nor deleted. These cells retain some characteristics of anergic cells, in that they have elevated basal BCR signaling but impaired induced responses and downregulate their cell-surface BCR expression. In contrast, whereas TLR9-intact anergic B cells accumulate near the T/B border, TLR9-deficient anti-DNA B cells are somewhat more dispersed throughout the follicle. Nonetheless, in older autoimmune-prone animals, TLR9 expression specifically within the B cell compartment is required for spontaneous peripheral activation of anti-DNA B cells and their differentiation into Ab-forming cells via an extrafollicular pathway. Thus, TLR9 has paradoxical roles in regulating anti-DNA B cells: it helps purge the peripheral repertoire of autoreactive cells, yet is also required for their activation. PMID:23296704

  3. FimY of Salmonella enterica serovar Typhimurium functions as a DNA-binding protein and binds the fimZ promoter.


    Wang, Ke-Chuan; Hsu, Yuan-Hsun; Huang, Yi-Ning; Lin, Jiunn-Horng; Yeh, Kuang-Sheng


    Salmonella enterica serovar Typhimurium produces type 1 fimbriae with binding specificity to mannose residues. Elements involved in fimbrial structural biosynthesis, transport, and regulation are encoded by the fim gene cluster. FimZ, FimY, FimW, STM0551, and an arginine transfer RNA (fimU) were previously demonstrated to regulate fimbrial expression. The amino acid sequences of the C-terminal portion of FimY revealed similarity with those of LuxR-like proteins. Electrophoretic mobility shift assays indicated that FimY possessed DNA-binding capacity and bound a 605-bp DNA fragment spanning the intergenic region between fimY and fimZ, while a FimY protein harboring a double mutation in the C-terminal helix-turn-helix region containing a glycine (G) to aspartate (D) substitution at residue 189 and isoleucine (I) to lysine (K) substitution at residue 195 lost its ability to bind this DNA fragment. A lux box sequence (5'-TCTGTTATTACATAACAAATACT-3') within the fimZ promoter was required for binding. None of the DNA fragments derived from the promoters for fimA, fimY, or fimW was shifted by FimY. Pull-down assays showed that there were physical protein/protein interactions between FimY and FimZ. We propose that in the regulatory circuit of type 1 fimbriae, FimY functions as a DNA-binding protein to activate fimZ, and a FimY-FimZ protein complex may form to regulate other fim genes. Confirming these proposals requires further study. PMID:24462182

  4. Induction of bovine papillomavirus E2 gene expression and early region transcription by cell growth arrest: correlation with viral DNA amplification and evidence for differential promoter induction.

    PubMed Central

    Burnett, S; Ström, A C; Jareborg, N; Alderborn, A; Dillner, J; Moreno-Lopez, J; Pettersson, U; Kiessling, U


    The bovine papillomavirus type 1 (BPV-1) genome replicates as a latent plasmid in mouse C127 cells transformed in vitro by the virus. However, we have recently shown that BPV-1 DNA amplification can be induced in a subpopulation of cells under culture conditions which suppress cell proliferation, a finding which led us to hypothesize that expression of a viral replication factor was regulated by cell growth stage. In this report, we describe the detection in these cells of abundant BPV-1 nuclear E2 antigen by immunofluorescence analysis. Expression of E2 antigen in fibropapilloma tissue was similarly localized to nonproliferating epidermal cells of the lower spinous layers--the natural site of induction of vegetative viral DNA replication. Immunoprecipitation analysis showed that the previously characterized 48-kilodalton (transactivator) and 31-kilodalton (repressor) E2 proteins were both induced in growth-arrested cell cultures. In parallel with E2 antigen synthesis under conditions of serum-deprivation in vitro, we observed a significant increase in levels of BPV-1 early region mRNAs. Furthermore, we present evidence for preferential induction of the P2443 promoter, in addition to specific induction of the P7940 promoter in response to serum deprivation. These observations indicate a central role for E2 transcription factors in the induction of viral DNA amplification in division-arrested cells in vitro and in vivo and suggest that this process is associated with a qualitative switch in the expression of viral early region genes. Images PMID:2170685

  5. DNA methylation in the NCAPH2/LMF2 promoter region is associated with hippocampal atrophy in Alzheimer's disease and amnesic mild cognitive impairment patients.


    Shinagawa, Shunichiro; Kobayashi, Nobuyuki; Nagata, Tomoyuki; Kusaka, Akira; Yamada, Hisashi; Kondo, Kazuhiro; Nakayama, Kazuhiko


    Several studies have noted an effect of DNA methylation on the pathogenesis of Alzheimer's disease (AD). We have already reported that DNA methylation levels in the NCAPH2/LMF2 promoter region can be a useful biomarker for the diagnosis of AD and amnesic mild cognitive impairment (aMCI). However, there is still uncertainty about the mechanism by which NCAPH2/LMF2 methylation affects the pathogenesis of AD and aMCI. In this study, we investigated relationships between NCAPH2/LMF2 methylation and other factors. AD (n=30) and aMCI (n=28) subjects were included in this study. NCAPH2/LMF2 methylation levels were measured by pyrosequencing. Correlations between methylation levels and other factors including age at onset, sex, duration of disease, education, mini-mental state examination (MMSE) and frontal assessment battery (FAB) scores, APOE genotype, degree of hippocampal atrophy, and total brain atrophy were measured. Degrees of hippocampal atrophy and total brain atrophy were measured by VSRAD (Voxel-Based Specific Regional Analysis System for Alzheimer's Disease). Regression analysis revealed that only hippocampal atrophy according to VSRAD is a significant dependent variable correlated with NCAPH2/LMF2 methylation levels. Our results suggest that DNA methylation in the NCAPH2/LMF2 promoter region is associated with hippocampal atrophy through apoptosis. PMID:27356276

  6. Promoter-restricted histone code, not the differentially methylated DNA regions or antisense transcripts, marks the imprinting status of IGF2R in human and mouse.


    Vu, Thanh H; Li, Tao; Hoffman, Andrew R


    Imprinting of the mouse Igf2r depends upon an intronic differentially methylated DNA region (DMR) and the presence of the Air antisense transcript. However, biallelic expression of mouse Igf2r in brain occurs despite the presence of Air, and biallelic expression of human IGF2R in peripheral tissues occurs despite the presence of an intronic DMR. We examined histone modifications throughout the mouse and human Igf2r/IGF2R using chromatin immuno-precipitation (ChIP) assays in combination with quantitative real time PCR. Methylation of Lys4 and Lys9 of histone H3 in the promoter regions marks the active and silenced alleles, respectively. We measured di- and tri-methyl Lys4 and Lys9 across the Igf2r and Air promoters. While both di- and tri-methyl Lys4 marked the active Igf2r and the active Air allele, tri-methyl Lys9, but not di-methyl Lys9, marked the suppressed Air allele. We show here that enrichment of parental allele-specific histone modifications in the promoter region, rather than the presence of DNA methylation or antisense transcription, correctly identifies the tissue- and species- specific imprinting status of Igf2r/IGF2R. We discuss these findings in light of recent progress in identifying specific components of the epigenetic marks in imprinted genes. PMID:15294879

  7. Tobacco Smoke Activates Human Papillomavirus 16 p97 Promoter and Cooperates with High-Risk E6/E7 for Oxidative DNA Damage in Lung Cells

    PubMed Central

    Muñoz, Juan P.; Chnaiderman, Jonás; Urzúa, Ulises; León, Oscar; Tornesello, Maria L.; Corvalán, Alejandro H.; Soto-Rifo, Ricardo; Aguayo, Francisco


    We have previously shown a functional interaction between human papillomavirus type 16 (HPV-16) E6 and E7 oncoproteins and cigarette smoke condensate (CSC) in lung cells suggesting cooperation during carcinogenesis. The molecular mechanisms of such interaction, however, remain to be elucidated. Here we first present evidence showing that cigarette smoke condensate (CSC) has the ability to activate the HPV-16 p97 promoter by acting on the long control region (LCR) in lung epithelial cells. Interestingly, we observed that CSC-induced p97 promoter activation occurs in a dose-dependent manner in both tumor A-549 (lung adenocarcinoma), H-2170 (bronchial carcinoma), SiHa or Hela (cervical carcinoma) cells but not in non-tumor BEAS-2B (bronchial) or NL-20 (alveolar) lung cells unless they ectopically expressed the HPV-16 E6 and E7 oncogenes. In addition, we also observed a significant increase of primary DNA damage in tumor and non-tumor CSC-treated lung cells expressing HPV-16 E6 and E7 oncogenes suggesting a cooperative effect in this process, even though the contribution of E7 was significantly higher. Taken together, our results strongly suggest that tobacco smoke is able to induce the activation of the HPV-16 p97 promoter in cooperation with HPV-16 E6 and E7 oncogenes that, in turn, sensitize lung cells to tobacco smoke-induced DNA damage. PMID:25830243

  8. O6-methylguanine-DNA methyltransferase activity is associated with response to alkylating agent therapy and with MGMT promoter methylation in glioblastoma and anaplastic glioma

    PubMed Central

    Bobola, Michael S.; Alnoor, Mohammad; Chen, John Y.-S.; Kolstoe, Douglas D.; Silbergeld, Daniel L.; Rostomily, Robert C.; Blank, A.; Chamberlain, Marc C.; Silber, John R.


    Background CpG methylation in the O6-methylguanine-DNA methyltransferase (MGMT) promoter is associated with better outcome following alkylating agent chemotherapy in glioblastoma (GBM) and anaplastic glioma (AG). To what extent improved response reflects low or absent MGMT activity in glioma tissue has not been unequivocally assessed. This information is central to developing anti-resistance therapies. Methods We examined the relationship of MGMT activity in 91 GBMs and 84 AGs with progression-free survival (PFS) following alkylator therapy and with promoter methylation status determined by methylation-specific PCR (MSP). Results Cox regression analysis revealed that GBMs with high activity had a significantly greater risk for progression in dichotomous (P ≤ 0.001) and continuous (P ≤ 0.003) models, an association observed for different alkylator regimens, including concurrent chemo-radiation with temozolomide. Analysis of MGMT promoter methylation status in 47 of the GBMs revealed that methylated tumors had significantly lower activity (P ≤ 0.005) and longer PFS (P ≤ 0.036) compared to unmethylated tumors, despite overlapping activities. PFS was also significantly greater in methylated vs. unmethylated GBMs with comparable activity (P ≤ 0.005), and among unmethylated tumors with less than median activity (P ≤ 0.026), suggesting that mechanisms in addition to MGMT promote alkylator resistance. Similar associations of MGMT activity with PFS and promoter methylation status were observed for AGs. Conclusions Our results provide strong support for the hypotheses that MGMT activity promotes alkylator resistance and reflects promoter methylation status in malignant gliomas. General significance MGMT activity is an attractive target for anti-resistance therapy regardless of methylation status. PMID:25558448

  9. Postproliferative transcription of the rat osteocalcin gene is reflected by vitamin D-responsive developmental modifications in protein-DNA interactions at basal and enhancer promoter elements.

    PubMed Central

    Owen, T A; Bortell, R; Shalhoub, V; Heinrichs, A; Stein, J L; Stein, G S; Lian, J B


    In the osteocalcin (OC) gene promoter, both independent positive and negative regulatory elements, as well as others with contiguous [TATA/glucocorticoid-responsive elements (GRE)] or overlapping [TATA/GRE, vitamin D-responsive enhancer elements (VDRE)/AP-1, and OC box/AP-1] domains, are sites for modifications in protein-DNA interactions. In the present studies, we have examined nuclear protein extracts from fetal rat calvarial cells that undergo a developmental sequence of bone cell differentiation. Our results demonstrate modifications in protein-DNA interactions that relate to the developmental stages of the osteoblast and support developmental regulation of OC gene transcription. Basal expression of the OC gene is associated with sequence-specific protein-DNA interactions at the OC box, VDRE, and TATA/GRE box. Distinct differences are observed in proliferating osteoblasts, where the OC gene is not transcribed compared to postproliferative, differentiated osteoblasts that transcribe the OC gene. Furthermore, the protein-DNA complexes that reflect hormonal control are also developmentally regulated, mediating both the transcriptionally active and repressed states of the OC gene. For example, in proliferating osteoblasts, a vitamin D receptor-antibody-sensitive complex is formed that is different from the DNA binding complex induced by vitamin D postproliferatively when the OC gene is transcribed. Mutational analysis of the steroid hormone binding domain and the overlapping AP-1 site at the VDRE supports mutually exclusive occupancy by Fos-Jun heterodimers and vitamin D receptor. Such protein-DNA interactions at the VDRE are consistent with repression of competency for vitamin D-mediated transcriptional enhancement in proliferating osteoblasts expressing high levels of Fos and Jun. Images PMID:8381969

  10. Arsenic trioxide promotes mitochondrial DNA mutation and cell apoptosis in primary APL cells and NB4 cell line.


    Meng, Ran; Zhou, Jin; Sui, Meng; Li, ZhiYong; Feng, GuoSheng; Yang, BaoFeng


    This study aimed to investigate the effects of arsenic trioxide (As(2)O(3)) on the mitochondrial DNA (mtDNA) of acute promyelocytic leukemia (APL) cells. The NB4 cell line was treated with 2.0 micromol/L As(2)O(3) in vitro, and the primary APL cells were treated with 2.0 micromol/L As(2)O(3) in vitro and 0.16 mg kg(-1) d(-1) As(2)O(3) in vivo. The mitochondrial DNA of all the cells above was amplified by PCR, directly sequenced and analyzed by Sequence Navigatore and Factura software. The apoptosis rates were assayed by flow cytometry. Mitochondrial DNA mutation in the D-loop region was found in NB4 and APL cells before As(2)O(3) use, but the mutation spots were remarkably increased after As(2)O(3) treatment, which was positively correlated to the rates of cellular apoptosis, the correlation coefficient: r (NB4-As2O3)=0.973818, and r (APL-As2O3)=0.934703. The mutation types include transition, transversion, codon insertion or deletion, and the mutation spots in all samples were not constant and regular. It is revealed that As(2)O(3) aggravates mtDNA mutation in the D-loop region of acute promyelocytic leukemia cells both in vitro and in vivo. Mitochondrial DNA might be one of the targets of As(2)O(3) in APL treatment. PMID:20596959

  11. Areca nut exposure increases secretion of tumor-promoting cytokines in gingival fibroblasts that trigger DNA damage in oral keratinocytes.


    Illeperuma, Rasika P; Kim, Do Kyeong; Park, Young Jin; Son, Hwa Kyung; Kim, Jue Young; Kim, Jinmi; Lee, Doo Young; Kim, Ki-Yeol; Jung, Da-Woon; Tilakaratne, Wanninayake M; Kim, Jin


    Molecular crosstalk between cancer cells and fibroblasts has been an emerging hot issue in understanding carcinogenesis. As oral submucous fibrosis (OSF) is an inflammatory fibrotic disease that can potentially transform into squamous cell carcinoma, OSF has been considered to be an appropriate model for studying the role of fibroblasts during early stage carcinogenesis. In this sense, this study aims at investigating whether areca nut (AN)-exposed fibroblasts cause DNA damage of epithelial cells. For this study, immortalized hNOF (hTERT-hNOF) was used. We found that the levels of GRO-α, IL-6 and IL-8 increased in AN-exposed fibroblasts. Cytokine secretion was reduced by antioxidants in AN-exposed fibroblasts. Increase in DNA double strand breaks (DSB) and 8-oxoG FITC-conjugate was observed in immortalized human oral keratinocytes (IHOK) after the treatment of cytokines or a conditioned medium derived from AN-exposed fibroblasts. Cytokine expression and DNA damage were also detected in OSF tissues. The DNA damage was reduced by neutralizing cytokines or antioxidant treatment. Generation of reactive oxygen species (ROS) and DNA damage response, triggered by cytokines, were abolished when NADPH oxidase (NOX) 1 and 4 were silenced in IHOK, indicating that cytokine-triggered DNA damage was caused by ROS generation through NOX1 and NOX4. Taken together, this study provided strong evidence that blocking ROS generation might be a rewarding approach for cancer prevention and intervention in OSF. PMID:26076896

  12. Areca nut exposure increases secretion of tumor‐promoting cytokines in gingival fibroblasts that trigger DNA damage in oral keratinocytes

    PubMed Central

    Illeperuma, Rasika P.; Kim, Do Kyeong; Park, Young Jin; Son, Hwa Kyung; Kim, Jue Young; Kim, Jinmi; Lee, Doo Young; Kim, Ki‐Yeol; Jung, Da‐Woon; Tilakaratne, Wanninayake M.


    Molecular crosstalk between cancer cells and fibroblasts has been an emerging hot issue in understanding carcinogenesis. As oral submucous fibrosis (OSF) is an inflammatory fibrotic disease that can potentially transform into squamous cell carcinoma, OSF has been considered to be an appropriate model for studying the role of fibroblasts during early stage carcinogenesis. In this sense, this study aims at investigating whether areca nut (AN)‐exposed fibroblasts cause DNA damage of epithelial cells. For this study, immortalized hNOF (hTERT‐hNOF) was used. We found that the levels of GRO‐α, IL‐6 and IL‐8 increased in AN‐exposed fibroblasts. Cytokine secretion was reduced by antioxidants in AN‐exposed fibroblasts. Increase in DNA double strand breaks (DSB) and 8‐oxoG FITC‐conjugate was observed in immortalized human oral keratinocytes (IHOK) after the treatment of cytokines or a conditioned medium derived from AN‐exposed fibroblasts. Cytokine expression and DNA damage were also detected in OSF tissues. The DNA damage was reduced by neutralizing cytokines or antioxidant treatment. Generation of reactive oxygen species (ROS) and DNA damage response, triggered by cytokines, were abolished when NADPH oxidase (NOX) 1 and 4 were silenced in IHOK, indicating that cytokine‐triggered DNA damage was caused by ROS generation through NOX1 and NOX4. Taken together, this study provided strong evidence that blocking ROS generation might be a rewarding approach for cancer prevention and intervention in OSF. PMID:26076896

  13. The BR domain of PsrP interacts with extracellular DNA to promote bacterial aggregation; structural insights into pneumococcal biofilm formation.


