Sample records for 15-lox-1 promoter dna

  1. DNA signals at isoform promoters

    PubMed Central

    Dai, Zhiming; Xiong, Yuanyan; Dai, Xianhua


    Transcriptional heterogeneity is extensive in the genome, and most genes express variable transcript isoforms. However, whether variable transcript isoforms of one gene are regulated by common promoter elements remain to be elucidated. Here, we investigated whether isoform promoters of one gene have separated DNA signals for transcription and translation initiation. We found that TATA box and nucleosome-disfavored DNA sequences are prevalent in distinct transcript isoform promoters of one gene. These DNA signals are conserved among species. Transcript isoform has a RNA-determined unstructured region around its start site. We found that these DNA/RNA features facilitate isoform transcription and translation. These results suggest a DNA-encoded mechanism by which transcript isoform is generated. PMID:27353836

  2. Autophagy promotes DNA-protein crosslink clearance.


    Mu, Haibo; Liu, Qianjin; Niu, Hong; Wang, Dongdong; Tang, Jiangjiang; Duan, Jinyou


    Toxic DNA-protein crosslinks (DPCs) can result from exposure to radiation or chemotherapeutic agents. DPCs can also accumulate during aging or stress. However, the cellular mechanisms underlying clearance of DPCs remain largely unknown. Here, we have identified an important role of autophagy in the processing of DPCs induced by three representative agents: formaldehyde, a chemical used widely in industry; UV light; and camptothecin, a cytotoxic anticancer drug. Autophagy inhibitors, 3-methyladenine (3-MA) or chloroquine (CQ), promoted the accumulation of DPCs in damaged cells and injured organs. siRNA-mediated silencing of Atg5 or Atg7, two essential components for the formation of the autophagosome, gave similar results. In contrast, the autophagy inducer rapamycin (RAP) attenuated DPCs in vitro and in vivo. Our findings reveal the importance of autophagy in controlling the level of DPCs, and may open up a new avenue for understanding the formation and clearance of this detrimental DNA adduct. PMID:26921017

  3. UV damage in DNA promotes nucleosome unwrapping.


    Duan, Ming-Rui; Smerdon, Michael J


    The association of DNA with histones in chromatin impedes DNA repair enzymes from accessing DNA lesions. Nucleosomes exist in a dynamic equilibrium in which portions of the DNA molecule spontaneously unwrap, transiently exposing buried DNA sites. Thus, nucleosome dynamics in certain regions of chromatin may provide the exposure time and space needed for efficient repair of buried DNA lesions. We have used FRET and restriction enzyme accessibility to study nucleosome dynamics following DNA damage by UV radiation. We find that FRET efficiency is reduced in a dose-dependent manner, showing that the presence of UV photoproducts enhances spontaneous unwrapping of DNA from histones. Furthermore, this UV-induced shift in unwrapping dynamics is associated with increased restriction enzyme accessibility of histone-bound DNA after UV treatment. Surprisingly, the increased unwrapping dynamics is even observed in nucleosome core particles containing a single UV lesion at a specific site. These results highlight the potential for increased "intrinsic exposure" of nucleosome-associated DNA lesions in chromatin to repair proteins. PMID:20562439

  4. DNA Methylation Profile at the DNMT3L Promoter

    PubMed Central

    Gokul, Gopinathan; Gautami, Bhimana; Malathi, Surapaneni; Sowjanya, A. Pavani; Poli, Usha Rani; Jain, Meenakshi; Ramakrishna, Gayatri; Khosla, Sanjeev


    Epigenetic events play a prominent role during cancer development. This is evident from the fact that almost all cancer types show aberrant DNA methylation. These abnormal DNA methylation levels are not restricted to just a few genes but affect the whole genome. Previous studies have shown genome-wide DNA hypomethylation and gene-specific hypermethylation to be a hallmark of most cancers. Molecules like DNA methyltransferase act as effectors of epigenetic reprogramming. In the present study we have examined the possibility that the reprogramming genes themselves undergo epigenetic modifications reflecting their changed transcriptional status during cancer development. Comparison of DNA methylation status between the normal and cervical cancer samples was carried out at the promoters of a few reprogramming molecules. Our study revealed statistically significant DNA methylation differences within the promoter of DNMT3L. A regulator of de novo DNA methyltransferases DNMT3A and DNMT3B, DNMT3L promoter was found to have lost DNA methylation to varying levels in 14 out of 15 cancer cervix samples analysed. The present study highlights the importance of DNA methylation profile at DNMT3L promoter not only as a promising biomarker for cervical cancer, which is the second most common cancer among women worldwide, but also provides insight into the possible role of DNMT3L in cancer development. PMID:17965599

  5. Common DNA structural features exhibited by eukaryotic ribosomal gene promoters.

    PubMed Central

    Marilley, M; Pasero, P


    Nucleotide sequences of DNA regions containing eukaryotic ribosomal promoters were analysed using strategies designed to reveal sequence-directed structural features. DNA curvature, duplex stability and pattern of twist angle variation were studied by computer modelling. Although ribosomal promoters are known to lack sequence homology (unless very closely related species are considered), investigation of these structural characteristics uncovered striking homologies in all the taxonomic groups examined so far. This wide conservation of DNA structures, while DNA sequence is not conserved, suggests that the determined structures are fundamental for ribosomal promoter function. Moreover, this result agrees well with the recent observations showing that RNA polymerase I transcription factors have not evolved as intensively as previously suspected. PMID:8710487

  6. Chromatin and DNA sequences in defining promoters for transcription initiation.


    Müller, Ferenc; Tora, Làszlò


    One of the key events in eukaryotic gene regulation and consequent transcription is the assembly of general transcription factors and RNA polymerase II into a functional pre-initiation complex at core promoters. An emerging view of complexity arising from a variety of promoter associated DNA motifs, their binding factors and recent discoveries in characterising promoter associated chromatin properties brings an old question back into the limelight: how is a promoter defined? In addition to position-dependent DNA sequence motifs, accumulating evidence suggests that several parallel acting mechanisms are involved in orchestrating a pattern marked by the state of chromatin and general transcription factor binding in preparation for defining transcription start sites. In this review we attempt to summarise these promoter features and discuss the available evidence pointing at their interactions in defining transcription initiation in developmental contexts. This article is part of a Special Issue entitled: Chromatin and epigenetic regulation of animal development.

  7. Equilibrious Strand Exchange Promoted by DNA Conformational Switching

    NASA Astrophysics Data System (ADS)

    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang


    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.

  8. Bayesian classification for promoter prediction in human DNA sequences

    NASA Astrophysics Data System (ADS)

    Bercher, J.-F.; Jardin, P.; Duriez, B.


    Many Computational methods are yet available for data retrieval and analysis of genomic sequences, but some functional sites are difficult to characterize. In this work, we examine the problem of promoter localization in human DNA sequences. Promoters are regulatory regions that governs the expression of genes, and their prediction is reputed difficult, so that this issue is still open. We present the Chaos Game representation (CGR) of DNA sequences which has many interesting properties, and the notion of `genomic signature' that proved relevant in phylogeny applications. Based on this notion, we develop a (naïve) bayesian classifier, evaluate its performances, and show that its adaptive implementation enable to reveal or assess core-promoter positions along a DNA sequence.

  9. Prediction of fine-tuned promoter activity from DNA sequence.


    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael


    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  10. Prediction of fine-tuned promoter activity from DNA sequence

    PubMed Central

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael


    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  11. Oxidation of DNA bases by tumor promoter-activated processes.

    PubMed Central

    Frenkel, K


    Evidence has accumulated showing that active oxygen species participate in at least one stage of tumor promotion. Tumor promoters can induce various types of cells to undergo processes that result in formation of active oxygen species. They stimulate polymorphonuclear leukocytes (PMNs) to undergo an oxidative burst that is characterized by rapid formation of .O2- and H2O2. We find that in vitro formation of H2O2 by tumor promoter-activated PMNs correlates with their in vivo first-stage promoting activity. Moreover, two thymidine derivatives are formed in DNA coincubated with tumor promoter-stimulated PMNs: 5-hydroxymethyl-2'-deoxyuridine (HMdU) and thymidine glycol (dTG). The amounts of HMdU and dTG formed correlate with the first-stage tumor-promoting potencies of the agents used for PMN stimulation and with the amount of H2O2 generated. We find that HMdU is also formed in the DNA of HeLa cells coincubated with 12-O-tetradecanoylphorbol-13-acetate (TPA)-activated PMNs, with the amount of HMdU being proportional to that of TPA used. Even in the absence of PMNs, HMdU is increasingly formed in cellular DNA with increased TPA concentration, although at much lower levels than in the presence of PMNs. When rat liver microsomes are incubated with benzo[a]pyrene (BaP), a complete carcinogen, H2O2 is also generated. Production of H2O2 increases linearly with increasing concentrations of BaP. Furthermore, HMdU is formed in DNA exposed to BaP-treated microsomes, and its formation is inhibited by catalase. These results suggest that carcinogen-induced processes generating H2O2 are associated with the first-stage promoting activity of complete carcinogens. PMID:2667984

  12. Mechanism of promoter repression by Lac repressor-DNA loops.


    Becker, Nicole A; Peters, Justin P; Maher, L James; Lionberger, Troy A


    The Escherichia coli lactose (lac) operon encodes the first genetic switch to be discovered, and lac remains a paradigm for studying negative and positive control of gene expression. Negative control is believed to involve competition of RNA polymerase and Lac repressor for overlapping binding sites. Contributions to the local Lac repressor concentration come from free repressor and repressor delivered to the operator from remote auxiliary operators by DNA looping. Long-standing questions persist concerning the actual role of DNA looping in the mechanism of promoter repression. Here, we use experiments in living bacteria to resolve four of these questions. We show that the distance dependence of repression enhancement is comparable for upstream and downstream auxiliary operators, confirming the hypothesis that repressor concentration increase is the principal mechanism of repression loops. We find that as few as four turns of DNA can be constrained in a stable loop by Lac repressor. We show that RNA polymerase is not trapped at repressed promoters. Finally, we show that constraining a promoter in a tight DNA loop is sufficient for repression even when promoter and operator do not overlap. PMID:23143103

  13. Impaired DNA replication within progenitor cell pools promotes leukemogenesis.


    Bilousova, Ganna; Marusyk, Andriy; Porter, Christopher C; Cardiff, Robert D; DeGregori, James


    Impaired cell cycle progression can be paradoxically associated with increased rates of malignancies. Using retroviral transduction of bone marrow progenitors followed by transplantation into mice, we demonstrate that inhibition of hematopoietic progenitor cell proliferation impairs competition, promoting the expansion of progenitors that acquire oncogenic mutations which restore cell cycle progression. Conditions that impair DNA replication dramatically enhance the proliferative advantage provided by the expression of Bcr-Abl or mutant p53, which provide no apparent competitive advantage under conditions of healthy replication. Furthermore, for the Bcr-Abl oncogene the competitive advantage in contexts of impaired DNA replication dramatically increases leukemogenesis. Impaired replication within hematopoietic progenitor cell pools can select for oncogenic events and thereby promote leukemia, demonstrating the importance of replicative competence in the prevention of tumorigenesis. The demonstration that replication-impaired, poorly competitive progenitor cell pools can promote tumorigenesis provides a new rationale for links between tumorigenesis and common human conditions of impaired DNA replication such as dietary folate deficiency, chemotherapeutics targeting dNTP synthesis, and polymorphisms in genes important for DNA metabolism. PMID:16277552

  14. Promoting DNA loading on magnetic nanoparticles using a DNA condensation strategy.


    Shan, Zhi; Jiang, Youjun; Guo, Mengyu; Bennett, J Craig; Li, Xianghai; Tian, Hefeng; Oakes, Ken; Zhang, Xu; Zhou, Yi; Huang, Qianming; Chen, Huaping


    Maximizing DNA loading on magnetic nanoparticles (MNPs) is crucial for their successful utilization in gene transfer, DNA isolation, and bio-analytical applications. This enhancement is typically achieved by altering particle size and surfaces as well as charge density and ionic strength. We demonstrate a novel route for promoting DNA loading on amino-modified silica-coated magnetic nanoparticles (ASMNPs) by prior condensation of elongated DNA to a compact globule before adsorption. The enhanced DNA-loading capacity, as demonstrated by a reduction in the number of ASMNPs needed to achieve complexation, was presumably due to the elimination of DNA wrapping around nanoparticles and substantially reduced electrostatic interactions of DNA with nanoparticles because the compacted DNA globule conformation decreases its exposed surface charge. The maximum loading capacity of ASMNPs for condensed DNA was 4.4 times greater than that for elongated coiled DNA, achieving the highest ever reported value of 385 μg mg(-1). Practical applications for plasmid DNA isolation from cleared lysate confirmed the reliability of the proposed method. PMID:25454752

  15. Promoter DNA Hypermethylation and Gene Repression in Undifferentiated Arabidopsis Cells

    PubMed Central

    Berdasco, María; Alcázar, Rubén; García-Ortiz, María Victoria; Ballestar, Esteban; Fernández, Agustín F.; Roldán-Arjona, Teresa; Tiburcio, Antonio F.; Altabella, Teresa; Buisine, Nicolas; Quesneville, Hadi; Baudry, Antoine; Lepiniec, Loïc; Alaminos, Miguel; Rodríguez, Roberto; Lloyd, Alan; Colot, Vincent; Bender, Judith; Canal, María Jesús; Esteller, Manel; Fraga, Mario F.


    Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells. PMID:18827894

  16. Rad52-mediated DNA annealing after Rad51-mediated DNA strand exchange promotes second ssDNA capture.


    Sugiyama, Tomohiko; Kantake, Noriko; Wu, Yun; Kowalczykowski, Stephen C


    Rad51, Rad52, and RPA play central roles in homologous DNA recombination. Rad51 mediates DNA strand exchange, a key reaction in DNA recombination. Rad52 has two distinct activities: to recruit Rad51 onto single-strand (ss)DNA that is complexed with the ssDNA-binding protein, RPA, and to anneal complementary ssDNA complexed with RPA. Here, we report that Rad52 promotes annealing of the ssDNA strand that is displaced by DNA strand exchange by Rad51 and RPA, to a second ssDNA strand. An RPA that is recombination-deficient (RPA(rfa1-t11)) failed to support annealing, explaining its in vivo phenotype. Escherichia coli RecO and SSB proteins, which are functional homologues of Rad52 and RPA, also facilitated the same reaction, demonstrating its conserved nature. We also demonstrate that the two activities of Rad52, recruiting Rad51 and annealing DNA, are coordinated in DNA strand exchange and second ssDNA capture. PMID:17093500

  17. Gadd45a promotes DNA demethylation through TDG

    PubMed Central

    Li, Zheng; Gu, Tian-Peng; Weber, Alain R.; Shen, Jia-Zhen; Li, Bin-Zhong; Xie, Zhi-Guo; Yin, Ruichuan; Guo, Fan; Liu, Xiaomeng; Tang, Fuchou; Wang, Hailin; Schär, Primo; Xu, Guo-Liang


    Growth arrest and DNA-damage-inducible protein 45 (Gadd45) family members have been implicated in DNA demethylation in vertebrates. However, it remained unclear how they contribute to the demethylation process. Here, we demonstrate that Gadd45a promotes active DNA demethylation through thymine DNA glycosylase (TDG) which has recently been shown to excise 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) generated in Ten-eleven-translocation (Tet)—initiated oxidative demethylation. The connection of Gadd45a with oxidative demethylation is evidenced by the enhanced activation of a methylated reporter gene in HEK293T cells expressing Gadd45a in combination with catalytically active TDG and Tet. Gadd45a interacts with TDG physically and increases the removal of 5fC and 5caC from genomic and transfected plasmid DNA by TDG. Knockout of both Gadd45a and Gadd45b from mouse ES cells leads to hypermethylation of specific genomic loci most of which are also targets of TDG and show 5fC enrichment in TDG-deficient cells. These observations indicate that the demethylation effect of Gadd45a is mediated by TDG activity. This finding thus unites Gadd45a with the recently defined Tet-initiated demethylation pathway. PMID:25845601

  18. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining

    PubMed Central

    Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom


    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724

  19. Generic eukaryotic core promoter prediction using structural features of DNA.


    Abeel, Thomas; Saeys, Yvan; Bonnet, Eric; Rouzé, Pierre; Van de Peer, Yves


    Despite many recent efforts, in silico identification of promoter regions is still in its infancy. However, the accurate identification and delineation of promoter regions is important for several reasons, such as improving genome annotation and devising experiments to study and understand transcriptional regulation. Current methods to identify the core region of promoters require large amounts of high-quality training data and often behave like black box models that output predictions that are difficult to interpret. Here, we present a novel approach for predicting promoters in whole-genome sequences by using large-scale structural properties of DNA. Our technique requires no training, is applicable to many eukaryotic genomes, and performs extremely well in comparison with the best available promoter prediction programs. Moreover, it is fast, simple in design, and has no size constraints, and the results are easily interpretable. We compared our approach with 14 current state-of-the-art implementations using human gene and transcription start site data and analyzed the ENCODE region in more detail. We also validated our method on 12 additional eukaryotic genomes, including vertebrates, invertebrates, plants, fungi, and protists.

  20. Daxx represses RelB target promoters via DNA methyltransferase recruitment and DNA hypermethylation

    PubMed Central

    Puto, Lorena A.; Reed, John C.


    The apoptosis-modulating protein Daxx functions as a transcriptional repressor that binds to and suppresses the activity of nuclear factor-κB member RelB, among other transcription factors. The mechanism by which Daxx represses RelB target genes remains elusive. In this report, we demonstrate that Daxx controls epigenetic silencing of RelB target genes by DNA methylation. Daxx potently represses the RelB target genes dapk1, dapk3, c-flip, and birc3 (ciap2) at both the mRNA and protein levels. Recruitment of Daxx to target gene promoters, and its ability to repress them, is RelB-dependent, as shown by experiments using relB−/− cells. Importantly, methylation of target promoters is decreased in daxx−/− cells compared with daxx+/+ cells, and stable transfection of daxx−/− cells with Daxx restores DNA methylation. Furthermore, Daxx recruits DNA methyl transferase 1 (Dnmt1) to target promoters, resulting in synergistic repression. The observation that Daxx functions to target DNA methyltransferases onto RelB target sites in the genome provides a rare example of a gene-specific mechanism for epigenetic silencing. Given the documented role of several of the RelB-regulated genes in diseases, particularly cancer, the findings have implications for developing therapeutic strategies based on epigenetic-modifying drugs. PMID:18413714

  1. SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing

    NASA Astrophysics Data System (ADS)

    Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team

    Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.

  2. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks.


    Lu, Huiming; Shamanna, Raghavendra A; Keijzers, Guido; Anand, Roopesh; Rasmussen, Lene Juel; Cejka, Petr; Croteau, Deborah L; Bohr, Vilhelm A


    The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR)-dependent DNA double-strand break repair (DSBR). Depletion of RECQL4 severely reduces HR-mediated repair and 5' end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN), which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4's helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4's unwinding activity in the process. Thus, we report that RECQL4 is an important participant in HR-dependent DSBR.

  3. Promoters responsive to DNA bending: a common theme in prokaryotic gene expression.

    PubMed Central

    Pérez-Martín, J; Rojo, F; de Lorenzo, V


    The early notion of DNA as a passive target for regulatory proteins has given way to the realization that higher-order DNA structures and DNA-protein complexes are at the basis of many molecular processes, including control of promoter activity. Protein binding may direct the bending of an otherwise linear DNA, exacerbate the angle of an intrinsic bend, or assist the directional flexibility of certain sequences within prokaryotic promoters. The important, sometimes essential role of intrinsic or protein-induced DNA bending in transcriptional regulation has become evident in virtually every system examined. As discussed throughout this article, not every function of DNA bends is understood, but their presence has been detected in a wide variety of bacterial promoters subjected to positive or negative control. Nonlinear DNA structures facilitate and even determine proximal and distal DNA-protein and protein-protein contacts involved in the various steps leading to transcription initiation. PMID:8078436

  4. Double-stranded DNA stereoselectively promotes aggregation of amyloid-like fibrils and generates peptide/DNA matrices.


    Yamada, Masanori; Hara, Sachiko; Yamada, Tetsuya; Katagiri, Fumihiko; Hozumi, Kentaro; Nomizu, Motoyoshi


    An amyloidogenic LAM-L peptide (AASIKVAVSADR, all-L configuration) derived from laminin promoted cell adhesion, neurite outgrowth, and angiogenesis. Here, we prepared novel matrices using double-stranded DNA and the LAM-L peptide. Double-stranded DNA promoted aggregation of amyloid-like fibrils and generated a LAM-L/DNA matrix through electrostatic interactions between the phosphate groups of DNA and the amino groups of LAM-L. This formation of peptide/DNA matrix depends on the Ile-Lys-Val-Ala-Val (IKVAV) sequence in the peptide, since LAM-RM peptide (AASVVIAKSADR), which is scrambled peptide of LAM-L, did not form a matrix with DNA. Further, LAM-D (all-D configuration of LAM-L), which forms amyloid-like fibrils and promotes similar biological activities as LAM-L, did not form amyloid-like fibrils with DNA, suggesting that DNA selectively interacts with the L-configured peptide. Moreover, the LAM-L/DNA matrices showed stronger cell attachment activity compared with LAM-L alone, suggesting the LAM-L/DNA matrices have potential for use as a novel biomaterial in tissue engineering.

  5. Genome-wide Mapping Reveals Conservation of Promoter DNA Methylation Following Chicken Domestication

    PubMed Central

    Li, Qinghe; Wang, Yuanyuan; Hu, Xiaoxiang; Zhao, Yaofeng; Li, Ning


    It is well-known that environment influences DNA methylation, however, the extent of heritable DNA methylation variation following animal domestication remains largely unknown. Using meDIP-chip we mapped the promoter methylomes for 23,316 genes in muscle tissues of ancestral and domestic chickens. We systematically examined the variation of promoter DNA methylation in terms of different breeds, differentially expressed genes, SNPs and genes undergo genetic selection sweeps. While considerable changes in DNA sequence and gene expression programs were prevalent, we found that the inter-strain DNA methylation patterns were highly conserved in promoter region between the wild and domestic chicken breeds. Our data suggests a global preservation of DNA methylation between the wild and domestic chicken breeds in either a genome-wide or locus-specific scale in chick muscle tissues. PMID:25735894

  6. Genome-wide mapping reveals conservation of promoter DNA methylation following chicken domestication.


    Li, Qinghe; Wang, Yuanyuan; Hu, Xiaoxiang; Zhao, Yaofeng; Li, Ning


    It is well-known that environment influences DNA methylation, however, the extent of heritable DNA methylation variation following animal domestication remains largely unknown. Using meDIP-chip we mapped the promoter methylomes for 23,316 genes in muscle tissues of ancestral and domestic chickens. We systematically examined the variation of promoter DNA methylation in terms of different breeds, differentially expressed genes, SNPs and genes undergo genetic selection sweeps. While considerable changes in DNA sequence and gene expression programs were prevalent, we found that the inter-strain DNA methylation patterns were highly conserved in promoter region between the wild and domestic chicken breeds. Our data suggests a global preservation of DNA methylation between the wild and domestic chicken breeds in either a genome-wide or locus-specific scale in chick muscle tissues.

  7. The DNA helicase Pfh1 promotes fork merging at replication termination sites to ensure genome stability.


    Steinacher, Roland; Osman, Fekret; Dalgaard, Jacob Z; Lorenz, Alexander; Whitby, Matthew C


    Bidirectionally moving DNA replication forks merge at termination sites composed of accidental or programmed DNA-protein barriers. If merging fails, then regions of unreplicated DNA can result in the breakage of DNA during mitosis, which in turn can give rise to genome instability. Despite its importance, little is known about the mechanisms that promote the final stages of fork merging in eukaryotes. Here we show that the Pif1 family DNA helicase Pfh1 plays a dual role in promoting replication fork termination. First, it facilitates replication past DNA-protein barriers, and second, it promotes the merging of replication forks. A failure of these processes in Pfh1-deficient cells results in aberrant chromosome segregation and heightened genome instability.

  8. Genistein promotes DNA demethylation of the steroidogenic factor 1 (SF-1) promoter in endometrial stromal cells

    SciTech Connect

    Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko


    Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.

  9. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.


    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong


    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  10. Bacterial promoter repression by DNA looping without protein-protein binding competition.


    Becker, Nicole A; Greiner, Alexander M; Peters, Justin P; Maher, L James


    The Escherichia coli lactose operon provides a paradigm for understanding gene control by DNA looping where the lac repressor (LacI) protein competes with RNA polymerase for DNA binding. Not all promoter loops involve direct competition between repressor and RNA polymerase. This raises the possibility that positioning a promoter within a tightly constrained DNA loop is repressive per se, an idea that has previously only been considered in vitro. Here, we engineer living E. coli bacteria to measure repression due to promoter positioning within such a tightly constrained DNA loop in the absence of protein-protein binding competition. We show that promoters held within such DNA loops are repressed ∼100-fold, with up to an additional ∼10-fold repression (∼1000-fold total) dependent on topological positioning of the promoter on the inner or outer face of the DNA loop. Chromatin immunoprecipitation data suggest that repression involves inhibition of both RNA polymerase initiation and elongation. These in vivo results show that gene repression can result from tightly looping promoter DNA even in the absence of direct competition between repressor and RNA polymerase binding. PMID:24598256

  11. DNA twist, flexibility and transcription of the osmoregulated proU promoter of Salmonella typhimurium.

    PubMed Central

    Jordi, B J; Owen-Hughes, T A; Hulton, C S; Higgins, C F


    Transcription from many bacterial promoters is sensitive to the level of DNA supercoiling. We have investigated the mechanism by which environmentally induced changes in DNA supercoiling might regulate transcription. For the proU promoter of Salmonella typhimurium, osmotically induced changes in DNA topology appear to play a primary regulatory role. Changes in DNA supercoiling (linking number; delta Lk) are partitioned into changes in the winding of the strands of the double helix about themselves (twist; delta Tw) and/or elastic deformations or flexibility of the DNA helix (writhe; delta Wr). Mutations of the proU promoter were isolated in vivo, or generated in vitro, which altered the spacing between the -10 and -35 motifs. Studies on these mutant promoters, both in vivo and in vitro, exclude models in which changes in DNA twist play a regulatory role. Instead, our data suggest that increased DNA flexibility, reflecting the osmotically induced increase in negative supercoiling of DNA, is required for promoter activation. Images PMID:8521826

  12. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    PubMed Central

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai


    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  13. Defective removal of ribonucleotides from DNA promotes systemic autoimmunity

    PubMed Central

    Günther, Claudia; Kind, Barbara; Reijns, Martin A.M.; Berndt, Nicole; Martinez-Bueno, Manuel; Wolf, Christine; Tüngler, Victoria; Chara, Osvaldo; Lee, Young Ae; Hübner, Norbert; Bicknell, Louise; Blum, Sophia; Krug, Claudia; Schmidt, Franziska; Kretschmer, Stefanie; Koss, Sarah; Astell, Katy R.; Ramantani, Georgia; Bauerfeind, Anja; Morris, David L.; Cunninghame Graham, Deborah S.; Bubeck, Doryen; Leitch, Andrea; Ralston, Stuart H.; Blackburn, Elizabeth A.; Gahr, Manfred; Witte, Torsten; Vyse, Timothy J.; Melchers, Inga; Mangold, Elisabeth; Nöthen, Markus M.; Aringer, Martin; Kuhn, Annegret; Lüthke, Kirsten; Unger, Leonore; Bley, Annette; Lorenzi, Alice; Isaacs, John D.; Alexopoulou, Dimitra; Conrad, Karsten; Dahl, Andreas; Roers, Axel; Alarcon-Riquelme, Marta E.; Jackson, Andrew P.; Lee-Kirsch, Min Ae


    Genome integrity is continuously challenged by the DNA damage that arises during normal cell metabolism. Biallelic mutations in the genes encoding the genome surveillance enzyme ribonuclease H2 (RNase H2) cause Aicardi-Goutières syndrome (AGS), a pediatric disorder that shares features with the autoimmune disease systemic lupus erythematosus (SLE). Here we determined that heterozygous parents of AGS patients exhibit an intermediate autoimmune phenotype and demonstrated a genetic association between rare RNASEH2 sequence variants and SLE. Evaluation of patient cells revealed that SLE- and AGS-associated mutations impair RNase H2 function and result in accumulation of ribonucleotides in genomic DNA. The ensuing chronic low level of DNA damage triggered a DNA damage response characterized by constitutive p53 phosphorylation and senescence. Patient fibroblasts exhibited constitutive upregulation of IFN-stimulated genes and an enhanced type I IFN response to the immunostimulatory nucleic acid polyinosinic:polycytidylic acid and UV light irradiation, linking RNase H2 deficiency to potentiation of innate immune signaling. Moreover, UV-induced cyclobutane pyrimidine dimer formation was markedly enhanced in ribonucleotide-containing DNA, providing a mechanism for photosensitivity in RNase H2–associated SLE. Collectively, our findings implicate RNase H2 in the pathogenesis of SLE and suggest a role of DNA damage–associated pathways in the initiation of autoimmunity. PMID:25500883

  14. DNA damage promotes Herpes Simplex Virus-1 protein expression in a neuroblastoma cell line

    PubMed Central

    Volcy, Ketna; Fraser, Nigel W.


    Although the induction of the cellular DNA damage response by Herpes simplex virus-1 (HSV-1) infection of epithelial cells in tissue culture promotes productive infection, there has been no experimental observation of the effect of the cellular DNA damage response on HSV-1 infection in vivo or in neuronal derived cell lines in tissue culture. Thus, it has been speculated that the lack of cellular DNA damage induction during infection of neurons may promote latency in these cells. This work examines the profile of HSV-1 promoter induction and protein expression, in the absence or presence of infection; using cellular DNA damage inducing topoisomerase inhibitors (Camptothecin and Etoposide) on a neuroblastoma cell line (C1300) in which HSV-1 infection fails to induce the DNA damage response. In the absence of infection, a plasmid expressing the immediate early ICP0 promoter was the most induced by the DNA damage drug treatments compared to the early (RR) and late (VP16) gene promoters. Similarly, drug treatment of C1300 cells infected with HSV-1 virus showed enhanced protein expression for ICP0, but not ICP4 and VP16 proteins. However, when the cells were infected with a HSV-1 virus defective in the immediate early gene trans-activator VP16 (in814) and treated with the DNA damaging drugs, there was enhanced expression of immediate early and late HSV-1 proteins. Although, viral infection of the neuroblastoma cell alone did not induce DNA damage, cellular DNA damage induced by drug treatments facilitated viral promoter induction and viral protein expression. This implicates a mechanism by which HSV-1 viral genes in a quiescent or latent state may become induced by cellular DNA damage in neuronal cells to facilitate productive infection. PMID:23354549

  15. The suppression and promotion of DNA charge inversion by mixing counterions.


    Qiu, Shixue; Wang, Yanwei; Cao, Bozhi; Guo, Zilong; Chen, Yang; Yang, Guangcan


    In the preset study, we report the suppression and promotion of DNA charge inversion by mixing a quadrivalent counterion (spermine) with mono-, di- and trivalent counterions by dynamic light scattering (DLS) and single molecule electrophoresis (SME) methods. We find that the electrophoretic mobility of DNA in spermine solution decreases in the presence of monovalent sodium ions and divalent magnesium ions. It means that the charge neutralization of DNA by the quadrivalent counterion is suppressed when adding extra mono- or divalent counterions. More specifically, at a high concentration of spermine, the positive mobility can switch back to a negative value by adding mono- and divalent counterions. Thus, charge neutralization and inversion of DNA by quadrivalent counterions is suppressed in the mono- and divalent ion solution. However, the scenario changes dramatically when we add trivalent ions into the solution of DNA and spermine. In this case, the charge neutralization and inversion of DNA is promoted rather than suppressed by mixing with trivalent ions. The negative electrophoretic mobility can be promoted to a positive value, which corresponds to the charge inversion, by trivalent counterions. Thus trivalent and quadrivalent counterions work cooperatively in DNA charge neutralization and inversion. This promotion also occurs when highly positively charged chitosan is introduced into the solution. We explain the observation by the counterion complexation that is related to DNA condensation, which is supported by the images of atomic force microscopy (AFM).

  16. Reversible Regulation of Promoter and Enhancer Histone Landscape by DNA Methylation in Mouse Embryonic Stem Cells.


    King, Andrew D; Huang, Kevin; Rubbi, Liudmilla; Liu, Shuo; Wang, Cun-Yu; Wang, Yinsheng; Pellegrini, Matteo; Fan, Guoping


    DNA methylation is one of a number of modes of epigenetic gene regulation. Here, we profile the DNA methylome, transcriptome, and global occupancy of histone modifications (H3K4me1, H3K4me3, H3K27me3, and H3K27ac) in a series of mouse embryonic stem cells (mESCs) with varying DNA methylation levels to study the effects of DNA methylation on deposition of histone modifications. We find that genome-wide DNA demethylation alters occupancy of histone modifications at both promoters and enhancers. This is reversed upon remethylation by Dnmt expression. DNA methylation promotes H3K27me3 deposition at bivalent promoters, while opposing H3K27me3 at silent promoters. DNA methylation also reversibly regulates H3K27ac and H3K27me3 at previously identified tissue-specific enhancers. These effects require DNMT catalytic activity. Collectively, our data show that DNA methylation is essential and instructive for deposition of specific histone modifications across regulatory regions, which together influences gene expression patterns in mESCs. PMID:27681438

  17. Acoustic stimulation promotes DNA fragmentation in the Guinea pig cochlea.


    Kamio, Tomonobu; Watanabe, Ken-Ichi; Okubo, Kimihiro


    Apoptosis can be described as programmed cell death. Apoptosis regulates cell turnover and is involved in various pathological conditions. The characteristic features of apoptosis are shrinkage of the cell body, chromatin condensation, and nucleic acid fragmentation. During apoptosis, double-stranded DNA is broken down into single-stranded DNA (ssDNA) by proteases. Acoustic trauma is commonly encountered in otorhinolaryngology clinics. Intense noise can cause inner ear damage, such as hearing disturbance, tinnitus, ear fullness, and decreased speech discrimination. In this study, we used immunohistochemical and electrophysiological methods to examine the fragmentation of DNA in the cochleas of guinea pigs that had been exposed to intense noise. Twenty-four guinea pigs weighing 250 to 350 g were used. The animals were divided into 4 groups: (I) a control group (n=6), (II) a group that was exposed to noise for 2 hours (n=6), (III) a group that was exposed to noise for 5 hours (n=6), and (IV) a group that was exposed to noise for 20 hours. The stimulus was a pure tone delivered at a frequency of 2 kHz. The sound pressure level was 120 dBSPL. No threshold shifts were apparent in group I. Group II showed a significant elevation of the hearing threshold (ANOVA, p<0.05(*)). The ABR threshold level was also significantly elevated immediately after the acoustic stimulation in groups III and IV (ANOVA, p<0.01(**)). In groups I, II, and IV, the lateral wall of the ear did not show immunoreactivity to ssDNA but did in group III. No immunoreactivity was apparent in the organ of Corti in group I or II. However, the supporting cells and outer hair cells in groups III and IV showed reactions for ssDNA. The fine structure of the organ of Corti had been destroyed in group IV. The lateral wall showed immunoreactivity for ssDNA only in group III, whereas the organ of Corti showed reactions for ssDNA in groups III and IV. Our study suggests that apoptotic changes occur in patients that

  18. Acoustic stimulation promotes DNA fragmentation in the Guinea pig cochlea.


    Kamio, Tomonobu; Watanabe, Ken-Ichi; Okubo, Kimihiro


    Apoptosis can be described as programmed cell death. Apoptosis regulates cell turnover and is involved in various pathological conditions. The characteristic features of apoptosis are shrinkage of the cell body, chromatin condensation, and nucleic acid fragmentation. During apoptosis, double-stranded DNA is broken down into single-stranded DNA (ssDNA) by proteases. Acoustic trauma is commonly encountered in otorhinolaryngology clinics. Intense noise can cause inner ear damage, such as hearing disturbance, tinnitus, ear fullness, and decreased speech discrimination. In this study, we used immunohistochemical and electrophysiological methods to examine the fragmentation of DNA in the cochleas of guinea pigs that had been exposed to intense noise. Twenty-four guinea pigs weighing 250 to 350 g were used. The animals were divided into 4 groups: (I) a control group (n=6), (II) a group that was exposed to noise for 2 hours (n=6), (III) a group that was exposed to noise for 5 hours (n=6), and (IV) a group that was exposed to noise for 20 hours. The stimulus was a pure tone delivered at a frequency of 2 kHz. The sound pressure level was 120 dBSPL. No threshold shifts were apparent in group I. Group II showed a significant elevation of the hearing threshold (ANOVA, p<0.05(*)). The ABR threshold level was also significantly elevated immediately after the acoustic stimulation in groups III and IV (ANOVA, p<0.01(**)). In groups I, II, and IV, the lateral wall of the ear did not show immunoreactivity to ssDNA but did in group III. No immunoreactivity was apparent in the organ of Corti in group I or II. However, the supporting cells and outer hair cells in groups III and IV showed reactions for ssDNA. The fine structure of the organ of Corti had been destroyed in group IV. The lateral wall showed immunoreactivity for ssDNA only in group III, whereas the organ of Corti showed reactions for ssDNA in groups III and IV. Our study suggests that apoptotic changes occur in patients that

  19. A salmon DNA scaffold promotes osteogenesis through activation of sodium-dependent phosphate cotransporters.


    Katsumata, Yuri; Kajiya, Hiroshi; Okabe, Koji; Fukushima, Tadao; Ikebe, Tetsuro


    We previously reported the promotion of bone regeneration in calvarial defects of both normal and ovariectomy-induced osteoporotic rats, with the use of biodegradable DNA/protamine scaffold. However, the method by which this DNA-containing scaffold promotes bone formation is still not understood. We hypothesize that the salmon DNA, from which this scaffold is derived, has an osteoinductive effect on pre-osteoblasts and osteoblasts. We examined the effects of salmon DNA on osteoblastic differentiation and calcification in MC3T3-E1 cells, mouse osteoblasts, in vitro and bone regeneration in a calvarial defect model of aged mouse in vivo. The salmon DNA fragments (300 bps) upregulated the expression of the osteogenic markers, such as alkaline phosphatase, Runx2, and osterix (Osx) in MC3T3E1 cells compared with incubation with osteogenic induction medium alone. Measurement of phosphate ion concentrations in cultures showed that the DNA scaffold degraded phosphate ions were released to the cell cultures. Interestingly, we found that the inclusion of DNA in osteoblastic cell cultures upregulated the expression of sodium-dependent phosphate (NaPi) cotransporters, SLC20A1 and SLC34A2, in MC3T3-E1 cells in a time dependent manner. Furthermore, the inclusion of DNA in cell cultures increased the transcellular permeability of phosphate. Conversely, the incubation of phosphonoformic acid, an inhibitor of NaPi cotransporters, attenuated the DNA-induced expression and activation of SLC20A1 and SLC34A2 in MC3T3-E1 cells, resulting in suppression of the osteogenic markers. The implantation of a salmon DNA scaffold disk promoted bone regeneration using calvarial defect models in 30-week-old mice. Our results indicate that the phosphate released from salmon DNA upregulated the expression and activation of NaPi cotransporters, resulting in the promotion of bone regeneration. PMID:26551467

  20. Human FAN1 promotes strand incision in 5'-flapped DNA complexed with RPA.


    Takahashi, Daisuke; Sato, Koichi; Hirayama, Emiko; Takata, Minoru; Kurumizaka, Hitoshi


    Fanconi anaemia (FA) is a human infantile recessive disorder. Seventeen FA causal proteins cooperatively function in the DNA interstrand crosslink (ICL) repair pathway. Dual DNA strand incisions around the crosslink are critical steps in ICL repair. FA-associated nuclease 1 (FAN1) is a DNA structure-specific endonuclease that is considered to be involved in DNA incision at the stalled replication fork. Replication protein A (RPA) rapidly assembles on the single-stranded DNA region of the stalled fork. However, the effect of RPA on the FAN1-mediated DNA incision has not been determined. In this study, we purified human FAN1, as a bacterially expressed recombinant protein. FAN1 exhibited robust endonuclease activity with 5'-flapped DNA, which is formed at the stalled replication fork. We found that FAN1 efficiently promoted DNA incision at the proper site of RPA-coated 5'-flapped DNA. Therefore, FAN1 possesses the ability to promote the ICL repair of 5'-flapped DNA covered by RPA.

  1. Fission Yeast Pxd1 Promotes Proper DNA Repair by Activating Rad16XPF and Inhibiting Dna2

    PubMed Central

    Zhang, Jia-Min; Liu, Xiao-Man; Ding, Yue-He; Xiong, Liang-Yao; Ren, Jing-Yi; Zhou, Zhi-Xiong; Wang, Hai-Tao; Zhang, Mei-Jun; Yu, Yang; Dong, Meng-Qiu; Du, Li-Lin


    Structure-specific nucleases play crucial roles in many DNA repair pathways. They must be precisely controlled to ensure optimal repair outcomes; however, mechanisms of their regulation are not fully understood. Here, we report a fission yeast protein, Pxd1, that binds to and regulates two structure-specific nucleases: Rad16XPF-Swi10ERCC1 and Dna2-Cdc24. Strikingly, Pxd1 influences the activities of these two nucleases in opposite ways: It activates the 3′ endonuclease activity of Rad16-Swi10 but inhibits the RPA-mediated activation of the 5′ endonuclease activity of Dna2. Pxd1 is required for Rad16-Swi10 to function in single-strand annealing, mating-type switching, and the removal of Top1-DNA adducts. Meanwhile, Pxd1 attenuates DNA end resection mediated by the Rqh1-Dna2 pathway. Disabling the Dna2-inhibitory activity of Pxd1 results in enhanced use of a break-distal repeat sequence in single-strand annealing and a greater loss of genetic information. We propose that Pxd1 promotes proper DNA repair by differentially regulating two structure-specific nucleases. PMID:25203555

  2. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate–Vertebrate Boundary

    PubMed Central

    Keller, Thomas E.; Han, Priscilla; Yi, Soojin V.


    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate–vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate–vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. PMID:26715626

  3. Structural Basis for DNA-Hairpin Promoter Recognition by the Bacteriophage N4 Virion RNA Polymerase

    SciTech Connect

    Gleghorn, M.; Davydova, E; Rothman-Denes, L; Murakami, K


    Coliphage N4 virion-encapsidated RNA polymerase (vRNAP) is a member of the phage T7-like single-subunit RNA polymerase (RNAP) family. Its central domain (mini-vRNAP) contains all RNAP functions of the full-length vRNAP, which recognizes a 5 to 7 base pair stem and 3 nucleotide loop hairpin DNA promoter. Here, we report the X-ray crystal structures of mini-vRNAP bound to promoters. Mini-vRNAP uses four structural motifs to recognize DNA sequences at the hairpin loop and stem and to unwind DNA. Despite their low sequence similarity, three out of four motifs are shared with T7 RNAP that recognizes a double-stranded DNA promoter. The binary complex structure and results of engineered disulfide linkage experiments reveal that the plug and motif B loop, which block the access of template DNA to the active site in the apo-form mini-vRNAP, undergo a large-scale conformational change upon promoter binding, explaining the restricted promoter specificity that is critical for N4 phage early transcription.

  4. Arsenic Biotransformation as a Cancer Promoting Factor by Inducing DNA Damage and Disruption of Repair Mechanisms

    PubMed Central

    Martinez, Victor D.; Vucic, Emily A.; Adonis, Marta; Gil, Lionel; Lam, Wan L.


    Chronic exposure to arsenic in drinking water poses a major global health concern. Populations exposed to high concentrations of arsenic-contaminated drinking water suffer serious health consequences, including alarming cancer incidence and death rates. Arsenic is biotransformed through sequential addition of methyl groups, acquired from s-adenosylmethionine (SAM). Metabolism of arsenic generates a variety of genotoxic and cytotoxic species, damaging DNA directly and indirectly, through the generation of reactive oxidative species and induction of DNA adducts, strand breaks and cross links, and inhibition of the DNA repair process itself. Since SAM is the methyl group donor used by DNA methyltransferases to maintain normal epigenetic patterns in all human cells, arsenic is also postulated to affect maintenance of normal DNA methylation patterns, chromatin structure, and genomic stability. The biological processes underlying the cancer promoting factors of arsenic metabolism, related to DNA damage and repair, will be discussed here. PMID:22091411

  5. Neil DNA glycosylases promote substrate turnover by Tdg during DNA demethylation

    PubMed Central

    Arab, Khelifa; Kienhöfer, Sabine; von Seggern, Annika; Niehrs, Christof


    DNA 5-methylcytosine is a dynamic epigenetic mark which plays important roles in development and disease. In the Tet-Tdg demethylation pathway, methylated cytosine is iteratively oxidized by Tet dioxygenases and unmodified cytosine is restored via thymine DNA glycosylase (Tdg). Here we show that human NEIL1 and NEIL2 DNA glycosylases coordinate abasic site processing during TET–TDG DNA demethylation. NEIL1 and NEIL2 cooperate with TDG during base excision: TDG occupies the abasic site and is displaced by NEILs, which further process the baseless sugar, thereby stimulating TDG substrate turnover. In early Xenopus embryos Neil2 cooperates with Tdg to remove oxidized methylcytosines and to specify neural crest development together with Tet3. Thus, Neils function as AP lyases in the coordinated AP site hand-over during oxidative DNA demethylation. PMID:26751644

  6. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways

    PubMed Central

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C.; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina


    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP–DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly different conditions. Employing single-pair fluorescence resonance energy transfer, we monitored DNA bending by eukaryotic and archaeal TBPs in the absence and presence of TFB in real-time. We observed that the lifetime of the TBP–DNA interaction differs significantly between the archaeal and eukaryotic system. We show that the eukaryotic DNA-TBP interaction is characterized by a linear, stepwise bending mechanism with an intermediate state distinguished by a distinct bending angle. TF(II)B specifically stabilizes the fully bent TBP–promoter DNA complex and we identify this step as a regulatory checkpoint. In contrast, the archaeal TBP–DNA interaction is extremely dynamic and TBP from the archaeal organism Sulfolobus acidocaldarius strictly requires TFB for DNA bending. Thus, we demonstrate that transcription initiation follows diverse pathways on the way to the formation of the pre-initiation complex. PMID:24744242

  7. 8-Farnesyloxycoumarin induces apoptosis in PC-3 prostate cancer cells by inhibition of 15-lipoxygenase-1 enzymatic activity.


    Hosseinymehr, Minoo; Matin, Maryam M; Sadeghian, Hamid; Bahrami, Ahmad Reza; Kaseb-Mojaver, Nasrin


    Prostate cancer is the second most common cancer in men worldwide. Overexpression of 15-lipoxygenase-1 (15-LOX-1) has been reported in prostate cancer patients. This study aimed to investigate the cytotoxic and anticancer effects of 8-farnesyloxycoumarin (8f), a prenylated coumarin, by inhibition of 15-LOX-1 activity, in prostate cancer cells. The activity of 15-LOX-1 and the inhibitory effects of 8f on this enzyme were first assessed in PC-3 and DU145 prostate cancer cells. The MTT assay was used to examine the cytotoxicity effects of 8f on PC-3 cells following 15-LOX-1 inhibition. To determine the type of cell death, chromatin condensation and DNA damage were examined by DAPI staining and comet assay, respectively. Furthermore, the effects of 8f on the cell cycle were evaluated by PI staining and flow cytometry. The activity of 15-LOX-1 was determined to be higher in PC-3 compared with DU145 cells; thus, this cell line was selected for further experiments. 8f induced cell death in PC-3 cells in a dose-dependent and time-dependent manner, with IC50 values similar to cisplatin, which was used as a control. However, 8f did not significantly affect the viability of HFF3, human foreskin fibroblast cells, under identical conditions. The appearance of apoptotic cells after 8f treatment was confirmed by the presence of PC-3 cells containing condensed chromatin as shown by DAPI staining. The comet assay indicated the induction of DNA damage in cancerous cells compared with normal cells. In addition, 8f induced a potent G1 cell-cycle arrest in PC-3 cells. Our results showed that the antitumor effects of 8f on PC-3 cells were promoted by apoptosis induction, probably via inhibition of 15-LOX-1 activity, thus suggesting that 8f may have therapeutic value in prostate cancer treatment. PMID:27362790

  8. TDP1 promotes assembly of non-homologous end joining protein complexes on DNA

    PubMed Central

    Heo, Jinho; Li, Jing; Summerlin, Matthew; Hays, Annette; Katyal, Sachin; McKinnon, Peter J.; Nitiss, Karin C.; Nitiss, John L.; Hanakahi, Leslyn A.


    The repair of DNA double-strand breaks (DSB) is central to the maintenance of genomic integrity. In tumor cells, the ability to repair DSBs predicts response to radiation and many cytotoxic anti-cancer drugs. DSB repair pathways include homologous recombination and non-homologous end joining (NHEJ). NHEJ is a template-independent mechanism, yet many NHEJ repair products carry limited genetic changes, which suggests that NHEJ includes mechanisms to minimize error. Proteins required for mammalian NHEJ include Ku70/80, the DNA-dependent protein kinase (DNA-PKcs), XLF/Cernunnos and the XRCC4:DNA ligase IV complex. NHEJ also utilizes accessory proteins that include DNA polymerases, nucleases, and other end-processing factors. In yeast, mutations of tyrosyl-DNA phosphodiesterase (TDP1) reduced NHEJ fidelity. TDP1 plays an important role in repair of topoisomerase-mediated DNA damage and 3′-blocking DNA lesions, and mutation of the human TDP1 gene results in an inherited human neuropathy termed SCAN1. We found that human TDP1 stimulated DNA binding by XLF and physically interacted with XLF to form TDP1:XLF:DNA complexes. TDP1:XLF interactions preferentially stimulated TDP1 activity on dsDNA as compared to ssDNA. TDP1 also promoted DNA binding by Ku70/80 and stimulated DNA-PK activity. Because Ku70/80 and XLF are the first factors recruited to the DSB at the onset of NHEJ, our data suggest a role for TDP1 during the early stages of mammalian NHEJ. PMID:25841101

  9. Unravelling the hidden DNA structural/physical code provides novel insights on promoter location.


    Durán, Elisa; Djebali, Sarah; González, Santi; Flores, Oscar; Mercader, Josep Maria; Guigó, Roderic; Torrents, David; Soler-López, Montserrat; Orozco, Modesto


    Although protein recognition of DNA motifs in promoter regions has been traditionally considered as a critical regulatory element in transcription, the location of promoters, and in particular transcription start sites (TSSs), still remains a challenge. Here we perform a comprehensive analysis of putative core promoter sequences relative to non-annotated predicted TSSs along the human genome, which were defined by distinct DNA physical properties implemented in our ProStar computational algorithm. A representative sampling of predicted regions was subjected to extensive experimental validation and analyses. Interestingly, the vast majority proved to be transcriptionally active despite the lack of specific sequence motifs, indicating that physical signaling is indeed able to detect promoter activity beyond conventional TSS prediction methods. Furthermore, highly active regions displayed typical chromatin features associated to promoters of housekeeping genes. Our results enable to redefine the promoter signatures and analyze the diversity, evolutionary conservation and dynamic regulation of human core promoters at large-scale. Moreover, the present study strongly supports the hypothesis of an ancient regulatory mechanism encoded by the intrinsic physical properties of the DNA that may contribute to the complexity of transcription regulation in the human genome. PMID:23761436

  10. FANCM interacts with PCNA to promote replication traverse of DNA interstrand crosslinks

    PubMed Central

    Rohleder, Florian; Huang, Jing; Xue, Yutong; Kuper, Jochen; Round, Adam; Seidman, Michael; Wang, Weidong; Kisker, Caroline


    FANCM is a highly conserved DNA remodeling enzyme that promotes the activation of the Fanconi anemia DNA repair pathway and facilitates replication traverse of DNA interstrand crosslinks. However, how FANCM interacts with the replication machinery to promote traverse remains unclear. Here, we show that FANCM and its archaeal homolog Hef from Thermoplasma acidophilum interact with proliferating cell nuclear antigen (PCNA), an essential co-factor for DNA polymerases in both replication and repair. The interaction is mediated through a conserved PIP-box; and in human FANCM, it is strongly stimulated by replication stress. A FANCM variant carrying a mutation in the PIP-box is defective in promoting replication traverse of interstrand crosslinks and is also inefficient in promoting FANCD2 monoubiquitination, a key step of the Fanconi anemia pathway. Our data reveal a conserved interaction mode between FANCM and PCNA during replication stress, and suggest that this interaction is essential for FANCM to aid replication machines to traverse DNA interstrand crosslinks prior to post-replication repair. PMID:26825464

  11. DNA demethylation of the TIM-3 promoter is critical for its stable expression on T cells.


    Chou, F-C; Kuo, C-C; Chen, H-Y; Chen, H-H; Sytwu, H-K


    The T-cell immunoglobulin and mucin domain-containing protein 3 (TIM-3) is selectively expressed on terminally differentiated T helper 1 (Th1) cells and acts as a negative regulator that terminates Th1 responses. The dysregulation of TIM-3 expression on T cells is associated with several autoimmune phenotypes and with chronic viral infections; however, the mechanism of this regulation is unclear. In this study, we investigated the effect of DNA methylation on the expression of TIM-3. By analyzing the sequences of TIM-3 promoter regions in human and mouse, we identified a CpG island within the TIM-3 promoter and demonstrated that the promoter activity was controlled by DNA methylation. Furthermore, treatment with 5-aza-2'-deoxycytidine enhanced TIM-3 expression on mouse primary CD4(+) T cells under Th0-, Th1- or Th2-polarizing conditions. Finally, pyrosequencing analysis revealed that the methylation level of the TIM-3 promoter gradually decreased after each round of T-cell polarization, and this decrease was inversely correlated with TIM-3 expression. These data suggest that the DNA methylation of the TIM-3 promoter cooperates with lineage-specific transcription factors in the control of Th-cell development. In conclusion, DNA methylation-based regulation of TIM-3 may provide novel insights into understanding the dysregulation of TIM-3 expression under pathogenic conditions.

  12. The splicing machinery promotes RNA-directed DNA methylation and transcriptional silencing in Arabidopsis

    PubMed Central

    Zhang, Cui-Jun; Zhou, Jin-Xing; Liu, Jun; Ma, Ze-Yang; Zhang, Su-Wei; Dou, Kun; Huang, Huan-Wei; Cai, Tao; Liu, Renyi; Zhu, Jian-Kang; He, Xin-Jian


    DNA methylation in transposons and other DNA repeats is conserved in plants as well as in animals. In Arabidopsis thaliana, an RNA-directed DNA methylation (RdDM) pathway directs de novo DNA methylation. We performed a forward genetic screen for suppressors of the DNA demethylase mutant ros1 and identified a novel Zinc-finger and OCRE domain-containing Protein 1 (ZOP1) that promotes Pol IV-dependent siRNA accumulation, DNA methylation, and transcriptional silencing. Whole-genome methods disclosed the genome-wide effects of zop1 on Pol IV-dependent siRNA accumulation and DNA methylation, suggesting that ZOP1 has both RdDM-dependent and -independent roles in transcriptional silencing. We demonstrated that ZOP1 is a pre-mRNA splicing factor that associates with several typical components of the splicing machinery as well as with Pol II. Immunofluorescence assay revealed that ZOP1 overlaps with Cajal body and is partially colocalized with NRPE1 and DRM2. Moreover, we found that the other development-defective splicing mutants tested including mac3a3b, mos4, mos12 and mos14 show defects in RdDM and transcriptional silencing. We propose that the splicing machinery rather than specific splicing factors is involved in promoting RdDM and transcriptional silencing. PMID:23524848

  13. Laser controlled singlet oxygen generation in mitochondria to promote mitochondrial DNA replication in vitro.


    Zhou, Xin; Wang, Yupei; Si, Jing; Zhou, Rong; Gan, Lu; Di, Cuixia; Xie, Yi; Zhang, Hong


    Reports have shown that a certain level of reactive oxygen species (ROS) can promote mitochondrial DNA (mtDNA) replication. However, it is unclear whether it is the mitochondrial ROS that stimulate mtDNA replication and this requires further investigation. Here we employed a photodynamic system to achieve controlled mitochondrial singlet oxygen ((1)O2) generation. HeLa cells incubated with 5-aminolevulinic acid (ALA) were exposed to laser irradiation to induce (1)O2 generation within mitochondria. Increased mtDNA copy number was detected after low doses of 630 nm laser light in ALA-treated cells. The stimulated mtDNA replication was directly linked to mitochondrial (1)O2 generation, as verified using specific ROS scavengers. The stimulated mtDNA replication was regulated by mitochondrial transcription factor A (TFAM) and mtDNA polymerase γ. MtDNA control region modifications were induced by (1)O2 generation in mitochondria. A marked increase in 8-Oxoguanine (8-oxoG) level was detected in ALA-treated cells after irradiation. HeLa cell growth stimulation and G1-S cell cycle transition were also observed after laser irradiation in ALA-treated cells. These cellular responses could be due to a second wave of ROS generation detected in mitochondria. In summary, we describe a controllable method of inducing mtDNA replication in vitro.

  14. Laser controlled singlet oxygen generation in mitochondria to promote mitochondrial DNA replication in vitro

    PubMed Central

    Zhou, Xin; Wang, Yupei; Si, Jing; Zhou, Rong; Gan, Lu; Di, Cuixia; Xie, Yi; Zhang, Hong


    Reports have shown that a certain level of reactive oxygen species (ROS) can promote mitochondrial DNA (mtDNA) replication. However, it is unclear whether it is the mitochondrial ROS that stimulate mtDNA replication and this requires further investigation. Here we employed a photodynamic system to achieve controlled mitochondrial singlet oxygen (1O2) generation. HeLa cells incubated with 5-aminolevulinic acid (ALA) were exposed to laser irradiation to induce 1O2 generation within mitochondria. Increased mtDNA copy number was detected after low doses of 630 nm laser light in ALA-treated cells. The stimulated mtDNA replication was directly linked to mitochondrial 1O2 generation, as verified using specific ROS scavengers. The stimulated mtDNA replication was regulated by mitochondrial transcription factor A (TFAM) and mtDNA polymerase γ. MtDNA control region modifications were induced by 1O2 generation in mitochondria. A marked increase in 8-Oxoguanine (8-oxoG) level was detected in ALA-treated cells after irradiation. HeLa cell growth stimulation and G1-S cell cycle transition were also observed after laser irradiation in ALA-treated cells. These cellular responses could be due to a second wave of ROS generation detected in mitochondria. In summary, we describe a controllable method of inducing mtDNA replication in vitro. PMID:26577055

  15. A second DNA binding site in human BRCA2 promotes homologous recombination

    PubMed Central

    von Nicolai, Catharina; Ehlén, Åsa; Martin, Charlotte; Zhang, Xiaodong; Carreira, Aura


    BRCA2 tumour-suppressor protein is well known for its role in DNA repair by homologous recombination (HR); assisting the loading of RAD51 recombinase at DNA double-strand breaks. This function is executed by the C-terminal DNA binding domain (CTD) which binds single-stranded (ss)DNA, and the BRC repeats, which bind RAD51 and modulate its assembly onto ssDNA. Paradoxically, analysis of cells resistant to DNA damaging agents missing the CTD restore HR proficiency, suggesting another domain may take over its function. Here, we identify a region in the N terminus of BRCA2 that exhibits DNA binding activity (NTD) and provide evidence for NTD promoting RAD51-mediated HR. A missense variant detected in breast cancer patients located in the NTD impairs HR stimulation on dsDNA/ssDNA junction containing substrates. These findings shed light on the function of the N terminus of BRCA2 and have implications for the evaluation of breast cancer variants. PMID:27628236

  16. A second DNA binding site in human BRCA2 promotes homologous recombination.


    von Nicolai, Catharina; Ehlén, Åsa; Martin, Charlotte; Zhang, Xiaodong; Carreira, Aura


    BRCA2 tumour-suppressor protein is well known for its role in DNA repair by homologous recombination (HR); assisting the loading of RAD51 recombinase at DNA double-strand breaks. This function is executed by the C-terminal DNA binding domain (CTD) which binds single-stranded (ss)DNA, and the BRC repeats, which bind RAD51 and modulate its assembly onto ssDNA. Paradoxically, analysis of cells resistant to DNA damaging agents missing the CTD restore HR proficiency, suggesting another domain may take over its function. Here, we identify a region in the N terminus of BRCA2 that exhibits DNA binding activity (NTD) and provide evidence for NTD promoting RAD51-mediated HR. A missense variant detected in breast cancer patients located in the NTD impairs HR stimulation on dsDNA/ssDNA junction containing substrates. These findings shed light on the function of the N terminus of BRCA2 and have implications for the evaluation of breast cancer variants. PMID:27628236

  17. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome.


    Weber, Michael; Hellmann, Ines; Stadler, Michael B; Ramos, Liliana; Pääbo, Svante; Rebhan, Michael; Schübeler, Dirk


    To gain insight into the function of DNA methylation at cis-regulatory regions and its impact on gene expression, we measured methylation, RNA polymerase occupancy and histone modifications at 16,000 promoters in primary human somatic and germline cells. We find CpG-poor promoters hypermethylated in somatic cells, which does not preclude their activity. This methylation is present in male gametes and results in evolutionary loss of CpG dinucleotides, as measured by divergence between humans and primates. In contrast, strong CpG island promoters are mostly unmethylated, even when inactive. Weak CpG island promoters are distinct, as they are preferential targets for de novo methylation in somatic cells. Notably, most germline-specific genes are methylated in somatic cells, suggesting additional functional selection. These results show that promoter sequence and gene function are major predictors of promoter methylation states. Moreover, we observe that inactive unmethylated CpG island promoters show elevated levels of dimethylation of Lys4 of histone H3, suggesting that this chromatin mark may protect DNA from methylation. PMID:17334365

  18. Introgression of mitochondrial DNA promoted by natural selection in the Japanese pipistrelle bat (Pipistrellus abramus).


    Dong, Ji; Mao, Xiuguang; Sun, Haijian; Irwin, David M; Zhang, Shuyi; Hua, Panyu


    Introgression of mitochondrial DNA (mtDNA) between closely related taxa can be promoted by either neutral processes or natural selection. Since mitochondrial gene-encoded proteins play critical roles in oxidative metabolism, mtDNA genes are commonly considered to experience strong selective constraint. However, metabolic requirements vary across climatic and ecological gradients, thus modifying potential selective pressures acting on mtDNA genes. Here we conducted tests to detect adaptive evolution occurring in two mtDNA genes (Cytb and ND5) in individuals of Japanese pipistrelle bat (Pipistrellus abramus) across the mainland of China and Hainan Island. Nuclear DNA markers identified two clades in both the mainland and Hainan Island populations, whereas each of these regions had a specific mtDNA clade. This cyto-nuclear discordance is most likely caused by introgression of the mtDNA by ruling out two other alternative scenarios (incomplete lineage sorting and sex-biased gene flow). Although population-based analyses revealed purifying selection acting on Cytb and neutrality in ND5, multiple nonsynonymous substitutions in both Cytb and ND5 were suggested to have been caused by positive selection by a divergence-based analysis. Our study supports the view that molecular adaptation can occur at genes under strong purifying selection if nonsynonymous substitutions cause radical changes in the physicochemical properties of amino acids.

  19. Epigenetic features in the oyster Crassostrea gigas suggestive of functionally relevant promoter DNA methylation in invertebrates

    PubMed Central

    Rivière, Guillaume


    DNA methylation is evolutionarily conserved. Vertebrates exhibit high, widespread DNA methylation whereas invertebrate genomes are less methylated, predominantly within gene bodies. DNA methylation in invertebrates is associated with transcription level, alternative splicing, and genome evolution, but functional outcomes of DNA methylation remain poorly described in lophotrochozoans. Recent genome-wide approaches improve understanding in distant taxa such as molluscs, where the phylogenetic position, and life traits of Crassostrea gigas make this bivalve an ideal model to study the physiological and evolutionary implications of DNA methylation. We review the literature about DNA methylation in invertebrates and focus on DNA methylation features in the oyster. Indeed, though our MeDIP-seq results confirm predominant intragenic methylation, the profiles depend on the oyster's developmental and reproductive stage. We discuss the perspective that oyster DNA methylation could be biased toward the 5′-end of some genes, depending on physiological status, suggesting important functional outcomes of putative promoter methylation from cell differentiation during early development to sustained adaptation of the species to the environment. PMID:24778620

  20. Mechanism of Microhomology-Mediated End-Joining Promoted by Human DNA Polymerase Theta

    PubMed Central

    Kent, Tatiana; Chandramouly, Gurushankar; McDevitt, Shane Michael; Ozdemir, Ahmet Y.; Pomerantz, Richard T.


    Microhomology-mediated end-joining (MMEJ) is an error-prone alternative double-strand break repair pathway that utilizes sequence microhomology to recombine broken DNA. Although MMEJ is implicated in cancer development, the mechanism of this pathway is unknown. We demonstrate that purified human DNA polymerase θ (Polθ) performs MMEJ of DNA containing 3’ single-strand DNA overhangs with two or more base-pairs of homology, including DNA modeled after telomeres, and show that MMEJ is dependent on Polθ in human cells. Our data support a mechanism whereby Polθ facilitates end-joining and microhomology annealing then utilizes the opposing overhang as a template in trans which stabilizes the DNA synapse. Polθ exhibits a preference for DNA containing a 5’-terminal phosphate, similar to polymerases involved in non-homologous end-joining. Lastly, we identify a conserved loop domain that is essential for MMEJ and higher-order structures of Polθ which likely promote DNA synapse formation. PMID:25643323

  1. NOMAD: a versatile strategy for in vitro DNA manipulation applied to promoter analysis and vector design.

    PubMed Central

    Rebatchouk, D; Daraselia, N; Narita, J O


    Molecular analysis of complex modular structures, such as promoter regions or multi-domain proteins, often requires the creation of families of experimental DNA constructs having altered composition, order, or spacing of individual modules. Generally, creation of every individual construct of such a family uses a specific combination of restriction sites. However, convenient sites are not always available and the alternatives, such as chemical resynthesis of the experimental constructs or engineering of different restriction sites onto the ends of DNA fragments, are costly and time consuming. A general cloning strategy (nucleic acid ordered assembly with directionality, NOMAD; WWW resource locator l) is proposed that overcomes these limitations. Use of NOMAD ensures that the production of experimental constructs is no longer the rate-limiting step in applications that require combinatorial rearrangement of DNA fragments. NOMAD manipulates DNA fragments in the form of "modules" having a standardized cohesive end structure. Specially designed "assembly vectors" allow for sequential and directional insertion of any number of modules in an arbitrary predetermined order, using the ability of type IIS restriction enzymes to cut DNA outside of their recognition sequences. Studies of regulatory regions in DNA, such as promoters, replication origins, and RNA processing signals, construction of chimeric proteins, and creation of new cloning vehicles, are among the applications that will benefit from using NOMAD. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8855278

  2. Spi-1/PU.1 oncogene accelerates DNA replication fork elongation and promotes genetic instability in the absence of DNA breakage.


    Rimmelé, Pauline; Komatsu, Jun; Hupé, Philippe; Roulin, Christophe; Barillot, Emmanuel; Dutreix, Marie; Conseiller, Emmanuel; Bensimon, Aaron; Moreau-Gachelin, Françoise; Guillouf, Christel


    The multistage process of cancer formation is driven by the progressive acquisition of somatic mutations. Replication stress creates genomic instability in mammals. Using a well-defined multistep leukemia model driven by Spi-1/PU.1 overexpression in the mouse and Spi-1/PU.1-overexpressing human leukemic cells, we investigated the relationship between DNA replication and cancer progression. Here, using DNA molecular combing and flow cytometry methods, we show that Spi-1 increases the speed of replication by acting specifically on elongation rather than enhancing origin firing. This shortens the S-phase duration. Combining data from Spi-1 knockdown in murine cells with Spi-1 overexpression in human cells, we provide evidence that inappropriate Spi-1 expression is directly responsible for the replication alteration observed. Importantly, the acceleration of replication progression coincides with an increase in the frequency of genomic mutations without inducing DNA breakage. Thus, we propose that the hitherto unsuspected role for spi-1 oncogene in promoting replication elongation and genomic mutation promotes blastic progression during leukemic development.

  3. Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.


    Ortega, Janice; Li, Jessie Y; Lee, Sanghee; Tong, Dan; Gu, Liya; Li, Guo-Min


    Proliferating cell nuclear antigen (PCNA) plays essential roles in eukaryotic cells during DNA replication, DNA mismatch repair (MMR), and other events at the replication fork. Earlier studies show that PCNA is regulated by posttranslational modifications, including phosphorylation of tyrosine 211 (Y211) by the epidermal growth factor receptor (EGFR). However, the functional significance of Y211-phosphorylated PCNA remains unknown. Here, we show that PCNA phosphorylation by EGFR alters its interaction with mismatch-recognition proteins MutSα and MutSβ and interferes with PCNA-dependent activation of MutLα endonuclease, thereby inhibiting MMR at the initiation step. Evidence is also provided that Y211-phosphorylated PCNA induces nucleotide misincorporation during DNA synthesis. These findings reveal a novel mechanism by which Y211-phosphorylated PCNA promotes cancer development and progression via facilitating error-prone DNA replication and suppressing the MMR function.

  4. Architecture of the Bacteriophage T4 Activator MotA/Promoter DNA Interaction during Sigma Appropriation*

    PubMed Central

    Hsieh, Meng-Lun; James, Tamara D.; Knipling, Leslie; Waddell, M. Brett; White, Stephen; Hinton, Deborah M.