    Schulte, Tim; Mikaelsson, Cecilia; Beaussart, Audrey; Kikhney, Alexey; Deshmukh, Maya; Wolniak, Sebastian; Pathak, Anuj; Ebel, Christine; Löfling, Jonas; Fogolari, Federico; Henriques-Normark, Birgitta; Dufrêne, Yves F; Svergun, Dmitri; Nygren, Per-Åke; Achour, Adnane


    The major human pathogen Streptococcus pneumoniae is a leading cause of disease and death worldwide. Pneumococcal biofilm formation within the nasopharynx leads to long-term colonization and persistence within the host. We have previously demonstrated that the capsular surface-associated pneumococcal serine rich repeat protein (PsrP), key factor for biofilm formation, binds to keratin-10 (KRT10) through its microbial surface component recognizing adhesive matrix molecule (MSCRAMM)-related globular binding region domain (BR187-385). Here, we show that BR187-385 also binds to DNA, as demonstrated by electrophoretic mobility shift assays and size exclusion chromatography. Further, heterologous expression of BR187-378 or the longer BR120-378 construct on the surface of a Gram-positive model host bacterium resulted in the formation of cellular aggregates that was significantly enhanced in the presence of DNA. Crystal structure analyses revealed the formation of BR187-385 homo-dimers via an intermolecular β-sheet, resulting in a positively charged concave surface, shaped to accommodate the acidic helical DNA structure. Furthermore, small angle X-ray scattering and circular dichroism studies indicate that the aggregate-enhancing N-terminal region of BR120-166 adopts an extended, non-globular structure. Altogether, our results suggest that PsrP adheres to extracellular DNA in the biofilm matrix and thus promotes pneumococcal biofilm formation. PMID:27582320

  14. Self-assembly of c-myc DNA promoted by a single enantiomer ruthenium complex as a potential nuclear targeting gene carrier

    PubMed Central

    Wu, Qiong; Mei, Wenjie; Zheng, Kangdi; Ding, Yang


    Gene therapy has long been limited in the clinic, due in part to the lack of safety and efficacy of the gene carrier. Herein, a single enantiomer ruthenium(II) complex, Λ-[Ru(bpy)2(p-BEPIP)](ClO4)2 (Λ-RM0627, bpy = 4,4′-bipyridine, p-BEPIP = 2-(4-phenylacetylenephenyl)imidazole [4,5f][1, 10] phenanthroline), has been synthesized and investigated as a potential gene carrier that targets the nucleus. In this report, it is shown that Λ-RM0627 promotes self-assembly of c-myc DNA to form a nanowire structure. Further studies showed that the nano-assembly of c-myc DNA that induced Λ-RM0627 could be efficiently taken up and enriched in the nuclei of HepG2 cells. After treatment of the nano-assembly of c-myc DNA with Λ-RM0627, over-expression of c-myc in HepG2 cells was observed. In summary, Λ-RM0627 played a key role in the transfer and release of c-myc into cells, which strongly indicates Λ-RM0627 as a potent carrier of c-myc DNA that targets the nucleus of tumor cells. PMID:27381008

  15. Self-assembly of c-myc DNA promoted by a single enantiomer ruthenium complex as a potential nuclear targeting gene carrier.


    Wu, Qiong; Mei, Wenjie; Zheng, Kangdi; Ding, Yang


    Gene therapy has long been limited in the clinic, due in part to the lack of safety and efficacy of the gene carrier. Herein, a single enantiomer ruthenium(II) complex, Λ-[Ru(bpy)2(p-BEPIP)](ClO4)2 (Λ-RM0627, bpy = 4,4'-bipyridine, p-BEPIP = 2-(4-phenylacetylenephenyl)imidazole [4,5f][1, 10] phenanthroline), has been synthesized and investigated as a potential gene carrier that targets the nucleus. In this report, it is shown that Λ-RM0627 promotes self-assembly of c-myc DNA to form a nanowire structure. Further studies showed that the nano-assembly of c-myc DNA that induced Λ-RM0627 could be efficiently taken up and enriched in the nuclei of HepG2 cells. After treatment of the nano-assembly of c-myc DNA with Λ-RM0627, over-expression of c-myc in HepG2 cells was observed. In summary, Λ-RM0627 played a key role in the transfer and release of c-myc into cells, which strongly indicates Λ-RM0627 as a potent carrier of c-myc DNA that targets the nucleus of tumor cells. PMID:27381008

  16. The BR domain of PsrP interacts with extracellular DNA to promote bacterial aggregation; structural insights into pneumococcal biofilm formation

    PubMed Central

    Schulte, Tim; Mikaelsson, Cecilia; Beaussart, Audrey; Kikhney, Alexey; Deshmukh, Maya; Wolniak, Sebastian; Pathak, Anuj; Ebel, Christine; Löfling, Jonas; Fogolari, Federico; Henriques-Normark, Birgitta; Dufrêne, Yves F.; Svergun, Dmitri; Nygren, Per-Åke; Achour, Adnane


    The major human pathogen Streptococcus pneumoniae is a leading cause of disease and death worldwide. Pneumococcal biofilm formation within the nasopharynx leads to long-term colonization and persistence within the host. We have previously demonstrated that the capsular surface-associated pneumococcal serine rich repeat protein (PsrP), key factor for biofilm formation, binds to keratin-10 (KRT10) through its microbial surface component recognizing adhesive matrix molecule (MSCRAMM)-related globular binding region domain (BR187–385). Here, we show that BR187–385 also binds to DNA, as demonstrated by electrophoretic mobility shift assays and size exclusion chromatography. Further, heterologous expression of BR187–378 or the longer BR120–378 construct on the surface of a Gram-positive model host bacterium resulted in the formation of cellular aggregates that was significantly enhanced in the presence of DNA. Crystal structure analyses revealed the formation of BR187–385 homo-dimers via an intermolecular β-sheet, resulting in a positively charged concave surface, shaped to accommodate the acidic helical DNA structure. Furthermore, small angle X-ray scattering and circular dichroism studies indicate that the aggregate-enhancing N-terminal region of BR120–166 adopts an extended, non-globular structure. Altogether, our results suggest that PsrP adheres to extracellular DNA in the biofilm matrix and thus promotes pneumococcal biofilm formation. PMID:27582320

  17. Loss of Nek11 Prevents G2/M Arrest and Promotes Cell Death in HCT116 Colorectal Cancer Cells Exposed to Therapeutic DNA Damaging Agents

    PubMed Central

    Sabir, Sarah R.; Sahota, Navdeep K.; Jones, George D. D.; Fry, Andrew M.


    The Nek11 kinase is a potential mediator of the DNA damage response whose expression is upregulated in early stage colorectal cancers (CRCs). Here, using RNAi-mediated depletion, we examined the role of Nek11 in HCT116 WT and p53-null CRC cells exposed to ionizing radiation (IR) or the chemotherapeutic drug, irinotecan. We demonstrate that depletion of Nek11 prevents the G2/M arrest induced by these genotoxic agents and promotes p53-dependent apoptosis both in the presence and absence of DNA damage. Interestingly, Nek11 depletion also led to long-term loss of cell viability that was independent of p53 and exacerbated following IR exposure. CRC cells express four splice variants of Nek11 (L/S/C/D). These are predominantly cytoplasmic, but undergo nucleocytoplasmic shuttling mediated through adjacent nuclear import and export signals in the C-terminal non-catalytic domain. In HCT116 cells, Nek11S in particular has an important role in the DNA damage response. These data provide strong evidence that Nek11 contributes to the response of CRC cells to genotoxic agents and is essential for survival either with or without exposure to DNA damage. PMID:26501353

  18. C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

    PubMed Central

    Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC


    CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

  19. The Phenazine 2-Hydroxy-Phenazine-1-Carboxylic Acid Promotes Extracellular DNA Release and Has Broad Transcriptomic Consequences in Pseudomonas chlororaphis 30-84.


    Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J; Pierson, Leland S; Pierson, Elizabeth A


    Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30-84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surface-attached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30-84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conducted comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30-84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage-derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30-84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities. PMID:26812402

  20. DNA methylation in cystathionine-γ-lyase (CSE) gene promoter induced by ox-LDL in macrophages and in apoE knockout mice.


    Du, Hua-Ping; Li, Jiaojiao; You, Shou-Jiang; Wang, Ya-Li; Wang, Fen; Cao, Yong-Jun; Hu, Li-Fang; Liu, Chun-Feng


    Recent studies suggest that epigenetic alterations such as DNA methylation control many aspects of monocytes/macrophages and participate in the pathogenesis of atherosclerosis, a lipid-driven inflammatory disorder. Our and other groups demonstrated that dysregulation of cystathionine γ-lyase (CSE) -hydrogen sulfide (H2S) pathway was involved in monocyte/macrophages-mediated inflammation and atherosclerosis. However, it remains unknown whether altered cse methylation in macrophages may play a role in linking CSE-H2S dysregulation and atherosclerosis. In the present study, we showed that plasma H2S and H2S production in the peritoneal macrophages of apolipoprotein knockout (apoE(-/-)) mice gradually decreased with ages, and were also lower than that in control mice at 12 weeks older. Moreover, CSE mRNA expressions decreased while DNA methyltransferase (DNMT) expressions increased in the peritoneal macrophages isolated from apoE(-/-) mice, compared to age-matched wildtype mice. Similar observations were obtained in an in vitro study. In oxidized low-density lipoprotein (ox-LDL)-treated raw264.7 macrophages, cse transcription was down-regulated while the expression and activity of DNMT was up-regulated, associated with enhanced DNA methylation in cse promoter. Suppression of DNMT with its inhibitor or siRNA reversed the decrease of CSE mRNA. Therefore, our data suggest that DNA hypermethylation of CpG rich region in cse promoter might contribute to the decrease of cse transcription and H2S production in macrophages, and thus contribute to atherosclerosis development. PMID:26692478

  1. The Phenazine 2-Hydroxy-Phenazine-1-Carboxylic Acid Promotes Extracellular DNA Release and Has Broad Transcriptomic Consequences in Pseudomonas chlororaphis 30–84

    PubMed Central

    Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J.; Pierson, Leland S.; Pierson, Elizabeth A.


    Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30–84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surface-attached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30–84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conducted comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30–84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage-derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30–84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities. PMID:26812402

  2. The Phenazine 2-Hydroxy-Phenazine-1-Carboxylic Acid Promotes Extracellular DNA Release and Has Broad Transcriptomic Consequences in Pseudomonas chlororaphis 30–84


    Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J.; Pierson, Leland S.; Pierson, Elizabeth A.


    Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30–84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surfaceattached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30–84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conductedmore » comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30–84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage- derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30–84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities.« less

  3. NFKB1 Promoter DNA from nt+402 to nt+99 Is Hypomethylated in Different Human Immune Cells

    PubMed Central

    Unterberg, Matthias; Kreuzer, Maxmiliane Julia; Schäfer, Simon Thomas; Bazzi, Zainab; Adamzik, Michael


    Sepsis, with a persistently high 90-day mortality of about 46%, is the third most frequent cause of death in intensive care units worldwide. Further understanding of the inflammatory signaling pathways occurring in sepsis is important for new efficient treatment options. Key regulator of the inflammatory response is the transcription factor NFκB. As we have recently shown, the -94 Ins/Del NFKB1 promoter polymorphism influences sepsis mortality. However, a molecular explanation is still missing. Thus, promoter activity might be varying depending on the NFKB1 genotype, explaining the genotype dependent mortality from sepsis, and one likely mechanism is the degree of promoter methylation. Therefore, we tested the hypothesis that NFκB mRNA expression is regulated by promoter methylation in human cell lines and primary immune cell cultures. First, we examined the methylation of the NFKB1 promoter in U937, REH and HL-60 cells. In the promoter region of nt+99/+229 methylation in all analyzed cell lines was below 1%. Following incubation with bacterial cell wall components, no significant changes in the frequency of promoter methylation in U937 and REH cells were measured and the methylation frequency was under 1%. However, NFκB1 mRNA expression was two-fold increased in U937 cells after 24 h incubation with LPS. By contrast, demethylation by 5-Aza-2′-deoxycytidine incubation enhanced NFκB1 expression significantly. In addition, we analyzed NFKB1 promoter methylation in primary cells from healthy volunteers depending on the NFKB1–94 Ins/Del genotype. Methylation in the promoter region from nt+402 to nt+99 was below 1%. Genotype dependent differences occurred in neutrophil cells, where DD-genotype was significantly more methylated compared to II genotype at nt+284/+402. Besides in the promoter region from nt-227/-8 in ID-genotypes methylation of neutrophils was significantly decreased compared to lymphocytes and in II-genotypes methylation in neutrophils was

  4. DNA binding and antigene activity of a daunomycin-conjugated triplex-forming oligonucleotide targeting the P2 promoter of the human c-myc gene

    PubMed Central

    Carbone, Giuseppina M.; McGuffie, Eileen; Napoli, Sara; Flanagan, Courtney E.; Dembech, Chiara; Negri, Umberto; Arcamone, Federico; Capobianco, Massimo L.; Catapano, Carlo V.


    Triplex-forming oligonucleotides (TFO) that bind DNA in a sequence-specific manner might be used as selective repressors of gene expression and gene-targeted therapeutics. However, many factors, including instability of triple helical complexes in cells, limit the efficacy of this approach. In the present study, we tested whether covalent linkage of a TFO to daunomycin, which is a potent DNA-intercalating agent and anticancer drug, could increase stability of the triple helix and activity of the oligonucleotide in cells. The 11mer daunomycin-conjugated GT (dauno-GT11) TFO targeted a sequence upstream of the P2 promoter, a site known to be critical for transcription of the c-myc gene. Band-shift assays showed that the dauno-GT11 formed triplex DNA with enhanced stability compared to the unmodified TFO. Band shift and footprinting experiments demonstrated that binding of dauno-GT11 was highly sequence-specific with exclusive binding to the 11 bp target site in the c-myc promoter. The daunomycin-conjugated TFO inhibited transcription in vitro and reduced c-myc promoter activity in prostate and breast cancer cells. The daunomycin-conjugated TFO was taken up by cells with a distinctive intracellular distribution compared to free daunomycin. However, cationic lipid-mediated delivery was required for enhanced cellular uptake, nuclear localization and biological activity of the TFO in cells. Dauno-GT11 reduced transcription of the endogenous c-myc gene in cells, but did not affect expression of non-target genes, such as ets-1 and ets-2, which contained very similar target sequences in their promoters. Daunomycin-conjugated control oligonucleotides unable to form triplex DNA with the target sequence did not have any effect in these assays, indicating that daunomycin was not directly responsible for the activity of daunomycin-conjugated TFO. Thus, attachment of daunomycin resulted in increased triplex stability and biological activity of the 11mer GT-rich TFO without

  5. The discovery of X-rays diffraction: From crystals to DNA. A case study to promote understanding of the nature of science and of its interdisciplinary character

    NASA Astrophysics Data System (ADS)

    Guerra, Francesco; Leone, Matteo; Robotti, Nadia


    The advantages of introducing history of science topics into the teaching of science has been advocated by a large number of scholars within the science education community. One of the main reasons given for using history of science in teaching is its power to promote understanding of the nature of science (NOS). In this respect, the historical case of X-rays diffraction, from the discovery of Max von Laue (1912) to the first X-rays diffraction photographs of DNA (1953), is a case in point for showing that a correct experimental strategy and a favourable theoretical context are not enough to make a scientific discovery.

  6. A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter

    PubMed Central


    Background The human papillomavirus (HPV) E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa) substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA) showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation. PMID:22333459

  7. Promotion of RAD51-Mediated Homologous DNA Pairing by the RAD51AP1-UAF1 Complex.


    Liang, Fengshan; Longerich, Simonne; Miller, Adam S; Tang, Caroline; Buzovetsky, Olga; Xiong, Yong; Maranon, David G; Wiese, Claudia; Kupfer, Gary M; Sung, Patrick


    The UAF1-USP1 complex deubiquitinates FANCD2 during execution of the Fanconi anemia DNA damage response pathway. As such, UAF1 depletion results in persistent FANCD2 ubiquitination and DNA damage hypersensitivity. UAF1-deficient cells are also impaired for DNA repair by homologous recombination. Herein, we show that UAF1 binds DNA and forms a dimeric complex with RAD51AP1, an accessory factor of the RAD51 recombinase, and a trimeric complex with RAD51 through RAD51AP1. Two small ubiquitin-like modifier (SUMO)-like domains in UAF1 and a SUMO-interacting motif in RAD51AP1 mediate complex formation. Importantly, UAF1 enhances RAD51-mediated homologous DNA pairing in a manner that is dependent on complex formation with RAD51AP1 but independent of USP1. Mechanistically, RAD51AP1-UAF1 co-operates with RAD51 to assemble the synaptic complex, a critical nucleoprotein intermediate in homologous recombination, and cellular studies reveal the biological significance of the RAD51AP1-UAF1 protein complex. Our findings provide insights into an apparently USP1-independent role of UAF1 in genome maintenance. PMID:27239033

  8. AMPKα1 deficiency promotes cellular proliferation and DNA damage via p21 reduction in mouse embryonic fibroblasts

    PubMed Central

    Xu, Hairong; Zhou, Yanhong; Coughlan, Kathleen A.; Ding, Ye; Wang, Shaobin; Wu, Yue; Song, Ping; Zou, Ming-Hui


    Emerging evidence suggests that activation of adenosine monophosphate-activated protein kinase (AMPK), an energy gauge and redox sensor, controls the cell cycle and protects against DNA damage. However, the molecular mechanisms by which AMPKα isoform regulates DNA damage remain largely unknown. The aim of this study was to determine if AMPKα deletion contributes to cellular hyperproliferation by reducing p21WAF1/Cip1 (p21) expression thereby leading to accumulated DNA damage. The markers for DNA damage, cell cycle proteins, and apoptosis were monitored in cultured mouse embryonic fibroblasts (MEFs) isolated from wild type (WT, C57BL/6J), AMPKα1, or AMPKα2 homozygous deficient (AMPKα1−/−, AMPKα2−/−) mice by Western blot, flow cytometry, and cellular immunofluorescence staining. Deletion of AMPKα1, the predominant AMPKα isoform, but not AMPKα2 in immortalized MEFs led to spontaneous DNA double-strand breaks (DSB) which corresponded to repair protein p53-binding protein1 (53BP1) foci formation and subsequent apoptosis. Furthermore, AMPKα1 localizes to chromatin and AMPKα1 deletion down-regulates cyclin-dependent kinase inhibitor, p21, an important protein that plays a role in decreasing the incidence of spontaneous DSB via inhibition of cell proliferation. In addition, AMPKα1 null cells exhibited enhanced cell proliferation. Finally, p21 overexpression partially blocked the cellular hyperproliferation of AMPKα1-deleted MEFs via the inhibition of cyclin-dependent kinase 2 (CDK2). Taken together, our results suggest that AMPKα1 plays a fundamental role in controlling the cell cycle thereby affecting DNA damage and cellular apoptosis. PMID:25307521

  9. DNA methylation analysis of human myoblasts during in vitro myogenic differentiation: de novo methylation of promoters of muscle-related genes and its involvement in transcriptional down-regulation

    PubMed Central

    Miyata, Kohei; Miyata, Tomoko; Nakabayashi, Kazuhiko; Okamura, Kohji; Naito, Masashi; Kawai, Tomoko; Takada, Shuji; Kato, Kiyoko; Miyamoto, Shingo; Hata, Kenichiro; Asahara, Hiroshi


    Although DNA methylation is considered to play an important role during myogenic differentiation, chronological alterations in DNA methylation and gene expression patterns in this process have been poorly understood. Using the Infinium HumanMethylation450 BeadChip array, we obtained a chronological profile of the genome-wide DNA methylation status in a human myoblast differentiation model, where myoblasts were cultured in low-serum medium to stimulate myogenic differentiation. As the differentiation of the myoblasts proceeded, their global DNA methylation level increased and their methylation patterns became more distinct from those of mesenchymal stem cells. Gene ontology analysis revealed that genes whose promoter region was hypermethylated upon myoblast differentiation were highly significantly enriched with muscle-related terms such as ‘muscle contraction’ and ‘muscle system process’. Sequence motif analysis identified 8-bp motifs somewhat similar to the binding motifs of ID4 and ZNF238 to be most significantly enriched in hypermethylated promoter regions. ID4 and ZNF238 have been shown to be critical transcriptional regulators of muscle-related genes during myogenic differentiation. An integrated analysis of DNA methylation and gene expression profiles revealed that de novo DNA methylation of non-CpG island (CGI) promoters was more often associated with transcriptional down-regulation than that of CGI promoters. These results strongly suggest the existence of an epigenetic mechanism in which DNA methylation modulates the functions of key transcriptional factors to coordinately regulate muscle-related genes during myogenic differentiation. PMID:25190712

  10. Transcriptional silencing induced by Arabidopsis T-DNA mutants is associated with 35S promoter siRNAs and requires genes involved in siRNA-mediated chromatin silencing.