    Gene expression can be regulated through factors that direct RNA polymerase to the correct promoter sequence at the correct time. Bacteriophage T4 controls its development in this way using phage proteins that interact with host RNA polymerase. Using a process called σ appropriation, the T4 co-activator AsiA structurally remodels the σ70 subunit of host RNA polymerase, while a T4 activator, MotA, engages the C terminus of σ70 and binds to a DNA promoter element, the MotA box. Structures for the N-terminal (NTD) and C-terminal (CTD) domains of MotA are available, but no structure exists for MotA with or without DNA. We report the first molecular map of the MotA/DNA interaction within the σ-appropriated complex, which we obtained by using the cleaving reagent, iron bromoacetamidobenzyl-EDTA (FeBABE). We conjugated surface-exposed, single cysteines in MotA with FeBABE and performed cleavage reactions in the context of stable transcription complexes. The DNA cleavage sites were analyzed using ICM Molsoft software and three-dimensional physical models of MotANTD, MotACTD, and the DNA to investigate shape complementarity between the protein and the DNA and to position MotA on the DNA. We found that the unusual “double wing” motif present within MotACTD resides in the major groove of the MotA box. In addition, we have used surface plasmon resonance to show that MotA alone is in a very dynamic equilibrium with the MotA element. Our results demonstrate the utility of fine resolution FeBABE mapping to determine the architecture of protein-DNA complexes that have been recalcitrant to traditional structure analyses. PMID:23902794

  5. The proteasomal de-ubiquitinating enzyme POH1 promotes the double-strand DNA break response

    PubMed Central

    Butler, Laura R; Densham, Ruth M; Jia, Junying; Garvin, Alexander J; Stone, Helen R; Shah, Vandna; Weekes, Daniel; Festy, Frederic; Beesley, James; Morris, Joanna R


    The regulation of Ubiquitin (Ub) conjugates generated by the complex network of proteins that promote the mammalian DNA double-strand break (DSB) response is not fully understood. We show here that the Ub protease POH1/rpn11/PSMD14 resident in the 19S proteasome regulatory particle is required for processing poly-Ub formed in the DSB response. Proteasome activity is required to restrict tudor domain-dependent 53BP1 accumulation at sites of DNA damage. This occurs both through antagonism of RNF8/RNF168-mediated lysine 63-linked poly-Ub and through the promotion of JMJD2A retention on chromatin. Consistent with this role POH1 acts in opposition to RNF8/RNF168 to modulate end-joining DNA repair. Additionally, POH1 acts independently of 53BP1 in homologous recombination repair to promote RAD51 loading. Accordingly, POH1-deficient cells are sensitive to DNA damaging agents. These data demonstrate that proteasomal POH1 is a key de-ubiquitinating enzyme that regulates ubiquitin conjugates generated in response to damage and that several aspects of the DSB response are regulated by the proteasome. PMID:22909820

  6. ARID1a-DNA interactions are required for promoter occupancy by SWI/SNF.


    Chandler, Ronald L; Brennan, Jennifer; Schisler, Jonathan C; Serber, Daniel; Patterson, Cam; Magnuson, Terry


    Every known SWI/SNF chromatin-remodeling complex incorporates an ARID DNA binding domain-containing subunit. Despite being a ubiquitous component of the complex, physiological roles for this domain remain undefined. Here, we show that disruption of ARID1a-DNA binding in mice results in embryonic lethality, with mutant embryos manifesting prominent defects in the heart and extraembryonic vasculature. The DNA binding-defective mutant ARID1a subunit is stably expressed and capable of assembling into a SWI/SNF complex with core catalytic properties, but nucleosome substrate binding and promoter occupancy by ARID1a-containing SWI/SNF complexes (BAF-A) are impaired. Depletion of ARID domain-dependent, BAF-A associations at THROMBOSPONDIN 1 (THBS1) led to the concomitant upregulation of this SWI/SNF target gene. Using a THBS1 promoter-reporter gene, we further show that BAF-A directly regulates THBS1 promoter activity in an ARID domain-dependent manner. Our data not only demonstrate that ARID1a-DNA interactions are physiologically relevant in higher eukaryotes but also indicate that these interactions facilitate SWI/SNF binding to target sites in vivo. These findings support the model wherein cooperative interactions among intrinsic subunit-chromatin interaction domains and sequence-specific transcription factors drive SWI/SNF recruitment.

  7. Metal-responsive promoter DNA compaction by the ferric uptake regulator.


    Roncarati, Davide; Pelliciari, Simone; Doniselli, Nicola; Maggi, Stefano; Vannini, Andrea; Valzania, Luca; Mazzei, Luca; Zambelli, Barbara; Rivetti, Claudio; Danielli, Alberto


    Short-range DNA looping has been proposed to affect promoter activity in many bacterial species and operator configurations, but only few examples have been experimentally investigated in molecular detail. Here we present evidence for a metal-responsive DNA condensation mechanism controlled by the Helicobacter pylori ferric uptake regulator (Fur), an orthologue of the widespread Fur family of prokaryotic metal-dependent regulators. H. pylori Fur represses the transcription of the essential arsRS acid acclimation operon through iron-responsive oligomerization and DNA compaction, encasing the arsR transcriptional start site in a repressive macromolecular complex. A second metal-dependent regulator NikR functions as nickel-dependent anti-repressor at this promoter, antagonizing the binding of Fur to the operator elements responsible for the DNA condensation. The results allow unifying H. pylori metal ion homeostasis and acid acclimation in a mechanistically coherent model, and demonstrate, for the first time, the existence of a selective metal-responsive DNA compaction mechanism controlling bacterial transcriptional regulation. PMID:27558202

  8. Metal-responsive promoter DNA compaction by the ferric uptake regulator

    PubMed Central

    Roncarati, Davide; Pelliciari, Simone; Doniselli, Nicola; Maggi, Stefano; Vannini, Andrea; Valzania, Luca; Mazzei, Luca; Zambelli, Barbara; Rivetti, Claudio; Danielli, Alberto


    Short-range DNA looping has been proposed to affect promoter activity in many bacterial species and operator configurations, but only few examples have been experimentally investigated in molecular detail. Here we present evidence for a metal-responsive DNA condensation mechanism controlled by the Helicobacter pylori ferric uptake regulator (Fur), an orthologue of the widespread Fur family of prokaryotic metal-dependent regulators. H. pylori Fur represses the transcription of the essential arsRS acid acclimation operon through iron-responsive oligomerization and DNA compaction, encasing the arsR transcriptional start site in a repressive macromolecular complex. A second metal-dependent regulator NikR functions as nickel-dependent anti-repressor at this promoter, antagonizing the binding of Fur to the operator elements responsible for the DNA condensation. The results allow unifying H. pylori metal ion homeostasis and acid acclimation in a mechanistically coherent model, and demonstrate, for the first time, the existence of a selective metal-responsive DNA compaction mechanism controlling bacterial transcriptional regulation. PMID:27558202

  9. Condensin promotes the juxtaposition of DNA flanking its loading site in Bacillus subtilis

    PubMed Central

    Wang, Xindan; Le, Tung B.K.; Lajoie, Bryan R.; Dekker, Job; Laub, Michael T.; Rudner, David Z.


    SMC condensin complexes play a central role in compacting and resolving replicated chromosomes in virtually all organisms, yet how they accomplish this remains elusive. In Bacillus subtilis, condensin is loaded at centromeric parS sites, where it encircles DNA and individualizes newly replicated origins. Using chromosome conformation capture and cytological assays, we show that condensin recruitment to origin-proximal parS sites is required for the juxtaposition of the two chromosome arms. Recruitment to ectopic parS sites promotes alignment of large tracks of DNA flanking these sites. Importantly, insertion of parS sites on opposing arms indicates that these “zip-up” interactions only occur between adjacent DNA segments. Collectively, our data suggest that condensin resolves replicated origins by promoting the juxtaposition of DNA flanking parS sites, drawing sister origins in on themselves and away from each other. These results are consistent with a model in which condensin encircles the DNA flanking its loading site and then slides down, tethering the two arms together. Lengthwise condensation via loop extrusion could provide a generalizable mechanism by which condensin complexes act dynamically to individualize origins in B. subtilis and, when loaded along eukaryotic chromosomes, resolve them during mitosis. PMID:26253537

  10. cDNA cloning and promoter analysis of rat caspase-9.

    PubMed Central

    Nishiyama, J; Yi, X; Venkatachalam, M A; Dong, Z


    Caspase-9 is the apex caspase of the mitochondrial pathway of apoptosis, which plays a critical role in apoptotic initiation and progression. However, gene regulation of caspase-9 is largely unknown. This is in part due to the lack of information on the gene promoter. Here we have cloned the full-length cDNA of rat caspase-9 and have isolated promoter regions of this gene. The rat caspase-9 cDNA of 2058 bp predicts a protein of 454 amino acids, which contains a caspase-recruitment domain ('CARD') at the N-terminus and enzymic domains at the C-terminus. The enzyme's active site, with a characteristic motif of QACGG, was also identified. Overall, rat and human caspase-9 have 71% identity. With the cDNA sequence, we subsequently isolated the proximal 5'-flanking regions of rat caspase-9 by the procedure of genomic walking. The 2270 bp genomic segment is 'TATA-less', but contains several GC boxes. Elements binding known transcription factors such as Sp-1, Pit-1, CCAAT-enhancer-binding protein (C/EBP), glucocorticoid receptor and hypoxia-inducible factor 1 (HIF-1) were also identified. When cloned into reporter gene vectors, the genomic segment showed significant promoter activity, indicating that the 5'-flanking regions isolated by genomic walking contain the gene promoter of rat caspase-9. Of significance is that the cloned promoter segments were activated by severe hypoxia, conditions inducing caspase-9 transcription. Thus, the genomic sequences reported here contain not only the basal promoter of rat caspase-9 but also regulatory elements responsive to pathophysiological stimuli including hypoxia. PMID:11695991

  11. Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival.


    Tinkum, Kelsey L; Stemler, Kristina M; White, Lynn S; Loza, Andrew J; Jeter-Jones, Sabrina; Michalski, Basia M; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S; Piwnica-Worms, David; Piwnica-Worms, Helen


    Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy.

  12. TH17 cells promote microbial killing and innate immune sensing of DNA via interleukin 26

    PubMed Central

    Meller, Stephan; Domizio, Jeremy Di; Voo, Kui S; Friedrich, Heike C; Chamilos, Georgios; Ganguly, Dipyaman; Conrad, Curdin; Gregorio, Josh; Roy, Didier Le; Roger, Thierry; Ladbury, John E; Homey, Bernhard; Watowich, Stanley; Modlin, Robert L; Kontoyiannis, Dimitrios P; Liu, Yong-Jun; Arold, Stefan T; Gilliet, Michel


    Interleukin 17–producing helper T cells (TH17 cells) have a major role in protection against infections and in mediating autoimmune diseases, yet the mechanisms involved are incompletely understood. We found that interleukin 26 (IL-26), a human TH17 cell–derived cytokine, is a cationic amphipathic protein that kills extracellular bacteria via membrane-pore formation. Furthermore, TH17 cell–derived IL-26 formed complexes with bacterial DNA and self-DNA released by dying bacteria and host cells. The resulting IL-26–DNA complexes triggered the production of type I interferon by plasmacytoid dendritic cells via activation of Toll-like receptor 9, but independently of the IL-26 receptor. These findings provide insights into the potent antimicrobial and proinflammatory function of TH17 cells by showing that IL-26 is a natural human antimicrobial that promotes immune sensing of bacterial and host cell death. PMID:26168081

  13. Recombination Promoted by DNA Viruses: Phage λ to Herpes Simplex Virus

    PubMed Central

    Weller, Sandra K.; Sawitzke, James A.


    The purpose of this review is to explore recombination strategies in DNA viruses. Homologous recombination is a universal genetic process that plays multiple roles in the biology of all organisms, including viruses. Recombination and DNA replication are interconnected, with recombination being essential for repairing DNA damage and supporting replication of the viral genome. Recombination also creates genetic diversity, and viral recombination mechanisms have important implications for understanding viral origins as well as the dynamic nature of viral-host interactions. Both bacteriophage λ and herpes simplex virus (HSV) display high rates of recombination, both utilizing their own proteins and commandeering cellular proteins to promote recombination reactions. We focus primarily on λ and HSV, as they have proven amenable to both genetic and biochemical analysis and have recently been shown to exhibit some surprising similarities that will guide future studies. PMID:25002096

  14. Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival

    PubMed Central

    Tinkum, Kelsey L.; Stemler, Kristina M.; White, Lynn S.; Loza, Andrew J.; Jeter-Jones, Sabrina; Michalski, Basia M.; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S.; Piwnica-Worms, David; Piwnica-Worms, Helen


    Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy. PMID:26644583

  15. The dnaKJ operon of Agrobacterium tumefaciens: transcriptional analysis and evidence for a new heat shock promoter.


    Segal, G; Ron, E Z


    The dnaKJ operon of Agrobacterium tumefaciens was cloned and sequenced and was found to be highly homologous to previously analyzed dnaKJ operons. Transcription of this operon in A. tumefaciens was stimulated by heat shock as well as by exposure to ethanol and hydrogen peroxide. There were two transcripts representing the dnaKJ operon: one containing the dnaK and dnaJ genes and the second containing only the dnaK gene. Primer extension analysis indicated that transcription started from the same site in heat-shocked cells and in untreated cells. The upstream regulatory region of the dnaKJ operon of A. tumefaciens does not contain the highly conserved inverted repeat sequence previously found in the groESL operon of this bacterium, as well as in many other groE and dnaK operons. Sequence analysis of the promoter region of several groESL and dnaK operons from alpha-purple proteobacteria indicates the existence of a putative promoter sequence different from the known consensus promoter sequences recognized by the Escherichia coli vegetative or heat shock sigma factor. This promoter may constitute the heat shock promoter of these alpha-purple proteobacteria.

  16. Structural basis of Ets1 cooperative binding to palindromic sequences on stromelysin-1 promoter DNA

    SciTech Connect

    Babayeva, Nigar D.; Wilder, Phillip J.; Shiina, Masaaki; Mino, Koshiki; Desler, Michelle; Ogata, Kazuhiro; Rizzino, Angie; Tahirov, Tahir H.


    Ets1 is a member of the Ets family of transcription factors. Ets1 is autoinhibited and its activation requires heterodimerization with a partner protein or DNA-mediated homodimerization for cooperative DNA binding. In the latter case, Ets1 molecules bind to palindromic sequences in which two Ets-binding sites (EBS) are separated by four base pairs, for example in the promoters of stromelysin-1 and p53. Interestingly, counteraction of autoinhibition requires the autoinhibitory region encoded by exon VII of the gene. The structural basis for the requirement of autoinhibitory sequences for Ets1 binding to palindromic EBS still remains unresolved. Here we report the crystal structure of two Ets1 molecules bound to an EBS palindrome of the stromelysin-1 promoter DNA, providing a plausible explanation for the requirement of exon VII-encoded sequences for Ets1 cooperative DNA binding. The proposed mechanism was verified both in vitro by surface plasmon resonance and in vivo by transcription-based assays.

  17. Sequence Features and Transcriptional Stalling within Centromere DNA Promote Establishment of CENP-A Chromatin

    PubMed Central

    Catania, Sandra; Pidoux, Alison L.; Allshire, Robin C.


    Centromere sequences are not conserved between species, and there is compelling evidence for epigenetic regulation of centromere identity, with location being dictated by the presence of chromatin containing the histone H3 variant CENP-A. Paradoxically, in most organisms CENP-A chromatin generally occurs on particular sequences. To investigate the contribution of primary DNA sequence to establishment of CENP-A chromatin in vivo, we utilised the fission yeast Schizosaccharomyces pombe. CENP-ACnp1 chromatin is normally assembled on ∼10 kb of central domain DNA within these regional centromeres. We demonstrate that overproduction of S. pombe CENP-ACnp1 bypasses the usual requirement for adjacent heterochromatin in establishing CENP-ACnp1 chromatin, and show that central domain DNA is a preferred substrate for de novo establishment of CENP-ACnp1 chromatin. When multimerised, a 2 kb sub-region can establish CENP-ACnp1 chromatin and form functional centromeres. Randomization of the 2 kb sequence to generate a sequence that maintains AT content and predicted nucleosome positioning is unable to establish CENP-ACnp1 chromatin. These analyses indicate that central domain DNA from fission yeast centromeres contains specific information that promotes CENP-ACnp1 incorporation into chromatin. Numerous transcriptional start sites were detected on the forward and reverse strands within the functional 2 kb sub-region and active promoters were identified. RNAPII is enriched on central domain DNA in wild-type cells, but only low levels of transcripts are detected, consistent with RNAPII stalling during transcription of centromeric DNA. Cells lacking factors involved in restarting transcription—TFIIS and Ubp3—assemble CENP-ACnp1 on central domain DNA when CENP-ACnp1 is at wild-type levels, suggesting that persistent stalling of RNAPII on centromere DNA triggers chromatin remodelling events that deposit CENP-ACnp1. Thus, sequence-encoded features of centromeric DNA create an

  18. Bidirectional promoter trapping T-DNA for insertional mutagenesis in Verticillium dahliae.


    Deng, Sheng; Wang, Cai-yue; Zhang, Xin; Lin, Ling


    Transfer DNA (T-DNA)-based random insertional mutagenesis is a universal forward genetic approach for gene identification and cloning in many phytopathogenic fungi. In a large number of randomly selected transformants, screening for mutants with a specific phenotype is laborious, especially for pathogenicity-defective mutants. To accelerate mutant screening and gene identification, a bidirectional promoter-trapping Ti binary vector, 1300-bisGFP-hyg, was constructed and deployed in this study. More than 6000 Verticillium dahliae transformants were obtained by the mediation of Agrobacterium tumefaciens carrying the vector. One thousand randomly selected transformants were cultured on Czapek-Dox and on Czapek-Dox plus cotton root extract media plates. The cultured transformants with green fluorescent protein (GFP) expression or changes in phenotype were selected and used in virulence or promoter-trapping assays. Based on the virulence assay of 60 transformants, the pathogenicity of 17 of these mutants was compromised. Ten pathogenicity-defective mutants were found with GFP expression, and 6 with expression in Czapek-Dox plus cotton root extract media specifically. Using TAIL-PCR (thermal asymmetric interlaced polymerase chain reaction), the T-DNA insertion sites were identified in 8 GFP-expressing transformants, including 5 pathogenicity-defective mutants and 3 unaffected transformants. Promoters of 6 genes were successfully trapped using the T-DNA method in this study. The nonpathogenic transformant 24C9 was the subject of additional investigation. It displayed strong GFP expression on water agar medium supplemented with cotton root extracts and on cotton seedling stems. The results obtained by Southern blot and quantitative real-time PCR confirmed that the transcription level of VdUGPU (encoding UTP-glucose-1-phosphate uridylyltransferase) was significantly reduced owing to T-DNA insertion in the gene promoter region. These results indicate that the bidirectional

  19. Bidirectional promoter trapping T-DNA for insertional mutagenesis in Verticillium dahliae.


    Deng, Sheng; Wang, Cai-yue; Zhang, Xin; Lin, Ling


    Transfer DNA (T-DNA)-based random insertional mutagenesis is a universal forward genetic approach for gene identification and cloning in many phytopathogenic fungi. In a large number of randomly selected transformants, screening for mutants with a specific phenotype is laborious, especially for pathogenicity-defective mutants. To accelerate mutant screening and gene identification, a bidirectional promoter-trapping Ti binary vector, 1300-bisGFP-hyg, was constructed and deployed in this study. More than 6000 Verticillium dahliae transformants were obtained by the mediation of Agrobacterium tumefaciens carrying the vector. One thousand randomly selected transformants were cultured on Czapek-Dox and on Czapek-Dox plus cotton root extract media plates. The cultured transformants with green fluorescent protein (GFP) expression or changes in phenotype were selected and used in virulence or promoter-trapping assays. Based on the virulence assay of 60 transformants, the pathogenicity of 17 of these mutants was compromised. Ten pathogenicity-defective mutants were found with GFP expression, and 6 with expression in Czapek-Dox plus cotton root extract media specifically. Using TAIL-PCR (thermal asymmetric interlaced polymerase chain reaction), the T-DNA insertion sites were identified in 8 GFP-expressing transformants, including 5 pathogenicity-defective mutants and 3 unaffected transformants. Promoters of 6 genes were successfully trapped using the T-DNA method in this study. The nonpathogenic transformant 24C9 was the subject of additional investigation. It displayed strong GFP expression on water agar medium supplemented with cotton root extracts and on cotton seedling stems. The results obtained by Southern blot and quantitative real-time PCR confirmed that the transcription level of VdUGPU (encoding UTP-glucose-1-phosphate uridylyltransferase) was significantly reduced owing to T-DNA insertion in the gene promoter region. These results indicate that the bidirectional

  20. Induced DNA demethylation by targeting Ten-Eleven Translocation 2 to the human ICAM-1 promoter

    PubMed Central

    Chen, Hui; Kazemier, Hinke G; de Groote, Marloes L.; Ruiters, Marcel H. J.; Xu, Guo-Liang; Rots, Marianne G.


    Increasing evidence indicates that active DNA demethylation is involved in several processes in mammals, resulting in developmental stage-specificity and cell lineage-specificity. The recently discovered Ten-Eleven Translocation (TET) dioxygenases are accepted to be involved in DNA demethylation by initiating 5-mC oxidation. Aberrant DNA methylation profiles are associated with many diseases. For example in cancer, hypermethylation results in silencing of tumor suppressor genes. Such silenced genes can be re-expressed by epigenetic drugs, but this approach has genome-wide effects. In this study, fusions of designer DNA binding domains to TET dioxygenase family members (TET1, -2 or -3) were engineered to target epigenetically silenced genes (ICAM-1, EpCAM). The effects on targeted CpGs’ methylation and on expression levels of the target genes were assessed. The results indicated demethylation of targeted CpG sites in both promoters for targeted TET2 and to a lesser extent for TET1, but not for TET3. Interestingly, we observed re-activation of transcription of ICAM-1. Thus, our work suggests that we provided a mechanism to induce targeted DNA demethylation, which facilitates re-activation of expression of the target genes. Furthermore, this Epigenetic Editing approach is a powerful tool to investigate functions of epigenetic writers and erasers and to elucidate consequences of epigenetic marks. PMID:24194590

  1. Isolation, cDNA cloning, and growth promoting activity of rabbitfish (Siganus guttatus) growth hormone.


    Ayson, F G; de Jesus, E G; Amemiya, Y; Moriyama, S; Hirano, T; Kawauchi, H


    We report the isolation, cDNA cloning, and growth promoting activity of rabbitfish (Siganus guttatus; Teleostei; Perciformes; Siganidae) growth hormone (GH). Rabbitfish GH was extracted from pituitary glands under alkaline conditions, fractionated by gel filtration chromatography on Sephadex G-100, and purified by high-performance liquid chromatography. The fractions containing GH were identified by immunoblotting with bonito GH antiserum. Under nonreducing conditions, the molecular weight of rabbitfish GH is about 19 kDa as estimated by SDS-PAGE. The purified hormone was potent in promoting growth in rabbitfish fry. Weekly intraperitoneal injections of the hormone significantly accelerated growth. This was evident 3 weeks after the start of the treatment, and its effect was still significant 2 weeks after the treatment was terminated. Rabbitfish GH cDNA was cloned to determine its nucleotide sequence. Excluding the poly (A) tail, rabbitfish GH cDNA is 860 base pairs (bp) long. It contained untranslated regions of 94 and 175 bp in the 5' and 3' ends, respectively. It has an open reading frame of 588 bp coding for a signal peptide of 18 amino acids and a mature protein of 178 amino acid residues. Rabbitfish GH has 4 cysteine residues. On the amino acid level, rabbitfish GH shows high identity (71-74%) with GHs of other perciforms, such as tuna, sea bass, yellow tail, bonito, and tilapia, and less (47-49%) identity with salmonid and carp GHs.

  2. The complete sequence of soybean chlorotic mottle virus DNA and the identification of a novel promoter.


    Hasegawa, A; Verver, J; Shimada, A; Saito, M; Goldbach, R; Van Kammen, A; Miki, K; Kameya-Iwaki, M; Hibi, T


    The complete nucleotide sequence of an infectious clone of soybean chlorotic mottle virus (SoyCMV) DNA was determined and compared with those of three other caulimoviruses, cauliflower mosaic virus (CaMV), carnation etched ring virus and figwort mosaic virus. The double-stranded DNA genome of SoyCMV (8,175 bp) contained nine open reading frames (ORFs) and one large intergenic region. The primer binding sites, gene organization and size of ORFs were similar to those of the other caulimoviruses, except for ORF I, which was split into ORF Ia and Ib. The amino acid sequences deduced from each ORF showed only short, highly homologous regions in several of the corresponding ORFs of the three other caulimoviruses. A promoter fragment of 378 bp in SoyCMV ORF III showed a strong expression activity, comparable to that of the CaMV 35S promoter, in tobacco mesophyll protoplasts as determined by a beta-glucuronidase assay using electrotransfection. The fragment contained CAAT and TATA boxes but no transcriptional enhancer signal as reported for the CaMV 35S promoter. Instead, it had sequences homologous to a part of the translational enhancer signal reported for the 5'-leader sequence of tobacco mosaic virus RNA.

  3. TET2 Promoter DNA Methylation and Expression in Childhood Acute Lymphoblastic Leukemia.


    Bahari, Gholamreza; Hashemi, Mohammad; Naderi, Majid; Taheri, Mohsen


    The ten-eleven-translocation-2 (TET2) gene is a novel tumor suppressor gene involved in several hematological malignancies of myeloid and lymphoid origin. Besides loss-of-function mutations and deletions, hypermethylation of the CpG island at the TET2 promoter has been found in human cancers. The TET2 encoded protein regulates DNA methylation. The present study aimed to examine DNA promoter methylation of TET2 in 100 childhood acute lymphoblastic leukemia (ALL) cases and 120 healthy children in southeast Iran. In addition, mRNA expression levels were assessed in 30 new cases of ALL and 32 controls. Our findings indicated that promoter methylation of TET2 significantly increases the risk of ALL (OR=2.60, 95% CI=1.31-5.12, p=0.0060) in comparison with absent methylation. Furthermore, the TET2 gene was significantly downregulated in childhood ALL compared to healthy children (p=0.0235). The results revealed that hypermethylation and downregulation of TET2 gene may play a role in predisposition to childhood ALL. Further studies with larger sample sizes and different ethnicities are needed to confirm our findings. PMID:27644645

  4. Overexpression of Ribosomal RNA in the Development of Human Cervical Cancer Is Associated with rDNA Promoter Hypomethylation

    PubMed Central

    Zhou, Hong; Wang, Yapei; Lv, Qiongying; Zhang, Juan; Wang, Qing; Gao, Fei; Hou, Haoli; Zhang, Hao; Zhang, Wei; Li, Lijia


    The ribosomal RNA (rRNA) gene encodes rRNA for protein synthesis. Aberrant expression of the rRNA gene has been generally observed in tumor cells and levels of its promoter methylation as an epigenetic regulator affect rRNA gene transcription. The possible relationship between expression and promoter methylation of rDNA has not been examined in human clinical cervical cancer. Here we investigate rRNA gene expression by quantitative real time PCR, and promoter methylation levels by HpaII/MspI digestion and sodium bisulfite sequencing in the development of human cervical cancer. We find that indeed rRNA levels are elevated in most of cervical intraepithelial neoplasia (CIN) specimens as compared with non-cancer tissues. The rDNA promoter region in cervical intraepithelial neoplasia (CIN) tissues reveals significant hypomethylation at cytosines in the context of CpG dinucleotides, accompanied with rDNA chromatin decondensation. Furthermore treatment of HeLa cells with the methylation inhibitor drug 5-aza-2’-deoxycytidine (DAC) demonstrates the negative correlation between the expression of 45S rDNA and the methylation level in the rDNA promoter region. These data suggest that a decrease in rDNA promoter methylation levels can result in an increase of rRNA synthesis in the development of human cervical cancer. PMID:27695092

  5. Neddylation promotes ubiquitylation and release of Ku from DNA-damage sites.


    Brown, Jessica S; Lukashchuk, Natalia; Sczaniecka-Clift, Matylda; Britton, Sébastien; le Sage, Carlos; Calsou, Patrick; Beli, Petra; Galanty, Yaron; Jackson, Stephen P


    The activities of many DNA-repair proteins are controlled through reversible covalent modification by ubiquitin and ubiquitin-like molecules. Nonhomologous end-joining (NHEJ) is the predominant DNA double-strand break (DSB) repair pathway in mammalian cells and is initiated by DSB ends being recognized by the Ku70/Ku80 (Ku) heterodimer. By using MLN4924, an anti-cancer drug in clinical trials that specifically inhibits conjugation of the ubiquitin-like protein, NEDD8, to target proteins, we demonstrate that NEDD8 accumulation at DNA-damage sites is a highly dynamic process. In addition, we show that depleting cells of the NEDD8 E2-conjugating enzyme, UBE2M, yields ionizing radiation hypersensitivity and reduced cell survival following NHEJ. Finally, we demonstrate that neddylation promotes Ku ubiquitylation after DNA damage and release of Ku and Ku-associated proteins from damage sites following repair. These studies provide insights into how the NHEJ core complex dissociates from repair sites and highlight its importance for cell survival following DSB induction.

  6. Exendin-4 promotes extracellular-superoxide dismutase expression in A549 cells through DNA demethylation

    PubMed Central

    Yasuda, Hiroyuki; Mizukami, Koji; Hayashi, Mutsuna; Kamiya, Tetsuro; Hara, Hirokazu; Adachi, Tetsuo


    Exendin-4 is an agonist of the glucagon-like peptide 1 receptor (GLP-1R) and is used in the treatment of type 2 diabetes. Since human GLP-1R has been identified in various cells besides pancreatic cells, exendin-4 is expected to exert extrapancreatic actions. It has also been suggested to affect gene expression through epigenetic regulation, such as DNA methylation and/or histone modifications. Furthermore, the expression of extracellular-superoxide dismutase (EC-SOD), a major SOD isozyme that is crucially involved in redox homeostasis, is regulated by epigenetic factors. In the present study, we demonstrated that exendin-4 induced the demethylation of DNA in A549 cells, which, in turn, affected the expression of EC-SOD. Our results showed that the treatment with exendin-4 up-regulated the expression of EC-SOD through GLP-1R and demethylated some methyl-CpG sites (methylated cytosine at 5'-CG-3') in the EC-SOD gene. Moreover, the treatment with exendin-4 inactivated DNA methyltransferases (DNMTs), but did not change their expression levels. In conclusion, the results of the present study demonstrated for the first time that exendin-4 regulated the expression of EC-SOD by reducing the activity of DNMTs and demethylation of DNA within the EC-SOD promoter region in A549 cells. PMID:26798195

  7. Global genome nucleotide excision repair is organized into domains that promote efficient DNA repair in chromatin

    PubMed Central

    Yu, Shirong; Evans, Katie; Bennett, Mark; Webster, Richard M.; Leadbitter, Matthew; Teng, Yumin; Waters, Raymond


    The rates at which lesions are removed by DNA repair can vary widely throughout the genome, with important implications for genomic stability. To study this, we measured the distribution of nucleotide excision repair (NER) rates for UV-induced lesions throughout the budding yeast genome. By plotting these repair rates in relation to genes and their associated flanking sequences, we reveal that, in normal cells, genomic repair rates display a distinctive pattern, suggesting that DNA repair is highly organized within the genome. Furthermore, by comparing genome-wide DNA repair rates in wild-type cells and cells defective in the global genome–NER (GG-NER) subpathway, we establish how this alters the distribution of NER rates throughout the genome. We also examined the genomic locations of GG-NER factor binding to chromatin before and after UV irradiation, revealing that GG-NER is organized and initiated from specific genomic locations. At these sites, chromatin occupancy of the histone acetyl-transferase Gcn5 is controlled by the GG-NER complex, which regulates histone H3 acetylation and chromatin structure, thereby promoting efficient DNA repair of UV-induced lesions. Chromatin remodeling during the GG-NER process is therefore organized into these genomic domains. Importantly, loss of Gcn5 significantly alters the genomic distribution of NER rates; this has implications for the effects of chromatin modifiers on the distribution of mutations that arise throughout the genome. PMID:27470111

  8. Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.


    Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad


    In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease.

  9. The murine biglycan: Complete cDNA cloning, genomic organization, promoter function, and expression

    SciTech Connect

    Wegrowski, Y.; Pillarisetti, J.; Danielson, K.G.; Iozzo, R.V.; Suzuki, S.


    Biglycan is a ubiquitous chondroitin/dermatan sulfate proteoglycan that belongs to a growing family of proteins harboring leucine-rich repeats. We have cloned and sequenced the cDNA containing the complete murine biglycan, elucidated its genomic organization, and demonstrated functional promoter activity of its 5{prime} flanking region. The deduced biglycan protein core was highly conserved across species. However, the mouse biglycan (Bgn) gene was significantly larger than the human counterpart, primarily because of a large > 4.5-kb intron between exons 1 and 2. The mouse Bgn gene spanned over 9.5 kb of continuous DNA and comprised 8 exons, with a perfectly conserved intron/exon organization vis-a-vis the human counterpart. The promoter region was enriched in GC dinucleotide and contained numerous cis-acting elements including binding sites for SP-1, AP-1, and AP-2 factors. It lacked TATA and CAAT boxes typical of housekeeping genes. In support of this, primer extension analysis showed the existence of multiple transcription start sites. Transient cell transfection assays with a construct comprising the 548 hp upstream of the major transcription start site fused to the chloramphenicol acetyl transferase reporter gene showed functional promoter activity. Internal and 5{prime} deletion constructs showed that the distal promoter of the Bgn gene was required for full transcriptional activity. In contrast to the homologous proteoglycan decorin, the highest expression of biglycan mRNA was observed in lung, liver, and spleen of adult mouse and the lowest in skin, heart, and kidney. These results will be useful for the study of biglycan gene regulation and for the generation of mice with targeted null mutation of the Bgn gene. 56 refs., 7 figs., 1 tab.

  10. HP1 promotes tumor suppressor BRCA1 functions during the DNA damage response

    PubMed Central

    Lee, Young-Ho; Kuo, Ching-Ying; Stark, Jeremy M.; Shih, Hsiu-Ming; Ann, David K.


    The DNA damage response (DDR) involves both the control of DNA damage repair and signaling to cell cycle checkpoints. Therefore, unraveling the underlying mechanisms of the DDR is important for understanding tumor suppression and cellular resistance to clastogenic cancer therapeutics. Because the DDR is likely to be influenced by chromatin regulation at the sites of DNA damage, we investigated the role of heterochromatin protein 1 (HP1) during the DDR process. We monitored double-strand breaks (DSBs) using the γH2AX foci marker and found that depleting cells of HP1 caused genotoxic stress, a delay in the repair of DSBs and elevated levels of apoptosis after irradiation. Furthermore, we found that these defects in repair were associated with impaired BRCA1 function. Depleting HP1 reduced recruitment of BRCA1 to DSBs and caused defects in two BRCA1-mediated DDR events: (i) the homologous recombination repair pathway and (ii) the arrest of cell cycle at the G2/M checkpoint. In contrast, depleting HP1 from cells did not affect the non-homologous end-joining (NHEJ) pathway: instead it elevated the recruitment of the 53BP1 NHEJ factor to DSBs. Notably, all three subtypes of HP1 seemed to be almost equally important for these DDR functions. We suggest that the dynamic interaction of HP1 with chromatin and other DDR factors could determine DNA repair choice and cell fate after DNA damage. We also suggest that compromising HP1 expression could promote tumorigenesis by impairing the function of the BRCA1 tumor suppressor. PMID:23589625

  11. The N-terminus of TDP-43 promotes its oligomerization and enhances DNA binding affinity

    SciTech Connect

    Chang, Chung-ke; Wu, Tzong-Huah; Wu, Chu-Ya; Chiang, Ming-hui; Toh, Elsie Khai-Woon; Hsu, Yin-Chih; Lin, Ku-Feng; Liao, Yu-heng; Huang, Tai-huang; Huang, Joseph Jen-Tse


    Highlights: Black-Right-Pointing-Pointer The N-terminus of TDP-43 contains an independently folded structural domain (NTD). Black-Right-Pointing-Pointer The structural domains of TDP-43 are arranged in a beads-on-a-string fashion. Black-Right-Pointing-Pointer The NTD promotes TDP-43 oligomerization in a concentration-dependent manner. Black-Right-Pointing-Pointer The NTD may assist nucleic acid-binding activity of TDP-43. -- Abstract: TDP-43 is a DNA/RNA-binding protein associated with different neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD-U). Here, the structural and physical properties of the N-terminus on TDP-43 have been carefully characterized through a combination of nuclear magnetic resonance (NMR), circular dichroism (CD) and fluorescence anisotropy studies. We demonstrate for the first time the importance of the N-terminus in promoting TDP-43 oligomerization and enhancing its DNA-binding affinity. An unidentified structural domain in the N-terminus is also disclosed. Our findings provide insights into the N-terminal domain function of TDP-43.

  12. Endothelial cells mitigate DNA damage and promote the regeneration of hematopoietic stem cells after radiation injury

    PubMed Central

    Zachman, Derek K.; Leon, Ronald P.; Das, Prerna; Goldman, Devorah C.; Hamlin, Kimberly L.; Guha, Chandan; Fleming, William H.


    Endothelial cells (ECs) are an essential component of the hematopoietic microenvironment, which maintains and regulates hematopoietic stem cells (HSCs). Although ECs can support the regeneration of otherwise lethally-irradiated HSCs, the mechanisms are not well understood. To further understand this phenomenon, we studied HSC regeneration from irradiated bone marrow using co-culture with human aortic endothelial cells (HAECs). Co-culture with HAECs induced a 24-fold expansion of long-term HSCs (CD150+, lineagelo, Sca-1+, c-Kit+; CD150+LSK cells) in vitro. These cells gave rise to functional hematopoietic stem and progenitor cells (HSPCs) with colony-forming activity, multilineage reconstitution and serial transplantation potential. Furthermore, HAECs significantly reduced DNA damage in irradiated LSK cells within 24 hours. Remarkably, we were able to delay the exposure of irradiated bone marrow to the regenerative, HAEC-derived signals for up to 48 hours and still rescue functional HSCs. G-CSF is the gold standard for promoting hematopoietic regeneration in vivo. However, when compared to HAECs, in vitro G-CSF treatment promoted lineage differentiation and regenerated 5-fold fewer CD150+LSK cells. Together, our results show that HAECs are powerful, direct mitigators of HSC injury and DNA damage. Identification of the HAEC-derived factors that rescue HSCs may lead to improved therapies for hematopoietic regeneration after radiation injury. PMID:23939266

  13. Endothelial cells mitigate DNA damage and promote the regeneration of hematopoietic stem cells after radiation injury.


    Zachman, Derek K; Leon, Ronald P; Das, Prerna; Goldman, Devorah C; Hamlin, Kimberly L; Guha, Chandan; Fleming, William H


    Endothelial cells (ECs) are an essential component of the hematopoietic microenvironment, which maintains and regulates hematopoietic stem cells (HSCs). Although ECs can support the regeneration of otherwise lethally-irradiated HSCs, the mechanisms are not well understood. To further understand this phenomenon, we studied HSC regeneration from irradiated bone marrow using co-culture with human aortic ECs (HAECs). Co-culture with HAECs induced a 24-fold expansion of long-term HSCs (CD150(+), lineage(lo), Sca-1(+), c-Kit(+); CD150(+)LSK cells) in vitro. These cells gave rise to functional hematopoietic stem and progenitor cells (HSPCs) with colony-forming activity, multilineage reconstitution and serial transplantation potential. Furthermore, HAECs significantly reduced DNA damage in irradiated LSK cells within 24h. Remarkably, we were able to delay the exposure of irradiated bone marrow to the regenerative, HAEC-derived signals for up to 48h and still rescue functional HSCs. G-CSF is the gold standard for promoting hematopoietic regeneration in vivo. However, when compared to HAECs, in vitro G-CSF treatment promoted lineage differentiation and regenerated 5-fold fewer CD150(+)LSK cells. Together, our results show that HAECs are powerful, direct mitigators of HSC injury and DNA damage. Identification of the HAEC-derived factors that rescue HSCs may lead to improved therapies for hematopoietic regeneration after radiation injury. PMID:23939266

  14. Silencing of transgene transcription precedes methylation of promoter DNA and histone H3 lysine 9.


    Mutskov, Vesco; Felsenfeld, Gary


    Transgenes stably integrated into cells or animals in many cases are silenced rapidly, probably under the influence of surrounding endogenous condensed chromatin. This gene silencing correlates with repressed chromatin structure marked by histone hypoacetylation, loss of methylation at H3 lysine 4, increase of histone H3 lysine 9 methylation as well as CpG DNA methylation at the promoter. However, the order and the timing of these modifications and their impact on transcription inactivation are less well understood. To determine the temporal order of these events, we examined a model system consisting of a transgenic cassette stably integrated in chicken erythroid cells. We found that histone H3 and H4 hypoacetylation and loss of methylation at H3 lysine 4 all occurred during the same window of time as transgene inactivation in both multicopy and low-copy-number lines. These results indicate that these histone modifications were the primary events in gene silencing. We show that the kinetics of silencing exclude histone H3 K9 and promoter DNA methylation as the primary causative events in our transgene system. PMID:14685282

  15. Reversible supramolecular assembly at specific DNA sites: nickel-promoted bivalent DNA binding with designed peptide and bipyridyl-bis(benzamidine) components.


    Sánchez, Mateo I; Mosquera, Jesús; Vázquez, M Eugenio; Mascareñas, José L


    At specific DNA sites, nickel(II) salts promote the assembly of designed components, namely a bis(histidine)-modified peptide that is derived from a bZIP transcription factor and a bis(benzamidine) unit that is equipped with a bipyridine. This programmed supramolecular system with emergent properties reproduces some key characteristics of naturally occurring DNA-binding proteins, such as bivalence, selectivity, responsiveness to external agents, and reversibility.

  16. Neddylation Promotes Ubiquitylation and Release of Ku from DNA-Damage Sites

    PubMed Central

    Brown, Jessica S.; Lukashchuk, Natalia; Sczaniecka-Clift, Matylda; Britton, Sébastien; le Sage, Carlos; Calsou, Patrick; Beli, Petra; Galanty, Yaron; Jackson, Stephen P.


    Summary The activities of many DNA-repair proteins are controlled through reversible covalent modification by ubiquitin and ubiquitin-like molecules. Nonhomologous end-joining (NHEJ) is the predominant DNA double-strand break (DSB) repair pathway in mammalian cells and is initiated by DSB ends being recognized by the Ku70/Ku80 (Ku) heterodimer. By using MLN4924, an anti-cancer drug in clinical trials that specifically inhibits conjugation of the ubiquitin-like protein, NEDD8, to target proteins, we demonstrate that NEDD8 accumulation at DNA-damage sites is a highly dynamic process. In addition, we show that depleting cells of the NEDD8 E2-conjugating enzyme, UBE2M, yields ionizing radiation hypersensitivity and reduced cell survival following NHEJ. Finally, we demonstrate that neddylation promotes Ku ubiquitylation after DNA damage and release of Ku and Ku-associated proteins from damage sites following repair. These studies provide insights into how the NHEJ core complex dissociates from repair sites and highlight its importance for cell survival following DSB induction. PMID:25921528

  17. Asymmetric Arginine dimethylation of Epstein-Barr virus nuclear antigen 2 promotes DNA targeting

    SciTech Connect

    Gross, Henrik; Barth, Stephanie; Mamiani, Alfredo; Zimber-Strobl, Ursula; West, Michelle J.; Kremmer, Elisabeth; Graesser, Friedrich A.


    The Epstein-Barr virus (EBV) growth-transforms B-lymphocytes. The virus-encoded nuclear antigen 2 (EBNA2) is essential for transformation and activates gene expression by association with DNA-bound transcription factors such as RBPJkappa (CSL/CBF1). We have previously shown that EBNA2 contains symmetrically dimethylated Arginine (sDMA) residues. Deletion of the RG-repeat results in a reduced ability of the virus to immortalise B-cells. We now show that the RG repeat also contains asymmetrically dimethylated Arginines (aDMA) but neither non-methylated (NMA) Arginines nor citrulline residues. We demonstrate that only aDMA-containing EBNA2 is found in a complex with DNA-bound RBPJkappa in vitro and preferentially associates with the EBNA2-responsive EBV C, LMP1 and LMP2A promoters in vivo. Inhibition of methylation in EBV-infected cells results in reduced expression of the EBNA2-regulated viral gene LMP1, providing additional evidence that methylation is a prerequisite for DNA-binding by EBNA2 via association with the transcription factor RBPJkappa.

  18. HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.


    Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael


    Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges.

  19. Inhibition of DNA methylation promotes breast tumor sensitivity to netrin-1 interference.


    Grandin, Mélodie; Mathot, Pauline; Devailly, Guillaume; Bidet, Yannick; Ghantous, Akram; Favrot, Clementine; Gibert, Benjamin; Gadot, Nicolas; Puisieux, Isabelle; Herceg, Zdenko; Delcros, Jean-Guy; Bernet, Agnès; Mehlen, Patrick; Dante, Robert


    In a number of human cancers, NTN1 upregulation inhibits apoptosis induced by its so-called dependence receptors DCC and UNC5H, thus promoting tumor progression. In other cancers however, the selective inhibition of this dependence receptor death pathway relies on the silencing of pro-apoptotic effector proteins. We show here that a substantial fraction of human breast tumors exhibits simultaneous DNA methylation-dependent loss of expression of NTN1 and of DAPK1, a serine threonine kinase known to transduce the netrin-1 dependence receptor pro-apoptotic pathway. The inhibition of DNA methylation by drugs such as decitabine restores the expression of both NTN1 and DAPK1 in netrin-1-low cancer cells. Furthermore, a combination of decitabine with NTN1 silencing strategies or with an anti-netrin-1 neutralizing antibody potentiates tumor cell death and efficiently blocks tumor growth in different animal models. Thus, combining DNA methylation inhibitors with netrin-1 neutralizing agents may be a valuable strategy for combating cancer. PMID:27378792

  20. Infrared A radiation promotes survival of human melanocytes carrying ultraviolet radiation-induced DNA damage.


    Kimeswenger, Susanne; Schwarz, Agatha; Födinger, Dagmar; Müller, Susanne; Pehamberger, Hubert; Schwarz, Thomas; Jantschitsch, Christian


    The link between solar radiation and melanoma is still elusive. Although infrared radiation (IR) accounts for over 50% of terrestrial solar energy, its influence on human skin is not well explored. There is increasing evidence that IR influences the expression patterns of several molecules independently of heat. A previous in vivo study revealed that pretreatment with IR might promote the development of UVR-induced non-epithelial skin cancer and possibly of melanoma in mice. To expand on this, the aim of the present study was to evaluate the impact of IR on UVR-induced apoptosis and DNA repair in normal human epidermal melanocytes. The balance between these two effects is a key factor of malignant transformation. Human melanocytes were exposed to physiologic doses of IR and UVR. Compared to cells irradiated with UVR only, simultaneous exposure to IR significantly reduced the apoptotic rate. However, IR did not influence the repair of UVR-induced DNA damage. IR partly reversed the pro-apoptotic effects of UVR via modification of the expression and activity of proteins mainly of the extrinsic apoptotic pathway. In conclusion, IR enhances the survival of melanocytes carrying UVR-induced DNA damage and thereby might contribute to melanomagenesis.

  1. DNA-histone interactions are sufficient to position a single nucleosome juxtaposing Drosophila Adh adult enhancer and distal promoter.

    PubMed Central

    Jackson, J R; Benyajati, C


    The alcohol dehydrogenase gene (Adh) of Drosophila melanogaster is transcribed from two tandem promoters in distinct developmental and tissue-specific patterns. Both promoters are regulated by separate upstream enhancer regions. In its wild-type context the adult enhancer specifically stimulates only the distal promoter, approximately 400 bp downstream, and not the proximal promoter, which is approximately 700 bp further downstream. Genomic footprinting and micrococcal nuclease analyses have revealed a specifically positioned nucleosome between the distal promoter and adult enhancer. In vitro reconstitution of this nucleosome demonstrated that DNA-core histone interactions alone are sufficient to position the nucleosome. Based on this observation and sequence periodicities in the underlying DNA, the mechanism of positioning appears to involve specific DNA structural features (ie flexibility or curvature). We have observed this nucleosome positioned early during development, before tissue differentiation, and before non-histone protein-DNA interactions are established at the distal promoter or adult enhancer. This nucleosome positioning element in the Adh regulatory region could be involved in establishing a specific tertiary nucleoprotein structure that facilitates specific cis-element accessibility and/or distal promoter-adult enhancer interactions. Images PMID:8451195

  2. Expression of human histo-blood group ABO genes is dependent upon DNA methylation of the promoter region.


    Kominato, Y; Hata, Y; Takizawa, H; Tsuchiya, T; Tsukada, J; Yamamoto, F


    We have investigated the regulatory role of DNA methylation in the expression of the human histo-blood group ABO genes. The ABO gene promoter region contains a CpG island whose methylation status correlates well with gene expression in the cell lines tested. The CpG island was found hypomethylated in some cell lines that expressed ABO genes, whereas the other cell lines that did not express ABO genes were hypermethylated. Whereas constitutive transcriptional activity of the ABO gene promoter was demonstrated in both expressor and nonexpressor cell lines by transient transfection of reporter constructs containing the ABO gene promoter sequence, HhaI methylase-catalyzed in vitro methylation of the promoter region prior to DNA transfection suppressed the promoter activity when introduced into the expressor gastric cancer cell line KATOIII cells. On the other hand, in the nonexpressor gastric cancer cell line MKN28 cells, treatment with DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine resulted in demethylation of the ABO gene promoter and appearance of A-transferase messages, as well as A-antigens synthesized by A-transferase. Taken together, these studies suggest that DNA methylation of the ABO gene promoter may play an important role in the regulation of ABO gene expression. PMID:10601288

  3. Cigarette Smoking, BPDE-DNA Adducts, and Aberrant Promoter Methylations of Tumor Suppressor Genes (TSGs) in NSCLC from Chinese Population.


    Jin, Yongtang; Xu, Peiwei; Liu, Xinneng; Zhang, Chunye; Tan, Cong; Chen, Chunmei; Sun, Xiaoyu; Xu, Yingchun


    Non-small cell lung cancer (NSCLC) is related to the genetic and epigenetic factors. The goal of this study was to determine association of cigarette smoking and BPDE-DNA adducts with promoter methylations of several genes in NSCLC. Methylation of the promoters of p16, RARβ, DAPK, MGMT, and TIMP-3 genes of tumor tissues from 199 lung cancer patients was analyzed with methylation-specific PCR (MSP), and BPDE-DNA adduct level in lung cancer tissue was obtained by ELISA. Level of BPDE-DNA adduct increased significantly in males, aged people (over 60 years), and smokers; however, no significant difference was found while comparing the BPDE-DNA adduct levels among different tumor types, locations, and stages. Cigarette smoking was also associated with increased BPDE-DNA adducts level (OR = 2.43, p > .05) and increased methylation level in at least 1 gene (OR = 5.22, p < .01), both in dose-response manner. Similarly, cigarette smoking also significantly increase the risk of p16 or DAPK methylation (OR = 3.02, p < .05 for p16, and 3.66, p < .05 for DAPK). The highest risk of BPDE-DNA adducts was detected among individuals with cigarette smoking for more than 40 pack-years (OR = 4.21, p < .01). Furthermore, the present study did not show that BPDE-DNA adducts are significantly associated with abnormal TSGs methylations in NSCLC, including SCC and AdO, respectively. Conclusively, cigarette smoking is significantly associated with the increase of BPDE-DNA adduct level, promoter hypermethylation of p16 and DAPK genes, while BPDE-DNA adduct was not significantly related to abnormal promoter hypermethylation in TSGs, suggesting that BPDE-DNA adducts and TSGs methylations play independent roles in NSCLC.

  4. Cigarette Smoking, BPDE-DNA Adducts, and Aberrant Promoter Methylations of Tumor Suppressor Genes (TSGs) in NSCLC from Chinese Population.


    Jin, Yongtang; Xu, Peiwei; Liu, Xinneng; Zhang, Chunye; Tan, Cong; Chen, Chunmei; Sun, Xiaoyu; Xu, Yingchun


    Non-small cell lung cancer (NSCLC) is related to the genetic and epigenetic factors. The goal of this study was to determine association of cigarette smoking and BPDE-DNA adducts with promoter methylations of several genes in NSCLC. Methylation of the promoters of p16, RARβ, DAPK, MGMT, and TIMP-3 genes of tumor tissues from 199 lung cancer patients was analyzed with methylation-specific PCR (MSP), and BPDE-DNA adduct level in lung cancer tissue was obtained by ELISA. Level of BPDE-DNA adduct increased significantly in males, aged people (over 60 years), and smokers; however, no significant difference was found while comparing the BPDE-DNA adduct levels among different tumor types, locations, and stages. Cigarette smoking was also associated with increased BPDE-DNA adducts level (OR = 2.43, p > .05) and increased methylation level in at least 1 gene (OR = 5.22, p < .01), both in dose-response manner. Similarly, cigarette smoking also significantly increase the risk of p16 or DAPK methylation (OR = 3.02, p < .05 for p16, and 3.66, p < .05 for DAPK). The highest risk of BPDE-DNA adducts was detected among individuals with cigarette smoking for more than 40 pack-years (OR = 4.21, p < .01). Furthermore, the present study did not show that BPDE-DNA adducts are significantly associated with abnormal TSGs methylations in NSCLC, including SCC and AdO, respectively. Conclusively, cigarette smoking is significantly associated with the increase of BPDE-DNA adduct level, promoter hypermethylation of p16 and DAPK genes, while BPDE-DNA adduct was not significantly related to abnormal promoter hypermethylation in TSGs, suggesting that BPDE-DNA adducts and TSGs methylations play independent roles in NSCLC. PMID:27042875

  5. Src Family Kinases Promote Silencing of ATR-Chk1 Signaling in Termination of DNA Damage Checkpoint*

    PubMed Central

    Fukumoto, Yasunori; Morii, Mariko; Miura, Takahito; Kubota, Sho; Ishibashi, Kenichi; Honda, Takuya; Okamoto, Aya; Yamaguchi, Noritaka; Iwama, Atsushi; Nakayama, Yuji; Yamaguchi, Naoto


    The DNA damage checkpoint arrests cell cycle progression to allow time for repair. Once DNA repair is completed, checkpoint signaling is terminated. Currently little is known about the mechanism by which checkpoint signaling is terminated, and the disappearance of DNA lesions is considered to induce the end of checkpoint signaling; however, here we show that the termination of checkpoint signaling is an active process promoted by Src family tyrosine kinases. Inhibition of Src activity delays recovery from the G2 phase DNA damage checkpoint following DNA repair. Src activity is required for the termination of checkpoint signaling, and inhibition of Src activity induces persistent activation of ataxia telangiectasia mutated (ATM)- and Rad3-related (ATR) and Chk1 kinases. Src-dependent nuclear protein tyrosine phosphorylation and v-Src expression suppress the ATR-mediated Chk1 and Rad17 phosphorylation induced by DNA double strand breaks or DNA replication stress. Thus, Src family kinases promote checkpoint recovery through termination of ATR- and Chk1-dependent G2 DNA damage checkpoint. These results suggest a model according to which Src family kinases send a termination signal between the completion of DNA repair and the initiation of checkpoint termination. PMID:24634213

  6. MAPK15 upregulation promotes cell proliferation and prevents DNA damage in male germ cell tumors.


    Rossi, Matteo; Colecchia, David; Ilardi, Gennaro; Acunzo, Mario; Nigita, Giovanni; Sasdelli, Federica; Celetti, Angela; Strambi, Angela; Staibano, Stefania; Croce, Carlo Maria; Chiariello, Mario


    Germ cell tumors (GCT) are the most common malignancies in males between 15 and 35 years of age. Despite the high cure rate, achieved through chemotherapy and/or surgery, the molecular basis of GCT etiology is still largely obscure. Here, we show a positive correlation between MAPK15 (ERK8; ERK7) expression and specific GCT subtypes, with the highest levels found in the aggressive embryonal carcinomas (EC). Indeed, in corresponding cellular models for EC, MAPK15 enhanced tumorigenicity in vivo and promoted cell proliferation in vitro, supporting a role for this kinase in human GCT. At molecular level, we demonstrated that endogenous MAPK15 is necessary to sustain cell cycle progression of EC cells, by limiting p53 activation and preventing the triggering of p53-dependent mechanisms resulting in cell cycle arrest.To understand MAPK15-dependent mechanisms impinging on p53 activation, we demonstrate that this kinase efficiently protects cells from DNA damage. Moreover, we show that the ability of MAPK15 to control the autophagic process is necessary for basal management of DNA damage and for tumor formation controlled by the kinase.In conclusion, our findings suggest that MAPK15 overexpression may contribute to the malignant transformation of germ cells by controlling a "stress support" autophagic pathway, able to prevent DNA damage and the consequent activation of the p53 tumor suppressor. Moreover, in light of these results, MAPK15-specific inhibitors might represent new tools to enhance the therapeutic index of cytotoxic therapy in GCT treatment, and to increase the sensitivity to DNA-damaging drugs in other chemotherapy-resistant human tumors. PMID:26988910

  7. MAPK15 upregulation promotes cell proliferation and prevents DNA damage in male germ cell tumors

    PubMed Central

    Ilardi, Gennaro; Acunzo, Mario; Nigita, Giovanni; Sasdelli, Federica; Celetti, Angela; Strambi, Angela; Staibano, Stefania; Croce, Carlo Maria; Chiariello, Mario


    Germ cell tumors (GCT) are the most common malignancies in males between 15 and 35 years of age. Despite the high cure rate, achieved through chemotherapy and/or surgery, the molecular basis of GCT etiology is still largely obscure. Here, we show a positive correlation between MAPK15 (ERK8; ERK7) expression and specific GCT subtypes, with the highest levels found in the aggressive embryonal carcinomas (EC). Indeed, in corresponding cellular models for EC, MAPK15 enhanced tumorigenicity in vivo and promoted cell proliferation in vitro, supporting a role for this kinase in human GCT. At molecular level, we demonstrated that endogenous MAPK15 is necessary to sustain cell cycle progression of EC cells, by limiting p53 activation and preventing the triggering of p53-dependent mechanisms resulting in cell cycle arrest. To understand MAPK15-dependent mechanisms impinging on p53 activation, we demonstrate that this kinase efficiently protects cells from DNA damage. Moreover, we show that the ability of MAPK15 to control the autophagic process is necessary for basal management of DNA damage and for tumor formation controlled by the kinase. In conclusion, our findings suggest that MAPK15 overexpression may contribute to the malignant transformation of germ cells by controlling a “stress support” autophagic pathway, able to prevent DNA damage and the consequent activation of the p53 tumor suppressor. Moreover, in light of these results, MAPK15-specific inhibitors might represent new tools to enhance the therapeutic index of cytotoxic therapy in GCT treatment, and to increase the sensitivity to DNA-damaging drugs in other chemotherapy-resistant human tumors. PMID:26988910

  8. Mitochondrial DNA Polymerase POLG1 Disease Mutations and Germline Variants Promote Tumorigenic Properties.


    Singh, Bhupendra; Owens, Kjerstin M; Bajpai, Prachi; Desouki, Mohamed Mokhtar; Srinivasasainagendra, Vinodh; Tiwari, Hemant K; Singh, Keshav K


    Germline mutations in mitochondrial DNA polymerase gamma (POLG1) induce mitochondrial DNA (mtDNA) mutations, depletion, and decrease oxidative phosphorylation. Earlier, we identified somatic mutations in POLG1 and the contribution of these mutations in human cancer. However, a role for germline variations in POLG1 in human cancers is unknown. In this study, we examined a role for disease associated germline variants of POLG1, POLG1 gene expression, copy number variation and regulation in human cancers. We analyzed the mutations, expression and copy number variation in POLG1 in several cancer databases and validated the analyses in primary breast tumors and breast cancer cell lines. We discovered 5-aza-2'-deoxycytidine led epigenetic regulation of POLG1, mtDNA-encoded genes and increased mitochondrial respiration. We conducted comprehensive race based bioinformatics analyses of POLG1 gene in more than 33,000 European-Americans and 5,000 African-Americans. We identified a mitochondrial disease causing missense variation in polymerase domain of POLG1 protein at amino acid 1143 (E1143G) to be 25 times more prevalent in European-Americans (allele frequency 0.03777) when compared to African-American (allele frequency 0.00151) population. We identified T251I and P587L missense variations in exonuclease and linker region of POLG1 also to be more prevalent in European-Americans. Expression of these variants increased glucose consumption, decreased ATP production and increased matrigel invasion. Interestingly, conditional expression of these variants revealed that matrigel invasion properties conferred by these germline variants were reversible suggesting a role of epigenetic regulators. Indeed, we identified a set of miRNA whose expression was reversible after variant expression was turned off. Together, our studies demonstrate altered genetic and epigenetic regulation of POLG1 in human cancers and suggest a role for POLG1 germline variants in promoting tumorigenic

  9. High-frequency deletion in recovered retrovirus vectors containing exogenous DNA with promoters.

    PubMed Central

    Emerman, M; Temin, H M


    We previously described infectious retrovirus vectors constructed from spleen necrosis virus which contain the herpes simplex virus thymidine kinase gene and the mouse alpha-globin gene (K. Shimotohno and H. M. Temin, Nature [London] 299:255-268, 1982). In the present study we report that when TK- chicken cells infected with a virus containing the mouse alpha-globin promoter and other 5' noncoding sequences in addition to the alpha-globin coding sequences were selected for thymidine kinase (TK) activity, all virus-producing TK+ cell clones shed virus with a deletion. These deletions were of different sizes and included the mouse alpha-globin coding sequences and the mouse alpha-globin transcriptional promoter. One of the deleted viruses was molecularly cloned. DNA sequencing showed that the deleted sequences are flanked by a short direct repeat. This deleted virus was also shown to have an advantage over the nondeleted parent both in multiplication and in its specific TK-transforming unit titer. In contrast to the results described above, TK+ cell clones established with viruses that contained only the coding sequences from the mouse alpha-globin gene did not delete and were stable over many cell passages. The implications of the high-frequency deletion of the viruses with internal promoters are discussed in terms of the evolution of retroviruses and the construction of retrovirus vectors. Images PMID:6321798

  10. Improved Specificity of Gene Electrotransfer to Skin Using pDNA Under the Control of Collagen Tissue-Specific Promoter.


    Kos, Spela; Tesic, Natasa; Kamensek, Urska; Blagus, Tanja; Cemazar, Maja; Kranjc, Simona; Lavrencak, Jaka; Sersa, Gregor


    In order to ensure safe, efficient and controlled gene delivery to skin, the improvement of delivery methods together with proper design of DNA is required. Non-viral delivery methods, such as gene electrotransfer, and the design of tissue-specific promoters are promising tools to ensure the safety of gene delivery to the skin. In the scope of our study, we evaluated a novel skin-specific plasmid DNA with collagen (COL) promoter, delivered to skin cells and skin tissue by gene electrotransfer. In vitro, we determined the specificity of the COL promoter in fibroblast cells. The specific expression under the control of COL promoter was obtained for the reporter gene DsRed as well as for therapeutic gene encoding cytokine IL-12. In vivo, the plasmid with COL promoter encoding the reporter gene DsRed was efficiently transfected to mouse skin. It resulted in the notable and controlled manner, however, in lower and shorter expression, compared to that obtained with ubiquitous promoter. The concentration of the IL-12 in the skin after the in vivo transfection of plasmid with COL promoter was in the same range as after the treatment in control conditions (injection of distilled water followed by the application of electric pulses). Furthermore, this gene delivery was local, restricted to the skin, without any evident systemic shedding of IL-12. Such specific targeting of skin cells, observed with tissue-specific COL promoter, would improve the effectiveness and safety of cutaneous gene therapies and DNA vaccines.

  11. Chromatin inactivation precedes de novo dna methylation during the progressive epigenetic silencing of the rassf1a promoter

    SciTech Connect

    Strunnikova Maria; Schagdarsurengin, Undraga; Kehlen, Astrid; Garbe, James C.; Stampfer, Martha R.; Dammann, Reinhard


    Epigenetic inactivation of the RASSF1A tumor suppressor by CpG island methylation was frequently detected in cancer. However, the mechanisms of this aberrant DNA methylation are unknown. In the RASSF1A promoter, we characterized four Sp1 sites, which are frequently methylated in cancer. We examined the functional relationship between DNA methylation, histone modification, Sp1 binding, and RASSF1A expression in proliferating human mammary epithelial cells. With increasing passages, the transcription of RASSF1A was dramatically silenced. This inactivation was associated with deacetylation and lysine 9 trimethylation of histone H3 and an impaired binding of Sp1 at the RASSF1A promoter. In mammary epithelial cells that had overcome a stress-associated senescence barrier, a spreading of DNA methylation in the CpG island promoter was observed. When the RASSF1A-silenced cells were treated with inhibitors of DNA methyltransferase and histone deacetylase, binding of Sp1 and expression of RASSF1 A reoccurred. In summary, we observed that histone H3 deacetylation and H3 lysine 9 trimethylation occur in the same time window as gene inactivation and precede DNA methylation. Our data suggest that in epithelial cells, histone inactivation may trigger de novo DNA methylation of the RASSF1A promoter and this system may serve as a model for CpG island inactivation of tumor suppressor genes.

  12. SUVH1, a Su(var)3–9 family member, promotes the expression of genes targeted by DNA methylation

    PubMed Central

    Li, Shaofang; Liu, Lin; Li, Shengben; Gao, Lei; Zhao, Yuanyuan; Kim, Yun Ju; Chen, Xuemei


    Transposable elements are found throughout the genomes of all organisms. Repressive marks such as DNA methylation and histone H3 lysine 9 (H3K9) methylation silence these elements and maintain genome integrity. However, how silencing mechanisms are themselves regulated to avoid the silencing of genes remains unclear. Here, an anti-silencing factor was identified using a forward genetic screen on a reporter line that harbors a LUCIFERASE (LUC) gene driven by a promoter that undergoes DNA methylation. SUVH1, a Su(var)3–9 homolog, was identified as a factor promoting the expression of the LUC gene. Treatment with a cytosine methylation inhibitor completely suppressed the LUC expression defects of suvh1, indicating that SUVH1 is dispensable for LUC expression in the absence of DNA methylation. SUVH1 also promotes the expression of several endogenous genes with promoter DNA methylation. However, the suvh1 mutation did not alter DNA methylation levels at the LUC transgene or on a genome-wide scale; thus, SUVH1 functions downstream of DNA methylation. Histone H3 lysine 4 (H3K4) trimethylation was reduced in suvh1; in contrast, H3K9 methylation levels remained unchanged. This work has uncovered a novel, anti-silencing function for a member of the Su(var)3–9 family that has previously been associated with silencing through H3K9 methylation. PMID:26400170

  13. A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.


    Prosseda, Gianni; Mazzola, Alessia; Di Martino, Maria Letizia; Tielker, Denis; Micheli, Gioacchino; Colonna, Bianca


    Among the molecular strategies bacteria have set up to quickly match their transcriptional program to new environments, changes in sequence-mediated DNA curvature play a crucial role. Bacterial promoters, especially those of mesophilic bacteria, are in general preceded by a curved region. The marked thermosensitivity of curved DNA stretches allows bacteria to rapidly sense outer temperature variations and affects transcription by favoring the binding of activators or repressors. Curved DNA is also able to influence the transcriptional activity of a bacterial promoter directly, without the involvement of trans-acting regulators. This study attempts to quantitatively analyze the role of DNA curvature in thermoregulated gene expression using a real-time in vitro transcription model system based on a specific fluorescence molecular beacon. By analyzing the temperature-dependent expression of a reporter gene in a construct carrying a progressively decreasing bent sequence upstream from the promoter, we show that with a decrease in temperature a narrow curvature range accounts for a significant enhancement of promoter activity. This strengthens the view that DNA curvature-mediated regulation of gene expression is likely a strategy offering fine-tuning control possibilities and that, considering the widespread presence of curved sequences upstream from bacterial promoters, it may represent one of the most primitive forms of gene regulation.

  14. Tubulin polymerization promoting protein 1 (TPPP1): A DNA-damage induced microtubule regulatory gene.


    Schofield, Alice; Bernard, Ora


    The eukaryotic cell cycle relies heavily on the mechanical forces vested by the dynamic rearrangement of the microtubule (MT) network. Tubulin Polymerization promoting Protein 1 (TPPP1) alters MT dynamics by driving MT polymerization as well as stabilization, via increasing MT acetylation. It increases MT rigidity, which results in reduced cell proliferation through downregulation of G1/S-phase and mitosis to G1-phase cell cycle transitioning. In this communication, we provide further evidence that TPPP1 may be an important regulator of genomic homeostasis. Our preliminary data show that long-term TPPP1 overexpression reduces cell viability via induction of apoptotic cell death pathways. Moreover, induction of DNA-damage results in increased TPPP1 expression, which is inhibited in the absence of expression of the tumor suppressor p53.

  15. Establishment of a promoter-based chromatin architecture on recently replicated DNA can accommodate variable inter-nucleosome spacing

    PubMed Central

    Fennessy, Ross T.; Owen-Hughes, Tom


    Nucleosomes, the fundamental subunits of eukaryotic chromatin, are organized with respect to transcriptional start sites. A major challenge to the persistence of this organization is the disassembly of nucleosomes during DNA replication. Here, we use complimentary approaches to map the locations of nucleosomes on recently replicated DNA. We find that nucleosomes are substantially realigned with promoters during the minutes following DNA replication. As a result, the nucleosomal landscape is largely re-established before newly replicated chromosomes are partitioned into daughter cells and can serve as a platform for the re-establishment of gene expression programmes. When the supply of histones is disrupted through mutation of the chaperone Caf1, a promoter-based architecture is generated, but with increased inter-nucleosomal spacing. This indicates that the chromatin remodelling enzymes responsible for spacing nucleosomes are capable of organizing nucleosomes with a range of different linker DNA lengths. PMID:27106059

  16. Interleukin-6 promotes tumorigenesis by altering DNA methylation in oral cancer cells.


    Gasche, Jacqueline A; Hoffmann, Jürgen; Boland, C Richard; Goel, Ajay


    Worldwide oral squamous cell carcinoma (OSCC) accounts for more than 100,000 deaths each year. Chronic inflammation constitutes one of the key risk factors for OSCC. Accumulating evidence suggests that aberrant DNA methylation may contribute to OSCC tumorigenesis. This study investigated whether chronic inflammation alters DNA methylation and expression of cancer-associated genes in OSCC. We established an in vitro model of interleukin (IL)-6 mediating chronic inflammation in OSCC cell lines. Thereafter, we measured the ability of IL-6 to induce global hypomethylation of long interspersed nuclear element-1 (LINE-1) sequences, as well as CpG methylation changes using multiple methodologies including quantitative pyrosequencing, methylation-specific multiplex ligation-dependent probe amplification and sensitive melting analysis after real-time-methylation-specific polymerase chain reaction (PCR). Gene expression was investigated by quantitative reverse transcriptase-PCR. IL-6 induced significant global LINE-1 hypomethylation (p=0.016) in our in vitro model of inflammatory stress in OSCC cell lines. Simultaneously, IL-6 induced CpG promoter methylation changes in several important putative tumor suppressor genes including CHFR, GATA5 and PAX6. Methylation changes correlated inversely with the changes in the expression of corresponding genes. Our results indicate that IL-6-induced inflammation promotes tumorigenesis in the oral cavity by altering global LINE-1 hypomethylation. In addition, concurrent hypermethylation of multiple tumor suppressor genes by IL-6 suggests that epigenetic gene silencing may be an important consequence of chronic inflammation in the oral cavity. These findings have clinical relevance, as both methylation and inflammation are suitable targets for developing novel preventive and therapeutic measures.