    Mlotshwa, Sizolwenkosi; Pruss, Gail J; Gao, Zhihuan; Mgutshini, Nomathamsanqa L; Li, Junjie; Chen, Xuemei; Bowman, Lewis H; Vance, Vicki


    The utility of many T-DNA insertion mutant lines of Arabidopsis is compromised by their propensity to trigger transcriptional silencing of transgenes expressed from the CaMV 35S promoter. To try to circumvent this problem, we characterized the genetic requirements for maintenance of 35S promoter homology-dependent transcriptional gene silencing induced by the dcl3-1 (SALK_005512) T-DNA insertion mutant line. Surprisingly, even though DCL3 and RDR2 are known components of the siRNA-dependent transcriptional gene silencing pathway, transcriptional gene silencing of a 35S promoter-driven GUS hairpin transgene did occur in plants homozygous for the dcl3-1 T-DNA insertion and was unaffected by loss of function of RDR2. However, the transcriptional gene silencing was alleviated in dcl2 dcl3 dcl4 triple mutant plants and also by mutations in AGO4, NRPD2, HEN1 and MOM1. Thus, some T-DNA insertion mutant lines induce 35S promoter homology-dependent transcriptional silencing that requires neither DCL3 nor RDR2, but involves other genes known to function in siRNA-dependent transcriptional silencing. Consistent with these results, we detected 35S promoter siRNAs in dcl3-1 SALK line plants, suggesting that the 35S promoter homology-dependent silencing induced by some T-DNA insertion mutant lines is siRNA-mediated. PMID:21070421

  11. The DNA-binding domain of the transcriptional activator protein NifA resides in its carboxy terminus, recognises the upstream activator sequences of nif promoters and can be separated from the positive control function of NifA.

    PubMed Central

    Morett, E; Cannon, W; Buck, M


    The positive control protein NifA activates transcription of nitrogen fixation promoters in Klebsiella pneumoniae. NifA is believed to bind to specific sites, the upstream activator sequences (UAS's), of the nif promoters which it activates. We have now shown by mutation of the carboxy terminus of NifA that this is the DNA-binding domain and that the DNA-binding and positive activator functions of NifA can be separated. Mutational analysis of the nifH UAS and in vivo methylation protection analysis of the interaction of NifA with the nifH promoter demonstrates that the UAS is recognised by the carboxy terminus of NifA. The UAS's of K. pneumoniae nif promoters are also required for activation by the Rhizobium meliloti NifA indicating that this activator also possesses DNA-binding activity. Images PMID:3062575

  12. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes.


    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu


    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. PMID:27343554

  13. Effects on specific promoter DNA methylation in zebrafish embryos and larvae following benzo[a]pyrene exposure

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Benzo[a]pyrene (BaP) is an established reproductive and developmental toxicant. BaP exposure in humans and animals has been linked to infertility and multigenerational health consequences. DNA methylation is the most studied epigenetic mechanism that regulates gene expression, and mapping of methyla...

  14. A methylation-dependent DNA-binding activity recognising the methylated promoter region of the mouse Xist gene.


    Huntriss, J; Lorenzi, R; Purewal, A; Monk, M


    Differential methylation of CpG sites in the promoter region of the mouse Xist gene is correlated with Xist expression and X-chromosome inactivation in the female. Using oligonucleotides encompassing the differentially methylated sites as probes in band-shift assays, we have identified a nuclear protein which binds to a specific region of the promoter (between base pairs -45 and -30 upstream from the transcription start site) only when CpG sites within the CG rich region (GCGCCGCGG, -44 to -36) are methylated. Competition experiments with methylated or unmethylated heterologous oligonucleotides demonstrate that the activity is sequence-specific as well as methylation-dependent. Analysis by Southwestern blot identifies a protein of approximately 100 kDa molecular weight and confirms strong binding to the methylated Xist promoter oligonucleotide. Using a 233bp Xist-promoter luciferase construct in which the cytosines in the three CpG sites in the -44 to -36 region are mutated to thymine, we have established that this region is required for transcription from the mouse Xist promoter. Therefore, we suggest that the binding of the 100kDa protein to the methylated sequence leads to repression of transcription from the methylated Xist allele, thus suggesting a role in the regulation of both imprinted and random Xist transcription and X-chromosome inactivation. PMID:9207230

  15. Fractionation of a tumor-initiating UV dose introduces DNA damage-retaining cells in hairless mouse skin and renders subsequent TPA-promoted tumors non-regressing

    PubMed Central

    van de Glind, Gerline; Rebel, Heggert; van Kempen, Marika; Tensen, Kees; de Gruijl, Frank


    Sunburns and especially sub-sunburn chronic UV exposure are associated with increased risk of squamous cell carcinomas (SCCs). Here we focus on a possible difference in tumor initiation from a single severe-sunburn dose (on day 1, 21 hairless mice) and from an equal dose fractionated into very low sub-sunburn doses not causing any (growth-promoting) epidermal hyperplasia (40 days daily exposure, n=20). From day 47 all mice received 12-O-Tetradecanoylphorbol-13-acetate (TPA) applications (2x/wk) for 20 weeks to promote tumor development within the lifetime of the animals. After the sub-sunburn regimen sparse DNA damage-retaining basal cells (quiescent stem cells, QSCs) remained in the non-hyperplastic epidermis. These cells were forced to divide by TPA. After discontinuation of TPA tumors regressed and disappeared in the ‘sunburn group’ but persisted and grew in the ‘sub-sunburn group’ (0.06 vs 2.50 SCCs and precursors ≥4mm/mouse after 280 days, p=0.03). As the tumors carried no mutations in p53, H/K/N-Ras and Notch1/2, these ‘usual suspects' were not involved in the UV-driven tumor initiation. Although we could not selectively eliminate QSCs (unknown phenotype) to establish causality, our data suggest that forcing specifically DNA damage-retaining QSCs to divide – with high mutagenic risk - gives rise to persisting (mainly ‘in situ’) skin carcinomas. PMID:26797757

  16. Fractionation of a tumor-initiating UV dose introduces DNA damage-retaining cells in hairless mouse skin and renders subsequent TPA-promoted tumors non-regressing.


    van de Glind, Gerline; Rebel, Heggert; van Kempen, Marika; Tensen, Kees; de Gruijl, Frank


    Sunburns and especially sub-sunburn chronic UV exposure are associated with increased risk of squamous cell carcinomas (SCCs). Here we focus on a possible difference in tumor initiation from a single severe-sunburn dose (on day 1, 21 hairless mice) and from an equal dose fractionated into very low sub-sunburn doses not causing any (growth-promoting) epidermal hyperplasia (40 days daily exposure, n=20). From day 47 all mice received 12-O-Tetradecanoylphorbol-13-acetate (TPA) applications (2x/wk) for 20 weeks to promote tumor development within the lifetime of the animals. After the sub-sunburn regimen sparse DNA damage-retaining basal cells (quiescent stem cells, QSCs) remained in the non-hyperplastic epidermis. These cells were forced to divide by TPA. After discontinuation of TPA tumors regressed and disappeared in the 'sunburn group' but persisted and grew in the 'sub-sunburn group' (0.06 vs 2.50 SCCs and precursors ≥4 mm/mouse after 280 days, p=0.03). As the tumors carried no mutations in p53, H/K/N-Ras and Notch1/2, these 'usual suspects' were not involved in the UV-driven tumor initiation. Although we could not selectively eliminate QSCs (unknown phenotype) to establish causality, our data suggest that forcing specifically DNA damage-retaining QSCs to divide--with high mutagenic risk--gives rise to persisting (mainly 'in situ') skin carcinomas. PMID:26797757

  17. Lithium chloride protects retinal neurocytes from nutrient deprivation by promoting DNA non-homologous end-joining

    SciTech Connect

    Zhuang Jing; Li Fan; Liu Xuan; Liu Zhiping; Lin Jianxian; Ge Yihong; Kaminski, Joseph M.; Summers, James Bradley; Wang Zhichong; Ge Jian Yu Keming


    Lithium chloride is a therapeutic agent for treatment of bipolar affective disorders. Increasing numbers of studies have indicated that lithium has neuroprotective effects. However, the molecular mechanisms underlying the actions of lithium have not been fully elucidated. This study aimed to investigate whether lithium chloride produces neuroprotective function by improving DNA repair pathway in retinal neurocyte. In vitro, the primary cultured retinal neurocytes (85.7% are MAP-2 positive cells) were treated with lithium chloride, then cultured with serum-free media to simulate the nutrient deprived state resulting from ischemic insult. The neurite outgrowth of the cultured cells increased significantly in a dose-dependent manner when exposed to different levels of lithium chloride. Genomic DNA electrophoresis demonstrated greater DNA integrity of retinal neurocytes when treated with lithium chloride as compared to the control. Moreover, mRNA and protein levels of Ligase IV (involved in DNA non-homologous end-joining (NHEJ) pathway) in retinal neurocytes increased with lithium chloride. The end joining activity assay was performed to determine the role of lithium on NHEJ in the presence of extract from retinal neurocytes. The rejoining levels in retinal neurocytes treated with lithium were significantly increased as compared to the control. Furthermore, XRCC4, the Ligase IV partner, and the transcriptional factor, CREB and CTCF, were up-regulated in retinal cells after treating with 1.0 mM lithium chloride. Therefore, our data suggest that lithium chloride protects the retinal neural cells from nutrient deprivation in vitro, which may be similar to the mechanism of cell death in glaucoma. The improvement in DNA repair pathway involving in Ligase IV might have an important role in lithium neuroprotection. This study provides new insights into the neural protective mechanisms of lithium chloride.

  18. RNF4, a SUMO-targeted ubiquitin E3 ligase, promotes DNA double-strand break repair.


    Galanty, Yaron; Belotserkovskaya, Rimma; Coates, Julia; Jackson, Stephen P


    Protein ubiquitylation and sumoylation play key roles in regulating cellular responses to DNA double-strand breaks (DSBs). Here, we show that human RNF4, a small ubiquitin-like modifier (SUMO)-targeted ubiquitin E3 ligase, is recruited to DSBs in a manner requiring its SUMO interaction motifs, the SUMO E3 ligases PIAS1 and PIAS4, and various DSB-responsive proteins. Furthermore, we reveal that RNF4 depletion impairs ubiquitin adduct formation at DSB sites and causes persistent histone H2AX phosphorylation (γH2AX) associated with defective DSB repair, hypersensitivity toward DSB-inducing agents, and delayed recovery from radiation-induced cell cycle arrest. We establish that RNF4 regulates turnover of the DSB-responsive factors MDC1 and replication protein A (RPA) at DNA damage sites and that RNF4-depleted cells fail to effectively replace RPA by the homologous recombination factors BRCA2 and RAD51 on resected DNA. Consistent with previous data showing that RNF4 targets proteins to the proteasome, we show that the proteasome component PSMD4 is recruited to DNA damage sites in a manner requiring its ubiquitin-interacting domains, RNF4 and RNF8. Finally, we establish that PSMD4 binds MDC1 and RPA1 in a DNA damage-induced, RNF4-dependent manner and that PSMD4 depletion cause MDC1 and γH2AX persistence in irradiated cells. RNF4 thus operates as a DSB response factor at the crossroads between the SUMO and ubiquitin systems. PMID:22661229

  19. Hepatic global DNA and peroxisome proliferator-activated receptor alpha promoter methylation are altered in peripartal dairy cows fed rumen-protected methionine.


    Osorio, J S; Jacometo, C B; Zhou, Z; Luchini, D; Cardoso, F C; Loor, J J


    The availability of Met in metabolizable protein (MP) of a wide range of diets for dairy cows is low. During late pregnancy and early lactation, in particular, suboptimal Met in MP limits its use for mammary and liver metabolism and also for the synthesis of S-adenosylmethionine, which is essential for many biological processes, including DNA methylation. The latter is an epigenetic modification involved in the regulation of gene expression, hence, tissue function. Thirty-nine Holstein cows were fed throughout the peripartal period (-21 d to 30 d in milk) a basal control (CON) diet (n=14) with no Met supplementation, CON plus MetaSmart (MS; Adisseo NA, Alpharetta, GA; n=12), or CON plus Smartamine M (SM; Adisseo NA; n=13). The total mixed ration dry matter for the close-up and lactation diets was measured weekly, then the Met supplements were adjusted daily and top-dressed over the total mixed ration at a rate of 0.19 (MS) or 0.07% (SM) on a dry matter basis. Liver tissue was collected on -10, 7, and 21 d for global DNA and peroxisome proliferator-activated receptor alpha (PPARα) promoter region-specific methylation. Several PPARα target and putative target genes associated with carnitine synthesis and uptake, fatty acid metabolism, hepatokines, and carbohydrate metabolism were also studied. Data were analyzed using PROC MIXED of SAS (SAS Institute Inc., Cary, NC) with the preplanned contrast CON versus SM + MS. Global hepatic DNA methylation on d 21 postpartum was lower in Met-supplemented cows than CON. However, of 2 primers used encompassing 4 to 12 CpG sites in the promoter region of bovine PPARA, greater methylation occurred in the region encompassing -1,538 to -1,418 from the transcription start site in cows supplemented with Met. Overall expression of PPARA was greater in Met-supplemented cows than CON. Concomitantly, PPARA-target genes, such as ANGPTL4, FGF21, and PCK1, were also upregulated overall by Met supplementation. The upregulation of PPAR

  20. Methylation status of the APC and RASSF1A promoter in cell-free circulating DNA and its prognostic role in patients with colorectal cancer

    PubMed Central



    DNA methylation is the most frequent epigenetic alteration. Using methylation-specific polymerase chain reaction (MSP), the methylation status of the adenomatous polyposis coli (APC) and Ras association domain family 1 isoform A (RASSF1A) genes was examined in cell-free circulating DNA from 155 plasma samples obtained from patients with early and advanced colorectal cancer (CRC). APC and RASSF1A hypermethylation was frequently observed in both early and advanced disease, and was significantly associated with a poorer disease outcome. The methylation status of the APC and RASSF1A promoters was investigated in cell-free DNA of patients with CRC. Using MSP, the promoter methylation status of APC and RASSF1A was examined in 155 blood samples obtained from patients with CRC, 88 of whom had operable CRC (oCRC) and 67 had metastatic CRC (mCRC). The frequency of APC methylation in patients with oCRC was 33%. Methylated APC promoter was significantly associated with older age (P=0.012), higher stage (P=0.014) and methylated RASSF1A status (P=0.050). The frequency of APC methylation in patients with mCRC was 53.7%. In these patients, APC methylation was significantly associated with methylated RASSF1A status (P=0.016). The frequency of RASSF1A methylation in patients with oCRC was 25%. Methylated RASSF1A in oCRC was significantly associated with higher stage (P=0.021). The frequency of RASSF1A methylation in mCRC was 44.8%. Methylated RASSF1A in mCRC was associated with moderate differentiation (P=0.012), high levels of carcinoembryonic antigen (P=0.023) and methylated APC status (P=0.016). Patients with an unmethylated APC gene had better survival in both early (81±5 vs. 27±4 months, P<0.001) and advanced disease (37±7 vs. 15±3 months, P<0.001), compared with patients with methylated APC. Patients with an unmethylated RASSF1A gene had better survival in both early (71±6 vs. 46±8 months, P<0.001) and advanced disease (28±4 vs. 16±3 months, P<0.001) than patients with

  1. DVC1 (C1orf124) is a DNA damage-targeting p97 adaptor that promotes ubiquitin-dependent responses to replication blocks.


    Mosbech, Anna; Gibbs-Seymour, Ian; Kagias, Konstantinos; Thorslund, Tina; Beli, Petra; Povlsen, Lou; Nielsen, Sofie Vincents; Smedegaard, Stine; Sedgwick, Garry; Lukas, Claudia; Hartmann-Petersen, Rasmus; Lukas, Jiri; Choudhary, Chunaram; Pocock, Roger; Bekker-Jensen, Simon; Mailand, Niels


    Ubiquitin-mediated processes orchestrate critical DNA-damage signaling and repair pathways. We identify human DVC1 (C1orf124; Spartan) as a cell cycle-regulated anaphase-promoting complex (APC) substrate that accumulates at stalled replication forks. DVC1 recruitment to sites of replication stress requires its ubiquitin-binding UBZ domain and PCNA-binding PIP box motif but is independent of RAD18-mediated PCNA monoubiquitylation. Via a conserved SHP box, DVC1 recruits the ubiquitin-selective chaperone p97 to blocked replication forks, which may facilitate p97-dependent removal of translesion synthesis (TLS) DNA polymerase η (Pol η) from monoubiquitylated PCNA. DVC1 knockdown enhances UV light-induced mutagenesis, and depletion of human DVC1 or the Caenorhabditis elegans ortholog DVC-1 causes hypersensitivity to replication stress-inducing agents. Our findings establish DVC1 as a DNA damage-targeting p97 adaptor that protects cells from deleterious consequences of replication blocks and suggest an important role of p97 in ubiquitin-dependent regulation of TLS. PMID:23042605

  2. Regional distribution of body fat in relation to DNA methylation within the LPL, ADIPOQ and PPARγ promoters in subcutaneous adipose tissue

    PubMed Central

    Drogan, D; Boeing, H; Janke, J; Schmitt, B; Zhou, Y; Walter, J; Pischon, T; Tierling, S


    Obesity may be related to differential DNA methylation and thus to differential expression of key genes in adipose tissue metabolism, such as LPL, ADIPOQ and PPARγ. Using subcutaneous adipose tissue (SAT) from 59 individuals of the European Prospective Investigation into Cancer and Nutrition–Potsdam study, we performed quantitative DNA methylation analysis within the promoters of LPL (LPL-CG1 and -CG2), ADIPOQ (ADIPOQ-CG1 and-CG2) and PPARγ (PPARγ-CG1). We then studied DNA methylation in relation to SAT gene expression, body composition measured using whole-body magnetic resonance imaging, body mass index (BMI), waist circumference (WC) and long-term changes in BMI and WC. For LPL-CG1 and LPL-CG2, higher methylation levels were associated with lower LPL expression, but with higher past WC gain. LPL-CG1 was also positively associated with BMI, WC, and visceral and subcutaneous fat mass. ADIPOQ-CG1 or -CG2 methylation exhibited no association with ADIPOQ expression or with anthropometric parameters. PPARγ-CG1 methylation was significantly higher in individuals with higher visceral fat mass. Among the investigated sites, LPL-CG1 methylation showed the strongest association with gene expression and regional body fat distribution, thereby possibly linking the degree of obesity with major metabolic processes in SAT. PMID:26148147

  3. Existence of G-quadruplex structures in promoter region of oncogenes confirmed by G-quadruplex DNA cross-linking strategy

    PubMed Central

    Yuan, Libo; Tian, Tian; Chen, Yuqi; Yan, Shengyong; Xing, Xiwen; Zhang, Zhengan; Zhai, Qianqian; Xu, Liang; Wang, Shaoru; Weng, Xiaocheng; Yuan, Bifeng; Feng, Yuqi; Zhou, Xiang


    Existence of G-quadruplex DNA in vivo always attract widespread interest in the field of biology and biological chemistry. We reported our findings for the existence of G-quadruplex structures in promoter region of oncogenes confirmed by G-quadruplex DNA cross-linking strategy. Probes for selective G-quadruplex cross-linking was designed and synthesized that show high selectivity for G-quadruplex cross-linking. Further biological studies demonstrated its good inhibition activity against murine melanoma cells. To further investigate if G-quadruplex DNA was formed in vivo and as the target, a derivative was synthesized and pull-down process toward chromosome DNAs combined with circular dichroism and high throughput deep sequencing were performed. Several simulated intracellular conditions, including X. laevis oocytes, Ficoll 70 and PEG, was used to investigate the compound's pure cross-linking ability upon preformed G-quadruplex. Thus, as a potent G-quadruplex cross-linking agent, our strategy provided both valuable evidence of G-quadruplex structures in vivo and intense potential in anti-cancer therapy. PMID:23657205

  4. The role of HERC2 and RNF8 ubiquitin E3 ligases in the promotion of translesion DNA synthesis in the chicken DT40 cell line.


    Mohiuddin; Kobayashi, Shunsuke; Keka, Islam Shamima; Guilbaud, Guillaume; Sale, Julian; Narita, Takeo; Abdel-Aziz, H Ismail; Wang, Xin; Ogawa, Saki; Sasanuma, Hiroyuki; Chiu, Roland; Oestergaard, Vibe H; Lisby, Michael; Takeda, Shunichi


    The replicative DNA polymerases are generally blocked by template DNA damage. The resulting replication arrest can be released by one of two post-replication repair (PRR) pathways, translesion DNA synthesis (TLS) and template switching by homologous recombination (HR). The HERC2 ubiquitin ligase plays a role in homologous recombination by facilitating the assembly of the Ubc13 ubiquitin-conjugating enzyme with the RNF8 ubiquitin ligase. To explore the role of HERC2 and RNF8 in PRR, we examined immunoglobulin diversification in chicken DT40 cells deficient in HERC2 and RNF8. Unexpectedly, the HERC2(-/-) and RNF8(-/-) cells and HERC2(-/-)/RNF8(-/-) double mutant cells exhibit a significant reduction in the rate of immunoglobulin (Ig) hypermutation, compared to wild-type cells. Further, the HERC2(-/-) and RNF8(-/-) mutants exhibit defective maintenance of replication fork progression immediately after exposure to UV while retaining proficient post-replicative gap filling. These mutants are both proficient in mono-ubiquitination of PCNA. Taken together, these results suggest that HERC2 and RNF8 promote TLS past abasic sites and UV-lesions at or very close to stalled replication forks. PMID:26994443

  5. DNA Promoter Methylation-dependent Transcription of the Double C2-like Domain β (DOC2B) Gene Regulates Tumor Growth in Human Cervical Cancer*

    PubMed Central

    Kabekkodu, Shama Prasada; Bhat, Samatha; Radhakrishnan, Raghu; Aithal, Abhijit; Mascarenhas, Roshan; Pandey, Deeksha; Rai, Lavanya; Kushtagi, Pralhad; Mundyat, Gopinath Puthiya; Satyamoorthy, Kapaettu


    Double C2-like domain β (DOC2B) gene encodes for a calcium-binding protein, which is involved in neurotransmitter release, sorting, and exocytosis. We have identified the promoter region of the DOC2B gene as hypermethylated in pre-malignant, malignant cervical tissues, and cervical cancer cell lines by methylation-sensitive dimethyl sulfoxide-polymerase chain reaction and bisulfite genome sequencing; whereas, it was unmethylated in normal cervical tissues (p < 0.05). The promoter hypermethylation was inversely associated with mRNA expression in SiHa, CaSki, and HeLa cells and treatment with demethylating agent 5-aza-2-deoxycytidine restored DOC2B expression. The region −630 to +25 bp of the DOC2B gene showed robust promoter activity by a luciferase reporter assay and was inhibited by in vitro artificial methylation with Sss1 methylase prior to transient transfections. Overexpression of the DOC2B gene in SiHa cells when compared with controls showed significantly reduced colony formation, cell proliferation, induced cell cycle arrest, and repressed cell migration and invasion (p < 0.05). Ectopic expression of DOC2B resulted in anoikis-mediated cell death and repressed tumor growth in a nude mice xenograft model (p < 0.05). DOC2B expressing cells showed a significant increase in intracellular calcium level (p < 0.05), impaired AKT1 and ERK1/2 signaling, and induced actin cytoskeleton remodeling. Our results show that promoter hypermethylation and silencing of the DOC2B gene is an early and frequent event during cervical carcinogenesis and whose reduced expression due to DNA promoter methylation may lead to selective cervical tumor growth. PMID:24570007

  6. The PBAF chromatin remodeling complex represses transcription and promotes rapid repair at DNA double-strand breaks

    PubMed Central

    Kakarougkas, Andreas; Downs, Jessica A; Jeggo, Penny A


    Transcription in the vicinity of DNA double-strand breaks (DSBs) is suppressed via a process involving ataxia telangiectasia mutated protein (ATM) and H2AK119 ubiquitylation.1 We discuss recent findings that components of the Polybromo and Brahma-related gene 1 (BRG1)-associated factor (PBAF) remodeling complex and the polycomb repressive complex (PRC1/2) are also required.2 Failure to activate transcriptional suppression impedes a rapid DSB repair process. PMID:27308404

  7. Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.


    Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J


    Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor. PMID:27000849

  8. SETD2 loss-of-function promotes renal cancer branched evolution through replication stress and impaired DNA repair

    PubMed Central

    Kanu, N; Grönroos, E; Martinez, P; Burrell, R A; Yi Goh, X; Bartkova, J; Maya-Mendoza, A; Mistrík, M; Rowan, A J; Patel, H; Rabinowitz, A; East, P; Wilson, G; Santos, C R; McGranahan, N; Gulati, S; Gerlinger, M; Birkbak, N J; Joshi, T; Alexandrov, L B; Stratton, M R; Powles, T; Matthews, N; Bates, P A; Stewart, A; Szallasi, Z; Larkin, J; Bartek, J; Swanton, C


    Defining mechanisms that generate intratumour heterogeneity and branched evolution may inspire novel therapeutic approaches to limit tumour diversity and adaptation. SETD2 (Su(var), Enhancer of zeste, Trithorax-domain containing 2) trimethylates histone-3 lysine-36 (H3K36me3) at sites of active transcription and is mutated in diverse tumour types, including clear cell renal carcinomas (ccRCCs). Distinct SETD2 mutations have been identified in spatially separated regions in ccRCC, indicative of intratumour heterogeneity. In this study, we have addressed the consequences of SETD2 loss-of-function through an integrated bioinformatics and functional genomics approach. We find that bi-allelic SETD2 aberrations are not associated with microsatellite instability in ccRCC. SETD2 depletion in ccRCC cells revealed aberrant and reduced nucleosome compaction and chromatin association of the key replication proteins minichromosome maintenance complex component (MCM7) and DNA polymerase δ hindering replication fork progression, and failure to load lens epithelium-derived growth factor and the Rad51 homologous recombination repair factor at DNA breaks. Consistent with these data, we observe chromosomal breakpoint locations are biased away from H3K36me3 sites in SETD2 wild-type ccRCCs relative to tumours with bi-allelic SETD2 aberrations and that H3K36me3-negative ccRCCs display elevated DNA damage in vivo. These data suggest a role for SETD2 in maintaining genome integrity through nucleosome stabilization, suppression of replication stress and the coordination of DNA repair. PMID:25728682

  9. SETD2 loss-of-function promotes renal cancer branched evolution through replication stress and impaired DNA repair.


    Kanu, N; Grönroos, E; Martinez, P; Burrell, R A; Yi Goh, X; Bartkova, J; Maya-Mendoza, A; Mistrík, M; Rowan, A J; Patel, H; Rabinowitz, A; East, P; Wilson, G; Santos, C R; McGranahan, N; Gulati, S; Gerlinger, M; Birkbak, N J; Joshi, T; Alexandrov, L B; Stratton, M R; Powles, T; Matthews, N; Bates, P A; Stewart, A; Szallasi, Z; Larkin, J; Bartek, J; Swanton, C


    Defining mechanisms that generate intratumour heterogeneity and branched evolution may inspire novel therapeutic approaches to limit tumour diversity and adaptation. SETD2 (Su(var), Enhancer of zeste, Trithorax-domain containing 2) trimethylates histone-3 lysine-36 (H3K36me3) at sites of active transcription and is mutated in diverse tumour types, including clear cell renal carcinomas (ccRCCs). Distinct SETD2 mutations have been identified in spatially separated regions in ccRCC, indicative of intratumour heterogeneity. In this study, we have addressed the consequences of SETD2 loss-of-function through an integrated bioinformatics and functional genomics approach. We find that bi-allelic SETD2 aberrations are not associated with microsatellite instability in ccRCC. SETD2 depletion in ccRCC cells revealed aberrant and reduced nucleosome compaction and chromatin association of the key replication proteins minichromosome maintenance complex component (MCM7) and DNA polymerase δ hindering replication fork progression, and failure to load lens epithelium-derived growth factor and the Rad51 homologous recombination repair factor at DNA breaks. Consistent with these data, we observe chromosomal breakpoint locations are biased away from H3K36me3 sites in SETD2 wild-type ccRCCs relative to tumours with bi-allelic SETD2 aberrations and that H3K36me3-negative ccRCCs display elevated DNA damage in vivo. These data suggest a role for SETD2 in maintaining genome integrity through nucleosome stabilization, suppression of replication stress and the coordination of DNA repair. PMID:25728682

  10. Decorin Binding Proteins of Borrelia burgdorferi Promote Arthritis Development and Joint Specific Post-Treatment DNA Persistence in Mice

    PubMed Central

    Salo, Jemiina; Jaatinen, Annukka; Söderström, Mirva; Viljanen, Matti K.; Hytönen, Jukka


    Decorin binding proteins A and B (DbpA and B) of Borrelia burgdorferi are of critical importance for the virulence of the spirochete. The objective of the present study was to further clarify the contribution of DbpA and B to development of arthritis and persistence of B. burgdorferi after antibiotic treatment in a murine model of Lyme borreliosis. With that goal, mice were infected with B. burgdorferi strains expressing either DbpA or DbpB, or both DbpA and B, or with a strain lacking the adhesins. Arthritis development was monitored up to 15 weeks after infection, and bacterial persistence was studied after ceftriaxone and immunosuppressive treatments. Mice infected with the B. burgdorferi strain expressing both DbpA and B developed an early and prominent joint swelling. In contrast, while strains that expressed DbpA or B alone, or the strain that was DbpA and B deficient, were able to colonize mouse joints, they caused only negligible joint manifestations. Ceftriaxone treatment at two or six weeks of infection totally abolished joint swelling, and all ceftriaxone treated mice were B. burgdorferi culture negative. Antibiotic treated mice, which were immunosuppressed by anti-TNF-alpha, remained culture negative. Importantly, among ceftriaxone treated mice, B. burgdorferi DNA was detected by PCR uniformly in joint samples of mice infected with DbpA and B expressing bacteria, while this was not observed in mice infected with the DbpA and B deficient strain. In conclusion, these results show that both DbpA and B adhesins are crucial for early and prominent arthritis development in mice. Also, post-treatment borrelial DNA persistence appears to be dependent on the expression of DbpA and B on B. burgdorferi surface. Results of the immunosuppression studies suggest that the persisting material in the joints of antibiotic treated mice is DNA or DNA containing remnants rather than live bacteria. PMID:25816291

  11. Remarkably high rate of DNA amplification promoted by the mating-type switching mechanism in Schizosaccharomyces pombe.


    Yu, Chuanhe; Bonaduce, Michael J; Klar, Amar J S


    A novel mating-type switching-defective mutant showed a highly unstable rearrangement at the mating-type locus (mat1) in fission yeast. The mutation resulted from local amplification of a 134-bp DNA fragment by the mat1-switching phenomenon. We speculate that the rolling-circle-like replication and homologous recombination might be the general mechanisms for local genome region expansion. PMID:22377633

  12. Delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA as a cancer therapeutic: a proof-of-concept study

    PubMed Central

    Lin, Kun-Yuan; Cheng, Siao Muk; Tsai, Shing-Ling; Tsai, Ju-Ya; Lin, Chun-Hui; Cheung, Chun Hei Antonio


    Survivin is a member of the inhibitor-of-apoptosis proteins family. It is overexpressed in many different cancer types but not in the differentiated normal tissue. In addition, overexpression of survivin promotes cancer cell survival and induces chemotherapeutic drug resistance, making it an attractive target for new anticancer interventions. Despite survivin being a promising molecular target for anticancer treatment, it is widely accepted that survivin is only a “semi-druggable” target. Therefore, it is important to develop a new strategy to target survivin for anticancer treatment. In this study, we constructed a novel survivin promoter-driven full-length antisense survivin (pSur/AS-Sur) expression plasmid DNA. Promoter activity assay revealed that the activity of the survivin promoter of pSur/AS-Sur correlated with the endogenous expression of survivin at the transcriptional level in the transfected A549, MDA-MB-231, and PANC-1 cancer cells. Western blot analysis showed that liposomal delivery of pSur/AS-Sur successfully downregulated the expression of survivin in A549, MBA-MB-231, and PANC-1 cells in vitro. In addition, delivery of pSur/AS-Sur induced autophagy, caspase-dependent apoptosis, and caspase-independent apoptosis as indicated by the increased LC3B-II conversion, autophagosome formation, caspase-9/-3 and poly(ADP-ribose) polymerase-1 cleavage, and apoptosis-inducing factor nuclear translocation in A549, MBA-MB-231, and PANC-1 cells. Importantly, liposomal delivery of pSur/AS-Sur was also capable of decreasing the proliferation of the survivin/MDR1 coexpressing multidrug-resistant KB-TAX50 cancer cells and the estrogen receptor-positive tamoxifen-resistant MCF7-TamC3 cancer cells in vitro. In conclusion, the results of this study suggest that delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA is a promising way to target survivin and to treat survivin-expressing cancers in the future. PMID:27217778

  13. Antimicrobial peptide LL-37 promotes the proliferation and invasion of skin squamous cell carcinoma by upregulating DNA-binding protein A

    PubMed Central

    Wang, Wei; Jia, Jinjing; Li, Changji; Duan, Qiqi; Yang, Jiao; Wang, Xin; Li, Ruilian; Chen, Caifeng; Yan, Huling; Zheng, Yan


    The antimicrobial peptide LL-37 not only contributes to the host defence against microbial invasion but also regulates immune activity, angiogenesis and cell proliferation. Studies have shown that LL-37 participates in the development of a variety of tumours, such as lung cancer, ovarian cancer, breast cancer and melanoma. However, the role of LL-37 in the development of skin squamous cell carcinoma (SCC) is not clear. The present study used immunohistochemistry to confirm that the expression of human DNA-binding protein A (dbpA) was increased in SCC tissues. After stimulating SCC A341 cells, LL-37 was shown promote the proliferation, migration and invasion of these malignant cells. LL-37 also promoted the upregulation of dbpA mRNA and protein expression. In addition, after using small interfering RNA to silence the normal dbpA expression in these malignant cells, the proliferation and invasion of the tumor cells were significantly reduced. When the NF-κB inhibitor PDTC was used to inhibit the process of LL-37-stimulated cells, it was found that the original upregulated expression of dbpA was downregulated. Overall, the present demonstrated that by upregulating the expression of dbpA, LL-37 can promote the proliferation and invasion of tumour cells, and that this process depends on the NF-κB signalling pathway. PMID:27588122

  14. Binding of the global response regulator protein CovR to the sag promoter of Streptococcus pyogenes reveals a new mode of CovR-DNA interaction.