  17. Tunable DNA cleavage activity promoted by copper(ii) ternary complexes with N-donor heterocyclic ligands.


    Bortolotto, T; Silva-Caldeira, P P; Pich, C T; Pereira-Maia, E C; Terenzi, H


    Several small molecules have the capacity to cleave DNA promptly at high yields, even under mild conditions. Usually, this activity has no constraints, occurring without external or user control. Here, we demonstrate that UV-light exposure can greatly enhance the DNA cleavage activity promoted by four ternary copper(ii) complexes. A remarkable photocontrolled activity was achieved, which may be interesting for chemical and biochemical applications. PMID:27168172

  18. Tousled-like kinases phosphorylate Asf1 to promote histone supply during DNA replication

    PubMed Central

    Klimovskaia, Ilnaz M; Young, Clifford; Strømme, Caroline B; Menard, Patrice; Jasencakova, Zuzana; Mejlvang, Jakob; Ask, Katrine; Ploug, Michael; Nielsen, Michael L; Jensen, Ole N; Groth, Anja


    During DNA replication, nucleosomes are rapidly assembled on newly synthesized DNA to restore chromatin organization. Asf1, a key histone H3-H4 chaperone required for this process, is phosphorylated by Tousled-Like Kinases (TLKs). Here, we identify TLK phosphorylation sites by mass spectrometry and dissect how phosphorylation impacts on human Asf1 function. The divergent C-terminal tail of Asf1a is phosphorylated at several sites and this is required for timely progression through S phase. Consistent with this, biochemical analysis of wild-type and phosphomimetic Asf1a shows that phosphorylation enhances binding to histones and the downstream chaperones CAF-1 and HIRA. Moreover, we find that TLK phosphorylation of Asf1a is induced in cells experiencing deficiency of new histones and that TLK interaction with Asf1a involves its histone-binding pocket. We thus propose that TLK signaling promotes histone supply in S phase by targeting histone-free Asf1 and stimulating its ability to shuttle histones to sites of chromatin assembly. PMID:24598821

  19. PERK promotes cancer cell proliferation and tumor growth by limiting oxidative DNA damage

    PubMed Central

    Bobrovnikova-Marjon, Ekaterina; Grigoriadou, Christina; Pytel, Dariusz; Zhang, Fang; Ye, Jiangbin; Koumenis, Constantinos; Cavener, Douglas; Diehl, J. Alan


    In order to proliferate and expand in an environment with limited nutrients, cancer cells co-opt cellular regulatory pathways that facilitate adaptation and thereby maintain tumor growth and survival potential. The endoplasmic reticulum (ER) is uniquely positioned to sense nutrient deprivation stress and subsequently engage signaling pathways that promote adaptive strategies. As such, components of the ER stress-signaling pathway represent potential anti-neoplastic targets. However, recent investigations into the role of the ER resident protein kinase PERK have paradoxically suggested both pro- and anti-tumorigenic properties. We have utilized animal models of mammary carcinoma to interrogate PERK contribution in the neoplastic process. The ablation of PERK in tumor cells resulted in impaired regeneration of intracellular antioxidants and accumulation of reactive oxygen species triggering oxidative DNA damage. Ultimately, PERK deficiency impeded progression through the cell cycle due to the activation of the DNA damage checkpoint. Our data reveal that PERK-dependent signaling is utilized during both tumor initiation and expansion to maintain redox homeostasis and thereby facilitates tumor growth. PMID:20453876

  20. PERK promotes cancer cell proliferation and tumor growth by limiting oxidative DNA damage.


    Bobrovnikova-Marjon, E; Grigoriadou, C; Pytel, D; Zhang, F; Ye, J; Koumenis, C; Cavener, D; Diehl, J A


    To proliferate and expand in an environment with limited nutrients, cancer cells co-opt cellular regulatory pathways that facilitate adaptation and thereby maintain tumor growth and survival potential. The endoplasmic reticulum (ER) is uniquely positioned to sense nutrient deprivation stress and subsequently engage signaling pathways that promote adaptive strategies. As such, components of the ER stress-signaling pathway represent potential antineoplastic targets. However, recent investigations into the role of the ER resident protein kinase, RNA-dependent protein kinase (PKR)-like ER kinase (PERK) have paradoxically suggested both pro- and anti-tumorigenic properties. We have used animal models of mammary carcinoma to interrogate the contribution of PERK in the neoplastic process. The ablation of PERK in tumor cells resulted in impaired regeneration of intracellular antioxidants and accumulation of reactive oxygen species triggering oxidative DNA damage. Ultimately, PERK deficiency impeded progression through the cell cycle because of the activation of the DNA damage checkpoint. Our data reveal that PERK-dependent signaling is used during both tumor initiation and expansion to maintain redox homeostasis, thereby facilitating tumor growth.

  1. Mutations in BALB Mitochondrial DNA Induce CCL20 Up-regulation Promoting Tumorigenic Phenotypes

    PubMed Central

    Sligh, James; Janda, Jaroslav; Jandova, Jana


    mtDNA mutations are common in human cancers and are thought to contribute to the process of neoplasia. We examined the role of mtDNA mutations in skin cancer by generating fibroblast cybrids harboring a mutation in the gene encoding the mitochondrial tRNA for arginine. This somatic mutation (9821insA) was previously reported in UV-induced hyperkeratotic skin tumors in hairless mice and confers specific tumorigenic phenotypes to mutant cybrids. Microarray analysis revealed and RT-PCR along with Western blot analysis confirmed the up-regulation of CCL20 and its receptor CCR6 in mtBALB haplotype containing the mt-Tr 9821insA allele compared to wild type mtB6 haplotype. Based on reported role of CCL20 in cancer progression we examined whether the hyper-proliferation and enhanced motility of mtBALB haplotype would be associated with CCL20 levels. Treatment of both genotypes with recombinant CCL20 (rmCCL20) resulted in enhanced growth and motility of mtB6 cybrids. Furthermore, the acquired somatic alteration increased the in vivo tumor growth of mtBALB cybrids through the up-regulation of CCL20 since neutralizing antibody significantly decreased in vivo tumor growth of these cells; and tumors from anti-CCL20 treated mice injected with mtBALB cybrids showed significantly decreased CCL20 levels. When rmCCL20 or mtBALB cybrids were used as chemotactic stimuli, mtB6 cybrids showed increased motility while anti-CCL20 antibody decreased the migration and in vivo tumor growth of mtBALB cybrids. Moreover, the inhibitors of MAPK signaling and NF-κB activation inhibited CCL20 expression in mtBALB cybrids and decreased their migratory capabilities. Thus, acquired mtDNA mutations may promote tumorigenic phenotypes through up-regulation of chemokine CCL20. PMID:25177208

  2. BRUCE regulates DNA double-strand break response by promoting USP8 deubiquitination of BRIT1

    PubMed Central

    Ge, Chunmin; Che, Lixiao; Ren, Jinyu; Pandita, Raj K.; Lu, Jing; Li, Kaiyi; Pandita, Tej K.; Du, Chunying


    The DNA damage response (DDR) is crucial for genomic integrity. BRIT1 (breast cancer susceptibility gene C terminus-repeat inhibitor of human telomerase repeat transcriptase expression), a tumor suppressor and early DDR factor, is recruited to DNA double-strand breaks (DSBs) by phosphorylated H2A histone family, member X (γ-H2AX), where it promotes chromatin relaxation by recruiting the switch/sucrose nonfermentable (SWI–SNF) chromatin remodeler to facilitate DDR. However, regulation of BRIT1 recruitment is not fully understood. The baculovirus IAP repeat (BIR)-containing ubiquitin-conjugating enzyme (BRUCE) is an inhibitor of apoptosis protein (IAP). Here, we report a non-IAP function of BRUCE in the regulation of the BRIT1–SWI–SNF DSB-response pathway and genomic stability. We demonstrate that BRIT1 is K63 ubiquitinated in unstimulated cells and that deubiquitination of BRIT1 is a prerequisite for its recruitment to DSB sites by γ-H2AX. We show mechanistically that BRUCE acts as a scaffold, bridging the ubiquitin-specific peptidase 8 (USP8) and BRIT1 in a complex to coordinate USP8-catalyzed deubiquitination of BRIT1. Loss of BRUCE or USP8 impairs BRIT1 deubiquitination, BRIT1 binding with γ-H2AX, the formation of BRIT1 DNA damage foci, and chromatin relaxation. Moreover, BRUCE-depleted cells display reduced homologous recombination repair, and BRUCE-mutant mice exhibit repair defects and genomic instability. These findings identify BRUCE and USP8 as two hitherto uncharacterized critical DDR regulators and uncover a deubiquitination regulation of BRIT1 assembly at damaged chromatin for efficient DDR and genomic stability. PMID:25733871

  3. Interaction of Individual Structural Domains of hnRNP LL with the BCL2 Promoter i-Motif DNA.


    Roy, Basab; Talukder, Poulami; Kang, Hyun-Jin; Tsuen, Shujian S; Alam, Mohammad P; Hurley, Laurence H; Hecht, Sidney M


    The recently discovered role of the BCL2 (B-cell lymphoma 2 gene) promoter i-motif DNA in modulation of gene expression via interaction with the ribonucleoprotein hnRNP L-like (hnRNP LL) has prompted a more detailed study of the nature of this protein-DNA interaction. The RNA recognition motifs (RRMs) of hnRNP LL were expressed individually, and both RRM1 and RRM2 were found to bind efficiently to the BCL2 i-motif DNA, as well as being critical for transcriptional activation, whereas RRM3-4 bound only weakly to this DNA. Binding was followed by unfolding of the DNA as monitored by changes in the CD spectrum. Mutational analysis of the i-motif DNA revealed that binding involved primarily the lateral loops of the i-motif. The kinetics of binding of the DNA with RRM1 was explored by recording CD spectra at predetermined times following admixture of the protein and DNA. The change in molar ellipticity was readily apparent after 30 s and largely complete within 1 min. A more detailed view of protein-DNA interaction was obtained by introducing the fluorescence donor 6-CNTrp in RRM1 at position 137, and the acceptor 4-aminobenzo[g]quinazoline-2-one (Cf) in lieu of cytidine22 in the i-motif DNA. The course of binding of the two species was monitored by FRET, which reflected a steady increase in energy transfer over a period of several minutes. The FRET signal could be diminished by the further addition of (unlabeled) RRM2, no doubt reflecting competition for binding to the i-motif DNA. These experiments using the individual RRM domains from hnRNP LL confirm the role of this transcription factor in activation of BCL2 transcription via the i-motif in the promoter element. PMID:27483029

  4. Histone Methyltransferase Enhancer of Zeste Homolog 2-Mediated ABCA1 Promoter DNA Methylation Contributes to the Progression of Atherosclerosis

    PubMed Central

    Wan, Wei; Yao, Feng; He, Ping-Ping; Xie, Wei; Mo, Zhong-Cheng; Shi, Jin-Feng; Wu, Jian-Feng; Peng, Juan; Liu, Dan; Cayabyab, Francisco S.; Zheng, Xi-Long; Tang, Xiang-Yang; Ouyang, Xin-Ping; Tang, Chao-Ke


    ATP-binding cassette transporter A1 (ABCA1) plays a critical role in maintaining cellular cholesterol homeostasis. The purpose of this study is to identify the molecular mechanism(s) underlying ABCA1 epigenetic modification and determine its potential impact on ABCA1 expression in macrophage-derived foam cell formation and atherosclerosis development. DNA methylation induced foam cell formation from macrophages and promoted atherosclerosis in apolipoprotein E-deficient (apoE−/−) mice. Bioinformatics analyses revealed a large CpG island (CGI) located in the promoter region of ABCA1. Histone methyltransferase enhancer of zeste homolog 2 (EZH2) downregulated ABCA1 mRNA and protein expression in THP-1 and RAW264.7 macrophage-derived foam cells. Pharmacological inhibition of DNA methyltransferase 1 (DNMT1) with 5-Aza-dC or knockdown of DNMT1 prevented the downregulation of macrophage ABCA1 expression, suggesting a role of DNA methylation in ABCA1 expression. Polycomb protein EZH2 induced DNMT1 expression and methyl-CpG-binding protein-2 (MeCP2) recruitment, and stimulated the binding of DNMT1 and MeCP2 to ABCA1 promoter, thereby promoting ABCA1 gene DNA methylation and atherosclerosis. Knockdown of DNMT1 inhibited EZH2-induced downregulation of ABCA1 in macrophages. Conversely, EZH2 overexpression stimulated DNMT1-induced ABCA1 gene promoter methylation and atherosclerosis. EZH2-induced downregulation of ABCA1 gene expression promotes foam cell formation and the development of atherosclerosis by DNA methylation of ABCA1 gene promoter. PMID:27295295

  5. Association between early promoter-specific DNA methylation changes and outcome in older acute myeloid leukemia patients.


    Achille, Nicholas J; Othus, Megan; Phelan, Kathleen; Zhang, Shubin; Cooper, Kathrine; Godwin, John E; Appelbaum, Frederick R; Radich, Jerald P; Erba, Harry P; Nand, Sucha; Zeleznik-Le, Nancy J


    Treatment options for older patients with acute myeloid leukemia (AML) range from supportive care alone to full-dose chemotherapy. Identifying factors that predict response to therapy may help increase efficacy and avoid toxicity. The phase II SWOG S0703 study investigated the use of hydroxyurea and azacitidine with gemtuzumab ozogamicin in the elderly AML population and found survival rates similar to those expected with standard AML regimens, with less toxicity. As part of this study, global DNA methylation along with promoter DNA methylation and expression analysis of six candidate genes (CDKN2A, CDKN2B, HIC1, RARB, CDH1 and APAF1) were determined before and during therapy to investigate whether very early changes are prognostic for clinical response. Global DNA methylation was not associated with a clinical response. Samples after 3 or 4 days of treatment with azacitidine showed significantly decreased CDKN2A promoter DNA methylation in patients achieving complete remission (CR) compared to those who did not. Samples from day 7 of treatment showed significantly decreased RARB, CDKN2B and CDH1 promoter DNA methylation in responders compared to nonresponders. Gene-specific DNA methylation analysis of peripheral blood samples may help early identification of those older AML patients most likely to benefit from demethylating agent therapy.

  6. The roles of DNA polymerase ζ and the Y family DNA polymerases in promoting or preventing genome instability

    PubMed Central

    Sharma, Shilpy; Helchowski, Corey M.; Canman, Christine E.


    Cancer cells display numerous abnormal characteristics which are initiated and maintained by elevated mutation rates and genome instability. Chromosomal DNA is continuously surveyed for the presence of damage or blocked replication forks by the DNA Damage Response (DDR) network. The DDR is complex and includes activation of cell cycle checkpoints, DNA repair, gene transcription, and induction of apoptosis. Duplicating a damaged genome is associated with elevated risks to fork collapse and genome instability. Therefore, the DNA Damage Tolerance (DDT) pathway is also employed to enhance survival and involves the recruitment of translesion DNA synthesis (TLS) polymerases to sites of replication fork blockade or single stranded DNA gaps left after the completion of replication in order to restore DNA to its double stranded form before mitosis. TLS polymerases are specialized for inserting nucleotides opposite DNA adducts, abasic sites, or DNA crosslinks. By definition, the DDT pathway is not involved in the actual repair of damaged DNA, but provides a mechanism to tolerate DNA lesions during replication thereby increasing survival and lessening the chance for genome instability. However this may be associated with increased mutagenesis. In this review, we will describe the specialized functions of Y family polymerases (Rev1, Polη, Polι and Polκ) and DNA polymerase ζ in lesion bypass, mutagenesis, and prevention of genome instability, the latter due to newly appreciated roles in DNA repair. The recently described role of the Fanconi anemia pathway in regulating Rev1 and Polζ-dependent TLS is also discussed in terms of their involvement in TLS, interstrand crosslink repair, and homologous recombination. PMID:23195997

  7. Genome-wide study predicts promoter-G4 DNA motifs regulate selective functions in bacteria: radioresistance of D. radiodurans involves G4 DNA-mediated regulation.


    Beaume, Nicolas; Pathak, Rajiv; Yadav, Vinod Kumar; Kota, Swathi; Misra, Hari S; Gautam, Hemant K; Chowdhury, Shantanu


    A remarkable number of guanine-rich sequences with potential to adopt non-canonical secondary structures called G-quadruplexes (or G4 DNA) are found within gene promoters. Despite growing interest, regulatory role of quadruplex DNA motifs in intrinsic cellular function remains poorly understood. Herein, we asked whether occurrence of potential G4 (PG4) DNA in promoters is associated with specific function(s) in bacteria. Using a normalized promoter-PG4-content (PG4(P)) index we analysed >60,000 promoters in 19 well-annotated species for (a) function class(es) and (b) gene(s) with enriched PG4(P). Unexpectedly, PG4-associated functional classes were organism specific, suggesting that PG4 motifs may impart specific function to organisms. As a case study, we analysed radioresistance. Interestingly, unsupervised clustering using PG4(P) of 21 genes, crucial for radioresistance, grouped three radioresistant microorganisms including Deinococcus radiodurans. Based on these predictions we tested and found that in presence of nanomolar amounts of the intracellular quadruplex-binding ligand N-methyl mesoporphyrin (NMM), radioresistance of D. radiodurans was attenuated by ~60%. In addition, important components of the RecF recombinational repair pathway recA, recF, recO, recR and recQ genes were found to harbour promoter-PG4 motifs and were also down-regulated in presence of NMM. Together these results provide first evidence that radioresistance may involve G4 DNA-mediated regulation and support the rationale that promoter-PG4s influence selective functions. PMID:23161683

  8. A dynamic CTCF chromatin binding landscape promotes DNA hydroxymethylation and transcriptional induction of adipocyte differentiation

    PubMed Central

    Dubois-Chevalier, Julie; Oger, Frédérik; Dehondt, Hélène; Firmin, François F.; Gheeraert, Céline; Staels, Bart; Lefebvre, Philippe; Eeckhoute, Jérôme


    CCCTC-binding factor (CTCF) is a ubiquitously expressed multifunctional transcription factor characterized by chromatin binding patterns often described as largely invariant. In this context, how CTCF chromatin recruitment and functionalities are used to promote cell type-specific gene expression remains poorly defined. Here, we show that, in addition to constitutively bound CTCF binding sites (CTS), the CTCF cistrome comprises a large proportion of sites showing highly dynamic binding patterns during the course of adipogenesis. Interestingly, dynamic CTCF chromatin binding is positively linked with changes in expression of genes involved in biological functions defining the different stages of adipogenesis. Importantly, a subset of these dynamic CTS are gained at cell type-specific regulatory regions, in line with a requirement for CTCF in transcriptional induction of adipocyte differentiation. This relates to, at least in part, CTCF requirement for transcriptional activation of both the nuclear receptor peroxisome proliferator-activated receptor gamma (PPARG) and its target genes. Functionally, we show that CTCF interacts with TET methylcytosine dioxygenase (TET) enzymes and promotes adipogenic transcriptional enhancer DNA hydroxymethylation. Our study reveals a dynamic CTCF chromatin binding landscape required for epigenomic remodeling of enhancers and transcriptional activation driving cell differentiation. PMID:25183525

  9. DNA sequences affecting specific initiation of transcription in vitro from the EIII promoter of adenovirus 2.

    PubMed Central

    Lee, D C; Roeder, R G; Wold, W S


    We have identified those sequences affecting the level of specific initiation of transcription in vitro from the EIII promoter of adenovirus 2. Mutants containing deletions in and around the initiation sites were constructed in cloned viral DNA fragments and assayed for their ability to initiate transcription in vitro. Three classes of mutants were studied with deletions in the following regions: -38 to -268, -21 to -71 (which includes the T-A-T-A-A box), and -29 through the cap sites (+1 and +3). Deletions that remove some or all of the area from -28 to several nucleotides downstream from the cap sites essentially abolished specific transcription. Small deletions in the region -30 to -41 reduced transcription to approximately 60% of wild type; larger deletions in the region -35 to -268 reduced transcription to 30-40% of wild type. Deletions beginning from approximately +10 to +25 and extending further downstream reduced transcription to 20-40% of wild type, whereas a deletion beginning at +31 had little or no effect. Our results suggest that the region including the T-A-T-A-A box and extending to the area immediately beyond the cap sites is essential for specific transcription in vitro from the EIII promoter. However, sequences upstream from the T-A-T-A-A box and those downstream from the cap sites appear to significantly modulate the levels of transcription. Images PMID:6275389

  10. Acute DNA damage activates the tumour suppressor p53 to promote radiation-induced lymphoma

    PubMed Central

    Lee, Chang-Lung; Castle, Katherine D.; Moding, Everett J.; Blum, Jordan M.; Williams, Nerissa; Luo, Lixia; Ma, Yan; Borst, Luke B.; Kim, Yongbaek; Kirsch, David G.


    Genotoxic cancer therapies, such as chemoradiation, cause haematological toxicity primarily by activating the tumour suppressor p53. While inhibiting p53-mediated cell death during cancer therapy ameliorates haematologic toxicity, whether it also impacts carcinogenesis remains unclear. Here we utilize a mouse model of inducible p53 short hairpin RNA (shRNA) to show that temporarily blocking p53 during total-body irradiation (TBI) not only ameliorates acute toxicity, but also improves long-term survival by preventing lymphoma development. Using KrasLA1 mice, we show that TBI promotes the expansion of a rare population of thymocytes that express oncogenic KrasG12D. However, blocking p53 during TBI significantly suppresses the expansion of KrasG12D-expressing thymocytes. Mechanistically, bone marrow transplant experiments demonstrate that TBI activates p53 to decrease the ability of bone marrow cells to suppress lymphoma development through a non-cell-autonomous mechanism. Together, our results demonstrate that the p53 response to acute DNA damage promotes the development of radiation-induced lymphoma. PMID:26399548

  11. RSC facilitates Rad59-dependent homologous recombination between sister chromatids by promoting cohesin loading at DNA double-strand breaks.


    Oum, Ji-Hyun; Seong, Changhyun; Kwon, Youngho; Ji, Jae-Hoon; Sid, Amy; Ramakrishnan, Sreejith; Ira, Grzegorz; Malkova, Anna; Sung, Patrick; Lee, Sang Eun; Shim, Eun Yong


    Homologous recombination repairs DNA double-strand breaks by searching for, invading, and copying information from a homologous template, typically the homologous chromosome or sister chromatid. Tight wrapping of DNA around histone octamers, however, impedes access of repair proteins to DNA damage. To facilitate DNA repair, modifications of histones and energy-dependent remodeling of chromatin are required, but the precise mechanisms by which chromatin modification and remodeling enzymes contribute to homologous DNA repair are unknown. Here we have systematically assessed the role of budding yeast RSC (remodel structure of chromatin), an abundant, ATP-dependent chromatin-remodeling complex, in the cellular response to spontaneous and induced DNA damage. RSC physically interacts with the recombination protein Rad59 and functions in homologous recombination. Multiple recombination assays revealed that RSC is uniquely required for recombination between sister chromatids by virtue of its ability to recruit cohesin at DNA breaks and thereby promoting sister chromatid cohesion. This study provides molecular insights into how chromatin remodeling contributes to DNA repair and maintenance of chromatin fidelity in the face of DNA damage.

  12. Long-term pancreatic beta cell exposure to high levels of glucose but not palmitate induces DNA methylation within the insulin gene promoter and represses transcriptional activity.


    Ishikawa, Kota; Tsunekawa, Shin; Ikeniwa, Makoto; Izumoto, Takako; Iida, Atsushi; Ogata, Hidetada; Uenishi, Eita; Seino, Yusuke; Ozaki, Nobuaki; Sugimura, Yoshihisa; Hamada, Yoji; Kuroda, Akio; Shinjo, Keiko; Kondo, Yutaka; Oiso, Yutaka


    Recent studies have implicated epigenetics in the pathophysiology of diabetes. Furthermore, DNA methylation, which irreversibly deactivates gene transcription, of the insulin promoter, particularly the cAMP response element, is increased in diabetes patients. However, the underlying mechanism remains unclear. We aimed to investigate insulin promoter DNA methylation in an over-nutrition state. INS-1 cells, the rat pancreatic beta cell line, were cultured under normal-culture-glucose (11.2 mmol/l) or experimental-high-glucose (22.4 mmol/l) conditions for 14 days, with or without 0.4 mmol/l palmitate. DNA methylation of the rat insulin 1 gene (Ins1) promoter was investigated using bisulfite sequencing and pyrosequencing analysis. Experimental-high-glucose conditions significantly suppressed insulin mRNA and increased DNA methylation at all five CpG sites within the Ins1 promoter, including the cAMP response element, in a time-dependent and glucose concentration-dependent manner. DNA methylation under experimental-high-glucose conditions was unique to the Ins1 promoter; however, palmitate did not affect DNA methylation. Artificial methylation of Ins1 promoter significantly suppressed promoter-driven luciferase activity, and a DNA methylation inhibitor significantly improved insulin mRNA suppression by experimental-high-glucose conditions. Experimental-high-glucose conditions significantly increased DNA methyltransferase activity and decreased ten-eleven-translocation methylcytosine dioxygenase activity. Oxidative stress and endoplasmic reticulum stress did not affect DNA methylation of the Ins1 promoter. High glucose but not palmitate increased ectopic triacylglycerol accumulation parallel to DNA methylation. Metformin upregulated insulin gene expression and suppressed DNA methylation and ectopic triacylglycerol accumulation. Finally, DNA methylation of the Ins1 promoter increased in isolated islets from Zucker diabetic fatty rats. This study helps to clarify the

  13. Role of anisomorphic DNA conformations in the negative regulation of a herpes simplex virus type 1 promoter.


    Sarisky, R T; Weber, P C


    The a sequence is a bifunctional element in the herpes simplex virus type 1 (HSV-1) genome which possesses both the signals required for the cleavage and encapsidation of replicated viral DNA and the promoter-regulatory sequences for the gene encoding the viral neurovirulence factor ICP34.5. Since the ICP34.5 promoter lacks features that are characteristic of most HSV-1 promoters, including a canonical TATA box, an initiator element, and upstream binding sites for host cell transcription factors, a mutational analysis was undertaken to identify the cis-acting elements which mediate transcription of this gene in transient transfection assays. A deletion derivative containing sequences just 83 nucleotides upstream of the second of two cap sites was found to exhibit full promoter activity. However, the presence of either of two far upstream regions, which coincided with the DR2 and DR6 tandem GC-rich repeat arrays, acted to abrogate transcriptional activity both in this segment of the ICP34.5 promoter and in a heterologous promoter construct. The DR2 and DR6 repeat arrays each possessed an unwound S1 nuclease-sensitive DNA conformation (anisomorphic DNA) whose formation was shown to be critical for mediating this transcriptional repression effect. Moreover, results from in vivo titration experiments suggested the existence of a cellular protein(s) which can mediate transcriptional repression in the ICP34.5 promoter by specifically interacting with the single-stranded regions of these tandem repeat arrays. Such DNA conformation-dependent transcriptional silencing appears to represent a novel mechanism of gene regulation in the HSV-1 life cycle.

  14. The DNA cytosine deaminase APOBEC3B promotes tamoxifen resistance in ER-positive breast cancer

    PubMed Central

    Law, Emily K.; Sieuwerts, Anieta M.; LaPara, Kelly; Leonard, Brandon; Starrett, Gabriel J.; Molan, Amy M.; Temiz, Nuri A.; Vogel, Rachel Isaksson; Meijer-van Gelder, Marion E.; Sweep, Fred C. G. J.; Span, Paul N.; Foekens, John A.; Martens, John W. M.; Yee, Douglas; Harris, Reuben S.


    Breast tumors often display extreme genetic heterogeneity characterized by hundreds of gross chromosomal aberrations and tens of thousands of somatic mutations. Tumor evolution is thought to be ongoing and driven by multiple mutagenic processes. A major outstanding question is whether primary tumors have preexisting mutations for therapy resistance or whether additional DNA damage and mutagenesis are necessary. Drug resistance is a key measure of tumor evolvability. If a resistance mutation preexists at the time of primary tumor presentation, then the intended therapy is likely to fail. However, if resistance does not preexist, then ongoing mutational processes still have the potential to undermine therapeutic efficacy. The antiviral enzyme APOBEC3B (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3B) preferentially deaminates DNA C-to-U, which results in signature C-to-T and C-to-G mutations commonly observed in breast tumors. We use clinical data and xenograft experiments to ask whether APOBEC3B contributes to ongoing breast tumor evolution and resistance to the selective estrogen receptor modulator, tamoxifen. First, APOBEC3B levels in primary estrogen receptor–positive (ER+) breast tumors inversely correlate with the clinical benefit of tamoxifen in the treatment of metastatic ER+ disease. Second, APOBEC3B depletion in an ER+ breast cancer cell line results in prolonged tamoxifen responses in murine xenograft experiments. Third, APOBEC3B overexpression accelerates the development of tamoxifen resistance in murine xenograft experiments by a mechanism that requires the enzyme’s catalytic activity. These studies combine to indicate that APOBEC3B promotes drug resistance in breast cancer and that inhibiting APOBEC3B-dependent tumor evolvability may be an effective strategy to improve efficacies of targeted cancer therapies. PMID:27730215

  15. Orientation-specific joining of AID-initiated DNA breaks promotes antibody class switching.


    Dong, Junchao; Panchakshari, Rohit A; Zhang, Tingting; Zhang, Yu; Hu, Jiazhi; Volpi, Sabrina A; Meyers, Robin M; Ho, Yu-Jui; Du, Zhou; Robbiani, Davide F; Meng, Feilong; Gostissa, Monica; Nussenzweig, Michel C; Manis, John P; Alt, Frederick W


    During B-cell development, RAG endonuclease cleaves immunoglobulin heavy chain (IgH) V, D, and J gene segments and orchestrates their fusion as deletional events that assemble a V(D)J exon in the same transcriptional orientation as adjacent Cμ constant region exons. In mice, six additional sets of constant region exons (CHs) lie 100-200 kilobases downstream in the same transcriptional orientation as V(D)J and Cμ exons. Long repetitive switch (S) regions precede Cμ and downstream CHs. In mature B cells, class switch recombination (CSR) generates different antibody classes by replacing Cμ with a downstream CH (ref. 2). Activation-induced cytidine deaminase (AID) initiates CSR by promoting deamination lesions within Sμ and a downstream acceptor S region; these lesions are converted into DNA double-strand breaks (DSBs) by general DNA repair factors. Productive CSR must occur in a deletional orientation by joining the upstream end of an Sμ DSB to the downstream end of an acceptor S-region DSB. However, the relative frequency of deletional to inversional CSR junctions has not been measured. Thus, whether orientation-specific joining is a programmed mechanistic feature of CSR as it is for V(D)J recombination and, if so, how this is achieved is unknown. To address this question, we adapt high-throughput genome-wide translocation sequencing into a highly sensitive DSB end-joining assay and apply it to endogenous AID-initiated S-region DSBs in mouse B cells. We show that CSR is programmed to occur in a productive deletional orientation and does so via an unprecedented mechanism that involves in cis Igh organizational features in combination with frequent S-region DSBs initiated by AID. We further implicate ATM-dependent DSB-response factors in enforcing this mechanism and provide an explanation of why CSR is so reliant on the 53BP1 DSB-response factor.

  16. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.


    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay


    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  17. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    SciTech Connect

    Fukumoto, Yasunori Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto


    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint.

  18. The SNF2 family ATPase LSH promotes cell-autonomous de novo DNA methylation in somatic cells

    PubMed Central

    Termanis, Ausma; Torrea, Natalia; Culley, Jayne; Kerr, Alastair; Ramsahoye, Bernard; Stancheva, Irina


    Methylation of DNA at carbon 5 of cytosine is essential for mammalian development and implicated in transcriptional repression of genes and transposons. New patterns of DNA methylation characteristic of lineage-committed cells are established at the exit from pluripotency by de novo DNA methyltransferases enzymes, DNMT3A and DNMT3B, which are regulated by developmental signaling and require access to chromatin-organized DNA. Whether or not the capacity for de novo DNA methylation of developmentally regulated loci is preserved in differentiated somatic cells and can occur in the absence of exogenous signals is currently unknown. Here, we demonstrate that fibroblasts derived from chromatin remodeling ATPase LSH (HELLS)-null mouse embryos, which lack DNA methylation from centromeric repeats, transposons and a number of gene promoters, are capable of reestablishing DNA methylation and silencing of misregulated genes upon re-expression of LSH. We also show that the ability of LSH to bind ATP and the cellular concentration of DNMT3B are critical for cell-autonomous de novo DNA methylation in somatic cells. These data suggest the existence of cellular memory that persists in differentiated cells through many cell generations and changes in transcriptional state. PMID:27179028

  19. Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.

    PubMed Central

    Katsani, K R; Hajibagheri, M A; Verrijzer, C P


    The POZ domain is a conserved protein-protein interaction motif present in a variety of transcription factors involved in development, chromatin remodelling and human cancers. Here, we study the role of the POZ domain of the GAGA transcription factor in promoter recognition. Natural target promoters for GAGA typically contain multiple GAGA-binding elements. Our results show that the POZ domain mediates strong co-operative binding to multiple sites but inhibits binding to single sites. Protein cross-linking and gel filtration chromatography experiments established that the POZ domain is required for GAGA oligomerization into higher order complexes. Thus, GAGA oligomerization increases binding specificity by selecting only promoters with multiple sites. Electron microscopy revealed that GAGA binds to multiple sites as a large oligomer and induces bending of the promoter DNA. Our results indicate a novel mode of DNA binding by GAGA, in which a large GAGA complex binds multiple GAGA elements that are spread out over a region of a few hundred base pairs. We suggest a model in which the promoter DNA is wrapped around a GAGA multimer in a conformation that may exclude normal nucleosome formation. PMID:9927429

  20. DNA methylation in the Neuropeptide S Receptor 1 (NPSR1) promoter in relation to asthma and environmental factors.


    Reinius, Lovisa E; Gref, Anna; Sääf, Annika; Acevedo, Nathalie; Joerink, Maaike; Kupczyk, Maciej; D'Amato, Mauro; Bergström, Anna; Melén, Erik; Scheynius, Annika; Dahlén, Sven-Erik; Pershagen, Göran; Söderhäll, Cilla; Kere, Juha


    Asthma and allergy are complex disorders influenced by both inheritance and environment, a relationship that might be further clarified by epigenetics. Neuropeptide S Receptor 1 (NPSR1) has been associated with asthma and allergy and a study suggested modulation of the genetic risk by environmental factors. We aimed to study DNA methylation in the promoter region of NPSR1 in relation to asthma and environmental exposures. Electrophoretic Mobility Shift Assay (EMSA) was used to investigate potential functional roles of both genotypes and methylation status in the NPSR1 promoter. DNA methylation was analysed using EpiTYPER in blood samples from two well-characterized cohorts; the BIOAIR study of severe asthma in adults and the Swedish birth cohort BAMSE. We observed that DNA methylation and genetic variants in the promoter influenced the binding of nuclear proteins to DNA, suggesting functional relevance. Significant, although small, differences in methylation were related to both adult severe asthma (p = 0.0001) and childhood allergic asthma (p = 0.01). Furthermore, DNA methylation was associated with exposures such as current smoking in adults for two CpG sites (p = 0.005 and 0.04), parental smoking during infancy in the children (p = 0.02) and in which month the sample was taken (p = 0.01). In summary, DNA methylation levels in the promoter of NPSR1 showed small but significant associations with asthma, both in adults and in children, and to related traits such as allergy and certain environmental exposures. Both genetic variation and the methylated state of CpG sites seem to have an effect on the binding of nuclear proteins in the regulatory region of NPSR1 suggesting complex regulation of this gene in asthma and allergy. PMID:23372674

  1. Hepatitis B virus basal core promoter mutations show lower replication fitness associated with cccDNA acetylation status.


    Koumbi, Lemonica; Pollicino, Teresa; Raimondo, Giovanni; Stampoulis, Dimitrios; Khakoo, Salim; Karayiannis, Peter


    In chronic hepatitis B virus (HBV) infection, variants with mutations in the basal core promoter (BCP) and precore region predominate and associate with more severe disease forms. Studies on their effect on viral replication remain controversial. Increasing evidence shows that epigenetic modifications of cccDNA regulate HBV replication and disease outcome. Here we determined the transcription and viral replication efficiency of well-defined BCP and precore mutations and their effect on cccDNA epigenetic control. HBV monomers bearing BCP mutations A1762T/G1764A and A1762T/G1764A/C1766T, and precore mutations G1896A, G1899A and G1896A/G1899A, were transfected into HepG2 cells using a plasmid-free approach. Viral RNA transcripts were detected by Northern blot hybridization and RT PCR, DNA replicative intermediates by Southern blotting and RT PCR, and viral release was measured by ELISA. Acetylation of cccDNA-bound histones was assessed by Chromatin ImmunoPrecipitation (ChIP) assay and methylation of cccDNA by bisulfite sequencing. BCP mutations resulted in low viral release, mRNA transcription and pgRNA/cccDNA ratios that paralleled the acetylation of cccDNA-bound H4 histone and inversely correlated with the HDAC1 recruitment onto cccDNA. Independently of the mutations, cccDNA was a target for methylation, accompanied by the upregulation of DNMT1 expression and DNMT1 recruitment onto cccDNA. Our results suggest that BCP mutations decrease viral replication capacity possibly by modulating the acetylation and deacetylation of cccDNA-bound histones while precore mutations do not have a significant effect on viral replication. These data provide evidence that epigenetic factors contribute to the regulation of HBV viral replication.

  2. A critical re-assessment of DNA repair gene promoter methylation in non-small cell lung carcinoma

    PubMed Central

    Do, Hongdo; Wong, Nicholas C.; Murone, Carmel; John, Thomas; Solomon, Benjamin; Mitchell, Paul L.; Dobrovic, Alexander


    DNA repair genes that have been inactivated by promoter methylation offer potential therapeutic targets either by targeting the specific repair deficiency, or by synthetic lethal approaches. This study evaluated promoter methylation status for eight selected DNA repair genes (ATM, BRCA1, ERCC1, MGMT, MLH1, NEIL1, RAD23B and XPC) in 56 non-small cell lung cancer (NSCLC) tumours and 11 lung cell lines using the methylation-sensitive high resolution melting (MS-HRM) methodology. Frequent methylation in NEIL1 (42%) and infrequent methylation in ERCC1 (2%) and RAD23B (2%) are reported for the first time in NSCLC. MGMT methylation was detected in 13% of the NSCLCs. Contrary to previous studies, methylation was not detected in ATM, BRCA1, MLH1 and XPC. Data from The Cancer Genome Atlas (TCGA) was consistent with these findings. The study emphasises the importance of using appropriate methodology for accurate assessment of promoter methylation. PMID:24569633

  3. DNA affinity labeling of adenovirus type 2 upstream promoter sequence-binding factors identifies two distinct proteins

    SciTech Connect

    Safer, B.; Cohen, R.B.; Garfinkel, S.; Thompson, J.A.


    A rapid affinity labeling procedure with enhanced specificity was developed to identify DNA-binding proteins. /sup 32/P was first introduced at unique phosphodiester bonds within the DNA recognition sequence. UV light-dependent cross-linking of pyrimidines to amino acid residues in direct contact at the binding site, followed by micrococcal nuclease digestion, resulted in the transfer of /sup 32/P to only those specific protein(s) which recognized the binding sequence. This method was applied to the detection and characterization of proteins that bound to the upstream promoter sequence (-50 to -66) of the human adenovirus type 2 major late promoter. We detected two distinct proteins with molecular weights of 45,000 and 116,000 that interacted with this promoter element. The two proteins differed significantly in their chromatographic and cross-linking behaviors.

  4. Gastric cancer associated variant of DNA polymerase beta (Leu22Pro) promotes DNA replication associated double strand breaks.


    Rozacky, Jenna; Nemec, Antoni A; Sweasy, Joann B; Kidane, Dawit


    DNA polymerase beta (Pol β) is a key enzyme for the protection against oxidative DNA lesions via its role in base excision repair (BER). Approximately 1/3 of tumors studied to date express Pol β variant proteins, and several tumors overexpress Pol β. Pol β possesses DNA polymerase and dRP lyase activities, both of which are known to be important for efficient BER. The dRP lyase activity resides within the 8kDa amino terminal domain of Pol β, is responsible for removal of the 5' phosphate group (5'-dRP). The DNA polymerase subsequently fills the gaps. Previously, we demonstrated that the human gastric cancer-associated variant of Pol β (Leu22Pro (L22P)) lacks dRP lyase function in vitro. Here, we report that L22P-expressing cells harbor significantly increased replication associated DNA double strand breaks (DSBs) and defective maintenance of the nascent DNA strand (NDS) during replication stress. Moreover, L22P-expressing cells are sensitive to PARP1 inhibitors, which suggests trapped PARP1 binds to the 5'-dRP group and blocks replications forks, resulting in fork collapse and DSBs. Our data suggest that the normal function of the dRP lyase is critical to maintain replication fork integrity and prevent replication fork collapse to DSBs and cellular transformation. PMID:26090616

  5. The cAMP phosphodiesterase Prune localizes to the mitochondrial matrix and promotes mtDNA replication by stabilizing TFAM

    PubMed Central

    Zhang, Fan; Qi, Yun; Zhou, Kiet; Zhang, Guofeng; Linask, Kaari; Xu, Hong


    Compartmentalized cAMP signaling regulates mitochondrial dynamics, morphology, and oxidative phosphorylation. However, regulators of the mitochondrial cAMP pathway, and its broad impact on organelle function, remain to be explored. Here, we report that Drosophila Prune is a cyclic nucleotide phosphodiesterase that localizes to the mitochondrial matrix. Knocking down prune in cultured cells reduces mitochondrial transcription factor A (TFAM) and mitochondrial DNA (mtDNA) levels. Our data suggest that Prune stabilizes TFAM and promotes mitochondrial DNA (mtDNA) replication through downregulation of mitochondrial cAMP signaling. In addition, our work demonstrates the prevalence of mitochondrial cAMP signaling in metazoan and its new role in mitochondrial biogenesis. PMID:25648146

  6. DNA promoter hypermethylation in nipple fluid: a potential tool for early breast cancer detection

    PubMed Central

    de Groot, Jolien S.; Moelans, Cathy B.; Elias, Sjoerd G.; Fackler, Mary Jo; van Domselaar, Robert; Suijkerbuijk, Karijn P.M.; Witkamp, Arjen J.; Sukumar, Saraswati; van Diest, Paul J.; van der Wall, Elsken


    Introduction Nipple fluid aspiration provides direct non-invasive sampling of fluid from the mammary ductal system, where the majority of breast cancers originate. DNA promoter hypermethylation (“methylation”) occurs early and at high frequency in breast carcinogenesis, bearing the potential as a biomarker for cancer detection at its earliest stages. We assessed methylation in nipple fluid from breasts of healthy women, of women with sporadic breast cancer and of their contralateral breasts. Our goal was to investigate whether nipple fluid can be used as a reliable methylation biomarker source. Methods Methylation levels of 13 genes were analysed by quantitative multiplex-methylation specific PCR (QM-MSP) in nipple fluid samples from breasts of healthy women, and from the affected and contralateral breasts of breast cancer patients. Results Methylation analysis of the low-volume nipple fluid samples was feasible. Despite the generally low methylation levels, cancerous and healthy breasts nipple fluid could be discriminated with an area under the receiver operating characteristic curve (AUC) of 0.64 (p<0.01) based on a multivariate model including AKR1B1, ALX1, RASSF1A and TM6SF1. Within-patient differences between cancerous and contralateral nipple fluid samples were less prominent. Conclusions Cancerous nipple fluid contains increased levels of methylation of tumor suppressor genes that potentially could serve as a biomarker for early breast cancer detection. PMID:27028854

  7. Gene conversion causing human inherited disease: evidence for involvement of non-B-DNA-forming sequences and recombination-promoting motifs in DNA breakage and repair

    PubMed Central

    Chuzhanova, Nadia; Chen, Jian-Min; Bacolla, Albino; Patrinos, George P.; Férec, Claude; Wells, Robert D.; Cooper, David N.


    A variety of DNA sequence motifs including inverted repeats, minisatellites, and the χ recombination hotspot, have been reported in association with gene conversion in human genes causing inherited disease. However, no methodical statistically-based analysis has been performed to formalize these observations. We have performed an in silico analysis of the DNA sequence tracts involved in 27 non-overlapping gene conversion events in 19 different genes reported in the context of inherited disease. We found that gene conversion events tend to occur within (C+G)- and CpG-rich regions and that sequences with the potential to form non-B-DNA structures, and which may be involved in the generation of double-strand breaks that could in turn serve to promote gene conversion, occur disproportionately within maximal converted tracts and/or short flanking regions. Maximal converted tracts were also found to be enriched (p<0.01) in a truncated version of the χ-element (a TGGTGG motif), immunoglobulin heavy chain class switch repeats, translin target sites and several novel motifs including (or overlapping) the classical meiotic recombination hotspot, CCTCCCCT. Finally, gene conversions tend to occur in genomic regions that have the potential to fold into stable hairpin conformations. These findings support the concept that recombination-inducing motifs, in association with alternative DNA conformations, can promote recombination in the human genome. PMID:19431182

  8. Transcriptional activation by TFIIB mutants that are severely impaired in interaction with promoter DNA and acidic activation domains.

    PubMed Central

    Chou, S; Struhl, K


    Biochemical experiments indicate that the general transcription factor IIB (TFIIB) can interact directly with acidic activation domains and that activators can stimulate transcription by increasing recruitment of TFIIB to promoters. For promoters at which recruitment of TFIIB to promoters is limiting in vivo, one would predict that transcriptional activity should be particularly sensitive to TFIIB mutations that decrease the association of TFIIB with promoter DNA and/or with activation domains; i.e., such TFIIB mutations should exacerbate a limiting step that occurs in wild-type cells. Here, we describe mutations on the DNA-binding surface of TFIIB that severely affect both TATA-binding protein (TBP)-TFIIB-TATA complex formation and interaction with the VP16 activation domain in vitro. These TFIIB mutations affect the stability of the TBP-TFIIB-TATA complex in vivo because they are synthetically lethal in combination with TBP mutants impaired for TFIIB binding. Interestingly, these TFIIB derivatives support viability, and they efficiently respond to Gal4-VP16 and natural acidic activators in different promoter contexts. These results suggest that in vivo, recruitment of TFIIB is not generally a limiting step for acidic activators. However, one TFIIB derivative shows reduced transcription of GAL4, suggesting that TFIIB may be limiting at a subset of promoters in vivo. PMID:9372910

  9. Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-β receptor promoter DNA

    PubMed Central

    Agarkar, Vinod B.; Babayeva, Nigar D.; Wilder, Phillip J.; Rizzino, Angie; Tahirov, Tahir H.


    The Ets family of transcription factors is composed of more than 30 members. One of its members, Elf3, is expressed in virtually all epithelial cells as well as in many tumors, including breast tumors. Several studies observed that the promoter of the type II TGF-β receptor gene (TβR-II) is strongly stimulated by Elf3 via two adjacent Elf3 binding sites, A-site and B-site. Here we report the 2.2 Å resolution crystal structure of a mouse Elf3 C-terminal fragment, containing the DNA-binding Ets domain, in complex with the B-site of mouse type II TGF-β receptor promoter DNA (mTβR-IIDNA). Elf3 contacts the core GGAA motif of the B-site from major groove similar to that of known Ets proteins. However, unlike other Ets proteins, Elf3 also contacts sequences of the A-site from the minor groove of the DNA. DNA binding experiments and cell-based transcription studies indicate that minor groove interaction by Arg349 located in the Ets domain is important for Elf3 function. Equally interesting, previous studies have shown that the C-terminal region of Elf3, which flanks the Ets domain, is required for Elf3 binding to DNA. In this study, we determined that Elf3 amino acid residues within this flanking region, including Trp361, are important for the structural integrity of the protein as well as for the Efl3 DNA binding and transactivation activity. PMID:20079749

  10. Enhanced GSH synthesis by Bisphenol A exposure promoted DNA methylation process in the testes of adult rare minnow Gobiocypris rarus.


    Yuan, Cong; Zhang, Yingying; Liu, Yan; Zhang, Ting; Wang, Zaizhao


    DNA methylation is a commonly studied epigenetic modification. The mechanism of BPA on DNA methylation is poorly understood. The present study aims to explore whether GSH synthesis affects DNA methylation in the testes of adult male rare minnow Gobiocypris rarus in response to Bisphenol A (BPA). Male G. rarus was exposed to 1, 15 and 225μgL(-1) BPA for 7 days. The levels of global DNA methylation, hydrogen peroxide (H2O2) and glutathione (GSH) in the testes were analyzed. Meanwhile, the levels of enzymes involved in DNA methylation and de novo GSH synthesis, and the substrate contents for GSH production were measured. Furthermore, gene expression profiles of the corresponding genes of all studied enzymes were analyzed. Results indicated that BPA at 15 and 225μgL(-1) caused hypermethylation of global DNA in the testes. The 15μgL(-1) BPA resulted in significant decrease of ten-eleven translocation proteins (TETs) while 225μgL(-1) BPA caused significant increase of DNA methyltransferase proteins (DNMTs). Moreover, 225μgL(-1) BPA caused significant increase of H2O2 and GSH levels, and the de novo GSH synthesis was enhanced. These results indicated that the significant decrease of the level of TETs may be sufficient to cause the DNA hypermethylation by 15μgL(-1) BPA. However, the significantly increased of DNMTs contributed to the significant increase of DNA methylation levels by 225μgL(-1) BPA. Moreover, the elevated de novo GSH synthesis may promote the DNA methylation process. PMID:27474941

  11. Identification of a Cryptic Bacterial Promoter in Mouse (mdr1a) P-Glycoprotein cDNA.


    Pluchino, Kristen M; Esposito, Dominic; Moen, Janna K; Hall, Matthew D; Madigan, James P; Shukla, Suneet; Procter, Lauren V; Wall, Vanessa E; Schneider, Thomas D; Pringle, Ian; Ambudkar, Suresh V; Gill, Deborah R; Hyde, Steven C; Gottesman, Michael M


    The efflux transporter P-glycoprotein (P-gp) is an important mediator of various pharmacokinetic parameters, being expressed at numerous physiological barriers and also in multidrug-resistant cancer cells. Molecular cloning of homologous cDNAs is an important tool for the characterization of functional differences in P-gp between species. However, plasmids containing mouse mdr1a cDNA display significant genetic instability during cloning in bacteria, indicating that mdr1a cDNA may be somehow toxic to bacteria, allowing only clones containing mutations that abrogate this toxicity to survive transformation. We demonstrate here the presence of a cryptic promoter in mouse mdr1a cDNA that causes mouse P-gp expression in bacteria. This expression may account for the observed toxicity of mdr1a DNA to bacteria. Sigma 70 binding site analysis and GFP reporter plasmids were used to identify sequences in the first 321 bps of mdr1a cDNA capable of initiating bacterial protein expression. An mdr1a M107L cDNA containing a single residue mutation at the proposed translational start site was shown to allow sub-cloning of mdr1a in E. coli while retaining transport properties similar to wild-type P-gp. This mutant mdr1a cDNA may prove useful for efficient cloning of mdr1a in E. coli.

  12. A novel fluorescent biosensor for detection of target DNA fragment from the transgene cauliflower mosaic virus 35S promoter.


    Qiu, Bin; Zhang, Ya-shan; Lin, Yi-bing; Lu, Yu-Jing; Lin, Zhen-yu; Wong, Kwok-Yin; Chen, Guo-nan


    In this paper, we reported a convenient fluorescence method for the detection of genetically modified organisms (GMOs). As it is known that the cauliflower mosaic virus (CaMV) 35S promoter is widely used in most transgenic plants (Schnurr and Guerra, 2000), we thus design a simple method based on the detection of a section target DNA (DNA-T) from the transgene CaMV 35S promoter. In this method, the full-length guanine-rich single-strand sequences were split into fragments (Probe 1 and 2) and each part of the fragment possesses two GGG repeats. In the presence of K(+) ion and berberine, if a complementary target DNA of the CaMV 35S promoter was introduced to hybridize with Probe 1 and 2, a G-quadruplex-berberine complex was thus formed and generated a strong fluorescence signal. The generation of fluorescence signal indicates the presence of CaMV 35S promoter. This method is able to identify and quantify Genetically Modified Organisms (GMOs), and it shows wide linear ranges from 5.0×10(-9) to 9.0×10(-7) mol/L with a detection limit of 2.0×10(-9) mol/L. PMID:22959013

  13. A novel fluorescent biosensor for detection of target DNA fragment from the transgene cauliflower mosaic virus 35S promoter.


    Qiu, Bin; Zhang, Ya-shan; Lin, Yi-bing; Lu, Yu-Jing; Lin, Zhen-yu; Wong, Kwok-Yin; Chen, Guo-nan


    In this paper, we reported a convenient fluorescence method for the detection of genetically modified organisms (GMOs). As it is known that the cauliflower mosaic virus (CaMV) 35S promoter is widely used in most transgenic plants (Schnurr and Guerra, 2000), we thus design a simple method based on the detection of a section target DNA (DNA-T) from the transgene CaMV 35S promoter. In this method, the full-length guanine-rich single-strand sequences were split into fragments (Probe 1 and 2) and each part of the fragment possesses two GGG repeats. In the presence of K(+) ion and berberine, if a complementary target DNA of the CaMV 35S promoter was introduced to hybridize with Probe 1 and 2, a G-quadruplex-berberine complex was thus formed and generated a strong fluorescence signal. The generation of fluorescence signal indicates the presence of CaMV 35S promoter. This method is able to identify and quantify Genetically Modified Organisms (GMOs), and it shows wide linear ranges from 5.0×10(-9) to 9.0×10(-7) mol/L with a detection limit of 2.0×10(-9) mol/L.

  14. Structure and dynamics of polymyxin-resistance-associated response regulator PmrA in complex with promoter DNA

    PubMed Central

    Lou, Yuan-Chao; Weng, Tsai-Hsuan; Li, Yi-Chuan; Kao, Yi-Fen; Lin, Wei-Feng; Peng, Hwei-Ling; Chou, Shan-Ho; Hsiao, Chwan-Deng; Chen, Chinpan


    PmrA, an OmpR/PhoB family response regulator, manages genes for antibiotic resistance. Phosphorylation of OmpR/PhoB response regulator induces the formation of a symmetric dimer in the N-terminal receiver domain (REC), promoting two C-terminal DNA-binding domains (DBDs) to recognize promoter DNA to elicit adaptive responses. Recently, determination of the KdpE–DNA complex structure revealed an REC–DBD interface in the upstream protomer that may be necessary for transcription activation. Here, we report the 3.2-Å-resolution crystal structure of the PmrA–DNA complex, which reveals a similar yet different REC–DBD interface. However, NMR studies show that in the DNA-bound state, two domains tumble separately and an REC–DBD interaction is transiently populated in solution. Reporter gene analyses of PmrA variants with altered interface residues suggest that the interface is not crucial for supporting gene expression. We propose that REC–DBD interdomain dynamics and the DBD–DBD interface help PmrA interact with RNA polymerase holoenzyme to activate downstream gene transcription. PMID:26564787

  15. DNA Methylation and Histone Modifications Are Associated with Repression of the Inhibin α Promoter in the Rat Corpus Luteum

    PubMed Central

    Meldi, Kristen M.; Gaconnet, Georgia A.


    The transition from follicle to corpus luteum after ovulation is associated with profound morphological and functional changes and is accompanied by corresponding changes in gene expression. The gene encoding the α subunit of the dimeric reproductive hormone inhibin is maximally expressed in the granulosa cells of the preovulatory follicle, is rapidly repressed by the ovulatory LH surge, and is expressed at only very low levels in the corpus luteum. Although previous studies have identified transient repressors of inhibin α gene transcription, little is known about how this repression is maintained in the corpus luteum. This study examines the role of epigenetic changes, including DNA methylation and histone modification, in silencing of inhibin α gene expression. Bisulfite sequencing reveals that methylation of the inhibin α proximal promoter is low in preovulatory and ovulatory follicles but is elevated in the corpus luteum. Increased methylation during luteinization is observed within the cAMP response element in the promoter, and EMSA demonstrate that methylation of this site inhibits cAMP response element binding protein binding in vitro. Chromatin immunoprecipitation reveals that repressive histone marks H3K9 and H3K27 trimethylation are increased on the inhibin α promoter in primary luteal cells, whereas the activation mark H3K4 trimethylation is decreased. The changes in histone modification precede the alterations in DNA methylation, suggesting that they facilitate the recruitment of DNA methyltransferases. We show that the DNA methyltransferase DNMT3a is present in the ovary and in luteal cells when the inhibin α promoter becomes methylated and observe recruitment of DNMT3a to the inhibin promoter during luteinization. PMID:22865368

  16. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley

    PubMed Central

    Solís, María-Teresa; El-Tantawy, Ahmed-Abdalla; Cano, Vanesa; Risueño, María C.; Testillano, Pilar S.


    Microspores are reprogrammed by stress in vitro toward embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC) cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5-methyl-deoxy-cytidine (5mdC) immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/decondensation) by light and electron microscopy. Four days of AzaC treatments (2.5 μM) increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC, and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition, and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition. Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs. PMID:26161085

  17. Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.


    Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni


    Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets.

  18. Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.


    Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni


    Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. PMID:26427337

  19. Lactase persistence DNA variant enhances lactase promoter activity in vitro: functional role as a cis regulatory element.


    Olds, Lynne C; Sibley, Eric


    Lactase persistence is a heritable, autosomal dominant, condition that results in a sustained ability to digest the milk sugar lactose throughout adulthood. The majority of the world's human population experiences a decline in production of the digestive enzyme lactase-phlorizin hydrolase during maturation. However, individuals with lactase persistence continue to express high levels of the lactase gene into adulthood. Lactase persistence has been strongly correlated with single nucleotide genetic variants, C/T_(13910) and G/A_(22018), located 13.9 and 22 kb upstream from the lactase structural gene. We aimed to characterize a functional role for the polymorphisms in regulating lactase gene transcription. DNA in the region of the C/T_(13910) or G/A_(22018) human lactase variants was cloned upstream of the 3.0 kb rat lactase gene promoter in a luciferase reporter construct. Human intestinal Caco-2 cells were transfected with the lactase variant/promoter-reporter constructs and assayed for promoter activity. A 200 bp region surrounding the C_(13910) variant, associated with lactase non-persistence, results in a 2.2-fold increase in lactase promoter activity. The T_(13910) variant, associated with lactase persistence, results in an even greater 2.8-fold increase. The DNA sequence of the C/T_(13910) variants differentially interacts with intestinal cell nuclear proteins on EMSAs. AP2 co-transfection results in a similar repression of the C/T_(13910) variant/promoter-reporter constructs. The DNA region of the C/T_(13910) lactase persistence/non-persistence variant functions in vitro as a cis element capable of enhancing differential transcriptional activation of the lactase promoter. Such differential regulation by the C and T variants is consistent with a causative role in the mechanism specifying the lactase persistence/non-persistence phenotypes in humans.

  20. Protein-DNA interactions in the promoter region of the amyloid precursor protein (APP) gene in human neocortex.


    Lukiw, W J; Rogaev, E I; Wong, L; Vaula, G; McLachlan, D R; St George Hyslop, P


    We have investigated protein-DNA interactions in the proximal promoter of the human amyloid precursor protein (APP) gene in temporal lobe neocortical nuclei isolated from control and Alzheimer disease (AD) affected brains. We report that the human APP 5' promoter sequence from -203 to +55 bp, which has been previously reported to contain essential regulatory elements for APP gene transcription, lies in a deoxyribonuclease I, micrococcal nuclease- and restriction endonuclease-sensitive, G+C-rich nucleosome-free gap flanked both 5' and 3' by typical nucleosome structures. As analyzed by electrophoretic mobility shift assay, this extended internucleosomal linker DNA is heavily occupied by nuclear protein factors, and interacts differentially with nuclear protein extracts obtained from HeLa and human brain neocortical nuclei. This suggests that the chromatin conformation of the APP gene promoter may vary in different cell types, and may correlate with differences in APP gene expression. Human recombinant transcription factors AP1, SP1 and TFIID (but not AP2 or brain histones H1, H2B and H4) interact with the -203 to +55 bp of the human APP promoter sequence. Only minor differences were observed in the chromatin structure of the immediate APP promoter between non-AD and AD affected neocortical nuclei, suggesting either that post-transcriptional processes, or that regulatory elements lying elsewhere in the APP gene may be important in the aberrant accumulation of the APP gene product.

  1. Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress

    PubMed Central

    Santos, Efrén; Remy, Serge; Thiry, Els; Windelinckx, Saskia; Swennen, Rony; Sági, László


    Background Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored in real time. Results Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26°C followed by a gradual decrease to 8°C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. Conclusion This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate promoters even in a multicopy T-DNA

  2. Systematic E2 screening reveals a UBE2D-RNF138-CtIP axis promoting DNA repair

    PubMed Central

    Sczaniecka-Clift, Matylda; Coates, Julia; Jhujh, Satpal; Demir, Mukerrem; Cornwell, Matthew; Beli, Petra; Jackson, Stephen P


    Ubiquitylation is crucial for proper cellular responses to DNA double-strand breaks (DSBs). If unrepaired, these highly cytotoxic lesions cause genome instability, tumourigenesis, neurodegeneration or premature ageing. Here, we conduct a comprehensive, multilayered screen to systematically profile all human ubiquitin E2-enzymes for impacts on cellular DSB responses. Applying a widely applicable approach, we use an exemplary E2 family, UBE2Ds, to identify ubiquitylation-cascade components downstream of E2s. Thus, we uncover the nuclear E3-ligase RNF138 as a key homologous recombination (HR)-promoting factor that functions with UBE2Ds in cells. Mechanistically, UBE2Ds and RNF138 accumulate at DNA-damage sites and act at early resection stages by promoting CtIP ubiquitylation and accrual. This work supplies insights into regulation of DSB repair by HR. Moreover, it provides a rich information resource on E2s that can be exploited by follow-on studies. PMID:26502057

  3. Rev1 promotes replication through UV lesions in conjunction with DNA polymerases η, ι, and κ but not DNA polymerase ζ

    PubMed Central

    Yoon, Jung-Hoon; Park, Jeseong; Conde, Juan; Wakamiya, Maki; Prakash, Louise; Prakash, Satya


    Translesion synthesis (TLS) DNA polymerases (Pols) promote replication through DNA lesions; however, little is known about the protein factors that affect their function in human cells. In yeast, Rev1 plays a noncatalytic role as an indispensable component of Polζ, and Polζ together with Rev1 mediates a highly mutagenic mode of TLS. However, how Rev1 functions in TLS and mutagenesis in human cells has remained unclear. Here we determined the role of Rev1 in TLS opposite UV lesions in human and mouse fibroblasts and showed that Rev1 is indispensable for TLS mediated by Polη, Polι, and Polκ but is not required for TLS by Polζ. In contrast to its role in mutagenic TLS in yeast, Rev1 promotes predominantly error-free TLS opposite UV lesions in humans. The identification of Rev1 as an indispensable scaffolding component for Polη, Polι, and Polκ, which function in TLS in highly specialized ways opposite a diverse array of DNA lesions and act in a predominantly error-free manner, implicates a crucial role for Rev1 in the maintenance of genome stability in humans. PMID:26680302

  4. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.


    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi


    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  5. [Methylation of FHIT gene promoter region in DNA from plasma of patients with myelodysplastic syndromes and demethylating effect of decitabine].


    Deng, Yin-Fen; Zhang, Lei; Zhang, Xiu-Qun; Hu, Ming-Qiu; Dai, Dan; Zhang, Xue-Zhong; Xu, Yan-Li


    This study was aimed to detect the methylation status of FHIT gene promoter region in the DNA from plasma of patients with myelodysplastic syndrome (MDS), and to investigate the demethylating effect of decitabine. Methylation-specific PCR method was used to detect the methylation status of FHIT gene promoter region in the DNA from plasma of 4 patients with MDS before and after treatment with decitabine plus semis CAG therapy (among them, 1 case of newly diagnosed MDS, 3 cases progressed into acute leukemia). The results indicated that 3 cases were found to have an increased methylation in the promoter region. After treatment with decitabine plus semis CAG, increased methylation was reversed in 2 cases. In 4 cases, 2 cases displayed clinical response. It is concluded that FHIT gene hypermethylation is associated with MDS pathogenesis. Decitabine has demethylating effect on the FHIT gene hypermethylation of plasma from MDS patients. Detecting the methylation status of FHIT gene in DNA from plasma may play a role in MDS auxiliary diagnosis or prognosis.

  6. Shifts in rDNA levels act as a genome buffer promoting chromosome homeostasis.


    Deregowska, Anna; Adamczyk, Jagoda; Kwiatkowska, Aleksandra; Gurgul, Artur; Skoneczny, Marek; Skoneczna, Adrianna; Szmatola, Tomasz; Jasielczuk, Igor; Magda, Michal; Rawska, Ewa; Pabian, Sylwia; Panek, Anita; Kaplan, Jakub; Lewinska, Anna; Wnuk, Maciej


    The nucleolus is considered to be a stress sensor and rDNA-based regulation of cellular senescence and longevity has been proposed. However, the role of rDNA in the maintenance of genome integrity has not been investigated in detail. Using genomically diverse industrial yeasts as a model and array-based comparative genomic hybridization (aCGH), we show that chromosome level may be balanced during passages and as a response to alcohol stress that may be associated with changes in rDNA pools. Generation- and ethanol-mediated changes in genes responsible for protein and DNA/RNA metabolism were revealed using next-generation sequencing. Links between redox homeostasis, DNA stability, and telomere and nucleolus states were also established. These results suggest that yeast genome is dynamic and chromosome homeostasis may be controlled by rDNA. PMID:26566866

  7. Identification of a heteromeric complex that promotes DNA replication origin firing in human cells.


    Boos, Dominik; Yekezare, Mona; Diffley, John F X


    Treslin/TICRR (TopBP1-interacting, replication stimulating protein/TopBP1-interacting, checkpoint, and replication regulator), the human ortholog of the yeast Sld3 protein, is an essential DNA replication factor that is regulated by cyclin-dependent kinases and the DNA damage checkpoint. We identified MDM two binding protein (MTBP) as a factor that interacts with Treslin/TICRR throughout the cell cycle. We show that MTBP depletion by means of small interfering RNA inhibits DNA replication by preventing assembly of the CMG (Cdc45-MCM-GINS) holohelicase during origin firing. Although MTBP has been implicated in the function of the p53 tumor suppressor, we found MTBP is required for DNA replication irrespective of a cell's p53 status. We propose that MTBP acts with Treslin/TICRR to integrate signals from cell cycle and DNA damage response pathways to control the initiation of DNA replication in human cells.

  8. Cdc6 ATPase activity disengages Cdc6 from the pre-replicative complex to promote DNA replication

    PubMed Central

    Chang, FuJung; Riera, Alberto; Evrin, Cecile; Sun, Jingchuan; Li, Huilin; Speck, Christian; Weinreich, Michael


    To initiate DNA replication, cells first load an MCM helicase double hexamer at origins in a reaction requiring ORC, Cdc6, and Cdt1, also called pre-replicative complex (pre-RC) assembly. The essential mechanistic role of Cdc6 ATP hydrolysis in this reaction is still incompletely understood. Here, we show that although Cdc6 ATP hydrolysis is essential to initiate DNA replication, it is not essential for MCM loading. Using purified proteins, an ATPase-defective Cdc6 mutant ‘Cdc6-E224Q’ promoted MCM loading on DNA. Cdc6-E224Q also promoted MCM binding at origins in vivo but cells remained blocked in G1-phase. If after loading MCM, Cdc6-E224Q was degraded, cells entered an apparently normal S-phase and replicated DNA, a phenotype seen with two additional Cdc6 ATPase-defective mutants. Cdc6 ATP hydrolysis is therefore required for Cdc6 disengagement from the pre-RC after helicase loading to advance subsequent steps in helicase activation in vivo. DOI: PMID:26305410

  9. Cdc6 ATPase activity disengages Cdc6 from the pre-replicative complex to promote DNA replication.


    Chang, FuJung; Riera, Alberto; Evrin, Cecile; Sun, Jingchuan; Li, Huilin; Speck, Christian; Weinreich, Michael


    To initiate DNA replication, cells first load an MCM helicase double hexamer at origins in a reaction requiring ORC, Cdc6, and Cdt1, also called pre-replicative complex (pre-RC) assembly. The essential mechanistic role of Cdc6 ATP hydrolysis in this reaction is still incompletely understood. Here, we show that although Cdc6 ATP hydrolysis is essential to initiate DNA replication, it is not essential for MCM loading. Using purified proteins, an ATPase-defective Cdc6 mutant 'Cdc6-E224Q' promoted MCM loading on DNA. Cdc6-E224Q also promoted MCM binding at origins in vivo but cells remained blocked in G1-phase. If after loading MCM, Cdc6-E224Q was degraded, cells entered an apparently normal S-phase and replicated DNA, a phenotype seen with two additional Cdc6 ATPase-defective mutants. Cdc6 ATP hydrolysis is therefore required for Cdc6 disengagement from the pre-RC after helicase loading to advance subsequent steps in helicase activation in vivo.

  10. The Fun30 ATP-dependent nucleosome remodeler promotes resection of DNA double-strand break ends

    PubMed Central

    Chen, Xuefeng; Cui, Dandan; Papusha, Alma; Zhang, Xiaotian; Chu, Chia-Dwo; Tang, Jiangwu; Chen, Kaifu; Pan, Xuewen; Ira, Grzegorz


    Chromosomal double-strand breaks (DSBs) are resected by 5′-nucleases to form 3′ single-strand DNA (ssDNA) substrates for binding by homologous recombination and DNA damage checkpoint proteins. Two redundant pathways of extensive resection were described both in cells 1-3 and in vitro 4-6, one relying on Exo1 exonuclease and the other on Sgs1 helicase and Dna2 nuclease. However, it remains unknown how resection proceeds within the context of chromatin where histones and histone-bound proteins represent barriers for resection enzymes. Here, we have identified the yeast nucleosome remodeling enzyme Fun30 as novel factor promoting DSB end resection. Fun30 is the major nucleosome remodeler promoting extensive Exo1- and Sgs1-dependent resection of DSBs while the RSC and INO80 chromatin remodeling complexes play redundant roles with Fun30 in resection adjacent to DSB ends. ATPase and helicase domains of Fun30, which are needed for nucleosome remodeling 7, are also required for resection. Fun30 is robustly recruited to DNA breaks and spreads around the DSB coincident with resection. Fun30 becomes less important for resection in the absence of the histone-bound Rad9 checkpoint adaptor protein known to block 5′ strand processing 8 and in the absence of either histone H3 K79 methylation or γ-H2A, which mediate recruitment of the Rad9 9, 10. Together these data suggest that Fun30 helps to overcome the inhibitory effect of Rad9 on DNA resection. PMID:22960743

  11. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    SciTech Connect

    Kiran, Shashi; Oddi, Vineesha; Ramakrishna, Gayatri


    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  12. De novo methylation, long-term promoter silencing, methylation patterns in the human genome, and consequences of foreign DNA insertion.