    Gao, Jinxin; Gusa, Asiya A; Scott, June R; Churchward, Gordon


    CovR (CsrR) is a response regulator of gene expression in Streptococcus pyogenes. It regulates approximately 15% of the genome, including the genes encoding several streptococcal virulence factors, and acts primarily as a repressor rather than an activator of transcription. We showed that in vitro, CovR is sufficient to repress transcription from the sag promoter, which directs the expression of streptolysin S, a hemolysin that can damage the membranes of eukaryotic cells and subcellular organelles. Repression was stimulated 10-fold by phosphorylation of CovR with acetyl phosphate. In contrast to binding at the has and cov promoters, which direct the expression of genes involved in capsule biosynthesis and of CovR itself, binding of CovR to Psag was highly cooperative. CovR bound to two extended regions of Psag, an upstream region overlapping the -35 and -10 promoter elements and a downstream region overlapping the translation initiation signals of the sagA gene. Each of these regions contains only a single consensus CovR binding sequence, ATTARA, which at the has promoter defines individual sites to which CovR binds non-cooperatively. At Phas and Pcov the T residues in the sequence ATTARA are important for CovR binding. However, using uracil interference experiments we find that although the ATTARA sequence in the Psag upstream region contains thymine residues important for CovR binding, important thymine residues in the Psag downstream region are located outside this sequence. Furthermore, again in contrast to its behavior at the has and cov promoters where phosphorylation of CovR leads to a 2-3-fold increase in DNA binding affinity, binding of CovR to the sag promoter was stimulated 8-32-fold by phosphorylation. We suggest that these differences in CovR binding mean that individual promoters will be repressed at different intracellular levels of phosphorylated CovR, permitting differences in the response of members of the CovR regulon to environmental and

  15. DNA-binding site for two skeletal actin promoter factors is important for expression in muscle cells

    SciTech Connect

    Walsh, K.; Schimmel, P.


    Two nuclear factors bind to the same site in the chicken skeletal actin promoter. Mutations in the footprint sequence which eliminate detectable binding decrease expression in transfected skeletal muscle cells by a factor of 25 to 50 and do not elevate the flow expression in nonmuscle cells. These results show that the factor-binding site contributes to the activation of expression in muscle cells and that it alone does not contribute significantly to repress expression in nonmuscle cells.

  16. IL-8 suppresses E-cadherin expression in nasopharyngeal carcinoma cells by enhancing E-cadherin promoter DNA methylation.


    Zhang, Rui-Li; Peng, Li-Xia; Yang, Jun-Ping; Zheng, Li-Sheng; Xie, Ping; Wang, Meng-Yao; Huang, Bi-Jun; Zhao, Hua-Rong; Bao, Yong-Xing; Qian, Chao-Nan


    Nasopharyngeal carcinoma (NPC) has the highest metastasis potential among head and neck cancers. Distant metastasis is the major cause of treatment failure. Recent studies from our laboratory have revealed that IL-8 promotes NPC metastasis via activation of AKT signaling and induction of epithelial-mesenchymal transition (EMT) in the cells. In the present study, we found that IL-8 treatment for NPC cells resulted in an accumulation of DNMT1 protein through activating AKT1 pathway and consequent DNMT1 protein stabilization. Then DNMT1 suppressed E-cadherin expression by increasing the methylation of its promoter region. LY-294002 blocked IL-8-induced p-AKT1 activation resulting in reduction of DNMT1 and increase of E-cadherin expression, whereas forced demethylation using 5-aza-2'-deoxycytidine restored E-cadherin expression. In conclusion, our study, for the first time, shows that the IL-8/AKT1 signaling pathway stabilizes DNMT1 protein, consequently enhancing hypermethylation of E-cadherin promoter regions and downregulating E-cadherin protein level in NPC cells. Upon blockage of the IL-8/AKT pathway and inhibition of DNMT1, E-cadherin expression can be reversed. These data suggest that targeting the IL-8/AKT1 signaling pathway and DNMT1 may provide a potential therapeutic approach for blocking NPC metastasis. PMID:26530812

  17. Krüppel-Like Factor 5 Promotes Epithelial Proliferation and DNA Damage Repair in the Intestine of Irradiated Mice

    PubMed Central

    Li, Ming; Gu, Yuan; Ma, Yan-Chao; Shang, Zeng-Fu; Wang, Chang; Liu, Fen-Ju; Cao, Jian-Ping; Wan, Hua-Jing; Zhang, Xue-Guang


    BACKGROUND & AIMS: High doses of radiation induce severe DNA damage in intestinal epithelial cells, especially crypt cells, and cause intestinal injury, but the underlying molecular mechanisms remain unclear. Krüppel-like factor 5 (KLF5), a zinc finger-containing transcription factor, is induced by various stress stimuli and is involved in cell proliferation and survival. The role of KLF5 in radiation-induced intestinal injury was investigated here. METHODS: Wild type mice were treated with 8 or 15 Gy total body irradiation (TBI). KLF5 content and cellular localization in the small intestines of irradiated mice were detected by Western blot and immunohistochemical analysis. Mice with intestinal-specific knockdown of KLF5 (Vil-Cre; Klf5fl/+ mice) were generated and their response to radiation was compared with controls. Morphological changes were determined by hematoxylin and eosin staining. Proliferation was examined by Ki67 immunostaining. The molecular response of the small intestine after KLF5 knockdown was investigated using microarrays. RESULTS: KLF5 expression correlated with the progression of intestinal damage. Decreased levels of KLF5 in the gut were associated with increased damage to the intestinal mucosa and reduced epithelial proliferation after TBI. Our microarray data disclosed that KLF5 knockdown down-regulated genes related to DNA damage repair pathways such as nucleotide excision repair, mismatch repair, non-homologous end joining and the Fanconi anemia pathway, which may suggest a novel function of KLF5. CONCLUSIONS: Our study illustrates that KLF5 may modulate DNA repair pathways to prevent intestinal injury induced by TBI. KLF5 signaling provides a novel field for identification of potential therapeutic targets for the treatment of radiation-induced intestinal damage. PMID:26681925

  18. Bicistronic DNA Vaccines Simultaneously Encoding HIV, HSV and HPV Antigens Promote CD8+ T Cell Responses and Protective Immunity

    PubMed Central

    Santana, Vinicius C.; Diniz, Mariana O.; Cariri, Francisco A. M. O.; Ventura, Armando M.; Cunha-Neto, Edécio; Almeida, Rafael R.; Campos, Marco A.; Lima, Graciela K.; Ferreira, Luís C. S.


    Millions of people worldwide are currently infected with human papillomavirus (HPV), herpes simplex virus (HSV) or human immunodeficiency virus (HIV). For this enormous contingent of people, the search for preventive and therapeutic immunological approaches represents a hope for the eradication of latent infection and/or virus-associated cancer. To date, attempts to develop vaccines against these viruses have been mainly based on a monovalent concept, in which one or more antigens of a virus are incorporated into a vaccine formulation. In the present report, we designed and tested an immunization strategy based on DNA vaccines that simultaneously encode antigens for HIV, HSV and HPV. With this purpose in mind, we tested two bicistronic DNA vaccines (pIRES I and pIRES II) that encode the HPV-16 oncoprotein E7 and the HIV protein p24 both genetically fused to the HSV-1 gD envelope protein. Mice i.m. immunized with the DNA vaccines mounted antigen-specific CD8+ T cell responses, including in vivo cytotoxic responses, against the three antigens. Under experimental conditions, the vaccines conferred protective immunity against challenges with a vaccinia virus expressing the HIV-derived protein Gag, an HSV-1 virus strain and implantation of tumor cells expressing the HPV-16 oncoproteins. Altogether, our results show that the concept of a trivalent HIV, HSV, and HPV vaccine capable to induce CD8+ T cell-dependent responses is feasible and may aid in the development of preventive and/or therapeutic approaches for the control of diseases associated with these viruses. PMID:23951135

  19. Functional analysis of the human annexin A5 gene promoter: a downstream DNA element and an upstream long terminal repeat regulate transcription.

    PubMed Central

    Carcedo, M T; Iglesias, J M; Bances, P; Morgan, R O; Fernandez, M P


    Human annexin A5 is a ubiquitous protein implicated in diverse signal transduction processes associated with cell growth and differentiation, and its gene regulation is an important component of this function. Promoter transcriptional activity was determined for a wide 5' portion of the human annexin A5 gene, from bp -1275 to +79 relative to the most 5' of several discrete transcription start points. Transfection experiments carried out in HeLa cells identified the segment from bp -202 to +79 as the minimal promoter conferring optimal transcriptional activity. Two canonical Sp1 sites in the immediate 5' flanking region of a CpG island were required for significant transcription. Strong repressive activity in the distal promoter region between bp -717 to -1153 was attributed to the presence of an endogenous retroviral long terminal repeat, homologous with long terminal repeat 47B. The downstream sequence from bp position +31 to +79 in untranslated exon 1 was also essential for transcription, as its deletion from any of the plasmid constructs abolished activity in transfection assays. Electrophoretic mobility-shift assays, Southwestern-blot analysis and affinity chromatography were used to identify a protein doublet of relative molecular mass 35 kDa that bound an octanucleotide palindromic sequence in exon 1. The DNA cis-element resembled an E-box, but did not bind higher molecular mass transcription factors, such as upstream stimulatory factor or activator protein 4. The discovery of a downstream element crucial for annexin A5 gene transcription, and its interaction with a potentially novel transcription factor or complex, may provide a clue to understanding the initiation of transcription by TATA-less, multiple start site promoters. PMID:11368787

  20. SA1 binds directly to DNA through its unique AT-hook to promote sister chromatid cohesion at telomeres

    PubMed Central

    Bisht, Kamlesh K.; Daniloski, Zharko; Smith, Susan


    Summary Sister chromatid cohesion relies on cohesin, a complex comprising a tri-partite ring and a peripheral subunit Scc3, which is found as two related isoforms SA1 and SA2 in vertebrates. There is a division of labor between the vertebrate cohesin complexes; SA1-cohesin is required at telomeres and SA2-cohesin at centromeres. Depletion of SA1 has dramatic consequences for telomere function and genome integrity, but the mechanism by which SA1-cohesin mediates cohesion at telomeres is not well understood. Here we dissect the individual contribution of SA1 and the ring subunits to telomere cohesion and show that telomeres rely heavily on SA1 and to a lesser extent on the ring for cohesion. Using chromatin immunoprecipitation we show that SA1 is highly enriched at telomeres, is decreased at mitosis when cohesion is resolved, and is increased when cohesion persists. Overexpression of SA1 alone was sufficient to induce cohesion at telomeres, independent of the cohesin ring and dependent on its unique (not found in SA2) N-terminal domain, which we show binds to telomeric DNA through an AT-hook motif. We suggest that a specialized cohesion mechanism may be required to accommodate the high level of DNA replication-associated repair at telomeres. PMID:23729739

  1. STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors.


    Deng, Liufu; Liang, Hua; Xu, Meng; Yang, Xuanming; Burnette, Byron; Arina, Ainhoa; Li, Xiao-Dong; Mauceri, Helena; Beckett, Michael; Darga, Thomas; Huang, Xiaona; Gajewski, Thomas F; Chen, Zhijian J; Fu, Yang-Xin; Weichselbaum, Ralph R


    Ionizing radiation-mediated tumor regression depends on type I interferon (IFN) and the adaptive immune response, but several pathways control I IFN induction. Here, we demonstrate that adaptor protein STING, but not MyD88, is required for type I IFN-dependent antitumor effects of radiation. In dendritic cells (DCs), STING was required for IFN-? induction in response to irradiated-tumor cells. The cytosolic DNA sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) mediated sensing of irradiated-tumor cells in DCs. Moreover, STING was essential for radiation-induced adaptive immune responses, which relied on type I IFN signaling on DCs. Exogenous IFN-? treatment rescued the cross-priming by cGAS or STING-deficient DCs. Accordingly, activation of STING by a second messenger cGAMP administration enhanced antitumor immunity induced by radiation. Thus radiation-mediated antitumor immunity in immunogenic tumors requires a functional cytosolic DNA-sensing pathway and suggests that cGAMP treatment might provide a new strategy to improve radiotherapy. PMID:25517616

  2. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.


    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W


    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium. PMID:20640386

  3. Intra-uterine undernutrition amplifies age-associated glucose intolerance in pigs via altered DNA methylation at muscle GLUT4 promoter.


    Wang, Jun; Cao, Meng; Yang, Mei; Lin, Yan; Che, Lianqiang; Fang, Zhengfeng; Xu, Shengyu; Feng, Bin; Li, Jian; Wu, De


    The present study aimed to investigate the effect of maternal malnutrition on offspring glucose tolerance and the epigenetic mechanisms involved. In total, twelve primiparous Landrace×Yorkshire gilts were fed rations providing either 100 % (control (CON)) or 75 % (undernutrition (UN)) nutritional requirements according to the National Research Council recommendations, throughout gestation. Muscle samples of offspring were collected at birth (dpn1), weaning (dpn28) and adulthood (dpn189). Compared with CON pigs, UN pigs showed lower serum glucose concentrations at birth, but showed higher serum glucose and insulin concentrations as well as increased area under the blood glucose curve during intravenous glucose tolerance test at dpn189 (P<0·05). Compared with CON pigs, GLUT-4 gene and protein expressions were decreased at dpn1 and dpn189 in the muscle of UN pigs, which was accompanied by increased methylation at the GLUT4 promoter (P<0·05). These alterations in methylation concurred with increased mRNA levels of DNA methyltransferase (DNMT) 1 at dpn1 and dpn28, DNMT3a at dpn189 and DNMT3b at dpn1 in UN pigs compared with CON pigs (P<0·05). Interestingly, although the average methylation levels at the muscle GLUT4 promoter were decreased at dpn189 compared with dpn1 in pigs exposed to a poor maternal diet (P<0·05), the methylation differences in individual CpG sites were more pronounced with age. Our results indicate that in utero undernutrition persists to silence muscle GLUT4 likely through DNA methylation during the ageing process, which may lead to the amplification of age-associated glucose intolerance. PMID:27265204

  4. Recurrent patterns of DNA methylation in the ZNF154, CASP8, and VHL promoters across a wide spectrum of human solid epithelial tumors and cancer cell lines

    PubMed Central

    Sánchez-Vega, Francisco; Gotea, Valer; Petrykowska, Hanna M; Margolin, Gennady; Krivak, Thomas C; DeLoia, Julie A; Bell, Daphne W; Elnitski, Laura


    The study of aberrant DNA methylation in cancer holds the key to the discovery of novel biological markers for diagnostics and can help to delineate important mechanisms of disease. We have identified 12 loci that are differentially methylated in serous ovarian cancers and endometrioid ovarian and endometrial cancers with respect to normal control samples. The strongest signal showed hypermethylation in tumors at a CpG island within the ZNF154 promoter. We show that hypermethylation of this locus is recurrent across solid human epithelial tumor samples for 15 of 16 distinct cancer types from TCGA. Furthermore, ZNF154 hypermethylation is strikingly present across a diverse panel of ENCODE cell lines, but only in those derived from tumor cells. By extending our analysis from the Illumina 27K Infinium platform to the 450K platform, to sequencing of PCR amplicons from bisulfite treated DNA, we demonstrate that hypermethylation extends across the breadth of the ZNF154 CpG island. We have also identified recurrent hypomethylation in two genomic regions associated with CASP8 and VHL. These three genes exhibit significant negative correlation between methylation and gene expression across many cancer types, as well as patterns of DNaseI hypersensitivity and histone marks that reflect different chromatin accessibility in cancer vs. normal cell lines. Our findings emphasize hypermethylation of ZNF154 as a biological marker of relevance for tumor identification. Epigenetic modifications affecting the promoters of ZNF154, CASP8, and VHL are shared across a vast array of tumor types and may therefore be important for understanding the genomic landscape of cancer. PMID:24149212

  5. Modifications of protein-DNA interactions in the proximal promoter of a cell-growth-regulated histone gene during onset and progression of osteoblast differentiation.

    PubMed Central

    Owen, T A; Holthuis, J; Markose, E; van Wijnen, A J; Wolfe, S A; Grimes, S R; Lian, J B; Stein, G S


    A temporal sequence of interrelated cellular, biochemical, and molecular events which occurs during the progressive expression of the differentiated osteoblast phenotype in primary cultures of fetal rat calvarial cells results in the development of a bone-tissue-like organization. This ordered developmental sequence encompasses three periods: proliferation, matrix maturation, and mineralization. Initially, the cells actively proliferate and synthesize type I collagen. This is followed by a period of matrix organization and maturation and then by a period of extracellular matrix mineralization. At the completion of proliferation, when expression of osteoblast phenotype markers such as alkaline phosphatase is observed, the cell-cycle-related histone genes are down-regulated transcriptionally, suggesting that a key signaling mechanism at this transition point involves modifications of protein-DNA interactions in the regulatory elements of these growth-regulated genes. Our results demonstrate that there is a selective loss of interaction of the promoter binding factor HiNF-D with the site II region of an H4 histone gene proximal promoter that regulates the specificity and level of transcription only when the down-regulation of proliferation is accompanied by modifications in the extracellular matrix that contribute to progression of osteoblast differentiation. Thus, this specific loss of protein-DNA interaction serves as a marker for a key transition point in the osteoblast developmental sequence, where the down-regulation of proliferation is functionally coupled to the appearance of osteoblast phenotypic properties associated with the organization and maturation of an extracellular matrix that becomes competent to mineralize. Images PMID:2367528

  6. Diphenylarsinic acid, a chemical warfare-related neurotoxicant, promotes liver carcinogenesis via activation of aryl hydrocarbon receptor signaling and consequent induction of oxidative DNA damage in rats.


    Wei, Min; Yamada, Takanori; Yamano, Shotaro; Kato, Minoru; Kakehashi, Anna; Fujioka, Masaki; Tago, Yoshiyuki; Kitano, Mistuaki; Wanibuchi, Hideki


    Diphenylarsinic acid (DPAA), a chemical warfare-related neurotoxic organic arsenical, is present in the groundwater and soil in some regions of Japan due to illegal dumping after World War II. Inorganic arsenic is carcinogenic in humans and its organic arsenic metabolites are carcinogenic in animal studies, raising serious concerns about the carcinogenicity of DPAA. However, the carcinogenic potential of DPAA has not yet been evaluated. In the present study we found that DPAA significantly enhanced the development of diethylnitrosamine-induced preneoplastic lesions in the liver in a medium-term rat liver carcinogenesis assay. Evaluation of the expression of cytochrome P450 (CYP) enzymes in the liver revealed that DPAA induced the expression of CYP1B1, but not any other CYP1, CYP2, or CYP3 enzymes, suggesting that CYP1B1 might be the enzyme responsible for the metabolic activation of DPAA. We also found increased oxidative DNA damage, possibly due to elevated CYP1B1 expression. Induction of CYP1B1 has generally been linked with the activation of AhR, and we found that DPAA activates the aryl hydrocarbon receptor (AhR). Importantly, the promotion effect of DPAA was observed only at a dose that activated the AhR, suggesting that activation of AhR and consequent induction of AhR target genes and oxidative DNA damage plays a vital role in the promotion effects of DPAA. The present study provides, for the first time, evidence regarding the carcinogenicity of DPAA and indicates the necessity of comprehensive evaluation of its carcinogenic potential using long-term carcinogenicity studies. PMID:23999541

  7. DNA damage-induced ephrin-B2 reverse signaling promotes chemoresistance and drives EMT in colorectal carcinoma harboring mutant p53.


    Alam, S K; Yadav, V K; Bajaj, S; Datta, A; Dutta, S K; Bhattacharyya, M; Bhattacharya, S; Debnath, S; Roy, S; Boardman, L A; Smyrk, T C; Molina, J R; Chakrabarti, S; Chowdhury, S; Mukhopadhyay, D; Roychoudhury, S


    Mutation in the TP53 gene positively correlates with increased incidence of chemoresistance in different cancers. In this study, we investigated the mechanism of chemoresistance and epithelial-to-mesenchymal transition (EMT) in colorectal cancer involving the gain-of-function (GOF) mutant p53/ephrin-B2 signaling axis. Bioinformatic analysis of the NCI-60 data set and subsequent hub prediction identified EFNB2 as a possible GOF mutant p53 target gene, responsible for chemoresistance. We show that the mutant p53-NF-Y complex transcriptionally upregulates EFNB2 expression in response to DNA damage. Moreover, the acetylated form of mutant p53 protein is recruited on the EFNB2 promoter and positively regulates its expression in conjunction with coactivator p300. In vitro cell line and in vivo nude mice data show that EFNB2 silencing restores chemosensitivity in mutant p53-harboring tumors. In addition, we observed high expression of EFNB2 in patients having neoadjuvant non-responder colorectal carcinoma compared with those having responder version of the disease. In the course of deciphering the drug resistance mechanism, we also show that ephrin-B2 reverse signaling induces ABCG2 expression after drug treatment that involves JNK-c-Jun signaling in mutant p53 cells. Moreover, 5-fluorouracil-induced ephrin-B2 reverse signaling promotes tumorigenesis through the Src-ERK pathway, and drives EMT via the Src-FAK pathway. We thus conclude that targeting ephrin-B2 might enhance the therapeutic potential of DNA-damaging chemotherapeutic agents in mutant p53-bearing human tumors. PMID:26494468

  8. An intragenic long noncoding RNA interacts epigenetically with the RUNX1 promoter and enhancer chromatin DNA in hematopoietic malignancies.


    Wang, Hong; Li, Wei; Guo, Rui; Sun, Jingnan; Cui, Jiuwei; Wang, Guanjun; Hoffman, Andrew R; Hu, Ji-Fan


    RUNX1, a master regulator of hematopoiesis, is the most commonly perturbed target of chromosomal abnormalities in hematopoietic malignancies. The t(8;21) translocation is found in 30-40% of cases of acute myeloid leukemia (AML). Recent whole-exome sequencing also reveals mutations and deletions of RUNX1 in some solid tumors. We describe a RUNX1-intragenic long noncoding RNA RUNXOR that is transcribed as unspliced transcript from an upstream overlapping promoter. RUNXOR was upregulated in AML samples and in response to Ara-C treatment in vitro. RUNXOR utilizes its 3'-terminal fragment to directly interact with the RUNX1 promoter and enhancers and participates in the orchestration of an intrachromosomal loop. The 3' region of RUNXOR also participates in long-range interchromosomal interactions with chromatin regions that are involved in multiple RUNX1 translocations. These data suggest that RUNXOR noncoding RNA may function as a previously unidentified candidate component that is involved in chromosomal translocation in hematopoietic malignancies. PMID:24752773

  9. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    NASA Astrophysics Data System (ADS)

    Huang, Yong-Zhen; Zhang, Liang-Zhi; Lai, Xin-Sheng; Li, Ming-Xun; Sun, Yu-Jia; Li, Cong-Jun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong


    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P < 0.05). A luciferase assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P < 0.05). An over-expression assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro. Taken together, these results suggest that ZBED6 inhibits IGF2 activity and expression via a G to A transition disrupts the interaction. Thus, we propose that ZBED6 plays a critical role in myogenic differentiation.

  10. Delineation of DNA sequences that are important for in vitro transcription from the adenovirus EIIa late promoter.

    PubMed Central

    Huang, D H; Roeder, R G


    Late in infection, transcription of the EIIa gene is initiated primarily at map unit 72 of the adenovirus genome. A cell-free nuclear extract system was used to determine sequence elements important for the function of this late promoter. In such a system, the transcriptional activity of a circular template was found to be much higher (5- to 10-fold) than that of a linear template. The effect of template topology appeared to be dependent on two distal upstream elements with 5' boundaries located near -265 to -223 and -147 to -133 (in relation to the initiation site), since deletions of these regions reduced transcription of the circular template, in a stepwise fashion, to a level similar to that observed with the linear template. Further deletions revealed an element in the -116 region that appeared to be more important for transcription of the circular template (10-fold reduction) than for transcription of the linear template (3-fold reduction). Lastly, deletion of the TACAAA sequence in the -29 region resulted in further reduction in transcription, indicating that this element functions as a promoter in vitro. Images PMID:2968498

  11. Isolation of cis-acting vaccinia virus DNA fragments promoting the expression of herpes simplex virus thymidine kinase by recombinant viruses.

    PubMed Central

    Vassef, A; Mars, M; Dru, A; Plucienniczak, A; Streeck, R E; Beaud, G


    Recombinant TK- vaccinia viruses containing the pBR322 sequence inserted in either orientation within the coding sequence of the viral thymidine kinase gene were constructed. They were characterized by genomic analysis, hybridization studies, reversion to wild-type virus by in vivo recombination, and rescue from their genomes of plasmids which contained all or parts of the pBR322 sequence. TK- cells were infected with one of these recombinant viruses and then transfected with pools of chimeric plasmids composed of a cloned herpes simplex virus thymidine kinase gene which contained upstream inserts of different vaccinia DNA fragments prepared by restriction or sonication. Recombination between homologous pBR322 sequences within infected cells generated selectable recombinant viruses in which expression of the herpes simplex virus thymidine kinase gene was promoted by the upstream vaccinia insert. These viruses were characterized by genomic analysis, hybridization, and in vivo or in vitro phosphorylation of (5-[125I]deoxycytidine as a specific assay for the expressed herpes simplex virus thymidine kinase. Vaccinia DNA inserts were isolated conveniently for transfer to bacteria by rescuing appropriate plasmids from the genome of recombinant viruses. The sequence of 100 nucleotides adjacent to the upstream region of the herpes simplex virus gene was determined in nine different inserts measuring 0.17 to 1.07 kilobase pairs. Images PMID:2989553

  12. Reversibly cross-linked polyplexes enable cancer-targeted gene delivery via self-promoted DNA release and self-diminished toxicity.


    He, Hua; Bai, Yugang; Wang, Jinhui; Deng, Qiurong; Zhu, Lipeng; Meng, Fenghua; Zhong, Zhiyuan; Yin, Lichen


    Polycations often suffer from the irreconcilable inconsistency between transfection efficiency and toxicity. Polymers with high molecular weight (MW) and cationic charge feature potent gene delivery capabilities, while in the meantime suffer from strong chemotoxicity, restricted intracellular DNA release, and low stability in vivo. To address these critical challenges, we herein developed pH-responsive, reversibly cross-linked, polyetheleneimine (PEI)-based polyplexes coated with hyaluronic acid (HA) for the effective and targeted gene delivery to cancer cells. Low-MW PEI was cross-linked with the ketal-containing linker, and the obtained high-MW analogue afforded potent gene delivery capabilities during transfection, while rapidly degraded into low-MW segments upon acid treatment in the endosomes, which promoted intracellular DNA release and reduced material toxicity. HA coating of the polyplexes shielded the surface positive charges to enhance their stability under physiological condition and simultaneously reduced the toxicity. Additionally, HA coating allowed active targeting to cancer cells to potentiate the transfection efficiencies in cancer cells in vitro and in vivo. This study therefore provides an effective approach to overcome the efficiency-toxicity inconsistence of nonviral vectors, which contributes insights into the design strategy of effective and safe vectors for cancer gene therapy. PMID:25756930

  13. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration via lncRNA XLOC 010623 and RHOA/ROCK2 Signal Pathway.


    Shi, Sirong; Peng, Qiang; Shao, Xiaoru; Xie, Jing; Lin, Shiyu; Zhang, Tao; Li, Qianshun; Li, Xiaolong; Lin, Yunfeng


    Self-assembled tetrahedral DNA nanostructures (TDNs) with precise sizes have been extensively applied in various fields owing to their exceptional mechanical rigidity, structural stability, and modification versatility. In addition, TDNs can be internalized by mammalian cells and remain mainly intact within the cytoplasm by escaping degradation by nucleases. Here, we studied the effects of TDNs on cell migration and the underlying molecular mechanisms. TDNs remarkably enhanced the migration of rat adipose-derived stem cells and down-regulated the long noncoding RNA (lncRNA) XLOC 010623 to activate the mRNA expression of Tiam1 and Rac1. Furthermore, TDNs highly up-regulated the mRNA and protein expression of RHOA, ROCK2, and VCL. These results indicate that TDNs suppressed the transcription of lncRNA XLOC 010623 and activated the TIAM1/RAC1 and RHOA/ROCK2 signaling pathways to promote cell migration. On the basis of these findings, TDNs show a high potential for application in tissue repair and regenerative medicine as a functional three-dimensional DNA nanomaterial. PMID:27403707

  14. Trehalose-Based Block Copolycations Promote Polyplex Stabilization for Lyophilization and in Vivo pDNA Delivery

    PubMed Central


    The development and thorough characterization of nonviral delivery agents for nucleic acid and genome editing therapies are of high interest to the field of nanomedicine. Indeed, this vehicle class offers the ability to tune chemical architecture/biological activity and readily package nucleic acids of various sizes and morphologies for a variety of applications. Herein, we present the synthesis and characterization of a class of trehalose-based block copolycations designed to stabilize polyplex formulations for lyophilization and in vivo administration. A 6-methacrylamido-6-deoxy trehalose (MAT) monomer was synthesized from trehalose and polymerized via reversible addition–fragmentation chain transfer (RAFT) polymerization to yield pMAT43. The pMAT43 macro-chain transfer agent was then chain-extended with aminoethylmethacrylamide (AEMA) to yield three different pMAT-b-AEMA cationic-block copolymers, pMAT-b-AEMA-1 (21 AEMA repeats), -2 (44 AEMA repeats), and -3 (57 AEMA repeats). These polymers along with a series of controls were used to form polyplexes with plasmids encoding firefly luciferase behind a strong ubiquitous promoter. The trehalose-coated polyplexes were characterized in detail and found to be resistant to colloidal aggregation in culture media containing salt and serum. The trehalose-polyplexes also retained colloidal stability and promoted high gene expression following lyophilization and reconstitution. Cytotoxicity, cellular uptake, and transfection ability were assessed in vitro using both human glioblastoma (U87) and human liver carcinoma (HepG2) cell lines wherein pMAT-b-AEMA-2 was found to have the optimal combination of high gene expression and low toxicity. pMAT-b-AEMA-2 polyplexes were evaluated in mice via slow tail vein infusion. The vehicle displayed minimal toxicity and discouraged nonspecific internalization in the liver, kidney, spleen, and lungs as determined by quantitative polymerase chain reaction (qPCR) and fluorescence imaging

  15. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    SciTech Connect

    Pittius, C.W.; Hennighausen, L.; Lee, E.; Westphal, H.; Nicols, E.; Vitale, J.; Gordon, K. )


    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation.

  16. A palindromic regulatory site within vertebrate GATA-1 promoters requires both zinc fingers of the GATA-1 DNA-binding domain for high-affinity interaction.


    Trainor, C D; Omichinski, J G; Vandergon, T L; Gronenborn, A M; Clore, G M; Felsenfeld, G


    GATA-1, a transcription factor essential for the development of the erythroid lineage, contains two adjacent highly conserved zinc finger motifs. The carboxy-terminal finger is necessary and sufficient for specific binding to the consensus GATA recognition sequence: mutant proteins containing only the amino-terminal finger do not bind. Here we identify a DNA sequence (GATApal) for which the GATA-1 amino-terminal finger makes a critical contribution to the strength of binding. The site occurs in the GATA-1 gene promoters of chickens, mice, and humans but occurs very infrequently in other vertebrate genes known to be regulated by GATA proteins. GATApal is a palindromic site composed of one complete [(A/T)GATA(A/G)] and one partial (GAT) canonical motif. Deletion of the partial motif changes the site to a normal GATA site and also reduces by as much as eightfold the activity of the GATA-1 promoter in an erythroid precursor cell. We propose that GATApal is important for positive regulation of GATA-1 expression in erythroid cells. PMID:8628290

  17. DNA demethylation in the PTEN gene promoter induced by 5-azacytidine activates PTEN expression in the MG-63 human osteosarcoma cell line.


    Song, Deye; Ni, Jiangdong; Xie, Hongming; Ding, Muliang; Wang, Jun


    This study used the MG-63 osteosarcoma cell line to investigate the demethylation of the phosphate and tension homolog (PTEN) gene promoter and the change in PTEN gene expression levels, which are caused by the methylation inhibitor 5-azacytidine (5-Zac), and the association between the two. Different concentrations of 5-Zac (0, 5 and 10 μmol/l) were added into the MG-63 cell culture medium and the cells were cultured for 72 h. The following techniques were performed on the cells: Western blot analysis to detect the PTEN protein; reverse transcription-polymerase chain reaction (PCR) to detect the mRNA transcription levels of the PTEN gene; flow cytometry to detect the cell apoptotic rate; and sodium bisulfate to deal with the DNA of each group. The genes of the PTEN promoter and the transcription factors specificity protein 1 (Sp1) and Myc were PCR amplified and transformed into Escherichia coli, then a number of clones were selected for sequencing and the methylation status of the amplified PTEN promoter fragment was detected. Following culture of the MG-63 cells with 5-Zac at concentrations of 0, 5 and 10 μmol/l for 72 h, the expression levels of PTEN protein in each group were gradually increased, presenting a concentration-dependent effect: Group 0 μmol/l compared with groups 5 and 10 μmol/l, P<0.05; and group 5 μmol/l compared with group 10 μmol/l, P=0.007. The mRNA expression levels of the PTEN gene significantly increased. The apoptotic rates of groups 0, 5 and 10 μmol/l were 0.69±0.42, 2.50±0.30 and 6.59±0.62%, and significant differences (P<0.01) were observed between every two groups. The bisulfate DNA sequencing results of three groups showed that, following the treatment with 5-Zac, the binding of the CG site to transcription factors was affected by demethylation. The average rate of demethylation indicated a statistical difference among the three groups. In conclusion, the methylation inhibitor 5-Zac leads to a significant increase in the

  18. DNA demethylation in the PTEN gene promoter induced by 5-azacytidine activates PTEN expression in the MG-63 human osteosarcoma cell line

    PubMed Central



    This study used the MG-63 osteosarcoma cell line to investigate the demethylation of the phosphate and tension homolog (PTEN) gene promoter and the change in PTEN gene expression levels, which are caused by the methylation inhibitor 5-azacytidine (5-Zac), and the association between the two. Different concentrations of 5-Zac (0, 5 and 10 μmol/l) were added into the MG-63 cell culture medium and the cells were cultured for 72 h. The following techniques were performed on the cells: Western blot analysis to detect the PTEN protein; reverse transcription-polymerase chain reaction (PCR) to detect the mRNA transcription levels of the PTEN gene; flow cytometry to detect the cell apoptotic rate; and sodium bisulfate to deal with the DNA of each group. The genes of the PTEN promoter and the transcription factors specificity protein 1 (Sp1) and Myc were PCR amplified and transformed into Escherichia coli, then a number of clones were selected for sequencing and the methylation status of the amplified PTEN promoter fragment was detected. Following culture of the MG-63 cells with 5-Zac at concentrations of 0, 5 and 10 μmol/l for 72 h, the expression levels of PTEN protein in each group were gradually increased, presenting a concentration-dependent effect: Group 0 μmol/l compared with groups 5 and 10 μmol/l, P<0.05; and group 5 μmol/l compared with group 10 μmol/l, P=0.007. The mRNA expression levels of the PTEN gene significantly increased. The apoptotic rates of groups 0, 5 and 10 μmol/l were 0.69±0.42, 2.50±0.30 and 6.59±0.62%, and significant differences (P<0.01) were observed between every two groups. The bisulfate DNA sequencing results of three groups showed that, following the treatment with 5-Zac, the binding of the CG site to transcription factors was affected by demethylation. The average rate of demethylation indicated a statistical difference among the three groups. In conclusion, the methylation inhibitor 5-Zac leads to a significant increase in the

  19. ADP-Dependent Phosphorylation Regulates Association of a DNA-Binding Complex with the Barley Chloroplast psbD Blue-Light-Responsive Promoter1

    PubMed Central

    Kim, Minkyun; Christopher, David A.; Mullet, John E.