    Doerfler, W


    This chapter presents a personal account of the work on DNA methylation in viral and mammalian systems performed in the author's laboratory in the course of the past 30 years. The text does not attempt to give a complete and meticulous account of the work accomplished in many other laboratories; in that sense it is not a review of the field in a conventional sense. Since the author is also one of the editors of this series of Current Topics in Immunology and Microbiology on DNA methylation, to which contributions by many of our colleagues in this field have been invited, the author's conscience is alleviated that he has not cited many of the relevant and excellent reports by others. The choice of viral model systems in molecular biology is well founded. Over many decades, viruses have proved their invaluable and pioneering role as tools in molecular genetics. When our interest turned to the demonstration of genome-wide patterns of DNA methylation, we focused mainly on the human genome. The following topics in DNA methylation will be treated in detail: (1) The de novo methylation of integrated foreign genomes; (2) the long-term gene silencing effect of sequence-specific promoter methylation and its reversal; (3) the properties and specificity of patterns of DNA methylation in the human genome and their possible relations to pathogenesis; (4) the long-range global effects on cellular DNA methylation and transcriptional profiles as a consequence of foreign DNA insertion into an established genome; (5) the patterns of DNA methylation can be considered part of a cellular defense mechanism against foreign or repetitive DNA; which role has food-ingested DNA played in the elaboration of this mechanism? The interest in problems related to DNA methylation has spread-like the mechanism itself-into many neighboring fields. The nature of the transcriptional programs orchestrating embryonal and fetal development, chromatin structure, genetic imprinting, genetic disease, X

  13. Development and Functional Analysis of Novel Genetic Promoters Using DNA Shuffling, Hybridization and a Combination Thereof

    PubMed Central

    Ranjan, Rajiv; Patro, Sunita; Pradhan, Bhubaneswar; Kumar, Alok; Maiti, Indu B.; Dey, Nrisingha


    Background Development of novel synthetic promoters with enhanced regulatory activity is of great value for a diverse range of plant biotechnology applications. Methodology Using the Figwort mosaic virus full-length transcript promoter (F) and the sub-genomic transcript promoter (FS) sequences, we generated two single shuffled promoter libraries (LssF and LssFS), two multiple shuffled promoter libraries (LmsFS-F and LmsF-FS), two hybrid promoters (FuasFScp and FSuasFcp) and two hybrid-shuffled promoter libraries (LhsFuasFScp and LhsFSuasFcp). Transient expression activities of approximately 50 shuffled promoter clones from each of these libraries were assayed in tobacco (Nicotiana tabacum cv. Xanthi) protoplasts. It was observed that most of the shuffled promoters showed reduced activity compared to the two parent promoters (F and FS) and the CaMV35S promoter. In silico studies (computer simulated analyses) revealed that the reduced promoter activities of the shuffled promoters could be due to their higher helical stability. On the contrary, the hybrid promoters FuasFScp and FSuasFcp showed enhanced activities compared to F, FS and CaMV 35S in both transient and transgenic Nicotiana tabacum and Arabidopsis plants. Northern-blot and qRT-PCR data revealed a positive correlation between transcription and enzymatic activity in transgenic tobacco plants expressing hybrid promoters. Histochemical/X-gluc staining of whole transgenic seedlings/tissue-sections and fluorescence images of ImaGene Green™ treated roots and stems expressing the GUS reporter gene under the control of the FuasFScp and FSuasFcp promoters also support the above findings. Furthermore, protein extracts made from protoplasts expressing the human defensin (HNP-1) gene driven by hybrid promoters showed enhanced antibacterial activity compared to the CaMV35S promoter. Significance/Conclusion Both shuffled and hybrid promoters developed in the present study can be used as molecular tools to study the

  14. Listeria monocytogenes induces host DNA damage and delays the host cell cycle to promote infection

    PubMed Central

    Leitão, Elsa; Costa, Ana Catarina; Brito, Cláudia; Costa, Lionel; Pombinho, Rita; Cabanes, Didier; Sousa, Sandra


    Listeria monocytogenes (Lm) is a human intracellular pathogen widely used to uncover the mechanisms evolved by pathogens to establish infection. However, its capacity to perturb the host cell cycle was never reported. We show that Lm infection affects the host cell cycle progression, increasing its overall duration but allowing consecutive rounds of division. A complete Lm infectious cycle induces a S-phase delay accompanied by a slower rate of DNA synthesis and increased levels of host DNA strand breaks. Additionally, DNA damage/replication checkpoint responses are triggered in an Lm dose-dependent manner through the phosphorylation of DNA-PK, H2A.X, and CDC25A and independently from ATM/ATR. While host DNA damage induced exogenously favors Lm dissemination, the override of checkpoint pathways limits infection. We propose that host DNA replication disturbed by Lm infection culminates in DNA strand breaks, triggering DNA damage/replication responses, and ensuring a cell cycle delay that favors Lm propagation. PMID:24552813

  15. A Yeast GSK-3 Kinase Mck1 Promotes Cdc6 Degradation to Inhibit DNA Re-Replication

    PubMed Central

    Ikui, Amy E.; Rossio, Valentina; Schroeder, Lea; Yoshida, Satoshi


    Cdc6p is an essential component of the pre-replicative complex (pre-RC), which binds to DNA replication origins to promote initiation of DNA replication. Only once per cell cycle does DNA replication take place. After initiation, the pre-RC components are disassembled in order to prevent re-replication. It has been shown that the N-terminal region of Cdc6p is targeted for degradation after phosphorylation by Cyclin Dependent Kinase (CDK). Here we show that Mck1p, a yeast homologue of GSK-3 kinase, is also required for Cdc6 degradation through a distinct mechanism. Cdc6 is an unstable protein and is accumulated in the nucleus only during G1 and early S-phase in wild-type cells. In mck1 deletion cells, CDC6p is stabilized and accumulates in the nucleus even in late S phase and mitosis. Overexpression of Mck1p induces rapid Cdc6p degradation in a manner dependent on Threonine-368, a GSK-3 phosphorylation consensus site, and SCFCDC4. We show evidence that Mck1p-dependent degradation of Cdc6 is required for prevention of DNA re-replication. Loss of Mck1 activity results in synthetic lethality with other pre-RC mutants previously implicated in re-replication control, and these double mutant strains over-replicate DNA within a single cell cycle. These results suggest that a GSK3 family protein plays an unexpected role in preventing DNA over-replication through Cdc6 degradation in Saccharomyces cerevisiae. We propose that both CDK and Mck1 kinases are required for Cdc6 degradation to ensure a tight control of DNA replication. PMID:23236290

  16. Reduced serine racemase expression in aging rat cerebellum is associated with oxidative DNA stress and hypermethylation in the promoter.


    Zhang, He; Kuang, Xiu-Li; Chang, Yuhua; Lu, Jinfang; Jiang, Haiyan; Wu, Shengzhou


    Regulation of serine racemase (SR) occurs at transcriptional and translational levels; post-translational modification, cytosolic distribution as well as allosteric effect regulate SR activity. In this study, we report a new route of SR regulation, i.e. oxidative stress and hypermethylation of the srr (gene of SR) promoter correlate with its reduced transcription in aging rat cerebella. We first showed that the mRNA and protein level of srr were decreased in the homogenates of rat cerebellum at age 12 months compared with the counterparts from age 20 days. The reduction of SR protein level in aging cerebella was evidenced by decreased immunostaining observed in the cell body of granule cells or Purkinje cells. Staining for 8-hydroxy-2'-deoxyguanosine (8-OHdG), a marker for oxidative stress to DNA, was much stronger in granule cell or Purkinje cell nuclei from rat cerebella at 12 months compared with staining at 20 days. We further detected srr promoter hypermethylation at 12 months compared with that at 20 days by use of bisulfite sequencing PCR, coinciding with elevated protein levels of DNA methyltransferase 1 (DNMT1) in homogenates of aging cerebella. In vitro, we demonstrated that chronic treatment with the oxidant, menadione (VK3), reduced srr mRNA levels, which was reversed by the DNA demethylating agent 5-Aza-dC-2'-deoxycytidine (5-Aza-dC) in primary cerebellar granule cell cultures. Together, the in vivo and ex vivo results suggest that oxidative DNA stress and srr promoter hypermethylation are associated with reduced srr gene transcription and corresponding reduced protein expression in aging cerebella.

  17. Large sex differences in chicken behavior and brain gene expression coincide with few differences in promoter DNA-methylation.


    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per


    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

  18. Large Sex Differences in Chicken Behavior and Brain Gene Expression Coincide with Few Differences in Promoter DNA-Methylation

    PubMed Central

    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per


    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation. PMID:24782041

  19. Large sex differences in chicken behavior and brain gene expression coincide with few differences in promoter DNA-methylation.


    Nätt, Daniel; Agnvall, Beatrix; Jensen, Per


    While behavioral sex differences have repeatedly been reported across taxa, the underlying epigenetic mechanisms in the brain are mostly lacking. Birds have previously shown to have only limited dosage compensation, leading to high sex bias of Z-chromosome gene expression. In chickens, a male hyper-methylated region (MHM) on the Z-chromosome has been associated with a local type of dosage compensation, but a more detailed characterization of the avian methylome is limiting our interpretations. Here we report an analysis of genome wide sex differences in promoter DNA-methylation and gene expression in the brain of three weeks old chickens, and associated sex differences in behavior of Red Junglefowl (ancestor of domestic chickens). Combining DNA-methylation tiling arrays with gene expression microarrays we show that a specific locus of the MHM region, together with the promoter for the zinc finger RNA binding protein (ZFR) gene on chromosome 1, is strongly associated with sex dimorphism in gene expression. Except for this, we found few differences in promoter DNA-methylation, even though hundreds of genes were robustly differentially expressed across distantly related breeds. Several of the differentially expressed genes are known to affect behavior, and as suggested from their functional annotation, we found that female Red Junglefowl are more explorative and fearful in a range of tests performed throughout their lives. This paper identifies new sites and, with increased resolution, confirms known sites where DNA-methylation seems to affect sexually dimorphic gene expression, but the general lack of this association is noticeable and strengthens the view that birds do not have dosage compensation.

  20. Prenatal stress-induced programming of genome-wide promoter DNA methylation in 5-HTT-deficient mice

    PubMed Central

    Schraut, K G; Jakob, S B; Weidner, M T; Schmitt, A G; Scholz, C J; Strekalova, T; El Hajj, N; Eijssen, L M T; Domschke, K; Reif, A; Haaf, T; Ortega, G; Steinbusch, H W M; Lesch, K P; Van den Hove, D L


    The serotonin transporter gene (5-HTT/SLC6A4)-linked polymorphic region has been suggested to have a modulatory role in mediating effects of early-life stress exposure on psychopathology rendering carriers of the low-expression short (s)-variant more vulnerable to environmental adversity in later life. The underlying molecular mechanisms of this gene-by-environment interaction are not well understood, but epigenetic regulation including differential DNA methylation has been postulated to have a critical role. Recently, we used a maternal restraint stress paradigm of prenatal stress (PS) in 5-HTT-deficient mice and showed that the effects on behavior and gene expression were particularly marked in the hippocampus of female 5-Htt+/− offspring. Here, we examined to which extent these effects are mediated by differential methylation of DNA. For this purpose, we performed a genome-wide hippocampal DNA methylation screening using methylated-DNA immunoprecipitation (MeDIP) on Affymetrix GeneChip Mouse Promoter 1.0 R arrays. Using hippocampal DNA from the same mice as assessed before enabled us to correlate gene-specific DNA methylation, mRNA expression and behavior. We found that 5-Htt genotype, PS and their interaction differentially affected the DNA methylation signature of numerous genes, a subset of which showed overlap with the expression profiles of the corresponding transcripts. For example, a differentially methylated region in the gene encoding myelin basic protein (Mbp) was associated with its expression in a 5-Htt-, PS- and 5-Htt × PS-dependent manner. Subsequent fine-mapping of this Mbp locus linked the methylation status of two specific CpG sites to Mbp expression and anxiety-related behavior. In conclusion, hippocampal DNA methylation patterns and expression profiles of female prenatally stressed 5-Htt+/− mice suggest that distinct molecular mechanisms, some of which are promoter methylation-dependent, contribute to the behavioral effects of the 5-Htt

  1. Evaluation of INK4A promoter methylation using pyrosequencing and circulating cell-free DNA from patients with hepatocellular carcinoma

    PubMed Central

    Kirk, Jason L.; Merwat, Shehzad N.; Ju, Hyunsu; Soloway, Roger D.; Wieck, Lucas R.; Li, Albert; Okorodudu, Anthony O.; Petersen, John R.; Abdulla, Nihal E.; Duchini, Andrea; Cicalese, Luca; Rastellini, Cristiana; Hu, Peter C.; Dong, Jianli


    Background Hyper-methylation of CpG dinucleotides in the promoter region of inhibitor of cyclin-dependent kinase 4A (INK4A) has been reported in 60%–80% of hepatocellular carcinoma (HCC). As INK4A promoter hypermethylation event occurs early in HCC progression, the quantification of INK4A promoter methylation in blood sample may represent a useful biomarker for non-invasive diagnosis and prediction of response to therapy. Methods We examined INK4A promoter methylation using circulating cell-free DNA (ccfDNA) in a total of 109 serum specimens, including 66 HCC and 43 benign chronic liver diseases. Methylation of the individual seven CpG sites was examined using pyrosequencing. Results Our results showed that there were significantly higher levels of methylated INK4A in HCC specimens than controls and that the seven CpG sites had different levels of methylation and might exist in different PCR amplicons. The area under receiver operating characteristic (ROC) curve was 0.82, with 65.3% sensitivity and 87.2% specificity at 5% (LOD), 39.0% sensitivity and 96.5% specificity at 7% LOD, and 20.3% sensitivity and 98.8% specificity at 10% LOD, respectively. Conclusions Our results support additional studies incorporating INK4A methylation testing of ccfDNA to further validate the diagnostic, predictive, and prognostic characteristics of this biomarker in HCC patients. The knowledge of the existence of epi-alleles should help improve assay design to maximize detection. PMID:24406287

  2. Quantitative detection of promoter hypermethylation of multiple genes in the tumor, urine, and serum DNA of patients with renal cancer.


    Hoque, Mohammad Obaidul; Begum, Shahnaz; Topaloglu, Ozlem; Jeronimo, Carmen; Mambo, Elizabeth; Westra, William H; Califano, J A; Sidransky, David


    Aberrant promoter hypermethylation of several known or putative tumor suppressor genes occurs frequently during the pathogenesis of human cancers and is a promising marker for cancer detection. We investigated the feasibility of detecting aberrant DNA methylation in the urine and serum samples of renal cancer patients. We examined the tumor and the matched urine and serum DNA for aberrant methylation of nine gene promoters (CDH1, APC, MGMT, RASSF1A, GSTP1, p16, RAR-beta2, and ARF) from 17 patients with primary kidney cancer by quantitative fluorogenic real-time PCR. An additional 9 urine samples (total, 26) and 1 serum sample (total, 18) also were tested from renal cancer patients. Urine from 91 patients without genitourinary cancer and serum from 30 age-matched noncancer individuals were used as controls. Promoter hypermethylation of at least two of the genes studied was detected in 16 (94%) of 17 primary tumors. Aberrant methylation in urine and serum DNA generally was accompanied by methylation in the matched tumor samples. Urine samples from 91 control subjects without evidence of genitourinary cancer revealed no methylation of the MGMT, GSTP1, p16, and ARF genes, whereas methylation of RAR-beta2, RASSF1A, CDH1, APC, and TIMP3 was detected at low levels in a few control subjects. Overall, 23 (88%) of 26 urine samples and 12 (67%) of 18 serum samples from cancer patients were methylation positive for at least one of the genes tested. By combination of urine or serum analysis of renal cancer patients, hypermethylation was detected in 16 of 17 patients (94% sensitivity) with high specificity. Our findings suggest that promoter hypermethylation in urine or serum can be detected in the majority of renal cancer patients. This noninvasive high-throughput approach needs to be evaluated in large studies to assess its value in the early detection and surveillance of renal cancer.

  3. Structure elucidation of the Pribnow box consensus promoter sequence by racemic DNA crystallography

    PubMed Central

    Mandal, Pradeep K.; Collie, Gavin W.; Srivastava, Suresh C.; Kauffmann, Brice; Huc, Ivan


    It has previously been shown that the use of racemic mixtures of naturally chiral macromolecules such as protein and DNA can significantly aid the crystallogenesis process, thereby addressing one of the major bottlenecks to structure determination by X-ray crystallographic methods—that of crystal growth. Although previous studies have provided convincing evidence of the applicability of the racemic crystallization technique to DNA through the study of well-characterized DNA structures, we sought to apply this method to a historically challenging DNA sequence. For this purpose we chose a non-self-complementary DNA duplex containing the biologically-relevant Pribnow box consensus sequence ‘TATAAT’. Four racemic crystal structures of this previously un-crystallizable DNA target are reported (with resolutions in the range of 1.65–2.3 Å), with further crystallographic studies and structural analysis providing insight into the racemic crystallization process as well as structural details of this highly pertinent DNA sequence. PMID:27137886

  4. Bisphenol A Promotes Cell Survival Following Oxidative DNA Damage in Mouse Fibroblasts

    PubMed Central

    Gassman, Natalie R.; Coskun, Erdem; Stefanick, Donna F.; Horton, Julie K.; Jaruga, Pawel; Dizdaroglu, Miral; Wilson, Samuel H.


    Bisphenol A (BPA) is a biologically active industrial chemical used in production of consumer products. BPA has become a target of intense public scrutiny following concerns about its association with human diseases such as obesity, diabetes, reproductive disorders, and cancer. Recent studies link BPA with the generation of reactive oxygen species, and base excision repair (BER) is responsible for removing oxidatively induced DNA lesions. Yet, the relationship between BPA and BER has yet to be examined. Further, the ubiquitous nature of BPA allows continuous exposure of the human genome concurrent with the normal endogenous and exogenous insults to the genome, and this co-exposure may impact the DNA damage response and repair. To determine the effect of BPA exposure on base excision repair of oxidatively induced DNA damage, cells compromised in double-strand break repair were treated with BPA alone or co-exposed with either potassium bromate (KBrO3) or laser irradiation as oxidative damaging agents. In experiments with KBrO3, co-treatment with BPA partially reversed the KBrO3-induced cytotoxicity observed in these cells, and this was coincident with an increase in guanine base lesions in genomic DNA. The improvement in cell survival and the increase in oxidatively induced DNA base lesions were reminiscent of previous results with alkyl adenine DNA glycosylase-deficient cells, suggesting that BPA may prevent initiation of repair of oxidized base lesions. With laser irradiation-induced DNA damage, treatment with BPA suppressed DNA repair as revealed by several indicators. These results are consistent with the hypothesis that BPA can induce a suppression of oxidized base lesion DNA repair by the base excision repair pathway. PMID:25693136

  5. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.


    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A


    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER.

  6. Rad52 promotes second-end DNA capture in double-stranded break repair to form complement-stabilized joint molecules.


    Nimonkar, Amitabh V; Sica, R Alejandro; Kowalczykowski, Stephen C


    Saccharomyces cerevisiae Rad52 performs multiple functions during the recombinational repair of double-stranded DNA (dsDNA) breaks (DSBs). It mediates assembly of Rad51 onto single-stranded DNA (ssDNA) that is complexed with replication protein A (RPA); the resulting nucleoprotein filament pairs with homologous dsDNA to form joint molecules. Rad52 also catalyzes the annealing of complementary strands of ssDNA, even when they are complexed with RPA. Both Rad51 and Rad52 can be envisioned to promote "second-end capture," a step that pairs the ssDNA generated by processing of the second end of a DSB to the joint molecule formed by invasion of the target dsDNA by the first processed end. Here, we show that Rad52 promotes annealing of complementary ssDNA that is complexed with RPA to the displaced strand of a joint molecule, to form a complement-stabilized joint molecule. RecO, a prokaryotic homolog of Rad52, cannot form complement-stabilized joint molecules with RPA-ssDNA complexes, nor can Rad52 promote second-end capture when the ssDNA is bound with either human RPA or the prokaryotic ssDNA-binding protein, SSB, indicating a species-specific process. We conclude that Rad52 participates in second-end capture by annealing a resected DNA break, complexed with RPA, to the joint molecule product of single-end invasion event. These studies support a role for Rad52-promoted annealing in the formation of Holliday junctions in DSB repair. PMID:19204284

  7. An Origin of DNA Replication in the Promoter Region of the Human Fragile X Mental Retardation (FMR1) Gene▿ †

    PubMed Central

    Gray, Steven J.; Gerhardt, Jeannine; Doerfler, Walter; Small, Lawrence E.; Fanning, Ellen


    Fragile X syndrome, the most common form of inherited mental retardation in males, arises when the normally stable 5 to 50 CGG repeats in the 5′ untranslated region of the fragile X mental retardation protein 1 (FMR1) gene expand to over 200, leading to DNA methylation and silencing of the FMR1 promoter. Although the events that trigger local CGG expansion remain unknown, the stability of trinucleotide repeat tracts is affected by their position relative to an origin of DNA replication in model systems. Origins of DNA replication in the FMR1 locus have not yet been described. Here, we report an origin of replication adjacent to the FMR1 promoter and CGG repeats that was identified by scanning a 35-kb region. Prereplication proteins Orc3p and Mcm4p bind to chromatin in the FMR1 initiation region in vivo. The position of the FMR1 origin relative to the CGG repeats is consistent with a role in repeat maintenance. The FMR1 origin is active in transformed cell lines, fibroblasts from healthy individuals, fibroblasts from patients with fragile X syndrome, and fetal cells as early as 8 weeks old. The potential role of the FMR1 origin in CGG tract instability is discussed. PMID:17101793

  8. AZD1775 sensitizes T cell acute lymphoblastic leukemia cells to cytarabine by promoting apoptosis over DNA repair.


    Ford, James B; Baturin, Dmitry; Burleson, Tamara M; Van Linden, Annemie A; Kim, Yong-Mi; Porter, Christopher C


    While some children with acute lymphoblastic leukemia (ALL) have excellent prognoses, the prognosis for adults and children with T cell ALL is more guarded. Treatment for T-ALL is heavily dependent upon antimetabolite chemotherapeutics, including cytarabine. Targeted inhibition of WEE1 with AZD1775 has emerged as a strategy to sensitize cancer cells to cytarabine and other chemotherapeutics. We sought to determine if this strategy would be effective for T-ALL with clinically relevant anti-leukemia agents. We found that AZD1775 sensitizes T-ALL cells to several traditional anti-leukemia agents, acting synergistically with cytarabine by enhancing DNA damage and apoptosis. In addition to increased phosphorylation of H2AX at serine 139 (γH2AX), AZD1775 led to increased phosphorylation of H2AX at tyrosine 142, a signaling event associated with promotion of apoptosis over DNA repair. In a xenograft model of T-ALL, the addition of AZD1775 to cytarabine slowed leukemia progression and prolonged survival. Inhibition of WEE1 with AZD1775 sensitizes T-ALL to several anti-leukemia agents, particularly cytarabine and that mechanistically, AZD1775 promotes apoptosis over DNA repair in cells treated with cytarabine. These data support the development of clinical trials including AZD1775 in combination with conventional chemotherapy for acute leukemia. PMID:26334102

  9. Homocysteine Triggers Inflammatory Responses in Macrophages through Inhibiting CSE-H2S Signaling via DNA Hypermethylation of CSE Promoter

    PubMed Central

    Li, Jiao-Jiao; Li, Qian; Du, Hua-Ping; Wang, Ya-Li; You, Shou-Jiang; Wang, Fen; Xu, Xing-Shun; Cheng, Jian; Cao, Yong-Jun; Liu, Chun-Feng; Hu, Li-Fang


    Hyperhomocysteinemia (HHcy) is an independent risk factor of atherosclerosis and other cardiovascular diseases. Unfortunately, Hcy-lowering strategies were found to have limited effects in reducing cardiovascular events. The underlying mechanisms remain unclear. Increasing evidence reveals a role of inflammation in the pathogenesis of HHcy. Homocysteine (Hcy) is a precursor of hydrogen sulfide (H2S), which is formed via the transsulfuration pathway catalyzed by cystathionine β-synthase and cystathionine γ-lyase (CSE) and serves as a novel modulator of inflammation. In the present study, we showed that methionine supplementation induced mild HHcy in mice, associated with the elevations of TNF-α and IL-1β in the plasma and reductions of plasma H2S level and CSE expression in the peritoneal macrophages. H2S-releasing compound GYY4137 attenuated the increases of TNF-α and IL-1β in the plasma of HHcy mice and Hcy-treated raw264.7 cells while CSE inhibitor PAG exacerbated it. Moreover, the in vitro study showed that Hcy inhibited CSE expression and H2S production in macrophages, accompanied by the increases of DNA methyltransferase (DNMT) expression and DNA hypermethylation in cse promoter region. DNMT inhibition or knockdown reversed the decrease of CSE transcription induced by Hcy in macrophages. In sum, our findings demonstrate that Hcy may trigger inflammation through inhibiting CSE-H2S signaling, associated with increased promoter DNA methylation and transcriptional repression of cse in macrophages. PMID:26047341

  10. TIPRL Inhibits Protein Phosphatase 4 Activity and Promotes H2AX Phosphorylation in the DNA Damage Response

    PubMed Central

    Rosales, Kimberly Romero; Reid, Michael A.; Yang, Ying; Tran, Thai Q.; Wang, Wen-I; Lowman, Xazmin; Pan, Min; Kong, Mei


    Despite advances in our understanding of protein kinase regulation in the DNA damage response, the mechanism that controls protein phosphatase activity in this pathway is unclear. Unlike kinases, the activity and specificity of serine/threonine phosphatases is governed largely by their associated proteins. Here we show that Tip41-like protein (TIPRL), an evolutionarily conserved binding protein for PP2A-family phosphatases, is a negative regulator of protein phosphatase 4 (PP4). Knockdown of TIPRL resulted in increased PP4 phosphatase activity and formation of the active PP4-C/PP4R2 complex known to dephosphorylate γ-H2AX. Thus, overexpression of TIPRL promotes phosphorylation of H2AX, and increases γ-H2AX positive foci in response to DNA damage, whereas knockdown of TIPRL inhibits γ-H2AX phosphorylation. In correlation with γ-H2AX levels, we found that TIPRL overexpression promotes cell death in response to genotoxic stress, and knockdown of TIPRL protects cells from genotoxic agents. Taken together, these data demonstrate that TIPRL inhibits PP4 activity to allow for H2AX phosphorylation and the subsequent DNA damage response. PMID:26717153

  11. A Transcriptional Repressor ZBTB1 Promotes Chromatin Remodeling and Translesion DNA Synthesis

    PubMed Central

    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A.; D’Andrea, Alan D.


    SUMMARY Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for PCNA monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for PCNA monoubiquitination, by localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a new ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair. PMID:24657165

  12. Transcriptional repressor ZBTB1 promotes chromatin remodeling and translesion DNA synthesis.


    Kim, Hyungjin; Dejsuphong, Donniphat; Adelmant, Guillaume; Ceccaldi, Raphael; Yang, Kailin; Marto, Jarrod A; D'Andrea, Alan D


    Timely DNA replication across damaged DNA is critical for maintaining genomic integrity. Translesion DNA synthesis (TLS) allows bypass of DNA lesions using error-prone TLS polymerases. The E3 ligase RAD18 is necessary for proliferating cell nuclear antigen (PCNA) monoubiquitination and TLS polymerase recruitment; however, the regulatory steps upstream of RAD18 activation are less understood. Here, we show that the UBZ4 domain-containing transcriptional repressor ZBTB1 is a critical upstream regulator of TLS. The UBZ4 motif is required for PCNA monoubiquitination and survival after UV damage. ZBTB1 associates with KAP-1, a transcriptional repressor whose phosphorylation relaxes chromatin after DNA damage. ZBTB1 depletion impairs formation of phospho-KAP-1 at UV damage sites and reduces RAD18 recruitment. Furthermore, phosphorylation of KAP-1 is necessary for efficient PCNA modification. We propose that ZBTB1 is required for localizing phospho-KAP-1 to chromatin and enhancing RAD18 accessibility. Collectively, our study implicates a ubiquitin-binding protein in orchestrating chromatin remodeling during DNA repair.

  13. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.


    Carrolo, Margarida; Frias, Maria João; Pinto, Francisco Rodrigues; Melo-Cristino, José; Ramirez, Mário


    Streptococcus pneumoniae (pneumococcus) is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages) residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA) is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population. PMID:21187931

  14. COX-2 gene promoter DNA methylation status in eutopic and ectopic endometrium of Egyptian women with endometriosis.


    Zidan, Haidy E; Rezk, Noha A; Alnemr, Amr Abd Almohsen; Abd El Ghany, Amany M


    The pathophysiology of COX-2 expression in endometriosis is a matter of debate. The aim was to investigate the role of DNA methylation of the NF-IL6 site within the promoter of COX-2 gene in the pathogenesis of endometriosis. The endometrial tissues (ectopic and eutopic) were collected from 60 women with endometriosis and 30 women without endometriosis (control group). The methylation status of COX-2 was examined by methylation-specific PCR. Quantitative real-time PCR (RT-PCR) was performed to measure COX-2 mRNA levels in endometrial tissues. We found significantly higher levels of COX-2 in ectopic endometriotic tissue compared with eutopic tissue. Also, we found that the frequencies of methylation status of the NF-IL6 site within the COX-2 promoter in the eutopic and ectopic endometrial tissues of endometriosis groups were significantly decreased in comparison to controls (P=0.002, P=0.000 respectively). Our study demonstrated that DNA hypomethylation of the NF-IL6 site within the promoter of COX-2 gene could be a key mechanism for its elevated expression in the eutopic and ectopic tissues of endometriosis.

  15. Characterization of NOBOX DNA binding specificity and its regulation of Gdf9 and Pou5f1 promoters.


    Choi, Youngsok; Rajkovic, Aleksandar


    Nobox (newborn ovary homeobox gene) deficiency disrupts early folliculogenesis and the expression of oocyte-specific genes in mice. Here, we identified several cis-acting sites, TAATTG, TAGTTG, and TAATTA as NOBOX DNA binding elements (NBEs) using a library of randomly generated oligonucleotides by cyclic amplification of sequence target assay and mutation analyses. We show that NOBOX preferentially binds to the NOBOX binding elements with high affinity. In addition, we found that promoter regions of mouse Pou5f1 and Gdf9 contain one (-426) and three NOBOX binding elements (-786, -967, and -1259), respectively. NOBOX binds to these putative NOBOX binding elements with high affinity and augmented transcriptional activity of luciferase reporter driven by mouse Pou5f1 and Gdf9 promoters containing the NOBOX binding elements. In chromatin immunoprecipitation assays, DNA sequences from Pou5f1 and Gdf9 promoters co-precipitated with anti-NOBOX antibody. These results suggest that NOBOX directly regulates the transcription of Pou5f1 and Gdf9 in oocytes during early folliculogenesis.

  16. Role of Bacillus subtilis Error Prevention Oxidized Guanine System in Counteracting Hexavalent Chromium-Promoted Oxidative DNA Damage

    PubMed Central

    Santos-Escobar, Fernando; Gutiérrez-Corona, J. Félix


    Chromium pollution is potentially detrimental to bacterial soil communities, compromising carbon and nitrogen cycles that are essential for life on earth. It has been proposed that intracellular reduction of hexavalent chromium [Cr(VI)] to trivalent chromium [Cr(III)] may cause bacterial death by a mechanism that involves reactive oxygen species (ROS)-induced DNA damage; the molecular basis of the phenomenon was investigated in this work. Here, we report that Bacillus subtilis cells lacking a functional error prevention oxidized guanine (GO) system were significantly more sensitive to Cr(VI) treatment than cells of the wild-type (WT) strain, suggesting that oxidative damage to DNA is involved in the deleterious effects of the oxyanion. In agreement with this suggestion, Cr(VI) dramatically increased the ROS concentration and induced mutagenesis in a GO-deficient B. subtilis strain. Alkaline gel electrophoresis (AGE) analysis of chromosomal DNA of WT and ΔGO mutant strains subjected to Cr(VI) treatment revealed that the DNA of the ΔGO strain was more susceptible to DNA glycosylase Fpg attack, suggesting that chromium genotoxicity is associated with 7,8-dihydro-8-oxodeoxyguanosine (8-oxo-G) lesions. In support of this notion, specific monoclonal antibodies detected the accumulation of 8-oxo-G lesions in the chromosomes of B. subtilis cells subjected to Cr(VI) treatment. We conclude that Cr(VI) promotes mutagenesis and cell death in B. subtilis by a mechanism that involves radical oxygen attack of DNA, generating 8-oxo-G, and that such effects are counteracted by the prevention and repair GO system. PMID:24973075

  17. DNA hypermethylation of promoter of gene p53 and p16 in arsenic-exposed people with and without malignancy.


    Chanda, Sarmishtha; Dasgupta, Uma B; Guhamazumder, Debendranath; Gupta, Mausumi; Chaudhuri, Utpal; Lahiri, Sarbari; Das, Subhankar; Ghosh, Nilima; Chatterjee, Debdutta


    Chronic arsenic exposure is known to produce arsenicosis and cancer. To ascertain whether perturbation of methylation plays a role in such carcinogenesis, the degree of methylation of p53 and p16 gene in DNA obtained from blood samples of people chronically exposed to arsenic and skin cancer subjects was studied. Methylation-specific restriction endonuclease digestion followed by polymerase chain reaction (PCR) of gene p53 and bisulfite treatment followed by methylation-sensitive PCR of gene p16 have been carried out to analyze the methylation status of the samples studied. Significant DNA hypermethylation of promoter region of p53 gene was observed in DNA of arsenic-exposed people compared to control subjects. This hypermethylation showed a dose-response relationship. Further, hypermethylation of p53 gene was also observed in arsenic-induced skin cancer patients compared to subjects having skin cancer unrelated to arsenic, though not at significant level. However, a small subgroup of cases showed hypomethylation with high arsenic exposure. Significant hypermethylation of gene p16 was also observed in cases of arsenicosis exposed to high level of arsenic. In man, arsenic has the ability to alter DNA methylation patterns in gene p53 and p16, which are important in carcinogenesis.

  18. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver.


    Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status.

  19. Osmotic pressure: resisting or promoting DNA ejection from phage? Internal capsid-pressure dependence of viral infection

    NASA Astrophysics Data System (ADS)

    Evilevitch, Alex; Jeembaeva, Meerim; Koester, Sarah; Castelnovo, Martin; Weitz, David


    Recent in vitro experiments have shown that DNA ejection from phage can be partially stopped by surrounding osmotic pressure when ejected DNA is digested by DNase I on the course of ejection. We argue in this work by combination of experimental techniques (UV absorbance, pulse-field electrophoresis, and cryo-EM) that intact genome (i.e. undigested) ejection in a crowded environment is, on the contrary, enhanced or eventually complete with the help of a pulling force resulting from DNA condensation induced by the osmotic stress itself. This demonstrates that in vivo, the osmotically stressed cell cytoplasm will promote phage DNA ejection rather than resisting it. While, in vitro, the ejection depends sensitively on internal pressure within the virus capsid, the effect of internal pressure on infection of bacteria is unknown. We use microfluidics to monitor individual cells and determine the distribution of lysis due to infection as the capsid pressure is varied. The lysis probability decreases markedly with decreased capsid pressure.

  20. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver.


    Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. PMID:26519879

  1. Frataxin Deficiency Promotes Excess Microglial DNA Damage and Inflammation that Is Rescued by PJ34

    PubMed Central

    Shen, Yan; McMackin, Marissa Z.; Shan, Yuxi; Raetz, Alan; David, Sheila; Cortopassi, Gino


    An inherited deficiency in the frataxin protein causes neurodegeneration of the dorsal root ganglia and Friedreich's ataxia (FA). Frataxin deficiency leads to oxidative stress and inflammatory changes in cell and animal models; however, the cause of the inflammatory changes, and especially what causes brain microglial activation is unclear. Here we investigated: 1) the mechanism by which frataxin deficiency activates microglia, 2) whether a brain-localized inflammatory stimulus provokes a greater microglial response in FA animal models, and 3) whether an anti-inflammatory treatment improves their condition. Intracerebroventricular administration of LPS induced higher amounts of microglial activation in the FA mouse model vs controls. We also observed an increase in oxidative damage in the form of 8-oxoguanine (8-oxo-G) and the DNA repair proteins MUTYH and PARP-1 in cerebellar microglia of FA mutant mice. We hypothesized that frataxin deficiency increases DNA damage and DNA repair genes specifically in microglia, activating them. siRNA-mediated frataxin knockdown in microglial BV2 cells clearly elevated DNA damage and the expression of DNA repair genes MUTYH and PARP-1. Frataxin knockdown also induced a higher level of PARP-1 in MEF cells, and this was suppressed in MUTYH-/- knockout cells. Administration of the PARP-1 inhibitor PJ34 attenuated the microglial activation induced by intracerebroventricular injection of LPS. The combined administration of LPS and angiotensin II provoke an even stronger activation of microglia and neurobehavioral impairment. PJ34 treatment attenuated the neurobehavioral impairments in FA mice. These results suggest that the DNA repair proteins MUTYH and PARP-1 may form a pathway regulating microglial activation initiated by DNA damage, and inhibition of microglial PARP-1 induction could be an important therapeutic target in Friedreich's ataxia. PMID:26954031

  2. DNA methylation signatures of the AIRE promoter in thymic epithelial cells, thymomas and normal tissues.


    Kont, Vivian; Murumägi, Astrid; Tykocinski, Lars-Oliver; Kinkel, Sarah A; Webster, Kylie E; Kisand, Kai; Tserel, Liina; Pihlap, Maire; Ströbel, Philipp; Scott, Hamish S; Marx, Alexander; Kyewski, Bruno; Peterson, Pärt


    Mutations in the AIRE gene cause autoimmune polyendocrinopathy candidiasis ectodermal dystrophy (APECED), which is associated with autoimmunity towards several peripheral organs. The AIRE protein is almost exclusively expressed in medullary thymic epithelial cells (mTEC) and CpG methylation in the promoter of the AIRE gene has been suggested to control its tissue-specific expression pattern. We found that in human AIRE-positive medullary and AIRE-negative cortical epithelium, the AIRE promoter is hypomethylated, whereas in thymocytes, the promoter had high level of CpG methylation. Likewise, in mouse mTECs the AIRE promoter was uniformly hypomethylated. In the same vein, the AIRE promoter was hypomethylated in AIRE-negative thymic epithelial tumors (thymomas) and in several peripheral tissues. Our data are compatible with the notion that promoter hypomethylation is necessary but not sufficient for tissue-specific regulation of the AIRE gene. In contrast, a positive correlation between AIRE expression and histone H3 lysine 4 trimethylation, an active chromatin mark, was found in the AIRE promoter in human and mouse TECs.

  3. The Vaccine Adjuvant Chitosan Promotes Cellular Immunity via DNA Sensor cGAS-STING-Dependent Induction of Type I Interferons.


    Carroll, Elizabeth C; Jin, Lei; Mori, Andres; Muñoz-Wolf, Natalia; Oleszycka, Ewa; Moran, Hannah B T; Mansouri, Samira; McEntee, Craig P; Lambe, Eimear; Agger, Else Marie; Andersen, Peter; Cunningham, Colm; Hertzog, Paul; Fitzgerald, Katherine A; Bowie, Andrew G; Lavelle, Ed C


    The cationic polysaccharide chitosan is an attractive candidate adjuvant capable of driving potent cell-mediated immunity, but the mechanism by which it acts is not clear. We show that chitosan promotes dendritic cell maturation by inducing type I interferons (IFNs) and enhances antigen-specific T helper 1 (Th1) responses in a type I IFN receptor-dependent manner. The induction of type I IFNs, IFN-stimulated genes and dendritic cell maturation by chitosan required the cytoplasmic DNA sensor cGAS and STING, implicating this pathway in dendritic cell activation. Additionally, this process was dependent on mitochondrial reactive oxygen species and the presence of cytoplasmic DNA. Chitosan-mediated enhancement of antigen specific Th1 and immunoglobulin G2c responses following vaccination was dependent on both cGAS and STING. These findings demonstrate that a cationic polymer can engage the STING-cGAS pathway to trigger innate and adaptive immune responses.

  4. The Vaccine Adjuvant Chitosan Promotes Cellular Immunity via DNA Sensor cGAS-STING-Dependent Induction of Type I Interferons.


    Carroll, Elizabeth C; Jin, Lei; Mori, Andres; Muñoz-Wolf, Natalia; Oleszycka, Ewa; Moran, Hannah B T; Mansouri, Samira; McEntee, Craig P; Lambe, Eimear; Agger, Else Marie; Andersen, Peter; Cunningham, Colm; Hertzog, Paul; Fitzgerald, Katherine A; Bowie, Andrew G; Lavelle, Ed C


    The cationic polysaccharide chitosan is an attractive candidate adjuvant capable of driving potent cell-mediated immunity, but the mechanism by which it acts is not clear. We show that chitosan promotes dendritic cell maturation by inducing type I interferons (IFNs) and enhances antigen-specific T helper 1 (Th1) responses in a type I IFN receptor-dependent manner. The induction of type I IFNs, IFN-stimulated genes and dendritic cell maturation by chitosan required the cytoplasmic DNA sensor cGAS and STING, implicating this pathway in dendritic cell activation. Additionally, this process was dependent on mitochondrial reactive oxygen species and the presence of cytoplasmic DNA. Chitosan-mediated enhancement of antigen specific Th1 and immunoglobulin G2c responses following vaccination was dependent on both cGAS and STING. These findings demonstrate that a cationic polymer can engage the STING-cGAS pathway to trigger innate and adaptive immune responses. PMID:26944200

  5. Histone chaperone Anp32e removes H2A.Z from DNA double-strand breaks and promotes nucleosome reorganization and DNA repair.


    Gursoy-Yuzugullu, Ozge; Ayrapetov, Marina K; Price, Brendan D


    The repair of DNA double-strand breaks (DSBs) requires open, flexible chromatin domains. The NuA4-Tip60 complex creates these flexible chromatin structures by exchanging histone H2A.Z onto nucleosomes and promoting acetylation of histone H4. Here, we demonstrate that the accumulation of H2A.Z on nucleosomes at DSBs is transient, and that rapid eviction of H2A.Z is required for DSB repair. Anp32e, an H2A.Z chaperone that interacts with the C-terminal docking domain of H2A.Z, is rapidly recruited to DSBs. Anp32e functions to remove H2A.Z from nucleosomes, so that H2A.Z levels return to basal within 10 min of DNA damage. Further, H2A.Z removal by Anp32e disrupts inhibitory interactions between the histone H4 tail and the nucleosome surface, facilitating increased acetylation of histone H4 following DNA damage. When H2A.Z removal by Anp32e is blocked, nucleosomes at DSBs retain elevated levels of H2A.Z, and assume a more stable, hypoacetylated conformation. Further, loss of Anp32e leads to increased CtIP-dependent end resection, accumulation of single-stranded DNA, and an increase in repair by the alternative nonhomologous end joining pathway. Exchange of H2A.Z onto the chromatin and subsequent rapid removal by Anp32e are therefore critical for creating open, acetylated nucleosome structures and for controlling end resection by CtIP. Dynamic modulation of H2A.Z exchange and removal by Anp32e reveals the importance of the nucleosome surface and nucleosome dynamics in processing the damaged chromatin template during DSB repair.

  6. Stably integrated mouse mammary tumor virus long terminal repeat DNA requires the octamer motifs for basal promoter activity.

    PubMed Central

    Buetti, E


    In the mouse mammary tumor virus promoter, a tandem of octamer motifs, recognized by ubiquitous and tissue-restricted Oct transcription factors, is located upstream of the TATA box and next to a binding site for the transcription factor nuclear factor I (NF-I). Their function was investigated with mutant long terminal repeats under different transfection conditions in mouse Ltk- cells and quantitative S1 nuclease mapping of the transcripts. In stable transfectants, which are most representative of the state of proviral DNA with respect to both number of integrated DNA templates and chromatin organization, a long terminal repeat mutant of both octamer sites showed an average 50-fold reduction of the basal transcription level, while the dexamethasone-stimulated level was unaffected. DNase I in vitro footprinting assays with L-cell nuclear protein extracts showed that the mutant DNA was unable to bind octamer factors but had a normal footprint in the NF-I site. I conclude that mouse mammary tumor virus employs the tandem octamer motifs of the viral promoter, recognized by the ubiquitous transcription factor Oct-1, for its basal transcriptional activity and the NF-I binding site, as previously shown, for glucocorticoid-stimulated transcription. A deletion mutant with only one octamer site showed a marked base-level reduction at high copy number but little reduction at low copies of integrated plasmids. The observed transcription levels may depend both on the relative ratio of transcription factors to DNA templates and on the relative affinity of binding sites, as determined by oligonucleotide competition footprinting. Images PMID:8289800

  7. Identification of animals produced by somatic cell nuclear transfer using DNA methylation in the retrotransposon-like 1 promoter.


    Couldrey, Christine; Maclean, Paul; Wells, David N


    Public perception of somatic cell nuclear transfer (SCNT) in the production of agricultural animals is surrounded by fear, which is exacerbated by the inability to differentiate animals generated by SCNT from those generated by natural mating or artificial insemination (AI). Unfortunately, the DNA sequence of animals produced by SCNT is indistinguishable from those generated by fertilization. With the current banning of all SCNT animal products from entering the food supply in some countries, the lack of a diagnostic test to identify SCNT animals may jeopardize market access for producers. The aim of this research was to exploit differences in epigenetic reprogramming that occur during SCNT and fertilization in the early embryo. The resulting differences in epigenetic signatures that persist to adulthood are proposed as the basis for a diagnostic test to identify animals generated by SCNT. Here we describe differences in DNA methylation at eight CpG sites in the retrotransposon-like 1 (Rtl1) promoter region in cattle blood and test whether these differences could be used as a diagnostic tool. For a definitive diagnosis, it is critical that no overlap in DNA methylation levels is observed between individuals produced by SCNT and fertilization. This was the case for the cohort of SCNT animals studied, their female half-siblings generated by AI, and a collection of unrelated cows also generated by AI. Further rigorous testing is required to determine what effects donor cell type, age, sex, genetic background, SCNT methods, and the environment have on the DNA methylation across this region, but the Rtl1 promoter is currently a promising candidate for the identification of SCNT generated cattle.

  8. Sex-dichotomous effects of NOS1AP promoter DNA methylation on intracranial aneurysm and brain arteriovenous malformation.


    Wang, Zhepei; Zhao, Jikuang; Sun, Jie; Nie, Sheng; Li, Keqing; Gao, Feng; Zhang, Tiefeng; Duan, Shiwei; Di, Yazhen; Huang, Yi; Gao, Xiang


    The goal of this study was to investigate the contribution of NOS1AP-promoter DNA methylation to the risk of intracranial aneurysm (IA) and brain arteriovenous malformation (BAVM) in a Han Chinese population. A total of 48 patients with IAs, 22 patients with BAVMs, and 26 control individuals were enrolled in the study. DNA methylation was tested using bisulfite pyrosequencing technology. We detected significantly higher DNA methylation levels in BAVM patients than in IA patients based on the multiple testing correction (CpG4-5 methylation: 5.86±1.04% vs. 4.37±2.64%, P=0.006). In women, CpG4-5 methylation levels were much lower in IA patients (3.64±1.97%) than in BAVM patients (6.11±1.20%, P<0.0001). However, in men, CpG1-3 methylation levels were much higher in the controls (6.92±0.78%) than in BAVM patients (5.99±0.70%, P=0.008). Additionally, there was a gender-based difference in CpG1 methylation within the controls (men vs. women: 5.75±0.50% vs. 4.99±0.53%, P=0.003) and BAVM patients (men vs. women: 4.70±0.74% vs. 5.50±0.87%, P=0.026). A subgroup analysis revealed significantly higher CpG3 methylation in patients who smoked than in those who did not (P=0.041). Our results suggested that gender modulated the interaction between NOS1AP promoter DNA methylation in IA and BAVM patients. Our results also confirmed that regular tobacco smoking was associated with increased NOS1AP methylation in humans. Additional studies with larger sample sizes are required to replicate and extend these findings. PMID:27080431

  9. The Rad9 protein enhances survival and promotes DNA repair following exposure to ionizing radiation

    SciTech Connect

    Brandt, Patrick D.; Helt, Christopher E.; Keng, Peter C.; Bambara, Robert A. . E-mail:


    Following DNA damage cells initiate cell cycle checkpoints to allow time to repair sustained lesions. Rad9, Rad1, and Hus1 proteins form a toroidal complex, termed the 9-1-1 complex, that is involved in checkpoint signaling. 9-1-1 shares high structural similarity to the DNA replication protein proliferating cell nuclear antigen (PCNA) and 9-1-1 has been shown in vitro to stimulate steps of the repair process known as long patch base excision repair. Using a system that allows conditional repression of the Rad9 protein in human cell culture, we show that Rad9, and by extension, the 9-1-1 complex, enhances cell survival, is required for efficient exit from G2-phase arrest, and stimulates the repair of damaged DNA following ionizing radiation. These data provide in vivo evidence that the human 9-1-1 complex participates in DNA repair in addition to its previously described role in DNA damage sensing.

  10. Genomically amplified Akt3 activates DNA repair pathway and promotes glioma progression.


    Turner, Kristen M; Sun, Youting; Ji, Ping; Granberg, Kirsi J; Bernard, Brady; Hu, Limei; Cogdell, David E; Zhou, Xinhui; Yli-Harja, Olli; Nykter, Matti; Shmulevich, Ilya; Yung, W K Alfred; Fuller, Gregory N; Zhang, Wei


    Akt is a robust oncogene that plays key roles in the development and progression of many cancers, including glioma. We evaluated the differential propensities of the Akt isoforms toward progression in the well-characterized RCAS/Ntv-a mouse model of PDGFB-driven low grade glioma. A constitutively active myristoylated form of Akt1 did not induce high-grade glioma (HGG). In stark contrast, Akt2 and Akt3 showed strong progression potential with 78% and 97% of tumors diagnosed as HGG, respectively. We further revealed that significant variations in polarity and hydropathy values among the Akt isoforms in both the pleckstrin homology domain (P domain) and regulatory domain (R domain) were critical in mediating glioma progression. Gene expression profiles from representative Akt-derived tumors indicated dominant and distinct roles for Akt3, consisting primarily of DNA repair pathways. TCGA data from human GBM closely reflected the DNA repair function, as Akt3 was significantly correlated with a 76-gene signature DNA repair panel. Consistently, compared with Akt1 and Akt2 overexpression models, Akt3-expressing human GBM cells had enhanced activation of DNA repair proteins, leading to increased DNA repair and subsequent resistance to radiation and temozolomide. Given the wide range of Akt3-amplified cancers, Akt3 may represent a key resistance factor.

  11. Genomically amplified Akt3 activates DNA repair pathway and promotes glioma progression

    PubMed Central

    Turner, Kristen M.; Sun, Youting; Ji, Ping; Granberg, Kirsi J.; Bernard, Brady; Hu, Limei; Cogdell, David E.; Zhou, Xinhui; Yli-Harja, Olli; Nykter, Matti; Shmulevich, Ilya; Yung, W. K. Alfred; Fuller, Gregory N.; Zhang, Wei


    Akt is a robust oncogene that plays key roles in the development and progression of many cancers, including glioma. We evaluated the differential propensities of the Akt isoforms toward progression in the well-characterized RCAS/Ntv-a mouse model of PDGFB-driven low grade glioma. A constitutively active myristoylated form of Akt1 did not induce high-grade glioma (HGG). In stark contrast, Akt2 and Akt3 showed strong progression potential with 78% and 97% of tumors diagnosed as HGG, respectively. We further revealed that significant variations in polarity and hydropathy values among the Akt isoforms in both the pleckstrin homology domain (P domain) and regulatory domain (R domain) were critical in mediating glioma progression. Gene expression profiles from representative Akt-derived tumors indicated dominant and distinct roles for Akt3, consisting primarily of DNA repair pathways. TCGA data from human GBM closely reflected the DNA repair function, as Akt3 was significantly correlated with a 76-gene signature DNA repair panel. Consistently, compared with Akt1 and Akt2 overexpression models, Akt3-expressing human GBM cells had enhanced activation of DNA repair proteins, leading to increased DNA repair and subsequent resistance to radiation and temozolomide. Given the wide range of Akt3-amplified cancers, Akt3 may represent a key resistance factor. PMID:25737557

  12. In vitro incubation of human spermatozoa promotes reactive oxygen species generation and DNA fragmentation.


    Cicaré, J; Caille, A; Zumoffen, C; Ghersevich, S; Bahamondes, L; Munuce, M J


    The aim of this study was to investigate the oxidative process associated with sperm capacitation and its impact on DNA fragmentation and sperm function. Redox activity and lipid peroxidation were analysed in human spermatozoa after 3, 6 and 22 h of incubation in Ham's F10 medium plus bovine albumin at 37° and 5% CO2 for capacitation. DNA status, tyrosine phosphorylation pattern and induced acrosome reaction were evaluated after capacitating conditions. At 22 h of incubation, there was a significant (P < 0.05) increase in oxygen-free radicals and lipid peroxidation, with no effect on sperm viability. There also was a significant (P < 0.001) increase in fragmented DNA in capacitated spermatozoa compared to semen values with higher rates being found after the occurrence of the induced acrosome reaction. Protein tyrosine phosphorylation pattern confirms that capacitation took place in parallel with the occurrence of DNA fragmentation. These results indicate that when spermatozoa are incubated for several hours (22 h), a common practice in assisted reproductive techniques, an increase in oxidative sperm metabolism and in the proportion of fragmented DNA should be expected. However, there was no effect on any of the other functional parameters associated with sperm fertilising capacity.

  13. Double Strand Breaks Can Initiate Gene Silencing and SIRT1-Dependent Onset of DNA Methylation in an Exogenous Promoter CpG Island

    PubMed Central

    O'Hagan, Heather M.; Mohammad, Helai P.; Baylin, Stephen B.


    Chronic exposure to inducers of DNA base oxidation and single and double strand breaks contribute to tumorigenesis. In addition to the genetic changes caused by this DNA damage, such tumors often contain epigenetically silenced genes with aberrant promoter region CpG island DNA hypermethylation. We herein explore the relationships between such DNA damage and epigenetic gene silencing using an experimental model in which we induce a defined double strand break in an exogenous promoter construct of the E-cadherin CpG island, which is frequently aberrantly DNA hypermethylated in epithelial cancers. Following the onset of repair of the break, we observe recruitment to the site of damage of key proteins involved in establishing and maintaining transcriptional repression, namely SIRT1, EZH2, DNMT1, and DNMT3B, and the appearance of the silencing histone modifications, hypoacetyl H4K16, H3K9me2 and me3, and H3K27me3. Although in most cells selected after the break, DNA repair occurs faithfully with preservation of activity of the promoter, a small percentage of the plated cells demonstrate induction of heritable silencing. The chromatin around the break site in such a silent clone is enriched for most of the above silent chromatin proteins and histone marks, and the region harbors the appearance of increasing DNA methylation in the CpG island of the promoter. During the acute break, SIRT1 appears to be required for the transient recruitment of DNMT3B and subsequent methylation of the promoter in the silent clones. Taken together, our data suggest that normal repair of a DNA break can occasionally cause heritable silencing of a CpG island–containing promoter by recruitment of proteins involved in silencing. Furthermore, with contribution of the stress-related protein SIRT1, the break can lead to the onset of aberrant CpG island DNA methylation, which is frequently associated with tight gene silencing in cancer. PMID:18704159

  14. Modulation of Promoter Occupancy by Cooperative DNA Binding and Activation-Domain Function is a Major Determinant of Transcriptional Regulation by Activators in vivo

    NASA Astrophysics Data System (ADS)

    Tanaka, Masafumi


    Binding of transcriptional activators to a promoter is a prerequisite process in transcriptional activation. It is well established that the efficiency of activator binding to a promoter is determined by the affinity of direct interactions between the DNA-binding domain of an activator and its specific target sequences. However, I describe here that activator binding to a promoter is augmented in vivo by the effects of two other determinants that have not been generally appreciated: (i) the number of activator binding sites present in a promoter and (ii) the potency of activation domains of activators. Multiple sites within a promoter can cooperatively recruit cognate factors regardless of whether they contain an effective activation domain. This cooperativity can result in the synergistic activation of transcription. The second effect is the enhancement of activator binding to a promoter by the presence of activation domains. In this case, activation domains are not simply tethered to the promoter by the DNA-binding domain but instead assist the DNA-binding domain being tethered onto the promoter. This effect of activation domains on DNA binding is instrumental in determining how potent activators can induce steep transcriptional increases at low concentrations.

  15. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone

    PubMed Central

    Schwarz, Megan C.; Sourisseau, Marion; Espino, Michael M.; Gray, Essanna S.; Chambers, Matthew T.; Tortorella, Domenico


    ABSTRACT The recent Zika virus (ZIKV) outbreak has been linked to severe pathogenesis. Here, we report the construction of a plasmid carrying a cytomegalovirus (CMV) promoter-expressed prototype 1947 Uganda MR766 ZIKV cDNA that can initiate infection following direct plasmid DNA transfection of mammalian cells. Incorporation of a synthetic intron in the nonstructural protein 1 (NS1) region of the ZIKV polyprotein reduced viral cDNA-associated toxicity in bacteria. High levels of infectious virus were produced following transfection of the plasmid bearing the wild-type MR766 ZIKV genome, but not one with a disruption to the viral nonstructural protein 5 (NS5) polymerase active site. Multicycle growth curve and plaque assay experiments indicated that the MR766 virus resulting from plasmid transfection exhibited growth characteristics that were more similar to its parental isolate than previously published 2010 Cambodia and 2015 Brazil cDNA-rescued ZIKV. This ZIKV infectious clone will be useful for investigating the genetic determinants of ZIKV infection and pathogenesis and should be amenable to construction of diverse infectious clones expressing reporter proteins and representing a range of ZIKV isolates. IMPORTANCE The study of ZIKV, which has become increasingly important with the recent association of this virus with microcephaly and Guillain-Barré syndrome, would benefit from an efficient strategy to genetically manipulate the virus. This work describes a model system to produce infectious virus in cell culture. We created a plasmid carrying the prototype 1947 Uganda MR766 ZIKV genome that both was stable in bacteria and could produce high levels of infectious virus in mammalian cells through direct delivery of this DNA. Furthermore, growth properties of this rescued virus closely resembled those of the viral isolate from which it was derived. This model system will provide a simple and effective means to study how ZIKV genetics impact viral replication and

  16. ATM-dependent Phosphorylation of the Fanconi Anemia Protein PALB2 Promotes the DNA Damage Response.


    Guo, Yingying; Feng, Wanjuan; Sy, Shirley M H; Huen, Michael S Y


    The Fanconi anemia protein PALB2, also known as FANCN, protects genome integrity by regulating DNA repair and cell cycle checkpoints. Exactly how PALB2 functions may be temporally coupled with detection and signaling of DNA damage is not known. Intriguingly, we found that PALB2 is transformed into a hyperphosphorylated state in response to ionizing radiation (IR). IR treatment specifically triggered PALB2 phosphorylation at Ser-157 and Ser-376 in manners that required the master DNA damage response kinase Ataxia telangiectasia mutated, revealing potential mechanistic links between PALB2 and the Ataxia telangiectasia mutated-dependent DNA damage responses. Consistently, dysregulated PALB2 phosphorylation resulted in sustained activation of DDRs. Full-blown PALB2 phosphorylation also required the breast and ovarian susceptible gene product BRCA1, highlighting important roles of the BRCA1-PALB2 interaction in orchestrating cellular responses to genotoxic stress. In summary, our phosphorylation analysis of tumor suppressor protein PALB2 uncovers new layers of regulatory mechanisms in the maintenance of genome stability and tumor suppression. PMID:26420486

  17. Heterogeneous DNA Methylation Patterns in the GSTP1 Promoter Lead to Discordant Results between Assay Technologies and Impede Its Implementation as Epigenetic Biomarkers in Breast Cancer

    PubMed Central

    Grenaker Alnaes, Grethe I.; Ronneberg, Jo Anders; Kristensen, Vessela N.; Tost, Jörg


    Altered DNA methylation patterns are found in many diseases, particularly in cancer, where the analysis of DNA methylation holds the promise to provide diagnostic, prognostic and predictive information of great clinical value. Methylation of the promoter-associated CpG island of GSTP1 occurs in many hormone-sensitive cancers, has been shown to be a biomarker for the early detection of cancerous lesions and has been associated with important clinical parameters, such as survival and response to treatment. In the current manuscript, we assessed the performance of several widely-used sodium bisulfite conversion-dependent methods (methylation-specific PCR, MethyLight, pyrosequencing and MALDI mass-spectrometry) for the analysis of DNA methylation patterns in the GSTP1 promoter. We observed large discordances between the results obtained by the different technologies. Cloning and sequencing of the investigated region resolved single-molecule DNA methylation patterns and identified heterogeneous DNA methylation patterns as the underlying cause of the differences. Heterogeneous DNA methylation patterns in the GSTP1 promoter constitute a major obstacle to the implementation of DNA methylation-based analysis of GSTP1 and might explain some of the contradictory findings in the analysis of the significance of GSTP1 promoter methylation in breast cancer. PMID:26393654

  18. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans

    PubMed Central

    Quilez, Javier; Guilmatre, Audrey; Garg, Paras; Highnam, Gareth; Gymrek, Melissa; Erlich, Yaniv; Joshi, Ricky S.; Mittelman, David; Sharp, Andrew J.


    Despite representing an important source of genetic variation, tandem repeats (TRs) remain poorly studied due to technical difficulties. We hypothesized that TRs can operate as expression (eQTLs) and methylation (mQTLs) quantitative trait loci. To test this we analyzed the effect of variation at 4849 promoter-associated TRs, genotyped in 120 individuals, on neighboring gene expression and DNA methylation. Polymorphic promoter TRs were associated with increased variance in local gene expression and DNA methylation, suggesting functional consequences related to TR variation. We identified >100 TRs associated with expression/methylation levels of adjacent genes. These potential eQTL/mQTL TRs were enriched for overlaps with transcription factor binding and DNaseI hypersensitivity sites, providing a rationale for their effects. Moreover, we showed that most TR variants are poorly tagged by nearby single nucleotide polymorphisms (SNPs) markers, indicating that many functional TR variants are not effectively assayed by SNP-based approaches. Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping TR variants are required to fully ascertain functional variation in the genome. PMID:27060133

  19. Recombinant plasmids carrying promoters, genes and the origin of DNA replication of the early region of bacteriophage T7.

    PubMed Central

    Scherzinger, E; Lauppe, H F; Voll, N; Wanke, M


    Two full-length contiguous HpaI fragments of the 0 to 18.2% region of T7 H DNA (HpF-H and HpG) were inserted into plasmids pHV14 or pC194 using oligo(dG . dC) connectors or synthetic HindIII adaptors. Amplification of the two early T7 fragments was achieved by transforming lysostaphin-treated S. aureus W57 with the hybrid plasmids. Experimental evidence is presented suggesting that neither of these T7 segments can be cloned in an intact form in E. coli. One of the hybrids, pHV14-HpF-H, proved to be unstable even in B. subtilis 168. The supercoiled recombinant plasmids were tested for their capacity to support RNA synthesis by purified E. coli or T7 RNA polymerases and to serve as templates in a cell-free T7 DNA replication system. The results of these in vitro studies indicate the presence of active "early" promoters in the cloned fragment HpF-H and active "late" promoters, as well as a functional origin of replication in the cloned fragment HpG. Images PMID:7433121

  20. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans.


    Quilez, Javier; Guilmatre, Audrey; Garg, Paras; Highnam, Gareth; Gymrek, Melissa; Erlich, Yaniv; Joshi, Ricky S; Mittelman, David; Sharp, Andrew J


    Despite representing an important source of genetic variation, tandem repeats (TRs) remain poorly studied due to technical difficulties. We hypothesized that TRs can operate as expression (eQTLs) and methylation (mQTLs) quantitative trait loci. To test this we analyzed the effect of variation at 4849 promoter-associated TRs, genotyped in 120 individuals, on neighboring gene expression and DNA methylation. Polymorphic promoter TRs were associated with increased variance in local gene expression and DNA methylation, suggesting functional consequences related to TR variation. We identified >100 TRs associated with expression/methylation levels of adjacent genes. These potential eQTL/mQTL TRs were enriched for overlaps with transcription factor binding and DNaseI hypersensitivity sites, providing a rationale for their effects. Moreover, we showed that most TR variants are poorly tagged by nearby single nucleotide polymorphisms (SNPs) markers, indicating that many functional TR variants are not effectively assayed by SNP-based approaches. Our study assigns biological significance to TR variations in the human genome, and suggests that a significant fraction of TR variations exert functional effects via alterations of local gene expression or epigenetics. We conclude that targeted studies that focus on genotyping TR variants are required to fully ascertain functional variation in the genome. PMID:27060133


    PubMed Central

    Sims, Hillel I.; Lane, Jacqueline M.; Ulyanova, Natalia P.; Schnitzler, Gavin R.


    The human SWI/SNF (hSWI/SNF) ATP-dependent chromatin remodeling complex is a tumor suppressor and essential transcriptional coregulator. SWI/SNF complexes have been shown to alter nucleosome positions, and this activity is likely to be important for their functions. However, previous studies have largely been unable to determine the extent to which DNA sequence might control nucleosome repositioning by SWI/SNF complexes. Here, we employ a minicircle remodeling approach to provide the first evidence that hSWI/SNF moves nucleosomes in a sequence dependent manner, away from nucleosome positioning sequences favored during nucleosome assembly. This repositioning is unaffected by the presence of DNA nicks, and can occur on closed-circular DNAs in the absence of topoisomerases. We observed directed nucleosome movement on minicircles derived from the human SWI/SNF-regulated c-myc promoter, which may contribute to the previously-observed “disruption” of two promoter nucleosomes during c-myc activation in vivo. Our results suggest a model wherein hSWI/SNF-directed nucleosome movement away from default positioning sequences results in sequence-specific regulatory effects. PMID:17877373

  2. Functional relevance of DNA polymorphisms within the promoter region of the prion protein gene and their association to BSE infection.


    Kashkevich, Kseniya; Humeny, Andreas; Ziegler, Ute; Groschup, Martin H; Nicken, Petra; Leeb, Tosso; Fischer, Christine; Becker, Cord-Michael; Schiebel, Katrin


    Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative diseases that can occur spontaneously or can be caused by infection or mutations within the prion protein gene PRNP. Nonsynonymous DNA polymorphisms within the PRNP gene have been shown to influence susceptibility/resistance to infection in sheep and humans. Analysis of DNA polymorphisms within the core promoter region of the PRNP gene in four major German bovine breeds resulted in the identification of both SNPs and insertion/deletion (indel) polymorphisms. Comparative genotyping of both controls and animals that tested positive for bovine spongiform encephalopathy (BSE) revealed a significantly different distribution of two indel polymorphisms and two SNPs within Braunvieh animals, suggesting an association of these polymorphisms with BSE susceptibility. The functional relevance of these polymorphisms was analyzed using reporter gene constructs in neuronal cells. A specific haplotype near exon 1 was identified that exhibited a significantly lower expression level. Genotyping of nine polymorphisms within the promoter region and haplotype calculation revealed that the haplotype associated with the lowest expression level was underrepresented in the BSE group of all breeds compared to control animals, indicating a correlation of reduced PRNP expression and increased resistance to BSE.

  3. Sumoylation Promotes the Stability of the DNA Sensor cGAS and the Adaptor STING to Regulate the Kinetics of Response to DNA Virus.


    Hu, Ming-Ming; Yang, Qing; Xie, Xue-Qin; Liao, Chen-Yang; Lin, Heng; Liu, Tian-Tian; Yin, Lei; Shu, Hong-Bing


    During viral infection, sensing of cytosolic DNA by the cyclic GMP-AMP synthase (cGAS) activates the adaptor protein STING and triggers an antiviral response. Little is known about the mechanisms that determine the kinetics of activation and deactivation of the cGAS-STING pathway, ensuring effective but controlled innate antiviral responses. Here we found that the ubiquitin ligase Trim38 targets cGas for sumoylation in uninfected cells and during the early phase of viral infection. Sumoylation of cGas prevented its polyubiquitination and degradation. Trim38 also sumoylated Sting during the early phase of viral infection, promoting both Sting activation and protein stability. In the late phase of infection, cGas and Sting were desumoylated by Senp2 and subsequently degraded via proteasomal and chaperone-mediated autophagy pathways, respectively. Our findings reveal an essential role for Trim38 in the innate immune response to DNA virus and provide insight into the mechanisms that ensure optimal activation and deactivation of the cGAS-STING pathway. PMID:27637147

  4. DNA hairpins promote temperature controlled cargo encapsulation in a truncated octahedral nanocage structure family

    NASA Astrophysics Data System (ADS)

    Franch, Oskar; Iacovelli, Federico; Falconi, Mattia; Juul, Sissel; Ottaviani, Alessio; Benvenuti, Claudia; Biocca, Silvia; Ho, Yi-Ping; Knudsen, Birgitta R.; Desideri, Alessandro


    In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous demonstration of temperature controlled reversible encapsulation of the cargo enzyme, horseradish peroxidase, in the cage with four hairpin forming strands. However, in this previous study the mechanism of cargo uptake was not directly addressed (Juul, et al., Temperature-Controlled Encapsulation and Release of an Active Enzyme in the Cavity of a Self-Assembled DNA Nanocage, ACS Nano, 2013, 7, 9724-9734). In the present study we use a combination of molecular dynamics simulations and in vitro analyses to unravel the mechanism of cargo uptake in hairpin containing DNA cages. We find that two hairpin forming strands are necessary and sufficient to facilitate efficient cargo uptake, which argues against a full opening-closing of one corner of the structure being responsible for encapsulation. Molecular dynamics simulations were carried out to evaluate the atomistic motions responsible for encapsulation and showed that the two hairpin forming strands facilitated extension of at least one of the face surfaces of the cage scaffold, allowing entrance of the cargo protein into the cavity of the structure. Hence, the presented data demonstrate that cargo uptake does not involve a full opening of the structure. Rather, the uptake mechanism represents a feature of increased flexibility integrated in this nanocage structure upon the addition of at least two hairpin-forming strands.In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous

  5. Induction of the lac promoter in the absence of DNA loops and the stoichiometry of induction.


    Oehler, Stefan; Alberti, Siegfried; Müller-Hill, Benno


    In vivo induction of the Escherichia coli lactose operon as a function of inducer concentration generates a sigmoidal curve, indicating a non-linear response. Suggested explanations for this dependence include a 2:1 inducer-repressor stoichiometry of induction, which is the currently accepted view. It is, however, known for decades that, in vitro, operator binding as a function of inducer concentration is not sigmoidal. This discrepancy between in vivo and in vitro data has so far not been resolved. We demonstrate that the in vivo non-linearity of induction is due to cooperative repression of the wild-type lac operon through DNA loop formation. In the absence of DNA loops, in vivo induction curves are hyperbolic. In the light of this result, we re-address the question of functional molecular inducer-repressor stoichiometry in induction of the lac operon. PMID:16432263

  6. DNA promoter methylation as a diagnostic and therapeutic biomarker in gallbladder cancer

    PubMed Central


    Gallbladder cancer is an infrequent neoplasia with noticeable geographical variations in its incidence around the world. In Chile, it is the main cause of death owing to cancer in women over 40 years old, with mortality rates up to 16.5 per 100,000 cases. The prognosis is poor with few therapeutic options; in advanced cases there is only a 10% survival at 5 years. Several studies mention the possible role of DNA methylation in gallbladder carcinogenesis. This epigenetic modification affects tumor suppressor genes involved in regulation pathways, cell cycle control, cell adhesion and extracellular matrix degradation, in a sequential and cumulative way. Determining DNA methylation patterns would allow them to be used as biomarkers for the early detection, diagnosis, prognosis and/or therapeutic selection in gallbladder cancer. PMID:22794276

  7. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing.


    Kon, Tatsuya; Yoshikawa, Nobuyuki


    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  8. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    PubMed Central

    Kon, Tatsuya; Yoshikawa, Nobuyuki


    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  9. Cyclin A2 promotes DNA repair in the brain during both development and aging

    PubMed Central

    Gygli, Patrick E.; Chang, Joshua C.; Gokozan, Hamza N.; Catacutan, Fay P.; Schmidt, Theresa A.; Kaya, Behiye; Goksel, Mustafa; Baig, Faisal S.; Chen, Shannon; Griveau, Amelie; Michowski, Wojciech; Wong, Michael; Palanichamy, Kamalakannan; Sicinski, Piotr; Nelson, Randy J.; Czeisler, Catherine; Otero, José J.


    Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential requirements of distinct brain regions for Cyclin A2, we utilized neuroanatomical, transgenic mouse, and mathematical modeling techniques to generate testable hypotheses that provide insight into how Cyclin A2 loss results in compensatory forebrain growth during late embryonic development. Using unbiased measurements of the forebrain stem cell niche, we parameterized a mathematical model whereby logistic growth instructs progenitor cells as to the cell-types of their progeny. Our data was consistent with prior findings that progenitors proliferate along an auto-inhibitory growth curve. The growth retardation in CCNA2-null brains corresponded to cell cycle lengthening, imposing a developmental delay. We hypothesized that Cyclin A2 regulates DNA repair and that CCNA2-null progenitors thus experienced lengthened cell cycle. We demonstrate that CCNA2-null progenitors suffer abnormal DNA repair, and implicate Cyclin A2 in double-strand break repair. Cyclin A2's DNA repair functions are conserved among cell lines, neural progenitors, and hippocampal neurons. We further demonstrate that neuronal CCNA2 ablation results in learning and memory deficits in aged mice. PMID:27425845

  10. Conjugative DNA Transfer Induces the Bacterial SOS Response and Promotes Antibiotic Resistance Development through Integron Activation

    PubMed Central

    Baharoglu, Zeynep; Bikard, David; Mazel, Didier


    Conjugation is one mechanism for intra- and inter-species horizontal gene transfer among bacteria. Conjugative elements have been instrumental in many bacterial species to face the threat of antibiotics, by allowing them to evolve and adapt to these hostile conditions. Conjugative plasmids are transferred to plasmidless recipient cells as single-stranded DNA. We used lacZ and gfp fusions to address whether conjugation induces the SOS response and the integron integrase. The SOS response controls a series of genes responsible for DNA damage repair, which can lead to recombination and mutagenesis. In this manuscript, we show that conjugative transfer of ssDNA induces the bacterial SOS stress response, unless an anti-SOS factor is present to alleviate this response. We also show that integron integrases are up-regulated during this process, resulting in increased cassette rearrangements. Moreover, the data we obtained using broad and narrow host range plasmids strongly suggests that plasmid transfer, even abortive, can trigger chromosomal gene rearrangements and transcriptional switches in the recipient cell. Our results highlight the importance of environments concentrating disparate bacterial communities as reactors for extensive genetic adaptation of bacteria. PMID:20975940

  11. EXD2 promotes homologous recombination by facilitating DNA-end resection

    PubMed Central

    Baddock, Hannah T.; Deshpande, Rajashree; Gileadi, Opher; Paull, Tanya T.; McHugh, Peter J; Niedzwiedz, Wojciech


    Repair of DNA double strand breaks (DSBs) by homologous recombination (HR) is critical for survival and genome stability of individual cells and organisms, but also contributes to the genetic diversity of species. A critical step in HR is MRN/CtIP-dependent end-resection that generates the 3′ single-stranded DNA overhangs required for the subsequent strand exchange reaction. Here, we identify EXD2 (EXDL2) as an exonuclease essential for DSB resection and efficient HR. EXD2 is recruited to chromatin in a damage-dependent manner and confers resistance to DSB-inducing agents. EXD2 functionally interacts with the MRN-complex to accelerate resection via its 3′-5′ exonuclease activity that efficiently processes dsDNA substrates containing nicks. Finally, we establish that EXD2 stimulates both short and long-range DSB resection, and thus together with MRE11 is required for efficient HR. This establishes a key role for EXD2 in controlling the initial steps of chromosomal break repair. PMID:26807646

  12. Involvement of miR-605 and miR-34a in the DNA Damage Response Promotes Apoptosis Induction

    PubMed Central

    Zhou, Chun-Hong; Zhang, Xiao-Peng; Liu, Feng; Wang, Wei


    MicroRNAs are key regulators of gene expression at the posttranscriptional level. In this study, we focus on miR-605 and miR-34a, which are direct transcriptional targets of p53 and in turn enhance its tumor suppressor function by acting upstream and downstream of it, respectively. miR-605 promotes p53 activation by repressing the expression of mdm2, while miR-34a promotes p53-dependent apoptosis by suppressing the expression of antiapoptotic genes such as bcl-2. What roles they play in the p53-mediated DNA damage response is less well understood. Here, we develop a four-module model of the p53 network to investigate the effect of miR-605 and miR-34a on the cell-fate decision after ionizing radiation. Results of numerical simulation indicate that the cell fate is closely associated with network dynamics. The concentration of p53 undergoes few pulses in response to repairable DNA damage, or it first oscillates and then switches to high plateau levels after irreparable damage. The amplitude of p53 pulses rises to various extents depending on miR-605 expression, and miR-605 accelerates the switching behavior of p53 levels to induce apoptosis. In parallel, miR-34a promotes apoptosis by enhancing the accumulation of free p53AIP1, a key proapoptotic protein. Thus, both miR-605 and miR-34a can mediate cellular outcomes and the timing of apoptosis. Moreover, miR-605 and PTEN complement each other in elevating p53 levels to trigger apoptosis. Taken together, miR-605 and miR-34a cooperate to endow the network with a fail-safe mechanism for apoptosis induction. This computational study also enriches our understanding of the action modes of p53-targeted microRNAs. PMID:24739178

  13. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary


    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  14. Interaction of a rhizobial DNA-binding protein with the promoter region of a plant leghemoglobin gene

    SciTech Connect

    Welters, P.; Metz, B.; Felix, G.; Palme, K. ); Szczyglowski, K. ); Bruijn, F.J. de Michigan State Univ., East Lansing, MI )


    A nucleotide sequence was identified approximately 650 bp upstream of the Sesbania rostrata leghemoglobin gene Srglb3 start codon, which interacts specifically with a proteinaceous DNA-binding factor found in nodule extracts but not in extracts from leaves or root. The binding site for this factor was delimited using footprinting techniques. The DNA-binding activity of this factor was found to be heat stable, dependent on divalent cations, and derived from the (infecting) Azorhizobium caulinodans bacteria or bacteroids (A. caulinodans bacterial binding factor 1, AcBBF1). A 9- to 10-kD protein was isolated from a free-living culture of A. caulinodans that co-purifies with the DNA-binding activity (A. caulinodans bacterial binding protein 1, AcBBP1) and interacts specifically with its target (S. rostrata bacterial binding site 1, SrBBS1). The amino acid sequence of the N-terminal 27 residues of AcBBP1 was determined and was found to share significant similarity (46% identity; 68% similarity) with a domain of the herpes simplex virus major DNA-binding protein infected cell protein 8(ICP8). An insertion mutation in the SrBBS1 was found to result in a substantial reduction of the expression of a Srglb3-gus reporter gene fusion in nodules of transgenic Lotus corniculatus plants, suggesting a role for this element in Srglb3 promoter activity. Based on these results, the authors propose that (a) bacterial transacting factor(s) may play a role in infected cell-specific expression of the symbiotically induced plant lb genes. 70 refs., 11 figs.

  15. A Conserved DNA Repeat Promotes Selection of a Diverse Repertoire of Trypanosoma brucei Surface Antigens from the Genomic Archive

    PubMed Central

    Hovel-Miner, Galadriel; Mugnier, Monica R.; Goldwater, Benjamin; Cross, George A. M.; Papavasiliou, F. Nina


    African trypanosomes are mammalian pathogens that must regularly change their protein coat to survive in the host bloodstream. Chronic trypanosome infections are potentiated by their ability to access a deep genomic repertoire of Variant Surface Glycoprotein (VSG) genes and switch from the expression of one VSG to another. Switching VSG expression is largely based in DNA recombination events that result in chromosome translocations between an acceptor site, which houses the actively transcribed VSG, and a donor gene, drawn from an archive of more than 2,000 silent VSGs. One element implicated in these duplicative gene conversion events is a DNA repeat of approximately 70 bp that is found in long regions within each BES and short iterations proximal to VSGs within the silent archive. Early observations showing that 70-bp repeats can be recombination boundaries during VSG switching led to the prediction that VSG-proximal 70-bp repeats provide recombinatorial homology. Yet, this long held assumption had not been tested and no specific function for the conserved 70-bp repeats had been demonstrated. In the present study, the 70-bp repeats were genetically manipulated under conditions that induce gene conversion. In this manner, we demonstrated that 70-bp repeats promote access to archival VSGs. Synthetic repeat DNA sequences were then employed to identify the length, sequence, and directionality of repeat regions required for this activity. In addition, manipulation of the 70-bp repeats allowed us to observe a link between VSG switching and the cell cycle that had not been appreciated. Together these data provide definitive support for the long-standing hypothesis that 70-bp repeats provide recombinatorial homology during switching. Yet, the fact that silent archival VSGs are selected under these conditions suggests the 70-bp repeats also direct DNA pairing and recombination machinery away from the closest homologs (silent BESs) and toward the rest of the archive. PMID

  16. Nuclear extracts of chicken embryos promote an active demethylation of DNA by excision repair of 5-methyldeoxycytidine.

    PubMed Central

    Jost, J P


    Here I show that nuclear extracts of chicken embryos can promote the active demethylation of DNA. The evidence shows that in hemimethylated DNA (i.e., methylated on one strand only) demethylation of 5mCpG occurs through nucleotide excision repair. The first step of demethylation is the formation of specific nicks 5' from 5-methyldeoxycytidine. Nicks are also observed in vitro on symmetrically methylated CpGs (i.e., methylated on both strands) but they result in breakage of the oligonucleotide with no repair. No specific nicks are observed on the nonmethylated CpG. Nicks are strictly 5mCpG specific and do not occur on 5mCpC, 5mCpT, 5mCpA, or 6mApT. The effect of nonspecific nuclease(s) has been ruled out. The nicking of mCpG takes place in the presence of 20 mM EDTA irrespective of the nature of the sequence surrounding the 5mCpG. No methylcytosine glycosylase activity could be detected. The repair is aphidicolin and N-ethylmaleimide resistant, suggesting a repair action by DNA polymerase beta. In extracts of chicken embryos, the excision repair of mCpG is highest between the 6th and the 12th day of development, whereas it is barely detectable in nuclear extracts from different organs of adults. The possible implications of 5mCpG endonuclease activity in active demethylation of DNA during differentiation is discussed. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 PMID:8506318

  17. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar


    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  18. DNaseI-hypersensitive sites at promoter-like sequences in the spacer of Xenopus laevis and Xenopus borealis ribosomal DNA.

    PubMed Central

    La Volpe, A; Taggart, M; McStay, B; Bird, A


    We have detected a DNAseI hypersensitive site in the ribosomal DNA spacer of Xenopus laevis and Xenopus borealis. The site is present in blood and embryonic nuclei of each species. In interspecies hybrids, however, the site is absent in unexpressed borealis rDNA, but is present normally in expressed laevis rDNA. Hypersensitive sites are located well upstream (over lkb) of the pre-ribosomal RNA promoter. Sequencing of the hypersensitive region in borealis rDNA, however, shows extensive homology with the promoter sequence, and with the hypersensitive region in X. laevis. Of two promoter-like duplications in each spacer, only the most upstream copy is associated with hypersensitivity to DNAaseI. Unlike DNAaseI, Endo R. MspI digests the rDNA of laevis blood nuclei at a domain extending downstream from the hypersensitive site to near the 40S promoter. Since the organisation of conserved sequence elements within this "proximal domain" is similar in three Xenopus species whose spacers have otherwise evolved rapidly, we conclude that this domain plays an important role in rDNA function. Images PMID:6310495

  19. Regulation of the alpha-fetoprotein promoter: Ku binding and DNA spatial conformation.


    Liénard, P; De Mees, C; Drèze, P-L; Dieu, M; Dierick, J-F; Raes, M; Szpirer, J; Szpirer, C


    This work shows that the proximal promoter of the mouse Afp gene contains a Ku binding site and that Ku binding is associated with down-regulation of the transcriptional activity of the Afp promoter. The Ku binding site is located in a segment able to adopt a peculiar structured form, probably a hairpin structure. Interestingly, the structured form eliminates the binding sites of the positive transcription factor HNF1. Furthermore, a DNAse hypersensitive site is detected in footprinting experiments done with extracts of AFP non-expressing hepatoma cells. These observations suggest that the structured form is stabilised by Ku and is associated with extinction of the gene in AFP non-expressing hepatic cells.

  20. Brusatol Enhances the Radiosensitivity of A549 Cells by Promoting ROS Production and Enhancing DNA Damage

    PubMed Central

    Sun, Xiaohui; Wang, Qin; Wang, Yan; Du, Liqing; Xu, Chang; Liu, Qiang


    NF-E2-related factor 2 (Nrf2) has been identified as a master regulatory factor in the protection of cells from oxidative and electrophilic stress. However, overexpression of Nrf2 in lung cancer may cause chemoresistance, as well as radioresistance. In this study, we examined the relationship between radioresistance and Nrf2 protein levels in H1299, A549, and H460 cells, and finally chose the A549 cell line to continue with due to its strong radioresistance and high Nrf2 protein levels. We found that the Nrf2 inhibitor, brusatol, could prevent the increase and accumulation of Nrf2 after exposure to irradiation. Additionally, following treatment with 80 nM brusatol, A549 cells became sensitive to irradiation, suffering severe DNA damage. Combination treatment with brusatol and ionizing radiation (IR) can distinctly increase the level of reactive oxygen species in A549 cells, causing a 1.8-fold increase compared with the control, and a 1.4-fold increase compared with IR alone. In fact, in the treatment with both brusatol and IR, lung cancer cell proliferation is halted, gradually leading to cell death. Because Nrf2 is closely linked to DNA damage repair, inhibiting the function of Nrf2, as in brusatol treatment, may increase the DNA damage caused by radiotherapy or chemotherapy, possibly enhancing the efficacy of chemotherapeutic drugs. Our study is the first to demonstrate brusatol’s ability to enhance the responsiveness of lung cancer cells to irradiation, and its potential application as a natural sensitizer in radiotherapy. PMID:27347930

  1. ATM regulates 3-Methylpurine-DNA glycosylase and promotes therapeutic resistance to alkylating agents

    PubMed Central

    Agnihotri, Sameer; Burrell, Kelly; Buczkowicz, Pawel; Remke, Marc; Golbourn, Brian; Chornenkyy, Yevgen; Gajadhar, Aaron; Fernandez, Nestor A.; Clarke, Ian D.; Barszczyk, Mark S.; Pajovic, Sanja; Ternamian, Christian; Head, Renee; Sabha, Nesrin; Sobol, Robert W.; Taylor, Michael D; Rutka, James T.; Jones, Chris; Dirks, Peter B.; Zadeh, Gelareh; Hawkins, Cynthia


    Alkylating agents are a frontline therapy for the treatment of several aggressive cancers including pediatric glioblastoma, a lethal tumor in children. Unfortunately, many tumors are resistant to this therapy. We sought to identify ways of sensitizing tumor cells to alkylating agents while leaving normal cells unharmed; increasing therapeutic response while minimizing toxicity. Using a siRNA screen targeting over 240 DNA damage response genes, we identified novel sensitizers to alkylating agents. In particular the base excision repair (BER) pathway, including 3-methylpurine-DNA glycosylase (MPG), as well as ataxia telangiectasia mutated (ATM) were identified in our screen. Interestingly, we identified MPG as a direct novel substrate of ATM. ATM-mediated phosphorylation of MPG was required for enhanced MPG function. Importantly, combined inhibition or loss of MPG and ATM resulted in increased alkylating agent-induced cytotoxicity in vitro and prolonged survival in vivo. The discovery of the ATM-MPG axis will lead to improved treatment of alkylating agent-resistant tumors. PMID:25100205

  2. Aag DNA Glycosylase Promotes Alkylation-Induced Tissue Damage Mediated by Parp1

    PubMed Central

    Calvo, Jennifer A.; Moroski-Erkul, Catherine A.; Lake, Annabelle; Eichinger, Lindsey W.; Shah, Dharini; Jhun, Iny; Limsirichai, Prajit; Bronson, Roderick T.; Christiani, David C.; Meira, Lisiane B.; Samson, Leona D.


    Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER) is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG) mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag−/− mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage. PMID:23593019

  3. PICH and BLM limit histone association with anaphase centromeric DNA threads and promote their resolution.


    Ke, Yuwen; Huh, Jae-Wan; Warrington, Ross; Li, Bing; Wu, Nan; Leng, Mei; Zhang, Junmei; Ball, Haydn L; Li, Bing; Yu, Hongtao


    Centromeres nucleate the formation of kinetochores and are vital for chromosome segregation during mitosis. The SNF2 family helicase PICH (Plk1-interacting checkpoint helicase) and the BLM (the Bloom's syndrome protein) helicase decorate ultrafine histone-negative DNA threads that link the segregating sister centromeres during anaphase. The functions of PICH and BLM at these threads are not understood, however. Here, we show that PICH binds to BLM and enables BLM localization to anaphase centromeric threads. PICH- or BLM-RNAi cells fail to resolve these threads in anaphase. The fragmented threads form centromeric-chromatin-containing micronuclei in daughter cells. Anaphase threads in PICH- and BLM-RNAi cells contain histones and centromere markers. Recombinant purified PICH has nucleosome remodelling activities in vitro. We propose that PICH and BLM unravel centromeric chromatin and keep anaphase DNA threads mostly free of nucleosomes, thus allowing these threads to span long distances between rapidly segregating centromeres without breakage and providing a spatiotemporal window for their resolution. PMID:21743438

  4. Atrazine promotes biochemical changes and DNA damage in a Neotropical fish species.


    Santos, Thais G; Martinez, Cláudia B R


    The effects of Atrazine, an herbicide used worldwide and considered as a potential contaminant in aquatic environments, were assessed on the Neotropical fish Prochilodus lineatus acutely (24 and 48 h) exposed to 2 or 10 μg L(-1) of atrazine by using a set of biochemical and genetic biomarkers. The following parameters were measured in the liver: activity of the biotransformation enzymes ethoxyresorufin-O-deethylase (EROD) and glutathione S transferase (GST), antioxidant enzymes superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), glutathione reductase (GR), content of reduced glutathione (GSH), generation of reactive oxygen species (ROS) and occurrence of lipid peroxidation (LPO); in brain and muscle the activity of acetylcholinesterase (AChE) and DNA damage (comet assay) on erythrocytes, gills and liver cells. A general decreasing trend on the biotransformation and antioxidant enzymes was observed in the liver of P. lineatus exposed to atrazine; except for GR, all the other antioxidant enzymes (SOD, CAT and GPx) and biotransformation enzymes (EROD and GST) showed inhibited activity. Changes in muscle or brain AChE were not detected. DNA damage was observed in the different cell types of fish exposed to the herbicide, and it was probably not from oxidative origin, since no increase in ROS generation and LPO was detected in the liver. These results show that atrazine behaves as enzyme inhibitor, impairing hepatic metabolism, and produces genotoxic damage to different cell types of P. lineatus.

  5. Mitochondrial DNA 10609T promotes hypoxia-induced increase of intracellular ROS and is a risk factor of high altitude polycythemia.


    Jiang, Chunhua; Cui, Jianhua; Liu, Fuyu; Gao, Liang; Luo, Yongjun; Li, Peng; Guan, Libin; Gao, Yuqi


    Hypobaric hypoxia is the primary cause of high altitude polycythemia (HAPC). Mitochondria are critical organelles that consume high levels of oxygen and generate ATP. We hypothesize that the mitochondrion may be at the center of HAPC, and mitochondrial DNA (mtDNA) SNPs may be involved in its development. First, we conducted a case-control study to investigate the association of mtDNA variants with HAPC in Han Chinese migrating to the Qinghai-Tibetan Plateau. Pearson's chi-square tests revealed that mtDNA 8414T (MU) frequency (19.5%) in the HAPC group was significantly higher than that of the control (13.0%, P = 0.04, OR = 1.615, 95%CI: 1.020-2.555). The multivariate logistic regression analysis, after adjustment for environmental factors, revealed that mtDNA 10609T (WT) was significantly associated with an increased risk of HAPC (P<0.01, OR = 2.558, 95%CI: 1.250-5.236). Second, to verify the association, in vitro experiments of transmitochondrial cybrids was performed and revealed that the mtDNA 10609 variant promoted hypoxia-induced increase of intracellular ROS, but the mtDNA 8414 variant did not. Our findings provide evidence that, in Han Chinese, mtDNA 10609T promotes hypoxia-induced increase of intracellular ROS and is a HAPC risk factor.

  6. ExsA and LcrF recognize similar consensus binding sites, but differences in their oligomeric state influence interactions with promoter DNA.


    King, Jessica M; Schesser Bartra, Sara; Plano, Gregory; Yahr, Timothy L


    ExsA activates type III secretion system (T3SS) gene expression in Pseudomonas aeruginosa and is a member of the AraC family of transcriptional regulators. AraC proteins contain two helix-turn-helix (HTH) DNA binding motifs. One helix from each HTH motif inserts into the major groove of the DNA to make base-specific contacts with the promoter region. The amino acids that comprise the HTH motifs of ExsA are nearly identical to those in LcrF/VirF, the activators of T3SS gene expression in the pathogenic yersiniae. In this study, we tested the hypothesis that ExsA/LcrF/VirF recognize a common nucleotide sequence. We report that Yersinia pestis LcrF binds to and activates transcription of ExsA-dependent promoters in P. aeruginosa and that plasmid-expressed ExsA complements a Y. pestis lcrF mutant for T3SS gene expression. Mutations that disrupt the ExsA consensus binding sites in both P. aeruginosa and Y. pestis T3SS promoters prevent activation by ExsA and LcrF. Our combined data demonstrate that ExsA and LcrF recognize a common nucleotide sequence. Nevertheless, the DNA binding properties of ExsA and LcrF are distinct. Whereas two ExsA monomers are sequentially recruited to the promoter region, LcrF binds to promoter DNA as a preformed dimer and has a higher capacity to bend DNA. An LcrF mutant defective for dimerization bound promoter DNA with properties similar to ExsA. Finally, we demonstrate that the activators of T3SS gene expression from Photorhabdus luminescens, Aeromonas hydrophila, and Vibrio parahaemolyticus are also sensitive to mutations that disrupt the ExsA consensus binding site. PMID:24142246

  7. The methylcytosine dioxygenase Tet2 promotes DNA demethylation and activation of cytokine gene expression in T cells

    PubMed Central

    Ichiyama, Kenji; Chen, Tingting; Wang, Xiaohu; Yan, Xiaowei; Kim, Byung-Seok; Tanaka, Shinya; Ndiaye-Lobry, Delphine; Deng, Yuhua; Zou, Yanli; Zheng, Pan; Tian, Qiang; Aifantis, Iannis; Wei, Lai; Dong, Chen


    Summary Epigenetic regulation of lineage-specific genes is important for the differentiation and function of T cell. Ten-eleven translocation (Tet) proteins catalyze 5-methylcytosine (5mC) conversion to 5-hydroxymethylcytosine (5hmC) to mediate DNA demethylation. However, the roles of Tet proteins in the immune response are unknown. Here, we characterized the genome-wide distribution of 5hmC in CD4+ T cells and found 5hmC marks putative regulatory elements in signature genes associated with effector cell differentiation. Moreover, Tet2 protein was recruited to 5hmC-containing regions, dependent on lineage-specific transcription factors. Deletion of the Tet2 gene in T cells decreased their cytokine expression, associated with reduced p300 recruitment. In vivo, Tet2 plays a critical role in the control of cytokine gene expression in autoimmune disease. Collectively, our findings suggest that Tet2 promotes DNA demethylation and activation of cytokine gene expression in T cells. PMID:25862091

  8. Pre-Exposure to Ionizing Radiation Stimulates DNA Double Strand Break End Resection, Promoting the Use of Homologous Recombination Repair

    PubMed Central

    Oike, Takahiro; Okayasu, Ryuichi; Murakami, Takeshi; Nakano, Takashi; Shibata, Atsushi


    The choice of DNA double strand break (DSB) repair pathway is determined at the stage of DSB end resection. Resection was proposed to control the balance between the two major DSB repair pathways, homologous recombination (HR) and non-homologous end joining (NHEJ). Here, we examined the regulation of DSB repair pathway choice at two-ended DSBs following ionizing radiation (IR) in G2 phase of the cell cycle. We found that cells pre-exposed to low-dose IR preferred to undergo HR following challenge IR in G2, whereas NHEJ repair kinetics in G1 were not affected by pre-IR treatment. Consistent with the increase in HR usage, the challenge IR induced Replication protein A (RPA) foci formation and RPA phosphorylation, a marker of resection, were enhanced by pre-IR. However, neither major DNA damage signals nor the status of core NHEJ proteins, which influence the choice of repair pathway, was significantly altered in pre-IR treated cells. Moreover, the increase in usage of HR due to pre-IR exposure was prevented by treatment with ATM inhibitor during the incubation period between pre-IR and challenge IR. Taken together, the results of our study suggest that the ATM-dependent damage response after pre-IR changes the cellular environment, possibly by regulating gene expression or post-transcriptional modifications in a manner that promotes resection. PMID:25826455

  9. Targeted expression of transforming growth factor-beta 1 in intracardiac grafts promotes vascular endothelial cell DNA synthesis.

    PubMed Central

    Koh, G Y; Kim, S J; Klug, M G; Park, K; Soonpaa, M H; Field, L J


    Intracardiac grafts comprised of genetically modified skeletal myoblasts were assessed for their ability to effect long-term delivery of recombinant transforming growth factor-beta (TGF-beta) to the heart. C2C12 myoblasts were stably transfected with a construct comprised of an inducible metallothionein promoter fused to a modified TGF-beta 1 cDNA. When cultured in medium supplemented with zinc sulfate, cells carrying this transgene constitutively secrete active TGF-beta 1. These genetically modified myoblasts were used to produce intracardiac grafts in syngeneic C3Heb/FeJ hosts. Viable grafts were observed as long as three months after implantation, and immunohistological analyses of mice maintained on water supplemented with zinc sulfate revealed the presence of grafted cells which stably expressed TGF-beta 1. Regions of apparent neovascularization, as evidenced by tritiated thymidine incorporation into vascular endothelial cells, were observed in the myocardium which bordered grafts expressing TGF-beta 1. The extent of vascular endothelial cell DNA synthesis could be modulated by altering dietary zinc. Similar effects on the vascular endothelial cells were not seen in mice with grafts comprised of nontransfected cells. This study indicates that genetically modified skeletal myoblast grafts can be used to effect the local, long-term delivery of recombinant molecules to the heart. Images PMID:7529257

  10. DNA damage–inducible SUMOylation of HERC2 promotes RNF8 binding via a novel SUMO-binding Zinc finger

    PubMed Central

    Danielsen, Jannie Rendtlew; Povlsen, Lou Klitgaard; Villumsen, Bine Hare; Streicher, Werner; Nilsson, Jakob; Wikström, Mats; Bekker-Jensen, Simon


    Nonproteolytic ubiquitylation of chromatin surrounding deoxyribonucleic acid (DNA) double-strand breaks (DSBs) by the RNF8/RNF168/HERC2 ubiquitin ligases facilitates restoration of genome integrity by licensing chromatin to concentrate genome caretaker proteins near the lesions. In parallel, SUMOylation of so-far elusive upstream DSB regulators is also required for execution of this ubiquitin-dependent chromatin response. We show that HERC2 and RNF168 are novel DNA damage–dependent SUMOylation targets in human cells. In response to DSBs, both HERC2 and RNF168 were specifically modified with SUMO1 at DSB sites in a manner dependent on the SUMO E3 ligase PIAS4. SUMOylation of HERC2 was required for its DSB-induced association with RNF8 and for stabilizing the RNF8–Ubc13 complex. We also demonstrate that the ZZ Zinc finger in HERC2 defined a novel SUMO-specific binding module, which together with its concomitant SUMOylation and T4827 phosphorylation promoted binding to RNF8. Our findings provide novel insight into the regulatory complexity of how ubiquitylation and SUMOylation cooperate to orchestrate protein interactions with DSB repair foci. PMID:22508508

  11. Roux-En Y Gastric Bypass Surgery Induces Genome-Wide Promoter-Specific Changes in DNA Methylation in Whole Blood of Obese Patients

    PubMed Central

    Nilsson, Emil K.; Ernst, Barbara; Voisin, Sarah; Almén, Markus Sällman; Benedict, Christian; Mwinyi, Jessica; Fredriksson, Robert; Schultes, Bernd; Schiöth, Helgi B.


    Context DNA methylation has been proposed to play a critical role in many cellular and biological processes. Objective To examine the influence of Roux-en-Y gastric bypass (RYGB) surgery on genome-wide promoter-specific DNA methylation in obese patients. Promoters are involved in the initiation and regulation of gene transcription. Methods Promoter-specific DNA methylation in whole blood was measured in 11 obese patients (presurgery BMI >35 kg/m2, 4 females), both before and 6 months after RYGB surgery, as well as once only in a control group of 16 normal-weight men. In addition, body weight and fasting plasma glucose were measured after an overnight fast. Results The mean genome-wide distance between promoter-specific DNA methylation of obese patients at six months after RYGB surgery and controls was shorter, as compared to that at baseline (p<0.001). Moreover, postsurgically, the DNA methylation of 51 promoters was significantly different from corresponding values that had been measured at baseline (28 upregulated and 23 downregulated, P<0.05 for all promoters, Bonferroni corrected). Among these promoters, an enrichment for genes involved in metabolic processes was found (n = 36, P<0.05). In addition, the mean DNA methylation of these 51 promoters was more similar after surgery to that of controls, than it had been at baseline (P<0.0001). When controlling for the RYGB surgery-induced drop in weight (-24% of respective baseline value) and fasting plasma glucose concentration (-16% of respective baseline value), the DNA methylation of only one out of 51 promoters (~2%) remained significantly different between the pre-and postsurgery time points. Conclusions Epigenetic modifications are proposed to play an important role in the development of and predisposition to metabolic diseases, including type II diabetes and obesity. Thus, our findings may form the basis for further investigations to unravel the molecular effects of gastric bypass surgery. Clinical Trial

  12. Sequences within the early and late promoters of archetype JC virus restrict viral DNA replication and infectivity.


    Daniel, A M; Swenson, J J; Mayreddy, R P; Khalili, K; Frisque, R J


    Two forms of JC virus (JCV) have been isolated from its human host, an archetype found in kidney tissue and urine of nonimmunocompromised individuals and a rearranged type detected in lymphocytes and brain tissue of patients with and without progressive multifocal leukoencephalopathy. To investigate the hypothesis that alterations to the archetype transcriptional control region yield rearranged forms of the virus exhibiting new tissue tropic and pathogenic potentials, attempts were made to propagate archetype JCV in human renal and glial cell cultures. Although rearranged forms of JCV multiplied in these cells, archetype JCV failed to do so. Through the use of chimeric and mutant viral genomes, and a cell line that constitutively expresses viral T protein, we demonstrated that archetype's inactivity relative to that of rearranged forms was due to differences in the promoter-enhancer and not in the protein coding regions or origin of DNA replication. Additional analyses revealed that the absence of a large tandem duplication and the presence of a 23- and a 66-base pair sequence in the archetype transcriptional control region were responsible for this restricted lytic behavior. We discuss the possibility that deletion and duplication events within the archetype promoter-enhancer might yield more active viral variants via the loss of a negative, or the creation of a positive, transcriptional control signal(s).

  13. Protein-DNA interactions within DNase I-hypersensitive sites located downstream of the HIV-1 promoter.


    el Kharroubi, A; Verdin, E


    We have examined by in vitro footprinting a region located downstream of the human immunodeficiency virus, type 1 (HIV-1) promoter found to be hypersensitive to DNase I digestion in vivo. Recognition sites for several constitutive or inducible DNA binding factors were identified. Three AP-1 binding sites and an AP-3-like motif were situated within the R-U5 region of the long terminal repeat. A novel purine-rich motif (5'-GAAAGC-GAAAGDD-3' (D represents G, A, or T residues)), which interacts with a nuclear factor designated downstream binding factor 1 (DBF1), and two juxtaposed Sp-1 binding sites were located in the untranslated sequence immediately downstream of the 5'-long terminal repeat. Genomic footprinting of these sequence elements in the HIV-1 chronically infected cell lines revealed that the DBF1 and Sp-1 sites are occupied in vivo. Furthermore, transient transfection assays showed that point mutations in the DBF1 binding site decreased significantly the HIV-1 basal promoter activity. Taken together, these results suggest that the DBF1 play a role in the HIV-1 transcription regulation. PMID:8051074

  14. Increased Putrescine Biosynthesis through Transfer of Mouse Ornithine Decarboxylase cDNA in Carrot Promotes Somatic Embryogenesis.

    PubMed Central

    Bastola, D. R.; Minocha, S. C.


    Carrot (Daucus carota L.) cells were transformed with Agrobacterium tumefaciens strains containing 3[prime]-truncated mouse ornithine decarboxylase (ODC) cDNA under the control of a cauliflower mosaic virus 35S promoter. A neomycin phosphotransferase gene linked with a nopaline synthase promoter was used to select transformed cell lines on kanamycin. Although the nontransformed cells contained no ODC, high amounts of mouse-specific ODC activity were observed in the transformed cells. Transgenic cells showed a significant increase in the cellular content of putrescine compared to control cells. Spermidine, however, remained unaffected. Not only did the transformed cells exhibit improved somatic embryogenesis in the auxin-free medium, they also regenerated some embryos in the presence of inhibitory concentrations of 2,4-dichlorophenoxyacetic acid. These cells acquired tolerance to [alpha]-difluoromethylarginine (a potent inhibitor of arginine decarboxylase) at concentrations that inhibit growth as well as embryogenesis in nontransformed carrot cells, showing that the mouse ODC can replace the carrot arginine decarboxylase for putrescine biosynthesis in the transgenic cells. PMID:12228581

  15. DNA methylation in Cosmc promoter region and aberrantly glycosylated IgA1 associated with pediatric IgA nephropathy.


    Sun, Qiang; Zhang, Jianqian; Zhou, Nan; Liu, Xiaorong; Shen, Ying


    IgA nephropathy (IgAN) is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc) is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26), other renal diseases (n = 11) and healthy children (n = 13). B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA). The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113), but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001) or AZA (P<0.0001). Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001). The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001). After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001) with more markedly decreased Cosmc mRNA content (P<0.0001). After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001), while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001). The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated IgA1

  16. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.


    Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap


    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

  17. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants

    PubMed Central

    Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap


    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10–32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

  18. A switch between DNA polymerases δ and λ promotes error-free bypass of 8-oxo-G lesions.


    Markkanen, Enni; Castrec, Benoît; Villani, Giuseppe; Hübscher, Ulrich


    7,8-Dihydro-8-oxoguanine (8-oxo-G) is a highly abundant and mutagenic lesion. Replicative DNA polymerases (pols) are slowed down at 8-oxo-G and insert both correct cytosine (C) and incorrect adenine (A) opposite 8-oxo-G, but they preferentially extend A:8-oxo-G mispairs. Nevertheless, 8-oxo-G bypass is fairly accurate in vivo. Thus, the question how correct bypass of 8-oxo-G lesions is accomplished despite the poor extension of C:8-oxo-G base pairs by replicative pols remains unanswered. Here we show that replicative pol δ pauses in front of 8-oxo-G and displays difficulties extending from correct C:8-oxo-G in contrast to extension from incorrect A:8-oxo-G. This leads to stalling of pol δ at 8-oxo-G after incorporation of correct C. This stalling at C:8-oxo-G can be overcome by a switch from pol δ to pols λ, β, or η, all of which are able to assist pol δ in 8-oxo-G bypass by translesion synthesis (TLS). Importantly, however, only pol λ selectively catalyzes the correct TLS past 8-oxo-G, whereas pols β and η show no selectivity and even preferentially enhance incorrect TLS. The selectivity of pol λ to promote the correct bypass depends on its N-terminal domain. Furthermore, pol λ(-/-) mouse embryonic fibroblast extracts display reduced 8-oxo-G TLS. Finally, the correct bypass of 8-oxo-G in gapped plasmids in mouse embryonic fibroblasts and HeLa cells is promoted in the presence of pol λ. Our findings suggest that even though 8-oxo-G is not a blocking lesion per se, correct replication over 8-oxo-G is promoted by a pol switch between pols δ and λ. PMID:23175785

  19. Molecular cloning of a small DNA binding protein with specificity for a tissue-specific negative element within the rps1 promoter.

    PubMed Central

    Zhou, D X; Bisanz-Seyer, C; Mache, R


    A cDNA encoding a specific binding activity for the tissue-specific negative cis-element S1F binding site of spinach rps1 was isolated from a spinach cDNA expression library. This cDNA of 0.7 kb encodes an unusual small peptide of only 70 amino acids, with a basic domain which contains a nuclear localization signal and a putative DNA binding helix. This protein, named S1Fa, is highly conserved between dicotyledonous and monocotyledonous plants and may represent a novel class of DNA binding proteins. The corresponding mRNA is accumulated more in roots and in etiolated seedlings than in green leaves. This expression pattern is correlated with the tissue-specific function of the S1F binding site which represses the rps1 promoter preferentially in roots and in etiolated plants. Images PMID:7739894

  20. DNA sequence-specific recognition by the Saccharomyces cerevisiae "TATA" binding protein: promoter-dependent differences in the thermodynamics and kinetics of binding.


    Petri, V; Hsieh, M; Jamison, E; Brenowitz, M


    The equilibrium binding and association kinetics of the Saccharomyces cerevisiae TATA Binding Protein (TBP) to the E4 and Major Late promoters of adenovirus (TATATATA and TATAAAAG, respectively), have been directly compared by quantitative DNase I titration and quench-flow "footprinting". The equilibrium binding of TBP to both promoters is described by the equilibrium TBP + DNA"TATA" left and right arrow TBP-DNA"TATA". The salt dependence of TBP binding to both promoters is identical within experimental error while the temperature dependence differs significantly. The observed rate of association follows simple second-order kinetics over the TBP concentration ranges investigated. The salt and temperature dependencies of the second-order association rate constants for TBP binding the two promoters reflect the dependencies determined by equilibrium binding. The TBP-E4 promoter interaction is entropically driven at low temperature and enthalpically driven at high temperature while the TBP-Major Late promoter reaction is entropically driven over virtually the entire temperature range investigated. These data suggest that the reaction mechanisms of TBP-promoter interactions are TATA sequence-specific and provide for differential regulation of promoters as a function of environmental variables.

  1. RecQ4 promotes the conversion of the pre-initiation complex at a site-specific origin for DNA unwinding in Xenopus egg extracts.


    Sanuki, Yosuke; Kubota, Yumiko; Kanemaki, Masato T; Takahashi, Tatsuro S; Mimura, Satoru; Takisawa, Haruhiko


    Eukaryotic DNA replication is initiated through stepwise assembly of evolutionarily conserved replication proteins onto replication origins, but how the origin DNA is unwound during the assembly process remains elusive. Here, we established a site-specific origin on a plasmid DNA, using in vitro replication systems derived from Xenopus egg extracts. We found that the pre-replicative complex (pre-RC) was preferentially assembled in the vicinity of GAL4 DNA-binding sites of the plasmid, depending on the binding of Cdc6 fused with a GAL4 DNA-binding domain in Cdc6-depleted extracts. Subsequent addition of nucleoplasmic S-phase extracts to the GAL4-dependent pre-RC promoted initiation of DNA replication from the origin, and components of the pre-initiation complex (pre-IC) and the replisome were recruited to the origin concomitant with origin unwinding. In this replication system, RecQ4 is dispensable for both recruitment of Cdc45 onto the origin and stable binding of Cdc45 and GINS to the pre-RC assembled plasmid. However, both origin binding of DNA polymerase α and unwinding of DNA were diminished upon depletion of RecQ4 from the extracts. These results suggest that RecQ4 plays an important role in the conversion of pre-ICs into active replisomes requiring the unwinding of origin DNA in vertebrates.

  2. Solvent-exposed serines in the Gal4 DNA-binding domain are required for promoter occupancy and transcriptional activation in vivo.


    Jeličić, Branka; Nemet, Josipa; Traven, Ana; Sopta, Mary


    The yeast transcriptional activator Gal4 has long been the prototype for studies of eukaryotic transcription. Gal4 is phosphorylated in the DNA-binding domain (DBD); however, the molecular details and functional significance of this remain unknown. We mutagenized seven potential phosphoserines that lie on the solvent-exposed face of the DBD structure and assessed them for transcriptional activity and DNA binding in vivo. Serine to alanine mutants at positions 22, 47, and 85 show the greatest reduction in promoter occupancy and transcriptional activity at the MEL1 promoter containing a single UASGAL . Substitutions with the phosphomimetic aspartate restored DNA-binding and transcriptional activity at serines 22 and 85, suggesting that they are potential sites of Gal4 phosphorylation in vivo. In contrast, the serine to alanine mutants, except serine 22, were fully proficient for binding to the GAL1-10 promoter, containing multiple UASGAL sites, although they had a reduced ability to activate transcription. Collectively, these data show that at the GAL1-10 promoter, functions of the DBD in transcriptional activation can be uncoupled from roles in promoter binding. We suggest that the serines in the DBD mediate protein-protein contacts with the transcription machinery, leading to stabilization of Gal4 at promoters.

  3. UV-induced DNA damage promotes resistance to the biotrophic pathogen Hyaloperonospora parasitica in Arabidopsis.


    Kunz, Bernard A; Dando, Paige K; Grice, Desma M; Mohr, Peter G; Schenk, Peer M; Cahill, David M


    Plant innate immunity to pathogenic microorganisms is activated in response to recognition of extracellular or intracellular pathogen molecules by transmembrane receptors or resistance proteins, respectively. The defense signaling pathways share components with those involved in plant responses to UV radiation, which can induce expression of plant genes important for pathogen resistance. Such intriguing links suggest that UV treatment might activate resistance to pathogens in normally susceptible host plants. Here, we demonstrate that pre-inoculative UV (254 nm) irradiation of Arabidopsis (Arabidopsis thaliana) susceptible to infection by the biotrophic oomycete Hyaloperonospora parasitica, the causative agent of downy mildew, induces dose- and time-dependent resistance to the pathogen detectable up to 7 d after UV exposure. Limiting repair of UV photoproducts by postirradiation incubation in the dark, or mutational inactivation of cyclobutane pyrimidine dimer photolyase, (6-4) photoproduct photolyase, or nucleotide excision repair increased the magnitude of UV-induced pathogen resistance. In the absence of treatment with 254-nm UV, plant nucleotide excision repair mutants also defective for cyclobutane pyrimidine dimer or (6-4) photoproduct photolyase displayed resistance to H. parasitica, partially attributable to short wavelength UV-B (280-320 nm) radiation emitted by incubator lights. These results indicate UV irradiation can initiate the development of resistance to H. parasitica in plants normally susceptible to the pathogen and point to a key role for UV-induced DNA damage. They also suggest UV treatment can circumvent the requirement for recognition of H. parasitica molecules by Arabidopsis proteins to activate an immune response.

  4. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.


    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  5. Effects of temperature on excluded volume-promoted cyclization and concatemerization of cohesive-ended DNA longer than 0.04 Mb.

    PubMed Central

    Louie, D; Serwer, P


    The 0.048502 megabase (Mb), primarily double-stranded DNA of bacteriophage lambda has single-stranded, complementary termini (cohesive ends) that undergo either spontaneous intramolecular joining to form open circular DNA or spontaneous intermolecular joining to form linear, end-to-end oligomeric DNAs (concatemers); concatemers also cyclize. In the present study, the effects of polyethylene glycol (PEG) on the cyclization and concatemerization of lambda DNA are determined at temperatures that, in the absence of PEG, favor dissociation of cohesive ends. Circular and linear lambda DNA, monomeric and concatemeric, are observed by use of pulsed field agarose gel (PFG) electrophoresis. During preparation of lambda DNA for these studies, hydrodynamic shear-induced, partial dissociation of joined cohesive ends is fortuitously observed. Although joined lambda cohesive ends progressively dissociate as their temperature is raised in the buffer used here (0.1 M NaCl, 0.01 M sodium phosphate, pH 7.4, 0.001 M EDTA), when PEG is added to this buffer, raising the temperature sometimes promotes joining of cohesive ends. Conditions for promotion of primarily either cyclization or concatemerization are described. Open circular DNAs as long as a 7-mer are produced and resolved. The concentration of PEG required to promote joining of cohesive ends decreases as the molecular weight of the PEG increases. The rate of cyclization is brought, the first time, to values that are high enough to be comparable to the rate observed in vivo. For double-stranded DNA bacteriophages that have a linear replicative form of DNA (bacteriophage T7, for example), a suppression, sometimes observed here, of cyclization mimics a suppression of cyclization previously observed in vivo. The PEG, temperature effects on DNA joining are explained by both the excluded volume of PEG random coils and an increase in this excluded volume that occurs when temperature increases. Images PMID:1829160

  6. Prognostic role of APC and RASSF1A promoter methylation status in cell free circulating DNA of operable gastric cancer patients.


    Balgkouranidou, I; Matthaios, D; Karayiannakis, A; Bolanaki, H; Michailidis, P; Xenidis, N; Amarantidis, K; Chelis, L; Trypsianis, G; Chatzaki, E; Lianidou, E S; Kakolyris, S


    Gastric carcinogenesis is a multistep process including not only genetic mutations but also epigenetic alterations. The best known and more frequent epigenetic alteration is DNA methylation affecting tumor suppressor genes that may be involved in various carcinogenetic pathways. The aim of the present study was to investigate the methylation status of APC promoter 1A and RASSF1A promoter in cell free DNA of operable gastric cancer patients. Using methylation specific PCR, we examined the methylation status of APC promoter 1A and RASSF1A promoter in 73 blood samples obtained from patients with gastric cancer. APC and RASSF1A promoters were found to be methylated in 61 (83.6%) and 50 (68.5%) of the 73 gastric cancer samples examined, but in none of the healthy control samples (p < 0.001). A significant association between methylated RASSF1A promoter status and lymph node positivity was observed (p = 0.005). Additionally, a significant correlation between a methylated APC promoter and elevated CEA (p = 0.033) as well as CA-19.9 (p = 0.032) levels, was noticed. The Kaplan-Meier estimates of survival, significantly favored patients with a non-methylated APC promoter status (p = 0.008). No other significant correlations between APC and RASSF1A methylation status and different tumor variables examined was observed. Serum RASSF1A and APC promoter hypermethylation is a frequent epigenetic event in patients with early operable gastric cancer. The observed correlations between APC promoter methylation status and survival as well as between a hypermethylated RASSF1A promoter and nodal positivity may be indicative of a prognostic role for those genes in early operable gastric cancer. Additional studies, in a larger cohort of patients are required to further explore whether these findings could serve as potential molecular biomarkers of survival and/or response to specific treatments. PMID:26073472

  7. Molecular Mechanisms of Transcription Initiation at gal Promoters and their Multi-Level Regulation by GalR, CRP and DNA Loop

    PubMed Central

    Lewis, Dale E.A.; Adhya, Sankar


    Studying the regulation of transcription of the gal operon that encodes the amphibolic pathway of d-galactose metabolism in Escherichia coli discerned a plethora of principles that operate in prokaryotic gene regulatory processes. In this chapter, we have reviewed some of the more recent findings in gal that continues to reveal unexpected but important mechanistic details. Since the operon is transcribed from two overlapping promoters, P1 and P2, regulated by common regulatory factors, each genetic or biochemical experiment allowed simultaneous discernment of two promoters. Recent studies range from genetic, biochemical through biophysical experiments providing explanations at physiological, mechanistic and single molecule levels. The salient observations highlighted here are: the axiom of determining transcription start points, discovery of a new promoter element different from the known ones that influences promoter strength, occurrence of an intrinsic DNA sequence element that overrides the transcription elongation pause created by a DNA-bound protein roadblock, first observation of a DNA loop and determination its trajectory, and piggybacking proteins and delivering to their DNA target. PMID:26501343

  8. Uranyl mediated photofootprinting reveals strong E. coli RNA polymerase--DNA backbone contacts in the +10 region of the DeoP1 promoter open complex.

    PubMed Central

    Jeppesen, C; Nielsen, P E


    Employing a newly developed uranyl photofootprinting technique (Nielsen et al. (1988) FEBS Lett. 235, 122), we have analyzed the structure of the E. coli RNA polymerase deoP1 promoter open complex. The results show strong polymerase DNA backbone contacts in the -40, -10, and most notably in the +10 region. These results suggest that unwinding of the -12 to +3 region of the promoter in the open complex is mediated through polymerase DNA backbone contacts on both sides of this region. The pattern of bases that are hyperreactive towards KMnO4 or uranyl within the -12 to +3 region furthermore argues against a model in which this region is simply unwound and/or single stranded. The results indicate specific protein contacts and/or a fixed DNA conformation within the -12 to +3 region. Images PMID:2503811

  9. NuMA promotes homologous recombination repair by regulating the accumulation of the ISWI ATPase SNF2h at DNA breaks

    PubMed Central

    Vidi, Pierre-Alexandre; Liu, Jing; Salles, Daniela; Jayaraman, Swaathi; Dorfman, George; Gray, Matthew; Abad, Patricia; Moghe, Prabhas V.; Irudayaraj, Joseph M.; Wiesmüller, Lisa; Lelièvre, Sophie A.


    Chromatin remodeling factors play an active role in the DNA damage response by shaping chromatin to facilitate the repair process. The spatiotemporal regulation of these factors is key to their function, yet poorly understood. We report that the structural nuclear protein NuMA accumulates at sites of DNA damage in a poly[ADP-ribose]ylation-dependent manner and functionally interacts with the ISWI ATPase SNF2h/SMARCA5, a chromatin remodeler that facilitates DNA repair. NuMA coimmunoprecipitates with SNF2h, regulates its diffusion in the nucleoplasm and controls its accumulation at DNA breaks. Consistent with NuMA enabling SNF2h function, cells with silenced NuMA exhibit reduced chromatin decompaction after DNA cleavage, lesser focal recruitment of homologous recombination repair factors, impaired DNA double-strand break repair in chromosomal (but not in episomal) contexts and increased sensitivity to DNA cross-linking agents. These findings reveal a structural basis for the orchestration of chromatin remodeling whereby a scaffold protein promotes genome maintenance by directing a remodeler to DNA breaks. PMID:24753406

  10. The Z-DNA motif d(TG)30 promotes reception of information during gene conversion events while stimulating homologous recombination in human cells in culture.


    Wahls, W P; Wallace, L J; Moore, P D


    Tracts of the alternating dinucleotide polydeoxythymidylic-guanylic [d(TG)].polydeoxyadenylic-cytidylic acid [d(AC)], present throughout the human genome, are capable of readily forming left-handed Z-DNA in vitro. We have analyzed the effects of the Z-DNA motif d(TG)30 upon homologous recombination between two nonreplicating plasmid substrates cotransfected into human cells in culture. In this study, the sequence d(TG)30 is shown to stimulate homologous recombination up to 20-fold. Enhancement is specific to the Z-DNA motif; a control DNA fragment of similar size does not alter the recombination frequency. The stimulation of recombination is observed at a distance (237 to 1,269 base pairs away from the Z-DNA motif) and involves both gene conversion and reciprocal exchange events. Maximum stimulation is observed when the sequence is present in both substrates, but it is capable of stimulating when present in only one substrate. Analysis of recombination products indicates that the Z-DNA motif increases the frequency and alters the distribution of multiple, unselected recombination events. Specifically designed crosses indicate that the substrate containing the Z-DNA motif preferentially acts as the recipient of genetic information during gene conversion events. Models describing how left-handed Z-DNA sequences might promote the initiation of homologous recombination are presented. PMID:2405255

  11. Structure of the Trichomonas vaginalis Myb3 DNA-binding domain bound to a promoter sequence reveals a unique C-terminal β-hairpin conformation.


    Wei, Shu-Yi; Lou, Yuan-Chao; Tsai, Jia-Yin; Ho, Meng-Ru; Chou, Chun-Chi; Rajasekaran, M; Hsu, Hong-Ming; Tai, Jung-Hsiang; Hsiao, Chwan-Deng; Chen, Chinpan


    Trichomonas vaginalis Myb3 transcription factor (tvMyb3) recognizes the MRE-1 promoter sequence and regulates ap65-1 gene, which encodes a hydrogenosomal malic enzyme that may play a role in the cytoadherence of the parasite. Here, we identified tvMyb3(53-180) as the essential fragment for DNA recognition and report the crystal structure of tvMyb3(53-180) bound to MRE-1 DNA. The N-terminal fragment adopts the classical conformation of an Myb DNA-binding domain, with the third helices of R2 and R3 motifs intercalating in the major groove of DNA. The C-terminal extension forms a β-hairpin followed by a flexible tail, which is stabilized by several interactions with the R3 motif and is not observed in other Myb proteins. Interestingly, this unique C-terminal fragment does not stably connect with DNA in the complex structure but is involved in DNA binding, as demonstrated by NMR chemical shift perturbation, (1)H-(15)N heteronuclear-nuclear Overhauser effect and intermolecular paramagnetic relaxation enhancement. Site-directed mutagenesis also revealed that this C-terminal fragment is crucial for DNA binding, especially the residue Arg(153) and the fragment K(170)KRK(173). We provide a structural basis for MRE-1 DNA recognition and suggest a possible post-translational regulation of tvMyb3 protein. PMID:21908401

  12. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao


    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  13. T-13910 DNA variant associated with lactase persistence interacts with Oct-1 and stimulates lactase promoter activity in vitro.


    Lewinsky, Rikke H; Jensen, Tine G K; Møller, Jette; Stensballe, Allan; Olsen, Jørgen; Troelsen, Jesper T


    Two phenotypes exist in the human population with regard to expression of lactase in adults. Lactase non-persistence (adult-type hypolactasia and lactose intolerance) is characterized by a decline in the expression of lactase-phlorizin hydrolase (LPH) after weaning. In contrast, lactase-persistent individuals have a high LPH throughout their lifespan. Lactase persistence and non-persistence are associated with a T/C polymorphism at position -13,910 upstream the lactase gene. A nuclear factor binds more strongly to the T-13,910 variant associated with lactase persistence than the C-13,910 variant associated with lactase non-persistence. Oct-1 and glyceraldehyde-3-phosphate dehydrogenase were co-purified by DNA affinity purification using the sequence of the T-13,910 variant. Supershift analyses show that Oct-1 binds directly to the T-13,910 variant, and we suggest that GAPDH is co-purified due to interactions with Oct-1. Expression of Oct-1 stimulates reporter gene expression from the T and the C-13,910 variant/LPH promoter constructs only when it is co-expressed with HNF1alpha. Binding sites for other intestinal transcription factors (GATA-6, HNF4alpha, Fox and Cdx-2) were identified in the region of the -13,910 T/C polymorphism. Three of these sites are required for the enhancer activity of the -13,910 region. The data suggest that the binding of Oct-1 to the T-13,910 variant directs increased lactase promoter activity and this might provide an explanation for the lactase persistence phenotype in the human population.

  14. An analysis of the binding of repressor protein ModE to modABCD (molybdate transport) operator/promoter DNA of Escherichia coli.


    Grunden, A M; Self, W T; Villain, M; Blalock, J E; Shanmugam, K T


    Expression of the modABCD operon in Escherichia coli, which codes for a molybdate-specific transporter, is repressed by ModE in vivo in a molybdate-dependent fashion. In vitro DNase I-footprinting experiments identified three distinct regions of protection by ModE-molybdate on the modA operator/promoter DNA, GTTATATT (-15 to -8; region 1), GCCTACAT (-4 to +4; region 2), and GTTACAT (+8 to +14; region 3). Within the three regions of the protected DNA, a pentamer sequence, TAYAT (Y = C or T), can be identified. DNA-electrophoretic mobility experiments showed that the protected regions 1 and 2 are essential for binding of ModE-molybdate to DNA, whereas the protected region 3 increases the affinity of the DNA to the repressor. The stoichiometry of this interaction was found to be two ModE-molybdate per modA operator DNA. ModE-molybdate at 5 nM completely protected the modABCD operator/promoter DNA from DNase I-catalyzed hydrolysis, whereas ModE alone failed to protect the DNA even at 100 nM. The apparent K(d) for the interaction between the modA operator DNA and ModE-molybdate was 0.3 nM, and the K(d) increased to 8 nM in the absence of molybdate. Among the various oxyanions tested, only tungstate replaced molybdate in the repression of modA by ModE, but the affinity of ModE-tungstate for modABCD operator DNA was 6 times lower than with ModE-molybdate. A mutant ModE(T125I) protein, which repressed modA-lac even in the absence of molybdate, protected the same region of modA operator DNA in the absence of molybdate. The apparent K(d) for the interaction between modA operator DNA and ModE(T125I) was 3 nM in the presence of molybdate and 4 nM without molybdate. The binding of molybdate to ModE resulted in a decrease in fluorescence emission, indicating a conformational change of the protein upon molybdate binding. The fluorescence emission spectra of mutant ModE proteins, ModE(T125I) and ModE(Q216*), were unaffected by molybdate. The molybdate-independent mutant Mod

  15. Effects of parturition and dexamethasone on DNA methylation patterns of IFN-γ and IL-4 promoters in CD4+ T-lymphocytes of Holstein dairy cows.


    Paibomesai, Marlene; Hussey, Brendan; Nino-Soto, Maria; Mallard, Bonnie A


    This study investigated epigenetic mechanisms by which DNA methylation affects the function of bovine adaptive immune system cells, particularly during the peripartum period, when shifts in type 1 and type 2 immune response (IR) biases are thought to occur. Stimulation of CD4+ T-lymphocytes isolated from 5 Holstein dairy cows before and after parturition with concanavalin A (ConA) and stimulation of CD4+ T-lymphocytes isolated from 3 Holstein dairy cows in mid-lactation with ConA alone or ConA plus dexamethasone (Dex) had significant effects on production of the cytokines interferon gamma (IFN-γ, type 1) and interleukin 4 (IL-4, type 2) that were consistent with DNA methylation profiles of the IFN-γ gene promoter region but not consistent for the IL-4 promoter region. ConA stimulation increased the production of both cytokines before and after parturition. It decreased DNA methylation in the IFN-γ promoter region but increased for IL-4 promoter region. Parturition was associated with an increase in IFN-γ production in ConA-stimulated cells that approached significance. Overall, DNA methylation in both promoter regions increased between the prepartum and postpartum periods, although this did not correlate with secreted cytokine concentrations. Dexamethasone treated cells acted in a manner consistent with the glucocorticoid's immunosuppressive activity, which mimicked the change at the IFN-γ promoter region observed during parturition. These results support pregnancy as type 2 IR biased, with increases of IFN-γ occurring after parturition and an increase in IL-4 production before calving. It is likely that these changes may be epigenetically controlled.

  16. Effects of parturition and dexamethasone on DNA methylation patterns of IFN-γ and IL-4 promoters in CD4+ T-lymphocytes of Holstein dairy cows

    PubMed Central

    Paibomesai, Marlene; Hussey, Brendan; Nino-Soto, Maria; Mallard, Bonnie A.


    This study investigated epigenetic mechanisms by which DNA methylation affects the function of bovine adaptive immune system cells, particularly during the peripartum period, when shifts in type 1 and type 2 immune response (IR) biases are thought to occur. Stimulation of CD4+ T-lymphocytes isolated from 5 Holstein dairy cows before and after parturition with concanavalin A (ConA) and stimulation of CD4+ T-lymphocytes isolated from 3 Holstein dairy cows in mid-lactation with ConA alone or ConA plus dexamethasone (Dex) had significant effects on production of the cytokines interferon gamma (IFN-γ, type 1) and interleukin 4 (IL-4, type 2) that were consistent with DNA methylation profiles of the IFN-γ gene promoter region but not consistent for the IL-4 promoter region. ConA stimulation increased the production of both cytokines before and after parturition. It decreased DNA methylation in the IFN-γ promoter region but increased for IL-4 promoter region. Parturition was associated with an increase in IFN-γ production in ConA-stimulated cells that approached significance. Overall, DNA methylation in both promoter regions increased between the prepartum and postpartum periods, although this did not correlate with secreted cytokine concentrations. Dexamethasone treated cells acted in a manner consistent with the glucocorticoid’s immunosuppressive activity, which mimicked the change at the IFN-γ promoter region observed during parturition. These results support pregnancy as type 2 IR biased, with increases of IFN-γ occurring after parturition and an increase in IL-4 production before calving. It is likely that these changes may be epigenetically controlled. PMID:23814356

  17. Sae2 promotes DNA damage resistance by removing the Mre11–Rad50–Xrs2 complex from DNA and attenuating Rad53 signaling

    PubMed Central

    Chen, Huan; Donnianni, Roberto A.; Handa, Naofumi; Deng, Sarah K.; Oh, Julyun; Timashev, Leonid A.; Kowalczykowski, Stephen C.; Symington, Lorraine S.


    The Mre11–Rad50–Xrs2/NBS1 (MRX/N) nuclease/ATPase complex plays structural and catalytic roles in the repair of DNA double-strand breaks (DSBs) and is the DNA damage sensor for Tel1/ATM kinase activation. Saccharomyces cerevisiae Sae2 can function with MRX to initiate 5′-3′ end resection and also plays an important role in attenuation of DNA damage signaling. Here we describe a class of mre11 alleles that suppresses the DNA damage sensitivity of sae2Δ cells by accelerating turnover of Mre11 at DNA ends, shutting off the DNA damage checkpoint and allowing cell cycle progression. The mre11 alleles do not suppress the end resection or hairpin-opening defects of the sae2Δ mutant, indicating that these functions of Sae2 are not responsible for DNA damage resistance. The purified MP110LRX complex shows reduced binding to single- and double-stranded DNA in vitro relative to wild-type MRX, consistent with the increased turnover of Mre11 from damaged sites in vivo. Furthermore, overproduction of Mre11 causes DNA damage sensitivity only in the absence of Sae2. Together, these data suggest that it is the failure to remove Mre11 from DNA ends and attenuate Rad53 kinase signaling that causes hypersensitivity of sae2Δ cells to clastogens. PMID:25831494

  18. Fe2+ promoted peroxidation of 1,2-diacyl-sn-glycero-3-phosphocholine liposomes in the presence of calf thymus DNA.


    Bruni, Paolo; Pisani, Michela; Iacussi, Marco; Francescangeli, Oriano


    The peroxidation reaction of some liposomes, namely egg yolk phosphatidylcholine (PC), dioleoyl- (DOPC) and dilinoleoyl- (DLPC) phosphocholines, promoted by ferrous ions (Fenton reaction) has been studied at the physiological pH value, in the absence and in the presence of calf thymus DNA. A catalytic effect of DNA, where the lag time reduces or is completely annihilated, together with an increase in both the yields and the rates of the reactions, has been observed. This effect of DNA has been attributed to the ability of the three components, liposomes, DNA and Fe2+, to form a stable ternary complex, which produces a reduction of the undulatory fluctuations of the hydrocarbon tails of liposomes and strengthens the packing between the acyl chains in the lipid bilayers, with the consequence of enhancing the liposome crystallinity. PMID:16172690

  19. The presence of an RNA:DNA hybrid that is prone to slippage promotes termination by T7 RNA polymerase.


    Molodtsov, Vadim; Anikin, Michael; McAllister, William T


    Intrinsic termination signals for multisubunit bacterial RNA polymerases (RNAPs) encode a GC-rich stem-loop structure followed by a polyuridine [poly(U)] tract, and it has been proposed that steric clash of the stem-loop with the exit pore of the RNAP imposes a shearing force on the RNA in the downstream RNA:DNA hybrid, resulting in misalignment of the active site. The structurally unrelated T7 RNAP terminates at a similar type of signal (TΦ), suggesting a common mechanism for termination. In the absence of a hairpin (passive conditions), T7 RNAP slips efficiently in both homopolymeric A and U tracts, and we have found that replacement of the U tract in TΦ with a slippage-prone A tract still allows efficient termination. Under passive conditions, incorporation of a single G residue following a poly(U) tract (which is the situation during termination at TΦ) results in a "locked" complex that is unable to extend the transcript. Our results support a model in which transmission of the shearing force generated by steric clash of the hairpin with the exit pore is promoted by the presence of a slippery tracts downstream, resulting in alterations in the active site and the formation of a locked complex that represents an early step in the termination pathway. PMID:24976131

  20. SWI/SNF and Asf1 independently promote derepression of the DNA damage response genes under conditions of replication stress.


    Minard, Laura V; Lin, Ling-ju; Schultz, Michael C


    The histone chaperone Asf1 and the chromatin remodeler SWI/SNF have been separately implicated in derepression of the DNA damage response (DDR) genes in yeast cells treated with genotoxins that cause replication interference. Using genetic and biochemical approaches, we have tested if derepression of the DDR genes in budding yeast involves functional interplay between Asf1 and SWI/SNF. We find that Asf1 and SWI/SNF are both recruited to DDR genes under replication stress triggered by hydroxyurea, and have detected a soluble complex that contains Asf1 and the Snf2 subunit of SWI/SNF. SWI/SNF recruitment to DDR genes however does not require Asf1, and deletion of Snf2 does not affect Asf1 occupancy of DDR gene promoters. A checkpoint engagement defect is sufficient to explain the synthetic effect of deletion of ASF1 and SNF2 on derepression of the DDR genes in hydroxyurea-treated cells. Collectively, our results show that the DDR genes fall into a class in which Asf1 and SWI/SNF independently control transcriptional induction.

  1. Checkpoint Kinase ATR Promotes Nucleotide Excision Repair of UV-induced DNA Damage via Physical Interaction with Xeroderma Pigmentosum Group A*

    PubMed Central

    Shell, Steven M.; Li, Zhengke; Shkriabai, Nikolozi; Kvaratskhelia, Mamuka; Brosey, Chris; Serrano, Moises A.; Chazin, Walter J.; Musich, Phillip R.; Zou, Yue


    In response to DNA damage, eukaryotic cells activate a series of DNA damage-dependent pathways that serve to arrest cell cycle progression and remove DNA damage. Coordination of cell cycle arrest and damage repair is critical for maintenance of genomic stability. However, this process is still poorly understood. Nucleotide excision repair (NER) and the ATR-dependent cell cycle checkpoint are the major pathways responsible for repair of UV-induced DNA damage. Here we show that ATR physically interacts with the NER factor Xeroderma pigmentosum group A (XPA). Using a mass spectrometry-based protein footprinting method, we found that ATR interacts with a helix-turn-helix motif in the minimal DNA-binding domain of XPA where an ATR phosphorylation site (serine 196) is located. XPA-deficient cells complemented with XPA containing a point mutation of S196A displayed a reduced repair efficiency of cyclobutane pyrimidine dimers as compared with cells complemented with wild-type XPA, although no effect was observed for repair of (6-4) photoproducts. This suggests that the ATR-dependent phosphorylation of XPA may promote NER repair of persistent DNA damage. In addition, a K188A point mutation of XPA that disrupts the ATR-XPA interaction inhibits the nuclear import of XPA after UV irradiation and, thus, significantly reduced DNA repair efficiency. By contrast, the S196A mutation has no effect on XPA nuclear translocation. Taken together, our results suggest that the ATR-XPA interaction mediated by the helix-turn-helix motif of XPA plays an important role in DNA-damage responses to promote cell survival and genomic stability after UV irradiation. PMID:19586908

  2. A DNA-binding factor, ArfA, interacts with the bldH promoter and affects undecylprodigiosin production in Streptomyces lividans.


    Xu, Delin; Kim, Tae-Jong; Park, Zee-Yong; Lee, Sung-Kwon; Yang, Seung Hwan; Kwon, Hyung-Jin; Suh, Joo-Won


    The fact that adpA promoter activity is enhanced by S-adenosylmethionine without the involvement of the A-factor/ArpA regulatory cascade suggests the existence of additional transcriptional regulators for adpA expression in Streptomyces griseus. In this study, an additional adpA promoter regulatory protein, named ArfA, that is conserved among many bacteria was identified using DNA affinity purification from the cell extracts of Streptomyces lividans. The interactions of ArfA with the adpA promoter from S. griseus and with the bldH promoter from S. lividans were specific and both adpA and bldH promoters required ArfA for the wild-type level of their expressions in S. lividans. bldH of S. lividans is a homolog of adpA of S. lividans. ArfA-deletion mutant had only 70% of the normal undecylprodigiosin production. This result was confirmed by reduced redD promoter activity in the ArfA-deletion mutant. These results suggest that ArfA is a new type of DNA-binding regulator.

  3. DNA Methylation of the Gonadal Aromatase (cyp19a) Promoter Is Involved in Temperature-Dependent Sex Ratio Shifts in the European Sea Bass

    PubMed Central

    Navarro-Martín, Laia; Viñas, Jordi; Ribas, Laia; Díaz, Noelia; Gutiérrez, Arantxa; Di Croce, Luciano; Piferrer, Francesc


    Sex ratio shifts in response to temperature are common in fish and reptiles. However, the mechanism linking temperature during early development and sex ratios has remained elusive. We show in the European sea bass (sb), a fish in which temperature effects on sex ratios are maximal before the gonads form, that juvenile males have double the DNA methylation levels of females in the promoter of gonadal aromatase (cyp19a), the enzyme that converts androgens into estrogens. Exposure to high temperature increased the cyp19a promoter methylation levels of females, indicating that induced-masculinization involves DNA methylation-mediated control of aromatase gene expression, with an observed inverse relationship between methylation levels and expression. Although different CpGs within the sb cyp19a promoter exhibited different sensitivity to temperature, we show that the increased methylation of the sb cyp19a promoter, which occurs in the gonads but not in the brain, is not a generalized effect of temperature. Importantly, these effects were also observed in sexually undifferentiated fish and were not altered by estrogen treatment. Thus, methylation of the sb cyp19a promoter is the cause of the lower expression of cyp19a in temperature-masculinized fish. In vitro, induced methylation of the sb cyp19a promoter suppressed the ability of SF-1 and Foxl2 to stimulate transcription. Finally, a CpG differentially methylated by temperature and adjacent to a Sox transcription factor binding site is conserved across species. Thus, DNA methylation of the aromatase promoter may be an essential component of the long-sought-after mechanism connecting environmental temperature and sex ratios in vertebrate species with temperature-dependent sex determination. PMID:22242011

  4. The acidic C-terminus of vaccinia virus I3 single-strand binding protein promotes proper assembly of DNA-protein complexes.


    Harrison, Melissa L; Desaulniers, Megan A; Noyce, Ryan S; Evans, David H


    The vaccinia virus I3L gene encodes a single-stranded DNA binding protein (SSB) that is essential for virus DNA replication and is conserved in all Chordopoxviruses. The I3 protein contains a negatively charged C-terminal tail that is a common feature of SSBs. Such acidic tails are critical for SSB-dependent replication, recombination and repair. We cloned and purified variants of the I3 protein, along with a homolog from molluscum contagiosum virus, and tested how the acidic tail affected DNA-protein interactions. Deleting the C terminus of I3 enhanced the affinity for single-stranded DNA cellulose and gel shift analyses showed that it also altered the migration of I3-DNA complexes in agarose gels. Microinjecting an antibody against I3 into vaccinia-infected cells also selectively inhibited virus replication. We suggest that this domain promotes cooperative binding of I3 to DNA in a way that would maintain an open DNA configuration around a replication site.

  5. An A-tract at the AtzR binding site assists DNA binding, inducer-dependent repositioning and transcriptional activation of the PatzDEF promoter.


    Porrúa, Odil; López-Sánchez, Aroa; Platero, Ana I; Santero, Eduardo; Shingler, Victoria; Govantes, Fernando


    The LysR-type regulator AtzR activates the Pseudomonas sp. ADP atzDEF operon in response to nitrogen limitation and cyanuric acid. Activation involves repositioning of the AtzR tetramer on the PatzDEF promoter and relaxation of an AtzR-induced DNA bend. Here we examine the in vivo and in vitro contribution of an A5 -tract present at the PatzDEF promoter region to AtzR binding and transcriptional activation. Substitution of the A-tract for the sequence ACTCA prevented PatzDEF activation and high-affinity AtzR binding, impaired AtzR contacts with the activator binding site and shifted the position of the AtzR-induced DNA bend. Analysis of a collection of mutants bearing different alterations in the A-tract sequence showed that the extent of AtzR-dependent activation does not correlate with the magnitude or orientation of the spontaneous DNA bend generated at this site. Our results support the notion that indirect readout of the A-tract-associated narrow minor groove is essential for the AtzR-DNA complex to achieve a conformation competent for activation of the PatzDEF promoter. Conservation of this motif in several binding sites of LysR-type regulators suggests that this mechanism may be shared by other proteins in this family.