    The chloroplast gene psbD encodes D2, a chlorophyll-binding protein located in the photosystem II reaction center. Transcription of psbD in higher plants involves at least three promoters, one of which is regulated by blue light. The psbD blue-light-regulated promoter (BLRP) consists of a −10 promoter element and an activating complex, AGF, that binds immediately upstream of −35. A second sequence-specific DNA-binding complex, PGTF, binds upstream of AGF between −71 and −100 in the barley (Hordeum vulgare) psbD BLRP. In this study we report that ADP-dependent phosphorylation selectively inhibits the binding of PGTF to the barley psbD BLRP. ATP at high concentrations (1–5 mm) inhibits PGTF binding, but in the presence of phosphocreatine and phosphocreatine kinase, this capacity is lost, presumably due to scavenging of ADP. ADP inhibits PGTF binding at relatively low concentrations (0.1 mm), whereas other nucleotides are unable to mediate this response. ADP-mediated inhibition of PGTF binding is reduced in the presence of the protein kinase inhibitor K252a. This and other results suggest that ADP-dependent phosphorylation of PGTF (or some associated protein) inhibits binding of PGTF to the psbD BLRP and reduces transcription. ADP-dependent phosphorylation is expected to increase in darkness in parallel with the rise in ADP levels in chloroplasts. ADP-dependent phosphorylation in chloroplasts may, therefore, in coordination, inactivate enzymes involved in carbon assimilation, protein synthesis, and transcription during diurnal light/dark cycles. PMID:9952463

  20. High salt promotes autoimmunity by TET2-induced DNA demethylation and driving the differentiation of Tfh cells.


    Wu, Haijing; Huang, Xin; Qiu, Hong; Zhao, Ming; Liao, Wei; Yuan, Shuguang; Xie, Yubing; Dai, Yong; Chang, Christopher; Yoshimura, Akihiko; Lu, Qianjin


    Follicular helper T cells (Tfh) have been well documented to play a critical role in autoimmunity, such as systemic lupus erythematosus (SLE), by helping B cells. In this study, high salt (sodium chloride, NaCl), under physiological conditions, was demonstrated to increase the differentiation of Tfh. A high-salt diet markedly increased lupus features in MRL/lpr mice. The mechanism is NaCl-induced DNA demethylation via the recruitment of the hydroxytransferase Ten-Eleven Translocation 2 (TET2). Gene silencing of TET2 obviously diminished NaCl-induced Tfh cell polarization in vitro. In addition, the gene expression of sh2d1a, map3k1, spn and stat5b was enhanced after NaCl treatment, consistent with the findings in lupus CD4(+)T cells. However, only spn was directly regulated by TET2, and spn was not the sole target for NaCl. Our findings not only explain the epigenetic mechanisms of high-salt induced autoimmunity but also provide an attractive molecular target for intervention strategies of patients. PMID:27325182

  1. High salt promotes autoimmunity by TET2-induced DNA demethylation and driving the differentiation of Tfh cells

    PubMed Central

    Wu, Haijing; Huang, Xin; Qiu, Hong; Zhao, Ming; Liao, Wei; Yuan, Shuguang; Xie, Yubing; Dai, Yong; Chang, Christopher; Yoshimura, Akihiko; Lu, Qianjin


    Follicular helper T cells (Tfh) have been well documented to play a critical role in autoimmunity, such as systemic lupus erythematosus (SLE), by helping B cells. In this study, high salt (sodium chloride, NaCl), under physiological conditions, was demonstrated to increase the differentiation of Tfh. A high-salt diet markedly increased lupus features in MRL/lpr mice. The mechanism is NaCl-induced DNA demethylation via the recruitment of the hydroxytransferase Ten-Eleven Translocation 2 (TET2). Gene silencing of TET2 obviously diminished NaCl-induced Tfh cell polarization in vitro. In addition, the gene expression of sh2d1a, map3k1, spn and stat5b was enhanced after NaCl treatment, consistent with the findings in lupus CD4+T cells. However, only spn was directly regulated by TET2, and spn was not the sole target for NaCl. Our findings not only explain the epigenetic mechanisms of high-salt induced autoimmunity but also provide an attractive molecular target for intervention strategies of patients. PMID:27325182

  2. G4-DNA Formation in the HRAS Promoter and Rational Design of Decoy Oligonucleotides for Cancer Therapy

    PubMed Central

    Membrino, Alexandro; Cogoi, Susanna; Pedersen, Erik B.; Xodo, Luigi E.


    HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2). When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R)-1-O-[4-(1-Pyrenylethynyl) phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys). The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated. PMID:21931711

  3. Sequence determinants of DNA bending in the ilvlH promoter and regulatory region of Escherichia coli.

    PubMed Central

    Wang, Q; Albert, F G; Fitzgerald, D J; Calvo, J M; Anderson, J N


    Previous studies have shown that the promoter/regulatory region of the ilvlH operon displays intrinsic curvature, with the bend center located at position -120 relative to the transcription start site. In this report, a 57 bp sequence spanning the bend center was mutagenized in vitro in order to study the relationship between nucleotide sequence and curvature measured by electrophoresis. The strategy used for analyzing the results consisted of determining the strengths of the relationships between electrophoretic anomaly and predicted curvature calculated by computer programs that differ in wedge angle composition. The results revealed that programs which assume that bending occurs only at AA/TT display good predictive value, with correlation coefficients between electrophoretic anomaly and predicted curvature as high as 0.93. In contrast, a program which assumes that bending occurs at all 16 dinucleotide steps exhibited lower predictive value, while there were no significant relationships between the experimental data and curvature calculated by a program that was based on all non-AA/TT wedge values. These results show that the complete wedge model which incorporates values for all dinucleotide steps does not adequately describe the electrophoretic data in this report. PMID:7838732

  4. EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing’s Sarcoma

    PubMed Central

    Hossain, Mohammad Motarab; Ray, Swapan Kumar


    Ewing’s sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing’s sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing’s sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing’s sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing’s sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing’s sarcoma in cell culture and animal models.

  5. HIPK2 phosphorylates ΔNp63α and promotes its degradation in response to DNA damage.


    Lazzari, C; Prodosmo, A; Siepi, F; Rinaldo, C; Galli, F; Gentileschi, M; Bartolazzi, A; Costanzo, A; Sacchi, A; Guerrini, L; Soddu, S


    Homeodomain-interacting protein kinase 2 (HIPK2) is an emerging player in cell response to genotoxic agents that senses damage intensity and contributes to the cell's choice between cell cycle arrest and apoptosis. Phosphorylation of p53 at S46, an apoptosis-specific p53 posttranslational modification, is the most characterized HIPK2 function in response to lethal doses of ultraviolet (UV), ionizing radiation or different anticancer drugs, such as cisplatin, roscovitine and doxorubicin (DOX). Indeed, like p53, HIPK2 has been shown to contribute to the effectiveness of these treatments. Interestingly, p53-independent mechanisms of HIPK2-induced apoptosis were described for UV and tumor growth factor-β treatments; however, it is unknown whether these mechanisms are relevant for the responses to anticancer drugs. Because of the importance of the so-called 'p53-independent apoptosis and drug response' in human cancer chemotherapy, we asked whether p53-independent factor(s) might be involved in HIPK2-mediated chemosensitivity. Here, we show that HIPK2 depletion by RNA interference induces resistance to different anticancer drugs even in p53-null cells, suggesting the involvement of HIPK2 targets other than p53 in response to chemotherapy. In particular, we found that HIPK2 phosphorylates and promotes proteasomal degradation of ΔNp63α, a prosurvival ΔN isoform of the p53 family member, p63. Indeed, effective cell response to different genotoxic agents was shown to require phosphorylation-induced proteasomal degradation of ΔNp63α. In DOX-treated cells, we show that HIPK2 depletion interferes with ΔNp63α degradation, and expression of a HIPK2-resistant ΔNp63α-Δ390 mutant induces chemoresistance. We identify T397 as the ΔNp63α residue phosphorylated by HIPK2, and show that the non-phosphorylatable ΔNp63α-T397A mutant is not degraded in the face of either HIPK2 overexpression or DOX treatment. These results indicate ΔNp63α as a novel target of HIPK2 in

  6. Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.


    Silva-Sanchez, Aaron; Liu, Cun Ren; Vale, Andre M; Khass, Mohamed; Kapoor, Pratibha; Elgavish, Ada; Ivanov, Ivaylo I; Ippolito, Gregory C; Schelonka, Robert L; Schoeb, Trenton R; Burrows, Peter D; Schroeder, Harry W


    Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3), which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH) gene segment sequence content by reading frame (RF) is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1), which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies. PMID:25706374

  7. DNA Helicase HIM-6/BLM Both Promotes MutSγ-Dependent Crossovers and Antagonizes MutSγ-Independent Interhomolog Associations During Caenorhabditis elegans Meiosis

    PubMed Central

    Schvarzstein, Mara; Pattabiraman, Divya; Libuda, Diana E.; Ramadugu, Ajit; Tam, Angela; Martinez-Perez, Enrique; Roelens, Baptiste; Zawadzki, Karl A.; Yokoo, Rayka; Rosu, Simona; Severson, Aaron F.; Meyer, Barbara J.; Nabeshima, Kentaro; Villeneuve, Anne M.


    Meiotic recombination is initiated by the programmed induction of double-strand DNA breaks (DSBs), lesions that pose a potential threat to the genome. A subset of the DSBs induced during meiotic prophase become designated to be repaired by a pathway that specifically yields interhomolog crossovers (COs), which mature into chiasmata that temporarily connect the homologs to ensure their proper segregation at meiosis I. The remaining DSBs must be repaired by other mechanisms to restore genomic integrity prior to the meiotic divisions. Here we show that HIM-6, the Caenorhabditis elegans ortholog of the RecQ family DNA helicase BLM, functions in both of these processes. We show that him-6 mutants are competent to load the MutSγ complex at multiple potential CO sites, to generate intermediates that fulfill the requirements of monitoring mechanisms that enable meiotic progression, and to accomplish and robustly regulate CO designation. However, recombination events at a subset of CO-designated sites fail to mature into COs and chiasmata, indicating a pro-CO role for HIM-6/BLM that manifests itself late in the CO pathway. Moreover, we find that in addition to promoting COs, HIM-6 plays a role in eliminating and/or preventing the formation of persistent MutSγ-independent associations between homologous chromosomes. We propose that HIM-6/BLM enforces biased outcomes of recombination events to ensure that both (a) CO-designated recombination intermediates are reliably resolved as COs and (b) other recombination intermediates reliably mature into noncrossovers in a timely manner. PMID:25053665

  8. DNA helicase HIM-6/BLM both promotes MutSγ-dependent crossovers and antagonizes MutSγ-independent interhomolog associations during caenorhabditis elegans meiosis.


    Schvarzstein, Mara; Pattabiraman, Divya; Libuda, Diana E; Ramadugu, Ajit; Tam, Angela; Martinez-Perez, Enrique; Roelens, Baptiste; Zawadzki, Karl A; Yokoo, Rayka; Rosu, Simona; Severson, Aaron F; Meyer, Barbara J; Nabeshima, Kentaro; Villeneuve, Anne M


    Meiotic recombination is initiated by the programmed induction of double-strand DNA breaks (DSBs), lesions that pose a potential threat to the genome. A subset of the DSBs induced during meiotic prophase become designated to be repaired by a pathway that specifically yields interhomolog crossovers (COs), which mature into chiasmata that temporarily connect the homologs to ensure their proper segregation at meiosis I. The remaining DSBs must be repaired by other mechanisms to restore genomic integrity prior to the meiotic divisions. Here we show that HIM-6, the Caenorhabditis elegans ortholog of the RecQ family DNA helicase BLM, functions in both of these processes. We show that him-6 mutants are competent to load the MutSγ complex at multiple potential CO sites, to generate intermediates that fulfill the requirements of monitoring mechanisms that enable meiotic progression, and to accomplish and robustly regulate CO designation. However, recombination events at a subset of CO-designated sites fail to mature into COs and chiasmata, indicating a pro-CO role for HIM-6/BLM that manifests itself late in the CO pathway. Moreover, we find that in addition to promoting COs, HIM-6 plays a role in eliminating and/or preventing the formation of persistent MutSγ-independent associations between homologous chromosomes. We propose that HIM-6/BLM enforces biased outcomes of recombination events to ensure that both (a) CO-designated recombination intermediates are reliably resolved as COs and (b) other recombination intermediates reliably mature into noncrossovers in a timely manner. PMID:25053665

  9. Obesity promotes PhIP-induced small intestinal carcinogenesis in hCYP1A-db/db mice: involvement of mutations and DNA hypermethylation of Apc.


    Wang, Hong; Liu, Anna; Kuo, Yingyi; Chi, Eric; Yang, Xu; Zhang, Lanjing; Yang, Chung S


    Obesity is associated with an increased risk of cancer. To study the promotion of dietary carcinogen-induced gastrointestinal cancer by obesity, we employed 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) to induce intestinal tumorigenesis in CYP1A-humanized (hCYP1A) mice, in which mouse Cyp1a1/1a2 was replaced with human CYP1A1/1A2 Obesity was introduced in hCYP1A mice by breeding with Lepr(db/+) mice to establish the genetically induced obese hCYP1A-Lepr(db/db) mice or by feeding hCYP1A mice a high-fat diet. PhIP induced the formation of small intestinal tumors at the ages of weeks 28-40 in obese hCYP1A mice, but not in lean hCYP1A mice. No tumors were found in colon and other gastrointestinal organs in the lean or obese mice. Using immunohistochemistry (IHC), we found strong positive staining of NF-κB p65, pSTAT3 and COX2 as well as elevated levels of nuclear β-catenin (Ctnnb1) in small intestinal tumors, but not in normal tissues. By sequencing Apc and Ctnnb1 genes, we found that most PhIP-induced small intestinal tumors in obese mice carried only a single heterozygous mutation in Apc By bisulfite-sequencing of CpG islands of Apc, we found DNA hypermethylation in a CpG cluster located in its transcription initiation site, which most likely caused the inactivation of the wild-type Apc allele. Our findings demonstrate that PhIP-induced small intestinal carcinogenesis in hCYP1A-db/db mice is promoted by obesity and involves Apc mutation and inactivation by DNA hypermethylation. This experimental result is consistent with the association of obesity and the increased incidence of small intestinal cancer in humans in recent decades. PMID:27207656

  10. Dynamic Changes in the Follicular Transcriptome and Promoter DNA Methylation Pattern of Steroidogenic Genes in Chicken Follicles throughout the Ovulation Cycle

    PubMed Central

    Zhu, Guiyu; Mao, Yong; Zhou, Wendi; Jiang, Yunliang


    The molecular mechanisms associated with follicle maturation and ovulation are not well defined in avian species. In this study, we used RNA-seq to study the gene expression profiles of the chicken follicles from different developmental stages (pre-hierarchical, pre-ovulatory and post-ovulatory). Transcriptomic analysis revealed a total of 1,277 and 2,310 genes were differentially expressed when follicles progressed through the pre-hierarchical to hierarchical and pre-ovulatory to post-ovulatory transitions, respectively. The differentially expressed genes (DEG) were involved in signaling pathways such as adherens junction, apoptosis and steroid biosynthesis. We further investigated the transcriptional regulation of follicular steroidogenesis by examining the follicle-specific methylation profiles of Star (steroidogenic acute regulatory protein), Cyp11a1 (cytochrome P450, family 11, subfamily a, polypeptide 1) and Hsd3b (hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1), genes encoding the key enzymes for progesterone synthesis. The varied patterns of DNA methylation in proximal promoters of Star and Cyp11a1but not Hsd3b in different follicles could play a major role in controlling gene expression as well as follicular steroidogenic activity. Finally, the promoter-reporter analysis suggests that TGF-β could be involved in the regulation of Hsd3b expression during ovulation. Together, current data not only provide novel insights into the molecular mechanisms of follicular physiology in chicken follicles, but also present the first evidence of epigenetic regulation of ovarian steroidogenesis in avian species. PMID:26716441

  11. Inhibition of mitogen-activated protein kinase kinase, DNA methyltransferase, and transforming growth factor-β promotes differentiation of human induced pluripotent stem cells into enterocytes.


    Kodama, Nao; Iwao, Takahiro; Kabeya, Tomoki; Horikawa, Takashi; Niwa, Takuro; Kondo, Yuki; Nakamura, Katsunori; Matsunaga, Tamihide


    We previously reported that small-molecule compounds were effective in generating pharmacokinetically functional enterocytes from human induced pluripotent stem (iPS) cells. In this study, to determine whether the compounds promote the differentiation of human iPS cells into enterocytes, we investigated the effects of a combination of mitogen-activated protein kinase kinase (MEK), DNA methyltransferase (DNMT), and transforming growth factor (TGF)-β inhibitors on intestinal differentiation. Human iPS cells cultured on feeder cells were differentiated into endodermal cells by activin A. These endodermal-like cells were then differentiated into intestinal stem cells by fibroblast growth factor 2. Finally, the cells were differentiated into enterocyte cells by epidermal growth factor and small-molecule compounds. After differentiation, mRNA expression levels and drug-metabolizing enzyme activities were measured. The mRNA expression levels of the enterocyte marker sucrase-isomaltase and the major drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 were increased by a combination of MEK, DNMT, and TGF-β inhibitors. The mRNA expression of CYP3A4 was markedly induced by 1α,25-dihydroxyvitamin D3. Metabolic activities of CYP1A1/2, CYP2B6, CYP2C9, CYP2C19, CYP3A4/5, UDP-glucuronosyltransferase, and sulfotransferase were also observed in the differentiated cells. In conclusion, MEK, DNMT, and TGF-β inhibitors can be used to promote the differentiation of human iPS cells into pharmacokinetically functional enterocytes. PMID:27161454

  12. Down-Regulation of miR-148a Promotes Metastasis by DNA Methylation and is Associated with Prognosis of Skin Cancer by Targeting TGIF2

    PubMed Central

    Tian, Yanli; Wei, Wei; Li, Li; Yang, Rongya


    Background MicroRNAs (miRNA) dysregulation has been considered to be significantly related to the occurrence and development of cancers. Several studies had proved that DNA methylation is an important cause of the abnormal expression of miRNAs. The purpose of this study was to investigate the methylation status of miR-148a and its effects on the metastasis and prognosis of skin cancer, as well as the interaction with TGIF2 gene. Material/Methods According to the qRT-PCR analysis, the expression of miR-148a was down-regulated in tumor tissues compared with the adjacent tissues and healthy controls (P<0.05). In vitro cell metastasis assay revealed that miR-148a could inhibit cell metastasis and its down-regulation promoted metastasis. Luciferase reporter assay found that TGIF2 gene was a target gene and its expression was suppressed by miR-148a in skin cancer. Results Methylation-specific PCR demonstrated that DNA methylation rate of miR-148a was higher in tumor tissues than in adjacent tissues and healthy tissues (P<0.05). miR-148a expression was proved to be epigenetically regulated after the demethylation of it by 5-aza-20-deoxycytidine treatment and qRT-PCR analysis. miR-148a methylation was significantly influenced by many clinicopathologic characteristics such as age (P=0.000), pathological differentiation (P=0.000), and lymph node metastasis (P=0.000). Besides, Kaplan-Meier analysis showed patients with miR-148a methylation lived shorter than those without that (P<0.001). Cox regression analysis manifested that miR-148a methylation (HR=0.053, 95CI%=0.005–0.548, P=0.014) could be serve as an independent prognostic marker for skin cancer. Conclusions Taken together, the expression of miR-148a was regulated by DNA methylation and targeted by TGIF2. Its methylation may be a potential prognostic indicator in skin cancer. PMID:26638007

  13. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.