  6. An RNA polymerase II transcription factor has an associated DNA-dependent ATPase (dATPase) activity strongly stimulated by the TATA region of promoters.

    PubMed Central

    Conaway, R C; Conaway, J W


    A transcription factor required for synthesis of accurately initiated run-off transcripts by RNA polymerase II has been purified and shown to have an associated DNA-dependent ATPase (dATPase) activity that is strongly stimulated by the TATA region of promoters. This transcription factor, designated delta, was purified more than 3000-fold from extracts of crude rat liver nuclei and has a native molecular mass of approximately 230 kDa. DNA-dependent ATPase (dATPase) and transcription activities copurify when delta is analyzed by hydrophobic interaction and ion-exchange HPLC, arguing that transcription factor delta possesses an ATPase (dATPase) activity. ATPase (dATPase) is specific for adenine nucleotides; ATP and dATP, but not CTP, UTP, or GTP, are hydrolyzed. ATPase (dATPase) is stimulated by both double-stranded and single-stranded DNAs, including pUC18, ssM13, and poly(dT); however, DNA fragments containing the TATA region of either the adenovirus 2 major late or mouse interleukin 3 promoters stimulate ATPase as much as 10-fold more effectively than DNA fragments containing nonpromoter sequences. These data suggest the intriguing possibility that delta plays a critical role in the ATP (dATP)-dependent activation of run-off transcription through a direct interaction with the TATA region of promoters. Images PMID:2552440

  7. 3-Methylcholanthrene elicits DNA adduct formation in the CYP1A1 promoter region and attenuates reporter gene expression in rat H4IIE cells

    SciTech Connect

    Moorthy, Bhagavatula . E-mail:; Muthiah, Kathirvel; Fazili, Inayat S.; Kondraganti, Sudha R.; Wang Lihua; Couroucli, Xanthi I.; Jiang Weiwu


    Cytochrome CYP1A (CYP1A) enzymes catalyze bioactivation of 3-methylcholanthrene (MC) to genotoxic metabolites. Here, we tested the hypothesis that CYP1A2 catalyzes formation of MC-DNA adducts that are preferentially formed in the promoter region of CYP1A1, resulting in modulation of CYP1A1 gene expression. MC bound covalently to plasmid DNA (50 {mu}g) containing human CYP1A1 promoter (pGL3-1A1), when incubated with wild-type (WT) liver microsomes (2 mg) and NAPPH 37 {sup o}C for 2 h, giving rise to 9 adducts, as determined by {sup 32}P-postlabeling. Eighty percent of adducts was located in the promoter region. Transient transfection of the adducted plasmids into rat hepatoma (H4IIE) cells for 16 h, followed by MC (1 {mu}M) treatment for 24 h inhibited reporter (luciferase) gene expression by 75%, compared to unadducted controls. Our results suggest that CYP1A2 plays a key role in sequence-specific MC-DNA adduct formation in the CYP1A1 promoter region, leading to attenuation of CYP1A1 gene expression.

  8. In vitro transcription directed from the somatostatin promoter is dependent upon a purified 43-kDa DNA-binding protein.

    PubMed Central

    Andrisani, O M; Zhu, Z N; Pot, D A; Dixon, J E


    In vitro transcription analyses were used to establish the biological function of a 43-kDa affinity-purified DNA-binding protein. The 43-kDa affinity-purified protein protects the region from position -59 to position -35 of the somatostatin promoter from DNase I digestion. This region of the somatostatin promoter harbors the TGACGTCA motif, also found and required for function in a number of other cAMP-responsive and adenovirus E1A-inducible promoters. Efficient and authentic transcription in vitro directed from the somatostatin promoter requires the TGACGTCA promoter element. In vitro transcription assays performed in the presence of somatostatin (positions -60 to -29), enkephalin (positions -105 to -71), and adenovirus type 5 E3 gene (positions -72 to -42) competitor fragments, harboring similar TGACGTCA motifs, selectively inhibit transcription directed from the somatostatin promoter, suggesting that the TGACGTCA element is the site of interaction of a somatostatin gene transactivator. Furthermore, extracts depleted of the TGACGTCA-binding activities by affinity chromatography utilizing a biotinylated oligonucleotide-avidin resin, are incapable of directing transcription from the somatostatin but not from the adenovirus major late promoter. Addition of the purified 43-kDa protein to the affinity-depleted extract restores transcription from the somatostatin promoter. These results are consistent with the 43-kDa protein being a trans-activator of the somatostatin gene. Images PMID:2564679

  9. Transcription from the second heavy-strand promoter of human mtDNA is repressed by transcription factor A in vitro.


    Lodeiro, Maria F; Uchida, Akira; Bestwick, Megan; Moustafa, Ibrahim M; Arnold, Jamie J; Shadel, Gerald S; Cameron, Craig E


    Cell-based studies support the existence of two promoters on the heavy strand of mtDNA: heavy-strand promoter 1 (HSP1) and HSP2. However, transcription from HSP2 has been reported only once in a cell-free system, and never when recombinant proteins have been used. Here, we document transcription from HSP2 using an in vitro system of defined composition. An oligonucleotide template representing positions 596-685 of mtDNA was sufficient to observe transcription by the human mtRNA polymerase (POLRMT) that was absolutely dependent on mitochondrial transcription factor B2 (TFB2M). POLRMT/TFB2M-dependent transcription was inhibited by concentrations of mitochondrial transcription factor A (TFAM) stoichiometric with the transcription template, a condition that activates transcription from the light-strand promoter (LSP) in vitro. Domains of TFAM required for LSP activation were also required for HSP2 repression, whereas other mtDNA binding proteins failed to alter transcriptional output. Binding sites for TFAM were located on both sides of the start site of transcription from HSP2, suggesting that TFAM binding interferes with POLRMT and/or TFB2M binding. Consistent with a competitive binding model for TFAM repression of HSP2, the impact of TFAM concentration on HSP2 transcription was diminished by elevating the POLRMT and TFB2M concentrations. In the context of our previous studies of LSP and HSP1, it is now clear that three promoters exist in human mtDNA. Each promoter has a unique requirement for and/or response to the level of TFAM present, thus implying far greater complexity in the regulation of mammalian mitochondrial transcription than recognized to date.

  10. The main early and late promoters of Bacillus subtilis phage phi 29 form unstable open complexes with sigma A-RNA polymerase that are stabilized by DNA supercoiling.


    Rojo, F; Nuez, B; Mencía, M; Salas, M


    Most Escherichia coli promoters studied so far form stable open complexes with sigma 70-RNA polymerase which have relatively long half-lives and, therefore, are resistant to a competitor challenge. A few exceptions are nevertheless known. The analysis of a number of promoters in Bacillus subtilis has suggested that the instability of open complexes formed by the vegetative sigma A-RNA polymerase may be a more general phenomenon than in Escherichia coli. We show that the main early and late promoters from the Bacillus subtilis phage phi 29 form unstable open complexes that are stabilized either by the formation of the first phosphodiester bond between the initiating nucleoside triphosphates or by DNA supercoiling. The functional characteristics of these two strong promoters suggest that they are not optimized for a tight and stable RNA polymerase binding. Their high activity is probably the consequence of the efficiency of further steps leading to the formation of an elongation complex.

  11. MMS exposure promotes increased MtDNA mutagenesis in the presence of replication-defective disease-associated DNA polymerase γ variants.


    Stumpf, Jeffrey D; Copeland, William C


    Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but

  12. Promoter methylation status of tumor suppressor genes and inhibition of expression of DNA methyltransferase 1 in non-small cell lung cancer.


    Liu, Bangqing; Song, Jianfei; Luan, Jiaqiang; Sun, Xiaolin; Bai, Jian; Wang, Haiyong; Li, Angui; Zhang, Lifei; Feng, Xiaoyan; Du, Zhenzong


    DNA methylation is an epigenetic DNA modification catalyzed by DNA methyltransferase 1 (DNMT1). The purpose of this study was to investigate DNMT1 gene and protein expression and the effects of methylation status on tumor suppressor genes in human non-small cell lung cancer (NSCLC) cell lines grown in vitro and in vivo Human lung adenocarcinoma cell lines, A549 and H838, were grown in vitro and inoculated subcutaneously into nude mice to form tumors and were then treated with the DNA methylation inhibitor, 5-aza-2'-deoxycytidine, with and without treatment with the benzamide histone deacetylase inhibitor, entinostat (MS-275). DNMT1 protein expression was quantified by Western blot. Promoter methylation status of tumor suppressor genes (RASSF1A, ASC, APC, MGMT, CDH13, DAPK, ECAD, P16, and GATA4) was evaluated by methylation-specific polymerase chain reaction. Methylation status of the tumor suppressor genes was regulated by the DNMT1 gene, with the decrease of DNMT1 expression following DNA methylation treatment. Demethylation of tumor suppressor genes (APC, ASC, and RASSF1A) restored tumor growth in nude mice. The results of this study support a role for methylation of DNA as a potential epigenetic clinical biomarker of prognosis or response to therapy and for DNMT1 as a potential therapeutic target in NSCLC. PMID:27190263

  13. The β2 clamp in the Mycobacterium tuberculosis DNA polymerase III αβ2ε replicase promotes polymerization and reduces exonuclease activity

    PubMed Central

    Gu, Shoujin; Li, Wenjuan; Zhang, Hongtai; Fleming, Joy; Yang, Weiqiang; Wang, Shihua; Wei, Wenjing; Zhou, Jie; Zhu, Guofeng; Deng, Jiaoyu; Hou, Jian; Zhou, Ying; Lin, Shiqiang; Zhang, Xian-En; Bi, Lijun


    DNA polymerase III (DNA pol III) is a multi-subunit replication machine responsible for the accurate and rapid replication of bacterial genomes, however, how it functions in Mycobacterium tuberculosis (Mtb) requires further investigation. We have reconstituted the leading-strand replication process of the Mtb DNA pol III holoenzyme in vitro, and investigated the physical and functional relationships between its key components. We verify the presence of an αβ2ε polymerase-clamp-exonuclease replicase complex by biochemical methods and protein-protein interaction assays in vitro and in vivo and confirm that, in addition to the polymerase activity of its α subunit, Mtb DNA pol III has two potential proofreading subunits; the α and ε subunits. During DNA replication, the presence of the β2 clamp strongly promotes the polymerization of the αβ2ε replicase and reduces its exonuclease activity. Our work provides a foundation for further research on the mechanism by which the replication machinery switches between replication and proofreading and provides an experimental platform for the selection of antimicrobials targeting DNA replication in Mtb. PMID:26822057

  14. The splicing regulator PTBP2 interacts with the cytidine deaminase AID and promotes binding of AID to switch-region DNA.


    Nowak, Urszula; Matthews, Allysia J; Zheng, Simin; Chaudhuri, Jayanta


    During immunoglobulin class-switch recombination (CSR), the cytidine deaminase AID induces double-strand breaks into transcribed, repetitive DNA elements called switch sequences. The mechanism that promotes the binding of AID specifically to switch regions remains to be elucidated. Here we used a proteomic screen with in vivo biotinylation of AID to identify the splicing regulator PTBP2 as a protein that interacts with AID. Knockdown of PTBP2 mediated by short hairpin RNA in B cells led to a decrease in binding of AID to transcribed switch regions, which resulted in considerable impairment of CSR. PTBP2 is thus an effector of CSR that promotes the binding of AID to switch-region DNA.

  15. Analysis of tissue-specific expression of human type II collagen cDNA driven by different sizes of the upstream region of the beta-casein promoter.


    Naruse, Kenji; Yoo, Seung Kwon; Kim, Sun Myoung; Choi, Yun Jaie; Lee, Hong Mie; Jin, Dong Il


    To investigate the ability of 1.8 kb or 3.1 kb bovine beta-casein promoter sequences for the expression regulation of transgene in vivo, transgenic mice were produced with human type II collagen gene fused to 1.8 kb and 3.1 kb of bovine beta-casein promoter by DNA microinjection. Five and three transgenic founder mice were produced using transgene constructs with 1.8 kb and 3.1 kb of bovine beta-casein promoters respectively. Founder mice were outbred with the wild type to produce F1 and F2 progenies. Total RNAs were extracted from four tissues (mammary gland, liver, kidney, and muscle) of female F1 transgenic mice of each transgenic line following parturition. RT-PCR and Northern blot analysis revealed that the expression level of transgene was variable among the transgenic lines, but transgenic mice containing 1.8 kb of promoter sequences exhibited more leaky expression of transgene in other tissues compared to those with 3.1 kb promoter. Moreover, Western blot analysis of transgenic mouse milk showed that human type II collagen proteins secreted into the milk of lactating transgenic mice contained 1.8 kb and 3.1 kb of bovine beta-casein promoter. These results suggest that promoter sequences of 3.1 kb bovine beta-casein gene can be used for induction of mammary gland-specific expression of transgenes in transgenic animals.

  16. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    PubMed Central


    Background Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Methods Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Results Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Conclusion Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment. PMID:24495356

  17. The Saccharomyces cerevisiae MGT1 DNA repair methyltransferase gene: its promoter and entire coding sequence, regulation and in vivo biological functions.

    PubMed Central

    Xiao, W; Samson, L


    We previously cloned a yeast DNA fragment that, when fused with the bacterial lacZ promoter, produced O6-methylguanine DNA repair methyltransferase (MGT1) activity and alkylation resistance in Escherichia coli (Xiao et al., EMBO J. 10,2179). Here we describe the isolation of the entire MGT1 gene and its promoter by sequence directed chromosome integration and walking. The MGT1 promoter was fused to a lacZ reporter gene to study how MGT1 expression is controlled. MGT1 is not induced by alkylating agents, nor is it induced by other DNA damaging agents such as UV light. However, deletion analysis defined an upstream repression sequence, whose removal dramatically increased basal level gene expression. The polypeptide deduced from the complete MGT1 sequence contained 18 more N-terminal amino acids than that previously determined; the role of these 18 amino acids, which harbored a potential nuclear localization signal, was explored. The MGT1 gene was also cloned under the GAL1 promoter, so that MTase levels could be manipulated, and we examined MGT1 function in a MTase deficient yeast strain (mgt1). The extent of resistance to both alkylation-induced mutation and cell killing directly correlated with MTase levels. Finally we show that mgt1 S.cerevisiae has a higher rate of spontaneous mutation than wild type cells, indicating that there is an endogenous source of DNA alkylation damage in these eukaryotic cells and that one of the in vivo roles of MGT1 is to limit spontaneous mutations. PMID:1641326

  18. Heterogeneous nuclear ribonucleoprotein K and nucleolin as transcriptional activators of the vascular endothelial growth factor promoter through interaction with secondary DNA structures

    PubMed Central

    Uribe, Diana J.; Guo, Kexiao; Shin, Yoon-Joo; Sun, Daekyu


    The human vascular endothelial growth factor (VEGF) promoter contains a polypurine/polypyrimidine (pPu/pPy) tract that is known to play a critical role in its transcriptional regulation. This pPu/pPy tract undergoes a conformational transition between B-DNA, single stranded DNA and atypical secondary DNA structures such as G-quadruplexes and i-motifs. We studied the interaction of the cytosine-rich (C-rich) and guanine-rich (G-rich) strands of this tract with transcription factors heterogeneous nuclear ribonucleoprotein (hnRNP) K and nucleolin, respectively, both in vitro and in vivo and their potential role in the transcriptional control of VEGF. Using chromatin immunoprecipitation (ChIP) assay for our in vivo studies and electrophoretic mobility shift assay (EMSA) for our in vitro studies, we demonstrated that both nucleolin and hnRNP K bind selectively to the G- and C-rich sequences, respectively, in the pPu/pPy tract of the VEGF promoter. The small interfering RNA (siRNA)-mediated silencing of either nucleolin or hnRNP K resulted in the down-regulation of basal VEGF gene, suggesting that they act as activators of VEGF transcription. Taken together, the identification of transcription factors that can recognize and bind to atypical DNA structures within the pPu/pPy tract will provide new insight into mechanisms of transcriptional regulation of the VEGF gene. PMID:21466159

  19. The DNA damage checkpoint pathway promotes extensive resection and nucleotide synthesis to facilitate homologous recombination repair and genome stability in fission yeast.


    Blaikley, Elizabeth J; Tinline-Purvis, Helen; Kasparek, Torben R; Marguerat, Samuel; Sarkar, Sovan; Hulme, Lydia; Hussey, Sharon; Wee, Boon-Yu; Deegan, Rachel S; Walker, Carol A; Pai, Chen-Chun; Bähler, Jürg; Nakagawa, Takuro; Humphrey, Timothy C


    DNA double-strand breaks (DSBs) can cause chromosomal rearrangements and extensive loss of heterozygosity (LOH), hallmarks of cancer cells. Yet, how such events are normally suppressed is unclear. Here we identify roles for the DNA damage checkpoint pathway in facilitating homologous recombination (HR) repair and suppressing extensive LOH and chromosomal rearrangements in response to a DSB. Accordingly, deletion of Rad3(ATR), Rad26ATRIP, Crb2(53BP1) or Cdc25 overexpression leads to reduced HR and increased break-induced chromosome loss and rearrangements. We find the DNA damage checkpoint pathway facilitates HR, in part, by promoting break-induced Cdt2-dependent nucleotide synthesis. We also identify additional roles for Rad17, the 9-1-1 complex and Chk1 activation in facilitating break-induced extensive resection and chromosome loss, thereby suppressing extensive LOH. Loss of Rad17 or the 9-1-1 complex results in a striking increase in break-induced isochromosome formation and very low levels of chromosome loss, suggesting the 9-1-1 complex acts as a nuclease processivity factor to facilitate extensive resection. Further, our data suggest redundant roles for Rad3ATR and Exo1 in facilitating extensive resection. We propose that the DNA damage checkpoint pathway coordinates resection and nucleotide synthesis, thereby promoting efficient HR repair and genome stability.

  20. The DNA damage checkpoint pathway promotes extensive resection and nucleotide synthesis to facilitate homologous recombination repair and genome stability in fission yeast

    PubMed Central

    Blaikley, Elizabeth J.; Tinline-Purvis, Helen; Kasparek, Torben R.; Marguerat, Samuel; Sarkar, Sovan; Hulme, Lydia; Hussey, Sharon; Wee, Boon-Yu; Deegan, Rachel S.; Walker, Carol A.; Pai, Chen-Chun; Bähler, Jürg; Nakagawa, Takuro; Humphrey, Timothy C.


    DNA double-strand breaks (DSBs) can cause chromosomal rearrangements and extensive loss of heterozygosity (LOH), hallmarks of cancer cells. Yet, how such events are normally suppressed is unclear. Here we identify roles for the DNA damage checkpoint pathway in facilitating homologous recombination (HR) repair and suppressing extensive LOH and chromosomal rearrangements in response to a DSB. Accordingly, deletion of Rad3ATR, Rad26ATRIP, Crb253BP1 or Cdc25 overexpression leads to reduced HR and increased break-induced chromosome loss and rearrangements. We find the DNA damage checkpoint pathway facilitates HR, in part, by promoting break-induced Cdt2-dependent nucleotide synthesis. We also identify additional roles for Rad17, the 9-1-1 complex and Chk1 activation in facilitating break-induced extensive resection and chromosome loss, thereby suppressing extensive LOH. Loss of Rad17 or the 9-1-1 complex results in a striking increase in break-induced isochromosome formation and very low levels of chromosome loss, suggesting the 9-1-1 complex acts as a nuclease processivity factor to facilitate extensive resection. Further, our data suggest redundant roles for Rad3ATR and Exo1 in facilitating extensive resection. We propose that the DNA damage checkpoint pathway coordinates resection and nucleotide synthesis, thereby promoting efficient HR repair and genome stability. PMID:24623809

  1. The DNA damage checkpoint pathway promotes extensive resection and nucleotide synthesis to facilitate homologous recombination repair and genome stability in fission yeast.


    Blaikley, Elizabeth J; Tinline-Purvis, Helen; Kasparek, Torben R; Marguerat, Samuel; Sarkar, Sovan; Hulme, Lydia; Hussey, Sharon; Wee, Boon-Yu; Deegan, Rachel S; Walker, Carol A; Pai, Chen-Chun; Bähler, Jürg; Nakagawa, Takuro; Humphrey, Timothy C


    DNA double-strand breaks (DSBs) can cause chromosomal rearrangements and extensive loss of heterozygosity (LOH), hallmarks of cancer cells. Yet, how such events are normally suppressed is unclear. Here we identify roles for the DNA damage checkpoint pathway in facilitating homologous recombination (HR) repair and suppressing extensive LOH and chromosomal rearrangements in response to a DSB. Accordingly, deletion of Rad3(ATR), Rad26ATRIP, Crb2(53BP1) or Cdc25 overexpression leads to reduced HR and increased break-induced chromosome loss and rearrangements. We find the DNA damage checkpoint pathway facilitates HR, in part, by promoting break-induced Cdt2-dependent nucleotide synthesis. We also identify additional roles for Rad17, the 9-1-1 complex and Chk1 activation in facilitating break-induced extensive resection and chromosome loss, thereby suppressing extensive LOH. Loss of Rad17 or the 9-1-1 complex results in a striking increase in break-induced isochromosome formation and very low levels of chromosome loss, suggesting the 9-1-1 complex acts as a nuclease processivity factor to facilitate extensive resection. Further, our data suggest redundant roles for Rad3ATR and Exo1 in facilitating extensive resection. We propose that the DNA damage checkpoint pathway coordinates resection and nucleotide synthesis, thereby promoting efficient HR repair and genome stability. PMID:24623809

  2. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.


    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela


    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  3. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

    PubMed Central

    Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela


    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  4. The AT-Hook motif as a versatile minor groove anchor for promoting DNA binding of transcription factor fragments

    PubMed Central

    Rodríguez, Jéssica; Mosquera, Jesús; Couceiro, Jose R.; Vázquez, M. Eugenio; Mascareñas, José L.


    We report the development of chimeric DNA binding peptides comprising a DNA binding fragment of natural transcription factors (the basic region of a bZIP protein or a monomeric zinc finger module) and an AT-Hook peptide motif. The resulting peptide conjugates display high DNA affinity and excellent sequence selectivity. Furthermore, the AT-Hook motif also favors the cell internalization of the conjugates. PMID:26290687

  5. The 3'-to-5' exonuclease activity of vaccinia virus DNA polymerase is essential and plays a role in promoting virus genetic recombination.


    Gammon, Don B; Evans, David H


    Poxviruses are subjected to extraordinarily high levels of genetic recombination during infection, although the enzymes catalyzing these reactions have never been identified. However, it is clear that virus-encoded DNA polymerases play some unknown yet critical role in virus recombination. Using a novel, antiviral-drug-based strategy to dissect recombination and replication reactions, we now show that the 3'-to-5' proofreading exonuclease activity of the viral DNA polymerase plays a key role in promoting recombination reactions. Linear DNA substrates were prepared containing the dCMP analog cidofovir (CDV) incorporated into the 3' ends of the molecules. The drug blocked the formation of concatemeric recombinant molecules in vitro in a process that was catalyzed by the proofreading activity of vaccinia virus DNA polymerase. Recombinant formation was also blocked when CDV-containing recombination substrates were transfected into cells infected with wild-type vaccinia virus. These inhibitory effects could be overcome if CDV-containing substrates were transfected into cells infected with CDV-resistant (CDV(r)) viruses, but only when resistance was linked to an A314T substitution mutation mapping within the 3'-to-5' exonuclease domain of the viral polymerase. Viruses encoding a CDV(r) mutation in the polymerase domain still exhibited a CDV-induced recombination deficiency. The A314T substitution also enhanced the enzyme's capacity to excise CDV molecules from the 3' ends of duplex DNA and to recombine these DNAs in vitro, as judged from experiments using purified mutant DNA polymerase. The 3'-to-5' exonuclease activity appears to be an essential virus function, and our results suggest that this might be because poxviruses use it to promote genetic exchange.

  6. Sufficient Amounts of Functional HOP2/MND1 Complex Promote Interhomolog DNA Repair but Are Dispensable for Intersister DNA Repair during Meiosis in Arabidopsis[W

    PubMed Central

    Uanschou, Clemens; Ronceret, Arnaud; Von Harder, Mona; De Muyt, Arnaud; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; Kobayashi, Wataru; Kurumizaka, Hitoshi; Schlögelhofer, Peter; Grelon, Mathilde


    During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The HOMOLOGOUS-PAIRING PROTEIN2/MEIOTIC NUCLEAR DIVISION PROTEIN1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases RADIATION SENSITIVE51 (RAD51) and DISRUPTED MEIOTIC cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair. PMID:24363313

  7. TDP2 promotes repair of topoisomerase I-mediated DNA damage in the absence of TDP1

    PubMed Central

    Zeng, Zhihong; Sharma, Abhishek; Ju, Limei; Murai, Junko; Umans, Lieve; Vermeire, Liesbeth; Pommier, Yves; Takeda, Shunichi; Huylebroeck, Danny; Caldecott, Keith W.; El-Khamisy, Sherif F.


    The abortive activity of topoisomerases can result in clastogenic and/or lethal DNA damage in which the topoisomerase is covalently linked to the 3′- or 5′-terminus of a DNA strand break. This type of DNA damage is implicated in chromosome translocations and neurological disease and underlies the clinical efficacy of an important class of anticancer topoisomerase ‘poisons’. Tyrosyl DNA phosphodiesterase-1 protects cells from abortive topoisomerase I (Top1) activity by hydrolyzing the 3′-phosphotyrosyl bond that links Top1 to a DNA strand break and is currently the only known human enzyme that displays this activity in cells. Recently, we identified a second tyrosyl DNA phosphodiesterase (TDP2; aka TTRAP/EAPII) that possesses weak 3′-tyrosyl DNA phosphodiesterase (3′-TDP) activity, in vitro. Herein, we have examined whether TDP2 contributes to the repair of Top1-mediated DNA breaks by deleting Tdp1 and Tdp2 separately and together in murine and avian cells. We show that while deletion of Tdp1 in wild-type DT40 cells and mouse embryonic fibroblasts decreases DNA strand break repair rates and cellular survival in response to Top1-induced DNA damage, deletion of Tdp2 does not. However, deletion of both Tdp1 and Tdp2 reduces rates of DNA strand break repair and cell survival below that observed in Tdp1−/− cells, suggesting that Tdp2 contributes to cellular 3′-TDP activity in the absence of Tdp1. Consistent with this idea, over-expression of human TDP2 in Tdp1−/−/Tdp2−/−/− DT40 cells increases DNA strand break repair rates and cell survival above that observed in Tdp1−/− DT40 cells, suggesting that Tdp2 over-expression can partially complement the defect imposed by loss of Tdp1. Finally, mice lacking both Tdp1 and Tdp2 exhibit greater sensitivity to Top1 poisons than do mice lacking Tdp1 alone, further suggesting that Tdp2 contributes to the repair of Top1-mediated DNA damage in the absence of Tdp1. In contrast, we failed to detect a

  8. Alcohol-induced One-carbon Metabolism Impairment Promotes Dysfunction of DNA Base Excision Repair in Adult Brain*

    PubMed Central

    Fowler, Anna-Kate; Hewetson, Aveline; Agrawal, Rajiv G.; Dagda, Marisela; Dagda, Raul; Moaddel, Ruin; Balbo, Silvia; Sanghvi, Mitesh; Chen, Yukun; Hogue, Ryan J.; Bergeson, Susan E.; Henderson, George I.; Kruman, Inna I.


    The brain is one of the major targets of chronic alcohol abuse. Yet the fundamental mechanisms underlying alcohol-mediated brain damage remain unclear. The products of alcohol metabolism cause DNA damage, which in conditions of DNA repair dysfunction leads to genomic instability and neural death. We propose that one-carbon metabolism (OCM) impairment associated with long term chronic ethanol intake is a key factor in ethanol-induced neurotoxicity, because OCM provides cells with DNA precursors for DNA repair and methyl groups for DNA methylation, both critical for genomic stability. Using histological (immunohistochemistry and stereological counting) and biochemical assays, we show that 3-week chronic exposure of adult mice to 5% ethanol (Lieber-Decarli diet) results in increased DNA damage, reduced DNA repair, and neuronal death in the brain. These were concomitant with compromised OCM, as evidenced by elevated homocysteine, a marker of OCM dysfunction. We conclude that OCM dysfunction plays a causal role in alcohol-induced genomic instability in the brain because OCM status determines the alcohol effect on DNA damage/repair and genomic stability. Short ethanol exposure, which did not disturb OCM, also did not affect the response to DNA damage, whereas additional OCM disturbance induced by deficiency in a key OCM enzyme, methylenetetrahydrofolate reductase (MTHFR) in Mthfr+/− mice, exaggerated the ethanol effect on DNA repair. Thus, the impact of long term ethanol exposure on DNA repair and genomic stability in the brain results from OCM dysfunction, and MTHFR mutations such as Mthfr 677C→T, common in human population, may exaggerate the adverse effects of ethanol on the brain. PMID:23118224

  9. Cell-specific transcriptional regulation and reactivation of galectin-1 gene expression are controlled by DNA methylation of the promoter region.

    PubMed Central

    Benvenuto, G; Carpentieri, M L; Salvatore, P; Cindolo, L; Bruni, C B; Chiariotti, L


    The galectin-1 gene is developmentally regulated gene whose activity is strongly modulated during cell differentiation and transformation. We have previously shown that galectin-1 promoter constructs are highly active when transiently transfected in cells both expressing and not expressing the endogenous gene and that the basal activity is determined by a small region encompassing the transcription start site (from positions -50 to +50). We have now investigated the role of DNA methylation in galectin-1 gene expression. Southern blot analysis with HpaII and MspI endonucleases and sodium bisulfite analysis of genomic DNA from expressing and nonexpressing cell lines and cell hybrids showed a close correlation between gene activity and demethylation of the 5' region of the galectin-1 gene. We found that the galectin-1 promoter region is fully methylated, at every CpG site on both strands, in nonexpressing differentiated rat liver (FAO) and thyroid (PC C13) cells and unmethylated in the expressing undifferentiated liver (BRL3A) and thyroid transformed (PC myc/raf) cell lines. In addition, reactivation of the silent FAO alleles in FAO-human osteosarcoma (143tk-) hybrid cells is accompanied by a complete demethylation of the promoter region. Finally, when galectin-1 chloramphenicol acetyltransferase (CAT) promoter constructs were methylated in vitro by SssI methylase at every cytosine residue of the CpG doublets and transfected into mouse fibroblasts, the transcription of the CAT reporter gene was strongly inhibited. PMID:8649381

  10. Escherichia coli Fis and DnaA proteins bind specifically to the nrd promoter region and affect expression of an nrd-lac fusion.

    PubMed Central

    Augustin, L B; Jacobson, B A; Fuchs, J A


    The Escherichia coli nrd operon contains the genes encoding the two subunits of ribonucleoside diphosphate reductase. The regulation of the nrd operon has been observed to be very complex. The specific binding of two proteins to the nrd regulatory region and expression of mutant nrd-lac fusions that do not bind these proteins are described. A partially purified protein from an E. coli cell extract was previously shown to bind to the promoter region and to regulate transcription of the nrd operon (C. K. Tuggle and J. A. Fuchs, J. Bacteriol. 172:1711-1718, 1990). We have purified this protein to homogeneity by affinity chromatography and identified it as the E. coli factor for inversion stimulation (Fis). Cu-phenanthroline footprinting experiments showed that Fis binds to a site centered 156 bp upstream of the start of nrd transcription. Mutants with deletion and site-directed mutations that do not bind Fis at this site have two- to threefold-lower expression of an nrd-lac fusion. The previously reported negative regulatory nature of this site (C. K. Tuggle and J. A. Fuchs, J. Bacteriol. 172:1711-1718, 1990) was found to be due to a change in polarity in the vectors used to construct promoter fusions. Two nine-base sequences with homology to the DnaA consensus binding sequence are located immediately upstream of the nrd putative -35 RNA polymerase binding site. Binding of DnaA to these sequences on DNA fragments containing the nrd promoter region was confirmed by in vitro Cu-phenanthroline footprinting. Footprinting experiments on fragments with each as well as both of the mutated 9-mers suggests cooperativity between the two sites in binding DnaA. Assay of in vivo expression from wild-type and DnaA box-mutated nrd promoter fragments fused to lacZ on single-copy plasmids indicates a positive effect of DnaA binding on expression of nrd. Images PMID:8288532

  11. Identification of the Ω4406 Regulatory Region, a Developmental Promoter of Myxococcus xanthus, and a DNA Segment Responsible for Chromosomal Position-Dependent Inhibition of Gene Expression

    PubMed Central

    Loconto, Jennifer; Viswanathan, Poorna; Nowak, Scott J.; Gloudemans, Monica; Kroos, Lee


    When starved, Myxococcus xanthus cells send signals to each other that coordinate their movements, gene expression, and differentiation. C-signaling requires cell-cell contact, and increasing contact brought about by cell alignment in aggregates is thought to increase C-signaling, which induces expression of many genes, causing rod-shaped cells to differentiate into spherical spores. C-signaling involves the product of the csgA gene. A csgA mutant fails to express many genes that are normally induced after about 6 h into the developmental process. One such gene was identified by insertion of Tn5 lac at site Ω4406 in the M. xanthus chromosome. Tn5 lac fused transcription of lacZ to the upstream Ω4406 promoter. In this study, the Ω4406 promoter region was identified by analyzing mRNA and by testing different upstream DNA segments for the ability to drive developmental lacZ expression in M. xanthus. The 5′ end of Ω4406 mRNA mapped to approximately 1.3 kb upstream of the Tn5 lac insertion. A 1.0-kb DNA segment from 0.8 to 1.8 kb upstream of the Tn5 lac insertion, when fused to lacZ and integrated at a phage attachment site in the M. xanthus chromosome, showed a similar pattern of developmental expression as Tn5 lac Ω4406. The DNA sequence upstream of the putative transcriptional start site was strikingly similar to promoter regions of other C-signal-dependent genes. Developmental lacZ expression from the 1.0-kb segment was abolished in a csgA mutant but was restored upon codevelopment of the csgA mutant with wild-type cells, which supply C-signal, demonstrating that the Ω4406 promoter responds to extracellular C-signaling. Interestingly, the 0.8-kb DNA segment immediately upstream of Tn5 lac Ω4406 inhibited expression of a downstream lacZ reporter in transcriptional fusions integrated at a phage attachment site in the chromosome but not at the normal Ω4406 location. To our knowledge, this is the first example in M. xanthus of a chromosomal position

  12. Differential Roles of Cell Death-inducing DNA Fragmentation Factor-α-like Effector (CIDE) Proteins in Promoting Lipid Droplet Fusion and Growth in Subpopulations of Hepatocytes.


    Xu, Wenyi; Wu, Lizhen; Yu, Miao; Chen, Feng-Jung; Arshad, Muhammad; Xia, Xiayu; Ren, Hao; Yu, Jinhai; Xu, Li; Xu, Dijin; Li, John Zhong; Li, Peng; Zhou, Linkang


    Lipid droplets (LDs) are dynamic subcellular organelles whose growth is closely linked to obesity and hepatic steatosis. Cell death-inducing DNA fragmentation factor-α-like effector (CIDE) proteins, including Cidea, Cideb, and Cidec (also called Fsp27), play important roles in lipid metabolism. Cidea and Cidec are LD-associated proteins that promote atypical LD fusion in adipocytes. Here, we find that CIDE proteins are all localized to LD-LD contact sites (LDCSs) and promote lipid transfer, LD fusion, and growth in hepatocytes. We have identified two types of hepatocytes, one with small LDs (small LD-containing hepatocytes, SLHs) and one with large LDs (large LD-containing hepatocytes, LLHs) in the liver. Cideb is localized to LDCSs and promotes lipid exchange and LD fusion in both SLHs and LLHs, whereas Cidea and Cidec are specifically localized to the LDCSs and promote lipid exchange and LD fusion in LLHs. Cideb-deficient SLHs have reduced LD sizes and lower lipid exchange activities. Fasting dramatically induces the expression of Cidea/Cidec and increases the percentage of LLHs in the liver. The majority of the hepatocytes from the liver of obese mice are Cidea/Cidec-positive LLHs. Knocking down Cidea or Cidec significantly reduced lipid storage in the livers of obese animals. Our data reveal that CIDE proteins play differential roles in promoting LD fusion and lipid storage; Cideb promotes lipid storage under normal diet conditions, whereas Cidea and Cidec are responsible for liver steatosis under fasting and obese conditions. PMID:26733203

  13. Differential Roles of Cell Death-inducing DNA Fragmentation Factor-α-like Effector (CIDE) Proteins in Promoting Lipid Droplet Fusion and Growth in Subpopulations of Hepatocytes.


    Xu, Wenyi; Wu, Lizhen; Yu, Miao; Chen, Feng-Jung; Arshad, Muhammad; Xia, Xiayu; Ren, Hao; Yu, Jinhai; Xu, Li; Xu, Dijin; Li, John Zhong; Li, Peng; Zhou, Linkang


    Lipid droplets (LDs) are dynamic subcellular organelles whose growth is closely linked to obesity and hepatic steatosis. Cell death-inducing DNA fragmentation factor-α-like effector (CIDE) proteins, including Cidea, Cideb, and Cidec (also called Fsp27), play important roles in lipid metabolism. Cidea and Cidec are LD-associated proteins that promote atypical LD fusion in adipocytes. Here, we find that CIDE proteins are all localized to LD-LD contact sites (LDCSs) and promote lipid transfer, LD fusion, and growth in hepatocytes. We have identified two types of hepatocytes, one with small LDs (small LD-containing hepatocytes, SLHs) and one with large LDs (large LD-containing hepatocytes, LLHs) in the liver. Cideb is localized to LDCSs and promotes lipid exchange and LD fusion in both SLHs and LLHs, whereas Cidea and Cidec are specifically localized to the LDCSs and promote lipid exchange and LD fusion in LLHs. Cideb-deficient SLHs have reduced LD sizes and lower lipid exchange activities. Fasting dramatically induces the expression of Cidea/Cidec and increases the percentage of LLHs in the liver. The majority of the hepatocytes from the liver of obese mice are Cidea/Cidec-positive LLHs. Knocking down Cidea or Cidec significantly reduced lipid storage in the livers of obese animals. Our data reveal that CIDE proteins play differential roles in promoting LD fusion and lipid storage; Cideb promotes lipid storage under normal diet conditions, whereas Cidea and Cidec are responsible for liver steatosis under fasting and obese conditions.

  14. The histone methyltransferase KMT2B is required for RNA polymerase II association and protection from DNA methylation at the MagohB CpG island promoter.


    Ladopoulos, Vasileios; Hofemeister, Helmut; Hoogenkamp, Maarten; Riggs, Arthur D; Stewart, A Francis; Bonifer, Constanze


    KMT2B (MLL2/WBP7) is a member of the MLL subfamily of H3K4-specific histone lysine methyltransferases (KMT2) and is vital for normal embryonic development in the mouse. To gain insight into the molecular mechanism underlying KMT2B function, we focused on MagohB, which is controlled by a CpG island promoter. We show that in cells lacking Mll2-the gene encoding KMT2B-the MagohB promoter resides in inaccessible chromatin and is methylated. To dissect the molecular events leading to the establishment of silencing, we performed kinetic studies in Mll2-conditional-knockout embryonic stem cells. KMT2B depletion was followed by the loss of the active chromatin marks and progressive loss of RNA polymerase II binding with a concomitant downregulation of MagohB expression. Once the active chromatin marks were lost, the MagohB promoter was rapidly methylated. We demonstrate that in the presence of KMT2B, neither transcription elongation nor RNA polymerase II binding is required to maintain H3K4 trimethylation at the MagohB promoter and protect it from DNA methylation. Reexpression of KMT2B was sufficient to reinstate an active MagohB promoter. Our study provides a paradigm for the idea that KMT2 proteins are crucial components for establishing and maintaining the transcriptionally active and unmethylated state of CpG island promoters. PMID:23358417

  15. Arginine residues within the DNA binding domain of STAT3 promote intracellular shuttling and phosphorylation of STAT3.


    Ginter, Torsten; Fahrer, Jörg; Kröhnert, Ulrike; Fetz, Verena; Garrone, Alessio; Stauber, Roland H; Reichardt, Werner; Müller-Newen, Gerhard; Kosan, Christian; Heinzel, Thorsten; Krämer, Oliver H


    Acetylation-dependent inactivation of STAT1 can be mimicked by the exchange of its lysine residues K410 and K413 to glutamine residues. STAT3 harbors non-acetylatable arginine moieties at the corresponding sites R414 and R417. It is unclear whether the mutation of these sites to glutamine residues antagonizes STAT3 activation. Here, we show that an arginine-glutamine-exchange at the STAT3 moieties R414 and R417 (R414Q and R417Q) reduces cytokine-dependent tyrosine phosphorylation of STAT3. This inhibitory effect can be partially rescued by phosphatase inhibition. In addition, the R414Q and R417Q mutations enhance the nuclear accumulation of unphosphorylated STAT3. STAT3 R414Q and STAT3 R417Q show a reduced response to cytokine stimulation emanating from the plasma membrane. Moreover, these STAT3 mutants have no direct inhibitory effect on the cytokine-induced activation of STAT1/STAT3-mediated gene expression. Since the mutations R414Q and R417Q reside within the STAT3 DNA binding domain (DBD), the STAT3 R414Q and R417Q mutants also lack intrinsic activity as transcription factors. Furthermore, in contrast to wild-type STAT3 they cannot compensate for a loss of STAT1 and they cannot promote STAT1/STAT3-dependent transcriptional activation. We further analyzed a STAT3 arginine-lysine-exchange mutant (R414K/R417K). This molecule mimics corresponding lysine residues found within the DBD of STAT1. Compared to wild-type STAT3, the STAT3 R414K/R417K mutant shows attenuated tyrosine phosphorylation and it is a less active transcription factor. In addition, STAT3 R414K/R417K is not activated by deacetylase inhibition. On the other hand, C-terminal acetylation of STAT3 is intact in STAT3 R414K/R417K. Our results suggest that the exchange of amino acid residues within the DBDs of STAT1/STAT3 affects their phosphorylation as well as their intracellular shuttling. PMID:24721162

  16. BRG1 promotes the repair of DNA double-strand breaks by facilitating the replacement of RPA with RAD51

    PubMed Central

    Qi, Wenjing; Wang, Ruoxi; Chen, Hongyu; Wang, Xiaolin; Xiao, Ting; Boldogh, Istvan; Ba, Xueqing; Han, Liping; Zeng, Xianlu


    ABSTRACT DNA double-strand breaks (DSBs) are a type of lethal DNA damage. The repair of DSBs requires tight coordination between the factors modulating chromatin structure and the DNA repair machinery. BRG1, the ATPase subunit of the chromatin remodelling complex Switch/Sucrose non-fermentable (SWI/SNF), is often linked to tumorigenesis and genome instability, and its role in DSB repair remains largely unclear. In the present study, we show that BRG1 is recruited to DSB sites and enhances DSB repair. Using DR-GFP and EJ5-GFP reporter systems, we demonstrate that BRG1 facilitates homologous recombination repair rather than nonhomologous end-joining (NHEJ) repair. Moreover, the BRG1–RAD52 complex mediates the replacement of RPA with RAD51 on single-stranded DNA (ssDNA) to initiate DNA strand invasion. Loss of BRG1 results in a failure of RAD51 loading onto ssDNA, abnormal homologous recombination repair and enhanced DSB-induced lethality. Our present study provides a mechanistic insight into how BRG1, which is known to be involved in chromatin remodelling, plays a substantial role in the homologous recombination repair pathway in mammalian cells. PMID:25395584

  17. Does urea promote the bisulfite-mediated deamination of cytosine in DNA? Investigation aiming at speeding-up the procedure for DNA methylation analysis.


    Hayatsu, Hikoya; Tsuji, Katsumi; Negishi, Kazuo


    Methylation of cytosine in DNA at position 5 plays important roles in gene functions. Changes in the methylation status are linked to cancer. These studies have been developed on the basis of determining 5-methylcytosine residues [mC] in DNA. This analytical procedure uses the principle that bisulfite deaminates cytosine [C] but it deaminates mC only very slowly. Thus, 'bisulfite genomic sequencing' involves treatment of a given DNA sample with bisulfite followed by PCR amplification and sequencing, through which C residues in the original DNA are found as T and mC as C. In this procedure, a treatment with 3-5 M sodium bisulfite for 12-16 hr at 55 degrees C has been conventionally used. Recently, we were able to improve the efficiency of this procedure by introducing a highly concentrated (10 M) bisulfite solution. Aiming at further improvement of the procedure, we have now explored the effect of adding urea in this bisulfite treatment, as urea was reported to improve the deamination efficiency. Using 7.5 M ammonium bisulfite (pH 5.4) at 70 degrees C with or without the presence of 6 M urea, we performed deamination and sequencing of a DNA sample having known multiple CpG sites with mC. The deaminated DNAs were then subjected to PCR amplification followed by sequencing. In the 15 min-treated sample, the deamination extents were; C 96.5%, mC 1.1% for "bisulfite-only"; and C 90.3%, mC 1.4% for "bisulfite + urea". In the 30 min-treated sample, these values were; C 99.7%, mC 3.6% for "bisulfite only"; and C 99.7%, mC 2.1% for "bisulfite + urea". These results indicate that urea did not enhance the deamination efficiency. In the PCR, we did not observe significant improvements regarding the amounts of DNA necessary to obtain adequate amplification. Urea at 2 M, 4 M, and 8 M, showed no improvements. We conclude that urea gave no significant effect in the bisulfite genomic sequencing of the DNA used. PMID:17150821

  18. BRCA1 promoter hypermethylation, 53BP1 protein expression and PARP-1 activity as biomarkers of DNA repair deficit in breast cancer

    PubMed Central


    Background Poly(adenosine diphosphate–ribose) polymerase 1 (PARP-1) and the balance between BRCA1 and 53BP1 play a key role in the DNA repair and cell stress response. PARP inhibitors show promising clinical activity in metastatic triple negative (TN) or BRCA-mutated breast cancer. However, a comprehensive analysis of PARP-1 activity, BRCA1 promoter methylation and 53BP1 expression in tumours without known BRCA1 mutation has not yet been carried out. Methods We investigated cytosolic PARP-1 activity, 53BP1 protein levels and BRCA1 promoter methylation in 155 surgical breast tumour samples from patients without familial breast cancer history or known BRCA1 mutations who were treated between January 2006 and November 2009 and evaluated their statistical association with classical predictive and prognostic factors. Results The mitotic count score was the only parameter clearly associated with PARP-1 activity. BRCA1 promoter hypermethylation (15.4% of all cancers) was significantly associated with uPA and PAI-1 levels, tumour grade, mitotic count score, hormone receptor and HER2 negative status and TN profile (29% of TN tumours showed BRCA1 promoter hypermethylation compared to 5% of grade II-III hormone receptor-positive/HER2-negative and 2% of HER2-positive tumours). No statistical association was found between BRCA1 promoter hypermethylation and PARP-1 activity. High 53BP1 protein levels correlated with lymph node positivity, hormone receptor positivity, molecular grouping, unmethylated BRCA1 promoter and PARP-1 activity. In TN tumours, BRCA1 promoter methylation was only marginally associated with age, PARP-1 activity was not associated with any of the tested clinico-pathological factors and high 53BP1 protein levels were significantly associated with lymph node positivity. Only 3 of the 14 TN tumours with BRCA1 promoter hypermethylation presented high 53BP1 protein levels. Conclusions Breast cancers that harbour simultaneously high 53BP1 protein level and BRCA1

  19. DNA methylation in the NCAPH2/LMF2 promoter region is associated with hippocampal atrophy in Alzheimer's disease and amnesic mild cognitive impairment patients.


    Shinagawa, Shunichiro; Kobayashi, Nobuyuki; Nagata, Tomoyuki; Kusaka, Akira; Yamada, Hisashi; Kondo, Kazuhiro; Nakayama, Kazuhiko


    Several studies have noted an effect of DNA methylation on the pathogenesis of Alzheimer's disease (AD). We have already reported that DNA methylation levels in the NCAPH2/LMF2 promoter region can be a useful biomarker for the diagnosis of AD and amnesic mild cognitive impairment (aMCI). However, there is still uncertainty about the mechanism by which NCAPH2/LMF2 methylation affects the pathogenesis of AD and aMCI. In this study, we investigated relationships between NCAPH2/LMF2 methylation and other factors. AD (n=30) and aMCI (n=28) subjects were included in this study. NCAPH2/LMF2 methylation levels were measured by pyrosequencing. Correlations between methylation levels and other factors including age at onset, sex, duration of disease, education, mini-mental state examination (MMSE) and frontal assessment battery (FAB) scores, APOE genotype, degree of hippocampal atrophy, and total brain atrophy were measured. Degrees of hippocampal atrophy and total brain atrophy were measured by VSRAD (Voxel-Based Specific Regional Analysis System for Alzheimer's Disease). Regression analysis revealed that only hippocampal atrophy according to VSRAD is a significant dependent variable correlated with NCAPH2/LMF2 methylation levels. Our results suggest that DNA methylation in the NCAPH2/LMF2 promoter region is associated with hippocampal atrophy through apoptosis. PMID:27356276

  20. Saccharomyces cerevisiae Dmc1 and Rad51 proteins preferentially function with Tid1 and Rad54 proteins, respectively, to promote DNA strand invasion during genetic recombination.


    Nimonkar, Amitabh V; Dombrowski, Christopher C; Siino, Joseph S; Stasiak, Alicja Z; Stasiak, Andrzej; Kowalczykowski, Stephen C


    The Saccharomyces cerevisiae Dmc1 and Tid1 proteins are required for the pairing of homologous chromosomes during meiotic recombination. This pairing is the precursor to the formation of crossovers between homologs, an event that is necessary for the accurate segregation of chromosomes. Failure to form crossovers can have serious consequences and may lead to chromosomal imbalance. Dmc1, a meiosis-specific paralog of Rad51, mediates the pairing of homologous chromosomes. Tid1, a Rad54 paralog, although not meiosis-specific, interacts with Dmc1 and promotes crossover formation between homologs. In this study, we show that purified Dmc1 and Tid1 interact physically and functionally. Dmc1 forms stable nucleoprotein filaments that can mediate DNA strand invasion. Tid1 stimulates Dmc1-mediated formation of joint molecules. Under conditions optimal for Dmc1 reactions, Rad51 is specifically stimulated by Rad54, establishing that Dmc1-Tid1 and Rad51-Rad54 function as specific pairs. Physical interaction studies show that specificity in function is not dictated by direct interactions between the proteins. Our data are consistent with the hypothesis that Rad51-Rad54 function together to promote intersister DNA strand exchange, whereas Dmc1-Tid1 tilt the bias toward interhomolog DNA strand exchange.

  1. Promoter hypermethylation and inactivation of hMLH1, a DNA mismatch repair gene, in head and neck squamous cell carcinoma.


    Liu, Kela; Zuo, Chunlai; Luo, Q Kevin; Suen, James Y; Hanna, Ehab; Fan, Chun-Yang


    Head and neck squamous cell carcinoma (HNSCC) is a multistage process during which adverse genetic alterations accumulate resulting in loss of cell cycle control, selective cell overgrowth, and ultimately formation of malignancy. Among various genetic alterations in HNSCC is increased microsatellite instability (MSI). hMLH1 is one of the major mismatch DNA repair genes, the inactivation of which caused increased MSI in a variety of human cancers including HNSCC. While somatic mutation is a major mechanism of the hMLH1 gene inactivation in hereditary form of human cancer, promoter hypermethylation appears to be primarily involved in the inactivation of the hMLH1 gene in sporadic form of human cancers. In the current study, we analyzed 78 cases of HNSCC for hMLH1 protein expression and promoter hypermethylation by IHC and methylation-specific PCR (MSP). Twenty-four of 78 cases (31%) of HNSCC contained markedly reduced levels of the hMLH1 protein. Based on the IHC results, 8 cases without and 8 with hMLH1 protein expression (total of 16) were further analyzed by MSP. Seven of 8 cases (88%) that were negative for the hMLH1 protein displayed promoter hypermethylation, whereas 7 of 7 cases (100%) strongly positive for the protein were free of promoter methylation. This study confirms our previous conclusion that promoter hypermethylation represents a major mechanism of the hMLH1 gene inactivation in HNSCC.

  2. A complex genetic switch involving overlapping divergent promoters and DNA looping regulates expression of conjugation genes of a gram-positive plasmid.


    Ramachandran, Gayetri; Singh, Praveen K; Luque-Ortega, Juan Roman; Yuste, Luis; Alfonso, Carlos; Rojo, Fernando; Wu, Ling J; Meijer, Wilfried J J


    Plasmid conjugation plays a significant role in the dissemination of antibiotic resistance and pathogenicity determinants. Understanding how conjugation is regulated is important to gain insights into these features. Little is known about regulation of conjugation systems present on plasmids from Gram-positive bacteria. pLS20 is a native conjugative plasmid from the Gram-positive bacterium Bacillus subtilis. Recently the key players that repress and activate pLS20 conjugation have been identified. Here we studied in detail the molecular mechanism regulating the pLS20 conjugation genes using both in vivo and in vitro approaches. Our results show that conjugation is subject to the control of a complex genetic switch where at least three levels of regulation are integrated. The first of the three layers involves overlapping divergent promoters of different strengths regulating expression of the conjugation genes and the key transcriptional regulator RcoLS20. The second layer involves a triple function of RcoLS20 being a repressor of the main conjugation promoter and an activator and repressor of its own promoter at low and high concentrations, respectively. The third level of regulation concerns formation of a DNA loop mediated by simultaneous binding of tetrameric RcoLS20 to two operators, one of which overlaps with the divergent promoters. The combination of these three layers of regulation in the same switch allows the main conjugation promoter to be tightly repressed during conditions unfavorable to conjugation while maintaining the sensitivity to accurately switch on the conjugation genes when appropriate conditions occur. The implications of the regulatory switch and comparison with other genetic switches involving DNA looping are discussed. PMID:25340403

  3. Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli

    PubMed Central

    Thomason, Lynn C.; Costantino, Nina


    ABSTRACT Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. PMID:27624131

  4. Areca nut exposure increases secretion of tumor‐promoting cytokines in gingival fibroblasts that trigger DNA damage in oral keratinocytes

    PubMed Central

    Illeperuma, Rasika P.; Kim, Do Kyeong; Park, Young Jin; Son, Hwa Kyung; Kim, Jue Young; Kim, Jinmi; Lee, Doo Young; Kim, Ki‐Yeol; Jung, Da‐Woon; Tilakaratne, Wanninayake M.


    Molecular crosstalk between cancer cells and fibroblasts has been an emerging hot issue in understanding carcinogenesis. As oral submucous fibrosis (OSF) is an inflammatory fibrotic disease that can potentially transform into squamous cell carcinoma, OSF has been considered to be an appropriate model for studying the role of fibroblasts during early stage carcinogenesis. In this sense, this study aims at investigating whether areca nut (AN)‐exposed fibroblasts cause DNA damage of epithelial cells. For this study, immortalized hNOF (hTERT‐hNOF) was used. We found that the levels of GRO‐α, IL‐6 and IL‐8 increased in AN‐exposed fibroblasts. Cytokine secretion was reduced by antioxidants in AN‐exposed fibroblasts. Increase in DNA double strand breaks (DSB) and 8‐oxoG FITC‐conjugate was observed in immortalized human oral keratinocytes (IHOK) after the treatment of cytokines or a conditioned medium derived from AN‐exposed fibroblasts. Cytokine expression and DNA damage were also detected in OSF tissues. The DNA damage was reduced by neutralizing cytokines or antioxidant treatment. Generation of reactive oxygen species (ROS) and DNA damage response, triggered by cytokines, were abolished when NADPH oxidase (NOX) 1 and 4 were silenced in IHOK, indicating that cytokine‐triggered DNA damage was caused by ROS generation through NOX1 and NOX4. Taken together, this study provided strong evidence that blocking ROS generation might be a rewarding approach for cancer prevention and intervention in OSF. PMID:26076896

  5. Epigenetic DNA methylation in the promoters of the Igf1 receptor and insulin receptor genes in db/db mice.


    Nikoshkov, Andrej; Sunkari, Vivekananda; Savu, Octavian; Forsberg, Elisabete; Catrina, Sergiu-Bogdan; Brismar, Kerstin


    We have investigated promoter methylation of the Insr, Igf1 and Igf1r genes in skeletal and cardiac muscles of normal and diabetic db/db mice. No differences in Insr promoter methylation were found in the heart and skeletal muscles and no methylation was detected in the Igf1 promoter in skeletal muscle. In skeletal muscle, db/db males exhibited a 7.4-fold increase in Igf1r promoter methylation, which was accompanied by a 1.8-fold decrease in Igf1r mRNA levels, compared with controls. More than 50% of the detected methylation events were concentrated within an 18 bp sequence that includes one of the Sp1 binding sites. We conclude that the methylation level and pattern of the Igf1r promoter in skeletal muscle is related to gender and the diabetic state. PMID:21474992

  6. The BR domain of PsrP interacts with extracellular DNA to promote bacterial aggregation; structural insights into pneumococcal biofilm formation

    PubMed Central

    Schulte, Tim; Mikaelsson, Cecilia; Beaussart, Audrey; Kikhney, Alexey; Deshmukh, Maya; Wolniak, Sebastian; Pathak, Anuj; Ebel, Christine; Löfling, Jonas; Fogolari, Federico; Henriques-Normark, Birgitta; Dufrêne, Yves F.; Svergun, Dmitri; Nygren, Per-Åke; Achour, Adnane


    The major human pathogen Streptococcus pneumoniae is a leading cause of disease and death worldwide. Pneumococcal biofilm formation within the nasopharynx leads to long-term colonization and persistence within the host. We have previously demonstrated that the capsular surface-associated pneumococcal serine rich repeat protein (PsrP), key factor for biofilm formation, binds to keratin-10 (KRT10) through its microbial surface component recognizing adhesive matrix molecule (MSCRAMM)-related globular binding region domain (BR187–385). Here, we show that BR187–385 also binds to DNA, as demonstrated by electrophoretic mobility shift assays and size exclusion chromatography. Further, heterologous expression of BR187–378 or the longer BR120–378 construct on the surface of a Gram-positive model host bacterium resulted in the formation of cellular aggregates that was significantly enhanced in the presence of DNA. Crystal structure analyses revealed the formation of BR187–385 homo-dimers via an intermolecular β-sheet, resulting in a positively charged concave surface, shaped to accommodate the acidic helical DNA structure. Furthermore, small angle X-ray scattering and circular dichroism studies indicate that the aggregate-enhancing N-terminal region of BR120–166 adopts an extended, non-globular structure. Altogether, our results suggest that PsrP adheres to extracellular DNA in the biofilm matrix and thus promotes pneumococcal biofilm formation. PMID:27582320

  7. IL-21 promotes the production of anti-DNA IgG but is dispensable for kidney damage in lyn-/- mice.


    Gutierrez, Toni; Mayeux, Jessica M; Ortega, Sterling B; Karandikar, Nitin J; Li, Quan-Zhen; Rakheja, Dinesh; Zhou, Xin J; Satterthwaite, Anne B


    The autoimmune disease systemic lupus erythematosus is characterized by loss of tolerance to nuclear Ags and a heightened inflammatory environment, which together result in end organ damage. Lyn-deficient mice, a model of systemic lupus erythematosus, lack an inhibitor of B-cell and myeloid cell activation. This results in B-cell hyper-responsiveness, plasma cell accumulation, autoantibodies, and glomerulonephritis (GN). IL-21 is associated with autoimmunity in mice and humans and promotes B-cell differentiation and class switching. Here, we explore the role of IL-21 in the autoimmune phenotypes of lyn(-/-) mice. We find that IL-21 mRNA is reduced in the spleens of lyn(-/-) IL-6(-/-) and lyn(-/-) Btk(lo) mice, neither of which produce pathogenic autoantibodies or develop significant GN. While IL-21 is dispensable for plasma cell accumulation and IgM autoantibodies in lyn(-/-) mice, it is required for anti-DNA IgG antibodies and some aspects of T-cell activation. Surprisingly, GN still develops in lyn(-/-) IL-21(-/-) mice. This likely results from the presence of IgG autoantibodies against a limited set of non-DNA Ags. These studies identify a specific role for IL-21 in the class switching of anti-DNA B cells and demonstrate that neither IL-21 nor anti-DNA IgG is required for kidney damage in lyn(-/-) mice.

  8. Brh2 and Rad51 promote telomere maintenance in Ustilago maydis, a new model system of DNA repair proteins at telomeres.


    Yu, Eun Young; Kojic, Milorad; Holloman, William K; Lue, Neal F


    Recent studies implicate a number of DNA repair proteins in mammalian telomere maintenance. However, because several key repair proteins in mammals are missing from the well-studied budding and fission yeast, their roles at telomeres cannot be modeled in standard fungi. In this report, we explored the dimorphic fungus Ustilago maydis as an alternative model for telomere research. This fungus, which belongs to the phylum Basidiomycota, has a telomere repeat unit that is identical to the mammalian repeat, as well as a constellation of DNA repair proteins that more closely mimic the mammalian collection. We showed that the two core components of homology-directed repair (HDR) in U. maydis, namely Brh2 and Rad51, both promote telomere maintenance in telomerase positive cells, just like in mammals. In addition, we found that Brh2 is localized to telomeres in vivo, suggesting that it acts directly at chromosome ends. We surveyed a series of mutants with DNA repair defects, and found many of them to have short telomeres. Our results indicate that factors involved in DNA repair are probably also needed for optimal telomere maintenance in U. maydis, and that this fungus is a useful alternative model system for telomere research.

  9. Helicobacter pylori AddAB helicase-nuclease and RecA promote recombination-related DNA repair and survival during stomach colonization.


    Amundsen, Susan K; Fero, Jutta; Hansen, Lori M; Cromie, Gareth A; Solnick, Jay V; Smith, Gerald R; Salama, Nina R


    Helicobacter pylori colonization of the human stomach is characterized by profound disease-causing inflammation. Bacterial proteins that detoxify reactive oxygen species or recognize damaged DNA adducts promote infection, suggesting that H. pylori requires DNA damage repair for successful in vivo colonization. The molecular mechanisms of repair remain unknown. We identified homologues of the AddAB class of helicase-nuclease enzymes, related to the Escherichia coli RecBCD enzyme, which, with RecA, is required for repair of DNA breaks and homologous recombination. H. pylori mutants lacking addA or addB genes lack detectable ATP-dependent nuclease activity, and the cloned H. pylori addAB genes restore both nuclease and helicase activities to an E. coli recBCD deletion mutant. H. pylori addAB and recA mutants have a reduced capacity for stomach colonization. These mutants are sensitive to DNA damaging agents and have reduced frequencies of apparent gene conversion between homologous genes encoding outer membrane proteins. Our results reveal requirements for double-strand break repair and recombination during both acute and chronic phases of H. pylori stomach infection. PMID:18573180

  10. Self-assembly of c-myc DNA promoted by a single enantiomer ruthenium complex as a potential nuclear targeting gene carrier

    PubMed Central

    Wu, Qiong; Mei, Wenjie; Zheng, Kangdi; Ding, Yang


    Gene therapy has long been limited in the clinic, due in part to the lack of safety and efficacy of the gene carrier. Herein, a single enantiomer ruthenium(II) complex, Λ-[Ru(bpy)2(p-BEPIP)](ClO4)2 (Λ-RM0627, bpy = 4,4′-bipyridine, p-BEPIP = 2-(4-phenylacetylenephenyl)imidazole [4,5f][1, 10] phenanthroline), has been synthesized and investigated as a potential gene carrier that targets the nucleus. In this report, it is shown that Λ-RM0627 promotes self-assembly of c-myc DNA to form a nanowire structure. Further studies showed that the nano-assembly of c-myc DNA that induced Λ-RM0627 could be efficiently taken up and enriched in the nuclei of HepG2 cells. After treatment of the nano-assembly of c-myc DNA with Λ-RM0627, over-expression of c-myc in HepG2 cells was observed. In summary, Λ-RM0627 played a key role in the transfer and release of c-myc into cells, which strongly indicates Λ-RM0627 as a potent carrier of c-myc DNA that targets the nucleus of tumor cells. PMID:27381008

  11. The BR domain of PsrP interacts with extracellular DNA to promote bacterial aggregation; structural insights into pneumococcal biofilm formation.


    Schulte, Tim; Mikaelsson, Cecilia; Beaussart, Audrey; Kikhney, Alexey; Deshmukh, Maya; Wolniak, Sebastian; Pathak, Anuj; Ebel, Christine; Löfling, Jonas; Fogolari, Federico; Henriques-Normark, Birgitta; Dufrêne, Yves F; Svergun, Dmitri; Nygren, Per-Åke; Achour, Adnane


    The major human pathogen Streptococcus pneumoniae is a leading cause of disease and death worldwide. Pneumococcal biofilm formation within the nasopharynx leads to long-term colonization and persistence within the host. We have previously demonstrated that the capsular surface-associated pneumococcal serine rich repeat protein (PsrP), key factor for biofilm formation, binds to keratin-10 (KRT10) through its microbial surface component recognizing adhesive matrix molecule (MSCRAMM)-related globular binding region domain (BR187-385). Here, we show that BR187-385 also binds to DNA, as demonstrated by electrophoretic mobility shift assays and size exclusion chromatography. Further, heterologous expression of BR187-378 or the longer BR120-378 construct on the surface of a Gram-positive model host bacterium resulted in the formation of cellular aggregates that was significantly enhanced in the presence of DNA. Crystal structure analyses revealed the formation of BR187-385 homo-dimers via an intermolecular β-sheet, resulting in a positively charged concave surface, shaped to accommodate the acidic helical DNA structure. Furthermore, small angle X-ray scattering and circular dichroism studies indicate that the aggregate-enhancing N-terminal region of BR120-166 adopts an extended, non-globular structure. Altogether, our results suggest that PsrP adheres to extracellular DNA in the biofilm matrix and thus promotes pneumococcal biofilm formation. PMID:27582320

  12. The Phenazine 2-Hydroxy-Phenazine-1-Carboxylic Acid Promotes Extracellular DNA Release and Has Broad Transcriptomic Consequences in Pseudomonas chlororaphis 30-84.


    Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J; Pierson, Leland S; Pierson, Elizabeth A


    Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30-84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surface-attached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30-84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conducted comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30-84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage-derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30-84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities. PMID:26812402

  13. The Phenazine 2-Hydroxy-Phenazine-1-Carboxylic Acid Promotes Extracellular DNA Release and Has Broad Transcriptomic Consequences in Pseudomonas chlororaphis 30–84

    PubMed Central

    Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J.; Pierson, Leland S.; Pierson, Elizabeth A.


    Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30–84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surface-attached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30–84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conducted comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30–84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage-derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30–84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities. PMID:26812402

  14. The Phenazine 2-Hydroxy-Phenazine-1-Carboxylic Acid Promotes Extracellular DNA Release and Has Broad Transcriptomic Consequences in Pseudomonas chlororaphis 30–84


    Wang, Dongping; Yu, Jun Myoung; Dorosky, Robert J.; Pierson, Leland S.; Pierson, Elizabeth A.


    Enhanced production of 2-hydroxy-phenazine-1-carboxylic acid (2-OH-PCA) by the biological control strain Pseudomonas chlororaphis 30–84 derivative 30-84O* was shown previously to promote cell adhesion and alter the three-dimensional structure of surfaceattached biofilms compared to the wild type. The current study demonstrates that production of 2-OH-PCA promotes the release of extracellular DNA, which is correlated with the production of structured biofilm matrix. Moreover, the essential role of the extracellular DNA in maintaining the mass and structure of the 30–84 biofilm matrix is demonstrated. To better understand the role of different phenazines in biofilm matrix production and gene expression, transcriptomic analyses were conductedmore » comparing gene expression patterns of populations of wild type, 30-84O* and a derivative of 30–84 producing only PCA (30-84PCA) to a phenazine defective mutant (30-84ZN) when grown in static cultures. RNA-Seq analyses identified a group of 802 genes that were differentially expressed by the phenazine producing derivatives compared to 30-84ZN, including 240 genes shared by the two 2-OH-PCA producing derivatives, the wild type and 30-84O*. A gene cluster encoding a bacteriophage- derived pyocin and its lysis cassette was upregulated in 2-OH-PCA producing derivatives. A holin encoded in this gene cluster was found to contribute to the release of eDNA in 30–84 biofilm matrices, demonstrating that the influence of 2-OH-PCA on eDNA production is due in part to cell autolysis as a result of pyocin production and release. The results expand the current understanding of the functions different phenazines play in the survival of bacteria in biofilm-forming communities.« less

  15. C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

    PubMed Central

    Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC


    CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

  16. RNA binding protein RBM14 promotes radio-resistance in glioblastoma by regulating DNA repair and cell differentiation

    PubMed Central

    Yuan, Ming; Eberhart, Charles G.; Kai, Mihoko


    Glioblastoma multiforme (GBM) is the most aggressive and lethal type of brain tumor. Standard treatment for GBM patients is surgery followed by radiotherapy and/or chemotherapy, but tumors always recur. Traditional therapies seem to fail because they eliminate only the bulk of the tumors and spare a population of stem-like cells termed tumor-initiating cells. The stem-like state and preferential activation of DNA damage response in the GBM tumor-initiating cells contribute to their radio-resistance and recurrence. The molecular mechanisms underlying this efficient activation of damage response and maintenance of stem-like state remain elusive. Here we show that RBM14 controls DNA repair pathways and also prevents cell differentiation in GBM spheres, causing radio-resistance. Knockdown of RBM14 affects GBM sphere maintenance and sensitizes radio-resistant GBM cells at the cellular level. We demonstrate that RBM14 knockdown blocks GBM regrowth after irradiation in vivo. In addition, RBM14 stimulates DNA repair by controlling the DNA-PK-dependent non-homologous end-joining (NHEJ) pathway. These results reveal unexpected functions of the RNA-binding protein RBM14 in control of DNA repair and maintenance of tumor-initiating cells. Targeting the RBM14-dependent pathway may prevent recurrence of tumors and eradicate the deadly disease completely. PMID:24811242

  17. Metastasis suppressor NM23-H1 promotes repair of UV-induced DNA damage and suppresses UV-induced melanomagenesis.


    Jarrett, Stuart G; Novak, Marian; Dabernat, Sandrine; Daniel, Jean-Yves; Mellon, Isabel; Zhang, Qingbei; Harris, Nathan; Ciesielski, Michael J; Fenstermaker, Robert A; Kovacic, Diane; Slominski, Andrzej; Kaetzel, David M


    Reduced expression of the metastasis suppressor NM23-H1 is associated with aggressive forms of multiple cancers. Here, we establish that NM23-H1 (termed H1 isoform in human, M1 in mouse) and two of its attendant enzymatic activities, the 3'-5' exonuclease and nucleoside diphosphate kinase, are novel participants in the cellular response to UV radiation (UVR)-induced DNA damage. NM23-H1 deficiency compromised the kinetics of repair for total DNA polymerase-blocking lesions and nucleotide excision repair of (6-4) photoproducts in vitro. Kinase activity of NM23-H1 was critical for rapid repair of both polychromatic UVB/UVA-induced (290-400 nm) and UVC-induced (254 nm) DNA damage, whereas its 3'-5' exonuclease activity was dominant in the suppression of UVR-induced mutagenesis. Consistent with its role in DNA repair, NM23-H1 rapidly translocated to sites of UVR-induced (6-4) photoproduct DNA damage in the nucleus. In addition, transgenic mice hemizygous-null for nm23-m1 and nm23-m2 exhibited UVR-induced melanoma and follicular infundibular cyst formation, and tumor-associated melanocytes displayed invasion into adjacent dermis, consistent with loss of invasion-suppressing activity of NM23 in vivo. Taken together, our data show a critical role for NM23 isoforms in limiting mutagenesis and suppressing UVR-induced melanomagenesis.

  18. E2F1 interactions with hHR23A inhibit its degradation and promote DNA repair.


    Singh, Randeep K; Dagnino, Lina


    Nucleotide excision repair (NER) is a major mechanism for removal of DNA lesions induced by exposure to UV radiation in the epidermis. Recognition of damaged DNA sites is the initial step in their repair, and requires multiprotein complexes that contain XPC and hHR23 proteins, or their orthologues. A variety of transcription factors are also involved in NER, including E2F1. In epidermal keratinocytes, UV exposure induces E2F1 phosphorylation, which allows it to recruit various NER factors to sites of DNA damage. However, the relationship between E2F1 and hHR23 proteins vis-à-vis NER has remained unexplored. We now show that E2F1 and hHR23 proteins can interact, and this interaction stabilizes E2F1, inhibiting its proteasomal degradation. Reciprocally, E2F1 regulates hHR23A subcellular localization, recruiting it to sites of DNA photodamage. As a result, E2F1 and hHR23A enhance DNA repair following exposure to UV radiation, contributing to genomic stability in the epidermis.

  19. Loss of the N-terminal methyltransferase NRMT1 increases sensitivity to DNA damage and promotes mammary oncogenesis

    PubMed Central

    Bonsignore, Lindsay A.; Butler, Jill Sergesketter; Klinge, Carolyn M.; Tooley, Christine E. Schaner


    Though discovered over four decades ago, the function of N-terminal methylation has mostly remained a mystery. Our discovery of the first mammalian N-terminal methyltransferase, NRMT1, has led to the discovery of many new functions for N-terminal methylation, including regulation of DNA/protein interactions, accurate mitotic division, and nucleotide excision repair (NER). Here we test whether NRMT1 is also important for DNA double-strand break (DSB) repair, and given its previously known roles in cell cycle regulation and the DNA damage response, assay if NRMT1 is acting as a tumor suppressor. We find that NRMT1 knockdown significantly enhances the sensitivity of breast cancer cell lines to both etoposide treatment and γ-irradiation, as well as, increases proliferation rate, invasive potential, anchorage-independent growth, xenograft tumor size, and tamoxifen sensitivity. Interestingly, this positions NRMT1 as a tumor suppressor protein involved in multiple DNA repair pathways, and indicates, similar to BRCA1 and BRCA2, its loss may result in tumors with enhanced sensitivity to diverse DNA damaging chemotherapeutics. PMID:25909287

  20. E2F1 interactions with hHR23A inhibit its degradation and promote DNA repair

    PubMed Central

    Singh, Randeep K.; Dagnino, Lina


    Nucleotide excision repair (NER) is a major mechanism for removal of DNA lesions induced by exposure to UV radiation in the epidermis. Recognition of damaged DNA sites is the initial step in their repair, and requires multiprotein complexes that contain XPC and hHR23 proteins, or their orthologues. A variety of transcription factors are also involved in NER, including E2F1. In epidermal keratinocytes, UV exposure induces E2F1 phosphorylation, which allows it to recruit various NER factors to sites of DNA damage. However, the relationship between E2F1 and hHR23 proteins vis-à-vis NER has remained unexplored. We now show that E2F1 and hHR23 proteins can interact, and this interaction stabilizes E2F1, inhibiting its proteasomal degradation. Reciprocally, E2F1 regulates hHR23A subcellular localization, recruiting it to sites of DNA photodamage. As a result, E2F1 and hHR23A enhance DNA repair following exposure to UV radiation, contributing to genomic stability in the epidermis. PMID:27028861

  1. The discovery of X-rays diffraction: From crystals to DNA. A case study to promote understanding of the nature of science and of its interdisciplinary character

    NASA Astrophysics Data System (ADS)

    Guerra, Francesco; Leone, Matteo; Robotti, Nadia


    The advantages of introducing history of science topics into the teaching of science has been advocated by a large number of scholars within the science education community. One of the main reasons given for using history of science in teaching is its power to promote understanding of the nature of science (NOS). In this respect, the historical case of X-rays diffraction, from the discovery of Max von Laue (1912) to the first X-rays diffraction photographs of DNA (1953), is a case in point for showing that a correct experimental strategy and a favourable theoretical context are not enough to make a scientific discovery.

  2. Gene promoter DNA methylation patterns have a limited role in orchestrating transcriptional changes in the fetal liver in response to maternal folate depletion during pregnancy

    PubMed Central

    Adriaens, Michiel; Evelo, Chris T.; Ford, Dianne; Mathers, John C.


    Scope Early‐life exposures are critical in fetal programming and may influence function and health in later life. Adequate maternal folate consumption during pregnancy is essential for healthy fetal development and long‐term offspring health. The mechanisms underlying fetal programming are poorly understood, but are likely to involve gene regulation. Epigenetic marks, including DNA methylation, regulate gene expression and are modifiable by folate supply. We observed transcriptional changes in fetal liver in response to maternal folate depletion and hypothesized that these changes are concomitant with altered gene promoter methylation. Methods and results Female C57BL/6J mice were fed diets containing 2 or 0.4 mg folic acid/kg for 4 wk before mating and throughout pregnancy. At 17.5‐day gestation, genome‐wide gene expression and promoter methylation were measured by microarray analysis in male fetal livers. While 989 genes were differentially expressed, 333 promoters had altered methylation (247 hypermethylated, 86 hypomethylated) in response to maternal folate depletion. Only 16 genes had both expression and methylation changes. However, most methylation changes occurred in genomic regions neighboring expression changes. Conclusion In response to maternal folate depletion, altered expression at the mRNA level was not associated with altered promoter methylation of the same gene in fetal liver. PMID:27133805

  3. Three sequence-specific DNA-protein complexes are formed with the same promoter element essential for expression of the rat somatostatin gene.

    PubMed Central

    Andrisani, O M; Pot, D A; Zhu, Z; Dixon, J E


    We identified three sequence-specific DNA-protein complexes which are formed after in vitro binding of nuclear extracts, derived from neuronal (CA-77, rat brain) or non-neuronal (HeLa) cells, to positions -70 to -29 of the rat somatostatin promoter. The protein(s) responsible for the formation of the three sequence-specific complexes was fractionated from rat brain whole cell extracts by DEAE-Sepharose chromatography. The critical contact residues of the factor(s) in each complex, as determined by methylation interference analyses, are located within positions -59 to -35, which is protected from DNase I digestion; these include the G residues of a TGACGTCA consensus also found in the cAMP-responsive human enkephalin (positions -105 to -76) and E1A-inducible adenovirus type 5 E3 (positions -72 to -42) promoters. Competition assays with these heterologous promoters reveal that the factor(s) of each complex displays approximately 50-fold greater affinity for the somatostatin promoter-binding site. Synthetic oligonucleotides spanning positions -70 to -29 of the somatostatin promoter and containing single-base substitutions of the G residues in the TGACGTCA consensus were utilized in competition assays. The G residues located in the center of the module are the most critical determinants in the formation of the three sequence-specific complexes. Deletions disrupting the TGACGTCA consensus abolish not only formation of the three complexes in vitro but also expression of the somatostatin promoter in vivo, suggesting that formation of one or more of these complexes is essential for transcription of the rat somatostatin gene. Images PMID:2898727

  4. Effects on specific promoter DNA methylation in zebrafish embryos and larvae following benzo[a]pyrene exposure

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Benzo[a]pyrene (BaP) is an established reproductive and developmental toxicant. BaP exposure in humans and animals has been linked to infertility and multigenerational health consequences. DNA methylation is the most studied epigenetic mechanism that regulates gene expression, and mapping of methyla...

  5. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes.


    Hasegawa, Tatsuya; Nakashima, Masaya; Suzuki, Yoshiharu


    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE2. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. PMID:27343554

  6. Lithium chloride protects retinal neurocytes from nutrient deprivation by promoting DNA non-homologous end-joining

    SciTech Connect

    Zhuang Jing; Li Fan; Liu Xuan; Liu Zhiping; Lin Jianxian; Ge Yihong; Kaminski, Joseph M.; Summers, James Bradley; Wang Zhichong; Ge Jian Yu Keming


    Lithium chloride is a therapeutic agent for treatment of bipolar affective disorders. Increasing numbers of studies have indicated that lithium has neuroprotective effects. However, the molecular mechanisms underlying the actions of lithium have not been fully elucidated. This study aimed to investigate whether lithium chloride produces neuroprotective function by improving DNA repair pathway in retinal neurocyte. In vitro, the primary cultured retinal neurocytes (85.7% are MAP-2 positive cells) were treated with lithium chloride, then cultured with serum-free media to simulate the nutrient deprived state resulting from ischemic insult. The neurite outgrowth of the cultured cells increased significantly in a dose-dependent manner when exposed to different levels of lithium chloride. Genomic DNA electrophoresis demonstrated greater DNA integrity of retinal neurocytes when treated with lithium chloride as compared to the control. Moreover, mRNA and protein levels of Ligase IV (involved in DNA non-homologous end-joining (NHEJ) pathway) in retinal neurocytes increased with lithium chloride. The end joining activity assay was performed to determine the role of lithium on NHEJ in the presence of extract from retinal neurocytes. The rejoining levels in retinal neurocytes treated with lithium were significantly increased as compared to the control. Furthermore, XRCC4, the Ligase IV partner, and the transcriptional factor, CREB and CTCF, were up-regulated in retinal cells after treating with 1.0 mM lithium chloride. Therefore, our data suggest that lithium chloride protects the retinal neural cells from nutrient deprivation in vitro, which may be similar to the mechanism of cell death in glaucoma. The improvement in DNA repair pathway involving in Ligase IV might have an important role in lithium neuroprotection. This study provides new insights into the neural protective mechanisms of lithium chloride.

  7. DNA and RNA topoisomerase activities of Top3β are promoted by mediator protein Tudor domain-containing protein 3.


    Siaw, Grace Ee-Lu; Liu, I-Fen; Lin, Po-Yen; Been, Michael D; Hsieh, Tao-Shih


    Topoisomerase 3β (Top3β) can associate with the mediator protein Tudor domain-containing protein 3 (TDRD3) to participate in two gene expression processes of transcription and translation. Despite the apparent importance of TDRD3 in binding with Top3β and directing it to cellular compartments critical for gene expression, the biochemical mechanism of how TDRD3 can affect the functions of Top3β is not known. We report here sensitive biochemical assays for the activities of Top3β on DNA and RNA substrates in resolving topological entanglements and for the analysis of TDRD3 functions. TDRD3 stimulates the relaxation activity of Top3β on hypernegatively supercoiled DNA and changes the reaction from a distributive to a processive mode. Both supercoil retention assays and binding measurement by fluorescence anisotropy reveal a heretofore unknown preference for binding single-stranded nucleic acids over duplex. Whereas TDRD3 has a structure-specific binding preference, it does not discriminate between DNA and RNA. This unique property for binding with nucleic acids can have an important function in serving as a hub to form nucleoprotein complexes on DNA and RNA. To gain insight into the roles of Top3β on RNA metabolism, we designed an assay by annealing two single-stranded RNA circles with complementary sequences. Top3β is capable of converting two such single-stranded RNA circles into a double-stranded RNA circle, and this strand-annealing activity is enhanced by TDRD3. These results demonstrate that TDRD3 can enhance the biochemical activities of Top3β on both DNA and RNA substrates, in addition to its function of targeting Top3β to critical sites in subcellular compartments.

  8. DNA and RNA topoisomerase activities of Top3β are promoted by mediator protein Tudor domain-containing protein 3.


    Siaw, Grace Ee-Lu; Liu, I-Fen; Lin, Po-Yen; Been, Michael D; Hsieh, Tao-Shih


    Topoisomerase 3β (Top3β) can associate with the mediator protein Tudor domain-containing protein 3 (TDRD3) to participate in two gene expression processes of transcription and translation. Despite the apparent importance of TDRD3 in binding with Top3β and directing it to cellular compartments critical for gene expression, the biochemical mechanism of how TDRD3 can affect the functions of Top3β is not known. We report here sensitive biochemical assays for the activities of Top3β on DNA and RNA substrates in resolving topological entanglements and for the analysis of TDRD3 functions. TDRD3 stimulates the relaxation activity of Top3β on hypernegatively supercoiled DNA and changes the reaction from a distributive to a processive mode. Both supercoil retention assays and binding measurement by fluorescence anisotropy reveal a heretofore unknown preference for binding single-stranded nucleic acids over duplex. Whereas TDRD3 has a structure-specific binding preference, it does not discriminate between DNA and RNA. This unique property for binding with nucleic acids can have an important function in serving as a hub to form nucleoprotein complexes on DNA and RNA. To gain insight into the roles of Top3β on RNA metabolism, we designed an assay by annealing two single-stranded RNA circles with complementary sequences. Top3β is capable of converting two such single-stranded RNA circles into a double-stranded RNA circle, and this strand-annealing activity is enhanced by TDRD3. These results demonstrate that TDRD3 can enhance the biochemical activities of Top3β on both DNA and RNA substrates, in addition to its function of targeting Top3β to critical sites in subcellular compartments. PMID:27582462

  9. DNA methylation analysis of human myoblasts during in vitro myogenic differentiation: de novo methylation of promoters of muscle-related genes and its involvement in transcriptional down-regulation

    PubMed Central

    Miyata, Kohei; Miyata, Tomoko; Nakabayashi, Kazuhiko; Okamura, Kohji; Naito, Masashi; Kawai, Tomoko; Takada, Shuji; Kato, Kiyoko; Miyamoto, Shingo; Hata, Kenichiro; Asahara, Hiroshi


    Although DNA methylation is considered to play an important role during myogenic differentiation, chronological alterations in DNA methylation and gene expression patterns in this process have been poorly understood. Using the Infinium HumanMethylation450 BeadChip array, we obtained a chronological profile of the genome-wide DNA methylation status in a human myoblast differentiation model, where myoblasts were cultured in low-serum medium to stimulate myogenic differentiation. As the differentiation of the myoblasts proceeded, their global DNA methylation level increased and their methylation patterns became more distinct from those of mesenchymal stem cells. Gene ontology analysis revealed that genes whose promoter region was hypermethylated upon myoblast differentiation were highly significantly enriched with muscle-related terms such as ‘muscle contraction’ and ‘muscle system process’. Sequence motif analysis identified 8-bp motifs somewhat similar to the binding motifs of ID4 and ZNF238 to be most significantly enriched in hypermethylated promoter regions. ID4 and ZNF238 have been shown to be critical transcriptional regulators of muscle-related genes during myogenic differentiation. An integrated analysis of DNA methylation and gene expression profiles revealed that de novo DNA methylation of non-CpG island (CGI) promoters was more often associated with transcriptional down-regulation than that of CGI promoters. These results strongly suggest the existence of an epigenetic mechanism in which DNA methylation modulates the functions of key transcriptional factors to coordinately regulate muscle-related genes during myogenic differentiation. PMID:25190712

  10. Binding sites for the herpes simplex virus immediate-early protein ICP4 impose an increased dependence on viral DNA replication on simple model promoters located in the viral genome.


    Koop, K E; Duncan, J; Smiley, J R


    We examined the ability of binding sites for the herpes simplex virus immediate-early protein ICP4 to alter the regulation of closely linked promoters by placing strong ICP4 binding sites upstream or downstream of simple TATA promoters in the intact viral genome. We found that binding sites strongly reduced the levels of expression at early times postinfection and that this effect was partially overcome after the onset of viral DNA replication. These data confirm that DNA-bound ICP4 can inhibit the activity of a closely linked promoter and raise the possibility that ICP4 binding sites contribute to temporal regulation during infection.

  11. Fractionation of a tumor-initiating UV dose introduces DNA damage-retaining cells in hairless mouse skin and renders subsequent TPA-promoted tumors non-regressing.


    van de Glind, Gerline; Rebel, Heggert; van Kempen, Marika; Tensen, Kees; de Gruijl, Frank


    Sunburns and especially sub-sunburn chronic UV exposure are associated with increased risk of squamous cell carcinomas (SCCs). Here we focus on a possible difference in tumor initiation from a single severe-sunburn dose (on day 1, 21 hairless mice) and from an equal dose fractionated into very low sub-sunburn doses not causing any (growth-promoting) epidermal hyperplasia (40 days daily exposure, n=20). From day 47 all mice received 12-O-Tetradecanoylphorbol-13-acetate (TPA) applications (2x/wk) for 20 weeks to promote tumor development within the lifetime of the animals. After the sub-sunburn regimen sparse DNA damage-retaining basal cells (quiescent stem cells, QSCs) remained in the non-hyperplastic epidermis. These cells were forced to divide by TPA. After discontinuation of TPA tumors regressed and disappeared in the 'sunburn group' but persisted and grew in the 'sub-sunburn group' (0.06 vs 2.50 SCCs and precursors ≥4 mm/mouse after 280 days, p=0.03). As the tumors carried no mutations in p53, H/K/N-Ras and Notch1/2, these 'usual suspects' were not involved in the UV-driven tumor initiation. Although we could not selectively eliminate QSCs (unknown phenotype) to establish causality, our data suggest that forcing specifically DNA damage-retaining QSCs to divide--with high mutagenic risk--gives rise to persisting (mainly 'in situ') skin carcinomas. PMID:26797757

  12. A molecular beacon strategy for the thermodynamic characterization of triplex DNA: triplex formation at the promoter region of cyclin D1.


    Antony, T; Thomas, T; Sigal, L H; Shirahata, A; Thomas, T J


    We studied the formation of triplex DNA in the purine-pyrimidine-rich promoter site sequence of cyclin D1, located at -116 to -99 from the transcription initiation site, with a molecular beacon comprised of a G-rich 18-mer triplex forming oligodeoxyribonucleotide. Formation of triplex DNA was monitored by enhanced fluorescence of the beacon, due to the weakening of fluorescence energy transfer, upon its binding to the target duplex. Electrophoretic mobility shift assay confirmed triplex DNA formation by these oligonucleotides. In low salt buffer (10 mM Na(+)), triplex DNA formation was not observed in the absence of a ligand such as spermine. At room temperature (22 degrees C), the equilibrium association constant (K(a)) calculated in the presence of 1 microM spermine and 10 mM Na(+) was 3.2 x 10(8) M(-1). The K(a) value was 1.0 x 10(9) M(-1) in the presence of 150 mM Na(+), and it increased by 10-fold by the addition of 1 mM spermine. Delta H, Delta S, and Delta G of triplex DNA formation, calculated from the temperature dependence of K(a) in the range of 20--45 degrees C, were -35.9 kcal/mol, -77 cal/(mol.K), and -13 kcal/mol, respectively, in the presence of 150 mM NaCl. The corresponding values were -52.9 kcal/mol, -132.5 cal/(mol.K), and -13.4 kcal/mol in the presence of 150 mM NaCl and 1 mM spermine. Structurally related polyamines exerted different degrees of triplex DNA stabilization, as determined by binding constant measurements. Comparison of spermine versus hexamine showed a 17-fold increase in the equilibrium association constant, whereas bis(ethyl) derivatization lead to a 4-fold decrease of this value. In the absence of added duplex and polyamines, the molecular beacon dissociated with a melting temperature of 67 degrees C. Thermodynamic parameters of beacon melting were calculated from the melting curve, and the Delta H, Delta S, and Delta G values were 37.8 kcal/mol, 112 cal/(mol.K), and 4.4 kcal/mol, respectively. These results demonstrate that

  13. Methylation status of the APC and RASSF1A promoter in cell-free circulating DNA and its prognostic role in patients with colorectal cancer

    PubMed Central



    DNA methylation is the most frequent epigenetic alteration. Using methylation-specific polymerase chain reaction (MSP), the methylation status of the adenomatous polyposis coli (APC) and Ras association domain family 1 isoform A (RASSF1A) genes was examined in cell-free circulating DNA from 155 plasma samples obtained from patients with early and advanced colorectal cancer (CRC). APC and RASSF1A hypermethylation was frequently observed in both early and advanced disease, and was significantly associated with a poorer disease outcome. The methylation status of the APC and RASSF1A promoters was investigated in cell-free DNA of patients with CRC. Using MSP, the promoter methylation status of APC and RASSF1A was examined in 155 blood samples obtained from patients with CRC, 88 of whom had operable CRC (oCRC) and 67 had metastatic CRC (mCRC). The frequency of APC methylation in patients with oCRC was 33%. Methylated APC promoter was significantly associated with older age (P=0.012), higher stage (P=0.014) and methylated RASSF1A status (P=0.050). The frequency of APC methylation in patients with mCRC was 53.7%. In these patients, APC methylation was significantly associated with methylated RASSF1A status (P=0.016). The frequency of RASSF1A methylation in patients with oCRC was 25%. Methylated RASSF1A in oCRC was significantly associated with higher stage (P=0.021). The frequency of RASSF1A methylation in mCRC was 44.8%. Methylated RASSF1A in mCRC was associated with moderate differentiation (P=0.012), high levels of carcinoembryonic antigen (P=0.023) and methylated APC status (P=0.016). Patients with an unmethylated APC gene had better survival in both early (81±5 vs. 27±4 months, P<0.001) and advanced disease (37±7 vs. 15±3 months, P<0.001), compared with patients with methylated APC. Patients with an unmethylated RASSF1A gene had better survival in both early (71±6 vs. 46±8 months, P<0.001) and advanced disease (28±4 vs. 16±3 months, P<0.001) than patients with

  14. Dioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver

    PubMed Central

    Amenya, Hesbon Z.; Tohyama, Chiharu; Ohsako, Seiichiroh


    The aryl hydrocarbon receptor (Ahr) is a highly conserved nuclear receptor that plays an important role in the manifestation of toxicity induced by polycyclic aromatic hydrocarbons. As a xenobiotic sensor, Ahr is involved in chemical biotransformation through activation of drug metabolizing enzymes. The activated Ahr cooperates with coactivator complexes to induce epigenetic modifications at target genes. Thus, it is conceivable that 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a potent Ahr ligand, may elicit robust epigenetic changes in vivo at the Ahr target gene cytochrome P450 1a1 (Cyp1a1). A single dose of TCDD administered to adult mice induced Ahr-dependent CpG hypomethylation, changes in histone modifications, and thymine DNA glycosylase (Tdg) recruitment at the Cyp1a1 promoter in the liver within 24 hrs. These epigenetic changes persisted until 40 days post-TCDD treatment and there was Cyp1a1 mRNA hyperinduction upon repeat administration of TCDD at this time-point. Our demethylation assay using siRNA knockdown and an in vitro methylated plasmid showed that Ahr, Tdg, and the ten-eleven translocation methyldioxygenases Tet2 and Tet3 are required for the TCDD-induced DNA demethylation. These results provide novel evidence of Ahr-driven active DNA demethylation and epigenetic memory. The epigenetic alterations influence response to subsequent chemical exposure and imply an adaptive mechanism to xenobiotic stress. PMID:27713569

  15. Existence of G-quadruplex structures in promoter region of oncogenes confirmed by G-quadruplex DNA cross-linking strategy

    PubMed Central

    Yuan, Libo; Tian, Tian; Chen, Yuqi; Yan, Shengyong; Xing, Xiwen; Zhang, Zhengan; Zhai, Qianqian; Xu, Liang; Wang, Shaoru; Weng, Xiaocheng; Yuan, Bifeng; Feng, Yuqi; Zhou, Xiang


    Existence of G-quadruplex DNA in vivo always attract widespread interest in the field of biology and biological chemistry. We reported our findings for the existence of G-quadruplex structures in promoter region of oncogenes confirmed by G-quadruplex DNA cross-linking strategy. Probes for selective G-quadruplex cross-linking was designed and synthesized that show high selectivity for G-quadruplex cross-linking. Further biological studies demonstrated its good inhibition activity against murine melanoma cells. To further investigate if G-quadruplex DNA was formed in vivo and as the target, a derivative was synthesized and pull-down process toward chromosome DNAs combined with circular dichroism and high throughput deep sequencing were performed. Several simulated intracellular conditions, including X. laevis oocytes, Ficoll 70 and PEG, was used to investigate the compound's pure cross-linking ability upon preformed G-quadruplex. Thus, as a potent G-quadruplex cross-linking agent, our strategy provided both valuable evidence of G-quadruplex structures in vivo and intense potential in anti-cancer therapy. PMID:23657205

  16. Dioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver

    NASA Astrophysics Data System (ADS)

    Amenya, Hesbon Z.; Tohyama, Chiharu; Ohsako, Seiichiroh


    The aryl hydrocarbon receptor (Ahr) is a highly conserved nuclear receptor that plays an important role in the manifestation of toxicity induced by polycyclic aromatic hydrocarbons. As a xenobiotic sensor, Ahr is involved in chemical biotransformation through activation of drug metabolizing enzymes. The activated Ahr cooperates with coactivator complexes to induce epigenetic modifications at target genes. Thus, it is conceivable that 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a potent Ahr ligand, may elicit robust epigenetic changes in vivo at the Ahr target gene cytochrome P450 1a1 (Cyp1a1). A single dose of TCDD administered to adult mice induced Ahr-dependent CpG hypomethylation, changes in histone modifications, and thymine DNA glycosylase (Tdg) recruitment at the Cyp1a1 promoter in the liver within 24 hrs. These epigenetic changes persisted until 40 days post-TCDD treatment and there was Cyp1a1 mRNA hyperinduction upon repeat administration of TCDD at this time-point. Our demethylation assay using siRNA knockdown and an in vitro methylated plasmid showed that Ahr, Tdg, and the ten-eleven translocation methyldioxygenases Tet2 and Tet3 are required for the TCDD-induced DNA demethylation. These results provide novel evidence of Ahr-driven active DNA demethylation and epigenetic memory. The epigenetic alterations influence response to subsequent chemical exposure and imply an adaptive mechanism to xenobiotic stress.

  17. Hepatitis B virus can be inhibited by DNA methyltransferase 3a via specific zinc-finger-induced methylation of the X promoter.


    Xirong, L; Rui, L; Xiaoli, Y; Qiuyan, H; Bikui, T; Sibo, Z; Naishuo, Z


    In this work we explored whether DNA methyltransferase 3a (Dnmt3a) targeted to the HBV X promoter (XP) causes epigenetic suppression of hepatitis B virus (HBV). The C-terminus of Dnmt3a (Dnmt3aC) was fused to a six-zinc-finger peptide specific to XP to form a fused DNA methyltransferase (XPDnmt3aC). The binding and methyl-modifying specificity of XPDnmt3aC were verified with an electrophoretic mobility shift assay and methylation-specific PCR, respectively. XP activity and HBV expression were clearly downregulated in HepG2 cells transfected with plasmid pXPDnmt3aC. The injection of XPDnmt3aC into HBV transgenic (TgHBV) mice also showed significant inhibition, leading to low serum HBV surface protein (HBsAg) levels and a reduced viral load. Thus, XPDnmt3aC specifically silenced HBV via site-selective DNA methylation delivered by zinc-finger peptides. This study establishes the foundation of an epigenetic way of controlling HBV-related diseases. PMID:24794726

  18. Decorin Binding Proteins of Borrelia burgdorferi Promote Arthritis Development and Joint Specific Post-Treatment DNA Persistence in Mice

    PubMed Central

    Salo, Jemiina; Jaatinen, Annukka; Söderström, Mirva; Viljanen, Matti K.; Hytönen, Jukka


    Decorin binding proteins A and B (DbpA and B) of Borrelia burgdorferi are of critical importance for the virulence of the spirochete. The objective of the present study was to further clarify the contribution of DbpA and B to development of arthritis and persistence of B. burgdorferi after antibiotic treatment in a murine model of Lyme borreliosis. With that goal, mice were infected with B. burgdorferi strains expressing either DbpA or DbpB, or both DbpA and B, or with a strain lacking the adhesins. Arthritis development was monitored up to 15 weeks after infection, and bacterial persistence was studied after ceftriaxone and immunosuppressive treatments. Mice infected with the B. burgdorferi strain expressing both DbpA and B developed an early and prominent joint swelling. In contrast, while strains that expressed DbpA or B alone, or the strain that was DbpA and B deficient, were able to colonize mouse joints, they caused only negligible joint manifestations. Ceftriaxone treatment at two or six weeks of infection totally abolished joint swelling, and all ceftriaxone treated mice were B. burgdorferi culture negative. Antibiotic treated mice, which were immunosuppressed by anti-TNF-alpha, remained culture negative. Importantly, among ceftriaxone treated mice, B. burgdorferi DNA was detected by PCR uniformly in joint samples of mice infected with DbpA and B expressing bacteria, while this was not observed in mice infected with the DbpA and B deficient strain. In conclusion, these results show that both DbpA and B adhesins are crucial for early and prominent arthritis development in mice. Also, post-treatment borrelial DNA persistence appears to be dependent on the expression of DbpA and B on B. burgdorferi surface. Results of the immunosuppression studies suggest that the persisting material in the joints of antibiotic treated mice is DNA or DNA containing remnants rather than live bacteria. PMID:25816291

  19. Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.


    Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J


    Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

  20. DNA Methylation Adjusts the Specificity of Memories Depending on the Learning Context and Promotes Relearning in Honeybees.


    Biergans, Stephanie D; Claudianos, Charles; Reinhard, Judith; Galizia, C G


    The activity of the epigenetic writers DNA methyltransferases (Dnmts) after olfactory reward conditioning is important for both stimulus-specific long-term memory (LTM) formation and extinction. It, however, remains unknown which components of memory formation Dnmts regulate (e.g., associative vs. non-associative) and in what context (e.g., varying training conditions). Here, we address these aspects in order to clarify the role of Dnmt-mediated DNA methylation in memory formation. We used a pharmacological Dnmt inhibitor and classical appetitive conditioning in the honeybee Apis mellifera, a well characterized model for classical conditioning. We quantified the effect of DNA methylation on naïve odor and sugar responses, and on responses following olfactory reward conditioning. We show that (1) Dnmts do not influence naïve odor or sugar responses, (2) Dnmts do not affect the learning of new stimuli, but (3) Dnmts influence odor-coding, i.e., 'correct' (stimulus-specific) LTM formation. Particularly, Dnmts reduce memory specificity when experience is low (one-trial training), and increase memory specificity when experience is high (multiple-trial training), generating an ecologically more useful response to learning. (4) In reversal learning conditions, Dnmts are involved in regulating both excitatory (re-acquisition) and inhibitory (forgetting) processes. PMID:27672359

  1. DNA Methylation Adjusts the Specificity of Memories Depending on the Learning Context and Promotes Relearning in Honeybees

    PubMed Central

    Biergans, Stephanie D.; Claudianos, Charles; Reinhard, Judith; Galizia, C. G.


    The activity of the epigenetic writers DNA methyltransferases (Dnmts) after olfactory reward conditioning is important for both stimulus-specific long-term memory (LTM) formation and extinction. It, however, remains unknown which components of memory formation Dnmts regulate (e.g., associative vs. non-associative) and in what context (e.g., varying training conditions). Here, we address these aspects in order to clarify the role of Dnmt-mediated DNA methylation in memory formation. We used a pharmacological Dnmt inhibitor and classical appetitive conditioning in the honeybee Apis mellifera, a well characterized model for classical conditioning. We quantified the effect of DNA methylation on naïve odor and sugar responses, and on responses following olfactory reward conditioning. We show that (1) Dnmts do not influence naïve odor or sugar responses, (2) Dnmts do not affect the learning of new stimuli, but (3) Dnmts influence odor-coding, i.e., ‘correct’ (stimulus-specific) LTM formation. Particularly, Dnmts reduce memory specificity when experience is low (one-trial training), and increase memory specificity when experience is high (multiple-trial training), generating an ecologically more useful response to learning. (4) In reversal learning conditions, Dnmts are involved in regulating both excitatory (re-acquisition) and inhibitory (forgetting) processes.

  2. DNA Methylation Adjusts the Specificity of Memories Depending on the Learning Context and Promotes Relearning in Honeybees.


    Biergans, Stephanie D; Claudianos, Charles; Reinhard, Judith; Galizia, C G


    The activity of the epigenetic writers DNA methyltransferases (Dnmts) after olfactory reward conditioning is important for both stimulus-specific long-term memory (LTM) formation and extinction. It, however, remains unknown which components of memory formation Dnmts regulate (e.g., associative vs. non-associative) and in what context (e.g., varying training conditions). Here, we address these aspects in order to clarify the role of Dnmt-mediated DNA methylation in memory formation. We used a pharmacological Dnmt inhibitor and classical appetitive conditioning in the honeybee Apis mellifera, a well characterized model for classical conditioning. We quantified the effect of DNA methylation on naïve odor and sugar responses, and on responses following olfactory reward conditioning. We show that (1) Dnmts do not influence naïve odor or sugar responses, (2) Dnmts do not affect the learning of new stimuli, but (3) Dnmts influence odor-coding, i.e., 'correct' (stimulus-specific) LTM formation. Particularly, Dnmts reduce memory specificity when experience is low (one-trial training), and increase memory specificity when experience is high (multiple-trial training), generating an ecologically more useful response to learning. (4) In reversal learning conditions, Dnmts are involved in regulating both excitatory (re-acquisition) and inhibitory (forgetting) processes.

  3. DNA Methylation Adjusts the Specificity of Memories Depending on the Learning Context and Promotes Relearning in Honeybees

    PubMed Central

    Biergans, Stephanie D.; Claudianos, Charles; Reinhard, Judith; Galizia, C. G.


    The activity of the epigenetic writers DNA methyltransferases (Dnmts) after olfactory reward conditioning is important for both stimulus-specific long-term memory (LTM) formation and extinction. It, however, remains unknown which components of memory formation Dnmts regulate (e.g., associative vs. non-associative) and in what context (e.g., varying training conditions). Here, we address these aspects in order to clarify the role of Dnmt-mediated DNA methylation in memory formation. We used a pharmacological Dnmt inhibitor and classical appetitive conditioning in the honeybee Apis mellifera, a well characterized model for classical conditioning. We quantified the effect of DNA methylation on naïve odor and sugar responses, and on responses following olfactory reward conditioning. We show that (1) Dnmts do not influence naïve odor or sugar responses, (2) Dnmts do not affect the learning of new stimuli, but (3) Dnmts influence odor-coding, i.e., ‘correct’ (stimulus-specific) LTM formation. Particularly, Dnmts reduce memory specificity when experience is low (one-trial training), and increase memory specificity when experience is high (multiple-trial training), generating an ecologically more useful response to learning. (4) In reversal learning conditions, Dnmts are involved in regulating both excitatory (re-acquisition) and inhibitory (forgetting) processes. PMID:27672359

  4. Coordinating responses to iron and oxygen stress with DNA and mRNA promoters: the ferritin story.


    Theil, Elizabeth C


    Combinations of DNA antioxidant response element and mRNA iron responsive element regulate ferritin expression in animals in response to oxidant and iron stress, or normal developmental signals. Ferritins are protein nanocages, found in animals, plants, bacteria, and archaea, that convert iron and oxygen to ferric oxy biominerals in the protein central cavity; the mineral traps potentially toxic reactants and concentrates iron for the future synthesis of other iron/heme proteins. Regulatory signals and the nanocage gene products are the same throughout biology, but the genetic mechanisms, DNA versus DNA + mRNA, vary. The number of genes, temporal regulation, tissue distribution in multi-cellular organisms, and gene product size (maxi-ferritins have 24 subunits and mini-ferritins, or Dps proteins, have 12 subunits and are restricted to bacteria and archaea) suggest an overwhelming diversity and variability. However, common themes of regulation and function are described which indicate not only that the three-dimensional protein structure and the functions of the ferritins are conserved, but also that broad features of genetic regulation are conserved relative to organismal and/or community needs. The analysis illustrates the centrality of the ferritins to life with iron and oxygen and models how Nature harnesses potentially dangerous chemistry for biology.

  5. Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe.


    Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L


    Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration.

  6. Delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA as a cancer therapeutic: a proof-of-concept study

    PubMed Central

    Lin, Kun-Yuan; Cheng, Siao Muk; Tsai, Shing-Ling; Tsai, Ju-Ya; Lin, Chun-Hui; Cheung, Chun Hei Antonio


    Survivin is a member of the inhibitor-of-apoptosis proteins family. It is overexpressed in many different cancer types but not in the differentiated normal tissue. In addition, overexpression of survivin promotes cancer cell survival and induces chemotherapeutic drug resistance, making it an attractive target for new anticancer interventions. Despite survivin being a promising molecular target for anticancer treatment, it is widely accepted that survivin is only a “semi-druggable” target. Therefore, it is important to develop a new strategy to target survivin for anticancer treatment. In this study, we constructed a novel survivin promoter-driven full-length antisense survivin (pSur/AS-Sur) expression plasmid DNA. Promoter activity assay revealed that the activity of the survivin promoter of pSur/AS-Sur correlated with the endogenous expression of survivin at the transcriptional level in the transfected A549, MDA-MB-231, and PANC-1 cancer cells. Western blot analysis showed that liposomal delivery of pSur/AS-Sur successfully downregulated the expression of survivin in A549, MBA-MB-231, and PANC-1 cells in vitro. In addition, delivery of pSur/AS-Sur induced autophagy, caspase-dependent apoptosis, and caspase-independent apoptosis as indicated by the increased LC3B-II conversion, autophagosome formation, caspase-9/-3 and poly(ADP-ribose) polymerase-1 cleavage, and apoptosis-inducing factor nuclear translocation in A549, MBA-MB-231, and PANC-1 cells. Importantly, liposomal delivery of pSur/AS-Sur was also capable of decreasing the proliferation of the survivin/MDR1 coexpressing multidrug-resistant KB-TAX50 cancer cells and the estrogen receptor-positive tamoxifen-resistant MCF7-TamC3 cancer cells in vitro. In conclusion, the results of this study suggest that delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA is a promising way to target survivin and to treat survivin-expressing cancers in the future. PMID:27217778

  7. All-Trans Retinoic Acid Promotes TGF-β-Induced Tregs via Histone Modification but Not DNA Demethylation on Foxp3 Gene Locus

    PubMed Central

    Li, Zhiyuan; Lan, Qin; Chen, Maogen; Liu, Ya; Xia, Zanxian; Wang, Julie; Han, Yuanping; Shi, Wei; Quesniaux, Valerie; Ryffel, Bernhard; Brand, David; Li, Bin; Liu, Zhongmin; Zheng, Song Guo


    Background It has been documented all-trans retinoic acid (atRA) promotes the development of TGF-β-induced CD4+Foxp3+ regulatory T cells (iTreg) that play a vital role in the prevention of autoimmune responses, however, molecular mechanisms involved remain elusive. Our objective, therefore, was to determine how atRA promotes the differentiation of iTregs. Methodology/Principal Findings Addition of atRA to naïve CD4+CD25− cells stimulated with anti-CD3/CD28 antibodies in the presence of TGF-β not only increased Foxp3+ iTreg differentiation, but maintained Foxp3 expression through apoptosis inhibition. atRA/TGF-β-treated CD4+ cells developed complete anergy and displayed increased suppressive activity. Infusion of atRA/TGF-β-treated CD4+ cells resulted in the greater effects on suppressing symptoms and protecting the survival of chronic GVHD mice with typical lupus-like syndromes than did CD4+ cells treated with TGF-β alone. atRA did not significantly affect the phosphorylation levels of Smad2/3 and still promoted iTreg differentiation in CD4+ cells isolated from Smad3 KO and Smad2 conditional KO mice. Conversely, atRA markedly increased ERK1/2 activation, and blockade of ERK1/2 signaling completely abolished the enhanced effects of atRA on Foxp3 expression. Moreover, atRA significantly increased histone methylation and acetylation within the promoter and conserved non-coding DNA sequence (CNS) elements at the Foxp3 gene locus and the recruitment of phosphor-RNA polymerase II, while DNA methylation in the CNS3 was not significantly altered. Conclusions/Significance We have identified the cellular and molecular mechanism(s) by which atRA promotes the development and maintenance of iTregs. These results will help to enhance the quantity and quality of development of iTregs and may provide novel insights into clinical cell therapy for patients with autoimmune diseases and those needing organ transplantation. PMID:21931768

  8. Antimicrobial peptide LL-37 promotes the proliferation and invasion of skin squamous cell carcinoma by upregulating DNA-binding protein A

    PubMed Central

    Wang, Wei; Jia, Jinjing; Li, Changji; Duan, Qiqi; Yang, Jiao; Wang, Xin; Li, Ruilian; Chen, Caifeng; Yan, Huling; Zheng, Yan


    The antimicrobial peptide LL-37 not only contributes to the host defence against microbial invasion but also regulates immune activity, angiogenesis and cell proliferation. Studies have shown that LL-37 participates in the development of a variety of tumours, such as lung cancer, ovarian cancer, breast cancer and melanoma. However, the role of LL-37 in the development of skin squamous cell carcinoma (SCC) is not clear. The present study used immunohistochemistry to confirm that the expression of human DNA-binding protein A (dbpA) was increased in SCC tissues. After stimulating SCC A341 cells, LL-37 was shown promote the proliferation, migration and invasion of these malignant cells. LL-37 also promoted the upregulation of dbpA mRNA and protein expression. In addition, after using small interfering RNA to silence the normal dbpA expression in these malignant cells, the proliferation and invasion of the tumor cells were significantly reduced. When the NF-κB inhibitor PDTC was used to inhibit the process of LL-37-stimulated cells, it was found that the original upregulated expression of dbpA was downregulated. Overall, the present demonstrated that by upregulating the expression of dbpA, LL-37 can promote the proliferation and invasion of tumour cells, and that this process depends on the NF-κB signalling pathway. PMID:27588122

  9. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    PubMed Central

    Ignatieva, Elena V.; Levitsky, Victor G.; Yudin, Nikolay S.; Moshkin, Mikhail P.; Kolchanov, Nikolay A.


    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100–1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli. PMID:24715883

  10. DNA-binding site for two skeletal actin promoter factors is important for expression in muscle cells

    SciTech Connect

    Walsh, K.; Schimmel, P.


    Two nuclear factors bind to the same site in the chicken skeletal actin promoter. Mutations in the footprint sequence which eliminate detectable binding decrease expression in transfected skeletal muscle cells by a factor of 25 to 50 and do not elevate the flow expression in nonmuscle cells. These results show that the factor-binding site contributes to the activation of expression in muscle cells and that it alone does not contribute significantly to repress expression in nonmuscle cells.

  11. Sublethal concentrations of di-n-butyl phthalate promote biochemical changes and DNA damage in juvenile Nile tilapia (Oreochromis niloticus).


    Khalil, Samah R; Abd Elhakim, Yasser; El-Murr, Abd Elhakeem


    Increase in consumption of consumer items such as plasticizers have resulted in a sharp rise in the presence of xenobiotics like phthalic acid esters (PEs) in freshwater and marine environments due to contaminated runoff and improper release of effluents. The sublethal toxicity of Di-n-butyl phthalate (DBP) was investigated in juvenile Nile tilapia, Oreochromis niloticus, in an attempt to determine the biological effect of exposure to 1/2 and 1/3 median lethal concentration (96-h LC50) which, in our study was experimentally determined to be 11.8 mg/l. Following four days of exposure, indices of the oxidative potential [Malondialdehyde content (MDA)], antioxidant parameters [superoxide dismutase activity (SOD) and reduced glutathione level (GSH)] and DNA damage were evaluated by single-cell gel electrophoresis (Comet assay). Hepato-renal markers [alanine aminotransferase activity (ALT), creatinine and urea level] and cortisol levels were also quantified in serum. Additionally, histopathological investigations of liver, kidney and gill tissues were conducted. Comparative results between the 1/2 96-h LC50 group and the 1/3 96-h LC50 group clearly showed that there was a significant elevation in MDA levels and a marked increase in DNA damage in addition to inhibition of antioxidant barriers as represented by attenuation of SOD activity and GSH level in the group that was exposed to higher concentration of DBP (1/2 96-h LC50). The hepatorenal markers and cortisol levels were also observed to be elevated. Histopathological examination of the liver, kidney and gills showed pathological alterations that could be correlated with changes in the biochemical profile of the exposed fish. Additionally, anomalous clinical signs were noted. Based on these findings, we conclude from our study that exposure of juvenile O. niloticus to DBP has the potential to induce biochemical as well as tissue morphological alterations associated with oxidative injury and DNA damage. PMID:27348890

  12. Deletion of A-antigen in a human cancer cell line is associated with reduced promoter activity of CBF/NF-Y binding region, and possibly with enhanced DNA methylation of A transferase promoter.


    Iwamoto, S; Withers, D A; Handa, K; Hakomori, S


    Employing blood group A- and A+ clones derived from the same parental colonic cancer cell lines, we studied the molecular mechanism of deletion/reduction vs. continuous expression of A antigen in A tumors, a crucial determinant of human tumor malignancy. A- transferase mRNA level in one of the A- clones (A- SW480) was undetectable, while that in A+ SW480 was strongly detectable by semiquantitative RT-PCR. Relatively lower (approximately 1/3) transcript level was detectable in another A- clone (A- HT29) in comparison to A+ HT29 by the same RT-PCR procedure, although none of these tumor cell lines showed detectable level of A transcript by Northern blotting or RNase protection methods. Therefore, subsequent studies were performed employing A- vs. A+ SW480 clones. Deletion of A transcript in A- cells was not due to gene deletion, since Southern blot analysis showed equal presence of genomic DNA regardless of A- vs. A+ (SW480 or HT29) or B+ (KATOIII) tumor cells. Two transcriptional control mechanisms leading to differences of A expression in SW480 cells are indicated. i. Luciferase assay in A- and A+ SW480 cells showed that promoter activities of segments of 5' flanking sequence of ABO gene reflected transcript levels in these cell lines. The enhancing activity of a 43 bp tandem repeat unit located between -3899 to -3618 was reduced in A- compared to A+ cells. ii. Distinct differences in the pattern of CpG dinucleotide methylation were found in A- vs. A+ cells. Therefore, the methylation process of A promoter DNA may be another important factor controlling A activity in SW480 tumor cells. Since proliferation and motility of tumor cells are associated closely with A expression, transcription control mechanism for expression of A transferase as described above may be of crucial importance in defining human tumor malignancy. PMID:10972144

  13. Human amiloride-sensitive epithelial Na+ channel gamma subunit promoter: functional analysis and identification of a polypurine-polypyrimidine tract with the potential for triplex DNA formation.

    PubMed Central

    Auerbach, S D; Loftus, R W; Itani, O A; Thomas, C P


    The mRNA for the epithelial Na(+) channel gamma subunit (gammaENaC) is regulated developmentally in the lung, colon and distal nephron and in response to Na(+) deprivation and systemic corticosteroids in the distal colon. Because such regulation is likely to be at the level of gene transcription, we examined the function of the promoter and other 5' flanking elements of the human gammaENaC gene. The proximal 5' flanking region contains two GC boxes but does not contain a TATA box. A 450 bp human gammaENaC fragment (-459 to +40) directed the expression of luciferase in H441 cells and primer extension analysis in transfected cells confirmed the correct initiation of human gammaENaC-luciferase chimaeric transcripts. By deletional analysis, GC boxes at -21 and -52 were found to be critical for this promoter activity. To begin to identify transcription factors that bind to the core promoter, a double-stranded oligonucleotide that corresponded to this region was synthesized and tested in a gel mobility-shift assay. Incubation of this radiolabelled oligonucleotide with nuclear extracts from H441 and FRTL5 cells resulted in the formation of four specific and distinct DNA-protein complexes. On the basis of antibody 'supershift' assays, one of these factors corresponds to Sp1, whereas the other three correspond to Sp3. Further upstream, an approx. 300 nt (-1143 to -839) polypurine-polypyrimidine tract (PPy tract) containing internal mirror repeats was identified. When contained in a supercoiled plasmid, the approx. 1200 nt 5' flanking region was sensitive to S1 endonuclease, which was consistent with the formation of an intramolecular triplex DNA ('H-DNA') structure with an unpaired single strand. High-resolution mapping with S1 endonuclease and sequencing of S1-generated clones confirmed that all S1-sensitive sites were within the PPy tract. Finally, a negative regulatory element was identified between -1525 and -1296 that functioned in lung, colon and collecting duct cell

  14. STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors.


    Deng, Liufu; Liang, Hua; Xu, Meng; Yang, Xuanming; Burnette, Byron; Arina, Ainhoa; Li, Xiao-Dong; Mauceri, Helena; Beckett, Michael; Darga, Thomas; Huang, Xiaona; Gajewski, Thomas F; Chen, Zhijian J; Fu, Yang-Xin; Weichselbaum, Ralph R


    Ionizing radiation-mediated tumor regression depends on type I interferon (IFN) and the adaptive immune response, but several pathways control I IFN induction. Here, we demonstrate that adaptor protein STING, but not MyD88, is required for type I IFN-dependent antitumor effects of radiation. In dendritic cells (DCs), STING was required for IFN-? induction in response to irradiated-tumor cells. The cytosolic DNA sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) mediated sensing of irradiated-tumor cells in DCs. Moreover, STING was essential for radiation-induced adaptive immune responses, which relied on type I IFN signaling on DCs. Exogenous IFN-? treatment rescued the cross-priming by cGAS or STING-deficient DCs. Accordingly, activation of STING by a second messenger cGAMP administration enhanced antitumor immunity induced by radiation. Thus radiation-mediated antitumor immunity in immunogenic tumors requires a functional cytosolic DNA-sensing pathway and suggests that cGAMP treatment might provide a new strategy to improve radiotherapy.

  15. Elevated cyclin A associated kinase activity promotes sensitivity of metastatic human cancer cells to DNA antimetabolite drug

    PubMed Central



    Drug resistance is a major obstacle in successful systemic therapy of metastatic cancer. We analyzed the involvement of cell cycle regulatory proteins in eliciting response to N (phosphonoacetyl)-L-aspartate (PALA), an inhibitor of de novo pyrimidine synthesis, in two metastatic variants of human cancer cell line MDA-MB-435 isolated from lung (L-2) and brain (Br-1) in nude mouse, respectively. L-2 and Br-l cells markedly differed in their sensitivity to PALA. While both cell types displayed an initial S phase delay/arrest, Br-l cells proliferated but most L-2 cells underwent apoptosis. There was distinct elevation in cyclin A, and phosphorylated Rb proteins concomitant with decreased expression of bcl-2 protein in the PALA treated L-2 cells undergoing apoptosis. Markedly elevated cyclin A associated and cdk2 kinase activities together with increased E2F1-DNA binding were detected in these L-2 cells. Induced ectopic cyclin A expression sensitized Br-l cells to PALA by activating an apoptotic pathway. Our findings demonstrate that elevated expression of cyclin A and associated kinase can activate an apoptotic pathway in cells exposed to DNA antimetabolites. Abrogation of this pathway can lead to resistance against these drugs in metastatic variants of human carcinoma cells. PMID:26058363

  16. DNA Methylation Profiling Revealed Promoter Hypermethylation-induced Silencing of p16, DDAH2 and DUSP1 in Primary Oral Squamous Cell Carcinoma

    PubMed Central

    Khor, Goot Heah; Froemming, Gabriele Ruth Anisah; Zain, Rosnah Binti; Abraham, Mannil Thomas; Omar, Effat; Tan, Su Keng; Tan, Aik Choon; Vincent-Chong, Vui King; Thong, Kwai Lin


    Background: Hypermethylation in promoter regions of genes might lead to altered gene functions and result in malignant cellular transformation. Thus, biomarker identification for hypermethylated genes would be very useful for early diagnosis, prognosis, and therapeutic treatment of oral squamous cell carcinoma (OSCC). The objectives of this study were to screen and validate differentially hypermethylated genes in OSCC and correlate the hypermethylation-induced genes with demographic, clinocopathological characteristics and survival rate of OSCC. Methods: DNA methylation profiling was utilized to screen the differentially hypermethylated genes in OSCC. Three selected differentially-hypermethylated genes of p16, DDAH2 and DUSP1 were further validated for methylation status and protein expression. The correlation between demographic, clinicopathological characteristics, and survival rate of OSCC patients with hypermethylation of p16, DDAH2 and DUSP1 genes were analysed in the study. Results: Methylation profiling demonstrated 33 promoter hypermethylated genes in OSCC. The differentially-hypermethylated genes of p16, DDAH2 and DUSP1 revealed positivity of 78%, 80% and 88% in methylation-specific polymerase chain reaction and 24% and 22% of immunoreactivity in DDAH2 and DUSP1 genes, respectively. Promoter hypermethylation of p16 gene was found significantly associated with tumour site of buccal, gum, tongue and lip (P=0.001). In addition, DDAH2 methylation level was correlated significantly with patients' age (P=0.050). In this study, overall five-year survival rate was 38.1% for OSCC patients and was influenced by sex difference. Conclusions: The study has identified 33 promoter hypermethylated genes that were significantly silenced in OSCC, which might be involved in an important mechanism in oral carcinogenesis. Our approaches revealed signature candidates of differentially hypermethylated genes of DDAH2 and DUSP1 which can be further developed as potential

  17. Environmental Tobacco Smoke Exposure during Intrauterine Period, Promotes Caspase Dependent and Independent DNA Fragmentation in Sertoli-Germ Cells

    PubMed Central

    Yüksel, Beril; Kilic, Sevtap; Lortlar, Nese; Tasdemir, Nicel; Sertyel, Semra; Bardakci, Yesim; Aksu, Tarik; Batioglu, Sertaç


    Objectives. To investigate the effect of cigarette smoke exposure during intrauterine period on neonatal rat testis. Methods. Twenty-five rats were randomized to be exposed to cigarette smoke with the Walton Smoking Machine or to room air during their pregnancies. The newborn male rats (n = 21) were grouped as group 1 (n = 15) which were exposed to cigarette smoke during intrauterine life and group 2 (n = 6) which were exposed to room air during intrauterine life. The orchiectomy materials were analyzed with TUNEL immunofluorescent staining for detection of DNA damage. To detect apoptosis, immunohistochemical analyses with caspase-3 were performed. Primary outcomes were apoptotic index and immunohistochemical scores (HSCORES); secondary outcomes were Sertoli-cell count and birth-weight of rats. Results. Sertoli cell apoptosis was increased in group 1 (HSCORE = 210.6 ± 41.9) when compared to group 2 (HSCORE = 100.0 ± 17.8) (P = 0.001). Sertoli cell count was decreased in group 1 (P = 0.043). The HSCORE for the germ cells was calculated as 214.0 ± 46.2 in group 1 and 93.3 ± 10.3 in group 2 (P = 0.001) referring to an increased germ cell apoptosis in group 1. The apoptotic indexes for group 1 were 49.6 ± 9.57 and 29.98 ± 2.34 for group 2 (P = 0.001). The immunofluorescent technique demonstrated increased DNA damage in seminiferous epithelium in group 1. Conclusions. Intrauterine exposure to cigarette smoke adversely affects neonatal testicular structuring and diminishes testicular reserve. PMID:25045542

  18. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    NASA Astrophysics Data System (ADS)

    Huang, Yong-Zhen; Zhang, Liang-Zhi; Lai, Xin-Sheng; Li, Ming-Xun; Sun, Yu-Jia; Li, Cong-Jun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong


    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P < 0.05). A luciferase assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P < 0.05). An over-expression assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro. Taken together, these results suggest that ZBED6 inhibits IGF2 activity and expression via a G to A transition disrupts the interaction. Thus, we propose that ZBED6 plays a critical role in myogenic differentiation.

  19. Crystallographic analysis of an RNA polymerase σ-subunit fragment complexed with -10 promoter element ssDNA: quadruplex formation as a possible tool for engineering crystal contacts in protein-ssDNA complexes.


    Feklistov, Andrey; Darst, Seth A


    Structural studies of -10 promoter element recognition by domain 2 of the RNA polymerase σ subunit [Feklistov & Darst (2011), Cell, 147, 1257-1269] reveal an unusual crystal-packing arrangement dominated by G-quartets. The 3'-terminal GGG motif of the oligonucleotide used in crystallization participates in G-quadruplex formation with GGG motifs from symmetry-related complexes. Stacking between neighboring G-quadruplexes results in the formation of pseudo-continuous four-stranded columns running throughout the length of the crystal (G-columns). Here, a new crystal form is presented with a different arrangement of G-columns and it is proposed that the fortuitous finding of G-quartet packing could be useful in engineering crystal contacts in protein-ssDNA complexes. PMID:23989139

  20. DNA damage-induced ephrin-B2 reverse signaling promotes chemoresistance and drives EMT in colorectal carcinoma harboring mutant p53.


    Alam, S K; Yadav, V K; Bajaj, S; Datta, A; Dutta, S K; Bhattacharyya, M; Bhattacharya, S; Debnath, S; Roy, S; Boardman, L A; Smyrk, T C; Molina, J R; Chakrabarti, S; Chowdhury, S; Mukhopadhyay, D; Roychoudhury, S


    Mutation in the TP53 gene positively correlates with increased incidence of chemoresistance in different cancers. In this study, we investigated the mechanism of chemoresistance and epithelial-to-mesenchymal transition (EMT) in colorectal cancer involving the gain-of-function (GOF) mutant p53/ephrin-B2 signaling axis. Bioinformatic analysis of the NCI-60 data set and subsequent hub prediction identified EFNB2 as a possible GOF mutant p53 target gene, responsible for chemoresistance. We show that the mutant p53-NF-Y complex transcriptionally upregulates EFNB2 expression in response to DNA damage. Moreover, the acetylated form of mutant p53 protein is recruited on the EFNB2 promoter and positively regulates its expression in conjunction with coactivator p300. In vitro cell line and in vivo nude mice data show that EFNB2 silencing restores chemosensitivity in mutant p53-harboring tumors. In addition, we observed high expression of EFNB2 in patients having neoadjuvant non-responder colorectal carcinoma compared with those having responder version of the disease. In the course of deciphering the drug resistance mechanism, we also show that ephrin-B2 reverse signaling induces ABCG2 expression after drug treatment that involves JNK-c-Jun signaling in mutant p53 cells. Moreover, 5-fluorouracil-induced ephrin-B2 reverse signaling promotes tumorigenesis through the Src-ERK pathway, and drives EMT via the Src-FAK pathway. We thus conclude that targeting ephrin-B2 might enhance the therapeutic potential of DNA-damaging chemotherapeutic agents in mutant p53-bearing human tumors.

  1. Recurrent patterns of DNA methylation in the ZNF154, CASP8, and VHL promoters across a wide spectrum of human solid epithelial tumors and cancer cell lines

    PubMed Central

    Sánchez-Vega, Francisco; Gotea, Valer; Petrykowska, Hanna M; Margolin, Gennady; Krivak, Thomas C; DeLoia, Julie A; Bell, Daphne W; Elnitski, Laura


    The study of aberrant DNA methylation in cancer holds the key to the discovery of novel biological markers for diagnostics and can help to delineate important mechanisms of disease. We have identified 12 loci that are differentially methylated in serous ovarian cancers and endometrioid ovarian and endometrial cancers with respect to normal control samples. The strongest signal showed hypermethylation in tumors at a CpG island within the ZNF154 promoter. We show that hypermethylation of this locus is recurrent across solid human epithelial tumor samples for 15 of 16 distinct cancer types from TCGA. Furthermore, ZNF154 hypermethylation is strikingly present across a diverse panel of ENCODE cell lines, but only in those derived from tumor cells. By extending our analysis from the Illumina 27K Infinium platform to the 450K platform, to sequencing of PCR amplicons from bisulfite treated DNA, we demonstrate that hypermethylation extends across the breadth of the ZNF154 CpG island. We have also identified recurrent hypomethylation in two genomic regions associated with CASP8 and VHL. These three genes exhibit significant negative correlation between methylation and gene expression across many cancer types, as well as patterns of DNaseI hypersensitivity and histone marks that reflect different chromatin accessibility in cancer vs. normal cell lines. Our findings emphasize hypermethylation of ZNF154 as a biological marker of relevance for tumor identification. Epigenetic modifications affecting the promoters of ZNF154, CASP8, and VHL are shared across a vast array of tumor types and may therefore be important for understanding the genomic landscape of cancer. PMID:24149212

  2. Nature of DNA binding and RNA polymerase interaction of the Bordetella pertussis BvgA transcriptional activator at the fha promoter.

    PubMed Central

    Boucher, P E; Murakami, K; Ishihama, A; Stibitz, S


    The expression of virulence factor genes in Bordetella pertussis is mediated by the BvgA-BvgS two-component signal transduction system. The response regulator, BvgA, acts directly as a transcriptional activator at the loci encoding pertussis toxin (ptx) and filamentous hemagglutinin (fha). Previous studies have demonstrated that these two loci are differentially regulated by BvgA. As an initial step in gaining insight into the mechanism underlying this differential regulation, we initiated DNA binding and in vitro transcription analyses to examine the activities of BvgA and RNA polymerase (RNAP) purified from both B. pertussis and Escherichia coli at the fha promoter. We discovered that unphosphorylated BvgA binds to a single region (-100 to -70, relative to the start of transcription), whereas phosphorylated BvgA binds both this region and another, farther downstream, that extends to the -35 nucleotide. In the absence of BvgA, RNAP binds a region farther upstream than expected (-104 to -35). However, occupation of both sites by BvgA phosphate repositions RNAP to the site used in vivo. The binding of BvgA phosphate to the downstream site correlates with in vitro transcriptional activity at the fha promoter. As the DNA binding and transcription activities of the E. coli-derived RNAP are similar to those observed for the B. pertussis enzyme, we employed several mutant E. coli proteins in in vitro transcription analyses. We observed that polymerases carrying either a deletion of the C-terminal domain of the alpha subunit or substitution of alanine at either of two critical residues within this domain were severely impaired in the ability to mediate BvgA-activated transcription at fha. PMID:9045838

  3. Intra-uterine undernutrition amplifies age-associated glucose intolerance in pigs via altered DNA methylation at muscle GLUT4 promoter.


    Wang, Jun; Cao, Meng; Yang, Mei; Lin, Yan; Che, Lianqiang; Fang, Zhengfeng; Xu, Shengyu; Feng, Bin; Li, Jian; Wu, De


    The present study aimed to investigate the effect of maternal malnutrition on offspring glucose tolerance and the epigenetic mechanisms involved. In total, twelve primiparous Landrace×Yorkshire gilts were fed rations providing either 100 % (control (CON)) or 75 % (undernutrition (UN)) nutritional requirements according to the National Research Council recommendations, throughout gestation. Muscle samples of offspring were collected at birth (dpn1), weaning (dpn28) and adulthood (dpn189). Compared with CON pigs, UN pigs showed lower serum glucose concentrations at birth, but showed higher serum glucose and insulin concentrations as well as increased area under the blood glucose curve during intravenous glucose tolerance test at dpn189 (P<0·05). Compared with CON pigs, GLUT-4 gene and protein expressions were decreased at dpn1 and dpn189 in the muscle of UN pigs, which was accompanied by increased methylation at the GLUT4 promoter (P<0·05). These alterations in methylation concurred with increased mRNA levels of DNA methyltransferase (DNMT) 1 at dpn1 and dpn28, DNMT3a at dpn189 and DNMT3b at dpn1 in UN pigs compared with CON pigs (P<0·05). Interestingly, although the average methylation levels at the muscle GLUT4 promoter were decreased at dpn189 compared with dpn1 in pigs exposed to a poor maternal diet (P<0·05), the methylation differences in individual CpG sites were more pronounced with age. Our results indicate that in utero undernutrition persists to silence muscle GLUT4 likely through DNA methylation during the ageing process, which may lead to the amplification of age-associated glucose intolerance. PMID:27265204

  4. Diphenylarsinic acid, a chemical warfare-related neurotoxicant, promotes liver carcinogenesis via activation of aryl hydrocarbon receptor signaling and consequent induction of oxidative DNA damage in rats.


    Wei, Min; Yamada, Takanori; Yamano, Shotaro; Kato, Minoru; Kakehashi, Anna; Fujioka, Masaki; Tago, Yoshiyuki; Kitano, Mistuaki; Wanibuchi, Hideki


    Diphenylarsinic acid (DPAA), a chemical warfare-related neurotoxic organic arsenical, is present in the groundwater and soil in some regions of Japan due to illegal dumping after World War II. Inorganic arsenic is carcinogenic in humans and its organic arsenic metabolites are carcinogenic in animal studies, raising serious concerns about the carcinogenicity of DPAA. However, the carcinogenic potential of DPAA has not yet been evaluated. In the present study we found that DPAA significantly enhanced the development of diethylnitrosamine-induced preneoplastic lesions in the liver in a medium-term rat liver carcinogenesis assay. Evaluation of the expression of cytochrome P450 (CYP) enzymes in the liver revealed that DPAA induced the expression of CYP1B1, but not any other CYP1, CYP2, or CYP3 enzymes, suggesting that CYP1B1 might be the enzyme responsible for the metabolic activation of DPAA. We also found increased oxidative DNA damage, possibly due to elevated CYP1B1 expression. Induction of CYP1B1 has generally been linked with the activation of AhR, and we found that DPAA activates the aryl hydrocarbon receptor (AhR). Importantly, the promotion effect of DPAA was observed only at a dose that activated the AhR, suggesting that activation of AhR and consequent induction of AhR target genes and oxidative DNA damage plays a vital role in the promotion effects of DPAA. The present study provides, for the first time, evidence regarding the carcinogenicity of DPAA and indicates the necessity of comprehensive evaluation of its carcinogenic potential using long-term carcinogenicity studies.

  5. DNA damage-induced ephrin-B2 reverse signaling promotes chemoresistance and drives EMT in colorectal carcinoma harboring mutant p53.


    Alam, S K; Yadav, V K; Bajaj, S; Datta, A; Dutta, S K; Bhattacharyya, M; Bhattacharya, S; Debnath, S; Roy, S; Boardman, L A; Smyrk, T C; Molina, J R; Chakrabarti, S; Chowdhury, S; Mukhopadhyay, D; Roychoudhury, S


    Mutation in the TP53 gene positively correlates with increased incidence of chemoresistance in different cancers. In this study, we investigated the mechanism of chemoresistance and epithelial-to-mesenchymal transition (EMT) in colorectal cancer involving the gain-of-function (GOF) mutant p53/ephrin-B2 signaling axis. Bioinformatic analysis of the NCI-60 data set and subsequent hub prediction identified EFNB2 as a possible GOF mutant p53 target gene, responsible for chemoresistance. We show that the mutant p53-NF-Y complex transcriptionally upregulates EFNB2 expression in response to DNA damage. Moreover, the acetylated form of mutant p53 protein is recruited on the EFNB2 promoter and positively regulates its expression in conjunction with coactivator p300. In vitro cell line and in vivo nude mice data show that EFNB2 silencing restores chemosensitivity in mutant p53-harboring tumors. In addition, we observed high expression of EFNB2 in patients having neoadjuvant non-responder colorectal carcinoma compared with those having responder version of the disease. In the course of deciphering the drug resistance mechanism, we also show that ephrin-B2 reverse signaling induces ABCG2 expression after drug treatment that involves JNK-c-Jun signaling in mutant p53 cells. Moreover, 5-fluorouracil-induced ephrin-B2 reverse signaling promotes tumorigenesis through the Src-ERK pathway, and drives EMT via the Src-FAK pathway. We thus conclude that targeting ephrin-B2 might enhance the therapeutic potential of DNA-damaging chemotherapeutic agents in mutant p53-bearing human tumors. PMID:26494468

  6. The Myc Transactivation Domain Promotes Global Phosphorylation of the RNA Polymerase II Carboxy-Terminal Domain Independently of Direct DNA Binding▿ †

    PubMed Central

    Cowling, Victoria H.; Cole, Michael D.


    Myc is a transcription factor which is dependent on its DNA binding domain for transcriptional regulation of target genes. Here, we report the surprising finding that Myc mutants devoid of direct DNA binding activity and Myc target gene regulation can rescue a substantial fraction of the growth defect in myc−/− fibroblasts. Expression of the Myc transactivation domain alone induces a transcription-independent elevation of the RNA polymerase II (Pol II) C-terminal domain (CTD) kinases cyclin-dependent kinase 7 (CDK7) and CDK9 and a global increase in CTD phosphorylation. The Myc transactivation domain binds to the transcription initiation sites of these promoters and stimulates TFIIH binding in an MBII-dependent manner. Expression of the Myc transactivation domain increases CDK mRNA cap methylation, polysome loading, and the rate of translation. We find that some traditional Myc transcriptional target genes are also regulated by this Myc-driven translation mechanism. We propose that Myc transactivation domain-driven RNA Pol II CTD phosphorylation has broad effects on both transcription and mRNA metabolism. PMID:17242204

  7. Phloroglucinol enhances the repair of UVB radiation-induced DNA damage via promotion of the nucleotide excision repair system in vitro and in vivo.


    Piao, Mei Jing; Ahn, Mee Jung; Kang, Kyoung Ah; Kim, Ki Cheon; Cha, Ji Won; Lee, Nam Ho; Hyun, Jin Won


    Exposure to solar UVB radiation can lead to the formation of DNA lesions such as cyclobutane pyrimidine dimers (CPDs). Nucleotide excision repair (NER) is critical for the repair of CPDs induced by UV radiation. The purpose of this study was to investigate the ability of phloroglucinol to protect against the formation of UVB-induced CPDs in vitro and in vivo. Exposure to UVB radiation increased the number of CPDs in both HaCaT keratinocytes and mouse skin; however, these increases were reduced by treatment with phloroglucinol. Expression levels of xeroderma pigmentosum complementation group C (XPC) and excision repair cross-complementation 1 (ERCC1), which are essential components of the NER pathway, were reduced following UVB exposure, although phloroglucinol treatment recovered these levels in both HaCaT keratinocytes and mouse skin. Phloroglucinol also inhibited UVB-induced reductions in binding of the transcription factors specificity protein 1 to the XPC promoter. These results demonstrate that phloroglucinol can protect cells against UVB-induced DNA damage by inducing NER. PMID:25766644

  8. Nucleoside diphosphate kinase from Mycobacterium tuberculosis cleaves single strand DNA within the human c-myc promoter in an enzyme-catalyzed reaction.


    Kumar, Praveen; Verma, Anjali; Saini, Adesh Kumar; Chopra, Puneet; Chakraborti, Pradip K; Singh, Yogendra; Chowdhury, Shantanu


    The reason for secretion of nucleoside diphosphate kinase (NdK), an enzyme involved in maintaining the cellular pool of nucleoside triphosphates in both prokaryotes and eukaryotes, by Mycobacterium tuberculosis is intriguing. We recently observed that NdK from M.tuberculosis (mNdK) localizes within nuclei of HeLa and COS-1 cells and also nicks chromosomal DNA in situ (A. K. Saini, K. Maithal, P. Chand, S. Chowdhury, R. Vohra, A. Goyal, G. P. Dubey, P. Chopra, R. Chandra, A. K. Tyagi, Y. Singh and V. Tandon (2004) J. Biol. Chem., 279, 50142-50149). In the current study, using a molecular beacon approach, we demonstrate that the mNdK catalyzes the cleavage of single strand DNA. It displays Michaelis-Menten kinetics with a kcat/K(M) of 9.65 (+/-0.88) x 10(6) M(-1) s(-1). High affinity (K(d) approximately K(M) of approximately 66 nM) and sequence-specific binding to the sense strand of the nuclease hypersensitive region in the c-myc promoter was observed. This is the first study demonstrating that the cleavage reaction is also enzyme-catalyzed in addition to the enzymatic kinase activity of multifunctional NdK. Using our approach, we demonstrate that GDP competitively inhibits the nuclease activity with a K(I) of approximately 1.9 mM. Recent evidence implicates mNdK as a potent virulence factor in tuberculosis owing to its DNase-like activity. In this context, our results demonstrate a molecular mechanism that could be the basis for assessing in situ DNA damage by secretory mNdK.