    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R


    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  14. DNA methylation-mediated silencing of matricellular protein dermatopontin promotes hepatocellular carcinoma metastasis by α3β1 integrin-Rho GTPase signaling.


    Fu, Ying; Feng, Ming-Xuan; Yu, Jian; Ma, Ming-Ze; Liu, Xiao-Jin; Li, Jun; Yang, Xiao-Mei; Wang, Ya-Hui; Zhang, Yan-Li; Ao, Jun-Ping; Xue, Feng; Qin, Wenxin; Gu, Jianren; Xia, Qiang; Zhang, Zhi-Gang


    Dermatopontin (DPT), a tyrosine-rich, acidic matricellular protein, has been implicated in several human cancers. However, its biological functions and molecular mechanisms in cancer progression, particular hepatocellular carcinoma (HCC), remain unknown. We demonstrated that DPT was significantly down-regulated in 202 HCC clinical samples and that its expression level was closely correlated with cancer metastasis and patient prognosis. The overexpression of DPT dramatically suppressed HCC cell migration in vitro and intrahepatic metastasis in vivo. We further revealed that the down-regulation of DPT in HCC was due to epigenetic silencing by promoter DNA methylation. And the inhibitory effects of DPT on HCC cell motility were associated with dysregulated focal adhesion assembly, decreased RhoA activity and reduced focal adhesion kinase (FAK) and c-Src tyrosine kinase (Src) phosphorylation, and all of these alterations required the involvement of integrin signaling. Furthermore, we determined that the inhibitory effects of DPT on HCC cell motility were primarily mediated through α3β1 integrin. Our study provides new evidence for epigenetic control of tumor microenvironment, and suggests matricellular protein DPT may serve as a novel prognostic marker and act as a HCC metastasis suppressor. PMID:25149533

  15. Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2.


    Vaidya, Himani; Rumph, Candie; Katula, Karen S


    WNT5A is a secreted ligand involved in Wnt pathway signaling and has a role in cell movement and differentiation. Altered WNT5A expression is associated with various cancers, although in most studies the focus has been on only one of the known WNT5A isoforms. In this study, we analyzed expression from two of the major WNT5A promoters, termed promoter A and promoter B, in normal human osteoblasts, SaOS-2 and U2OS osteosarcoma cell lines, and osteosarcoma tumor tissue. We found that both promoters A and B are active in normal osteoblasts with nearly 11-fold more promoter B than A transcripts. Promoter B but not promoter A transcripts are decreased or nearly undetectable in the SaOS-2 and U2OS cell lines and osteosarcoma tumor tissues. Transient transfection of promoter A and promoter B reporter constructs confirmed that SaOS-2 cells have the necessary factors to transcribe both promoters. Bisulfite sequencing analysis revealed that three CpG enriched regions upstream of the promoter B exon 1βare highly methylated in both SaOS-2 and U2OS cells. The CpG island sub-region R6 located in promoter B exon 1β was approximately 51% methylated in SaOS-2 and 25% methylated in U2OS. Region 3 was approximately 28% methylated in normal osteoblasts, whereas the others were unmethylated. Promoter B was re-activated by treatment of SaOS-2 cells with 1 μM 5-azacytidine, which was associated with only a small insignificant change in methylation of sub-region R6. ChIP analysis of U2OS and SaOS-2 cells indicated that the promoter B region is less enriched in the active histone mark H3K4me3, in comparison to promoter A and that there is increased enrichment of the repressive mark H3K27me3 in association with the promoter B genomic region in the cell line SaOS-2. These findings show that epigenetic inactivation of the WNT5A promoter B involves both DNA methylation and histone modifications and suggest that differential expression of the WNT5A alternative promoters A and B is a

  16. Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2

    PubMed Central

    Vaidya, Himani; Rumph, Candie; Katula, Karen S.


    WNT5A is a secreted ligand involved in Wnt pathway signaling and has a role in cell movement and differentiation. Altered WNT5A expression is associated with various cancers, although in most studies the focus has been on only one of the known WNT5A isoforms. In this study, we analyzed expression from two of the major WNT5A promoters, termed promoter A and promoter B, in normal human osteoblasts, SaOS-2 and U2OS osteosarcoma cell lines, and osteosarcoma tumor tissue. We found that both promoters A and B are active in normal osteoblasts with nearly 11-fold more promoter B than A transcripts. Promoter B but not promoter A transcripts are decreased or nearly undetectable in the SaOS-2 and U2OS cell lines and osteosarcoma tumor tissues. Transient transfection of promoter A and promoter B reporter constructs confirmed that SaOS-2 cells have the necessary factors to transcribe both promoters. Bisulfite sequencing analysis revealed that three CpG enriched regions upstream of the promoter B exon 1βare highly methylated in both SaOS-2 and U2OS cells. The CpG island sub-region R6 located in promoter B exon 1β was approximately 51% methylated in SaOS-2 and 25% methylated in U2OS. Region 3 was approximately 28% methylated in normal osteoblasts, whereas the others were unmethylated. Promoter B was re-activated by treatment of SaOS-2 cells with 1 μM 5-azacytidine, which was associated with only a small insignificant change in methylation of sub-region R6. ChIP analysis of U2OS and SaOS-2 cells indicated that the promoter B region is less enriched in the active histone mark H3K4me3, in comparison to promoter A and that there is increased enrichment of the repressive mark H3K27me3 in association with the promoter B genomic region in the cell line SaOS-2. These findings show that epigenetic inactivation of the WNT5A promoter B involves both DNA methylation and histone modifications and suggest that differential expression of the WNT5A alternative promoters A and B is a

  17. Non-random distribution of methyl-CpG sites and non-CpG methylation in the human rDNA promoter identified by next generation bisulfite sequencing.


    Pietrzak, Maciej; Rempala, Grzegorz A; Nelson, Peter T; Hetman, Michal


    A next generation bisulfite sequencing (NGBS) was used to study rDNA promoter methylation in human brain using postmortem samples of the parietal cortex. Qualitative analysis of patterns of CpG methylation was performed at the individual rDNA unit level. CpG site-specific differences in methylation frequency were observed with the core promoter harboring three out of four most methylated CpGs. Moreover, there was an overall trend towards co-methylation for all possible pairs of 26 CpG sites. The hypermethylated CpGs from the core promoter were also most likely to be co-methylated. Finally, although rare, non-CpG (CpH) methylation was detected at several sites with one of them confirmed using the PspGI-qPCR assay. Similar trends were observed in samples from control individuals as well as patients suffering of Alzheimer's disease (AD), mild cognitive impairment (MCI) or ataxia telangiectasia (AT). Taken together, while some methyl-CpG sites including those in the core promoter may have relatively greater inhibitory effect on rRNA transcription, co-methylation at multiple sites may be required for full and/or long lasting silencing of human rDNA. PMID:27008990

  18. The cAMP signaling system inhibits the repair of {gamma}-ray-induced DNA damage by promoting Epac1-mediated proteasomal degradation of XRCC1 protein in human lung cancer cells

    SciTech Connect

    Cho, Eun-Ah; Juhnn, Yong-Sung


    Highlights: Black-Right-Pointing-Pointer cAMP signaling system inhibits repair of {gamma}-ray-induced DNA damage. Black-Right-Pointing-Pointer cAMP signaling system inhibits DNA damage repair by decreasing XRCC1 expression. Black-Right-Pointing-Pointer cAMP signaling system decreases XRCC1 expression by promoting its proteasomal degradation. Black-Right-Pointing-Pointer The promotion of XRCC1 degradation by cAMP signaling system is mediated by Epac1. -- Abstract: Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNA repair activity, and we investigated the effects of the cAMP signaling system on {gamma}-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (G{alpha}sQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of G{alpha}sQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after {gamma}-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2 Prime -O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2 Prime -O-Me-cAMP and restored XRCC1 protein level following {gamma}-ray irradiation. From

  19. Downregulation of the DNA repair enzyme apurinic/apyrimidinic endonuclease 1 stimulates transforming growth factor-β1 production and promotes actin rearrangement.


    Sakai, Yuri; Yamamori, Tohru; Yasui, Hironobu; Inanami, Osamu


    The DNA repair enzyme apurinic/apyrimidinic endonuclease 1 (APE1) plays a central role in base excision repair and functions as a reductive activator of various transcription factors. Multiple other functionalities have been ascribed to APE1 in addition to these major functions. A recent study showed that APE1 knockdown upregulated the expression of a set of genes related to extracellular matrix (ECM) production, indicating an additional novel biological role for this enzyme. Based on this finding, we have investigated the effect of APE1 downregulation on ECM-related gene expression and its biological consequences. Endogenous APE1 expression was downregulated in human cervical carcinoma HeLa cells and human lung carcinoma A549 cells using siRNA. When the expression of six ECM-related genes (TGFB1, LAMC1, FN1, COL1A1, COL3A1, and COL4A1) was evaluated, we found that APE1 knockdown upregulated the expression of TGFB1 in both cell lines. APE1 downregulation promoted actin rearrangement, inducing F-actin accumulation in HeLa cells and the dissipation of stress fibers in A549 cells. We also discovered that APE1 knockdown enhanced cellular motility in A549 cells, which was suppressed by the inhibition of transforming growth factor (TGF)-β1 signaling. These results suggested that APE1 controls the organization of actin cytoskeleton through the regulation of TGF-β1 expression, providing novel insights into the biological significance of APE1. PMID:25858321

  20. Inhibition of Homologous Recombination and Promotion of Mutagenic Repair of DNA Double-Strand Breaks Underpins Arabinoside-Nucleoside Analogue Radiosensitization.


    Magin, Simon; Papaioannou, Maria; Saha, Janapriya; Staudt, Christian; Iliakis, George


    In concurrent chemoradiotherapy, drugs are used to sensitize tumors to ionizing radiation. Although a spectrum of indications for simultaneous treatment with drugs and radiation has been defined, the molecular mechanisms underpinning tumor radiosensitization remain incompletely characterized for several such combinations. Here, we investigate the mechanisms of radiosensitization by the arabinoside nucleoside analogue 9-β-D-arabinofuranosyladenine (araA) placing particular emphasis on the repair of DNA double-strand breaks (DSB), and compare the results to those obtained with fludarabine (F-araA) and cytarabine (araC). Postirradiation treatment with araA strongly sensitizes cells to ionizing radiation, but leaves unchanged DSB repair by NHEJ in logarithmically growing cells, in sorted G1 or G2 phase populations, as well as in cells in the plateau phase of growth. Notably, araA strongly inhibits DSB repair by homologous recombination (HRR), as assessed by scoring ionizing radiation-induced RAD51 foci, and in functional assays using integrated reporter constructs. Cells compromised in HRR by RNAi-mediated transient knockdown of RAD51 show markedly reduced radiosensitization after treatment with araA. Remarkably, mutagenic DSB repair compensates for HRR inhibition in araA-treated cells. Compared with araA, F-araA and araC are only modestly radiosensitizing under the conditions examined. We propose that the radiosensitizing potential of nucleoside analogues is linked to their ability to inhibit HRR and concomitantly promote the error-prone processing of DSBs. Our observations pave the way to treatment strategies harnessing the selective inhibitory potential of nucleoside analogues and the development of novel compounds specifically utilizing HRR inhibition as a means of tumor cell radiosensitization. PMID:25840584

  1. Loss of p21{sup Sdi1} expression in senescent cells after DNA damage accompanied with increase of miR-93 expression and reduced p53 interaction with p21{sup Sdi1} gene promoter

    SciTech Connect

    Choi, Ok Ran; Lim, In Kyoung


    Highlights: {yields} Reduced p21 expression in senescent cells treated with DNA damaging agents. {yields} Increase of [{sup 3}H]thymidine and BrdU incorporations in DNA damaged-senescent cells. {yields} Upregulation of miR-93 expression in senescent cells in response to DSB. {yields} Failure of p53 binding to p21 promoter in senescent cells in response to DSB. {yields} Molecular mechanism of increased cancer development in aged than young individuals. -- Abstract: To answer what is a critical event for higher incidence of tumor development in old than young individuals, primary culture of human diploid fibroblasts were employed and DNA damage was induced by doxorubicin or X-ray irradiation. Response to the damage was different between young and old cells; loss of p21{sup sdi1} expression in spite of p53{sup S15} activation in old cells along with [{sup 3}H]thymidine and BrdU incorporation, but not in young cells. The phenomenon was confirmed by other tissue fibroblasts obtained from different donor ages. Induction of miR-93 expression and reduced p53 binding to p21 gene promoter account for loss of p21{sup sdi1} expression in senescent cells after DNA damage, suggesting a mechanism of in vivo carcinogenesis in aged tissue without repair arrest.

  2. Short-Fragment DNA Residue from Vaccine Purification Processes Promotes Immune Response to the New Inactivated EV71 Vaccine by Upregulating TLR9 mRNA

    PubMed Central

    Shao, Jie; Gao, Fan; Lin, Hui-Juan; Mao, Qun-Ying; Chen, Pan; Wu, Xing; Yao, Xin; Kong, Wei; Liang, Zheng-Lun


    To reduce potential oncogenic long genomic DNA in vaccines, nuclease treatment has been applied in the purification processes. However, this action increased the residue of short-fragment DNA and its effect on vaccine potency was still elusive. In this study, we found residual sf-DNA in an inactivated EV71 vaccine could enhance humoral immune response in mice. Ag stimulation in vitro and vaccine injection in vivo revealed that TLR9 transcription level was elevated, indicating that sf-DNA could activate TLR9. These new findings will help us to understand the molecular mechanism induced by vero-cell culture-derived vaccines. PMID:27082865

  3. Short-Fragment DNA Residue from Vaccine Purification Processes Promotes Immune Response to the New Inactivated EV71 Vaccine by Upregulating TLR9 mRNA.


    Shao, Jie; Gao, Fan; Lin, Hui-Juan; Mao, Qun-Ying; Chen, Pan; Wu, Xing; Yao, Xin; Kong, Wei; Liang, Zheng-Lun


    To reduce potential oncogenic long genomic DNA in vaccines, nuclease treatment has been applied in the purification processes. However, this action increased the residue of short-fragment DNA and its effect on vaccine potency was still elusive. In this study, we found residual sf-DNA in an inactivated EV71 vaccine could enhance humoral immune response in mice. Ag stimulation in vitro and vaccine injection in vivo revealed that TLR9 transcription level was elevated, indicating that sf-DNA could activate TLR9. These new findings will help us to understand the molecular mechanism induced by vero-cell culture-derived vaccines. PMID:27082865

  4. T(lys), a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes.


    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta; Contursi, Patrizia


    While studying the gene expression of the Sulfolobus spindle-shaped virus 1 (SSV1) in Sulfolobus solfataricus lysogenic cells, a novel viral transcript (T(lys)) was identified. Transcriptional analysis revealed that T(lys) is expressed only in the absence of UV irradiation and is downregulated during the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and T(ind)) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA-binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and T(ind) transcripts, as well as of its own promoter. Binding sites of F55 are included within a tandem-repeated sequence overlapping the transcription start sites and/or the B recognition element of the pertinent genes. The strongest binding was observed with the promoters of T5 and T6, and an apparent cooperativity in binding was observed with the T(ind) promoter. Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1. PMID:23514883

  5. Reduced function of the RNA-binding protein FPA rescues a T-DNA insertion mutant in the Arabidopsis ZHOUPI gene by promoting transcriptional read-through.


    Zhang, Yaohua; Li, Xin; Goodrich, Justin; Wu, Chunxia; Wei, Haichao; Yang, Suxin; Feng, Xianzhong


    T-DNA insertion mutants have been widely used to investigate plant gene functions. Unexpectedly, in several reported cases, the phenotype of T-DNA insertion mutations can be suppressed because of trans T-DNA interactions associated with epigenetic modification, which indicates that caution is needed when T-DNA mutants are used. In the present study, we characterized a novel process suppressing a T-DNA mutation. The spz2 (suppressor of zou 2) mutant was isolated as a suppressor of the phenotype of the zou-4 mutant caused by a T-DNA insertion in the first intron. The spz2 mutation partially recovered the native ZOU gene expression in the zou-4 background, but not in two other zou alleles, zou-2 and zou-3, with T-DNAs inserted in the exon and intron, respectively. The suppressed phenotype was inherited in a Mendelian fashion and is not associated with epigenetic modification. The recovery of the native ZOU gene expression in the spz2 zou-4 double mutant is caused by transcriptional read-through of the intronic T-DNA as a result of decreased proximal polyadenylation. SPZ2 encodes an RNA-binding protein, FPA, which is known to regulate polyadenylation site selection. This is the first example of FPA rescuing a T-DNA insertion mutation by affecting the polyadenylation site selection. PMID:27164978

  6. Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Shanak, Siba; Helms, Volkhard


    Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

  7. NRAGE is involved in homologous recombination repair to resist the DNA-damaging chemotherapy and composes a ternary complex with RNF8-BARD1 to promote cell survival in squamous esophageal tumorigenesis.


    Yang, Q; Pan, Q; Li, C; Xu, Y; Wen, C; Sun, F


    NRAGE, a neurotrophin receptor-interacting melanoma antigen-encoding gene homolog, is significantly increased in the nucleus of radioresistant esophageal tumor cell lines and is highly upregulated to promote cell proliferation in esophageal carcinomas (ECs). However, whether the overexpressed NRAGE promotes cell growth by participating in DNA-damage response (DDR) is still unclear. Here we show that NRAGE is required for efficient double-strand breaks (DSBs) repair via homologous recombination repair (HRR) and downregulation of NRAGE greatly sensitizes EC cells to DNA-damaging agents both in vitro and in vivo. Moreover, NRAGE not only regulates the stability of DDR factors, RNF8 and BARD1, in a ubiquitin-proteolytic pathway, but also chaperons the interaction between BARD1 and RNF8 via their RING domains to form a novel ternary complex. Additionally, the expression of NRAGE is closely correlated with RNF8 and BARD1 in esophageal tumor tissues. In summary, our findings reveal a novel function of NRAGE that will help to guide personalized esophageal cancer treatments by targeting NRAGE to increase cell sensitivity to DNA-dama