  9. Trehalose-Based Block Copolycations Promote Polyplex Stabilization for Lyophilization and in Vivo pDNA Delivery

    PubMed Central


    The development and thorough characterization of nonviral delivery agents for nucleic acid and genome editing therapies are of high interest to the field of nanomedicine. Indeed, this vehicle class offers the ability to tune chemical architecture/biological activity and readily package nucleic acids of various sizes and morphologies for a variety of applications. Herein, we present the synthesis and characterization of a class of trehalose-based block copolycations designed to stabilize polyplex formulations for lyophilization and in vivo administration. A 6-methacrylamido-6-deoxy trehalose (MAT) monomer was synthesized from trehalose and polymerized via reversible addition–fragmentation chain transfer (RAFT) polymerization to yield pMAT43. The pMAT43 macro-chain transfer agent was then chain-extended with aminoethylmethacrylamide (AEMA) to yield three different pMAT-b-AEMA cationic-block copolymers, pMAT-b-AEMA-1 (21 AEMA repeats), -2 (44 AEMA repeats), and -3 (57 AEMA repeats). These polymers along with a series of controls were used to form polyplexes with plasmids encoding firefly luciferase behind a strong ubiquitous promoter. The trehalose-coated polyplexes were characterized in detail and found to be resistant to colloidal aggregation in culture media containing salt and serum. The trehalose-polyplexes also retained colloidal stability and promoted high gene expression following lyophilization and reconstitution. Cytotoxicity, cellular uptake, and transfection ability were assessed in vitro using both human glioblastoma (U87) and human liver carcinoma (HepG2) cell lines wherein pMAT-b-AEMA-2 was found to have the optimal combination of high gene expression and low toxicity. pMAT-b-AEMA-2 polyplexes were evaluated in mice via slow tail vein infusion. The vehicle displayed minimal toxicity and discouraged nonspecific internalization in the liver, kidney, spleen, and lungs as determined by quantitative polymerase chain reaction (qPCR) and fluorescence imaging

  10. Antisense vimentin cDNA combined with chondroitinase ABC promotes axon regeneration and functional recovery following spinal cord injury in rats.


    Xia, Yongzhi; Yan, Yi; Xia, Haijian; Zhao, Tianzhi; Chu, Weihua; Hu, Shengli; Feng, Hua; Lin, Jiangkai


    The formation of glial scar restricts axon regeneration after spinal cord injury (SCI) in adult mammalian. Chondroitin sulfate proteoglycans (CSPGs) are mostly secreted by reactive astrocytes, which form dense scar tissues after SCI. Chondroitinase ABC (ChABC), which can digest CSPGs, is a promising therapeutic strategy for SCI. However, to date ChABC has exhibited only limited success in the treatment of chronic SCI. The intermediate filament protein vimentin underpins the cytoskeleton of reactive astrocytes. We targeted glial scar in injured spinal cord by sustained infusion of ChABC and antisense vimentin cDNA. Using anterograde tracing, BBB scoring and hind limb placing response, we found that this combined treatment promoted axon regeneration and functional recovery after SCI in rats. Our results indicate that axon regeneration may be promoted by modified physical and biochemical characteristics of intra- and extracellular architecture in glial scar tissues. Theses findings could potentially help us to understand better the composition of glial scar in central nervous system injury.

  11. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    SciTech Connect

    Pittius, C.W.; Hennighausen, L.; Lee, E.; Westphal, H.; Nicols, E.; Vitale, J.; Gordon, K. )


    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation.

  12. A palindromic regulatory site within vertebrate GATA-1 promoters requires both zinc fingers of the GATA-1 DNA-binding domain for high-affinity interaction.


    Trainor, C D; Omichinski, J G; Vandergon, T L; Gronenborn, A M; Clore, G M; Felsenfeld, G


    GATA-1, a transcription factor essential for the development of the erythroid lineage, contains two adjacent highly conserved zinc finger motifs. The carboxy-terminal finger is necessary and sufficient for specific binding to the consensus GATA recognition sequence: mutant proteins containing only the amino-terminal finger do not bind. Here we identify a DNA sequence (GATApal) for which the GATA-1 amino-terminal finger makes a critical contribution to the strength of binding. The site occurs in the GATA-1 gene promoters of chickens, mice, and humans but occurs very infrequently in other vertebrate genes known to be regulated by GATA proteins. GATApal is a palindromic site composed of one complete [(A/T)GATA(A/G)] and one partial (GAT) canonical motif. Deletion of the partial motif changes the site to a normal GATA site and also reduces by as much as eightfold the activity of the GATA-1 promoter in an erythroid precursor cell. We propose that GATApal is important for positive regulation of GATA-1 expression in erythroid cells. PMID:8628290

  13. High salt promotes autoimmunity by TET2-induced DNA demethylation and driving the differentiation of Tfh cells.


    Wu, Haijing; Huang, Xin; Qiu, Hong; Zhao, Ming; Liao, Wei; Yuan, Shuguang; Xie, Yubing; Dai, Yong; Chang, Christopher; Yoshimura, Akihiko; Lu, Qianjin


    Follicular helper T cells (Tfh) have been well documented to play a critical role in autoimmunity, such as systemic lupus erythematosus (SLE), by helping B cells. In this study, high salt (sodium chloride, NaCl), under physiological conditions, was demonstrated to increase the differentiation of Tfh. A high-salt diet markedly increased lupus features in MRL/lpr mice. The mechanism is NaCl-induced DNA demethylation via the recruitment of the hydroxytransferase Ten-Eleven Translocation 2 (TET2). Gene silencing of TET2 obviously diminished NaCl-induced Tfh cell polarization in vitro. In addition, the gene expression of sh2d1a, map3k1, spn and stat5b was enhanced after NaCl treatment, consistent with the findings in lupus CD4(+)T cells. However, only spn was directly regulated by TET2, and spn was not the sole target for NaCl. Our findings not only explain the epigenetic mechanisms of high-salt induced autoimmunity but also provide an attractive molecular target for intervention strategies of patients. PMID:27325182

  14. High salt promotes autoimmunity by TET2-induced DNA demethylation and driving the differentiation of Tfh cells

    PubMed Central

    Wu, Haijing; Huang, Xin; Qiu, Hong; Zhao, Ming; Liao, Wei; Yuan, Shuguang; Xie, Yubing; Dai, Yong; Chang, Christopher; Yoshimura, Akihiko; Lu, Qianjin


    Follicular helper T cells (Tfh) have been well documented to play a critical role in autoimmunity, such as systemic lupus erythematosus (SLE), by helping B cells. In this study, high salt (sodium chloride, NaCl), under physiological conditions, was demonstrated to increase the differentiation of Tfh. A high-salt diet markedly increased lupus features in MRL/lpr mice. The mechanism is NaCl-induced DNA demethylation via the recruitment of the hydroxytransferase Ten-Eleven Translocation 2 (TET2). Gene silencing of TET2 obviously diminished NaCl-induced Tfh cell polarization in vitro. In addition, the gene expression of sh2d1a, map3k1, spn and stat5b was enhanced after NaCl treatment, consistent with the findings in lupus CD4+T cells. However, only spn was directly regulated by TET2, and spn was not the sole target for NaCl. Our findings not only explain the epigenetic mechanisms of high-salt induced autoimmunity but also provide an attractive molecular target for intervention strategies of patients. PMID:27325182

  15. Early-life stress changes expression of GnRH and kisspeptin genes and DNA methylation of GnRH3 promoter in the adult zebrafish brain.


    Khor, Yee Min; Soga, Tomoko; Parhar, Ishwar S


    Early-life stress can cause long-term effects in the adulthood such as alterations in behaviour, brain functions and reproduction. DNA methylation is a mechanism of epigenetic change caused by early-life stress. Dexamethasone (DEX) was administered to zebrafish larvae to study its effect on reproductive dysfunction. The level of GnRH2, GnRH3, Kiss1 and Kiss2 mRNAs were measured between different doses of DEX treatment groups in adult zebrafish. Kiss1 and GnRH2 expression were increased in the 200mg/L DEX treated while Kiss2 and GnRH3 mRNA levels were up-regulated in the 2mg/L DEX-treated zebrafish. The up-regulation may be related to programming effect of DEX in the zebrafish larvae, causing overcompensation mechanism to increase the mRNA levels. Furthermore, DEX treatment caused negative impact on the development and maturation of the testes, in particular spermatogenesis. Therefore, immature gonadal development may cause positive feedback by increasing GnRH and Kiss. This indicates that DEX can alter the regulation of GnRH2, GnRH3, Kiss1 and Kiss2 in adult zebrafish, which affects maturation of gonads. Computer analysis of 1.5 kb region upstream of the 5' UTR of Kiss1, Kiss2, GnRH2 and GnRH3 promoter showed that there are putative binding sites of glucocorticoid response element and transcription factors involved in stress response. GnRH3 promoter analysed from pre-optic area, ventral telencephalon and ventral olfactory bulb showed higher methylation at CpG residues located on -1410, -1377 and -1355 between control and 2mg/L DEX-treated groups. Hence, early-life DEX treatment can alter methylation of GnRH3 gene promoter, which subsequently affects gene regulation and reproductive functions.

  16. Genome-Wide Anaplasma phagocytophilum AnkA-DNA Interactions Are Enriched in Intergenic Regions and Gene Promoters and Correlate with Infection-Induced Differential Gene Expression

    PubMed Central

    Dumler, J. Stephen; Sinclair, Sara H.; Pappas-Brown, Valeria; Shetty, Amol C.


    Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils, and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR)-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: (i) intergenic regions predicted to be MARs; (ii) within predicted lamina-associated domains; and (iii) at promoters ≤ 3000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome “re-organizer.” AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity. PMID:27703927

  17. Structural organization of the human S-antigen gene. cDNA, amino acid, intron, exon, promoter, in vitro transcription, retina, and pineal gland.


    Yamaki, K; Tsuda, M; Kikuchi, T; Chen, K H; Huang, K P; Shinohara, T


    S-Antigen (S-Ag) is a major soluble photoreceptor protein involved in the visual transduction cascade. Several S-Ag cDNAs and a gene coding for human S-Ag were isolated from cDNA and gene libraries. The gene sequences of the coding, noncoding, and 5'-flanking regions of the gene were determined. The S-Ag gene was approximately 50 kbp (kilobase pairs) in length and contained 16 exons and 15 introns. The length of most exons was less than 100 base pairs (bp) and the smallest one was only 10 bp. In contrast, the length of most introns was larger than 2 kbp, and the gene comprised 97% intron and 3% exon. The splice sites for donor and acceptor were in good agreement with the GT/AG rule. The S-Ag protein of 403 amino acid residues was translated from a mRNA of 1.9 kbp, and the mRNA was transcribed from a gene of 50 kbp. The 5'-flanking region of the gene, approximately 1.1 kbp long, had no known regulatory elements for transcription such as TATA, GC, and CCAAT boxes. Interestingly, the 5'-flanking region had promoter activity in an in vitro transcription assay using a nuclear extract of rat brain. A major transcription start site was found at 387 bp upstream from the translation start site ATG. Our results indicate that the sequence of S-Ag promoter differs from other known promoters and may, perhaps, be specific for photoreceptor rod cells and pinealocytes.

  18. UV-Induced DNA Damage Promotes Resistance to the Biotrophic Pathogen Hyaloperonospora parasitica in Arabidopsis1[C][OA

    PubMed Central

    Kunz, Bernard A.; Dando, Paige K.; Grice, Desma M.; Mohr, Peter G.; Schenk, Peer M.; Cahill, David M.


    Plant innate immunity to pathogenic microorganisms is activated in response to recognition of extracellular or intracellular pathogen molecules by transmembrane receptors or resistance proteins, respectively. The defense signaling pathways share components with those involved in plant responses to UV radiation, which can induce expression of plant genes important for pathogen resistance. Such intriguing links suggest that UV treatment might activate resistance to pathogens in normally susceptible host plants. Here, we demonstrate that pre-inoculative UV (254 nm) irradiation of Arabidopsis (Arabidopsis thaliana) susceptible to infection by the biotrophic oomycete Hyaloperonospora parasitica, the causative agent of downy mildew, induces dose- and time-dependent resistance to the pathogen detectable up to 7 d after UV exposure. Limiting repair of UV photoproducts by postirradiation incubation in the dark, or mutational inactivation of cyclobutane pyrimidine dimer photolyase, (6-4) photoproduct photolyase, or nucleotide excision repair increased the magnitude of UV-induced pathogen resistance. In the absence of treatment with 254-nm UV, plant nucleotide excision repair mutants also defective for cyclobutane pyrimidine dimer or (6-4) photoproduct photolyase displayed resistance to H. parasitica, partially attributable to short wavelength UV-B (280–320 nm) radiation emitted by incubator lights. These results indicate UV irradiation can initiate the development of resistance to H. parasitica in plants normally susceptible to the pathogen and point to a key role for UV-induced DNA damage. They also suggest UV treatment can circumvent the requirement for recognition of H. parasitica molecules by Arabidopsis proteins to activate an immune response. PMID:18667719

  19. G4-DNA Formation in the HRAS Promoter and Rational Design of Decoy Oligonucleotides for Cancer Therapy

    PubMed Central

    Membrino, Alexandro; Cogoi, Susanna; Pedersen, Erik B.; Xodo, Luigi E.


    HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2). When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R)-1-O-[4-(1-Pyrenylethynyl) phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys). The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated. PMID:21931711

  20. EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing’s Sarcoma

    PubMed Central

    Hossain, Mohammad Motarab; Ray, Swapan Kumar


    Ewing’s sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing’s sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing’s sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing’s sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing’s sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing’s sarcoma in cell culture and animal models. PMID:27547487

  1. Environmental Stress Affects DNA Methylation of a CpG Rich Promoter Region of Serotonin Transporter Gene in a Nurse Cohort

    PubMed Central

    Alasaari, Jukka S.; Lagus, Markus; Ollila, Hanna M.; Toivola, Auli; Kivimäki, Mika; Vahtera, Jussi; Kronholm, Erkki; Härmä, Mikko; Puttonen, Sampsa; Paunio, Tiina


    Background Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4) promoter methylation among nurses from high and low work stress environments. Methodology Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24) to low work stress environment (n = 25). We also analyzed the association of 5-HTTLPR polymorphism at 5′ end of SLC6A4. Work stress was assessed by the Karasek’s Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes. Principal Findings We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01). There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58). In unadjusted (bivariate) analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively) to methylation levels. Conclusions Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that

  2. The Caulobacter crescentus ctrA P1 promoter is essential for the coordination of cell cycle events that prevent the overinitiation of DNA replication.


    Schredl, Alexander T; Perez Mora, Yannet G; Herrera, Anabel; Cuajungco, Math P; Murray, Sean R


    The master regulator CtrA oscillates during the Caulobacter cell cycle due to temporally regulated proteolysis and transcription. It is proteolysed during the G1-S transition and reaccumulates in predivisional cells as a result of transcription from two sequentially activated promoters, P1 and P2. CtrA reinforces its own synthesis by directly mediating the activation of P2 concurrently with repression of P1. To explore the role of P1 in cell cycle control, we engineered a mutation into the native ctrA locus that prevents transcription from P1 but not P2. As expected, the ctrA P1 mutant exhibits striking growth, morphological and DNA replication defects. Unexpectedly, we found CtrA and its antagonist SciP, but not DnaA, GcrA or CcrM accumulation to be dramatically reduced in the ctrA P1 mutant. SciP levels closely paralleled CtrA accumulation, suggesting that CtrA acts as a rheostat to modulate SciP abundance. Furthermore, the reappearance of CtrA and CcrM in predivisional cells was delayed in the P1 mutant by 0.125 cell cycle unit in synchronized cultures. High levels of ccrM transcription despite low levels of CtrA and increased transcription of ctrA P2 in the ctrA P1 mutant are two examples of robustness in the cell cycle. Thus, Caulobacter can adjust regulatory pathways to partially compensate for reduced and delayed CtrA accumulation in the ctrA P1 mutant.

  3. DNA helicase HIM-6/BLM both promotes MutSγ-dependent crossovers and antagonizes MutSγ-independent interhomolog associations during caenorhabditis elegans meiosis.


    Schvarzstein, Mara; Pattabiraman, Divya; Libuda, Diana E; Ramadugu, Ajit; Tam, Angela; Martinez-Perez, Enrique; Roelens, Baptiste; Zawadzki, Karl A; Yokoo, Rayka; Rosu, Simona; Severson, Aaron F; Meyer, Barbara J; Nabeshima, Kentaro; Villeneuve, Anne M


    Meiotic recombination is initiated by the programmed induction of double-strand DNA breaks (DSBs), lesions that pose a potential threat to the genome. A subset of the DSBs induced during meiotic prophase become designated to be repaired by a pathway that specifically yields interhomolog crossovers (COs), which mature into chiasmata that temporarily connect the homologs to ensure their proper segregation at meiosis I. The remaining DSBs must be repaired by other mechanisms to restore genomic integrity prior to the meiotic divisions. Here we show that HIM-6, the Caenorhabditis elegans ortholog of the RecQ family DNA helicase BLM, functions in both of these processes. We show that him-6 mutants are competent to load the MutSγ complex at multiple potential CO sites, to generate intermediates that fulfill the requirements of monitoring mechanisms that enable meiotic progression, and to accomplish and robustly regulate CO designation. However, recombination events at a subset of CO-designated sites fail to mature into COs and chiasmata, indicating a pro-CO role for HIM-6/BLM that manifests itself late in the CO pathway. Moreover, we find that in addition to promoting COs, HIM-6 plays a role in eliminating and/or preventing the formation of persistent MutSγ-independent associations between homologous chromosomes. We propose that HIM-6/BLM enforces biased outcomes of recombination events to ensure that both (a) CO-designated recombination intermediates are reliably resolved as COs and (b) other recombination intermediates reliably mature into noncrossovers in a timely manner.

  4. DNA Helicase HIM-6/BLM Both Promotes MutSγ-Dependent Crossovers and Antagonizes MutSγ-Independent Interhomolog Associations During Caenorhabditis elegans Meiosis

    PubMed Central

    Schvarzstein, Mara; Pattabiraman, Divya; Libuda, Diana E.; Ramadugu, Ajit; Tam, Angela; Martinez-Perez, Enrique; Roelens, Baptiste; Zawadzki, Karl A.; Yokoo, Rayka; Rosu, Simona; Severson, Aaron F.; Meyer, Barbara J.; Nabeshima, Kentaro; Villeneuve, Anne M.


    Meiotic recombination is initiated by the programmed induction of double-strand DNA breaks (DSBs), lesions that pose a potential threat to the genome. A subset of the DSBs induced during meiotic prophase become designated to be repaired by a pathway that specifically yields interhomolog crossovers (COs), which mature into chiasmata that temporarily connect the homologs to ensure their proper segregation at meiosis I. The remaining DSBs must be repaired by other mechanisms to restore genomic integrity prior to the meiotic divisions. Here we show that HIM-6, the Caenorhabditis elegans ortholog of the RecQ family DNA helicase BLM, functions in both of these processes. We show that him-6 mutants are competent to load the MutSγ complex at multiple potential CO sites, to generate intermediates that fulfill the requirements of monitoring mechanisms that enable meiotic progression, and to accomplish and robustly regulate CO designation. However, recombination events at a subset of CO-designated sites fail to mature into COs and chiasmata, indicating a pro-CO role for HIM-6/BLM that manifests itself late in the CO pathway. Moreover, we find that in addition to promoting COs, HIM-6 plays a role in eliminating and/or preventing the formation of persistent MutSγ-independent associations between homologous chromosomes. We propose that HIM-6/BLM enforces biased outcomes of recombination events to ensure that both (a) CO-designated recombination intermediates are reliably resolved as COs and (b) other recombination intermediates reliably mature into noncrossovers in a timely manner. PMID:25053665

  5. Obesity promotes PhIP-induced small intestinal carcinogenesis in hCYP1A-db/db mice: involvement of mutations and DNA hypermethylation of Apc.


    Wang, Hong; Liu, Anna; Kuo, Yingyi; Chi, Eric; Yang, Xu; Zhang, Lanjing; Yang, Chung S


    Obesity is associated with an increased risk of cancer. To study the promotion of dietary carcinogen-induced gastrointestinal cancer by obesity, we employed 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) to induce intestinal tumorigenesis in CYP1A-humanized (hCYP1A) mice, in which mouse Cyp1a1/1a2 was replaced with human CYP1A1/1A2 Obesity was introduced in hCYP1A mice by breeding with Lepr(db/+) mice to establish the genetically induced obese hCYP1A-Lepr(db/db) mice or by feeding hCYP1A mice a high-fat diet. PhIP induced the formation of small intestinal tumors at the ages of weeks 28-40 in obese hCYP1A mice, but not in lean hCYP1A mice. No tumors were found in colon and other gastrointestinal organs in the lean or obese mice. Using immunohistochemistry (IHC), we found strong positive staining of NF-κB p65, pSTAT3 and COX2 as well as elevated levels of nuclear β-catenin (Ctnnb1) in small intestinal tumors, but not in normal tissues. By sequencing Apc and Ctnnb1 genes, we found that most PhIP-induced small intestinal tumors in obese mice carried only a single heterozygous mutation in Apc By bisulfite-sequencing of CpG islands of Apc, we found DNA hypermethylation in a CpG cluster located in its transcription initiation site, which most likely caused the inactivation of the wild-type Apc allele. Our findings demonstrate that PhIP-induced small intestinal carcinogenesis in hCYP1A-db/db mice is promoted by obesity and involves Apc mutation and inactivation by DNA hypermethylation. This experimental result is consistent with the association of obesity and the increased incidence of small intestinal cancer in humans in recent decades. PMID:27207656

  6. Synergy between the N-terminal and C-terminal domains of Mycobacterium tuberculosis HupB is essential for high-affinity binding, DNA supercoiling and inhibition of RecA-promoted strand exchange.


    Sharadamma, N; Khan, Krishnendu; Kumar, Sandeep; Patil, K Neelakanteshwar; Hasnain, Seyed E; Muniyappa, K


    The occurrence of DNA architectural proteins containing two functional domains derived from two different architectural proteins is an interesting emerging research theme in the field of nucleoid structure and function. Mycobacterium tuberculosis HupB, unlike Escherichia coli HU, is a two-domain protein that, in the N-terminal region, shows broad sequence homology with bacterial HU. The long C-terminal extension, on the other hand, contains seven PAKK/KAAK motifs, which are characteristic of the histone H1/H5 family of proteins. In this article, we describe several aspects of HupB function, in comparison with its truncated derivatives lacking either the C-terminus or N-terminus. We found that HupB binds a variety of DNA repair and replication intermediates with K(d) values in the nanomolar range. By contrast, the N-terminal fragment of M. tuberculosis HupB (HupB(MtbN)) showed diminished DNA-binding activity, with K(d) values in the micromolar range, and the C-terminal domain was completely devoid of DNA-binding activity. Unlike HupB(MtbN) , HupB was able to constrain DNA in negative supercoils and introduce negative superhelical turns into relaxed DNA. Similarly, HupB exerted a robust inhibitory effect on DNA strand exchange promoted by cognate and noncognate RecA proteins, whereas HupB(MtbN), even at a 50-fold molar excess, had no inhibitory effect. Considered together, these results suggest that synergy between the N-terminal and C-terminal domains of HupB is essential for its DNA-binding ability, and to modulate the topological features of DNA, which has implications for processes such as DNA compaction, gene regulation, homologous recombination, and DNA repair.

  7. Down-Regulation of miR-148a Promotes Metastasis by DNA Methylation and is Associated with Prognosis of Skin Cancer by Targeting TGIF2

    PubMed Central

    Tian, Yanli; Wei, Wei; Li, Li; Yang, Rongya


    Background MicroRNAs (miRNA) dysregulation has been considered to be significantly related to the occurrence and development of cancers. Several studies had proved that DNA methylation is an important cause of the abnormal expression of miRNAs. The purpose of this study was to investigate the methylation status of miR-148a and its effects on the metastasis and prognosis of skin cancer, as well as the interaction with TGIF2 gene. Material/Methods According to the qRT-PCR analysis, the expression of miR-148a was down-regulated in tumor tissues compared with the adjacent tissues and healthy controls (P<0.05). In vitro cell metastasis assay revealed that miR-148a could inhibit cell metastasis and its down-regulation promoted metastasis. Luciferase reporter assay found that TGIF2 gene was a target gene and its expression was suppressed by miR-148a in skin cancer. Results Methylation-specific PCR demonstrated that DNA methylation rate of miR-148a was higher in tumor tissues than in adjacent tissues and healthy tissues (P<0.05). miR-148a expression was proved to be epigenetically regulated after the demethylation of it by 5-aza-20-deoxycytidine treatment and qRT-PCR analysis. miR-148a methylation was significantly influenced by many clinicopathologic characteristics such as age (P=0.000), pathological differentiation (P=0.000), and lymph node metastasis (P=0.000). Besides, Kaplan-Meier analysis showed patients with miR-148a methylation lived shorter than those without that (P<0.001). Cox regression analysis manifested that miR-148a methylation (HR=0.053, 95CI%=0.005–0.548, P=0.014) could be serve as an independent prognostic marker for skin cancer. Conclusions Taken together, the expression of miR-148a was regulated by DNA methylation and targeted by TGIF2. Its methylation may be a potential prognostic indicator in skin cancer. PMID:26638007

  8. Quantitation of 35S promoter in maize DNA extracts from genetically modified organisms using real-time polymerase chain reaction, part 2: interlaboratory study.


    Feinberg, Max; Fernandez, Sophie; Cassard, Sylvanie; Bertheau, Yves


    The European Committee for Standardization (CEN) and the European Network of GMO Working Laboratories have proposed development of a modular strategy for stepwise validation of complex analytical techniques. When applied to the quantitation of genetically modified organisms (GMOs) in food products, the instrumental quantitation step of the technique is separately validated from the DNA extraction step to better control the sources of uncertainty and facilitate the validation of GMO-specific polymerase chain reaction (PCR) tests. This paper presents the results of an interlaboratory study on the quantitation step of the method standardized by CEN for the detection of a regulatory element commonly inserted in GMO maize-based foods. This is focused on the quantitation of P35S promoter through using the quantitative real-time PCR (QRT-PCR). Fifteen French laboratories participated in the interlaboratory study of the P35S quantitation operating procedure on DNA extract samples using either the thermal cycler ABI Prism 7700 (Applied Biosystems, Foster City, CA) or Light Cycler (Roche Diagnostics, Indianapolis, IN). Attention was focused on DNA extract samples used to calibrate the method and unknown extract samples. Data were processed according to the recommendations of ISO 5725 standard. Performance criteria, obtained using the robust algorithm, were compared to the classic data processing after rejection of outliers by the Cochran and Grubbs tests. Two laboratories were detected as outliers by the Grubbs test. The robust precision criteria gave values between the classical values estimated before and after rejection of the outliers. Using the robust method, the relative expanded uncertainty by the quantitation method is about 20% for a 1% Bt176 content, whereas it can reach 40% for a 0.1% Bt176. The performances of the quantitation assay are relevant to the application of the European regulation, which has an accepted tolerance interval of about +/-50%. These data

  9. Dynamic Changes in the Follicular Transcriptome and Promoter DNA Methylation Pattern of Steroidogenic Genes in Chicken Follicles throughout the Ovulation Cycle

    PubMed Central

    Zhu, Guiyu; Mao, Yong; Zhou, Wendi; Jiang, Yunliang


    The molecular mechanisms associated with follicle maturation and ovulation are not well defined in avian species. In this study, we used RNA-seq to study the gene expression profiles of the chicken follicles from different developmental stages (pre-hierarchical, pre-ovulatory and post-ovulatory). Transcriptomic analysis revealed a total of 1,277 and 2,310 genes were differentially expressed when follicles progressed through the pre-hierarchical to hierarchical and pre-ovulatory to post-ovulatory transitions, respectively. The differentially expressed genes (DEG) were involved in signaling pathways such as adherens junction, apoptosis and steroid biosynthesis. We further investigated the transcriptional regulation of follicular steroidogenesis by examining the follicle-specific methylation profiles of Star (steroidogenic acute regulatory protein), Cyp11a1 (cytochrome P450, family 11, subfamily a, polypeptide 1) and Hsd3b (hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1), genes encoding the key enzymes for progesterone synthesis. The varied patterns of DNA methylation in proximal promoters of Star and Cyp11a1but not Hsd3b in different follicles could play a major role in controlling gene expression as well as follicular steroidogenic activity. Finally, the promoter-reporter analysis suggests that TGF-β could be involved in the regulation of Hsd3b expression during ovulation. Together, current data not only provide novel insights into the molecular mechanisms of follicular physiology in chicken follicles, but also present the first evidence of epigenetic regulation of ovarian steroidogenesis in avian species. PMID:26716441

  10. Inhibition of mitogen-activated protein kinase kinase, DNA methyltransferase, and transforming growth factor-β promotes differentiation of human induced pluripotent stem cells into enterocytes.


    Kodama, Nao; Iwao, Takahiro; Kabeya, Tomoki; Horikawa, Takashi; Niwa, Takuro; Kondo, Yuki; Nakamura, Katsunori; Matsunaga, Tamihide


    We previously reported that small-molecule compounds were effective in generating pharmacokinetically functional enterocytes from human induced pluripotent stem (iPS) cells. In this study, to determine whether the compounds promote the differentiation of human iPS cells into enterocytes, we investigated the effects of a combination of mitogen-activated protein kinase kinase (MEK), DNA methyltransferase (DNMT), and transforming growth factor (TGF)-β inhibitors on intestinal differentiation. Human iPS cells cultured on feeder cells were differentiated into endodermal cells by activin A. These endodermal-like cells were then differentiated into intestinal stem cells by fibroblast growth factor 2. Finally, the cells were differentiated into enterocyte cells by epidermal growth factor and small-molecule compounds. After differentiation, mRNA expression levels and drug-metabolizing enzyme activities were measured. The mRNA expression levels of the enterocyte marker sucrase-isomaltase and the major drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 were increased by a combination of MEK, DNMT, and TGF-β inhibitors. The mRNA expression of CYP3A4 was markedly induced by 1α,25-dihydroxyvitamin D3. Metabolic activities of CYP1A1/2, CYP2B6, CYP2C9, CYP2C19, CYP3A4/5, UDP-glucuronosyltransferase, and sulfotransferase were also observed in the differentiated cells. In conclusion, MEK, DNMT, and TGF-β inhibitors can be used to promote the differentiation of human iPS cells into pharmacokinetically functional enterocytes.

  11. DNA methylation-mediated silencing of matricellular protein dermatopontin promotes hepatocellular carcinoma metastasis by α3β1 integrin-Rho GTPase signaling.


    Fu, Ying; Feng, Ming-Xuan; Yu, Jian; Ma, Ming-Ze; Liu, Xiao-Jin; Li, Jun; Yang, Xiao-Mei; Wang, Ya-Hui; Zhang, Yan-Li; Ao, Jun-Ping; Xue, Feng; Qin, Wenxin; Gu, Jianren; Xia, Qiang; Zhang, Zhi-Gang


    Dermatopontin (DPT), a tyrosine-rich, acidic matricellular protein, has been implicated in several human cancers. However, its biological functions and molecular mechanisms in cancer progression, particular hepatocellular carcinoma (HCC), remain unknown. We demonstrated that DPT was significantly down-regulated in 202 HCC clinical samples and that its expression level was closely correlated with cancer metastasis and patient prognosis. The overexpression of DPT dramatically suppressed HCC cell migration in vitro and intrahepatic metastasis in vivo. We further revealed that the down-regulation of DPT in HCC was due to epigenetic silencing by promoter DNA methylation. And the inhibitory effects of DPT on HCC cell motility were associated with dysregulated focal adhesion assembly, decreased RhoA activity and reduced focal adhesion kinase (FAK) and c-Src tyrosine kinase (Src) phosphorylation, and all of these alterations required the involvement of integrin signaling. Furthermore, we determined that the inhibitory effects of DPT on HCC cell motility were primarily mediated through α3β1 integrin. Our study provides new evidence for epigenetic control of tumor microenvironment, and suggests matricellular protein DPT may serve as a novel prognostic marker and act as a HCC metastasis suppressor. PMID:25149533

  12. Sp1 acetylation is associated with loss of DNA binding at promoters associated with cell cycle arrest and cell death in a colon cell line

    PubMed Central


    Butyrate, a known histone deacetylase inhibitor (HDACi) and product of fibre fermentation, is postulated to mediate the protective effect of dietary fibre against colon cancer. The transcription factor Sp1 is a target of acetylation and is known to be associated with class I HDACs, including HDAC1. Sp1 is a ubiquitous transcription factor and Sp1-regulated genes include those involved in cell cycle regulation, apoptosis and lipogenesis: all major pathways in cancer development. The only known acetylated residue of Sp1 is lysine703 which resides in the DNA binding domain. Here we show that acetylated Sp1 loses p21- and bak-promoter -binding function in vitro. Furthermore treatment with a panel of HDAC inhibitors showed clustering of activities for a subset of inhibitors, causing G2 cell cycle arrest, Sp1 acetylation, p21 and Bak over-expression, all with very similar EC50 concentrations. These HDACi activities were not distributed according to the molecular class of compound. In order to mimic loss of binding, an siRNA strategy was used to reduce Sp1 expression. This resulted in altered expression of multiple elements of the p53/p21 pathway. Taken together our data suggest a mechanistic model for the chemopreventive actions of butyrate in colon epithelial cells, and provide new insight into the differential activities some classes of HDAC inhibitors. PMID:20950428

  13. Kr-pok increases FASN expression by modulating the DNA binding of SREBP-1c and Sp1 at the proximal promoter.


    Jeon, Bu-Nam; Kim, Yeon-Sook; Choi, Won-Il; Koh, Dong-In; Kim, Min-Kyeong; Yoon, Jae-Hyeon; Kim, Min-Young; Hur, Benjamin; Paik, Philip Dong-Hyun; Hur, Man-Wook


    Kr-pok (kidney cancer-related POZ domain and Krüppel-like protein) is a new proto-oncogenic POZ-domain transcription factor. Fatty acid synthase gene (FASN) encodes one of the key enzymes in fatty acids synthesis and is the only enzyme that synthesizes fatty acids in cancer cells. Sp1 and SREBP-1c are the two major transcription activators of FASN. We investigated whether Kr-pok modulates transcription of the FASN. FASN expression is significantly decreased in Kr-pok knockout murine embryonic fibroblasts. Coimmunoprecipitation, GST fusion protein pull-down, and immunocytochemistry assays show that the zinc-finger domain of Kr-pok interacts directly with the bZIP DNA binding domain of SREBP-1. Electrophoretic mobility shift assay, oligonucleotide pull-down, and chromatin immunoprecipitation assays showed that Kr-pok changes the transcription factor binding dynamics of Sp1 and SREBP-1c to the SRE/E-box elements of the proximal promoter. We found that Kr-pok expression increased during 3T3-L1 preadipocyte differentiation and that FASN expression is decreased by the knockdown of Kr-pok. Kr-pok facilitates the SREBP-1c-mediated preadipocyte differentiation and/or fatty acid synthesis. Kr-pok may act as an important regulator of fatty acid synthesis and may induce rapid cancer cell proliferation by increasing palmitate synthesis.

  14. Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria.

    PubMed Central

    de Lorenzo, V; Herrero, M; Jakubzik, U; Timmis, K N


    A collection of Tn5-derived minitransposons has been constructed that simplifies substantially the generation of insertion mutants, in vivo fusions with reporter genes, and the introduction of foreign DNA fragments into the chromosome of a variety of gram-negative bacteria, including the enteric bacteria and typical soil bacteria like Pseudomonas species. The minitransposons consist of genes specifying resistance to kanamycin, chloramphenicol, streptomycin-spectinomycin, and tetracycline as selection markers and a unique NotI cloning site flanked by 19-base-pair terminal repeat sequences of Tn5. Further derivatives also contain lacZ, phoA, luxAB, or xylE genes devoid of their native promoters located next to the terminal repeats in an orientation that affords the generation of gene-operon fusions. The transposons are located on a R6K-based suicide delivery plasmid that provides the IS50R transposase tnp gene in cis but external to the mobile element and whose conjugal transfer to recipients is mediated by RP4 mobilization functions in the donor. PMID:2172217

  15. DNA methylation-mediated silencing of matricellular protein dermatopontin promotes hepatocellular carcinoma metastasis by α3β1 integrin-Rho GTPase signaling.


    Fu, Ying; Feng, Ming-Xuan; Yu, Jian; Ma, Ming-Ze; Liu, Xiao-Jin; Li, Jun; Yang, Xiao-Mei; Wang, Ya-Hui; Zhang, Yan-Li; Ao, Jun-Ping; Xue, Feng; Qin, Wenxin; Gu, Jianren; Xia, Qiang; Zhang, Zhi-Gang


    Dermatopontin (DPT), a tyrosine-rich, acidic matricellular protein, has been implicated in several human cancers. However, its biological functions and molecular mechanisms in cancer progression, particular hepatocellular carcinoma (HCC), remain unknown. We demonstrated that DPT was significantly down-regulated in 202 HCC clinical samples and that its expression level was closely correlated with cancer metastasis and patient prognosis. The overexpression of DPT dramatically suppressed HCC cell migration in vitro and intrahepatic metastasis in vivo. We further revealed that the down-regulation of DPT in HCC was due to epigenetic silencing by promoter DNA methylation. And the inhibitory effects of DPT on HCC cell motility were associated with dysregulated focal adhesion assembly, decreased RhoA activity and reduced focal adhesion kinase (FAK) and c-Src tyrosine kinase (Src) phosphorylation, and all of these alterations required the involvement of integrin signaling. Furthermore, we determined that the inhibitory effects of DPT on HCC cell motility were primarily mediated through α3β1 integrin. Our study provides new evidence for epigenetic control of tumor microenvironment, and suggests matricellular protein DPT may serve as a novel prognostic marker and act as a HCC metastasis suppressor.

  16. Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2.


    Vaidya, Himani; Rumph, Candie; Katula, Karen S


    WNT5A is a secreted ligand involved in Wnt pathway signaling and has a role in cell movement and differentiation. Altered WNT5A expression is associated with various cancers, although in most studies the focus has been on only one of the known WNT5A isoforms. In this study, we analyzed expression from two of the major WNT5A promoters, termed promoter A and promoter B, in normal human osteoblasts, SaOS-2 and U2OS osteosarcoma cell lines, and osteosarcoma tumor tissue. We found that both promoters A and B are active in normal osteoblasts with nearly 11-fold more promoter B than A transcripts. Promoter B but not promoter A transcripts are decreased or nearly undetectable in the SaOS-2 and U2OS cell lines and osteosarcoma tumor tissues. Transient transfection of promoter A and promoter B reporter constructs confirmed that SaOS-2 cells have the necessary factors to transcribe both promoters. Bisulfite sequencing analysis revealed that three CpG enriched regions upstream of the promoter B exon 1βare highly methylated in both SaOS-2 and U2OS cells. The CpG island sub-region R6 located in promoter B exon 1β was approximately 51% methylated in SaOS-2 and 25% methylated in U2OS. Region 3 was approximately 28% methylated in normal osteoblasts, whereas the others were unmethylated. Promoter B was re-activated by treatment of SaOS-2 cells with 1 μM 5-azacytidine, which was associated with only a small insignificant change in methylation of sub-region R6. ChIP analysis of U2OS and SaOS-2 cells indicated that the promoter B region is less enriched in the active histone mark H3K4me3, in comparison to promoter A and that there is increased enrichment of the repressive mark H3K27me3 in association with the promoter B genomic region in the cell line SaOS-2. These findings show that epigenetic inactivation of the WNT5A promoter B involves both DNA methylation and histone modifications and suggest that differential expression of the WNT5A alternative promoters A and B is a

  17. Long-term arsenic exposure induces histone H3 Lys9 dimethylation without altering DNA methylation in the promoter region of p16(INK4a) and down-regulates its expression in the liver of mice.


    Suzuki, Takehiro; Nohara, Keiko


    Long-term exposure of humans to high concentrations of arsenic is associated with an increased risk of cancer. Previous studies have suggested that arsenic exposure promotes tumorigenesis by inducing changes in the expression of tumor-related genes by dysregulating DNA methylation at tumor-related gene loci. However, the causal relationships between epigenetic changes and both arsenic exposure and tumorigenesis are still unclear. In the present study, we investigated whether arsenic can change the expression of tumor-related genes by inducing epigenetic modifications before tumorigenesis. We did so by investigating the effects of long-term arsenic exposure on representative epigenetic modifications, DNA methylation and histone modifications, in the tumor-free normal liver of C57Bl/6 mice. We focused on the tumor-related genes, p16(INK4a) , RASSF1A, Ha-ras and ER-α as target genes, because their expression and promoter methylation status in mice have been reported to be affected by long-term arsenic exposure. The results showed that long-term arsenic exposure induced a significant decrease in expression of p16(INK4a) associated with an increase in level of dimethylated histone H3 lysine 9 (H3K9), a transcription-suppressive histone modification, in the promoter region, but that DNA methylation of the promoter region was unaffected. The results also showed a significant increase in recruitment of H3K9 histone methyltransferase G9a to the promoter after arsenic exposure. These findings suggest that long-term arsenic exposure may induce down-regulation of p16(INK4a) by targeting recruitment of G9a and H3K9 dimethylation without altering DNA methylation before tumorigenesis in the liver.

  18. The cAMP signaling system inhibits the repair of {gamma}-ray-induced DNA damage by promoting Epac1-mediated proteasomal degradation of XRCC1 protein in human lung cancer cells

    SciTech Connect

    Cho, Eun-Ah; Juhnn, Yong-Sung


    Highlights: Black-Right-Pointing-Pointer cAMP signaling system inhibits repair of {gamma}-ray-induced DNA damage. Black-Right-Pointing-Pointer cAMP signaling system inhibits DNA damage repair by decreasing XRCC1 expression. Black-Right-Pointing-Pointer cAMP signaling system decreases XRCC1 expression by promoting its proteasomal degradation. Black-Right-Pointing-Pointer The promotion of XRCC1 degradation by cAMP signaling system is mediated by Epac1. -- Abstract: Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNA repair activity, and we investigated the effects of the cAMP signaling system on {gamma}-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (G{alpha}sQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of G{alpha}sQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after {gamma}-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2 Prime -O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2 Prime -O-Me-cAMP and restored XRCC1 protein level following {gamma}-ray irradiation. From

  19. Downregulation of the DNA repair enzyme apurinic/apyrimidinic endonuclease 1 stimulates transforming growth factor-β1 production and promotes actin rearrangement.


    Sakai, Yuri; Yamamori, Tohru; Yasui, Hironobu; Inanami, Osamu


    The DNA repair enzyme apurinic/apyrimidinic endonuclease 1 (APE1) plays a central role in base excision repair and functions as a reductive activator of various transcription factors. Multiple other functionalities have been ascribed to APE1 in addition to these major functions. A recent study showed that APE1 knockdown upregulated the expression of a set of genes related to extracellular matrix (ECM) production, indicating an additional novel biological role for this enzyme. Based on this finding, we have investigated the effect of APE1 downregulation on ECM-related gene expression and its biological consequences. Endogenous APE1 expression was downregulated in human cervical carcinoma HeLa cells and human lung carcinoma A549 cells using siRNA. When the expression of six ECM-related genes (TGFB1, LAMC1, FN1, COL1A1, COL3A1, and COL4A1) was evaluated, we found that APE1 knockdown upregulated the expression of TGFB1 in both cell lines. APE1 downregulation promoted actin rearrangement, inducing F-actin accumulation in HeLa cells and the dissipation of stress fibers in A549 cells. We also discovered that APE1 knockdown enhanced cellular motility in A549 cells, which was suppressed by the inhibition of transforming growth factor (TGF)-β1 signaling. These results suggested that APE1 controls the organization of actin cytoskeleton through the regulation of TGF-β1 expression, providing novel insights into the biological significance of APE1. PMID:25858321

  20. Inhibition of Homologous Recombination and Promotion of Mutagenic Repair of DNA Double-Strand Breaks Underpins Arabinoside-Nucleoside Analogue Radiosensitization.


    Magin, Simon; Papaioannou, Maria; Saha, Janapriya; Staudt, Christian; Iliakis, George


    In concurrent chemoradiotherapy, drugs are used to sensitize tumors to ionizing radiation. Although a spectrum of indications for simultaneous treatment with drugs and radiation has been defined, the molecular mechanisms underpinning tumor radiosensitization remain incompletely characterized for several such combinations. Here, we investigate the mechanisms of radiosensitization by the arabinoside nucleoside analogue 9-β-D-arabinofuranosyladenine (araA) placing particular emphasis on the repair of DNA double-strand breaks (DSB), and compare the results to those obtained with fludarabine (F-araA) and cytarabine (araC). Postirradiation treatment with araA strongly sensitizes cells to ionizing radiation, but leaves unchanged DSB repair by NHEJ in logarithmically growing cells, in sorted G1 or G2 phase populations, as well as in cells in the plateau phase of growth. Notably, araA strongly inhibits DSB repair by homologous recombination (HRR), as assessed by scoring ionizing radiation-induced RAD51 foci, and in functional assays using integrated reporter constructs. Cells compromised in HRR by RNAi-mediated transient knockdown of RAD51 show markedly reduced radiosensitization after treatment with araA. Remarkably, mutagenic DSB repair compensates for HRR inhibition in araA-treated cells. Compared with araA, F-araA and araC are only modestly radiosensitizing under the conditions examined. We propose that the radiosensitizing potential of nucleoside analogues is linked to their ability to inhibit HRR and concomitantly promote the error-prone processing of DSBs. Our observations pave the way to treatment strategies harnessing the selective inhibitory potential of nucleoside analogues and the development of novel compounds specifically utilizing HRR inhibition as a means of tumor cell radiosensitization. PMID:25840584

  1. 15-Lipoxygenase-1 suppression of colitis-associated colon cancer through inhibition of the IL-6/STAT3 signaling pathway

    PubMed Central

    Mao, Fei; Xu, Min; Zuo, Xiangsheng; Yu, Jiang; Xu, Weiguo; Moussalli, Micheline J.; Elias, Elias; Li, Haiyan S.; Watowich, Stephanie S.; Shureiqi, Imad


    The IL-6/signal transducer and activator of transcription 3 (STAT3) pathway is a critical signaling pathway for colitis-associated colorectal cancer (CAC). Peroxisome proliferator-activated receptor (PPAR)-δ, a lipid nuclear receptor, up-regulates IL-6. 15-Lipoxygenase-1 (15-LOX-1), which is crucial to production of lipid signaling mediators to terminate inflammation, down-regulates PPAR-δ. 15-LOX-1 effects on IL-6/STAT3 signaling and CAC tumorigenesis have not been determined. We report that intestinally targeted transgenic 15-LOX-1 expression in mice inhibited azoxymethane- and dextran sodium sulfate–induced CAC, IL-6 expression, STAT3 phosphorylation, and IL-6/STAT3 downstream target (Notch3 and MUC1) expression. 15-LOX-1 down-regulation was associated with IL-6 up-regulation in human colon cancer mucosa. Reexpression of 15-LOX-1 in human colon cancer cells suppressed IL-6 mRNA expression, STAT3 phosphorylation, IL-6 promoter activity, and PPAR-δ mRNA and protein expression. PPAR-δ overexpression in colonic epithelial cells promoted CAC tumorigenesis in mice and increased IL-6 expression and STAT3 phosphorylation, whereas concomitant 15-LOX-1 expression in colonic epithelial cells (15-LOX-1-PPAR-δ-Gut mice) suppressed these effects: the number of tumors per mouse (mean ± sem) was 4.22 ± 0.68 in wild-type littermates, 6.67 ± 0.83 in PPAR-δ-Gut mice (P = 0.026), and 2.25 ± 0.25 in 15-LOX-1-PPAR-δ-Gut mice (P = 0.0006). Identification of 15-LOX-1 suppression of PPAR-δ to inhibit IL-6/STAT3 signaling-driven CAC tumorigenesis provides mechanistic insights that can be used to molecularly target CAC.—Mao, F., Xu, M., Zuo, X., Yu, J., Xu, W., Moussalli, M. J., Elias, E., Li, H. S., Watowich, S. S., Shureiqi, I. 15-Lipoxygenase-1 suppression of colitis-associated colon cancer through inhibition of the IL-6/STAT3 signaling pathway. PMID:25713055

  2. Chromatin remodeler sucrose nonfermenting 2 homolog (SNF2H) is recruited onto DNA replication origins through interaction with Cdc10 protein-dependent transcript 1 (Cdt1) and promotes pre-replication complex formation.


    Sugimoto, Nozomi; Yugawa, Takashi; Iizuka, Masayoshi; Kiyono, Tohru; Fujita, Masatoshi


    From late mitosis to the G(1) phase of the cell cycle, ORC, CDC6, and Cdt1 form the machinery necessary to load MCM2-7 complexes onto DNA. Here, we show that SNF2H, a member of the ATP-dependent chromatin-remodeling complex, is recruited onto DNA replication origins in human cells in a Cdt1-dependent manner and positively regulates MCM loading. SNF2H physically interacted with Cdt1. ChIP assays indicated that SNF2H associates with replication origins specifically during the G(1) phase. Binding of SNF2H at origins was decreased by Cdt1 silencing and, conversely, enhanced by Cdt1 overexpression. Furthermore, SNF2H silencing prevented MCM loading at origins and moderately inhibited S phase progression. Although neither SNF2H overexpression nor SNF2H silencing appeared to impact rereplication induced by Cdt1 overexpression, Cdt1-induced checkpoint activation was inhibited by SNF2H silencing. Collectively, these data suggest that SNF2H may promote MCM loading at DNA replication origins via interaction with Cdt1 in human cells. Because efficient loading of excess MCM complexes is thought to be required for cells to tolerate replication stress, Cdt1- and SNF2H-mediated promotion of MCM loading may be biologically relevant for the regulation of DNA replication.

  3. Analysis of the transcriptional regulation of cancer-related genes by aberrant DNA methylation of the cis-regulation sites in the promoter region during hepatocyte carcinogenesis caused by arsenic

    PubMed Central

    Miao, Zhuang; Wu, Lin; Lu, Ming; Meng, Xianzhi; Gao, Bo; Qiao, Xin; Zhang, Weihui; Xue, Dongbo


    Liver is the major organ for arsenic methylation metabolism and may be the potential target of arsenic-induced cancer. In this study, normal human liver cell was treated with arsenic trioxide, and detected using DNA methylation microarray. Some oncogenes, tumor suppressor genes, transcription factors (TF), and tumor-associated genes (TAG) that have aberrant DNA methylation have been identified. However, simple functional studies of genes adjacent to aberrant methylation sites cannot well reflect the regulatory relationship between DNA methylation and gene transcription during the pathogenesis of arsenic-induced liver cancer, whereas a further analysis of the cis-regulatory elements and their trans-acting factors adjacent to DNA methylation can more precisely reflect the relationship between them. MYC and MAX (MYC associated factor X) were found to participating cell cycle through a bioinformatics analysis. Additionally, it was found that the hypomethylation of cis-regulatory sites in the MYC promoter region and the hypermethylation of cis-regulatory sites in the MAX promoter region result in the up-regulation of MYC mRNA expression and the down-regulation of MAX mRNA, which increased the hepatocyte carcinogenesis tendency. PMID:26046465

  4. Loss of p21{sup Sdi1} expression in senescent cells after DNA damage accompanied with increase of miR-93 expression and reduced p53 interaction with p21{sup Sdi1} gene promoter

    SciTech Connect

    Choi, Ok Ran; Lim, In Kyoung


    Highlights: {yields} Reduced p21 expression in senescent cells treated with DNA damaging agents. {yields} Increase of [{sup 3}H]thymidine and BrdU incorporations in DNA damaged-senescent cells. {yields} Upregulation of miR-93 expression in senescent cells in response to DSB. {yields} Failure of p53 binding to p21 promoter in senescent cells in response to DSB. {yields} Molecular mechanism of increased cancer development in aged than young individuals. -- Abstract: To answer what is a critical event for higher incidence of tumor development in old than young individuals, primary culture of human diploid fibroblasts were employed and DNA damage was induced by doxorubicin or X-ray irradiation. Response to the damage was different between young and old cells; loss of p21{sup sdi1} expression in spite of p53{sup S15} activation in old cells along with [{sup 3}H]thymidine and BrdU incorporation, but not in young cells. The phenomenon was confirmed by other tissue fibroblasts obtained from different donor ages. Induction of miR-93 expression and reduced p53 binding to p21 gene promoter account for loss of p21{sup sdi1} expression in senescent cells after DNA damage, suggesting a mechanism of in vivo carcinogenesis in aged tissue without repair arrest.

  5. DNA element downstream of the κB site in the Lcn2 promoter is required for transcriptional activation by IκBζ and NF-κB p50.


    Kohda, Akira; Yamazaki, Soh; Sumimoto, Hideki


    The nuclear protein IκBζ activates transcription of a subset of NF-κB-dependent innate immune genes such as Lcn2 encoding the antibacterial protein lipocalin-2. IκBζ functions as a coactivator via its interaction with NF-κB p50, which contains a DNA-binding Rel-homology domain but lacks a transcriptional activation domain. However cis-regulatory elements involved in IκBζ function have remained unknown. Here, we show that, although IκBζ by itself is unable to associate with the Lcn2 promoter, IκBζ interacts with the promoter via p50 binding to the NF-κB-binding site (κB site) and the interaction also requires the pyrimidine-rich site (CCCCTC) that localizes seven bases downstream of the κB site. The pyrimidine-rich site is also essential for IκBζ-mediated activation of the Lcn2 gene. Introduction of both sites into an IκBζ-independent gene culminates in IκBζ-p50-DNA complex formation and transcriptional activation. Furthermore, spacing between the two sites is crucial for both IκBζ-DNA interaction and IκBζ-mediated gene activation. Thus, the pyrimidine-rich IκBζ-responsive site plays an essential role in productive interaction of IκBζ with the p50-DNA complex.

  6. Plasmid RSF1010 DNA replication in vitro promoted by purified RSF1010 RepA, RepB and RepC proteins.

    PubMed Central

    Scherzinger, E; Haring, V; Lurz, R; Otto, S


    We have constructed and analyzed an in vitro system that will efficiently replicate plasmid RSF1010 and its derivatives. The system contains a partially purified extract from E.coli cells and three purified RSF1010-encoded proteins, the products of genes repA, repB (or mobA/repB), and repC. Replication in this system mimics the in vivo mechanism in that it (i) is initiated at oriV, the origin of vegetative DNA replication, (ii) proceeds in a population of plasmid molecules in both directions from this 396-base-pair origin region, and (iii) is absolutely dependent on the presence of each of the three rep gene products. In addition, we find that E.coli DNA gyrase, DnaZ protein (gamma subunit of poIIII holoenzyme) and SSB are required for in vitro plasmid synthesis. The bacterial RNA polymerase, the initiation protein DnaA, and the primosomal proteins DnaB, DnaC, DnaG and DnaT are not required. Furthermore, the replicative intermediates seen in the electron microscope suggest that replication in vitro begins with the simultaneous or non-simultaneous formation of two displacement loops that expand for a short stretch of DNA toward each other, and form a theta-type structure when the two displacing strands pass each other. Images PMID:1851552

  7. Short-Fragment DNA Residue from Vaccine Purification Processes Promotes Immune Response to the New Inactivated EV71 Vaccine by Upregulating TLR9 mRNA.


    Shao, Jie; Gao, Fan; Lin, Hui-Juan; Mao, Qun-Ying; Chen, Pan; Wu, Xing; Yao, Xin; Kong, Wei; Liang, Zheng-Lun


    To reduce potential oncogenic long genomic DNA in vaccines, nuclease treatment has been applied in the purification processes. However, this action increased the residue of short-fragment DNA and its effect on vaccine potency was still elusive. In this study, we found residual sf-DNA in an inactivated EV71 vaccine could enhance humoral immune response in mice. Ag stimulation in vitro and vaccine injection in vivo revealed that TLR9 transcription level was elevated, indicating that sf-DNA could activate TLR9. These new findings will help us to understand the molecular mechanism induced by vero-cell culture-derived vaccines.

  8. Short-Fragment DNA Residue from Vaccine Purification Processes Promotes Immune Response to the New Inactivated EV71 Vaccine by Upregulating TLR9 mRNA

    PubMed Central

    Shao, Jie; Gao, Fan; Lin, Hui-Juan; Mao, Qun-Ying; Chen, Pan; Wu, Xing; Yao, Xin; Kong, Wei; Liang, Zheng-Lun


    To reduce potential oncogenic long genomic DNA in vaccines, nuclease treatment has been applied in the purification processes. However, this action increased the residue of short-fragment DNA and its effect on vaccine potency was still elusive. In this study, we found residual sf-DNA in an inactivated EV71 vaccine could enhance humoral immune response in mice. Ag stimulation in vitro and vaccine injection in vivo revealed that TLR9 transcription level was elevated, indicating that sf-DNA could activate TLR9. These new findings will help us to understand the molecular mechanism induced by vero-cell culture-derived vaccines. PMID:27082865

  9. T(lys), a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes.


    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta; Contursi, Patrizia


    While studying the gene expression of the Sulfolobus spindle-shaped virus 1 (SSV1) in Sulfolobus solfataricus lysogenic cells, a novel viral transcript (T(lys)) was identified. Transcriptional analysis revealed that T(lys) is expressed only in the absence of UV irradiation and is downregulated during the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and T(ind)) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA-binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and T(ind) transcripts, as well as of its own promoter. Binding sites of F55 are included within a tandem-repeated sequence overlapping the transcription start sites and/or the B recognition element of the pertinent genes. The strongest binding was observed with the promoters of T5 and T6, and an apparent cooperativity in binding was observed with the T(ind) promoter. Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1. PMID:23514883

  10. Tlys, a Newly Identified Sulfolobus Spindle-Shaped Virus 1 Transcript Expressed in the Lysogenic State, Encodes a DNA-Binding Protein Interacting at the Promoters of the Early Genes

    PubMed Central

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta


    While studying the gene expression of the Sulfolobus spindle-shaped virus 1 (SSV1) in Sulfolobus solfataricus lysogenic cells, a novel viral transcript (Tlys) was identified. Transcriptional analysis revealed that Tlys is expressed only in the absence of UV irradiation and is downregulated during the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and Tind) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA-binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and Tind transcripts, as well as of its own promoter. Binding sites of F55 are included within a tandem-repeated sequence overlapping the transcription start sites and/or the B recognition element of the pertinent genes. The strongest binding was observed with the promoters of T5 and T6, and an apparent cooperativity in binding was observed with the Tind promoter. Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1. PMID:23514883

  11. Reduced function of the RNA-binding protein FPA rescues a T-DNA insertion mutant in the Arabidopsis ZHOUPI gene by promoting transcriptional read-through.


    Zhang, Yaohua; Li, Xin; Goodrich, Justin; Wu, Chunxia; Wei, Haichao; Yang, Suxin; Feng, Xianzhong


    T-DNA insertion mutants have been widely used to investigate plant gene functions. Unexpectedly, in several reported cases, the phenotype of T-DNA insertion mutations can be suppressed because of trans T-DNA interactions associated with epigenetic modification, which indicates that caution is needed when T-DNA mutants are used. In the present study, we characterized a novel process suppressing a T-DNA mutation. The spz2 (suppressor of zou 2) mutant was isolated as a suppressor of the phenotype of the zou-4 mutant caused by a T-DNA insertion in the first intron. The spz2 mutation partially recovered the native ZOU gene expression in the zou-4 background, but not in two other zou alleles, zou-2 and zou-3, with T-DNAs inserted in the exon and intron, respectively. The suppressed phenotype was inherited in a Mendelian fashion and is not associated with epigenetic modification. The recovery of the native ZOU gene expression in the spz2 zou-4 double mutant is caused by transcriptional read-through of the intronic T-DNA as a result of decreased proximal polyadenylation. SPZ2 encodes an RNA-binding protein, FPA, which is known to regulate polyadenylation site selection. This is the first example of FPA rescuing a T-DNA insertion mutation by affecting the polyadenylation site selection. PMID:27164978

  12. An E3-14.7K peptide that promotes microtubules-mediated transport of plasmid DNA increases polyplexes transfection efficiency.


    Pigeon, Lucie; Gonçalves, Cristine; Gosset, David; Pichon, Chantal; Midoux, Patrick


    Chemical vectors as cationic polymers and cationic lipids are promising alternatives to viral vectors for gene therapy. Beside endosome escape and nuclear import, plasmid DNA (pDNA) migration in the cytosol toward the nuclear envelope is also regarded as a limiting step for efficient DNA transfection with non-viral vectors. Here, the interaction between E3-14.7K and FIP-1 to favor migration of pDNA along microtubules is exploited. E3-14.7K is an early protein of human adenoviruses that interacts via FIP-1 (Fourteen.7K Interacting Protein 1) protein with the light-chain components of the human microtubule motor protein dynein (TCTEL1). This peptide is conjugated with pDNA and mediates interaction of pDNA in vitro with isolated microtubules as well as with microtubules in cellulo. Videomicroscopy and tracking treatment of images clearly demonstrate that P79-98/pDNA conjugate exhibits a linear transport with large amplitude along microtubules upon 2 h transfection with polyplexes whereas control pDNA conjugate exhibits small non-directional movements in the cytoplasm. Remarkably, P79-98/peGFP polyplexes enhance by a factor 2.5 (up to 76%) the number of transfected cells. The results demonstrate, for the first time, that the transfection efficiency of polyplexes can be drastically increased when the microtubules migration of pDNA is facilitated by a peptide allowing pDNA docking to TCTEL1. This is a real breakthrough in the non viral gene delivery field that opens hope to build artificial viruses.

  13. Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations.


    Shanak, Siba; Helms, Volkhard


    Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

  14. Hydration properties of natural and synthetic DNA sequences with methylated adenine or cytosine bases in the R.DpnI target and BDNF promoter studied by molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Shanak, Siba; Helms, Volkhard


    Adenine and cytosine methylation are two important epigenetic modifications of DNA sequences at the levels of the genome and transcriptome. To characterize the differential roles of methylating adenine or cytosine with respect to their hydration properties, we performed conventional MD simulations and free energy perturbation calculations for two particular DNA sequences, namely the brain-derived neurotrophic factor (BDNF) promoter and the R.DpnI-bound DNA that are known to undergo methylation of C5-methyl cytosine and N6-methyl adenine, respectively. We found that a single methylated cytosine has a clearly favorable hydration free energy over cytosine since the attached methyl group has a slightly polar character. In contrast, capping the strongly polar N6 of adenine with a methyl group gives a slightly unfavorable contribution to its free energy of solvation. Performing the same demethylation in the context of a DNA double-strand gave quite similar results for the more solvent-accessible cytosine but much more unfavorable results for the rather buried adenine. Interestingly, the same demethylation reactions are far more unfavorable when performed in the context of the opposite (BDNF or R.DpnI target) sequence. This suggests a natural preference for methylation in a specific sequence context. In addition, free energy calculations for demethylating adenine or cytosine in the context of B-DNA vs. Z-DNA suggest that the conformational B-Z transition of DNA transition is rather a property of cytosine methylated sequences but is not preferable for the adenine-methylated sequences investigated here.

  15. Investigating actinomycin D binding to G-quadruplex, i-motif and double-stranded DNA in 27-nt segment of c-MYC gene promoter.


    Niknezhad, Zhila; Hassani, Leila; Norouzi, Davood


    c-MYC DNA is an attractive target for drug design, especially for cancer chemotherapy. Around 90% of c-MYC transcription is controlled by NHE III1, whose 27-nt purine-rich strand has the ability to form G-quadruplex structure. In this investigation, interaction of ActD with 27-nt G-rich strand (G/c-MYC) and its equimolar mixture with the complementary sequence, (GC/c-MYC) as well as related C-rich oligonucleotide (C/c-MYC) was evaluated. Molecular dynamic simulations showed that phenoxazine and lactone rings of ActD come close to the outer G-tetrad nucleotides indicating that ActD binds through end-stacking to the quadruplex DNA. RMSD and RMSF revealed that fluctuation of the quadruplex DNA increases upon interaction with the drug. The results of spectrophotometry and spectrofluorometry indicated that ActD most probably binds to the c-MYC quadruplex and duplex DNA via end-stacking and intercalation, respectively and polarity of ActD environment decreases due to the interaction. It was also found that binding of ActD to the GC-rich DNA is stronger than the two other forms of DNA. Circular dichroism results showed that the type of the three forms of DNA structures doesn't change, but their compactness alters due to their interaction with ActD. Finally, it can be concluded that ActD binds differently to double stranded DNA, quadruplex DNA and i-motif.

  16. The amdR product and a CCAAT-binding factor bind to adjacent, possibly overlapping DNA sequences in the promoter region of the Aspergillus nidulans amdS gene.

    PubMed Central

    van Heeswijck, R; Hynes, M J


    The amdS gene of Aspergillus nidulans is regulated by a number of positively acting regulatory genes which act additively and independently. Using gel mobility shift assays with crude nuclear extracts we show here that the product of one of these regulatory genes, the amdR gene, binds to DNA fragments containing part of the promoter region of the amdS gene. This confirms the earlier prediction from DNA sequence data that amdR encodes a DNA-binding protein containing a cysteine-rich 'zinc finger' motif. In addition we detected the binding of another previously unidentified protein to an adjacent, possibly overlapping region of the amdS 5' sequence at the site of a consensus 'CCAAT-box' sequence. Replacement of the CCAAT sequence with CCTTT abolished the binding of this protein which we have designated as an A. nidulans 'CCAAT-box' binding factor (AnCF). The 'CCAAT-box' sequence appears to be involved in determining the basal level of transcription of amdS (T.G.Littlejohn and M.J.H., unpublished data). This suggests that AnCF is a transcription factor, and that the 'CCAAT-box' sequences found in the promoters of some filamentous fungal genes function as binding sites for these factors, as in other eucaryotes. Images PMID:2041742

  17. The amdR product and a CCAAT-binding factor bind to adjacent, possibly overlapping DNA sequences in the promoter region of the Aspergillus nidulans amdS gene.


    van Heeswijck, R; Hynes, M J


    The amdS gene of Aspergillus nidulans is regulated by a number of positively acting regulatory genes which act additively and independently. Using gel mobility shift assays with crude nuclear extracts we show here that the product of one of these regulatory genes, the amdR gene, binds to DNA fragments containing part of the promoter region of the amdS gene. This confirms the earlier prediction from DNA sequence data that amdR encodes a DNA-binding protein containing a cysteine-rich 'zinc finger' motif. In addition we detected the binding of another previously unidentified protein to an adjacent, possibly overlapping region of the amdS 5' sequence at the site of a consensus 'CCAAT-box' sequence. Replacement of the CCAAT sequence with CCTTT abolished the binding of this protein which we have designated as an A. nidulans 'CCAAT-box' binding factor (AnCF). The 'CCAAT-box' sequence appears to be involved in determining the basal level of transcription of amdS (T.G. Littlejohn and M.J.H., unpublished data). This suggests that AnCF is a transcription factor, and that the 'CCAAT-box' sequences found in the promoters of some filamentous fungal genes function as binding sites for these factors, as in other eucaryotes.

  18. Interaction of Epstein-Barr Virus BZLF1 C-Terminal Tail Structure and Core Zipper Is Required for DNA Replication but Not for Promoter Transactivation ▿

    PubMed Central

    McDonald, Carol M.; Petosa, Carlo; Farrell, Paul J.


    The Epstein-Barr virus (EBV) protein BZLF1 contains a bZIP DNA binding domain in which C-terminal tail residues fold back against a zipper region that forms a coiled coil and mediates dimerization. Point mutagenesis in the zipper region reveals the importance of individual residues within the 208SSENDRLR215 sequence that is conserved in C/EBP for transactivation and EBV DNA replication. The restoration of BZLF1 DNA replication activity by the complementation of two deleterious mutations (S208E and D236K) indicates that the interaction of the C-terminal tail and the core zipper is required for DNA replication, identifying a functional role for this structural feature unique to BZLF1. PMID:19144704

  19. The SAGA Deubiquitination Module Promotes DNA Repair and Class Switch Recombination through ATM and DNAPK-Mediated γH2AX Formation.


    Ramachandran, Shaliny; Haddad, Dania; Li, Conglei; Le, Michael X; Ling, Alexanda K; So, Clare C; Nepal, Rajeev M; Gommerman, Jennifer L; Yu, Kefei; Ketela, Troy; Moffat, Jason; Martin, Alberto


    Class switch recombination (CSR) requires activation-induced deaminase (AID) to instigate double-stranded DNA breaks at the immunoglobulin locus. DNA breaks activate the DNA damage response (DDR) by inducing phosphorylation of histone H2AX followed by non-homologous end joining (NHEJ) repair. We carried out a genome-wide screen to identify CSR factors. We found that Usp22, Eny2, and Atxn7, members of the Spt-Ada-Gcn5-acetyltransferase (SAGA) deubiquitination module, are required for deubiquitination of H2BK120ub following DNA damage, are critical for CSR, and function downstream of AID. The SAGA deubiquitinase activity was required for optimal irradiation-induced γH2AX formation, and failure to remove H2BK120ub inhibits ATM- and DNAPK-induced γH2AX formation. Consistent with this effect, these proteins were found to function upstream of various double-stranded DNA repair pathways. This report demonstrates that deubiquitination of histone H2B impacts the early stages of the DDR and is required for the DNA repair phase of CSR. PMID:27160905

  20. Molecular cloning of a cDNA encoding human SPH-binding factor, a conserved protein that binds to the enhancer-like region of the U6 small nuclear RNA gene promoter.


    Rincon, J C; Engler, S K; Hargrove, B W; Kunkel, G R


    Many vertebrate small nuclear RNA gene promoters contain an SPH motif in their distal control regions that can confer transcriptional stimulation by RNA polymerase II or RNA polymerase III. Using the human U6 gene SPH motif as a probe, we isolated a cDNA encoding human SPH-binding factor (hSBF) from a HeLa cell expression library. The coding region of hSBF is almost identical to ZNF143, a 626 amino acid, seven zinc finger protein of previously unknown function. Furthermore, the predicted amino acid sequence of hSBF is highly homologous to Xenopus laevis and mouse Staf proteins, that bind to SPH motifs and stimulate transcription of selenocysteine tRNA gene promoters. Recombinant hSBF expressed in vitro or from Escherichia coli bound specifically to the human U6 gene SPH motif as shown by DNase I footprinting and electrophoretic mobility shift assays using various mutant SPH sites as competitors. Antibodies prepared against recombinant hSBF inhibited assembly of native SBF-DNA complexes. Immunodepleted HeLa S100 transcription extract no longer supported elevated levels of transcription by RNA polymerase III from a U6 promoter containing an SPH motif, whereas addition of recombinant hSBF protein to the immunodepleted extract reconstituted stimulated transcription.